BIOTECHNOLOGY - Facultatea de Biotehnologii

MINISTRY OF EDUCATION AND RESEARCH 

UNIVERSITY OF AGRONOMICAL SCIENCES AND VETERINARY 

MEDICINE BUCHAREST 

„Proceedings of the International Symposium 

on New Researches in Biotechnology” 

Serie F 

- Special Volume - 

2008 

BIOTECHNOLOGY 

ISSN 1224-7774 

BUCHAREST 

2008

Proceeding of the International Symposium “NEW RESEARCH IN BIOTECHNOLOGY” 

USAMV Bucharest, Romania, 2008 

Redactarea şi coordonarea buletinului de lucrări ştiinţifice: 

U.S.A.M.V.Bucureşti, Facultatea de Biotehnologii 

B-dul Mărăşti nr.59,Bucureşti, sectorul 1,România 

Tel: + 40 21 318 25 67 

Fax: + 40 21 318 28 88 

Pentru schimb de publicaţii va rugam sa contactati Prof Dr Petru Niculiţă, Decanul 

Facultăţii de Biotehnologii 

Tel: + 40 21 318 36 40 

Mobil: + 40 740 11 44 01 

e-mail: petruniculita@agral.usamv.ro, petruniculita@yahoo.com 

Editorial board and coordination of the scientific bulletin: 

U.S.A.M.V.Bucuresti, Facultatea de Biotehnologii 


Tel: + 40 21 318 25 67 

Fax: + 40 21 318 28 88 

2 

∗ 

For the publications exchange please contact contactati Prof Dr Petru Niculiţă, 

Dean of the Faculty of Biotechnology 

Tel: + 40 21 318 36 40 

Mobil: + 40 740 11 44 01 

e-mail: petruniculita@agral.usamv.ro, petruniculita@yahoo.com 

∗ 

La redaction et la coordination de bulletin scientifique : 

U.S.A.M.V.Bucuresti, Facultatea de Biotehnologii 


Tel: + 40 21 318 25 67 

Fax: + 40 21 318 28 88 

Pour l’echange de publications prier de contacter Prof Dr Petru Niculiţă, Doyenne 

de la Faculte de Biotechnologie 

Tel: + 40 21 318 36 40 

Mobil: + 40 740 11 44 01 

e-mail: petruniculita@agral.usamv.ro, petruniculita@yahoo.com



SCIENTIFIC COMMITTEE 

Petru NICULITA - Prof. univ. dr., Decanul Facultatii de Biotehnologii - USAMV 

Bucuresti, Membru titular al Academiei de Stiinte Agricole si 

Silvice, Presedinte al sectiei de Industrie Alimentara - ASAS 

- Prof. Dr., Dean of the Faculty of Biotechnologies - USAMV 

Bucharest, Full-member of the Academy of Agricultural and 

Forestry Sciences, President of the Food Industry Department- 

ASAS 

Mona Elena POPA - Prof. univ. dr., Secretar Stiintific al Facultatii de Biotehnologii - 

USAMV Bucuresti 

- Prof. Dr., Scientific Secretary of the Faculty of Biotechnologies - 

USAMV Bucharest 

Ovidiu POPA – Conf. univ. dr., prodecan al Facultatiii de Biotenologii – USAMV 

Bucuresti 

- Secondary dean of the Faculty of Biotechnologies - USAMV 

Bucharest 

Stefana JURCOANE – Prof. univ. dr., Facultatea de Biotehnologii - USAMV Bucuresti; 

- Faculty of Biotechnologies - USAMV Bucharest 

Maria PELE – Prof univ. dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


Narcisa BABEANU – Conf. univ. dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


Adrian VAMANU – Conf. univ dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


ORGANIZING and EDITORIAL COMMITTEE 

Mona Elena POPA - Prof. univ. dr., Secretar Stiintific al Facultatii de Biotehnologii - 

USAMV Bucuresti 

- Prof. Dr.,Scientific Secretary of the Faculty of Biotechnologies - 

USAMV Bucharest 

Florentina RADOI MATEI – Lecturer dr., Facultatea de Biotehnologii - USAMV 

Bucuresti; 


Ana ROSU – Conf. univ. dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


Florentina ISRAEL – Lecturer dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


Irina LUPESCU – Lecturer dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


Catalina VOAIDES – Asist. Dr., Facultatea de Biotehnologii - USAMV Bucuresti; 


3



4 

ORGANIZERS 

USAMV Bucharest, Faculty of Biotechnology 

Centre of Microbial Biotechnology BIOTEHGEN 

SPONSORS 

Main sponsor: AMEX Import-Export SRL 

Other sponsors: DEXTER SRL 

DACCHIM SRL



CONTENT 

SECTION I: AGRICULTURAL BIOTECHNOLOGY 

Attempts to create genetic diversity of barley by reversions 

R. Šiukšta, V. Vaitkūnienė, L. Balčiūnienė, D. Žvingila, V. Rančelis 

Hiperhydricity annihilation out of vitrocultures with deuterium depleted water and pi water, 

using a double layer system 

Petrus - Vancea, Adriana, Radovet – Salinschi, Dorina, Cachita - Cosma, Dorina 

Microrpropagation and antiviral activity of extracts from Lamium album L. 

S.Shishkov, M.Dimitrova, K.Kostova, Atanasova, V.Kapchina-Toteva 

Molecular characterization of some Azospirillum spp. And Rhizobium spp. Strains, useful for 

plant protection 

Cornea Calina Petruta, Sorina Dinu, Matilda Ciuca, Catalina Voaides, Florin Oancea 

Researches regarding design, realization and test of an installation for bio-preservatives based 

on acid-lactic bacteria. 

I Ţenu; C. Bercovici; Aurelia Soare 

Researches regarding design, realization and test of a filter installation for obtaining, under 

liquid form, of bio-preservative based on acid-lactic bacteria. 

I Ţenu; C. Bercovici; Aurelia Soare 

Researches regarding the optimization of honey bee (Apis mellifera l) instrumental 

insemination technology 

Cauia Eliza, Siceanu Adrian, Sapcaliu Agripina, 

Studies regarding lead regulated genes and metal hyperaccumulation 

Mihacea S., Cincu E. 

The determination of changes induced by the treatment with laser diodes on solanaceae 

vegeteble plants in the first stages of vegetation 

P. Niculita, F. Israel-Roming, S. Danaila-Guidea, E. Gherghina,V. Simion, G. Luţă, Oana 

Livadariu,J. Ristici and M. Ristici 

The influence of modulated magnetic field at audio frequency over over some biochemical 

results in pepper (opal variety) and tomatoes (dacia variety) seeds and plantlets 

P. Niculita, F. Israel-Roming, S. Danaila-Guidea, R. Gherghina, G. Luţă, V. Simion, 

Oana Livadariu, A. Patroi 

The intralocus and average gene diversity among Romanian alfalfa genotypes 

Petolescu C., Mihacea S., Nedelea G. 

13 

20 

31 

38 

45 

51 

59 

66 

72 

81 

89 

5



The use of biotechnology in new phitohormonal treatments for plants with the aim of 

achieving nutritional quality and a superior production 

Evelina Gherghina, Gabriela Luta, Florentina Israel Roming, Daniela Balan 

6 

SECTION II: BIOTECHNOLOGY IN VETERINARY MEDICINE 

A contribution to insight of the most important etiological factors with influence of farm 

animal health in Serbia 

Bojkovski, J., Radojicic Biljana 

Differential diagnostic of neurological disorders to support surveillance passive programme of 

transmissible spongiphorm encephalopathies (TSE) in the ruminants 

Radojicic Biljana, J. Bojkovski, B. Dimitrijevic 

Effect of lactic bacteria on corn steeping 

Mironescu M., Mironescu V., Georgescu C. 

Fatty liver incidence on dairy cow farms in Serbia and Romania 

Danijela Kirovski, Horea Samanc, Horia Cernescu, Milijan Jovanovic and Ivan Vujanac 

Monitoring of drinking water quality in intensive pig production concerning animal welfare 

Alenka Tofant, Zeljko Pavicic, Mario Ostovic, Marina Mikulic 

The use of new probiotic preparation to inactivation of ochratoxin A in fodder for poultry 

Slizewska Katarzyna 

Review and future Potencial for Utilization of Biomes Byproducts in Animal feed 

Jovanka Levic, Slavica Sredanovic, Ljubinko Levic 

SECTION III: FOOD BIOTECHNOLOGY 

Achievement of a fortifying fruit products riched with iron 

Adriana Voicu, Gheorghe Campeanu 

An application of statistical modeling to a problem of the predictive mycology 

Varga Mioara, Matei Florentina 

Aspects regarding application of traceability in the process of manufacturing liquid 

hop yeast used in baking industry 

Iuliana Bratu, Cecilia Georgescu 

Biological activity of some selective extracts obtained from Rosmarinus officinalis L. 

Georgeta Neagu-Caraene, Cornelia Nichita, Virginia Vulturescu, Nicoleta Badea, 

Cristina Bazdoaca, Georgeta Radulescu, Radu Albulescu 

95 

101 

115 

123 

130 

138 

144 

149 

158 

165 

172 

179



Centaurea cyanus L. - herba, chemical composition and therapeutical potential 

Lucia Pirvu, Alice Armatu, Stelian Schiopu, Ileana Rau, Dragomir Coprean 

Correlation between active principles naturally present in some vegetal products and sedative 

activity 

Svetlana Colceru-Mihul, Alice Armatu, Sultana Nita, Nuta Manaila, Minerva Panteli, 

Iuksel Rasit, Maria Ichim 

Dynamics of galanthamine and lycorine contents in long-term in vitro cultures of Leucojum 

aestivum L. (Amaryllidaceae) 

Marina Stanilova, Emil Molle, Yuliyana Bogdanova, Lyubov Hristova, Bozhidarka 

Pandova, Monique Burrus, Stanislav Yanev 

Effect of selenium on morphology and activity of the genus lactobacillus 

Ilona Motyl 

Effects of dietary oligofructose on the children gut flora 

Kordyl Marzena, Libudzisz Zdzisława, Śliżewska Katarzyna 

Effects of Jasmonic acid on galanthamine content in Leucojum aestivum long-term cultures 

Yuliyana Bogdanova, Bozhidarka Pandova, Stanislav Yanev and Marina Stanilova 

Evaluation of antioxidant and free radical scavenging potential and determination of 

bioactive compounds of various plant extracts 

Alice Armatu, Svetlana Colceru-MihuL, Lucia Parvu, Nuta Manaila, Maria Ichim 

Evolution of thiamin, riboflavin, niacin and ascorbic acid content during germination of 

soybean seeds (Glycine max.) 

Gratziela-Victoria Bahaciu 

Food processing by ohmic heating applied to meat products 

A. Miteluț, M. Popa, P. Niculiță, R. Cramariuc, I. Vătuiu, M. Geicu, M. Ghiduruș, M. 

Turtoi, D. Vătuiu 

Fruit wines polyphenols and S.cerevisiae yeast interactions 

Agata Czyzowska 

Functional yoghurt containing encapsulated Lactobacillus Acidophillus 

Anicuta Stoica, Marta Stroescu, Mariana Ferdes, Iuliana Jipa, Tatiana Ofiteru 

Improvement of biomass production and DNA extraction from filamentous fungi Ioana 

Vatuiu, Daniela Vatuiu, Beatrice Gilea, Luminita Dejan, Catalina Voaides, Calina Petruta 

Cornea, Florentina Matei 

Influence of laser irradiation on seed germination: case study Stevia rebaudiana Shevchenko 

J., Smetanska I 

187 

195 

203 

213 

218 

223 

233 

241 

247 

254 

260 

267 

272 

7



Influence of pulsed electric fields on micotoxigenic fungi growth 

Mihaela Geicu, Petru Niculita, Mona Popa, Radu Cramariuc, Mira Turtoi 

Influence of packaging method on bacterial flora of meat products 

Agnieszka Nowak, Anna Rygała 

Investigation of the composition of Rhododendron kotschyi Simk. volatile oil by GC-MS 

Cecilia Georgescu, Iuliana Bratu, Monica Mironescu 

Microbial air quality as a control point in meat processing plant 

Agnieszka Nowak, Małgorzata Piotrowska 

Modify atmosphere packaging equipment for Food Safety, between producers supply and 

customer demand 

Moldovan Laurentiu, Daniela Cioboata, Gabriela Margarit 

Modern substances used as a fungicidal disinfectants 

Anna Koziróg 

Modulation in the intestinal microbiota by probiotic lactobacillus strains in children with 

atopic Dermatitis 

Ilona Motyl, Elżbieta Klewicka, Katarzyna Śliżewska, Bożena Cukrowska, Zdzisława 

Libudzisz 

Nutraceutical product with prophylactic and therapeutic activity in hepatic diseases Cornelia 

Nichita, Georgeta Caraene, Virginia Vulturescu, Cristina Bazdoaca, Georgeta Radulescu, 

Radu Albulescu, Maria Giurginca 

PEF treatment effect on minced pork meat shelf-life 

Mira Turtoi, Mona Popa, Petru Niculită, Radu Cramariuc, Ioana Vătuiu, Mihaela 

Ghidurus, Amalia Mitelut, Mihaela Geicu, Daniela Vătuiu 

Posibilities for reducing the rate of DON contamination through physical methods Anca 

Radu, Valeria Gagiu, Mihaela Avram, Enuta Iorga, Nastasia Belc 

Role of Differential Scanning Calorimetriy studies (DSC) in the protocol designing for 

bioconservation by freeze-drying of total grape seed polyphenolic extract (TGSPE). 

B Burghelea, P Budrugeac, R Campeanu, G Neagu-Caraene, V Vulturescu, R Porumb 

The assay of heavy metals content from sea buckthorn, wheat germs and fish oils with 

purpose to estimate theirs food security like foods and foods supplements 

Isabela Crăciun, Mihaela Chefani, Cecilia Georgescu, Vasile Jâscanu 

The growth and end products of Lactobacillus probiotic strains in the presence of resistant 

dextrin 

Śliżewska Katarzyna, Barczyńska Renata, Kapuśniak Janusz, Libudzisz Zdzisława 

8 

276 

283 

289 

297 

303 

312 

319 

327 

335 

341 

347 

356 

366



The influence of culture conditions on DON production by Fusarium graminearum 

Anca Radu, Valeria Gagiu, Mihaela Avram, Enuta Iorga, Nastasia Belc 

The optimizing extraction of a crude phytosterols with a view to obtain functional foods, 

chem. 

Pascal S. Livia, Segal Rodica 

The use of dried sourdough in breadmaking 

Duta Denisa Eglantina 

Traceability assurance technics in fish processing 

Mihaela Geicu, Adriana Sterian, Mona Elena Popa 

Wort Production from Grist Using Different Portions of Malt Triticale and Commercial 

Enzyme 

Kokic, Bojana Msc, Grujic, Olgica 

Wort Production from Grist with Different Portions of Malt Triticale 

Kokic, Bojana Msc, Grujic, Olgica 

SECTION IV: INDUSTRIAL AND ENVIRONMENTAL BIOTECHNOLOGY 

Biodiversity conservation through alternative crops 

Marin Doru Ioan, Babeanu Narcisa, Popa Ovidiu 

Contributions to the chemical characterization of some vegetal products with insecticidal 

activity obtained from Chrysanthemum cinerariaefolium L. acclimatized in Constanta 

Lucia Pirvu, Alice Armatu, Dragomir Coprean 

Effect of the genotype-environmental interaction on the phenotype variation of the bunch 

weight in white and red wine varieties 

Nevena Petrovic, Branislava Sivcev, Ivana Tosic 

Ex situ conservation in Gentiana lutea L. through somatic embryogenesis 

Holobiuc Irina, Blindu R., Brezeanu A. 

Fermentation profiles of yeast strains cultivated on apple pomace 

Agata Czyzowska, Dorota Kręgiel, Wojciech Ambroziak 

Fluorescent methods for evaluation of cytotoxic activity based on high performance 

techniques 

Virginia Vulturescu, Georgeta Caraene, Lucian Albulescu, Cornelia Nichita, Radu 

Albulescu 

Genotyping of wild raspberry (Rubus Idaeus l.) accessions with RAPD markers 

J. Patamsytė, L. Balčiūnienė, J. Labokas, V. Kleizaitė, V. Rančelis, D. Žvingila. 

371 

378 

385 

396 

404 

412 

420 

426 

437 

449 

459 

464 

470 

9



Influence of microbial bioproducts on agricultural crops 

Narcisa Babeanu, O. Popa, D.I. Marin, A. Vamanu, E. Vamanu, Marina Pamfil, N. Dinca 

Influence of the liquefaction conditions on the composition in sugars of the liquefied starch 

Mironescu V., Trifan A. 

Investigation of the adhesion capabilities of Aeromonas hydrophila to different polysiloxane 

carriers 

Kregiel D., Rygala A., Ambroziak W., Mizerska U., Fortuniak W., Chojnowski J. 

Metabolites with biotechnological potential synthesized by pseudomonas bacterial strains 

Anca Voicu, Mihaela Marilena Lăzăroaie, Mugur Ştefănescu 

Modelling starch structure for the simulation of the enzymatic hydrolysis 

Mironescu I. D., Mironescu V. 

Molecular techniques used for evaluation of the romanian honeybees genofond in order to 

establish the purity of local race for conservation and amelioration. 

Usurelu Daniela, Cauia Eliza, Magdalena Laura Monica, Cimponeriu Danut, Apostol 

Pompilia, Holban Alina, Siceanu Adrian 

Odor removal from the environment through the action of microorganisms 

Borowski Sebastian, Gutarowska Beata 

Pharmacological evaluation of total grape seed polyphenolic extract (TGSPE) as ingredient in 

cosmetics, complying with EU regulation concerning natural bioactive products. 

B Burghelea, G Neagu-Caraene, R Campeanu, L Cremer, R Iuksel, V Vulturescu, C 

Nichita, R Albulescu, R Porumb, A Lupu 

Researches regarding the influence of some biopreparations on the control of the pathogen 

bacteria for Lycopersicon esculentum L. and Solanum melongena L 

O. Livadariu, N. Babeanu, O. Popa, M. Oprea, M. Pamfil, A. Vamanu, E. Vamanu 

Spatial climate variability and viticulture in the regions: South Banat, Shumadia-Danube and 

Timoc of Serbia 

Branislava Sivcev, Nevena Petrrovic, Ivana Tosic 

The evaluation of stimulative and protective effect induced by treatments with biocontrol 

agents on plant development 

Helepciuc F.E., Carasan E.M., Brezeanu A., Cornea C.P., Voaides C. 

The selection of yeast strains suitable for growth on apple residues 

Kregiel D., Czyzowska A., Ambroziak W. 

The importance of nitrogen fixators as biofertilisers in the organic production 

Gorica Cvijanovic, Jonel Subic, Gordana Dozet 

10 

479 

489 

498 

503 

513 

519 

529 

539 

548 

557 

562 

569 

574



SECTION V: OTHERS 

Flowering and fruit- particularities of the dena lettuce variety 

Elena Stefanescu, Elena-Liliana Milovici, Minerva Heitz, Gapsa Florin 

Flowering and fruit- setting biology of the spinach cultivar smarald 

Elena Stefanescu, Elena-Liliana Milovici, Minerva Heitz, Gapsa Florin 

Magnetospirillum gryphiswaldense as a source of magnetite nanoparticles:biological and 

bionanotechnological significance 

Moisescu C, Ignat M., Constantin M, Virgolici M. Cârnu M. , Ardelean I. 

Morpho-anatomic changes of some horticultural plants induced by mites 

Vasilica Luchian, Minodora Tudose, Elena Savulescu 

Morpho-anatomic changes of some horticultural plants when are attacked by aphids 

Vasilica Luchian, Minodora Tudose, Elena Savulescu 

Obtaining of metallic nanoparticles using B. subtilis 

Manoiu Vasile-Sorin, Ovidiu Popa, Narcisa Băbeanu, Drugulescu Manuel, Zambilă Nela, 

Manoiu Valentina-Mariana 

Representation of Romanian companies in European e-commerce 

Gabriela Margarit, Radu Toma 

The behavior of a varieties of Vitis vinifera L. when are attacked by mites 

Vasilica Luchian, Minodora Tudose 

582 

586 

594 

603 

609 

615 

622 

630 

11



12 

FOREWORD 

Currently, Biotechnology, a large coverage and maximum importance area in the 

entire science and applied engineering, faces spectacular development and expansion, 

comparable only with the development of information technology field. 

Forecasts for the future are unanimous regarding the extension and amplification 

of biotechnology development in all areas of human activity. 

Modern biotechnology in European recognition represents the integration of the 

biological sciences into engineering in order to achieve the manipulation of organisms, 

cells, and components of molecular analogues to obtain goods and services. 

Current research and applications grant biotechnology a particular place and a 

special importance throughout the current and future sciences and technologies. 

The main engine of biotechnology development as science and its applications is 

represented by the scientific research and by the scientists and professors involved in the 

research institutes and universities. 

That is why biotechnology researchers and specialists meetings, contacts and 

results communication are welcome and beneficial. 

The International Symposium organized by the Faculty of Biotechnology within 

USAMV Bucharest has enjoyed a participation that honors us. 

We all accept that the technological transfer of research results to companies and 

real economy is a fundamental objective of the research. And we all agree that the 

presentation and publication of research results are essential for the extension of 

knowledge and technology dissemination. 

The publication in this volume of work presented at the conference confirms this 

reality. The amount of work gives value to the current book. 

I express on this way my compliments to the authors who presented at the 

symposium and published in this volume and thank them for the value, passion and the 

work they have embedded in them. 

Professor Dr Petru Niculita 

Dean of Biotechnology Faculty



ATTEMPTS TO CREATE THE GENETIC DIVERSITY OF 

BARLEY BY REVERSIONS 

R. ŠIUKŠTA 1,2 , L. BALČIŪNIENĖ 2 , V. VAITKŪNIENĖ 1 , T. 

ČĖSNIENĖ 1 , D. ŽVINGILA 1 , V. RANČELIS 1 

Abstract: Part of the newly induced plant mutants are characterised 

by genetic instability and an increased frequency of revertants in their 

progenies, as well as by the pleiotropic action of mutant genes. The 

barley mutant ′tweaky spike′ (tw) belongs to such mutants. Splitting of 

the complex of pleiotropic characters has been proposed and 

confirmed experimentally, and the nature of reversions was controlled 

by different means, including the RAPD method of DNA analysis. 

Investigations show that revertants from pleiotropic mutants are a 

real new source of plant diversity for biotechnological purposes. 

