High-Frequency Genetic Contents Variations in Clinical

624 Regular Article
Biol. Pharm. Bull. 34(5) 624—631 (2011)
Vol. 34, No. 5
High-Frequency Genetic Contents Variations in Clinical Candida albicans
Isolates
Feng YANG, a,# Tian-Hua YAN, a,# Elena RUSTCHENKO, b Ping-Hui GAO, c Yan WANG, c Lan YAN, c
Ying-Ying CAO, c Qiu-Juan WANG, c Hui JI,* ,a Yong-Bing CAO,* ,c and Yuan-Ying JIANG c
a Department of Pharmacology, School of Pharmacy, China Pharmaceutical University; Nanjing 210009, China:
b Department of Biochemistry and Biophysics, School of Medicine and Dentistry, University of Rochester Medical School;
Rochester, N.Y., 14642, U.S.A.: and c Department of Pharmacology, School of Pharmacy, Second Military Medical
University; Shanghai 200433, China.
Received October 25, 2010; accepted January 24, 2011; published online February 16, 2011
Genome plasticity is a hallmark of Candida albicans and is believed to be an adaptation strategy. But the
extent of such genomic variability is not well investigated. In this study, genetic contents of clinical C. albicans
isolates were investigated at whole-genome level with array-based comparative genomic hybridization (array
CGH) technology. It was revealed that C. albicans possessed variations of genetic contents, as well as aneuploidy.
The variable genes were scattered across the chromosomes, as well clustered in particular regions, including subtelomeric
regions, retrotransposon-insertion sites and a variable region on chromosome 6.
Key words Candida albicans; comparative genomic; copy number variation; array-based comparative genomic hybridization
Candida albicans is the most common fungal pathogen,
causing skin and mucosal infections in generally healthy individuals,
life-threatening infections in immunocompromised
patients, and leading to death in up to 50% of patients with
bloodstream infections. 1,2)
C. albicans is known for its unstable genome. The instability
of the chromosome copy number of entire chromosomes,
as well as the large portions of chromosomes was extensively
studied with laboratory and freshly isolated strains using
pulse-field gene electrophoresis (PFGE) as reviewed by
Rustchenko, 3) Rustchenko and Sherman, 4) and Selmecki
et al. 5) Combined with Southern blot analysis, PFGE allowed
limited analysis of gene copy number, and also could be
extended to the analysis of chromosome deletions and other
rearrangements. 6—15) Recently, array technology opened a
new dimension in the study of genome instability. Array
comparative genomic hybridization (array CGH) allows the
detection of genomic variations across a whole genome.
When the CGH intensity data are plotted as a function of position
on the genetic map, aneuploidy of chromosomes or
chromosomal segments are readily identified. The availability
of the C. albicans strain SC5314 genome sequence has
allowed the construction of microarrays for the analysis of
gene copy number. Berman’s laboratory largely used array
CGH to demonstrate aneuploidies in C. albicans derivatives
Table 1. C. albicans Isolates Used in This Study
Patient Isolate Anatomical source Isolation date
∗ To whom correspondence should be addressed. e-mail: huijicpu@163.com; ybcao@vip.sina.com
# These authors contributed equally to this work.
of the sequencing strain SC5314, several laboratory strains,
as well as clinical isolates, as reviewed by Selmecki et al. 5)
Also, Thewes et al. 16) used array CGH to elucidate the genomic
diversity among C. albicans less virulent strain
ATCC10231 and the reference sequencing strain SC5314 in
the hope to uncover genetic basis of pathogenicity. Although
some variable genes were identified, this study was limited to
a single strain.
Despite the extensive effort of various laboratories, a comprehensive
study, which would include various strains and
which would focus on the DNA sequence and gene copy
number variability is still lacking, although this approach
was applied to other organisms, including Saccharomyces
cerevisiae. 17,18) In order to fill this need, we examined the genomic
contents of eight clinical isolates, as compared to the
SC5314 reference strain, using array CGH. The Cluster
Along Chromosomes (CLAC) algorithm was employed to
identify variable genes.
MATERIALS AND METHODS
Isolates and Culture Conditions A list of isolates used
in this study is provided in Table 1. SC5314 was kindly provided
by William A. Fonzi (Department of Microbiology and
Immunology, Georgetown University, Washington, D.C.,
No. of unstable genes
Loss Gain
Strainspecific
False discovery rate
(FDR)
1 U885 Urine 08-11-06 111 31 75 0.10
2 S204 Sputum 13-02-06 291 5 74 0.08
3 S727 Sputum 26-05-06 88 9 50 0.15
4 F32 Feces 04-10-06 160 2 53 0.09
5 S241 Sputum 08-08-06 302 10 62 0.07
6 S904 Sputum 25-07-06 282 11 37 0.08
7 P546 Pharynx 19-04-06 125 0 55 0.12
8 S197 Sputum 12-05-06 92 354 356 0.03
© 2011 Pharmaceutical Society of Japan

May 2011 625
U.S.A.). Clinical isolates were obtained from Changhai Hospital
of Shanghai, China.
All samples were maintained as 80 °C stocks in 30%
glycerol. All isolates were cultivated in YEPD (1% yeast extract,
2% peptone, 2% glucose) at 30 °C, with 200 rpm agitation.
Genotyping Analysis Polymerase chain reaction (PCR)
for MTL status and the ribosomal RNA (rRNA) gene transcribed
spacer region was done as previously described. 19)
DNA Isolation C. albicans isolates stored at 80 °C
were streaked on a Sabouraud agar plate. After incubation
overnight at 30 °C, several colonies were collected and
inoculated overnight in 5 ml YEPD medium at 30 °C, harvested
and washed with distilled water, resuspended in
200 ml lysis buffer (2% Triton X-100, 1% sodium dodecyl
sulfate (SDS), 100 mM NaCl, 1 mM ethylenediaminetetraacetic
acid (EDTA), 10 mM Tris, pH 8.0). DNA was isolated
as described by Hoffman and Winson. 20) DNA was purified
using the PCR Clean-up NucleoSpin Extract II Kit
(Macherey-Nagel, Germany) according to manufacturer’s
instructions.
