Detection of Salmonella by polymerase chain reaction - Biologia ...

More documents

Recommendations

Info

crease in salmonellosis in industrialized countries over the past 35 years has accompanied the centralisation of food production and processing, despite of improvements in epidemiological and microbiological methods. Conventional methods of Salmonella detection rely on enrichment in nonselective and selective broths, followed by differential agar media and serological confirmation. These methods offer a satisfactory detection limit and specificity, but require at least 4 or 6 days to obtain negative or positive results, respectively (ISO 6579, 1993). There are consequently efforts to develop new, faster methods. Detection of Salmonella byPCR,basedontheenzymatic amplification of a pre-selected region of DNA, is one such method reducing the time requirement for the analysis without a negative effect on the analytical parameters. Several PCR-based methods for the detection of Salmonella have been described. These were based on the identification of various genes, such as pathogenic determinants invA (Stone et al., 1994; Burkhalter et al., 1995), spvA (Lampel et al., 1996), iroB (Baumler et al., 1997), fimbrial genes fimA (Cohen et al., 1996) and agfA (Doran et al., 1996), genes encoding for rRNA (Iida et al., 1993) or Salmonella-specific DNA sequences with an unknown function (Aabo et al., 1993). In this work, primers were designed targeted to the fimC gene, which encodes a chaperone involved in the synthesis of type 1 fimbriae. These are proteinaceous filaments localised on the surface of the bacterial cell and are responsible for binding to specific receptors on the epithelial cell during infection. The fim operon is commonly present in members of the entire family Enterobacteriaceae, including all Salmonella serotypes (Low et al., 1996). An important feature of PCR-based methods for routine detection of pathogens should be high reproducibility and reliability. These can be improved by the application of an internal standard, which facilitates monitoring the amplification and helps to recognize false negative results caused by the inhibition of PCR. For the primers designed, a mimic internal standard (Lambertz et al., 1998) was here constructed and its use optimized. To achieve satisfactory analytical parameters, food samples have to be appropriately processed prior to the detection of Salmonella by PCR. Enrichment in a single non-selective medium (Manzano et al., 1998), enrichment in a nonselective medium followed by two parallel selective media (Cohen et al., 1996), and a successive enrichment in three media (Aabo et al., 1995) have 612 been reported to be used for this purpose. Another possibility is the use of a combination of nonselective and selective enrichment with immunomagnetic separation (Rijpens et al., 1999; Trkov et al., 1999) In this work, two enrichment protocols followed by PCR targeted to the fimC gene were compared with the standard method for the detection of Salmonella in selected naturally contaminated foods. Material and methods Bacterial strains were from the collection of Food Research Institute, Bratislava, or they were isolates from food by the State Veterinary Institute, Bratislava. Bacteria were cultured on solid or liquid Luria-Bertani (LB) media (Maniatis et al., 1982). For the determination of the detection limit, overnight cultures were serially diluted in LB broth and numbers of viable bacteria were determined by plating on LB agar. DNA preparation Chromosomal DNA was prepared according to Flamm et al. (1984). Crude lysates were prepared from 1 mL of the culture grown in the liquid medium, or suspending one loopful of the culture grown on the solid medium. Bacterial cells were suspended in 1 mL of 0.8% NaCl, centrifuged at 8000 g for 10 min, and the pellet was resuspended in 1% Triton X-100. The suspension was boiled for 15 min and, after centrifugation the supernatant was used in PCR. PCR Avolumeof2µL of the DNA template solution was added to 23 µL of the reaction mixture containing 10 mmol/L Tris-HCl, pH 8.8, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.05% Tween 20, 200 µmol/L each dNTP, 250 nmol/L each primer, 1 U Taq DNA polymerase. Amplification was carried out in a T1 thermal cycler (Biometra, Göttingen, Germany) with a temperature programme consisting of the initial