Key words: barley, unstable mutants, diversity of reversions, 

splitting of pleiotropic complex. 

1. Revertants in plant biotechnology and genetics 

Reversions from mutant state to normal wild type are used in plant 

biotechnology and genetics for various purposes, - not only for the analysis of gene 

structure, but also for restoring transgene silencing [1], suppression of phenotypical 

effects of T-DNA [2] or of transposable elements [3, 4], for investigating the viral 

DNA [5] or RNA [6] interaction with the host genome and the movement of virus 

macromolecules across the plant, relation between nuclear and mitochondrial genes 

and for restoring CMS [7], the nature of regulatoraly sequences in the exon−intron 

boundary and intron mutations [8]. Reversions were especially effectively used for 

producing plant material resistant to fungal infections [5, 6, 9, 10]. 

1 

Department of Botany and Genetics, Vilnius University, Lithuania, e-mail: 

jolanta.patamsyte@gf.vu.lt 

2 

Botanical Garden of Vilnius University, Lithuania 

13



With discovering the new types of mutations, also new types of reversions 

were discovered. For instance, reversions from intron mutations [8], epimutations 

[11] have been fixed, and even a principially new type of reversions from 

Arabidopsis hothead mutation, owing to the long-living RNA templet [12], are 

widely discussed. 

From the classical works (well known even from textbooks about reversion 

from missense or nonsense mutations), confirmed also in several works [8, 10] 

reffered above, it is well known that in many cases revertants do not mean an exact 

return to the initial state of gene: only the restoration of gene activity takes place. 

In flax, it has even been shown that revertants do not always possess the parental 

specificity as regards resistance to flax rust races [10]. Two pecularities – the 

genetic instability and pleiotropy of barley mutants tweaky spike (tw) –offer an 

excelent possibility to elaborate the technology of creating diversity of revertants 

having practical significance. 

A large collection of revertants characterised by a diversity of quantitative 

traits and having an economic value was created by us. 

The investigation or revertants proceeded in three directions: the revertant 

nature of plants arised from mutant to wild type, characterisation of revertants by 

quantitative features, and transfer of revertant analysis and selection to cell culture. 

To latter goals just steps have been made. 

2. Grounding of reversions 

At the first, all tw type mutants are allelic recessive and characterised by a 

specific form of spikes (Fig. 1, A). This peculiarity helps significantly to 

distinguish reversions to the wild type (WT) even in field trials. The recessive 

nature of tw mutants also helps to determine newly arisen revertants, because the 

WT gene is dominant and is not masked by the heterozygotic state. 

14 

Fig. 1. Reversions: 

(A) in spike structure: R – full reversion to wild type (WT); C – 

compact spike; 

(B) – from mutant homeotic flower (5 stamens + 1 carpel) to normal 

WT (2 lodicules + 3 stamens + 1 carpel). 

The other important peculiarity of tw mutants as a system for 

detection of revertants is homeotic conversion of lodicules to stamens 

(Fig. 1, B) or, more rarely, to carpels or both plant sexual organs. 

Lodicules are specific flower organs for grasses. Revertants have a



normal flower structure as has also the WT: 2 lodicules + 3 stamens + 1 carpel 

(Fig. 1, B). Reversions of the flower structure of the homeotic mutants to WT 

allows an additional and important test to control the reversion process. 

The homeotic conversion test was successfully applied for the reversion 

type specific only to mutants tw1 and tw2. Several phenotypic polymorphisms of 

allelic mutants reflected also on the revertants. Allelic mutants tw1 and tw2 a more 

slightly expressed mutant phenotype, and two types of revertants were revealed 

among their progenies. Beside a typical reversion as shown in Fig. 1 A, also 

compactoid plants were observed. Compactoid plants are of interest for their higher 

resistance to lodging. No compactoid plants were detected among the progenies of 

other tw allelic mutants. 

The revertant nature of compactoid plants was proven by flower structure 

analysis. All 100% of tested flowers from a compactoid plant had a normal 

structure as also WT and other revertants, while about 50% of tw1 flowers showed a 

homeotic conversion of lodicules. 

3. The use of the RAPD DNA analysis for reversion control 

In the present work, all the test tw allelic mutants and revertants from them 

had the comon initial genetic background. All were induced by chemical 

mutagenesis from the same barley cultivar ′Auksiniai II′. The common history of 

tw mutants offers a great perspective to use molecular markers for comparing the 

revertants with the initial tw mutants, as well as with the historically initial WT type 

cv. ′Auksiniai II′. 

The RAPD method of DNA polymorphism analysis was adapted. 

Methodical details can be found in [13]. 

Table 1. Comparison of DNA genetic distances (%) between 

revertants and initial mutant tw1 or initial wild type barley cv. 

′Auksiniai II′ (AII) 

tw1 R1 R7 R9 R11 R12 R17 R18 R19 R20 R29 R30 R35 R48 C4 

AII 7.9 0.3 0.8 0.8 0.8 0.8 5.8 1.1 3.8 0.3 1.0 0.5 1.4 0.3 2.0 

tw1 0 7.7 7.1 7.1 7.1 7.1 6.2 6.8 6.4 7.7 7.4 7.4 8.8 7.7 6.6 

For DNA analysis, 33 random decamer primers were used, and 

summarized results for a concrete revertant are expressed as genetic distances (in 

%) to the initial tw mutant and to the initial WT type ′Auksiniai II′. 

In Table 1, only results for revertants from tw1 are shown. Beside the full 

revertants, one compactoid revertant C4 is also presented. It belongs to a group of 

15



revertants for which the genetic distance from the initial WT is more than 1%. 

However, several full revertants (R) were genetically even more different from the 

initial WT (as, for instance, R19, see also Fig. 2). Such more distinct revertants 

comprised about half of the test revertants. Figure 2 shows RAPD phenotypes for 

both groups: R1 and R7 differ from WT slightly, and R17 or R19, as well as C4, are 

more different from WT. 

16 

Fig. 2. Selected RAPD phenotypes (primer Roth 470- 

6) showing differences among various revertants: 

M – molecular marker; AII – wild type cv. ′Auksiniai 

II′; tw1 – initial tw mutant; R1, R7 – close to AII and 

R17, R19 – more different from AII revertants; C – 

compactoid line. 

On the other hand, DNA analysis also confirms the difference of the 

revertants from the same background, and the polymorphism of revertants is 

reflected on the DNA level. 

4. Phenotypic characteristics and practical use of revertants 

Two phenomena were basic for creating the collection of revertants: 

genetic instability of several tw type mutants, and the pleiotropic character of 

mutation in the tw locus. The latter was observed despite the monogenic nature of 

tw mutants, determined experimentally [14]. It was expected that the splitting of 

the complex of pleiotropic traits may happen in revertants, and this idea was 

grounded experimentally. 

The first character that attracted our attention in tw mutants was a 

significantly higher protein content (1.5–2 times) in grains. It may be caused not 

only by mutant gene, but also by a lower seed production of tw mutants. However, 

revertants were chose with restored seed production and a higher, in comparison 

with WT, protein content. The composition of amino acids in grains was also 

altered, but a high polymorphism was present. Reversions with a higher lysine 

content were very rare, and revertants with an increased content of methionin or 

tryptophan were absent. The content of these three amino acids is very important 

for food quality. More frequent were alterations in Glu, Gly, Asp, Ala content.



Data on the revertants are summarized in Table 2. 

Another practically important feature of tw type mutants is their 

immunodeficiency to fungal infection. This peculiarity of tw mutants was explored 

by us in several directions, including selection of immunoresistant plants. 

The composition of micromycetes in grains was determined. At present, the pure 

culture of Cochliobolus sativus is made, and toxins from C. sativus and other fungi 

are used in cell cultures as selective factors. The collection of revertants is also 

used for immunity induction by chemical inducers (salicylic and trans-cinnamic 

acids) [15]. 

Table 2. Summary of the main pecularities of revertants from barley tw mutants 

Character/peculiarity 

Alteration to initial WT 

− + 

Productivity − + + 

Protein content − + + 

Soluble protein fractions 

Variation between tw and WT; the new 

fractions determined 

Amino acids: 

Pro Asp Glu Pro − 

Lys 1 Ala Gly Asp + 

Resistance to lodging − + + 2 

Mass of grains − + + 

Sensitivity to studied micromycetes 

− − + + 

1 – Only one revertant (tw2 → R). 

2 – Resistant compactoid lines. 

Acknowledgments 

This work was supported by Grant T-45 from Lithuanian State Science and 

Studies Fundation, the Lithuanian State Programme ′Genefund′ and by the Agency 

for International Science and Technology Development Programmes in Lithuania. 

17



References 

1. Morino, K., Olsen, O.-A., Shimamoto, K.: Silencing of the aleurone-specific 

Ltp2-gus gene in transgenic rice is reversed by transgene rearrangements and loss 

of aberrant transcripts. In: Plant Cell and Physiology, vol. 45 (10), 2004, p. 1500- 

1508. 

2. Sincar, V.P., White, F.F., Furner, I.J., Abrahamsen, M., Pythoud, F., Gordon, 

M.P.: Reversion of aberrant plants transformed with Agrobacetrium rhizogenes is 

associated with transcriptional inactivation of the TL-DNA genes. In: Plant 

Physiology, vol. 86 (2), 1988, p. 584-590. 

3. Chopra, S., Brendel, V., Zhang, J., Axtell, J.D., Peterson, T.: Molecular 

characterisation of a mutable pigmentation phenotype and isolation ot the first 

active transposable element from Sorghum bicolor. In.: Proceedings of the 

National Academy of Sciences (USA), vol. 90 (26), 1999, p. 15330-15335. 

4. Vandenbussche, M., Zethof, J., Souer, E., Koes, R., Tornielli, G.B., Pezzotti, M., 

Ferrario, S., Angenent, G.C., Gerats, T.: Toward the analysis of the Petunia MADS 

box gene family by reverse and forward transposon insertion mutagenesis 

approaches: B, C, and D floral organ identity functions require SEPALATA-like 

MADS box genes in Petunia. In: Plant Cell, vol. 15 (11), 2003, p. 2680-2693. 

5. Gilbertson, R.L., Sudarshana M., Jiang, H., Rojas, M.R., Lucas, W.J.: 

Limitations on geminivirus genome size imposed by plasmodesmata and virusencoded 

movement protein: insights into DNA trafficking. In: Plant Cell, vol. 15 

(11), 2003, p. 2578-2591. 

6. Boonrod, K., Chotewutmontri, S., Galetzka, D., Krczal, G.: Analysis of 

tombusvirus revetants to identify essential amino acid residues within RNAdependent 

RNA plymerase motifs. In: Journal of General Virology, vol. 86 (3), 

2005, p. 823-826. 

7. Fauron, C.M.-R., Havlik, M., Brettell, R.I.S.: The mitochondrial genome 

organization of a maize fertile cmsT revertant line is generated through 

recombination between two sets of repeats. In: Genetics, vol. 12 (2), 1990, p. 423- 

428. 

8. Yi, Y., Jack, T.: An intragenic suppressor of the Arabidopsis floral organ 

identity mutant apetala 3-1 functions by suppressing defects in splicing. In: Plant 

Cell, vol. 10 (9), 1998, p. 1465-1477. 

9. Zhang, Y., Goritschnig, S., Dong, X., Li, X.: A gain-of-function mutation in a 

plant disease resistance gene leads to constitutive activation of downstream signal 

transduction pathways in suppressor of npr1-1, constitutive 1. In: Plant Cell, vol. 

15 (11), 2003, p. 2636-2646. 

18



10. Islam, M.R., Shepherd, K.W.: Analysis of phenotypes of recombinants and 

revertants from testcrosses progenies involving genes at the L group, conferring 

resistance to rust in flax. In: Hereditas, vol. 114 (2), 1991, p. 125-129. 

11. Meins, F.Jr., Thomas, M.: Meiotic transmission of epigenetic changes in the 

cell-division factor reqiurement of plant cells. In: Development, vol. 130 (25), 

2003, p. 6201-6208. 

12. Lolle, S.J., Victor, J.L., Young, J.M., Pruitt, R.E.: Genome-wide non-mendelian 

inheritance of extra-genomic information in Arabidopsis. In: Nature, vol. 434 

(7032), 2005, p. 505-509. 

13. Patamsytė, J., Žvingila, D., Balčiūnienė, L., Baliuckas, V., Labokas, J., 

Kleizaitė, V., Rančelis, V.: Genotyping of the wild raspberry (Rubus idaeus L.) 

accessions with RAPD markers. In: Proceedings of the International Symposium 

′New Research in Biotechnology′. USAMV Bucharest, Romania, 2008, p. 00-00. 

14. Rančelis, V., Vaitkūnienė, V., Balčiūnienė, L., Mačkinaitė, R., Leistrumaitė, 

A.: Reversions from genetically unstable mutants as a means of expanding the 

genetic diversity of barley. In: Genetic Variation for Plant Breeding. Eds. J. 

Vallmann, H. Grausgruber, P. Ruckenbauer. Vienna. EUCARPIA and BOKU, 

2004, p. 219-222. 

15. Vaikūnienė, V., Drumstienė, A., Balčiūnienė, L., Šiukšta, R., Mačkinaitė, R., 

Leistrumaitė, A., Rančelis, V.: Attempts to improve the resistance of plant material 

by treatment with salicylic and trans-cinnamic acids using barley tw mutants as a 

model. In: Modern Variety Breeding for Present and Future Needs. Proceedings of 

18 EUCARPIA General Congress. Eds. J. Prohens and M.L. Badenes. Universidad 

Politecnica de Valencia, Spain, 2008, p. 485-489. 

19



HYPERHYDRICITY ANNIHILATION FROM 

VITROCULTURES WITH DEUTERIUM DEPLETED 

WATER AND Pi WATER, BY DOUBLE LAYER SYSTEM 

A. PETRUŞ – VANCEA ∗ , D. RADOVEŢ – SALINSCHI ∗∗ , D. 

∗ ∗ ∗ 

CACHIŢĂ – COSMA 

Introduction 

v.cachita@gmail.com 

20 

Abstract: The motivation of this experiment was to develop new 

methods of removing hyperhydricity from vitrocultures. The solution 

that we found it at Coleus and Petunia vitroplantlets, suffering by 

hyperhydricity, is their vitrocultivation in double layer system (by 

applying over vitroplantlets a supernatant consisted in deuterium 

depleted water [DDW] or Pi water [PiW]). After 30 days of 

vitrocultures in double layer we observed the following results: at the 

Coleus vitroplantlets a new formation of healthy apexes, which were 

subcultivated on fresh medium and finally the new regenerated 

vitroplantlets were ready for acclimatization, especially to those lots 

which were treated with a 1,5 % glucose solution, prepared with 

DDW or PiW and to the Petunia vitroplantlets, the acclimatization 

surviving rate was 90% - 95% to the lots treated with DDW, 

respectively PiW and was zero to the vitroplantlets submersed in 

distilled water (DW - control lot). 

Keywords: hyperhydricity, deuterium depleted water, Pi water, 

double layer system 

Hyperhydricity, old called vitrification, is unwanted morpho-physiological 

phenomenon (with some exceptions) which affect vegetal vitrocultures, frequently 

∗ Depart. of Biology, Faculty of Science, University of Oradea, Romania, e – mail: 

adrianavan@yahoo.com 

∗ ∗ Environmental Protection Agency of Bihor County, Romania, e – mail: dorinaradovet@yahoo.com 

∗ ∗ ∗ Faculty of Nature Science, "Vasile Goldiş” West University Arad, Romania, e-mail:



the phytoinoculs becoming glassy, malformated, depigmentated, those vitroplantlets 

being unfit to acclimatization causing great damage in the biotechnologies based on 

micropropagation (Cachiţă, 1987). 

Was noticed that different types of water, as deuterium depleted water or Pi 

water may be used on antitumor treatments, to plants (Somlyai, 2001; Fülőp, 

manuscript), but to vitroplantlets this effects was less studied. 

Deuterium depleted water (DDW) – produced by National Research- 

Development Institute for Cryogenic Technologies from Râmnicu Vâlcea, had 

already many uses in cancer therapy and was made researches regarding their effect 

upon vegetal organisms, including they effect an phytoinoculs (Cachiţă & co., 

2002; Petruş - Vancea & co., 2003; Blidar & co., 2004; Petruş & co., 2004 a; 

Radoveţ – Salinschi, 2004 b; Radoveţ – Salinschi and Cachiţă, 2005 a and b; Beleş 

and Cachiţă, 2007; Petruş – Vancea, 2007; Radoveţ – Salinschi, 2007; Petruş and 

Cachiţă, 2008). 

Deuterium is affecting the metabolism and the mitosis. Studies reveal that 

when a cell starts to divide itself, is activating its membrane pump which eliminate 

the hydrogen from the cell. By evacuating the hydrogen (H) from cell, this remains 

deuterium (D). The increases of water deuterium concentration release the division 

signal. 

After Nuţiu and Ardelean (2002), the water with 25 ppm (part per 

molecule) D inhibit the tumor growing (especially in xenotransplants) and is 

stimulating the vascular reactivity and natural immunity to humans and animals, 

and increase their resistance to small gamma radiation a.s.o. 

Pi water (PiW) is produced basing on Bio Control System Technology, 

using a Japanese license. It is obtained by purifications and bioenergization of 

drinking water using Life Energy excellent removing harmful substances from 

water, Pi water getting physical and chemical properties (Fülőp, manuscript). Using 

Pi water were obtained positive result as regarding the important of plant 

development but also to prevent the appearance of some dysfunction in plant 

organism (for example the diminution of corn cob treated with Pi water). To corn, 

the caryopsis treated with Pi water germinated easer comparatively to control 

(watered with normally drinking water) and the germinated plantlets, sprinkled with 

PiW, form dens root and are harmoniously growing, the leafs and roots growing 

synchronous (Fülőp, manuscript). These treated plants have a high resistance to 

unfavorable effects caused by insufficient soil aeration, with an unpropitious hydro 

balance, drought, decreased fertilizer, low humidity, sudden change of temperature 

or frozen. The higher resistance and a good capacity of acclimatization conduct to a 

rich harvest (with 30 – 40% plus) of those plants watered with PiW, comparatively 

with control plants, and their quality is higher with 40 – 70%. Positive effect of 

21



PiW begin to be often mentioned in botanic researches (Godeanu & co., 1999; 

Petruş and Petruş – Vancea, 2004; Petruş & co., 2004 b; Radoveţ – Salinschi, 2004 

a; Radoveţ – Salinschi & co., 2005; Blidar and Cachiţă, 2006; Petruş and Cachiţă, 

2008), but his role is less know in tissue and cell vegetal culture. 

22 

Material and method 

Table 1 

Research methodology in the case of investigation of deuterium depleted water 

(DDW) or Pi water (PiW) effects on hyperhydricity from Coleus or Petunia 

vitrocultures organized in double layer system for 30 days. 

Species 

Culture recipient 

type 

Culture media (basal 

layer) 

The hyperhydricity 

induction 

Period of culture 

into single layer 

The composition of 

second layer 

(supernatant) 

Subculture 

Acclimatization 

conditions 

Coleus 

blumei 

Benth 

Coleus 

hybridus 

Jupiter 

Petunia sp. 

Test tube, 16 /1,6 cm h/θ Recipient, 14/ 4 cm h/θ 

Mb - MS solidified with agar 

5 ml 

Thermic stress, at 40 o C 

Mb - MS solidified with biogel 

into lufa lignoskeleton 

20 ml 

The agar change with biogel into 

lufa lignoskeleton 

60 days 60 days 

DW 

G 

G-DDW 

G-PiW 

DDW 

PiW 

5 ml 

From neoapex, on MS - MB 

media 

30 days 

peat + perlite, 3:1, in incubators 

with 5/22/35 cm dimensions 

30 days 

DW 

DDW 

PiW 

10 ml 

- 

peat + perlite, 3:1, in incubators 

with 5/22/35 cm dimensions 

30 days 

Note: h/θ - height/diameter; Mb - MS – basal media Murashige – Skoog (1962), without growth 

regulators; DW – distilled water; G – glucose solution 1,5 %, prepared with DW; G-DDW - 

glucose solution 1,5 %, prepared with DDW (with 87,5 ppm D); G-PiW - glucose solution 1,5 

%, prepared with PiW; DDW – deuterium depleted water, with 25 ppm D; PiW – Pi water. 

The vitrocultures consisted in subcultivation during 60 days of uninodal 

and apical minicuttings inoculated on mineral medium Murashige – Skoog (1962),



without growth regulators. In table 1 we present: the working species, the type of 

culture recipient, the medium used as supernatant, the hyperhydricity inducing 

procedure at the level of vitroplantlets regenerated from minicuttings (either by 

maintaining vitrocultures at 40 o C (to Coleus) or replacing the agar – agar from 

base substratum with imbibed biogel on lufa lignoskeleton passage (to Petunia) 

(Cachiţă & co., 1991), and finally, their acclimatization conditions to septic 

medium. 

The vitroplantlets ailing of hyperhydricity - regenerated from apical and 

uninodal minicuttings – in the moment when the second layer was applied they 

had, at Coleus blumei Benth and Coleus hybridus Jupiter the following: 1 – 2 

stemlets with 9 – 10 cm waist and 5 – 6 rootlets having maximum 2 cm, and to 

Petunia sp.:1 – 2 stemlets with approximately 4 cm medium waist and 1-2 rootlets 

with length between 0,5 – 0,7 cm. 

Results and discussions 

a. Result obtained to Coleus experiments 

At 30 days from supernatant administration in the double layer 

culture system was observed the forming – at vitroplantlets apical level – 2 nodes 

without hyperhydricity which look closely with the normal aspect (Fig. 1 A and B). 

A. 

Coleus blumei Benth apexes 

Coleus hybridus Jupiter apexes 

B. 

Coleus blumei Benth vitroplantlets regenerated from apexes 

23



24 

C. 

Coleus hybridus Jupiter vitroplantlets regenerated from apexes 

D. 

Fig. 1. The comparative aspects of Coleus blumei Benth and Coleus hybridus 

Jupiter vitroplantlets, obtained from hyperhydric vitroplantlets prelevated neoapex 

(A and B) subculture, after their submersion in follow supernatants: DW – distilled 

water; G – glucose solution 1,5 %, prepared with DW; G-DDW - glucose solution 

1,5 %, prepared with DDW (with 87,5 ppm D); G-PiW - glucose solution 1,5 %, 

prepared with PiW; DDW – deuterium depleted water, with 25 ppm D; PiW – Pi 

water, at 30 days from this nonhyperhidric apex subculture on MB – MS (1962) 

culture media (C and D). 