Microarray Production For the production of spotted
DNA-microarrays, 7925 70 mer oligonucleotides targeting
the ORFeome of C. albicans were printed triplicate on amino
silaned glass slides using a SmartArrayer TM microarrayer
(CapitalBio Corp.). Prior to hybridization, the slides were
rehydrated over 65 °C water for 10 s, UV cross-linked at
250 mJ/cm 2 .
DNA Labeling for Array CGH Analysis The generation
of DNA fragments by sonication was performed with
10 mg buffered DNA sample. For each labeling reaction,
3.5 mg of fragmented DNA and 4 mg of random nonamer
were heated to 95 °C for 3 min and snap cooled on ice, then
10Klenow buffer, dNTPs and Cy5-dCTP or Cy3-dCTP
(GE HealthCare) were added at final concentrations of
120 m M each dATP, dGTP, dTTP, 60 m M dCTP and 40 m M Cydye,
respectively. Klenow enzyme (1 ml, Takara, Dalian,
China) was added and reaction was performed at 37 °C for
1 h. The labeled DNA was purified with a PCR Clean-up NucleoSpin
Extract II Kit. All samples had dye-swap replicates
to remove any dye bias.
Microarray Hybridization, Scanning and Data Processing
For array CGH, the labeled control and test samples
were mixed into 80 ml hybridization solution (3SSC, 0.2%
SDS, 50% formamide). DNA in hybridization solution was
denatured at 95 °C for 3 min prior to loading on the microarray.
The arrays were hybridized at 42 °C overnight and
washed with two consecutive washing solutions (0.2% SDS,
2SSC for 5 min at 42 °C and 0.2% SSC for 5 min at room
temperature). Two types of arrays were performed under the
same experimental conditions; one was a normal array (reference/reference
hybridization) and the other test arrays (reference/test
hybridization).
Arrays were scanned with a confocal LuxScan TM scanner
(CapitalBio Corp.), and the data of obtained images were
extracted with LuxScan 3.0 software (CapitalBio Corp). A
spatial and intensity-dependent normalization based on a
LOWESS program was employed. 21) The normalized log 2
(test/control) ratio of signal intensity was considered as a
measure of the relative abundance of each gene relative to
that of the reference isolate SC5314. We used CGH-Miner
for statistical analysis of DNA copy number gains and
losses. 22) CGH-Miner uses a “Cluster Along Chromosomes
(CLAC)” algorithm, which builds a hierarchical cluster-style
tree along each chromosome (or chromosome arm), and the
neighboring genes with positive and negative ratios are separated
into different clusters. Gains and losses are then called
significantly based on the height and width of clusters, and a
false discovery rate (FDR) is estimated by comparison to
normal–normal hybridization data. Consensus FDR, which is
an estimator of the consensus result of the gain/loss across all
samples, is also calculated. For data smoothing, the parameters
were set for BAC analysis, to produce a moving window
of three ORFs for averaging the hybridization signal. 18) And
the cluster tree was built on whole chromosomes.
Variable genes identified by array CGH were validated by
quantitative real-time PCR (qPCR) using 7500 Real Time
PCR system (Applied Biosystems) and SYBR Green I
(Takara Bio, Tokyo, Japan). The DNA copy number of the
variable genes was determined relative to the gene TDH3
(orf19.6814), a reference gene that array CGH showed not to
vary in all the clinical isolates. We used the comparative Ct
method (2 DDCt ) to determine target gene copy number in the
test isolates relative to the reference gene and the reference
DNA sample of SC5314. 23,24)
Raw data have been deposited in NCBIs Gene Expression
Omnibus (GEO) and are accessible through GEO series
accession number GSE18819. Functional annotations and
GO term association was done following Candida Genome
Database (CGD) annotations.
RESULTS
Characterization of Isolates A total of eight C. albicans
isolates were isolated from eight different patients
attending the same hospital in the year 2006 (Table 1). All
the test isolates and the reference isolate SC5314 were maintained
on Sabouraud agar plates at 4 °C or as 80 °C stocks
in 30% glycerol. Initially, the isolates were streaked for independent
colonies on CHROMagar medium (CHROMagar
Company, Paris, France) and incubated, as recommended by
manufacturer. If the green color of the colonies indicated
C. albicans, we then performed, in addition, polymerase
chain reaction (PCR) with primers that amplified the ITS1
region of ribosomal DNA (rDNA), which also designated the
ATP-binding cassette (ABC) type of each isolate (ABC
type). 19) ABC typing revealed that isolates SC5314, U885,
S204 and S727 were of genotype A, isolates F32, S241 and
S9-04 were of genotype B, and the rest two isolates (P546,
S197) were of genotype C (data not shown).
Statistical Analysis of Array CGH Data We estimated
the DNA content of each of eight clinical isolates with array
CGH approach, as compared to a control sequencing strain
SC5314. Every microarray contained 19056 probes representing
6111 ORFs of SC5314 (Materials and Methods). We
calculated the DNA content of every gene, as the ratio
test/control and, subsequently, averaged the six values corresponding
to six data points (Materials and Methods). Furthermore,
we used CGH-Miner for statistical analysis of
DNA copy number gains and losses (Materials and Methods).