denaturation (1 min at 94 ◦ C), 35 amplification cycles (30 s at 90 ◦ C, 30 s at 54 C, 60 s at 72 ◦ C), and the final extension (8 min at 72 ◦ C). A volume of 10 µL of the PCR product was analysed by electrophoresis in a 1.5% agarose gel (Maniatis et al., 1982). Internal standard preparation The internal standard was produced by the method described previously (Drahovská et al., 1999). Briefly, PCR with E. coli chromosomal DNA as a template was made with the annealing temperature lowered to 40 ◦ C. From several non-specific products, a fragment of about 800 bp was selected, extracted from the gel, and cloned to the pCR2.1 vector (Invitrogen). Sequencing of the PCR products Sequencing was performed by an automatic DNA sequencer (Vistra, Amersham) with individual products cloned to the pCR2.1 vector.
Table 1. Primers used in this study. primer orientation position 1 sequence S5 forward 224–262 AGCGAGCCCAAAAGTGAAA S6 reverse 665–646 GTCAATGCGCCGTAATCATT S212 forward 212–231 AAACGTTTATCGTTACGCCG S500 reverse 450–481 ATCTTGAGATGGTTGCCGAC 1 In the fimC gene of S. typhimurium. Table 2. Specificity of the primer combinations. Reaction conditions were as stated in materials and methods, annealing temperature was 50 ◦ C. S212/S500 S5/S6 S212/S6 S5/S500 Escherichia coli – – – – Enterobacter cloacae – – – – Citrobacter braakii – + – – Citrobacter diversus – + – – Citrobacter freundii – + – – Salmonella typhimurium + + + + Salmonella arisonae + – + – Salmonella detection in foods Food products were purchased from local retail stores. A method according to ISO 6579 (1993) was used as the reference one; all media were from Merck (Darmstadt, Germany). Samples (25 g) were homogenized in the buffered peptone water (BPW; 225 mL) and incubated at 37 ◦ C for 16 h. A volume of 0.1 mL of the culture was inoculated to 9.9 mL of the Rappaport- Vassiliadis medium, another 1 mL to 9 mL of the selenite-cystine broth, and the cultures were incubated at 41 ◦ C and at 35 ◦ C, respectively, for 7 h. Subsequently, aliquots of 1 mL were withdrawn from the selective media and subcultured in LB broth at 37 ◦ C for 16-18 h. Volumes of 1 mL of the culture in BPW, or of the two cultures in LB, were used for the lysis and PCR. For the three-step enrichment, samples were considered positive when at least one of the two LB cultures gave rise to a positive result. Results Design of the primers Three fimbrial sequences accessible in the database were compared: fimC of S. typhimurium (L19338), fimC of S. typhi (X74602), and sfmC of E. coli (AE000159). The last sequence was found to be of a higher homology with fimC of Salmonella than fimC of E. coli. Based on this comparison, four primers were designed (Tab. 1). Primers S212 and S500 were selected to be Salmonella-specific, while primers S5 and S6 were conservative for all the three genes considered. Evaluation of the primers Specificity of the primers was tested on a number of bacterial strains (Tab. 2). The primer combination S212/S500 was specific for the genus Salmonella in a broad interval of annealing temperatures (46–58 ◦ C). The primer combination S5/S6 amplified a defined DNA fragment at a medium annealing temperature (50 ◦ C) not only from Salmonella spp., but from Citrobacter spp. as well. When the annealing temperature was increased to 58 ◦ C, the stringency improved and amplification took place only for Salmonella spp. On the other hand, S. arizonae was not detected with this primer combination at given reaction conditions. Based on these results, the primer combination S212/S500 was chosen for further work. Sequencing the PCR products Identity of the PCR product was confirmed by sequencing. The sequence of the PCR product from S. typhimurium 34 was identical to that in the GeneBank (L19338), the sequence of the PCR product from S. enteritidis 173 differed only in one nucleotide (data not shown). Specificity of Salmonella detection The specificity of the primer pair S212/S500 was further tested on a panel of Salmonella and non- Salmonella strains. All of 53 Salmonella serotypes tested (95 strains) gave a positive signal in the PCR analysis. No product was amplified with 613
Page 1: Biologia, Bratislava, 56/6: 611—6
Page 5 and 6: in the presence of 10 6 CFU of E. c

Detection of Salmonella by polymerase chain reaction - Biologia ...

Create successful ePaper yourself

Delete template?

Save as template?