Because the remaining vitroplantlets maintain its hyperhydric moon these 

new formed nods in double layer system, nonhyperhydric, were removed and 

subcultured on fresh Mb – MS (1962) culture medium, without growing regulators, 

and after 4 weeks from the subcultured apexes were regenerated normal 

vitroplantlets, capable to be transferred to septic medium (Fig. 1 C and D). 

Coleus vitroplantlets reaction resulted after subculture from hyperhydric 

vitrocultures treated with different types of water, according to the described 

experiment, was dependent on the nature administered supernatant. So, the 

vitrocultures according to DW (distilled water), G (1,5% glucose solution) and



PiW (Pi water) variants has remained in an advanced hyperhydric situation, 

couldn’t be acclimatized, in the mean time when to follow variants: G-DDW (1,5% 

glucose solution, prepared with DDW, having 87,5 ppm D), G-PiW (1,5% glucose 

solution, prepared with PiW) and specially DDW (deuterium depleted water having 

25 ppm D), the vitroplantlets had a lower hyperhydricity level (Table 2). 

Table 2 

Estimations of Coleus blumei Benth and Coleus hybridus Jupiter vitroplantlets 

hyperhydric level, evaluated at 30 days from neoapex subculture which was 

provide by double layer culture and second layer applications, consisted in: DW – 

distilled water; G – glucose solution 1,5 %, prepared with DW; G-DDW - glucose 

solution 1,5 %, prepared with DDW (with 87,5 ppm D; G-PiW - glucose solution 

1,5 %, prepared with PiW; DDW – deuterium depleted water, with 25 ppm D; PiW 

– Pi water. 

Vitroplantlets level of 

hyperhydricity, before second 

+ + + + + 

layer application 

Type of treatment DW G G-DDW G-PiW DDW PiW 

After treatment level of 

hyperhydricity 

Coleus blumei Benth 



Coleus hybridus Jupiter 

+ + + + 

+ 

+ + + + 

+ 

+ + + 

+ + 

+ + + 

+ + 

+ + + 

+ + + 

Note: „+” – show vitroplantlets transparence level; „–” show hyperhydricity missing. 

% 100 

80 

60 

40 

20 

0 

After acclimatization survival percent 

0 0 0 0 

DW G G‐ 

DDW 

85 87 8887,7 

3949 

0 0 

G‐PiW DDW PiW 

C.blumei 

Benth 

C.blumei 

Jupiter 

+ + + + 

+ 

+ + + 

++ 

Fig. 2. Survival percent of 

Coleus blumei Benth. and 

Coleus hybridus Jupiter 

exvitroplantlets, at 30 days 

from their transfer in septic 

medium on peat-perlite 

mixture, in 3:1 rapport, 

comparatively to 

acclimatization initiation 

moment, of plantlets 

provided from excizated apex subculture of hyperhydric vitroplantlets treated with 

follow supernatants: DW – distilled water; G – glucose solution 1,5 %, prepared 

with DW; G-DDW - glucose solution 1,5 %, prepared with DDW (with 87,5 ppm 

D; G-PiW - glucose solution 1,5 %, prepared with PiW; DDW – deuterium 

depleted water, with 25 ppm D; PiW – Pi water. 

25



After analyzing the experimental dates we can deduce that to both Coleus 

species, the exvitroplantlets acclimatization capacity sown a normalization of cell 

functions of proliferation processes, the higher surviving rate was between 85% - 

88%, at the plantlets from culture with G-DDW and G-PiW supernatant, and the 

lowest (39% - 49%) to those from DDW supernatant – to both species – 

mentioning that the regenerated vitroplantlets from apexes treated with DW, G or 

PiW did not survive in septic conditions. 

To both Coleus species, Pi water did not consisted in an optimum 

supernatant for treating the hyperhydricity but was better in mixture with 1,5% 

glucose (although neither the 1,5% glucose solution did not annihilated the 

neoplazic process). 

b. Result obtained to Petunia experiments 

Petunia hyperhydric plantlets, regenerated on Mb – MS culture medium imbibed 

in biogel (solidification agent) on lufa lignoskeleton had a feeble look, the stemlets 

being slight, contorted, the leaflets was small, transparent, twisted, some of them 

being necrosis (Fig. 3). 

After 30 days after administrating the second water layer, over the basal and solid 

medium, to those lots of treated hyperhydric vitroplantlets with PiW and DDW we 

observed the appearance of approximately three nods on main stemlets. These 

vitroplantlets came to its initial normal stage and the aerial vegetal parts new 

formed after applying the supernatant had normal morphological aspects, the 

stemlets and leaflets becoming opacity, the hyperhydricity being totally or partially 

remove in double layer system with this two types of water, DDW and PiW (Table 

3). 

After 30 days after treated hyperhydriced vitroplantlets “ex vitro” transfer, 

maintained in double layer vitrocultures system, with deuterium depleted water or 

Pi water supernatant, we establish that the exvitroplantlets surviving rate was 90%, 

respectively 95% while the exvitroplantlets provided 

from the control medium, being distilled water as 

supernatant, totally withered (Fig. 4). 

Fig.3. Petunia sp. vitroplantlets aspects, at 

60 days from uninodal, apical minicuttings 

inoculation on Mb – MS media solidified with agaragar 

(nonhyperhydric vitroplantlets – V0) or with 

biogel and lufa lignoskeleton (hyperhydric 

vitroplantlets, over those being applied on the 

second layer– V1). 

26



Table 3 

Estimation on Petunia sp. vitroplantlets hyperhydric level, evaluated at 30 days 

from follow supernatant application: DW – distilled water; DDW – deuterium 

depleted water, with 25 ppm D; PiW – Pi water. 

Vitroplantlets level of 

hyperhydricity, before second layer 

application 

+ + + 

Type of treatment DW DDW PiW 



+ + + ++ + - 

Note: „+” – show vitroplantlets transparence level; „–” show hyperhydricity missing. 

% 100 

After acclimatization survival percent 

80 

60 

40 

20 

0 

0 

Conclusions 

90 

95 

DW DDW PiW 

Fig. 4. Survival percent of Petunia sp. 

exvitroplantlets, at 30 days after their 

transfer in septic medium in perlite 

substratum, plantlets provided from double 

system vitrocultures, which has follow 

supernatant: DW – distilled water; DDW – 

deuterium depleted water, with 25 ppm D; 

PiW – Pi water, comparatively to 

acclimatization initiation moment. 

1. If to Petunia applying the two types of water (deuterium depleted water or Pi 

water) conducted to the vitroplantlets revitalization, to Coleus vitroplantlets only 

the apexes new formed after applying the supernatant could be recovered, and the 

mixture of both water types (DDW or PiW) with 1,5% glucose solution (in 

supernatant deuterium being 87,5 ppm D) we succeeded to better annihilation of 

neoplazic process and finally a higher post-acclimatization survival, to 88% in case 

of Coleus blumei Benth lot, kept “in vitro” in a supernatant consisted in 1,5% 

glucose solution prepared with Pi water, comparatively with that which was 

identified to the exvitroplantlets provided from deuterium depleted water 

supernatant, applied individual, them whom, although the tumoral phenomenon 

had an intensity rate similar, to those lots treated with specified above, had a 

smaller “ex vitro” surviving percent (49% maximum) at C. hybridus Jupiter. 

27



2. Removing the hyperhydricity and obtaining the higher post acclimatization 

surviving rate of the vitroplantlets saved from hyperhydricity was realized to both 

Coleus species, by submersation, during 30 days, of hyperhydriced vitroplantlets in 

a supernatant consisted in 1,5% glucose solution prepared in Pi water (PiW) and to 

Petunia by maintaining same period in deuterium depleted water (DDW) or Pi 

water PiW), individually. 

28 

References 

1. Beleş, D., Cachiţă, C.D.: Aclimatizarea exvitroplantulelor de Pistia stratiotes 

L. pe medii preparate cu apă sărăcită în deuteriu. In: Lucrările celui de al 

XV–lea Simpozion Naţional de Culturi de Ţesuturi şi Celule Vegetale. C.D. 

Cachiţă (vol. coord.). Cluj – Napoca. Editura Risoprint, 2007, p. 173 - 181. 

2. Blidar, C.F., Cachiţă, C.D.: Studierea efectelor exercitate de apa sărăcită în 

deuteriu şi de apa Pi, asupra creşterii vitroculturilor de protocormi de 

Cymbidium hybridum. In: Lucrările celui de al XIV-lea Simpozion Naţional 

de Culturi de Ţesuturi şi Celule Vegetale, „Conservarea Vitroculturilor 

Vegetale”. C.D. Cachiţă and S. Sand (vol. coord.). Sibiu. Editura Alma Mater, 

2006, p. 146-157. 

3. Blidar, C.F., Cachiţă, C.D., Petruş – Vancea, A.: The contemplation of the 

water efects of different kinds on „in vitro” cultures of Cymbidium hybridum 

protocorms. In: Lucrările celui de al III-lea Congres „Apa – un miracol”, 

Constanţa, 2004. 

4. Cachiţă, C.D.: Metode „in vitro” la plantele de cultură. Bucureşti. Editura 

Ceres, 1987. 

5. Cachiţă, C.D., Zăpîrţan, M., Vâlceanu, R., Neamţu, I., Vâlceanu, N.: Brevet de 

invenţie nr.105011, Compoziţie pentru stimularea rizogenezei la butaşi, 1991. 

6. Cachiţă, C.D., Petruş, C.M., Vancea, A., Ardelean, A., Morariu, V., 

Ştefănescu, I.: Efectul apei cu un conţinut scăzut în deuteriu asupra 

germinaţiei la grâu, porumb şi ridichi. Proceedings of „Water, Environment 

and Health”. Arad. EASA Conference, 2002, p. 83–86. 

7. Fülőp L, Istoria apei vieţii (manuscris). 

8. Godeanu, M., Bogăţeanu, M., Nuţă, D.: Implicarea apei Pi in refacerea 

solurilor deteriorate prin reziduuri petroliere Brevetul RO 112481. 

http://www.cttecotech.ro /salon/postere/P330.png, 1999. 

9. Murashige, T., Skoog, F.: A revised medium for rapid growth bioassays with 

tobacco tissue cultures. Physiol. Plant., 15, 1962, p. 473–497. 

10. Petruş, C.M., Cachiţă, C.D.: Foliar and radicular sprinkling of Tradescantia 

cuttings, with different types of water, and their effect to organogenesis and



the epidermal formations of foliar limbs. Analele Univ. Oradea, Fasc. 

Biologie, Tom. XV, 2008, p. 73-78. 

11. Petruş, C.M., Petruş – Vancea, A.: Înrădăcinarea la butaşii de Tradescantia 

L., în condiţiile udării acestora cu apă Pi. Analele Univ. Oradea, Fasc. 

Biologie, Tom. XI., 2004, p. 187–189. 

12. Petruş, C.M., Petruş – Vancea, A., Cachiţă, C.D.: Micropropagarea la 

Cymbidium şi Petunia pe medii de cultură preparate cu apă sărăcită în 

deuteriu. In: Lucrările celui de al XII -lea Simpozion Naţional de Culturi de 

Ţesuturi şi Celule Vegetale „Fiziopatologia celulei vegetale în regim de 

vitrocultură”. C.D. Cachiţă and A. Ardelean (vol. coord). Satu – Mare. Editura 

Daya, 2004 a, p. 185–192. 

13. Petruş, C.M., Petruş – Vancea, A., Zahan, A.: Efectul apei Pi asupra 

germinaţiei la grâu, porumb şi ridichi. Analele Univ. Oradea, Fasc. Biologie, 

Tom. XI., 2004 b, p. 183–186. 

14. Petruş – Vancea, A.: Cercetări privind procesele morfofiziologice şi 

biochimice care au loc în decursul aclimatizării plantulelor generate „in 

vitro”, la viaţa în mediul septic. Teză de doctorat, Universitatea din Oradea, 

2007 

15. Petruş – Vancea, A., Cachiţă, C.D., Blidar, C.F., Ştefănescu, I.: The Effect of 

Dedeuterised Water in Acclimatization of Chrysanthemum Vitroplantlets to 

Septic Medium. In: Papers of the 5th International Symposium Young People 

and Multidisciplinary Research. Timişoara. Editura Sudura, 2003, p. 335–340. 

16. Radoveţ-Salinschi, D., Studii privind morfogeneza în vitrocultură a 

explantelor de Coleus de provenienţă diferită. Teză de doctorat. Universitatea 

din Oradea, 2007. 

17. Radoveţ-Salinschi, D.: Studierea efectului apei „Pi” asupra vitroplantulelor 

hiperhidrice de Coleus blumei Benth.. In: Papers of the 5th International 

Symposium Young People and Multidisciplinary Research. Timişoara. Editura 

Sudura, 2004 a, p. 499-506. 

18. Radoveţ-Salinschi, D.: Studierea capacităţii de aclimatizare a vitroplantulelor 

de Coleus blumei Benth. rezultate în subcultură din plantule hiperhidrice 

tratate cu apă sărăcită în deuterium. In: Papers of the 5th International 

Symposium Young People and Multidisciplinary Research. Timişoara. Editura 

Sudura, 2004 b, p. 507-515. 

19. Radoveţ-Salinschi, D., Cachiţă, C.D.: Influenţa apei sărăcite în deuteriu (87,5 

ppm deuteriu) asupra vitroculturilor hiperhidrice de Coleus hybridus Ethna 

var. Ethna. In: Lucrările celui de al XIV-lea Simpozion Naţional de Culturi de 

Ţesuturi şi Celule Vegetale, „Conservarea Vitroculturilor Vegetale”. C.D. 

Cachiţă and C. Sand (vol. coord). Sibiu. Editura Alma Mater, 2005 a, p. 158– 

173. 

29



20. Radoveţ-Salinschi, D., Cachiţă, C.D.: Efectele apei sărăcite în deuteriu în 

recuperarea vitroculturilor de Coleus decompensate de hiperhidrie. Chişinău. 

Analele Ştiinţifice ale Universităţii de Stat din Moldova, Fascicolul „Ştiinţe 

chimico-biologice”, 2005 b, p. 257-265. 

21. Radoveţ-Salinschi, D., Cachiţă, C.D., Blidar, C.F., Petruş –Vancea, A.: 

Capacitatea de aclimatizare a vitroplantulelor de Coleus blumei Benth. 

generate în subcultură de apexuri provenite de la plantule hiperhidrice tratate 

cu apă Pi. In: Volumul de rezumate ale Lucrărilor celui de al III-lea Congres 

„Apa – un miracol” Vol.I, Constanţa, 2005, p. 60-61. 

22. Somlyai, G.: Să învingem cancerul! Efectele biologice ale reducerii de 

deuteriu. Râmnicu Vâlcea. Editura Conphys, 2001. 

30

MICROPROPAGATION AND ANTIVIRAL ACTIVITY 

OF EXTRACTS FROM Lamium album L. 

S.Shishkov 1 , M.Dimitrova 2 , K.Kostova 1 , A.Atanasova 2 , 

V.Kapchina-Toteva 2 

1 Laboratory of Virology, Faculty of Biology, St. Kl. Ohridski Sofia University, 8 Dragan Tzankov 

blvd, 1164 Sofia, Bulgaria, 2 Department of Plant Physiology 

* corresponding author e-mail: veneta@biofac.uni-sofia.bg 

ABSTRACT:Lamium album L. was successfully propagated in vitro 

on basal MS medium. Addition of different concentrations of 

benzyladenine stimulated micropropagation and callusogenesis. The 

cytotoxicity and the antiviral activity of chloroform and methanol 

extracts, derived from in vitro propagated Lamium album against HSV 

replication was evaluated on herpes simplex type 1 (HSV-1) and type 2 

(HSV-2) in cell line MDBK. The chloroform extract had most potent 

anti-HSV activity. The replication of both viruses was inhibited 

practically completely with application. The 50% effective doses were 

550μg/ml and 467μg/ml respectively. The herpes virus replications 

ware suppressed with 48% roughly after addition of second extract. 

Key words: secondary metabolites, in vitro propagation, antiviral 

activity, HSV-1, HSV-2. 

Introduction 

Native plants are often ignored in horticulture because they lack major 

horticultural traits. They may also be difficult to propagate and grow. The 

environments where endemic or threatened species live are under strong 

anthropogenic and natural pressures, and proper management of plant diversity 

through local measures of protection is required. Conservation of the endemic or 

threatened species is carried out using different strategies. Micropropagation is a 

powerful tool for ex situ conservation programs of the rich flora, especially for the 

species with the reduced populations. It is also irreplaceable for low seed 

producing plants and for rapid multiplication of species producing important 

secondary metabolites or possessing other valuable traits. The type and 

concentration of plant growth regulators affect the capacity of in vitro propagation 

since they play a major role in cell division, differentiation and morphogenesis in 

plant tissue cultures. Axillary bud outgrowth, which is considered as a process of 

apical dominance release, can be enhanced in response to exogenous cytokinins 

(Philips, 1975; Bollmark, 1995).



The genus Lamium (Labiatae) comprises about 40 species (Willis, 1973), 

distributed in Europe, Asia and Africa. Some Lamium plants have been used in 

official and folk medicine. The most popular is L.album L. (White Dead Nettle) 

with uterytonic, astringent, antispasmodic and anti-inflammatory activities 

(Bremness, 1995; Scygan et al., 1989); antioxidative effect (Matkowski A., et al., 

2006). Phytochemical investigations of the genus Lamium resulted in the isolation 

of benzoxazinoids, iridoid glu-cosides, flavonoids, phenolics, phenylpropanoids, 

polysaccarides, triterpene saponins, tannins and phytoecdysteroids (Alipieva et al., 

2003, 2006, 2007;Berezina et al., 2000; Savchenko et al., 2001). 

Some of the most common infectious agents in nature are the herpes 

viruses. Several drugs are used to treat the infections, caused by herpes viruses – 

the nucleoside analog acyclovir and its derivatives (Elion et al, 1977). However, 

continuous therapy with these or other antiviral agents against herpes viruses leads 

to the development of resistant strains (Kimberlin et al., 1995). The problem can be 

solved by using a combined therapy with antiviral drugs. However, current data 

indicate the existence of mutant viral strains, including clinical strains, with 

double-crossed resistance against these antiviral drugs (Mengoli et al. 1993, 

Sarasini et al. 1995). That is why the search for new therapeutic agents for systemic 

and local use is an ongoing process. A special attention is focused on compounds 

with natural origin. One of the advantages of this kind of compounds over the 

synthetic drugs is that the occurrence of resistant strains against their action is 

delayed due to their complex chemical structure. 

Material and Methods 

Plant material 

Plant material from Bulgarian population of L. album was collected in the 

Lozen mountain, near Sofia, Bulgaria. The voucher105183 have been deposited 

in the Herbarium of the Department of Botany, Faculty of Biology, Sofia 

University. Lamium album was propagated in vitro on basal MS culture medium. 

The explants isolated from these cultures - axillary buds from the 3 rd and 4 th 

position with a small part of shoots (single nodes) were grown on the same 

medium, supplemented with different concentrations of BA (N 6 -benzyladenine), 

from 0.1mg.l -1 to 1 mg.l -1 . Growth conditions were 25 o C and 16 hours of light (60 

μmol.m -2 .s -1 photosynthetic photon flux density, Philips TLD-33). 

Viruses and cell culture 

The Herpes simplex virus type 1, strain Vic, (HSV-1) and Herpes simplex 

virus type 2, strain BA, (HSV-2) were supplied by National center of infectious 

and parasitic diseases, Sofia, Bulgaria.Cell line MDBK (Madin-Darby Bovine 

32



Kidney), grown in medium MEM (Flow Laboratories) with 10% new born calf 

serum. 

Extraction 

The dry crude plant material from in vitro cultured control plants was 

extracted with chloroform and MeOH at 60 o C by Soxhlet and evaporated in 

vacuum at 40 o C. The dry extract was weighted and dissolved in MeOH for further 

study. 

Cytotoxicity assay 

Confluent monolayers were covered with media contain different 

concentrations of extract and cultured at 37°C for 96h. Cells grown in extract-free 

medium served as a control. The maximal concentration, which did not alter 

neither the morphology nor viability of the cells, was recognized as maximal 

tolerate concentration (MTC). 

Antiviral assay 

Experiments were done in multicycle growth conditions. Confluent cell 

monolayers in 96-well microplates were infected with 320 CCID50/0.1ml of the 

appropriate virus. After one-hour adsorbtion in room temperature the investigated 

compounds, in respective dilutions, were added to the monolayer. Every dilution 

was applied in three-fold repetitions. The viral cytopathic effect was determined by 

four-cross system when there was a full destruction of the cell monolayer in the 

viral control. The average value from three wells for every dilution was taken and 

was presented as percentage of the viral control. Effective concentration required to 

inhibit the replication by 50% (ED50) was determined by dose-response curve. 

Each experiment was done in triplicate. 

Results and Discussion 

Cytokinins are considered as an important factor in controlling and 

breaking the dormancy and apical dominance (Cline, 1994, 1997). A number of 

physiological effects of natural and synthetic cytokinins are well documented, but 

the mechanism through which theses plant growth regulators control the processes 

of growth and development are not yet quite clear. 

In our experiments the application of BA stimulated the bud opening 

(Fig.1) to a greater extent in higher concentrations. The number of explants per 

single node is presented in Fig.1. Culture on BA containing medium caused an 

33



increase in shoot numbers. The length of the stems was reduced in the variants with 

BA more than 0.5mg.l -1 . 

Cytotoxicity in vitro. 

The chloroform and methanol extracts of L. album applied in concentration range 

from 1000 to 200µg/ml. The data sowed no affect the morphology of the cell 

cultures with both extracts. Therefore the value of MTC for test substances no 

determined. This fact is due to the natural components of the extracts. 

34 

180 

160 

140 

120 

100 

% 

80 

60 

40 

20 

0 

control 

0,1 ВА 

0,2 ВА 

0,3 ВА 

0,4 BA 

0,5 BA 

0,6 BA 

0,7 BA 

0,8 BA 

0,9 BA 

1 BA 

stem length 

number of explants 

number of stems 

Fig. 1.Effect of 

different 

concentrations of 

BA on some 

parameters 

of 

in vitro propagated 

Lamium album L. 

The dry weight of shoots was reduced in the variants with BA (Fig.2), 

possibly connected with stimulation of the callus formation (the data are not 

presented). In general, the application of BA stimulated the bud break and increase 

of shoot number and explants. 