In order to determine if the differences in hybridization
efficiency were due to divergence of the DNA sequence, we

626 Vol. 34, No. 5
Table 2. Primers Used for PCR Amplification and Sequencing
Name Sequence (5–3)
orf19.5370 Fwd: AGCCTCTGAACACCTTATC
Rev: GTAGTTGCCCTTCTCTCTG
orf19.5469 Fwd: GGGATTTCTGTCGCATGAAC
Rev: TGTCTAAAACACCGCACCTC
orf19.5472 Fwd: CAACTGAAGCGGGTAGAAC
Rev: ATCAAGGTGACGACGGACT
orf19.5474 Fwd: ATGAGGTGCGGTGTTTTAG
Rev: CTCGTTCCTCCAGTTGCTT
orf19.5475 Fwd: CAACATACCCCCGCATCCT
Rev: GTTCAAGAGCCAGCCCACG
orf19.1831 Fwd: TTCTAACATCAGGCGGTCCCAT
Rev: ACCAGACCCCTTATTGCTCGGC
orf19.7475 Fwd: CGAGAAACCCTCCCTACTG
Rev: CTTTGCGTAAGATTGCGTC
orf19.101 Fwd: AGCAGAGGAGTGAACGAA
Rev: AGCAGAGGAGTGAACGAA
orf19.105 Fwd: TTCTACTCACCCATACCAA
Rev: CACTTTCCCATCTTCAATC
orf19.107 Fwd: GTGAAGCCAGAGATGAAAT
Rev: AAGCGATACATACCGTGAG
orf19.109 Fwd: ATCCTACGGCATCATCACTAC
Rev: CAATCTTCTCATTTCACCCTT
orf19.48 Fwd: CACCATCTCAACCACATA
Rev: GACCATTCACCACACTTT
orf19.6192 Fwd: GTCATCAATTATCCACGGGTT
Rev: AGCAAGAAAGTTGGTAAGAAG
compared the sequence of the 70 mer oligonucleotides between
test strains and the reference strain from 13 genes that
displayed diminished hybridization signals in test strains.
Fragments of 13 genes corresponding to the 70 mer oligonucleotides
were PCR-amplified from test strains and sequenced
(Primer sequences are provided in Table 2). It was revealed
that eight genes (orf19.5472, orf19.5474, orf19.5469,
orf19.5475, orf19.109, orf19.48, orf19.107, orf19.6192) had
from 100% to more than 97% similarity to the control sequences,
while five genes (orf19.101, PHO81 (orf19.7475),
orf19.5370, orf19.1831, HAL22 (orf19.105)) had from 92%
to 70% similarity (data not shown). Thus, in approximately
50% of cases, the sequence divergence might account for the
diminished signal intensities in the test strains.
We used quantitative real-time PCR (qPCR) to validate the
loss of DNA in the eight genes with 100% to more than 97%
similarity to the control sequences. Since array CGH
revealed that the variable genes were scattered across the
chromosomes, as well clustered in particular regions, several
genes from these locations were also included in qPCR
analysis, including the retrotransposon Tca4 open reading
frames (ORFs) (RHD2 (orf19.2668), orf19.2669), retrotransposon
Tca8 ORFs (POL93 (orf19.6078), orf19.6079), two
genes on chromosome 6 (HAL22 (orf19.105), orf19.111),
one gene near right sub-telomeric region on chromosome 3
(orf19.6191), two genes located on the arm of chromosome 2
(orf19.4069, orf19.4070). qPCR revealed that, except one
gene, orf19.48, all the genes analyzed possessed copy number
variations as indicated by array CGH. This finding suggests
that, in addition to sequence divergence, copy number
variations might also account for the diminished hybridization
signals in the test strains. Primer sequences and the results
were provided in Tables 3 and 4, respectively.
Determining Variable Genes For the self–self control
Table 3. Primers Used for qPCR Validation of Array CGH Data
Name Sequence (5–3)
Orf19.6078 Fwd: TGCTTATGAACTTGATTTGCC
Rev: TTCACTTTCTTTACCTGGACG
Orf19.6079 Fwd: GCCGAAGCAAGGAACATTA
Rev: CACTCCGAGCGAACATACC
Orf19.2669 Fwd: GACTTAGGGTCTGGAACAA
Rev: CCGTTAAGCATAGGAGAGT
Orf19.2668 Fwd: TACCTGGATCATGTGTTTTA
Rev: ATTCAAGTGTTTACCTGTGT
Orf19.5472 Fwd: GTCTCGCCACATCATAC
Rev: GGTGACGACGGACTACAT
Orf19.5474 Fwd: TTCAAGAGCCAGCCCACG
Rev: ATCCACCTCACCATCATCACAT
Orf19.5469 Fwd: TCAGCGACTCTGAGGACG
Rev: GATGACAACATTGCCACTT
Orf19.5475 Fwd: CCGACAATACTCCGAAT
Rev: GTGATGATGGTGAGGTGG
Orf19.109 Fwd: TTTTATTCCCTACTCCA
Rev: ATCTTCTCATTTCACCC
Orf19.48 Fwd: AGATACCGTGGAAGACAGA
Rev: TGGATAATGGTGGACAGAG
Orf19.107 Fwd: CGCATGAAAGAACTAT
Rev: CAAAGAACATCACCCT
Orf19.6192 Fwd: CCCCGAGCAGTTTGAC
Rev: AAGCGAACAAGGATAGGT
Orf19.6191 Fwd: ATCCATAACCCAACTGCT
Rev: ACTTCTTCGCTTCCTCTG
Orf19.111 Fwd: TAACATCCCTCAAAGACAA
Rev: CAATGGCAATCATAGAAACA
Orf19.4069 Fwd: TTGGTAACGCTAATGCT
Rev: CGAAAGTGGGACTGTATC
Orf19.4070 Fwd: CATTACTAAACTTGCTGCTC
Rev: AATGGCTCCTTGTCAATC
Orf19.105 Fwd: GCAGTAAAGCGTGCCTCAT
Rev: TTCTTCACCCACAATCTCG
Orf19.101 Fwd: TTGTTTACTCCGAACTTATC
Rev: AAGTAGGTTGCTGGACAT
Orf19.7475 Fwd: CCTGCTTCCATTGTTTGAC
Rev: GACACTGATCCTGGCGATA
Orf19.5370 Fwd: ACTATGACTGGTCGTTGC
Rev: AGATAAGGTGTTCAGAGGC
Orf19.1831 Fwd: TTGTTATCTATTTAGTGTCGTT
MTLa1 a)
Rev: GGTGAATTTATTATTAGTCGT
Fwd: AGAACAAACAGCCTAATCG
Rev: ATCATCAATCCCACCAAGA
MTLa2 a) Fwd: GTGTTAGAAGGGTGGTT
Rev: TAGGGTTACAAAGAATG
PAP1 a) Fwd: CTGATTTGTTAGAGCGAC
Rev: CACCATCCCACTGTATTT
PAPa a) Fwd: GAACACGAAGACATACGGAG
Rev: GCCATTGAATCGGACAT
OBPa a) Fwd: TGAAATGGATAACGAGGGA
Rev: CACGCAAGAACTGAAACAA
OBPa a) Fwd: TGGCATATTTCTCCTA
Rev: GTAAACCTCGTTGTCC
PIKa a) Fwd: TAATAACGAGTGCGAAT
Rev: GTGAGTCAACCAGTCCG
PIKa a) Fwd: GGCTGCCAAACTCTACT
Rev: CACTATCAACACCACCA
TDH3 b) Fwd: TAACATTATCCCATCTTCCA
Rev: AGCATCTTCAGTGTAGCCCA
a) Primer sequences of the MTL locus genes are also included in this table. b)
TDH3 is the reference gene used as internal control for qPCR.