% 

14 

12 

10 

8 

6 

4 

2 

0 

control 

0,1 ВА 

0,2 ВА 

0,3 ВА 

0,4 BA 

0,5 BA 

0,6 BA 

0,7 BA 

0,8 BA 

0,9 BA 

1 BA 

Fig. 2. Effect of different 

concentrations of BA on 

dry weight of the shoots.



Inhibitory effect of the substances on the replications on HSV-1 and HSV-2. 

The examined extracts were added in concentrations 1000, 800, 600 and 

400µg/ml. They show antiviral activity and inhibit the viral replication (Fig.3, a). 

The experimental data suggested dose-depend effects. We founded that 

chloroform extract of L. album was more effective inhibitor than the methanol 

extract. First extract applied in concentration 1000 µg/ml inhibited practically the 

growth of HSV-1 completely – 97%. Other extract in same dose suppressed viral 

replication 52%. 

The results from treatment with the extracts of cells, infected with HSV-2 

are presented in figure 3, b. The effect of chloroform extract on the replication of 

this viral strain is similar to its effect on the replication of HSV-1. This has been 

demonstrated by the respective curves and the insignificant difference in the values 

of ED50, which are respectively 550 μg/ml and 467 μg/ml. Different results for 

inhibitory effect of chloroform extract against HSV-1 and HSV-2 maybe due to 

little different steps in replication of the viruses – different regulator proteins (ICP 

group) and different activity of some viral enzymes of both viruses. In addition the 

extract applied in the maximal investigated con-centration inhibited the growth of 

HSV-2 in same manner - 98%. The methanol extract had a weak effect on the 

HSV-2. The inhibition to the maximal concentration was 48 % only. 

35



The results of this study indicate that the chloroform extract of Lamium 

album L. pro-pagated in vitro shown strong antiviral effect against the replication 

on HSV tape 1 and type 2 in cell line MDBK. The investigated extracts maybe 

posses and inactivated effect on the extracellular viruses. 

References 

1. Alipieva K.I., Taskova R.M.,Evstatieva L.N., Handjieva N.V.Popov S.S. 

Benzoxazinoids and iridoid glucosides from four Lamium species. 

Phytochemistry,64, 2003, p.1413-1417. 

2. Alipieva K.I., Taskova R.M., Jensen, S., Han-djieva N. Iridoid glucosides from 

Lamium album and Lamium maculatum (Lamiaceae). Bio-chemical Systematics 

and Ecology, 34,2006, p.88-91. 

3. Alipieva K.I., Kokubun, T., Taskova R.M., Evstatieva L.N., Handjieva N. LC- 

ESI-MS analysis of iridoid glucosides in Lamium Species. Benzoxazinoids and 

iridoid glucosides from four Lamium species. Biochemical Systematics and 

Ecology, 35, 2007, p.17-22. 

4. Berezina V.,Budantsev, A., Teslov, L.. Chemical composition og genus Lamium 

L s.I. species. Rast.Resursy (Russion) 36, 2000, p.122-132. Moritz, T.,Eliasson, 

L. Relation between cytokinin level in bud development and apical control in 

Norway spruce Picea abies. Physiol.Plant. 95, 1995, p.563-568. 

5. Bremness L.1995. The complete Book of Herbs. Dorling Kindersley, London. 

6. Cline, M., The role of hormones in apical dominance. New approaches to an old 

problem in plant development.Physiol.Plant. 90,1994,p. 230-237. 

7. Cline, M., Consepts and terminology of apical dominance.Amer.J.Bot., 

84(8),1997, p. 1064-1069. 

8. Elion, G. B., P.A.Furman, J. A. Fyfe, P. De Miranda, L. Beauchamp, H. 

Schaeffer. Selectivity of action of antiherpetic agent, 9-(2hydroxyethoxymetyl)guanine. 

Proc. Natl. Acad. Sci. USA; 74, 1977, p.5716- 

5720. 

9. Kimberlin DW, Coen DM, Biron KK, Cohen JL, Lamb RA, McKinlay M, Emini 

EA, Whitley RJ,. Molecular mechanisms of antiviral resistance. Antiviral Res; 26 

(4): 1995,p.369-401. 

10. Matkowski A., Piotrowska, M. Antioxidant and free radical scavenging 

activities of some medicinal plants from the Lamiaceae. Fitoterapia, 77,2006, 

346-353. 

11. Phillips, D. Apical dominance. Ann.Rev.Plant Physiol.,26,1975,p. 341- 

367. 

36



12. Mengoli, G. et al. Molecular bases of drug resistance in animal viruses. 

Current topics in mol. Pharmacol., 1,1993,p. 33-48. 

13. Savchenko T., Blackford,M., Sarker, S., Dinan, L.,Phytoecdysteroids from 

Lamium spp.: identification and distribution within plants. Biochem.Syst.Ecol. 

29,2001, p.891-900. 

14. Scygan, F., Frohne, D., Hoeltzel, Ch., Nageli, A., Pfaender, J., Willuhn, G., 

Buff, W. Teedrogen. Wissenschaftliche Verlagsgesellschaft mbH, Stuttgart,1989, 

p. 495-487. 

15. Willis, A., A Dictionary of Flowering Plants and Ferns, eighth ed. 

Cambridhe University Press, Cambridge, 1973, p.624-626. 

37



MOLECULAR CHARACTERIZATION OF SOME 

AZOSPIRILLUM SPP. AND RHIZOBIUM SPP. STRAINS, 

USEFUL FOR PLANT PROTECTION 

38 

C.P.CORNEA 1,2 , S.DINU 3 , M.CIUCA 4 , C.VOAIDES ,2 , F.OANCEA 3 

1 Dept.of Biological Sciences, Faculty of Biotechnology Bucharest, Romania 

2 Applied Biochemistry and Biotechnology Centre (Biotehnol) Bucharest, Romania 

3 Researches and Development Plant Protection Institute 

4 National Agricultural Research and Development Institute 

Introduction 

Abstract: The paper presents the application of some molecular 

techniques to new isolates of Azospirillum, Rhizobium and 

Bradyrhizobium, in order to characterize them. ITS-RFLP and RAPD 

analysis were performed. An increased molecular polymorphism was 

observed between R.leguminosarum bv.phaseoli isolates. For 

rhizobia, for the characterization of the strains, more useful was 

RAPD analysis that confirmed the appurtenance of some of the 

isolates to Bradyrhizobium japonicum species. More uniform from 

molecular point of view were the strains of Azospirillum brasiliense 

used in the experiments. The results obtained proved the useful of 

molecular method for bacterial characterization. 

Keywords: PGPR, Azospirillum spp, Rhizobium spp, RAPD, ITS- 

RFLP. 

The use of microbial cells as biocontrol agents or biofertilizers involves both 

their identification and characterization, and the possibility of their assessment in 

natural ecosystems. Among other techniques, the molecular methods (PCR, RAPD, 

AFLP, FIGE etc) applied for these purposes are very important (Oliveira et al, 

2000; Germano et al., 2006). Such methods allow the identification of possible 

molecular markers, associated with a species or with a strain, which could be 

useful for their survey in nature (Manassila et al., 2007, Lau and Liu, 2007). 

Azospirillum is a associate symbiotic nitrogen fixer, aerobic free living which 

fixes atmospheric nitrogen in the soil, in the rhizosphere (plant root region). 

Rhizobium is the nitrogen fixer that is able to assimilate atmospheric nitrogen and 

fixes in the root nodule, formed in the roots of leguminous plants. Both bacterial 

genus are Gram negative bacteria and are included in the group of PGPR („plant 

growth-promoting rhizobacteria”). Due to the practical importance of these



bacteria, many genetically studies were performed with them. For Azospirillum, 

among the 8 species included in this genus, the most studied and used is 

A.brasiliense, but for now no specific molecular markers markers were identified 

(Didonet et al., 2000). Moreover, various intraspecific rearrangements at 

chromosomal or plasmidial level were reported, even if no modified phenotype 

was observed (Vial şi colab., 2006). Similar aspects were reported for 

various strains belonging to Rhizobium spp, (Sikora et al., 2003, Laguerre et 

al., 1994, 1996) or Bradyrhizobium (Tan et al., 2001, Bourcier et al., 2000). 

The aim of this work was the characterization of some bacterial isolates belonging 

to Azospirillum, Bradyrhizobium and Rhizobium genera, in order to establish 

possible molecular markers useful for monitoring them in natural ecosystems. 

Material and methods 

Bacterial strains. 9 strains of Rhizobium leguminosarum (R1, R2, R3, R15, 

R23, R24, FL400, RCR3644, Mz804), 5strains of Bradyrhizobium japonicum 

(R18, R19, FR10, A600, L34), 2 strains of Sinorhizobium meliloti (R5 and R14), 

one strain of Rhizobium (Mesorhizobium) loti R20, one strain of Rhizobium sp. R7 

and two strains of Azospirillum brasiliense (T2W and Spo 01). The strains are 

included in the Collection of the Faculty of Biotechnology Bucharest and in the 

collection of Plant Protection Institute. Among them, the strains of A.brasiliense, 

the strain B.japonicum FR10 and R.leguminosarum RCR3644 were able to grow in 

waste water containing significant quantities of glycerol, and were also tested for 

their potential use as biofertilizers. 

Growth of bacteria. Bacteria were cultivated on specific liquid or solid 

media, according to the aim of studies. For Azospirillum was used AFM2 medium, 

and YMA medium for rhizobia. 

DNA isolation. Genomic bacterial DNA was isolated by Promega 

Wizard R Genomic DNA Purification Kit. 

ITS-PCR-RFLP analysis. PCR-RFLP of the internal transcribed spacer 

(ITS) region between the 16S and 23S rDNA was examined with ITS1 (5’AAG 

TCG TAA CAA GGT AG 3’)/ITS2 (5’ GAC CAT ATA TAA CCC CAA G 3’) 

primer pair. For RFLP analysis, the restriction enzymes Hae III, Hha I, Alu I, Taq I 

and Msp I were used to digest the amplicons corresponding to 16S-23S intergenic 

spacer. For PCR amplification, reactions were carried out in 25 μl containing 40 ng 

DNA, buffer 1x, dNTPs 0,2 mM, 1U Taq polymerase, and 1 μM primers, in 40 

cycles (94 o C - 1 min., 48 o C - 1 min., 72 o C-10 min.) 

The size of the restriction products was verified by electrophoresis in 2% agarose 

gels. 

39



RAPD analysis. Six decameric primers (Operon Technologies) were used in 

the experiments: OPA3, OPA7, OPA9, OPE 02, OPO 13 and OPP 07. The 

amplification reactions were carried out in 25 μl containing 40ng DNA, 1x-buffer; 

MgCl2-2,5mM, Taq polymerase 1U, 1,3μM primer and 0,2mM dNTPs, in 36 

cycles (94 o C - 1 min., 36 o C - 1 min., 72 o C-2 min and, finally, 72 o C - 10 min). PCR 

products were separated by gel electrophoresis using a 1,5% agarose gel in 0,5x 

Tris-borate-EDTA buffer at 5,0 V/cm and visualized in UV light in a BioDocIt 

UVP equipment. 


Several strains of rhizobia and azospirili were tested for genomic DNA 

isolation. The method used proved to be efficient for every bacterial strain, the 

quantity and purity of DNA being convenient for experiments. These samples were 

used for ITS-PCR-RFLP and RAPD analysis, in order to detect inter- and 

intraspecific molecular polymorphism of the strains. 

The use of ITS1/ITS2 primer pair, several amplicons were obtained for all 

the strains (fig.1). The length of these amplicons was about 1600 bp for the strains 

designated as R5, R2, R1, R3, R14 and R18. Instead of these, the length of the 

main amplicon obtained with the strains R7, R15, R23, FR10, A600, R24 and R20 

was around 2000 bp. Exception the strains RCR3644 and Mz804 where the main 

amplicon has 1018 bp, and 1300 bp, respectively. Similar results, of a great 

heterogeneity of the amplicons, were presented by other authors (Laguere et al., 

1994, 1996; Maatallah et al., 2002). 

40 

Fig.1. Electrophoretic pattern of the 

amplicons obtained with ITS1/ITS2 

primer pair. Upper gel:1 kb DNA 

ladder, R5, R2, RCR3644, FL400, 

R20, R1, R7, R15, R23, FR10, A600, 

R3, R24. Bottom gel: 1 kb DNA 

ladder, Mz804, RCR3644, R14, L34, 

R18, R19



The treatment of these amplicons with restriction enzymes (Hha I and Hae 

III) allowed the observation of an increased polymorphism of the restriction pattern 

not only at interspecific level but also intraspecific one (fig.2). 

Fig.2. Restriction profile of the DNA 

fragments obtained after HaeIII digestion 

of ITS1/ITS2 amplicons. The order is the 

same as in fig.1 with the difference that 

100 pb DNA ladder was used. 

Bands obtained from the three restriction 

digestion analysis were recorded (0 = band 

absent, 1 = band present) and a 

dendrogram was produced using the 

unweighted pair group method with 

arithmetic averages (UPGMA) (fig3) 

Fig.3. Dendrogram of 17 strains oh rhizobia resulting from UPGMA analysis of 

restriction fragments. 

41



It is obvious that the strains could be grouped but this is not clearly related 

to the previously identification of the strains (strictly based on phenotypic 

characteristics). 

Instead of the surprisingly associations, it can be assumed that the bacterial 

strains analyses are related each other, with a similarity coefficient higher than 

50%. 

Due to these observations, we further examined the amplification products 

obtained with six arbitrary decameric primers (OPA3, OPA7, OPA9, OPE 02, OPO 

13 and OPP 07). Among them, significant results were obtained with the primers 

OPA3 and OPA9 (fig.4). Based on the electrophoretic pattern of the amplicons we 

suggest that RAPD analysis could be more useful for the characterization of the 

rhizobial strains, comparing with ITS-RFLP analysis, at least for our strains. 

According to the results, it can be say that the strains FR10, A600 L34 and R18 are 

similar, belonging to the same species that confirm their previous identification as 

Bradyrhizobium japonicum. 

Similar aspects for B.japonicum were also observed by other authors 

(Bourcier et al., 2000;Germano et al, 2006). 

42 

1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 2 3 4 5 6 7 8 9 10 11 12 13 14 

Fig.4. Amplification products obtained with OPA3 (upper gel) and OPA9 (bottom 

gel). The samples order: 1 kb DNA ladder, 2-8 = strains designated as 

R.leguminosarum bv.phaseoli (FL400, R23, R3, R24, RCR 3644, Mz804, 

RCR3644), 8-14 = strains designated as B.japonicum (FR10, A600 L34, R18, 

FR10, R19) 

The results obtained with the strains previously identified as 

R.leguminosarum bv.phaseoli applying the same primers allowed the conclusion 

that a higher heterogeneity of the DNA fragments is present in this specia (fig.4).



Similar techniques were applied for the strains of Azospirillum brasiliense 

(T2W and Spo 01). With the primers pair ITS1/ITS2, two amplification products 

were obtained (fig.5), they being subjected to Taq I and MspI digestion. 

1 2 3 

Fig.5. Amplicons obtained with ITS1/ITS2 primers. 1=1kb DNA 

ladder; 2=T2W; 3= Spo01 

The restriction fragments produced by the digestion with the 

mentioned restriction enzymes were the same for both strains, no 

differences being observed. For this species, the intraspecific 

polymorphism is reduced, at least for the strains examined in these 

experiments. 

The conclusion from these observations is that for the identification and 

characterization of a new bacterial strain, a polyphasic approach is necessary, 

which use microbiological methods, biochemical methods and molecular methods. 

Moreover, the methods applied in these experiments are reproducible, similar 

results being obtained during repeated tests with the same strains. For example, for 

the strains designated as FR10 and RCR 3644, several variants were used, each 

time the results being the same. 

Acknowledgements 

This work was partially supported from national project CEEX no.8/2005 (acronym 

CONVERTOL). 

References 

1. Bourcier,F., Willems,A., Coopman,R., Laguerre,G., Gillis,M., Lajudie,P., 

Genotypic characterization of Bradyrhizobium strains nodulating small 

senegalese legumes by 16S-23S rRNA intergenic gene spacers and AFLP 

fingerprint analysis, Appl.Environ. Microbiol., 66, 2000, p.3987-3997 

2. Didonet,C., Chubatsu,L.S., Souza,E.M., Kleina,M., Pedrosa,F.O., Genome 

structure of the genus Azospirillum, J.Bacteriol., 182, 2000, p.4113-4116 

3. Germno,M.G., Menna,P., Mostasso,F.L., Hungria,M., RFLP analysis of the 

rRNA operon of a brazilian collection of bradyrhizobial strains from 33 

legume species, Internat.J.Syst.Evol.Microbiol., 56, 2006, p.217-229 

4. Laguerre,G., Allard,MR., Revoy,F., Amarger,N., Rapid identification of 

rhizobia by restriction fragment lenght polymorphism analysis of PCRamplified 

16S rRNA genes, Appl. Environ.Microbiol., 60, 1994, p.56-63 

5. Laguerre,G., Mavengui,P., Allard,M., Charnay,M.P., Louvrier,P., Amarger,N., 

Typing of rhizobia by PCR DNA fingerprinting and PCR-restriction fragment 

43



lenght polymorphism analysis of chromosomal and symbiotic gene regions: 

application to Rhizobium leguminosarum and its different biovars, 

Appl.Environ. Microbiol., 62, 1996, p.2029-2036 

6. Lau,S.C.K., Liu,W.T., Recent advances in molecular techniques for detection 

of phylogenetic markers and functional genes in microbial communities, FEMS 

Microbiol. Lett., 275, 2007, p.1830190 

7. Maatallah,J., Berraho,E.B., Munoz,S., Sanjuan,J., Lluch,C., Phenotypic and 

molecular characterization of chickpea rhizobia isolated from different areas 

of Morocco, J.Appl.Microbiol., 93, 2002, p.531-540 

8. Manassila,M., Nuntagij,A., Kotepong,S., Teaumroog,N., Characterization and 

monitoring of selected rhizobial strains isolated fromm tree legumes in 

Thailand, Afr.J.Biotecyhnol., 6, 12, 2007, p.1393-1402 

9. Oliveira,I.A., Vasconcellos,M.J., Seldin,L., Paiva,E., Vargas,M.A., Random 

amplified polymorphic DNA analysis of effective Rhizobium sp. associated with 

beans cultivated in brazilian cerrado soils, Brazilian J.Microbiol., 31, 2000, 

p.1-9 

10. Sikora,S., Redzepovic,S., Genotypic characterisation of indigenous soybean 

rhizobia by PCR-RFLP of 16S rDNA, rep-PCR and RAPD analysis, Food 

Technol. Biotechnol. 41 (1), 2003, p.61–67 

11. Tan,Z., Hurek,T., Vineusa,P., Muller,P., Ladha,J.K., Specific detection of 

Bradyrhizobium and Rhizobium strains colonizing rixe roots by 16S-23S 

ribosomal DNA intergeneric spacer-targeted PCR, Appl.Environ.Microbiol., 

67, 2001, p.3655-3664 

12. Vial,L., Lavire,C., Blaha,D., Haurat;J., Bally,R., Dye,F, Phase variation and 

genomic architecture changes in Azospirillum, J.Bacteriol., 188, 2006, p.5364- 

5373 

44

RESEARCHES REGARDING DESIGN, REALIZATION 

AND TEST OF A FILTER INSTALLATION FOR 

OBTAINING, UNDER LIQUID FORM, OF BIO- 

PRESERVATIVE BASED ON ACID-LACTIC BACTERIA. 

Introduction 

I.ŢENU * ; C. BERCOVICI ** ; AURELIA SOARE *** 

Abstract: Biologic preparation, realised based on 

selectinated cultures of acid-lactic bacteria, under liquid form, have a 

large utilization in animal husbandry, being able to short and to 

improve fermentative processes from fodders, enriches the digestibility 

and consumption degree. 

In the present paper was design, realised and test a complex 

filter installation which allows to obatin bio-preservative under liquid 

form. 

Keywords: bio-preservative, technological installation, biotechnology, 

bio-product, laboratory for micro-production. 

Biologic products obtained on the basis of selected culture of acid-lactic 

bacteria, under liquid form, have a large utilisation in animal husbandry, being able 

to short and to stimulate the fermentation processes in the fodders which will be 

stored in silos, increasing their degree of consumption and digestibility. When is 

used directly in animals’ feed, acid-lactic bio-product offer good results at all 

categories of cattle and pigs, but the effect is better in the case of pregnant animals, 

veal and piglets. 

The usage of acid-lactic bio-product at processing fodders or directly in animal 

nutrition leads to positive results, which could be explain by the fact that lactic acid 

stops the development of some micro-organs groups which could damage both the 

digestive processes and also the preservation of fodders by silo. So, in this way it is 

realized a decrease of loses by degradation of the fodders and decrease of juice 

losing from them, increasing dry matter content, proteins, vitamins, amino-acids, 

enzymes and antibiotics. 

* 

UŞAMV Iaşi, Romania, e-mail: itenu@univagro-iasi.ro 

** 

IMA Iaşi, Romania 

*** 

IBNA Baloteşti, Romania




Filtering installation for obtaining in a liquid form of the bio-preservative based 

on acid-lactic bacteria; realize a partial separation and bottling of the liquid phase 

of the biologic preservative mixture. This installation is formed from the following 

parts (Fig. 1): horizontal centrifuge separator (1); staircase and access platform (2); 

pipe for evacuation of the liquid phase (3); tank (4); bottling ramp (5); alimentation 

pipe (6). Centrifuge separator, tank and hydraulic installation are the main parts of 

the filtering installation. 

Hydraulic installation (Fig. 2) realizes the following operations: alimentation 

with mix product of the centrifuge separator or mixer; adjustment of the 

alimentation flow with product of the separator; bottling of the liquid phase in 

PET; washing of tank. 

Tank, realized from polypropylene, allows a temporary storage of the obtained 

liquid in centrifuge separator. 

Horizontal centrifuge separator (Fig. 3), the main assembly of the filtering 

installation for obtaining under liquid form of the biological preservative based on 

acid-lactic bacteria, is compose from several units, from which the most important 

ones are: separator frame, rotor and sieve. 

Separator frame, made by rolled plate and stainless steel metallic profiles, 

welded, represents the resistance structure of the centrifuge separator. At the upper 

of the frame (connecting 9) the absorption of the material which must be separated 

is made, and at the lower part (pipe 10) is realized the evacuation of the liquid 

phase. 

Rotor is a metallic construction from plate, round steel and stainless steel holey 

plate and inside it is mounted filtering sieve. 

Sieve has at the base two metallic frames, inside of them being mounted 

separation texture. Metallic texture, from stainless steel, will be replaced whenever 

it is necessary. 

The product (mixture) supplied through alimentation connecting (9) reaches, 

through central pipe (5), sieve (3), which is in a rotation movement. Due to the 

centrifuge force, the liquid pass through metallic texture, and reaches frame (1) and 

it is evacuated through pipe 10. 

Due to the conic form of the sieve which is in a rotation movement and due to 

the action of razor (14), the solid particles retained by the metallic texture are 

evacuated through the emptying space (8) from the lower part of the frame. 

The rotation movement of the rotor is obtained from an electro-engine, through 

a belt transmission. 

46

Fig.1. Filtering installation for obtaining under liquid form of the biological 

preservative based on acid-lactic bacteria: 1 – horizontal centrifuge separator; 2 – 

staircase and access platform; 3 – pipe for evacuation of the liquid phase; 4 – tank; 

5 – bottling ramp; 6 – alimentation pipe.



48 

Fig. 2. Hydraulic installation 

Fig. 3. Horizontal centrifuge separator: 1 – 

frame; 2 – rotor; 3 – sieve; 4 – lid; 5 – pipe; 

6 – bearing; 7 – electro-engine; 8 – emptying 

space for solid substance; 9 – alimentation 

connecting;10 – evacuation pipe for liquid 

phase; 11 – belt transmission; 12 – support; 

13 – elastic buffers; 14 – razor device.


To establish the optimal exploitation conditions and also the technical 

characteristics of filtering installation were made experimental tests in laboratory 

and filtering conditions. 

Experimental laboratory tests have as main goal to determine the constructive 

characteristics of the installation as follows: 

- clearance gauge dimensions: 4.2 x 3.5 x 2.98 m; 

- capacity of the tank for collecting the bio-preservative under the liquid form 

(filtered product) – 0.7 m 3 ; 

- number of connecting for bottling – 3. 

To establish the optimal function regime were made experimental tests in 

conditions of filtering of the processed bio-product. In according with the 

technology bio-product is a product which contains 15% dry matter and by 

filtration with the above described installation is decreased the content in dry 

matter 1.0 – 3.0%, and the solid particles’ size which could be found in the biopreservative 

is no greater than 0.5 – 0.8 mm function of working regime and 

sieves’ eyes. 

Experimental tests were made, by filtering a 1000 l charge, for different regimes 

of rotation of centrifuge separator, respectively 750 rot/min; 1000 rot/min and 1500 

rot/min, and for separation texture was used a sieve with the opening of free eyes 

of 0.5 mm, 0.75 mm and 1.0 mm. 

The results of the tests are presented in table 1. 

Nr. 

crt. 

Separator 

rotation 

(rot/min) 

1 750 

2 1000 

3 1500 

Results regarding bio-preservative filtering 

Size of 

sieves’ eye 

(mm) 

Quantity of 

liquid 

product 

filtered in a 

charge (l) 

Dry matter 

content 

(%) 

0.5 552.3 0.81 

0.75 631.4 1.06 

1.0 781.5 1.54 

0.5 630.2 1.26 

0.75 715.4 1.92 

1.0 832.6 2.56 

0.5 716.9 1.52 

0.75 780.6 2.56 

1.0 892.4 3.68 

Table 1 

Observations 

Installation 

works without 

vibrations 

Installation 

works with 

vibrations

By analysing the obtained results it is obviously that the centrifugal separator 

function normally, without vibrations at rotations of 750 and 1000 rot/min. as 

regarding the quality of the bio-product, respectively the content in dry matter, this 

one has smaller values at lower rotations and for textures at which the eyes opening 

is 0.5 and 0.75 mm. 

Face to the above presented facts we consider that centrifuge separator has an 

optimal function for a rotation of 1000 rot/min and for a texture at which the size of 

the eyes to be maximum 0.75 mm. 

Conclusions 

The designed and realized installation for obtaining bio-preservative in liquid 

phase have a simple construction, it is reliable and in according with the imposed 

demands and also have a high productivity at separation of the filtrate. 

References 

1. Soare Aurelia, ş.a: Contract de cercetare CEEX nr 130/2006. 

2. Ţenu I.: Tehnologii şi instalaţii pentru industrializarea produselor vegetale. 

Iaşi. Editura Junimea, 1999. 

3.Banu C. : Biotehnologii în industria alimentara. Bucuresti, Editura Tehnică, 

1987. 

4. Jurcoane Ştefana : Biotehnologii. Bucuresti, Editura Tehnică, 2000. 

5. Doran P.M.: Bioprocess Engineering Principles. New York , Academic 

Press, 1988



RESEARCHES REGARDING DESIGN, REALIZATION 

AND TEST OF AN INSTALLATION FOR BIO- 

PRESERVATIVES BASED ON ACID-LACTIC BACTERIA 

Introduction 

I.ŢENU * ; C. BERCOVICI ** ; AURELIA SOARE *** 

Abstract: Bio-preservatives based on acid-lactic bacteria is 

a product used in animal husbandry to reduce the gastro-intenstinal 

infections at cattle and pigs and also to improve the fermentative 

processes of the fodders preserved by siloing. 

In the paper were tracked design, realization and test of a 

complex installation for processing bio-preservatives based on lactic 

bacteria and passing in cultures on solid support, formed by cereals 

flours and rests from cereals’ milling. 

Keywords: Bio-preservatives, acid-lactic bacteria, complex 

installation for processing bio-preservatives 

Bio-products are more and more often used in animal feeding, having as target 

to gain strength for animals’ health state but also to realize a superior capitalization 

of the fodders. 

The studied bio-product is realized based on selected culture of acid-lactic 

bacterium’s, able to short and to stimulate the fermentation processes in the fodders 

which will be stored in silos, enriching them in antibiotic substances and giving 

them also pleasant tasty features. 

Acid-lactic bio-product it is presented in a liquid form (15–18 % dry matter), 

containing cultures of acid-lactic bacteria from Lactobacillus plantarum, 

Lactobacillus thermophylum, Lactobacillus acidophylum, Lactobacillus 

bulgaricum species which are characterized by a great multiplication capacity and 

also by producing lactic acid and antibiotic substances on rich mediums in 

glucides. 

* 

UŞAMV Iaşi, Romania, e-mail: itenu@univagro-iasi.ro 

** 

IMA Iaşi, Romania 

*** 

IBNA Baloteşti, Romania 

51



The usage of acid-lactic bio-product in animals’ nutrition is justified because 

the presence of lactic acid and also of some antibiotic substances produced by acidlactic 

micro-flora stops the development of some micro-organs groups which could 

damage both the digestive processes and also the preservation of fodders by silo. 

So, the usage of acid-lactic bio-product at fodders silo leads to a decrease of juice 

losing from the silo with 10–15 %, decrease the degenerative loses with 10–20 % 

and improves the tasty features in the same time with the increasing of dry matter 

content, proteins, vitamins, amino-acids and enzymes. 

Direct used in the animal feed, acid-lactic bio-product offers good results at all 

categories of cattle and pigs, but the effect is better in the case of pregnant animals, 

veal and piglets. 


To produce bio-product in safety condition, was realized at IBNA Baloteşti a 

complex laboratory, with spaces for raw material reception and storage, for bioproduct 

processing, for storage of the final product, with rooms for analyses, and 

also with locker rooms and toilets. 

The bio-technologic installation for processing the biological preservative based 

on acid-lactic bacteria is complex and has the following units (Fig.1): flour bunker 

, worm gear conveyer, horizontal mixer, installation for biological preservative 

processing and electric installation. This installation was designed, realized and 

tested by the research team. 

Acid-lactic bio-products obtained in the installation are transported with the 

help of an environment pump to the horizontal mixer tub. The mixes (wheat chaff, 

cereals flours and other mixtures) introduced in the receiving bunker, are 

transported by the worm gear conveyer in the horizontal mixer tub. The mixer 

realizes a fastening of the acid-lactic bio-products on the support. 

Having in view the fact that flours receiving bunker, worm gear conveyer and 

mixer have a well-known construction, being currently used to process combined 

fodders, we will present only the installation for biological preservative processing 

with its components. 

The installation for processing the biological preservative based on acid-lactic 

bacteria. 

(Fig. 2) is the unit in which the bio-product is obtained. The parts of the installation 

are: hydrolyser (1); thermo-stator (2); platform (3); pedestal and access way(4); 

environment aspiration circuit (5); 

DN 25 hose connection (6); environment drive back circuit (7); CO – 350/15 

horizontal electro-pump (8); water aspiration circuit (9); water drive back circuit 

(10); CEA – V 120/3 horizontal electro-pump (11). 

52



The main components of the installation are hydrolyser and thermo-stator. In 

the installation are two horizontal electro-pumps, one for environment and the 

other one for water, with their aspiration and drive back circuits. 

The hydrolyser (Fig. 3), is formed by hydrolyser vessel, which is a welded 

construction with double walls made by 

unoxidable steel plate. The external cover is suited with three connections for: 

introducing the water in the casing; for water evacuation; for water evacuation 

from casing if are requested some adjustments. The internal part of the vessel has 

also three connections which are for: water introduction in vessel; environment 

introduction in vessel; evacuation of environment from vessel. 

a 

Fig.1. Bio-technologic installation for processing biological preservative based 

on acid-lactic bacteria: a – self installation for obtaining poly-culture of acidlactic 

bacteria; b - installation for passing on support of acid-lactic bacteria polyculture. 

Inside the vessel a mixer is rotating. At the lower part, hydrolyser has 6 groups 

of 3 electric resistances for heating the water which is in between the two walls. 

The level of the liquid from vessel could be read on the level indicator line. The 

safety valve will open when in the vessel casing the pressure overpass 0.05 MPa or 

the pumped water quantity overpass the casing volume. 

Thermo-stator (Fig. 4), also as hydrolyser, is a welded construction with double 

walls made by unoxidable steel plate. The external cover has three connections for: 

introducing water in the casing; water evacuation from casing; water evacuation 

b 

53



from casing if are requested some adjustments. The internal part of the vessel has 

two connections, for: environment introduction in vessel; evacuation of 

environment from vessel. 

Inside the vessel a mixer is rotating. At the lower part, thermo-stator has 3 electric 

resistances for heating and keeping a constant temperature. 

54 

Fig. 2. Designed installation for processing biological preservative based on 

acid-lactic bacteria: 1 – hydrolyser; 2 – thermo-stator; 3 – platform; 4 – pedestal 

and access way; 5 – environment aspiration circuit; 6 – DN 25 hose connection; 7 

– environment drive back circuit; 8 – CO – 350/15 horizontal electro-pump; 9 – 

water aspiration circuit; 10 – water drive back circuit; 11 – CEA – V 120/3 

horizontal electro-pump. 

The level of the liquid from vessel could be read on the level indicator line. 

The safety valve will open when in the vessel casing the pressure overpass 0.05 

MPa or the pumped water quantity overpass the casing volume. 

Thermo-stator (Fig. 4), also as hydrolyser, is a welded construction with 

double walls made by unoxidable steel plate. The external cover has three 

connections for: introducing water in the casing; water evacuation from casing; 

water evacuation from casing if are requested some adjustments. The internal part 

of the vessel has two connections, for: environment introduction in vessel; 

evacuation of environment from vessel.



Fig. 3. Hydrolyser: 1 – hydrolysers’ vessel; 2 – hydrolysers’ bottom; 3 – 1 inch 

protecting device of the connecting piece; 4 – 1 ¼ inch protecting device of the 

connecting piece; 5 – 1 ½ inch protecting device of the connecting piece; 6 – 

bearing; 7 – ball; 8 – 1 inch emptying tap; 9 – thermo-resistance; 10 – 1 kW 

resistance; 11 – mixer; 12 – felt from P60 mineral wadding; 13 – lid; 14 – floating; 

15 – reducing; 16 – button; 17 – AT 90 – L-6 135 1.1 kW x 1000 rot/min engine; 

18 – pipe for steam evacuation; 19 – casing isolation. 

Inside the vessel a mixer is rotating. At the lower part, thermo-stator has 3 

electric resistances for heating and keeping a constant temperature. 

The level of the liquid from vessel could be read on the level indicator line. 

The safety valve will open when in the vessel casing the pressure overpass 0.05 

MPa or the pumped water quantity overpass the casing volume. 


In our research a main goal was beside of designing and realization of the 

installation for bio-product processing also its experimentation for determining an 

optimal exploitation with minimal energy consumption. 

Experimental tests for determination of technical characteristics of the 

installation were made in according with the technological line for bio-preservative 

processing. 

As a result of the research was establishing the following technical and 

functional characteristics for the units of the installation: 

55



Fig.4. Thermo-stator: 1 – thermo-stator vessel; 2 – thermo-stator bottom; 3 – 1 

inch protecting device of the connecting piece; 4 – 1 ¼ inch protecting device of 

the connecting piece; 5 – 1 ½ inch protecting device of the connecting piece; 6 – 

bearing; 7 – ball; 8 – 1 inch emptying tap with sphere; 9 – thermo-resistance; 10 – 

1 kW resistance; 11 – mixer; 12 – felt from P60 mineral wadding; 13 – lid; 14 – 

floating; 15 – reducing; 16 – button; 17 – AT 90 – L-6 135 1.1 kW x 1000 rot/min 

engine; 18 – pipe for steam evacuation; 19 – casing isolation 

Hydrolyser characteristics: 

- fitting out capacity of the hydrolyser vessel – 620 l; 

- vessel type – with double walls; 

- moving system – mix with mechanic and hydraulic mixer powered by 

environment pump; 

- rotation of the mechanic mixer – 33 rot/min; 

- the power of electro-engine for mechanic mixer – 1.1 kW; 

- capacity of heating casing – 245 l; 

- heating system of hydrolyser – electric, with resistances for heating, in a 

number of 6 groups and each group contain 3 resistances, with 1 kW power for 

each resistance; 

cooling system – hydraulic, water circulates through vessel casing. 

Thermo-stator characteristics: 

- fitting out capacity of the thermo-stator vessel – 620 l; 

56



- vessel type – with double walls; 

- rotation of mixer – 33 rot/min; 

- capacity of casing – 355 l; 

- heating system – electric, with three groups of 3 resistances, with 0.7 kW power 

for each resistance; 

- cooling system – with cold water. 

Characteristics of the hydraulic installation for circulation of culture 

environment: 

- pump type – centrifuge, with open rotor; 

- pump flow – variable, function of working pressure, 6 – 25 mc/h; 

- working pressure – 6 – 17 m water collum; 

- pumps’ electro-engine – 1.5 kW. 

Characteristics of the hydraulic installation for water circulation: 

- pump type – centrifuge, with closed rotor; 

- pump flow – variable, function of working pressure, 10 – 20 mc/h; 

- pumps’ electro-engine – 0.75 kW. 

Characteristics of mixing installation: 

- capacity of receiving bunker – 0.84 m 3 ; 

- characteristics of the worm gear conveyer – transport capacity – 2 m 3 /h; up 

rising distance – 1.9 m; conveyers’ length – 4.3 m; worms’ diameter – 130 mm; 

worms’ step – 140 mm; worms’ rotation 750 rot/min; 

- characteristics of mixing equipment – fitting out capacity – 0.8 m 3 ; rotors’ 

rotation 24 rot/min; driving power – 4 kW. 

General characteristics of installation: 

- working capacity – 1000 l/day, liquid phase; 

- energy consumption per charge – 145,6 kW/charge; 

- specific energy consumption – 0.146 kW/l, liquid phase. 

By analysing the obtained results it is obviously that the designed installation 

works in a semi-automatic regime and processed bio-preservative in optimal 

conditions and with minimum costs. 

Conclusions 

Face to the above mentioned result the following conclusions: 

1. For obtaining bio-preservative based on selected culture of acid-lactic 

bacteria was designed and realised an original installation. 

2 The laboratory designed and realised at IBNA Baloteşti, it is complex and 

respect all the micro-biological safety conditions for receiving and storage of the 

57



raw materials, for processing the bio-product, for storage of the final product, with 

rooms for analyses; and also with locker rooms and toilets. 

3. The designed and realised installation for bio-product processing based on 

selected culture of acid-lactic bacteria is in according with the requested 

technology. 

References 

1. Soare Aurelia, ş.a: Contract de cercetare CEEX nr 130/2006. 

2. Ţenu I.: Tehnologii şi instalaţii pentru industrializarea produselor vegetale. 

Iaşi. Editura Junimea, 1999. 

3.Banu C. : Biotehnologii în industria alimentara. Bucuresti, Editura Tehnică, 

1987. 

4. Jurcoane Ştefana : Biotehnologii. Bucuresti, Editura Tehnică, 2000. 

5. Doran P.M.: Bioprocess Engineering Principles. New York , Academic Press, 

1988. 

58



RESEARCHES REGARDING THE OPTIMIZATION OF 

HONEY BEE (Apis mellifera L) INSTRUMENTAL 

INSEMINATION TECHNOLOGY 

E. CAUIA * , A. SICEANU * , A. SAPCALIU * 

Abstract. In the present time the instrumental insemination in honey bees has 

became an essential tool for researchers and breeders, too. The genetic progress in 

a selection stock could not be maintained without a precise control. Taking into 

account also the last problems of beekeeping as diseases’ resistance to medical 

drugs, pollution of the pure subspecies in different countries) is imperious necessary 

to focus on some sustainable solutions in bee breeding programs which use simple 

techniques to obtain instrumentally inseminated queens. The success in using 

currently and on large scale the technology of artificial insemination of queens 

depends firstly on the safety and the simplicity of apparatus and optimization of 

technology stages to obtain instrumentally inseminated queens. The researches 

carried out till now aimed to optimize some important stages in obtaining quality 

instrumentally inseminated honeybee queens. 

Keywords: honeybee queens, instrumental insemination, breeding 

1. Introduction. 

The instrumental insemination of queens (IIQ) is a very specialized technique 

which mainly require good knowledge about the biology of queens and drones, 

investments (the apparatus, stereomicroscope and accessories –CO2 tank, 

cages.etc) and skills (a lot of practice) 

The first goal of using instrumental insemination of queens is to assure the 

desired control of mating in a breeding apiary. 

The queen breeders usually have only a partial control on mating: maternal – 

by organized production of queens in selected colonies for the desired traits, and - 

paternal – by saturation of surrounded areas with drones reared in the selected bee 

colonies. 

* 

Institute for Beekeeping Research and Development-Bucharest, e-mail: 

elizacauia@yahoo.com 

59



Utilization of instrumentally inseminated queens together with the advanced 

programs of selection is the only way for the amelioration of the most important 

traits in honeybees, being also a modern tool in order to perform different scientific 

studies. 

Thus, the instrumental insemination of queens is addressed to scientists in 

order to perform genetics and breeding studies and to queen breeders to have the 

total control in the breeding process. 

The IIQ consists shortly in the following stages: narcosis preparation with 

CO2, syringe preparation, syringe filling (collection of sperm), queen preparation, 

the insemination and cleaning and sterilization of equipments. The success of 

currently using and on a large scale of IIQ depends largely on the easily way of 

manipulation of active components and their simplicity. Auxiliary, there are very 

important the knowledge regarding the biology of rearing and maintaining the 

queens and drones. 

The standard apparatus (described by Ruttner F. in “Instrumental insemination 

of the queen bee”, Apimondia 1976) type Mackensen is composed shortly by: the 

stand with two supporters, queen block with the queen holder and the gas tube, 

syringe block, ventral and sting hook blocks 

Since then a lot of apparatus appeared but the principles remained the same. 

Thus there are: the Vesely apparatus based on standard (Mackensen) model with 

some improvements of the shape and manipulation of syringe. The tips used are 

from Plexiglas, but generally, in the last time, are used only glass tips which are 

better in terms of manipulation, sterilization and are cheaper. The recent types are 

for example: Schley type (Germany), the syringe of great capacity Harbo (USA), 

the polish type of syringe block, Latshaw type (USA), Laidlaw –Goss (USA), 

Swienty (Denmark) etc. Beside the apparatus, the other necessary equipments 

consist in: a stereomicroscope (the necessary magnify being max 20X), the CO2 

tank with debit regulator and control of CO2 flow, a specific lamp, preferable cold 

light lamp, adapted to the stereomicroscope. 

2. Researches regarding the instrumental insemination apparatus 

improvement. 

Our researches carried out in the frame of the Institute for Beekeeping Research 

and Development Bucharest (2001-2002) aimed to obtain a better apparatus in 

terms of manipulation of its active components. In this way, a series of innovative 

modifications have been brought to some components of the apparatus. 

The most important modification of the apparatus consisted in the following: 

- The syringe block has been modified at the fixing level on the round post by 

means of some pieces and little rolls in order to work continuously (up–down). 

This system differs from classic system based on screws and vaseline, which is 

not so preciseness, and the movements are not delicately and continuously. 

60



- The supporter for the syringe stands is a rounded piece and can be moved in a 

circular way. 

- The support of the syringe can be moved horizontally (forward-backward) in 

order to assure the optimal placement of the syringe. 

- The fixing system of the syringe was modified by using 2 clips, simplifying the 

manipulations of the syringe, in order to easily taking over and replace it in the 

syringe block, as these manipulation are very numerous in instrumental 

insemination process. 

- The system of fixing the queen block was also modified. In this way, contrary 

to the classic fixing system with screw it was adapted a more simple and 

flexible system with a magnet, thus making possible the queen positioning, 

which depend of the necessities of the inseminator. 

On this modified instrumental insemination apparatus it is possible to use the 

following components that are on other instrumental insemination apparatus, too: 

Two types of syringes: 

- a medical syringe adapted in instrumental insemination use and which may be 

provided with graded glass insemination tips with the possibility to collect 

16mmc semen, quantity required for two inseminations or 

- a vacuum pump syringe of great capacity (Harbo), to collect approx. 200mmc 

semen in capillary glass, quantity for approx. 20 inseminations. 

The syringe block – provided with a guide rod to be manipulated with the left hand 

in order to easily adjust the syringe on the practical necessities. 

Stainless hooks. The dorsal hook could have an orifice made to grasp the queen’s 

sting in lateral – right, to open the vaginal chamber. 

Advantages of the improved apparatus: 

- A great preciseness and flexibility of all components in work; 

- The possibility to fix the syringe in optimal position; 

- Delicately movements of syringe in the moment of insemination tip introduction 

to avoid damaging the queen’ internal membranes; 

- The queen block offers the possibility to permanently modify the work angle to 

find the optimum one; 

- The easily taking off the syringe in order to be filled with liquid (pump role), to 

remove the air bubbles, to collect the semen or to be washed and sterilized. 