experiment, no genes with log 2 fluorescence ratio greater
than 1 or less than 1 were yielded. Using CLAC method,
we found a total of 1116 variable genes having significant
changes of signal intensities among test isolates. Of the 1116

May 2011 627
Table 4. qPCR Validation of Array CGH Data
Gene
genes, 702 genes were associated with diminished signal
intensities and, thus considered as absent/divergent, while a
total of 383 genes were associated with increased signal
intensities and thus considered as amplified. A small number
of genes, 31, were either absent/divergent or amplified in different
isolates. Different number of variable genes was identified
in each isolate, ranging from 97 to 446, as presented in
Table 1. Of the 1116 variable genes, 354 genes were shared
between at least two isolates, including 196 putative genes of
unknown function and 158 genes annotated with some molecular
functions.
The variable genes could be found randomly scattered on
each of the eight chromosomes. However, clusters of variable
genes could be clearly identified in some particular regions,
as presented in Fig. 1 (also see below).
Copy Number Variations of Genes Near Sub-telomeric
Regions Clusters of variable genes were revealed at subtelomeric
regions of chromosomes 1, 2, and 3 (Fig. 1). Near
the right sub-telomeric region of chromosome 1, seven
Ratio (test/control)
P546 U885 F32 S241 S904 S204 S197 S727
orf19.5472 aCGH 0.42 0.40 0.93 1.22 1.78 0.16 0.00 0.05
qPCR 0.31 0.35 0.85 0.77 2.26 0.22 0.37 0.43
orf19.5474 aCGH 0.59 0.23 0.96 1.17 1.40 0.11 0.00 0.06
qPCR 0.37 0.11 0.72 1.36 0.84 0.18 0.44 0.15
orf19.5469 aCGH 0.67 0.26 0.92 0.96 1.10 0.09 0.00 0.06
qPCR 0.22 0.17 1.29 0.73 0.98 0.36 0.12 0.15
orf19.5475 aCGH 0.54 0.40 0.76 1.39 2.13 0.12 0.01 0.07
qPCR 0.23 0.03 0.81 1.83 2.06 0.10 0.01 0.22
orf19.109 aCGH 1.10 1.09 1.05 1.02 1.01 1.08 0.70 0.54
qPCR 0.84 0.96 1.27 0.62 1.14 0.92 0.89 0.66
orf19.48 aCGH 0.12 0.10 0.18 0.67 0.14 0.30 0.16 0.09
qPCR 1.06 1.02 1.41 1.18 2.02 0.84 1.19 0.31
orf19.107 aCGH 1.14 1.02 1.53 1.30 0.75 1.34 0.59 0.45
qPCR 0.93 0.85 1.39 1.11 0.87 0.88 0.31 0.51
orf19.6192 aCGH 2.12 3.00 3.32 1.12 0.02 3.06 0.01 0.02
qPCR 2.00 4.28 4.47 0.85 0.01 4.48 0.19 0.01
orf19.6191 aCGH 0.56 0.50 0.79 0.63 0.44 0.45 0.55 0.30
qPCR 0.68 0.09 0.21 0.38 0.86 0.29 0.23 0.18
orf19.111 aCGH 0.76 0.72 0.67 0.96 0.88 0.69 0.75 0.56
qPCR 0.33 0.15 0.01 1.19 1.18 1.29 1.27 0.73
orf19.2668 aCGH 0.01 0.02 0.01 0.98 5.18 1.00 1.01 1.03
qPCR 0.00 0.00 0.00 1.10 2.54 1.22 1.12 1.17
orf19.2669 aCGH 0.10 0.06 0.04 0.96 4.61 1.16 1.10 1.03
qPCR 0.00 0.00 0.00 1.18 2.36 1.06 1.36 1.22
orf19.6079 aCGH 0.03 0.11 0.02 0.85 0.02 0.04 0.61 0.83
qPCR 0.00 0.00 0.00 1.66 0.00 0.00 1.30 0.77
orf19.6078 aCGH 0.09 0.16 0.12 0.79 0.09 0.10 0.55 0.80
qPCR 0.00 0.01 0.04 1.80 0.00 0.00 1.36 0.85
orf19.4069 aCGH 0.01 0.02 0.02 0.62 0.02 1.43 0.01 0.81
qPCR 0.01 0.01 0.00 0.98 0.00 1.76 0.00 1.09
orf19.4070 aCGH 0.10 0.23 0.09 0.86 0.12 1.51 0.08 1.69
qPCR 0.11 0.08 0.08 1.13 0.01 2.24 0.04 2.20
orf19.105 aCGH 0.44 0.67 0.21 0.41 0.55 0.24 0.57 1.17
qPCR 0.52 0.24 0.35 0.02 0.28 0.54 0.15 0.94
orf19.101 aCGH 0.65 0.48 0.90 1.10 0.79 1.61 0.76 0.51
qPCR 0.38 0.00 0.75 0.69 0.40 2.30 0.44 0.38
orf19.7574 aCGH 0.52 0.52 0.18 0.22 0.65 0.30 0.19 1.03
qPCR 0.22 0.00 0.00 0.30 0.38 0.18 0.33 0.82
orf19.5370 aCGH 0.28 0.48 0.54 0.51 0.76 0.21 0.31 0.16
qPCR 0.34 0.05 0.53 0.30 0.30 0.75 0.41 0.36
orf19.1831 aCGH 0.24 0.17 0.29 0.51 0.40 0.87 0.31 0.30
qPCR 0.36 0.01 0.26 0.16 0.71 0.01 0.01 0.00
consecutive genes (orf19.7276.1, orf19.7278, orf19.7271,
orf19.7272, orf19.7274, orf19.7275, orf19.7277) spanning
approximately 7.2 kb displayed copy number variations in
multiple strains. In isolate P546, all the seven genes were
absent. In isolate S197, three of the seven genes (orf19.7277,
orf19.7276.1, orf19.7278) were absent. In isolate S904, five
of the seven genes (orf19.7274, orf19.7275, orf19.7277,