3. Queens and drone preparing for instrumental insemination. 

3.1. Drone collecting 

Some researches carried out in the ICDA aimed to develop an optimized 

technique to produce, self-select and to store the sexually mature drones used in 

instrumental insemination. 

61



Instrumental insemination of a large number of queens in periods of intensive 

activity requires the collection of a large number of sexually mature drones, from 

bee colonies. 

It is well known that the percentage of the sexually mature drones and their 

storage in bee colonies in the season depends on many factors: age and their 

possibility of flying, the suitable flying time during the season, the melliferous 

resources, and the strength of the colony. 

Thus, the percentage of sexually mature drones varies in a normal colony from 

20-30% in April-May to 50-70% in July-August while the natural rearing period of 

drones in Romanian conditions lasts till July-August. 

Having in view the need to perform an optimal collection of the sexually mature 

drones our studies were based on designing a special compartmented hive which 

allows the permanent rearing of the required number of drones, originating from 

different colonies and on the other hand, the collection of the respective drones 

which have reached the first flying age (generally this first fly occurs at the age of 

8-10 days). 

The system uses a strong colony with a large number of young bees (nurse bees) 

where a sealed drone brood comb from a mother colony is periodically introduced. 

On one side of the hive the designed selection compartment, consisting of 2-3 

honey and bee bread combs, is placed close to the uncapped brood combs of the 

colony. 

This compartment is meant to ensure the selection and the storage of the drones 

that have had hatched in the respective colony. 

A queen excluder (Hanemann) is used to separate this compartment from the 

nest, allowing thus, the isolation of the selected drones and the free access of the 

workers. 

The selection of the relatively sexually mature drones (that have already 

performed their first flight) into the storage compartment can be achieved by 

adapting at the hive entrance of a special device (a transparent tube) meant to 

ensure the one way flight of the drones (and of the workers) from the hatching 

compartment to the storage one. 

Thus, the drones that have already performed their first flight will be 

continuously selected and from here they can be readily taken to collect the semen 

and the foragers will be allowed to cross through the excluder to reach the colony. 

Some experiments (May-July 2001) proved out that this system is very efficient 

selecting the sexually mature drones with 20-30% more than in normal bee 

colonies. 

3.2. The queens maintaining and storage before and after insemination there 

are different methods but they essentially are based on individual and collective 

systems: in mating nucleus, in queen banks, in small unities as cages. The best 

62



way, biologically speaking, is the method of nucleus that are used in natural 

mating. The queen bank is a very useful method when there is a great production of 

inseminated queens. The number of bee queens on a bee colony depends on many 

factors as the number of inseminated queens correlated with their selling or using 

in the apiary, the number of daily inseminated queens to use the entire frame of 

queens in the insemination. 

The bee colony used as queen bank will be queen less and well populated with 

honeybees especially young bees (less aggressive and nurse bees for queens). Some 

disadvantages regarding this system is connected with some injuries that bees do to 

some queens and that the queens are fed selectively, so this system needs a special 

attention. 

The 3 rd method doesn’t use the bee colony; the bee queens are maintained in cages, 

with accompanying bees (~150), in laboratory conditions or in incubator; 

The success of insemination depends on other many factors but the main factors 

are: 

- The state of queens – the conditions of rearing queens(the queens to be 

inseminated have to be well developed without injuries). The specific condition to 

be reared: very young larvae- 1,5 days of larval stage, the starter have to be well 

populated with young bees, food storage and supplementary feedings. 

- The optimal age for II. The best period is the between the 5 th and 14 th days old to 

obtain a good viability of IIQ and for a good semen migration. 

- The conditions after insemination (24-48h) are: temperature, the free movements 

of queens and the presence of bees in contact with the queens; the first 24h are very 

important for the semen migration as the sperms migrate from the lateral oviducts 

to spermatheca so that the temperature have to be between 24°C to 34°C). 

- The system to be maintained. The IIQ can be maintained after the insemination in 

the above mentioned systems, but the best results are in nucleus system. 

- The amount of semen used in insemination. The consecutive inseminations with 

4mmc of semen in two successive days is better than one with 8 mmc of semen, 

but the risks to transfer diseases and for bad manipulation are higher. We 

recommend 8 mmc in one dose. 

- The treatments with CO2, is the artificial stimulation for queen to begin the egg 

laying similarly to natural mated queens. There are necessary 2-3 treatments: 

during insemination and after insemination, in the next day for 1-3 minutes each 

treatment. 

4. Researches regarding the quality of instrumentally inseminated queens. In 

the frame of beekeeping Institute-Bucharest some researches regarding the quality 

of instrumentally inseminated queens were carried out (2008). 

63



4.1. Materials and methods. 

Three series of bee queens, summing 25 virgin queens produced in Baneasa 2 

apiary belonging to the BRDI, were inseminated using the above mentioned 

improved apparatus from the genetic and breeding laboratory of institute. The 

virgin queens were transported to the laboratory in Foti cages (with approx 50 

young bees) and maintained for a period of approx 12 days in the laboratory 

conditions. They were instrumentally inseminated with one dose semen according 

to the table 1 at the age between 8 and 10 days. The queens received 3 treatments 

with CO2 to stimulate the oviposition: one during the insemination –the narcosis, 

one in the second day after insemination and one in the moment of transferring the 

in introduction cages for testing nucleuses. The weight was measured as it is shown 

in the mentioned table. At the transfer moment into the nucleuses, the right 

forewing of each queen it was partially cut to prevent the flight. In plus, the mating 

nucleuses were prepared in order to avoid the flight of queens, so they were 

provided with a piece of queen excluder at each entrance. 

After their introduction, the instrumentally inseminated queens were daily 

checked in order to notice their acceptance, the beginning of egg laying and the 

quality of brood. 

4.2. Results and discussions. 

As it is shown in the table no. 1 the age of queens for insemination was between 

8 and 9 days. The semen quantity was 4mmc (µl) in 2 cases, 6 mmc in 5 cases and 

8 mmc in 18 cases. 

The weight of queens after insemination varied between 153, 3 and 186, 2 mg 

for the first 5 queens that were weighted after 7 days from insemination and 

between 149, 1 and 183, 4 mg after 2 days from insemination in the case of 15 

queens. In the same time we noticed that 4 queens died (16%). Regarding the 

accepted queens into the nucleus the results shows that 10 queens were quickly 

accepted (in three days from introduction), and 11 queens were accepted in an 

interval of 7 to 13 days because of some problems connected with nucleuses 

formation. 

The time intervals from the moment of insemination and introduction until the 

egg laying were very different, depending of different factors. So, regarding the 

time interval from insemination to egg laying this was between 9 and 28 days with 

the average of 16, 7 days; the time interval from acceptation into the nucleus to egg 

laying was between 3 days and 17 days with the average interval of 8, 4 days. The 

average of first time interval could be shortened by a correct introduction of queens 

into the nucleuses which directly influence the queens’ acceptance. 

64



Regarding the aspect of brood it was noticed a normal egg laying with a 

compact and uniform pattern. 

4.3. Conclusions 

The obtained results regarding the instrumental insemination could be concluded as 

satisfactory: 

a relatively good viability of instrumentally inseminated queens (84%); 

a very good acceptation of inseminated queens into the nucleuses, -100% out 

of the viable ones; 

a good percentage of egg laying inseminated queens out of the accepted ones- 

85,8% ; 

a relatively normal average of the time interval from the acceptation in nucleus 

till the starting of the egg laying - 8,4 days (the expecting time for egg laying); 

a compact and normal (worker honeybee’s brood) pattern of brood for all the 

queens; 

5. References 

1. Cobey S, (1995) Instrumental insemination equipment: sophistication and 

simplification in designs. American Bee Journal 135 (10): 697-701; 

2. Cobey S, (2007). The Comparison studies of instrumentally inseminated and 

naturally mated honeybee queens and factors affecting their performance. 

Apidologie 38 390-410; 

3. Cobey S, (1983) Instrumental insemination: Current developments and its 

application today. American Bee Journal 123 (3) 182-185 

4. Collins A. (2000) Relationship between semen quality and performance of 

instrumentally inseminated honeybee queens. Apidologie 31: 421- 429 ; 

5. Doug Mccutcheon (2001) Queens introduction, no. 185, -„La sante de lÀbeille, 

p.299-311 ; 

6. Foti N., Grosu E.,. (1975) Comparative research on migration of spermatozoa in 

caged queens, both naturally and artificially inseminated. 25 International 

Congres Apicultura-Grenoble – France: 270-274. Gilles Ratia - (1986): Wintering 

fertilized Queens in Banks - Abeilles & Fleurs, no 357. 

7. Jasinski Z., Fliszkiewicz C (1996) Different body injuries of queen bees caused 

by agressivity of workers in queenbanks. Pszczelnicze Zeszyty Naukowe, Vol 

XL, n.2, p.265. 

8. Ruttner F. -(1976) Instrumental insemination of honeybee queens –Apimondia. 

9. Woyke, J. -(1960): Natural and artificial insemination of queen honey bees. In: 

Pszczelnicze Zesz. Nauk. 4, S. 183 ; 

10. Woyke J, (1991) Syringe guide for instrumental insemination apparatus of 

queen bees. Apidologie 22 : 81-85; 

65

STUDIES REGARDING LEAD REGULATED GENES ND 

METAL HYPERACCUMULATION 

S. MIHACEA * E. CINCU * 

Abstract: In this paper we have focused on expression studies of the genes 

involved in the pytochelatins metabolic pathway on alfalfa, namely yglutamicilcysteine 

synthetase and gluthation sysnthetase. It turned out that these 

genes are up-regulated by the lead presence mostly for the tolerant genotype. 

The lead effect is emphasized mostly at the higher concentration.In the same 

time the correlation of the gene expression level in heavy metals presence (RT – 

PCR) and the heavy metal content in the vegetal tissue allowed the identification 

of the genes involved in the heavy metals binding and inactivation in alfalafa. 

Keywords: phytochelatins, heavy metals, RT-PCR 

1. Introduction 

The environment contamination with heavy metals became a stringent problem 

all over the world because it has major impact on crop plants, soil fertility and at 

the same time it leads to their bioaccumulation in the food chain. Nowadays it is 

considered that phytoremediation represents the ecological and economical 

alternative to remove the polluting factors from soil. 

It is known that heavy metals may be detoxified in plants by a family of sulphur 

rich peptides termed phytochelatins (PCs), that are able to bind heavy metals [3, 4, 

8]. Phytochelatins consist of just three aminoacids: cysteine, glycine and glutamic 

acid, arranged generally in a (γ-Glu-Cys)n Gly conformation. The fact that PCs are 

arranged in a γ carboxylamide bond suggests that the phytochelatins are not direct 

result of expression of a metal tolerance gene, but rather a product of a 

biosynthetic pathway with glutathione, most likely the substrate on which the 

pathway begins. The patway of glutathione biosynthesis is well established: two 

sequential ATP-dependent reactions allow the synthesis of γ-glutamylcysteine (γ - 

EC) from L-glutamate and L cysteine, followed by the formation of GSH by 

addition of glycine to the C-terminal end of γ-EC. These reactions are catalysed by 

γ-glutamylcysteine synthetase (γ-ECS) and glutathione synthetase (GS) [5,7,1,2, 

9,10]. 

* 

Dept. of Plant Biotechnology, USAMVB Timisoara, Romania, e-mail: 

biotehnologii_usab@yahoo.com



For the understanding of the genetics mechanisms involved in the heavy metals 

tolerance and bioaccumulation on alfalfa the first step is genes expression 

evaluation. 

The aim of this work was to correlate the glutamylcysteine synthetase (γ-ECS) 

and glutathione synthetase (GS) genes expression level in heavy metals presence 

(RT –PCR) with the heavy metal content in the vegetal tissue. 

We used as biological materials alfalfa plants due to their relatively high amount 

of biomass, high heavy metals tolerance and high capacity of heavy metals 

accumulation. The previous researches allowed us to identify a tolerant and a 

sensitive alfalafa genotypes which were used further on in our investigation. 


Alfalfa plants (Sigma and Satelit variety) were grown in a controlled 

environment chamber with 16h/8h photoperiod at 24°C on artificial substrate. The 

nutrients were administrated as KNOP solution (Ca(NO3)2 0,1%, KNO3 0,025%; 

KCl 0,012%; KH2PO4 0,025%; MgSO4 0,025%), in each two days. 

After 3 weeks the plantlets (2-4 trifoliolate leaves) were treated with different 

volume of Pb(CH3COO)2 solution therefore in each pot specific lead quantity was 

distributed: 10, 20, 50, 100 and 500 ppm. 

Gene identification 

Genes encoding for γ-glutamylcysteine synthetase and gluthatione synthetase had 

already been described in literature. We performed database searches to those 

genes and identified putative cDNA sequences in Medicago truncatula as their 

probable homologs. Specific primers for each sequence were designed based on the 

BLAST results and fragments containing putative complete open reading frames 

were PCR amplified. 

RNA extraction and RT-PCRs 

Total RNA was isolated from roots with the RNAgents Total RNA Isolation 

System from Promega according with the supplier recommendations.. Eight plants 

per treatment were pooled to extract RNA and one batch of plants was analysed. 

0,2 μg total RNA was subjected to reverse transcription and amplification in one 

reaction, using Accessquick RT-PCR System (Promega), according to the 

manufacturers instructions. The amplification follows the next steps: 1. revers 

transcription - 45 min /45°C; 2. AMV-aT inactivation and RNA/cDNA/primer 

denaturation - 2 min / 95°C 3. PCR amplification (35 cycles): denaturation 

30s/95°C, primer annealing 1min/ different temperature, according with the primer 

67



sequence, extension 1min/70°C; final extension 5 min /70°C. The amplification 

products, separated on 1,5% agarose gels and 

analyzed by UVP BioImaging System. 

Heavy metals quantifications 

After one month the leaves and stems of the plants treated with different lead 

concentrations were dried and the Pb content was determined by Atomic 

Absorbtion spectroscopy (AAS) method. 


According to the growth tests, previously performed in our laboratory, Sigma was 

considered as the most tolerant variety and Satelit as the most sensitive one. The 

Sigma variety plants had a good behavior at 20 and 50 ppm and the negative effect 

was observed only for 500 ppm variant. For Satelit variety the negative effect was 

high even at the lowest concentration and it was emphasized at higher 

concentrations [6]. 

Further on the molecular analysis were performed for the two alfalfa varieties – 

the most tolerant - Sigma and the most sensitive – Satelit variety. 

The RNA samples were quantified and diluted at the same concentration (0.2 μg/ 

μl). The sequences for the interest genes established according with the literature 

data were used for the primers design (Table 1). 

For each genotype the total RNA was extracted after 1 day, 1 week and 1 month 

of treatment. The heavy metal effect on the studied genes expression was evaluated 

after one day of treatment because it was pointed out that the effect decrease in 

time. The RT-PCR reactions were first optimized by gradient temperature reactions 

(data not shown). For each pair of primers temperatures from the 55 - 65°C 

intervals were used as annealing temperatures. The specific PCR product (120bp) 

was generated by the γ-ECS primers at 55°C. For the GS primers the best 

temperature to generate specific products (200bp) was 65°C. As a control the 

primers for the elongation factor EF1 were used. 

After the RT-PCR was optimize the amplification reactions were done using the 

RNA samples extracted from tolerant and sensitive genotypes, treated with 

different lead concentrations after one day treatment. 

Using γ-ECS (γ-glutamylcysteine synthetase) primers specific products were 

synthesized (120 bp), with different intensities. Similar results were obtained when 

the GS (gluthatione synthetase) primers were used (Fig. 1). The ratio between the 

intensities of the bands for treated variants and control were evaluated using Image 

J software (Fig. 2). It turned out that the studied genes were overexpressed in lead 

presence mainly for the tolerant genotype Sigma. The results could be correlated 

68



with the heavy metal content, which was higher in the tolerant genotype compared 

with the sensitive one, when the concentrations 10, 20, 50 and 100 ppm were used 

(Table 2). 

At the highest concentration (500 ppm) an overepressing was observed for the 

sensitive genotype too. Both studied genes had a high expression and the 

phytochelatins were synthesized. Thus a very high amount of lead was 

accumulated (121% compared with the tolerant genotype). This high heavy metal 

content seems to be very toxic and all the plants died. The plants from the tolerant 

genotype were negative influenced by the highest lead concentration, but the plants 

survived. 

Table 1 

The primers sequences for the genes involved in phytochelatins pathway 

Gene Primers sequence The expected size for 

the PCR products 

γ- glutamylcysteine 

F: CTTAGTGGAGCCCCTCTGGAA 

119 bp 

synthetase (γ-ECS) 

R: CTGGAAACCAATCCCCAAAAA 

gluthatione synthetase F: CAATCTTCTGCTGTCAAATGCCCTTCAA 186 bp 

(GS) 

R: TGCTTTTCTAACAATATCCGAGTCATCCA 

C 10 20 50 100 500 M C 10 20 50 100 500 

Sigma Satelit 

ECS 

Fig. 1 The agarose gel electrophoresis (1,5%) of the ECS (γ- glutamylcysteine 

synthetase) and GS RT-PCR products for the plants treated with different lead 

concentration, after 1 day treatment 

C – control variant – not-treated; 10, 20, 50, 100 and 500 – variants with different 

Pb concentration (ppm); M – PCR marker (Promega) 

GS 

69



70 

GS ECS 

500 ppm 

100 pm 

50 ppm 

20 ppm 

10 ppm 

500 ppm 

100 pm 

50 ppm 

20 ppm 

10 ppm 

0 0,2 0,4 0,6 0,8 1 1,2 1,4 

Fig. 2 The ratio between the intensities of the bands for treated variants and 

control, evaluated with Image J software, for the studied genes 

The lead accumulated by alfalfa plants (mg Pb/g dried mass) 

Table 2 

Genotype C 10 ppm 20 ppm 50 ppm 100 ppm 500 ppm 

SIGMA 0.00088 0.02409 0.02357 0.09700 0.25690 1.84615 

SATELIT 0.00031 0.04149 0.04316 0.12048 0.17160 2.23944 

Conclusions 

The study of the γ -glutamicilcysteine synthetase and gluthation synthetase genes 

expression pointed out that these genes are up-regulated by the lead presence 

mostly for the tolerant genotype. The lead effect is emphasized mostly at the higher 

concentration. The results could be correlated with the heavy metal content, 

which was higher in the tolerant genotype compared with the sensitive one, 

when the concentrations 10, 20, 50 and 100 ppm were used. The highest 

concentration (500 ppm) was lethal for the sensitive genotype due to the 

very high accumulation of heavy metal. 

References 

1. Bustin S.A., 2002, Quantification of mRNA using real-time reverse transcription 

PCR (RT-PCR): trends and problems. J MolEndocrinol. 29: 23–39. 

Satelit 

Sigma



2. Basile A, Alba di Nuzzo R, Capasso C, Sorbo S, Capasso A, Carginale V. 2005, 

Effect of cadmium on gene expression in the liverwort Lunularia cruciata, 

Gene.,15;356:153-9 

3. Cobbett C., P. Goldsbrough, 2002, Phytochelatins and metallothioneins: Roles in 

heavy metal detoxification and homeostasis. Ann. Rev. Plant Biol. 53: 159-182 

4. David G., Mendoza-Cozatl, Sanchez R.M., 2006, Control of glutathione and 

phyrochelatin synthesis under cadmium stress. Pathway modeling for plants, 

Journal of Theoretical Biology 238: 919-936 

5. Lee S., B.S. Kang, 2005, Expression of Arabidopsis phytochelatin synthase 2 is 

too low to complement an AtPCS1-defective Cad1-3 mutant, Mol Cells.; 

28;19(1):81 

6. Mihacea S., Cincu E., 2008, Expression studies of the genes involved in the 

phytochelatins metabolic pathway, Buletin USAMV-CN, 65(1-2) 

7. Minglin L, Z. Yuxiu, C. Tuanyao, 2005, Identification of genes up-regulated in 

response to Cd exposure in Brassica juncea L. Gene, 19;363:151-8 

8. Sarry J.E., L. Kuhn, C. Ducruix, A. Lafaye, C. Junot, V. Hugouvieux, A. 

Jourdain, O. Bastien, J.B. Fievet, D. Vailhen, B. Amekraz, C. Moulin, E. Ezan, J. 

Garin , J. Bourguignon, 2006, The early responses of Arabidopsis thaliana cells 

to cadmium exposure explored by protein and metabolite profiling analyses, 

Proteomics.; 6(7):2180-98 

9. Srivastava A.K., Venkatachalam P., Raghothama K.G., Sabi S.V., 2007, 

Identification of lead-regulated genes by suppression subtractive hybridization in 

the heavy metal accumulator Sesbania drummondii, Planta 225:1353-1365 

10. Vatamaniuk O.K., S. Mari, A. Lang, S. Chalasani, L.O. Demkiv, P.A. Rea, 

2004, Phytochelatin synthase, a dipeptidyl transferase that undergoes multisite 

acylation with gamma-glutamylcysteine during catalysis - Stoichiometric and 

site-directed mutagenic analysis of Arabidopsis thaliana PCS1-catalyzed 

phytochelatin synthesis. J. Biol. Chem. 279: 22449-22460 

71

THE DETERMINATION OF CHANGES INDUCED BY 

THE TREATMENT WITH LASER DIODES ON 

SOLANACEAE VEGETEBLE PLANTS IN THE FIRST 

STAGES OF VEGETATION 

P. NICULITA * , F. ISRAEL-ROMING * , S. DANAILA-GUIDEA * , O. 

LIVADARIU * , E. GHERGHINA * , V. SIMION * , G. LUŢĂ * , M. 

DRAGHICI, J. RISTICI ** , M. RISTICI ** 

Abstract: The life of plants depends on light, which is essential in unfolding the 

photosynthesis process and so, the bright solar energy is transformed, in this process, 

into biochemical energy. .[1,2,3]. The light influences the germination process and the 

plants growth through photosensitive pigments and the spectral composition of light 

influences directly the plants growth process. .[4,5]. 

For establishing the biochemical changes induced by treatments with red laser 

diodes in the vegetative and juvenile development stage (first pair of real leaves), in 

tomatoes, red peppers and eggplants plantlets, biochemical determinations have been 

performed which following the accumulation on fresh biomasse, dry substance and 

chlorophyll pigments (total chlorophyll, a chlorophyll, b chlorophyll and the report a/b 

chlorophyll) 

The biological material used for applying the treatment with laser diodes has been 

represented by vegetables certificated seeds from the Solanaceae family: tomatoes- 

Lycopersicon esculentum, cv.DACIA; pepper-Capsicum annuum, cv.OPAL and 

eggplant-Solanum melongena, cv.DANIELA . 

The experimental scheme of illumination with laser diodes of the seeds resulted and 

plantlets consisted in 3 variants with 3 repetitions/ each variant and untreated control 

sample. For the exposure time at supplementary light there have also been used 3 

variants with 3 repetitions/ each variant and species: 15, 30 and 45 minutes. .[4,5]. 

Between the analyzed three species of solano-fruits vegetables, the most promising 

results have been obtained in red peppers where all variants have outran the result 

obtained in the control variant. As regards the content in total chlorophyll assayed 

through spectrophotometric methods the V3 variant (the 30 minutes irradiation 

variant) has recorded a net superior value than the control (control = 43,914 mg/ 100 

d.w. and V3 = 70,189 mg/ 100 d.w), corresponding to a 60% increase. 

Keywords: laser diodes, tomatoes, pepper, eggplant, seeds 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: petruniculita@yahoo.com 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: eveghe@yahoo.com 

** 4R OPTICS, Bucharest, Romania, e-mail: josefina_ristici@yahoo.com




The water content in all living organisms is very high, water being the 

main compound of all the substances. The water content of the plants depends also 

on the age, making the young leaves to have a higher water amount unlike the aged 

leaves, due to the progressive reduction of the protoplasm hydration ability that 

comes with the aging process. 

The dry substance (percent/average value) content is calculated in 

accordance with the analyzed sample (g) and the weighed value at 105 0 C. 

The gravimetric method used to determine the biological samples of dry 

substance for the biological samples of dry substance for experimental batches was 

formulated in percentage/ medium value of the sample. 

The qualitative and quantitative separation of pigments from the leaves is 

based on the different solubility degree of the organic solvents (Sorby-Krauss and 

Timireazev methods) or on the different absorption degree of pigments on the filter 

paper or some inert powders, insoluble in organic solvents. 

Facts from the speciality literature concerning the pigment content in 

Solanaceae leaves indicate that the ratio between a chlorophyll and b chlorophyll 

stays constant (a/b = 3/1), with small variations due to the lighting conditions; for 

direct sun light it is higher than for the shadow plants, and for the alpine plants it 

reaches 5.5/1. [1,2]. 

The analyses have established some quantitative differences also between 

the assimilating pigments; in the leaves of the heliophilic plant the ratio between a 

and b chlorophyll and between carotene and xanthophylls are higher than in the 

leaves of the ombrophilic plant. The content of a and b chlorophyll and carotenoides 

found in the plastids of the leaves rises up to 1.534; 1.131 and 0.480 mg/100 cm2 

leaves, and the content of ascorbic acid in leaves when blooming represents 509.5 

mg% g dry substance. .[1]. 

2. Material and methods 

Biological Material 

In order to establish the changes induced by the non thermal laser treatment on 

the plants, we used seeds from the Solanaceae fam.(tomato, pepper and aubergine). 

The vegetal material was represented by certified seeds, along with the analysis 

report, supplied by the Vidra Institute of Vegetable and Floriculture Research and 

Development, that pertain to the following breeds: the OPAL near early pepper 

breed, the DACIA field tomato breed and the DANIELA near early aubergine breed. 

A. Biochemical determinations in the seedling phase 

For establishing the biochemical modifications induced by the red light from the 

laser diodes in the vegetative and juvenile developing stage (the first pair of real 

73



leaves) on the tomato and pepper plantlet, there were made biochemical 

determinations which analysed the content of fresh biomass/ plantlets (mg/ 

plantlets), dry substance (% average value for weighed sample) and chlorophyll 

pigments. 

By using the spectrophotometer method for determining the chlorophyll pigments 

in the biological samples for the experimental batches the chlorophyll was given in 

mg / 100 g fresh substance. Extinction is determined by reading at 645nm and 

663nm against acetone at 80% concentration. 

B. Technical characteristics of experimental devices (laser diodes and non 

thermal laser) used for illumination 

Laser diodes are someway similar to the LEDs, but different by the fact that 

light is generated by stimulated emission and not by spontaneous emission, leading 

to a better efficiency and different proprieties of the emitted beam. 

In Table 1 is given information regarding the irradiation exposure time and doses 

with 20 red coloured laser diodes, having a total strength of 100mW on a surface of 

20 x 10 cm 2 . 

The experimental device that is used consists of a “mobile arm” system which 

allows to adjust the distance between the system of laser diodes and the exposure 

surface and a laser head that consists of system with 20 laser diodes aligned in a 

cylinder so that the emitted light can be equally superposed on the exposure 

surface. 

T( min) D (J/cm2) Table 1. 

15 

0.9 

Irradiation doses values versus 

exposure time 

30 

1.8 

45 

2.7 

Picture 1. Irradiation device with laser diodes 

The device (Picture 1) is independent and it can be placed on a surface that 

allows the recipients with the seeds or the plants that must me irradiated to be 

exposed. In our experiments, on the exposure surface were placed 3 Petri recipients 

containing 25 seeds of every species each. The light emitted by the laser diodes is 

assigned on a 200 cm 

74 

2 surface. The aim is to make the illumination as even as



possible on the entire surface so that the seeds can be irradiated at the same dose. 

The Petri recipients with the seeds which represented the control sample where not 

exposed to the supplementary illumination with red coloured laser diodes. 

C. Experimental scheme 

The seeds were placed on sterile wet filter paper, at room temperature 23-25ºC 

and air relative humidity of 35-40% suitable to the ambient medium. These were 

placed in one time use plastic Petri recipients (9 cm diameter and 2 cm high). 

Experiments were developed for each species in the same time (pepper, 

aubergine and tomato) for 3 repetitions, in the same controlled working and culture 

conditions in Laboratory of Vegetable Biotechnology from Biotechnology Faculty, 

USAMV – Bucharest. 

Daily, the seeds were supplementary illuminated by the red light emitted by laser 

diodes in different exposure times corresponding the following experimental 

schemes: 

Experimental series 1: 

V1 – experimental variant illuminated for 15 minutes; 



VM – experimental control variant non-illuminated; 

Experimental series 2: 




VM – experimental control variant non-illuminated; 

After applying the treatment all the seeds were preserved at a photoperiod of 8 

hours dark/ 16 hour day at artificial white light (Phillips neon - 40W). 

3. Results and discussion 

A. Experimental results of the biochemical determinations of series 1 

I. Fresh biomass/ plantlets (mg) – Graph. 1. 

For pepper: all variants have higher results than the control sample. Variant V2 

(30 minutes) has recorded a value significant higher than the value of the control 

sample (control sample = 44.95 mg and V2 = 62.29 mg); 

For the aubergine just variant V2 (irradiated for 30 minutes) recorded a higher 

value than the control sample (control sample = 43.94 and V2 = 47.93 mg); 

For the tomato all variants have values smaller than the control sample (control 

sample = 35,65mg and V1 = 34,94mg). 

75



76 

mg 

70 

60 

50 

40 

30 

20 

10 

0 

pepper var. control 

eggplant var. control 

tomatoes var. III 

tomatoes var. control 

pepper var. I 

eggplant var.I 

tomatoes var.I 

pepper var.II 

eggplant var. II 

tomatoes var. II 

pepper var. III 

eggplant var. III 

Fresh biomass / plantlet 

Fig. 1. Fresh biomass/ plantlets (mg) 






pepper var.II 



pepper var. I 

tomatoes var. 

control 

eggplant var. 

control 


II. Dry substance content (%) – Graph.2: 

For pepper: all variants have smaller values of dry substance than the control 

sample (control sample = 7.13 mg); 

For the aubergine: Just V1 and V2 (15 and 30 minutes) have higher values than 

the control sample (control sample = 4.49 mg, V1 =4.52 and V2 =4.59); 

For the tomato: all variants have smaller values of dry substance than the 

control sample 

(control sample = 5.007 mg and V1 = 4.71 mg); 

III. The content of total Chlorophyll, a Chlorophyll, and b Chlorophyll and 

the ratio calculation of a/b Chlorophyll (mg/100g fresh substance) - Graph 3: 

For pepper: all variants have higher values than the control sample. V3 (45 

minutes) has a significant higher value (control sample = 43.914 mg and V3 = 

70.189 mg). 

For aubergine: just in the case of determining the content of b chlorophyll all 

the samples reached values that outran the control sample. V2 (30 minutes) has a 

value with 5% higher than that the control sample (control sample = 20.13 mg and 

V2 = 21.08 mg). The other results are smaller than the control sample.



% 

70 

60 

50 

40 

30 

20 

10 

0 




pepper var. I 



pepper var.II 






Dry substance content / variant 

Fig.2 - Dry substance content (%) 






pepper var.II 



pepper var. I 

tomatoes var. 

control 

eggplant var. 

control 


For tomato: all variants have higher values than the control sample. V3 (45 

minutes) has a higher value of fresh substance with 10%control sample = 43.248 

mg and V3 = 48.773 mg). For a chlorophyll and b chlorophyll determination and 

the a/b chlorophyll ratio calculation (mg/ 100 g of fresh substance) still V3 had 

recorded higher values than the control sample. 

mg / 100g fresh substance 

70 

60 

50 

40 

30 

20 

10 

0 




pepper var. I 



pepper var.II 






Total chlorophyll / variant 

Fig 3. - The content of total Chlorophyll 






pepper var.II 



pepper var. I 

tomatoes var. 

control 

eggplant var. 

control 


77



B. Experimental results for the biochemical determinations of series 2 

For the determination of biochemical modification induced by the treatments 

with laser diodes in the vegetative and juvenile developing stage on the tomato 

and pepper plantlets which are in the stage of first pair of true leaves, chemical 

determinations where carried out in order to establish: fresh biomass/plantlet, dry 

substance and clorophillian pigment amount. 

The biochemical determinations at tomato and pepper plantlets, in the stage of 

first pair of leaves - (25 days) reached the following results from Tables 2 -5. 

Fresh biomass/plantlets (mg): 

All variants have smaller values than the control sample. 

Table 2. 

Biochemical determinations for pepper and tomato: Variant I – 10 minute of 

ilumination with laser diode (experimental series 2) 

Species 

Pepper Tomato 

Biochemical determinations 

Fresh biomass / explants (mg) 48.13 30.30 

Dry substance (%) 7.309 5.517 

Chlorophyll total 54.416 33.175 

(mg/100g fresh a 40.456 26.473 

Biomass) b 13.960 6.702 

a / b rapport 2.90:1 3.95:1 

78 

Table 3. 

Biochemical determinations for pepper and tomato: Variant II – 20 minute of 

illumination with laser diode (experimental series 2) 

Species 

Pepper Tomato 





(mg/100g fresh a 39.205 25.553 

Biomass) 

b 13.277 7.268 

a / b rapport 2.95:1 3.51:1 

Dry substance content (%) 

For pepper: All variants have smaller values than the control sample (control sample 

= 7.377% and V1 = 7.309%).



For tomato: All variants have smaller values than the control sample (control sample 

= 5.705% and V3 = 5.569%). 

Table 4. 

Biochemical determinations for pepper and tomato: Variant III – 30 minute of 

illumination with laser diode (experimental series 2) 

Species 


Pepper Tomato 




(mg/100g fresh a 38.435 23.262 

Biomass) 

b 13.084 6.522 

a / b rapport 2.94:1 3.57:1 

Table 5. 

Biochemical determinations for pepper and tomato: 

Control sample – non- illuminated with laser diodes (experimental series 2) 

Species 


Pepper Tomato 



Chlorophyll 

total 47.102 34.908 

(mg/100g fresh a 35.243 28.437 

Biomass) 

b 11.859 6.471 

a / b rapport 2.97:1 4.39:1 

The content of total chlorophyll, a and b chlorophyll and a/b chlorophyll ratio 

calculation (mg/100g fresh substance): 

For pepper: all variant have higher values than the control sample. V1 (10 min.) 

and V2 (20 min.) have the highest values (control sample = 47.102 mg and V1 = 

54.416 mg, V2 = 52.481mg). That means about 15.5% more than the control 

sample recorded. 

For tomato: all variants have smaller values than the control sample (control 

sample = 34.908 mg). 

79



For a chlorophyll and b chlorophyll determination and the a/b chlorophyll ratio 

calculation (mg/ 100 g of fresh substance), all variants had higher values, only of b 

chlorophyll, that the control sample. 

4. Conclusions 

Seed stimulation using laser diodes induces important changes in the plant 

metabolism, as the increasing or the decreasing of some physiological processes 

with consequences over the shorting of shoot period, precocity, resistance to cold 

and over the increasing of productive potential. 

For the tomato seeds (Lycopersicon esculentum type Dacia) we can say that the 

supplementary daily treatment using the red light from the laser diodes does not 

increase the content of fresh substance/seedling (mg/seedling), dry substance and 

chlorophyll pigments. Just the total chlorophyll content from V2 (45 min.) was 

higher that the value corresponding to control sample. 

For the pepper seeds (Capsicum annuum type Opal) we can say that the 

supplementary daily treatment using the red light from the laser diodes (20, 30 and 

45 min.), during the entire seed germination period, has had a positive influence 

over the values of biochemical determinations, the obtained results were higher, in 

most of the cases, comparing with the values of control sample. So, the fresh 

biomass content was with 38% higher, the dry substance was with 10% higher and 

the total chlorophyll content of V2 (30 min.) was with 60% higher than the values 

corresponding to control sample. So, the pepper is the species which has the best 

reaction to the red laser diode treatment. 

For the eggplant (Solanum melongena type Daniela) we can say that the 

treatment has slowed the metabolism processes of plants. 

References 

1. Burzo, I., Voican, V.: Fiziologia plantelor de cultură”. ED Stiinţa , vol. IV , 2000, 

pag. 52-55. 

2. Butnariu, H., si colab.: – Legumicultura, Editura Didactică şi Pedagogică, Bucureşti 

- 1993 

3. Jurcoane, Ş., Săsărman, E., Roşu A., ş. a.: Tratat de biotehnologie (Vol. I), 

Bucureşti, Ed. Tehnică, 2004. 

4. Niculiţă, P. , Dănăilă-Guidea,S., Livadariu, O., Popa, M., Ristici, M., Ristici, E.: - 

Influence of Laser Diode Red Beams on Germination Rate of Tomato Seeds. 

calculation of interlaminar stress in material. In Volumul de abstracte al Conferinţei 

Internaţionale “Micro-to-Nano-Photonics” ROMOPTO 2006, Sibiu, România., 2006 

5. Niculiţă, P. , Dănăilă-Guidea,S., Livadariu, O., Popa, M., Ristici, M., Ristici, E.: 

Influence of red laser diode radiation on plant growth. In: Lucrari stiintifice Seria F 

XI 2006 Biotehnologii, ISSN 1224-7774, Bucuresti 

80

THE INFLUENCE OF MODULATED MAGNETIC FIELD AT 

AUDIO FREQUENCY OVER SOME BIOCHEMICAL 

RESULTS IN PEPPER (OPAL VARIETY) AND TOMATOES 

(DACIA VARIETY) SEEDS AND PLANTLETS 

P. NICULITA * , F. ISRAEL-ROMING * , S. M. DANAILA-GUIDEA * , 

* * * * 

O. 

LIVADARIU , E. GHERGHINA , G. LUTA , V. SIMION , 

A. PATROI * * ,M. DRAGHICI. 

Abstract: The stimulation of seeds throgh physical methods causes important 

changes to the metabolism that leads to the intensification or the reduction of some 

physiological processes, with consequences over the period of spring, the precocity 

of the resulted plantlets, the resistance at low temperatures, the augmentation of 

productive potential [2, 6]. 

Because the objective of our research is centered on establishing the changes 

induced by the treatment with modulated magnetic field at audio frequencies over 

germination of seeds and plantlets that are in the first stages of vegetation, [7] 

besides determining the germinal energy and the germinal aptitude there have also 

been made biochemical determinations that followed the content of dry substance 

(%), total nucleic acids (µg / mg s.u.) and brute protein (N x 6,25/ 100 g s.u.) which 

were related to the dry substance analyzed at the untreated seeds (S1) and also at the 

treated ones(S2). 

In our tests there have been used 3 irradiation frequencies (5 Hz, 10 kHz and 20 

kHz) and 2 exposure durations (5 and 10 minutes) for the seeds in each solano-fruits 

species. 

The preliminary analyses performed in the pepper and tomato seeds, both before 

the magnetic field treatments and 5 days after their application with magnetic field 

were ment to represent a starting point for the subsequent biochemical 

determinations made in the resulted plantlets. 

Keywords: magnetic field, biochemical determination, modulated audio frequency, 

seeds 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: petruniculita@yahoo.com 

** 

INCDIE-ICPE- Bucharest, Romania , e-mail: alessandroeros@yahoo.com




Through the permanent exchange of substances and energy, the plants are in an 

intimate contact with the environment, and the intensification of the photosynthesis 

has at its bases the action of the external and internal factors, determined by the 

nature of the plants and the interaction of all factors [1]. 

In the green plants, as a following of the photosynthesis, accumulate a multitude 

of substances which are transported to the growing 

area, to increase the volume and weight of all ant organs. Some of these organic 

substances are consumed in the process of respiration to procure cellular metabolic 

energy, and most are deposed in the reserve organs and fruits. 

Intense migration of organic substances in plants is made through a form of 

solution, organic essence (developed), mainly through the phloem, liberian vessels 

in small part by xylem, especially in spring time. Photosynthesis depends to a great 

extent by light intensity and duration of action on its leaves [1, 2]. 

Stimulating seeds causes significant changes in the metabolism [5] which leads to 

intensification or reduction of physiological processes, [3,4] with followings upon 

the shortened period of sunrise, precocity of small resulted plants, resistance to low 

temperatures, increasing the productive potential. 

Since the objective of our research was the establishment of the changes induced 

by the treatment with magnetic field modulated by audio field on the common 

plants found in the first stages of vegetation, observations were subsequently 

focused on determining the percentage of germination of seeds. 

With regard to the use modulating magnetic field at frequencies audio seed 

treatment, in order to increase the percentage of germination, carried out 

experiments have shown that it is important to determine the frequency of radiation 

by modulating the magnetic field common audio and time of exposure of seed 

[2,6]. 


To initiate experiments, the seed used as biological material were placed in 2 

series: 

-„Experimental Series I for pepper seeds from Opal variety”; 

-„Experimental Series II for tomato seeds from Dacia variety“. 

For each experimental series have been used 6 possibilities distributed in 

rehearsals (4 rehearsals / option for seeds of peppers and 6 rehearsals / option for 

tomato seeds) and a trial witness un-irradiated (seeds that were not treated with 

magnetic modulated fields at audio frequencies) with 4 repetitions as following: 

A – experimental variant treated for 5 minutes at 5 Hz frequency; 

82



B – experimental variant treated for 10 minutes at 5 Hz frequency; 

C – experimental variant treated for 5 minutes at 10 KHz frequency; 

D – experimental variant treated for 10 minutes at 10 KHz frequency, 

E – experimental variant treated for 5 minutes at 20 KHz frequency, 

F – experimental variant treated for 10 minutes at 20 KHz frequency. 

plus VM – experimental variant, untreated witness. 

The irradiation experiments were carried out in parallel and in the same working 

conditions and culture on the seeds of peppers and tomatoes being in dry state for 5 

days. 

To determine the biochemical changes induced by the treatments with magnetic 

modulated fields at audio frequencies were carried out two series of tests as 

following: S1- tests conducted on the seeds before applying treatment with 

modulated magnetic field at audio frequencies and S2- tests carried out on seeds 

after the treatment with modulated magnetic field at audio frequencies 

Biochemical samplings were carried out which followed the dry matter content 

(%), total nucleic acids (microgram / mg su) and gross protein (N x 6.25 g / 100g 

su). 

Determinations of total nucleic acids (microgram / mg s.u.) and gross protein (N x 

6.25 g / 100g s.u.) were reported in dry analyzed substance at untreated seeds (S1) 

and treated ones (S2). 

The method of work used to determine the quantity of dry substance 

The exactly weighing exhibit, taken after the homogenization resulted by mixing 

the reaction mass, is inserted in the vial weighing treated, brought to constant. After 

weighing test in vial, vials are maintained in the drying stove at 105°C, until 

constant mass. Duration of bringing to constant varies depending on the analyzed 

sample, but can not be less than 3 hours. For the achievement of reproducible 

values, analysis was performed in three repetitions of the same variants. 

The calculation of the dry matter is made taking into account the evidence taken in 

the analysis (in g) and the value resulted from constant weighing at 105°C. 

Gravimetry method used in the determination of the dry matter of biological 

samples for experimental series was expressed in percentage / average value of the 

sample. 

Determinations of biochemical changes in the seeds were performed in the 

Laboratory of Biochemistry and enzymology the Faculty of Biotechnologies 

(USAMV Bucharest). 

Technical characteristics of the experimental device used to irradiate seeds in 

modulated magnetic field at audio frequencies. 

83



Magnetic field is the mean through which are inserted controlled disturbances in 

the material, the magnetic properties reflecting the behavior of the sample under 

these disturbances. 

The general principle of operation of a device for producing modulated magnetic 

field at audio frequencies phenomenon is based on the induction of a magnetic 

field using a 3D Helmholtz coil. 

Fundamental properties of the modulated magnetic field at audio frequencies 

obtained with a 3D Helmholtz coil are: increased homogeneity on a given volume, 

high value field and well-defined control on all 3 axis. 

In table 1 are given information on the time of exposure and the modulated 

magnetic field at audio frequencies with the value of approximately 10 Mt per 

surface of 20 x 20 x 20 cm3. 

84 

Values of the magnetic field 

(mT) 

T (min) 5 Hz 10 KHz 20 KHz 

5 12 mT 9.9 mT 10 mT 

10 11.6 mT 9.8 mT 10.1 mT 

Table 1 

The values of the magnetic field 

used in the experiment depending 

on the time of exposure 

Experimental device used is a system of triaxial Helmholtz coils composed of 3 pairs 

of coils arranged triaxial, a wave generator Tektronix TDS 2014, a power amplifier 

NF HSA 4014, and the surface exposure allows placing a container (Petri boxes with 

a diameter of 10 -15 Cm) so that issued energy would overlap in a uniform way on 

the surface of all treated seeds of probation. 