orf19.7276.1, orf19.7278) were amplified, and in isolate
S204, six of the seven genes (orf19.7271, orf19.7272,
orf19.7274, orf19.7275, orf19.7277, orf19.7276.1) were amplified.
Consensus FDRs (see Materials and Methods) were
0.192 for orf19.7271 and orf19.7272; 0.017 for orf19.7274,
orf19.7275, and orf19.7278; as well as 0.002 for orf19.7277
and orf19.7276.
Near the right sub-telomeric region of chromosome 2,
three consecutive genes (orf19.5370, orf19.5369, orf19.5368)
spanning approximately 4.6 kb were absent in three isolates
(P546, S204, S727), and the consensus FDR was 0.017.
Genes near both the left and the right sub-telomeric

628 Vol. 34, No. 5
Fig. 1. Consensus Plot for Each Chromosome from Eight Test Arrays, as Determined with CLAC Method
Genes are ordered according to the nucleotide position on 8 chromosomes. Both the height and the color of the vertical bar of each gene stand for the percentage of arrays in
which the corresponding gene has DNA copy number variation. The gain/loss regions are plotted in red/green, respectively. The relationship between the percentage and the colors
as well as the height is illustrated in the legend. The distance between two background gray horizontal lines is 20%. Black arrows indicate the position of retrotransposons.
regions of chromosome 3 showed copy number variations in
seven of the eight test isolates. Near the left sub-telomeric
region of chromosome 3, five consecutive genes spanning
approximately 10 kb (orf19.5475, orf19.5474, orf19.5472,
orf19.5469, orf19.5467) were absent in five test isolates
(P546, U885, S204, S197, S727), while three of the five
genes (orf19.5475, orf19.5474, orf19.5472) were amplified
in isolate S904. In addition, one gene (orf19.5466) downstream
of the five consecutive genes was also absent in the
isolate S204, and two genes (orf19.5466, orf19.5465) downstream
of the five consecutive genes were also absent in the
isolate U885. The consensus FDR of this region was 0.01.
Near the right sub-telomeric region of chromosome 3, four
consecutive genes (orf19.6192, orf19.6191, orf19.6190,
orf19.6189) spanning approximately 12 kb were absent in
three test isolates (S904, S197, S727). The consensus FDR
for these genes was 0.017.
Variability of Retrotransposon-Encoded ORFs In this
study, probes representing ORFs of 8 retrotranspons were
spotted on the microarrays, thus, providing an opportunity to
investigate the corresponding ORFs copy number. As presented
in Table 5 and Fig. 1, there were 4 patterns of copy
change in test isolates: the copies of the non-long terminal
repeat (LTR) retrotransposons Zorro3 and Zorro2 were
equivalent to or more than SC5314; Copies of LTR-retrotransposons
Tca2, Tca3, and Tca8 were equivalent to or less
than SC5314; Copies of LTR-retrotransposon Tca17 were
equivalent to SC5314 in all test isolates; and copies of LTRretrotransposons
Tca4 and TCA11 were equivalent to, more
or less than SC5314 in different isolates. Taken together, of
the 354 shared variable genes, eleven genes (orf19.7274,
orf19.7275, orf19.559, orf19.2371, orf19.2372, orf19.2219,
orf19.6078, orf19.6079, orf19.2668, orf19.2669, orf19.6469)
were retrotransposon ORFs. Within the retrotransposon sequence,
in addition to the retrotransposon ORFs encoding
gag or pol proteins, there are some other predicted ORFs
with the sequence not similar to gag or pol region. There
genes can be classified as predicted ORFs located in the
Fig. 2. Scatter Plot for Chromosome 6 from Eight Clinical Isolates
X axis indicates the position of the genes on chromosome 6. Y axis is the average
ratio (test/control) of each gene, as revealed by array CGH. Name of each clinical isolate
is indicated on the right. The black frame encompasses the variable region.
retrotransposon. Array CGH revealed that, five variable
genes (orf19.7272, orf19, 7277, orf19.562, orf19.6078.1,
orf19.6465) belonged to this category.
A Variable Region on Chromosome 6 In addition to
sub-telomeric regions and retrotransposon insertion sites, we
found a region on chromosome 6 where genes displayed
high-frequency loss or gain of the copy number. This region
spans approximately 11.782 kb with chromosomal coordinates
195973 to 207755 (Fig. 2) and contains eight ORFs:
RIM9 (orf19.101), orf19.102, KAR5 (orf19.103), orf19.104,
HAL22 (orf19.105), orf19.107, orf19.109, and CAN2

May 2011 629
Table 5. Comparsion of Retrotransposon Copy Numbers between Control and Test Isolates as Revealed by Array CGH
Retrotransposon Orf
(orf19.111). A total of four genes RIM9, orf19.102; KAR5,
and orf19.104 encode proteins with unknown functions and
the rest four genes are annotated with molecular functions:
HAL22 is a putative phosphoadenosine-5-phosphate (PAP)
or 3-phosphoadenosine 5-phosphosulfate (PAPS) phosphatase;
orf19.107 is an RNA helicase; orf19.109 is an
tyrosin-tRNA ligase; while CAN2 is an arginine transmembrane
transporter. Consensus FDRs was less than 0.001 for
this region. qPCR confirmed the copy number variations of
the above genes (Table 4).
Functional Analysis of Genes with Copy Number Variations
We attempted to analyze the molecular functions of
158 annotated genes that were shared between at least two
isolates, with the Gene Onthology (GO) Term Finder, as well
as with GO Slim Mapper. Both tools are provided by the
Candida Genome Database (CGD). Go Term Finder searches
for GO terms significantly shared by the query genes. The
p-value was set to be 0.1. GO Slim Mapper maps annotations
of a group of genes to more general terms and/or bins
them into broad categories. We used chi-square test for significance
analysis of the GO Slim Mapper result. For Go
Term Finder, the query set was the 158 variable genes with
annotations of molecular functions, and the background set
of genes was specified as the total of C. albicans genes annotated
with molecular functions, excluding genes with unknown
function. We found no enrichment in any functional
category with the two tools.
Aneuploidy of an Entire Chromosome or a Large Portion
of Chromosome Array CGH unambiguously revealed
chromosomal aneuploidy in two isolates: the duplication of
an entire chromosome 1 in S197 and the loss of an approximately
55 kb portion of chromosome R in S241, as presented
in Fig. 3. The segmental aneuploidy in S241 extended from
479692 to 535105 bp encompassing a total of twenty genes.
One gene, orf19.3746, was excluded from array CGH analysis
because of the bad hybridization efficiency of genomic
DNA from both SC5314 and S241 with the probes on the microarray.
Ratios (S241/SC5314) of three genes, orf19.3749,
orf19.3735, and orf19.3734, were approximately 1.0, thus,
implying no change of the DNA amounts. A simple explanation
of this result is the translocation of these genes on the
other chromosome(s). Ratios of the remaining sixteen genes
were approximately 0.5, which indicated the loss of one
copy.
In addition, we found that the MTLa locus on chromosome
5 that spans approximately 9 kb is homozygous in S727. Although
our microarrays lacked the probes representing the
OBPa, PIKa, PAPa, and MTLa2 genes from the MTLa
locus, we used PCR approach to amplify these genes from
both MTL loci from the same batch of genomic DNA, which
we used for array CGH. We found MTLa, but no MTLa
locus (Fig. 4A, Table 6). Furthermore, we used qPCR to confirm
that the MTLa locus is present in two copies (Fig. 4B,
Table 3). Future research is needed to establish if the entire
chromosome 5 or, alternatively, one copy of MTL was lost
and subsequently duplicated.
DISCUSSION
Ratio (test/control)
P546 U885 F32 S241 S904 S204 S197 S727
Zorro2(0.017 a) ) Orf19.7274 0.94 1.41 1.25 1.03 1.42 1.68 0.88 1.47
Orf19.7275 1.12 1.23 1.54 1.02 1.44 1.65 0.80 1.66
Zorro3(0.19) Orf19.559 1.04 1.06 1.32 1.09 0.92 1.11 1.05 3.30
Tca2(1.2E-06) Orf19.2371 0.01 0.46 0.97 0.36 1.00 0.52 0.01 0.48
Orf19.2372 0.03 0.46 1.34 0.36 1.80 0.46 0.02 0.42
Tca3(5.1E-05) Orf19.2219 0.42 0.68 0.30 0.41 0.39 0.80 0.25 0.86
Tca8 (5.12E-05) Orf19.6078 0.42 0.39 0.58 0.97 0.30 0.33 0.75 0.81
Orf19.6079 0.29 0.34 0.29 0.91 0.28 0.32 0.81 0.81
Tca17(1) Orf19.6807 1.01 0.98 0.94 0.96 0.98 0.95 0.97 0.97
Tca4(0.0016) Orf19.2668 0.10 0.10 0.07 0.97 1.89 1.03 1.00 0.93
Orf19.2669 0.10 0.10 0.06 0.96 1.90 1.02 1.08 1.03
Tca11(1.2E-06) Orf19.6469 0.26 0.53 0.22 1.59 1.08 0.49 0.12 1.20
a) Consensus FDR across all the test samples.
Fig. 3. Segmental Loss on Chromosome R in Isolate S241
Panel A: Each row corresponds to a specific spot (gene) on the microarray. The genes
are arranged according to their chromosomal coordinates on chromosome R. Each column
corresponds to a test isolate. The status of each gene is indicated as follows: black,
present; red, amplified; green, absent. The hybridization ratios are in logarithmic scale.
Panel B presents the systemic names and array CGH profiles of these genes.
The extent of genomic variation within a species is

630 Vol. 34, No. 5
Fig. 4. Homozygosity at the MTL Locus in Isolate S727
Panel A is the result of PCR amplification of the MTLa locus genes (MTLa1, PIKa, PAP1, OBPa) and the MTLa locus genes (MTLa2, PIKa, PAPa, OBPa) with genomic DNA
of isolates SC5314 and S727 as templates. Panel B is the result of qPCR analysis of the copies of MTL locus genes in S727 as compared to SC5314. Array CGH profile of the
MTLa locus genes is also presented.
Table 6. Primers Used for PCR Amplification of MTL Locus Genes
Name Sequence (5–3)
MTLa1 Fwd: AGAATGAAGACAACGAGGA
Rev: CTTACTGTGGGAAAAATGA
MTLa2 Fwd: ATGAATTCACATCTGGAGGC
Rev: CTGTTAATAGCAAAGCAGCC
PIKa Fwd: CATCTGAGGTCATCAAGTAGG
Rev: GTGAGTCAACCAGTCCGTAAA
PIKa Fwd: GTTACCCCTTCTATTACGG
Rev: TGACCATCTCCATCTACCA
OBPa Fwd: AATTGCTGGTCGCTGATCG
Rev: ATTATTCCCAATGTGTGCCAAC
OBPa Fwd: AATTTATCCAGCGAACATGCAC
Rev: CTTCTGTCCTGGAACAATCGG
PAP1 Fwd: AATCAAGCATACGGTGTTACAC
Rev: CCTCATGTCGCCAACCACAG
PAPa Fwd: CAAGAGTGACCGATGAGATA
Rev: CGCCTTCAGTAAAAGATGTA
believed to contribute to the species survival in their natural
environment. 25) Previous study of the C. albicans isolate
ATCC10231 identified 42 variable genes, including 5 amplified,
and 37 absent/divergent genes, as compared with
SC5314. 16) It is of interest, that we found that 20 of the 42
variable genes in ATCC10231 were also amplified or
absent/divergent in our isolates. However, in contrast to the
ATCC10231, eight clinical isolates from this study revealed
higher genomic variability. Of the 6111 chromosomal genes
represented on our microarrays, approximately 1116 genes
(18.3%) differed, as compared to the reference strain
SC4314. The absent/divergent genes, ranging from 88 to
302, prevailed in a total of seven isolates, while the amplified
genes prevailed in one isolate, S197, which was trisomic of
chromosome 1. In this regard, full or segmental aneuploidy
of different chromosomes that we found in three isolates also
seems to be a frequent event. Aneuploidy of the entire chromosomes
or large portions of chromosomes was previously
largely investigated in C. albicans. 3,14,15,26) Aneuploidy was
revealed in clinical isolates, 27—29) as well as in vitro experiments
that established formation of a specific chromosome alteration
in response to a specific stressful environment. 3,30—32)
Our analysis with GO Term Finder showed no significant
enrichment of any functional category among variable genes
from different isolates. We interpreted this fact, as an indication
that variability is not related to the function of the variable
genes, but rather to the structural features of DNA. Indeed,
substantial portion number of variations among genes
occurred in the same regions on chromosomes in different
isolates. These included sub-telomeric regions, retrotransposon-insertion
sites, and other regions. Genome variability at
sub-telomeric regions has been reported in such different
organisms, as, for example, humans and S. cerevisiae, and is
thought to result from ectopic recombination. 33,34) C. albicans
sub-telomeric regions contain repetitive sequences, including,
for example, CARE-2 or Rel-2. 35) These sequences
might contribute to the sub-telomeric instability.
Retrotransposon-insertion sites are known as regions that
generate high genome diversity between yeast isolates and
species. 36,37) In the strain ATCC10231, 11 of the 42 variable
genes were shown to be retrotransposon ORFs. 16) In this
study, we revealed the high variability in retrotransposon
composition, with copy number variations of retrotransposon

May 2011 631
ORFs as well as predicted ORFs located within retrotransposon.
The high retrotransposon variability observed in this
study raises the question whether the reduced number of
retrotransposons could result from selective pressures that
affect particular regions of the genome in response to adaptation
to particular environments, and the increased number of
retrotransposons results from stress-activated transposition.
Among the seven retrotransposons identified with copy number
variations, Zorro2, Zorro3, and Tca2 are active. 38,39)
In addition to sub-telomeric regions and retrotransposoninsertion
sites, some variable genes were clustered in a region
on chromosome 6 starting from 19.5973 to 20.6049 kb. A
total of 6 of the 8 genes in this region varied in at least 3 of
the 8 test isolates. This region was previously reported highly
polymorphic in C. albicans genome. 40)
In summary, this work provides the first comprehensive
evaluation of intraspecies genomic variation with clinical
isolates of C. albicans. We found genomic variability in different
chromosomal locations scattered across the chromosomes,
as well as clustered with high-frequency in certain
portions of chromosomes, including the sub-telomeric
regions, retrotransposon-insertion sites, as well as a variable
region on chromosome 6. Genes of diverse molecular functions
were involved, thus, indicating that, at least in some
cases, the cause of the variability could be the structural features
of the chromosomal regions. Further research is needed
to elucidate the molecular mechanisms of the variability.
Acknowledgements We thank Professor William A.
Fonzi for the gift of SC5314. We are grateful to Dr. Liang
Zhang, Dr. Yi-Min Sun, and Dr. Jian-Qing Zhao of Beijing
CapitalBio Corporation for their kind help of microarray
experiment. This work was supported by National High
Technology Research and Development Program of China
2008AA02Z128, Major State Basic Research Development
Program 2005CB523105, and Shanghai Major Basic Research
Development Program 08JC1405900.
REFERENCES
1) Eggimann P., Garbino J., Pittet D., Lancet Infect. Dis., 3, 685—702
(2003).
2) Gudlaugsson O., Gillespie S., Lee K., Vande Berg J., Hu J., Messer S.,
Herwaldt L., Pfaller M., Diekema D., Clin. Infect. Dis., 37, 1172—
1177 (2003).
3) Rustchenko E., FEMS Yeast Res., 7, 2—11 (2007).
4) Rustchenko E., Sherman F., “Fungi Pathogenic for Humans and Animals,”
ed. by Howard D. H., Vol. 16, Marcel Dekker, New York, 2002.
5) Selmecki A., Forche A., Berman J., Eukaryot. Cell., 9, 991—1008
(2010).
6) Iwaguchi S., Homma M., Tanaka K., J. Gen. Microbiol., 136, 2433—
2442 (1990).
7) Rustchenko-Bulgac E. P., J. Bacteriol., 173, 6586—6596 (1991).
8) Thrash-Bingham C., Gorman J. A., Curr. Genet., 22, 93—100 (1992).
9) Rustchenko E. P., Curran T. M., Sherman F., J. Bacteriol., 175, 7189—
7199 (1993).
10) Rustchenko E. P., Howard D. H., Sherman F., J. Bacteriol., 176,
3231—3241 (1994).
11) Perepnikhatka V., Fischer F. J., Niimi M., Baker R. A., Cannon R. D.,
Wang Y. K., Sherman F., Rustchenko E., J. Bacteriol., 181, 4041—
4049 (1999).
12) Chibana H., Beckerman J. L., Magee P. T., Genome Res., 10, 1865—
1877 (2000).
13) Magee B. B., Sanchez M. D., Saunders D., Harris D., Berriman M.,
Magee P. T., Fungal Genet. Biol., 45, 338—350 (2008).
14) Andaluz E., Gomez-Raja J., Hermosa B., Ciudad T., Rustchenko E.,
Calderone R., Larriba G., Fungal Genet. Biol., 44, 789—798 (2007).
15) Ahmad A., Kabir M. A., Kravets A., Andaluz E., Larriba G.,
Rustchenko E., Yeast, 25, 433—448 (2008).
16) Thewes S., Moran G. P., Magee B. B., Schaller M., Sullivan D. J.,
Hube B., BMC Microbiol., 8, 187 (2008).
17) Daran-Lapujade P., Daran J. M., Kotter P., Petit T., Piper M. D., Pronk
J. T., FEMS Yeast Res., 4, 259—269 (2003).
18) Carreto L., Eiriz M. F., Gomes A. C., Pereira P. M., Schuller D., Santos
M. A., BMC Genomics, 9, 524 (2008).
19) McCullough M. J., Clemons K. V., Stevens D. A., J. Clin. Microbiol.,
37, 417—421 (1999).
20) Hoffman C. S., Winston F., Gene, 57, 267—272 (1987).
21) Yang Y. H., Dudoit S., Luu P., Lin D. M., Peng V., Ngai J., Speed T. P.,
Nucleic Acids Res., 30, e15 (2002).
22) Wang P., Kim Y., Pollack J., Narasimhan B., Tibshirani R., Biostatistics,
6, 45—58 (2005).
23) Brennan C., Zhang Y., Leo C., Feng B., Cauwels C., Aguirre A. J.,
Kim M., Protopopov A., Chin L., Cancer Res., 64, 4744—4748
(2004).
24) Nicolet C., Guerin E., Neuville A., Kerckaert J. P., Wicker N.,
Bergmann E., Brigand C., Kedinger M., Gaub M. P., Guenot D., Cancer
Lett., 282, 195—204 (2009).
25) Chaillou S., Daty M., Baraige F., Dudez A. M., Anglade P., Jones R.,
Alpert C. A., Champomier-Verges M. C., Zagorec M., Appl. Environ.
Microbiol., 75, 970—980 (2009).
26) Selmecki A., Bergmann S., Berman J., Mol. Microbiol., 55, 1553—
1565 (2005).
27) Legrand M., Forche A., Selmecki A., Chan C., Kirkpatrick D. T.,
Berman J., PLoS Genet., 4, e1 (2008).
28) Wu W., Pujol C., Lockhart S. R., Soll D. R., Genetics, 169, 1311—
1327 (2005).
29) Diogo D., Bouchier C., d’Enfert C., Bougnoux M. E., Fungal Genet.
Biol., 46, 159—168 (2009).
30) Rustad T. R., Stevens D. A., Pfaller M. A., White T. C., Microbiology,
148, 1061—1072 (2002).
31) Selmecki A., Forche A., Berman J., Science, 313, 367—370 (2006).
32) Cowen L. E., Anderson J. B., Kohn L. M., Annu. Rev. Microbiol., 56,
139—165 (2002).
33) Liti G., Louis E. J., Annu. Rev. Microbiol., 59, 135—153 (2005).
34) Winzeler E. A., Castillo-Davis C. I., Oshiro G., Liang D., Richards D.
R., Zhou Y., Hartl D. L., Genetics, 163, 79—89 (2003).
35) Chibana H., Magee B. B., Grindle S., Ran Y., Scherer S., Magee P. T.,
Genetics, 149, 1739—1752 (1998).
36) Fischer G., James S. A., Roberts I. N., Oliver S. G., Louis E. J., Nature
(London), 405, 451—454 (2000).
37) Garfinkel D. J., Cytogenet. Genome Res., 110, 63—69 (2005).
38) Goodwin T. J., Ormandy J. E., Poulter R. T., Curr. Genet., 39, 83—91
(2001).
39) Holton N. J., Goodwin T. J., Butler M. I., Poulter R. T., Nucleic Acids
Res., 29, 4014—4024 (2001).
40) Jones T., Federspiel N. A., Chibana H., Dungan J., Kalman S., Magee
B. B., Newport G., Thorstenson Y. R., Agabian N., Magee P. T., Davis
R. W., Scherer S., Proc. Natl. Acad. Sci. U.S.A., 101, 7329—7334
(2004).