The device is independent and can sit on a surface on which it can be exposed and 

recipients with seeds or plants to be irradiated. 

Exposure surface is chosen according to the Petri vessel or plants that need to be 

irradiated. 

On the exposure surface we can place a Petri recipient with 1 ~ 50-60 seeds / 

variant of tested sample. The energy issued by the device is distributed on an area of 

20 x 20 x 20 cm3. 

Measuring the strength of the modulated magnetic field on audio frequencies 

there has been done using a Gaussmetru Lakeshore with 3D probe. 

Choosing the time of exposure was conducted according to the surface of 

irradiated and the desired dose of radiation.




A. Experimental results obtained from biochemical calculations made on 

peppers and tomatoes seeds treated with modulated magnetic field at audio 

frequencies. (Table 2) 

These tests that took place on seeds of peppers and tomatoes have to be a point of 

departure for subsequent biochemical determinations which have been made to 

plants resulting therefore, because we consider that only at plants level can be 

measured the changes through treatments with modulating magnetic field at audio 

frequencies. 

Table 2. 

Experimental results obtained from calculations made on biochemical treated peppers and 

tomatoes seeds with modulated magnetic field at audio frequencies 

Species Work 

Variant 

PEPPERS 

TOMATOES 

Biochemical determinations made in seeds 

s.u. (%) nucleicitotal Acids 

(µg / mg s.u.) 

S1 

92,115 11,43 

17,54 

S2 92,445 9,88 18,10 

S1 92,416 15,11 31,81 

S2 92,661 6,86 31,72 

gross protein 

(N x 6,25 g /100g s.u.) 

B. Experimental results obtained from biochemical calculations made on plants 

of tomatoes and peppers treated with modulated magnetic field at audio 

frequencies 

Plants used as biological material derived from the seeds used as biological material 

in the previous stage for germination testing under the influence of treatment with 

modulated magnetic field at audio frequencies. 

Biochemical analysis that followed the dry matter content (%), total nucleic acids 

(microgram / mg su) and gross protein (N x 6.25 g / 100g strain) were made from 

the leaves of plants from seeds treated with modulated magnetic field at audio 

frequencies in 2 series and were reported in dry analyzed as follows: 

(S1) biochemical determinations made in the leaves of tomatoes and peppers 

plants from seeds treated with modulated magnetic field at audio frequencies of 20 

kHz (var.E- 5 minutes treatment / day and F-10 minutes treatment per day), 15 days 

after transfer in the greenhouse (Table 3); 

85



(S2) biochemical determinations made in the leaves of tomatoes and 

peppers plants from seeds treated with modulated magnetic field at audio 

frequencies of 20 kHz (var.E- 5 minutes treatment / day and F-10 minutes 

treatment per day), after 45 days, transfer in the greenhouse (Table 4). 

For each of the 2 series of determinations has also been made a witness probe (VM 

- plants resulting from untreated witness seeds) for reporting results analysis being 

carried out also in the leaves of plants located in the same period of development 

with those of the variants considered experimental. 

The applied working protocol has been the same as the one used in case of seeds, 

the analysis being carried out this time, as well, in Analysis Laboratory of 

Biochemistry Faculty of Biotechnologies in the USAMV Bucharest. 

Table 3. 

Experimental results obtained from biochemical calculations made from the leaves of 

tomatoes and peppers plant from seeds treated with modulated magnetic field at audio 

frequencies of 20 kHz (S1-15 days after the transfer of the greenhouse). 

Species Sample 

86 


s.u. (%) total nucleic acids 

(µg / mg s.u.) 

PEPPERS • E 8,708 44,522 52,981 

• F 7,106 57,360 60,186 

• VM 7,823 43,781 51,964 

TOMATOES • E 6,736 54,751 50,477 

• F 6,433 54,360 62,438 

• VM 6,130 47,341 48,621 

E – plants from the seeds treated at 20 kHz frequency for 5 minutes / day; 

F – plants from the seeds treated at 20 kHz frequency for 5 minutes / day; 

VM – plants resulting from untreated witness seeds. 

gross protein 

(N x 6,25 g / 100g s.u.) 

The results obtained from determinations made on the leaves of peppers and 

tomatoes (experimental var. E and F) have been shown to be superior to witness the 

series - S1 performed after 15 days of the transfer in greenhouse plants. Regarding 

the samples analyzed in the S2 series - the results obtained at the determinations 

made on the leaves of peppers and tomatoes (experimental var. E and F) values are 

lower as the gross protein (g% su) of the values registered for trial witness but in 

superior content of nucleic acids (mg / g su).



In this case we believe that further research is necessary, testing of new exposure 

times and value of treatment frequencies with modulated magnetic field at audio 

frequencies. 

Table 4. 

Experimental results obtained from biochemical calculations made from the leaves of 

tomatoes and peppers plants from seeds treated with modulated magnetic field at audio 

frequencies of 20 kHz (S2-after 45 days of the transfer of plants in the greenhouse). 

Species Sample 


s.u. (%) total nucleic acids 

(mg / g s.u.) 

gross protein 

(N x 6,25 g / 100g s.u.) 

PEPPER • E 16,21 28,908 41,061 

• F 15,19 24,885 28,49 

• VM 13,21 20,184 57,530 

TOMATOES • E 16,66 10,774 38,56 

• F 16,30 16,619 54,85 

• VM 17,36 10,772 31,912 

E - plants from the seeds treated at 20 kHz frequency for 5 minutes / day; 

F - plants from the seeds treated at 20 kHz frequency for 5 minutes / day; 

VM – plants resulting from untreated witness seeds. 


Seeds that have not been watered were subjected for 5 days before the start of 

experiments to test the germination at treatment with modulated magnetic field at 

audio frequencies of 5Hz, 10Hz and 20KHz 

In the case of pepper seeds of the Opal variety were recorded higher germination 

percentage witness rehearsal for all 5 variants (var. A - E) taken in question, so after 

10 days when it was analyzed the germination energy of seeds and in the 20th day 

following the seeding, when the final germination analyze has been made compared 

with untreated witness seeds. 

The results obtained in the case of tomato seeds have not proved to be superior to 

the witness and therefore that results obtained on the 10 th as well as on the 20 th day 

were similar to those values registered of untreated seeds. 

Experimental results obtained from variations in work taken in case of the pepper 

plant variety Opal (experimental series 1) were analyzed in terms of length of 

exposure, 5 minutes and 10 minutes compared with three frequency treatment with 

87



modulated magnetic field at audio frequencies. Registered differences in this aspect 

are in correlation with the frequency of the magnetic field. There has been noticed 

uniformity in the development and growth of pepper plants from variations A-D (5 

and 10 minutes of treatment on the seeds). 

Results obtained for variations taken for work in case of tomato plants of the 

variety DACIA (experimental series 2) were the following: 

Results that exceeded the witness for all rehearsal of 6 variations have been 

recorded (var. A - F) taken in the discussion throughout the 3 months to maintain 

plants in culture and in the 3 parameters biometric review: plant height, number 

flower / fruit plantations and the related schedule compared with untreated witness 

evidence, but the recorded differences are so insignificant through experimental 

variations and regarding the growing values of growth of witness plants. Taking 

into account that some of the results are encouraging, we continue research on 

determining the changes induced by treatment with modulated magnetic field at 

audio frequencies on culture plants because of the results obtained in these 

researches that have shown that response differences appear between studied 

genotypes. 

References 

1. Burzo s.a.: Fiziologia plantelor de cultura, Vol. 2 , 1999 

2. Emil Burzo: Fizica fenomenelor magnetice, vol. I, Ed. Academiei RSR, 1979 

3. Butnariu H., Indrea D., Petrescu C., Ciofu R., Popescu V. ş. a.: Legumicultură, 

Bucureşti, Ed. Didactică şi Pedagogică, R. A., 1992 

4. Drăghici Elena: Legumicultură, Bucureşti, Editura Granada, 2002 

5. G.A. Lang: Plant Dormancy, CABI, 1996, 386 p. 

6. Al. Nicula: Electricitate si magnetism, Ed. Didactica si Pedagogica, 1973 

7. Petru Niculiţă, Silvana M. Dănăilă-Guidea, Alexandru Patroi, Oana Livadariu, Esofina 

Ristici, Marin Ristici, 2007 - Preliminary results in modulated magnetic field 

treatment of plants, IBWAP 2007, Constanta, Romania. 

88

THE INTRALOCUS AND AVERAGE GENE 

DIVERSITY AMONG ROMANIAN ALFALFA 

GENOTYPES 

CERASELA PETOLESCU*, SORINA MIHACEA*, G. NEDELEA* 

Introduction 

Abstract: In this study, few alfalfa genotypes, cultivated in Romania, 

were analyzed to verify genetic identity using RAPD primers. The 

aims of this project are to use molecular markers to assess the overall 

genetic diversity among the studied alfalfa genotypes and to carried 

out to verify genetic identity, among individuals from each considered 

genotype. The approach developed here was based on individual 

specific bands so each population was represented by 10 individuals. 

However this study shows that RAPD markers could be used in variety 

distinction, as specific bands were found. 

10 pt. 

Keywords: alfalfa, molecular markers, RAPD, genetic diversity 

The characterization of genetic variability and estimation of genetic relationship 

among varieties are essential to any breeding program. RAPD molecular markers 

have been used for many purposes, ranging from studies at the individual level 

(genetic identity) to studies involving closely related species. Due to their very 

high genomic abundance, RAPDs have also been applied in gene mapping studies 

[5]. Genetic variability evaluated in different ways which estimates the probability 

of two alleles in two different individuals being identical by descent. 

Alfalfa (Medicago sativa L.) is a very important forage crop specie in many 

countries throughout of the world [3]. It is widely adaptable to diverse 

environmental conditions. It is an important member of the crop rotation due their 

ability to fix the atmospheric nitrogen in symbiosis with Rhizobium meliloti. 

However, since alfalfa is autotetraploid (2n = 4x = 32), allogamous and seed 

propagated successful assessment of the genetic diversity of alfalfa has been 

hampered by the statistical methods available [1,2]. 

The objectives of the present study were to use the RAPD markers to estimate the 

genetic diversity among and within alfalfa population. The analysis of the genetic 

variability within and among populations of cultivated alfalfa can assess future risk 

of genetic erosion and help in the development of sustainable conservation and 

genetic improvement strategies. In this study, five alfalfa genotypes, cultivated in 

Romania, were analyzed to verify genetic identity using RAPD primers. The aims 

of this project are to use molecular markers to assess the overall genetic diversity

90 

Proceeding of the International Symposium BIOTECHNOLOGY 2008, USAMV 

Bucharest, Romania 

among and within Gloria, Sigma, Coral, Satelit and Super alfalfa genotypes. The 

approach developed here was based on individual specific bands so each 

population was represented by 10 individuals. However this study shows that 

RAPD markers could be used in variety distinction, as specific bands were found. 


Seeds of five alfalfa genotypes Gloria, Sigma, Coral, Satelit and Super cultivated 

in Romania, were disinfected by immersion in a 70% EtOH for 10 sec. followed by 

0,1% HgCl2 solution for 3 min, followed by 5 rinses in sterile water. Seeds were 

placed on half-strength MS basal medium to obtain plant material [4]. We tested 10 

individuals from each considered genotypes. 

DNA fingerprinting protocols 

Molecular analysis based on Random amplified polymorphic DNA (RAPD) 

markers was carried out to verify genetic identity, among and within five alfalfa 

genotypes. 

We used five RAPD primers (G03, G06, G10, G17, B07) with following 

sequences: 5’ GAGCCCTCCA 3’ , 5’ GTGCCTAACC 3’ , 

5’ AGGGCCGTCT 3’ , 5’ ACGACCGACA 3' , 

5’ GGTGACGCAG 3' . Total genomic DNA was extracted from each plantlets leaf 

tissues using a modified CTAB method. DNA samples were diluted in TE buffer 

and submitted to electrophoresis (3V cm-1) in 0.7% agarose gels (w/v). DNA was 

stained by gel immersion into ethidium bromide solution for 30 min. RAPD 

reactions were performed in a final volume of 25 μl in PCR buffer containing 

MgCl2, RAPD primers, dNTP, DNA template and Taq DNA polymerase. 

Reactions were submitted to the following PCR program: preliminary DNA 

denaturation for 3 min at 94°C, followed by 45 cycles consisting of denaturation (3 

min, 94°C), primer annealing (1,5 min, 36°C), and extension (2 min, 72°C). A final 

extension for 2 min at 72°C was included. The RAPD products were separated by 

electrophoresis (3V cm-1) in 2% agarose gels, which run with 1 x TAE buffer. 

Photo documentation was performed under UV light using a photo imaging system. 


The frequencies of the RAPD fragments among individuals from each genotype 

PCR amplification products of the 250 samples were scored as presence (1) or 

absence (0) of bands (Table1). The frequencies of the RAPD fragments were 

estimated for each of individuals from each genotype. The total number of clear 

bands obtained from each primer ranged from 2 (G03) to 6 (G10).



Concerning RAPD analysis, template DNA produced clear PCR profiles.As a 

result of UV light screening of agarose gel, it has not been observed differences 

between the genetic fingerprints of the studied varieties induced by amplification 

using GO3 primer. GO6 primer found complementary sequences in the genome of 

the varieties taken into study. 

The polymorphism was emphasized on Gloria genotype which showed a 

supplementary lane at middle distance between 750 and 500 bp. The amplification 

using G10 primers have led to satisfactory results, emphasizing strong 

polymorphism at molecular level. 

The primer G10 was used to analyze genetic variability among individuals from 

each genotype taken into this study. We can see a gel of Gloria genotype with a 

size marker on the left (M) and 10 individuals analyzed with a dominant marker. 

Six loci are identified (A, B, C, D, E and F). All of these loci are polymorphic 

(Fig.1). 

The average heterozygoty (He) cannot be estimated because dominant markers 

do not allow discrimination between heterozygous and homozygous individuals. 

The intralocus gene diversity (hj) may be calculated for each locus using the 

formula: 

hj= (1-p 2 -q 2 ), 

where, hj = heterozygosity per locus, 

p and q = allele frequencies, 

H = average heterozygosity for several loci. 

All the loci were polymorphic.Locus C diversity (hj=0,5) is the best that another 

loci. The average diversity (Hi) is Hj=0,31 (Table 2). 

Analysis of the genetic diversity is the same for all the individuals taken into this 

study (Table 3). 

The frequencies of the RAPD fragments among each genotype 

Bulked total genomic DNA extracted from all individuals from each genotype 

were used to perform RAPD reactions. For all of the RAPD primers (G03, G06, 

G10, G17, B07) 1 µl DNA from each individual and the same PCR marker were 

used. 

The evaluation of the genetic diversity among alfalfa genotypes pointed out: 

• The best results were obtain with G10 and G17 primers which gave a 

strong polymorphism at molecular level; 

• Amplification with G03 and G06 primers showed small differences 

between genotypes fingerprint; 

91

92 



• It has not been observed differences between the genetic fingerprints of the 

studied varieties induced by amplification using B07 primer; 

• The loci 1,4,8,15,17,19,20,21 were not polymorphic; 

• The intralocus gene diversity (hj) of the many loci are the same 

hj2=hj3=hj10=hj16=0,5; 

hj5=hj6=hj9=hj18=0,19; 

hj7=hj11=hj14=0,46; 

hj12=hj13=0,35; 

• The genotypes average diversity is Hj=0,23; 

M 1 2 3 4 5 6 7 8 

Fig 1. RAPD patterns generated by primer G10-Gloria genotype 

Legend: M - PCR marker (1000, 750, 500, 300,150, 50bp); Lanes 1-10 –individuals from 

Gloria genotype 

Primer 

G10 

Conclusions 

D 

F 

Table 1 

Genetic variation using G10 primer - Gloria genotype 

Indiv. 

Locus 

1 2 3 4 5 6 7 8 9 10 

Locus A 0 1 0 0 0 0 0 0 1 0 

Locus B 0 0 0 0 0 1 1 1 1 0 

Locus C 1 0 1 1 1 1 1 1 0 1 

Locus D 0 1 0 0 0 0 1 0 0 0 

Locus E 0 0 0 0 0 0 1 1 1 0 

Locus F 0 0 0 1 0 1 1 0 1 0 

The evaluation of diversity between alfalfa studied genotypes using dominant 

RAPD markers alloed to draw the following conclusions: 

E 

A 

B 

C



• The best results were obtained by amplification using G10 and G17, that 

emphasized a strong polymorphism at molecular level; 

• The amplification using G03 and GO6 primers showed small differences 

between genetical fingerprints of the studied varieties; 

Table 2 

Calculating diversity with a dominant molecular marker G10- Gloria genotype 

Locus Data analysis Allele 

freq. 

Genotype AA Aa aa Total 

Gen frecv. 

(exp) 

p 2 2pq q 2 

A 

p q 

1 

Individuals(no) 2 8 10 

B 

C 

D 

E 

F 

h j= 

(1-p 2 -q 2 ) 

Gen frecv. 0,2 0,8 1 0,11 0,89 0,19 


Gen frecv. 

(exp) 

p 2 2pq q 2 p q 

1 


Gen frecv. 0,4 0,6 1 0,23 0,77 0,35 


Gen frecv. 

(exp) 

p 2 

2pq q 2 p q 

1 


Gen frecv. 0,8 0,2 1 0,55 0,45 0,5 


Gen frecv. 

(exp) 

p 2 

2pq q 2 

p q 

1 


Gen frecv. 0,2 0,8 1 0,11 0,89 0,19 


Gen frecv. 

(exp) 

p 2 

2pq q 2 

p q 

1 


Gen frecv. 0,3 0,7 1 0,16 0,84 0,27 


Gen frecv. 

(exp) 

p 2 

2pq q 2 

p q 

1 


Gen frecv. 0,4 0,6 1 0,23 0,77 0,35 0,31 

• The amplification using B07 primer has not detected the variability at 

molecular level; 

H j 

93

94 



• The individuals average diversity from Gloria, Sigma şi Super is equal 

(Hj=0,31), all the individuals have the same level of variability; 

• Genetic variability within Coral genotype is very closed by Gloria, Sigma 

and Super genotypes, average diversity is Hj=0,32; 

• The smallest average diversity belong individuals from Satelit genotype 

(Hj=0,27). 

References 

The average diversity for each genotype 

No. Genotype average diversity 

1 Gloria 0,31 

2 Sigma 0,31 

3 Coral 0,32 

4 Satelit 0,27 

5 Super 0,31 

Table 3 

1. Flajoulot S, Ronfort J, Baudouin P, Barre P, Huguet T, Huyghe Cand Julier B 

(2005) Genetic diversity among alfalfa (Medicago sativa) cultivars coming 

from a breeding program, using SSR markers. Theor Appl Genet 111:1420- 

1429; 

2. Stanford EH (1951) Tetrasomic inheritance in alfalfa. Agron J 43:222-225. 

3. Michaud, R., Lehman, W.F. and Rumbaugh, M.D. (1988). World distribution 

and historical development. In: Alfalfa and Alfalfa Improvement, Hanson, A.A. 

(ed.). ASA, CSSA, SSSA Publishers, Madison, Wisconsin, pp. 25-91. 

4. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays 

with tobacco tissue cultures. 1962. Physiologia Plantarum, v.15, p.473-497. 

5. Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V., 1990, 

DNA polymorphisms amplified by arbitrary primers are useful as genetic 

markers, Nucleic Acids Research 18, pag. 6531-6535

THE USE OF BIOTECHNOLOGY IN NEW 

PHYTOHORMONAL TREATMENTS FOR PLANTS 

WITH THE AIM OF ACHIEVING NUTRITIONAL 

QUALITY AND A SUPERIOR PRODUCTION 

EVELINA GHERGHINA * , GABRIELA LUTA * , FLORENTINA 

ISRAEL ROMING * , DANIELA BALAN * 

*Dep. of Chemistry, Biotechnology Faculty, USAMV Bucharest, Romania 

Abstract: Plants, the green gold of mankind, represent the main food source 

for both human and animal, being at the same time the row material in some branches 

of the light industry. Fallowing this idea, plants must be studied and their value must be 

enhanced by complex means, depending on the constituting biochemical compounds, on 

the nutritional and technological potential that is provided. [3] 

Accompanying the obtaining of a new plant form of superior quality (lines, 

hybrids, sorts) it is necessary to apply the latest biotechnologies that imply real 

progress so that a superior nutritional quality of the plant is permitted, with low energy 

consumption and a great economic efficiency. 

Each part of a vegetable mechanism has its own specific job that contributes 

to metabolically processes, yet ensuring the plants functionality as a great whole. In 

carrying out worldwide "the green revolution” it is necessary to know the biochemical 

mechanisms that lie at the basis of biological phenomena in vegetable organisms, with 

the aim of influencing and directing, according to plant’s nature and the aimed goal, 

the biochemical processes in order to increase output of photosynthesis, enlargement of 

biomass, increasing the amount of proteins, glucide vitamins and other active 

substances.[5] 

The discovery of substances with regulating physiological action - 

phytohormones - has placed in the hand of specialists a sensitive efficient instrument, 

for leading and controlling the plant's development processes, of vegetable biology 

and biochemistry. In a future ecological agriculture that will keep in mind all the 

environment’s factors, the phitoregulators will be of great importance. The fact that 

phytohormones increase the efficiency in the use of minerals and fertilizers, determines 

the specialists to state the superiority of conducting the development of plants 

throughout bioregulators rather than using chemical fertilizers since bioregulators do 

not cause pollution. The phytohormons determine the plant's growth by intensifying the 

cellular division and by stretching the already existent cells. The mechanism throughout 

which the plants are brought up depends on the type of the phytohormone. [6] 

These reasons being given, the research regarding phytohormonal 

treatments in guiding the biocompounds accumulation metabolisms for plants with the 

aim of obtaining products and row materials in the food industry with superior 

nutritional qualities, represents research of great present interest in what concerns the 

quality of the alimentation and also from the economic perspective. [7]



Keywords: phytohormones, biocompounds, superior nutritional quality, 

economic efficiency. 

Material and method. 

The phytohormons determine the plant's growth by intensifying the 

cellular division and by stretching the already existent cells. The mechanism 

throughout which the plants are brought up depends on the type of the 

phitohormone. Auxins, gibberellins and cytokinins are growth promoters. [2] 

Auxins represent the first class of substances which stimulate the growth 

of cellular dimensions discovered by the most illustrating representative: indole- 

3-acetic-acid. The presence of auxins causes cellular elongation, noticing an 

increase of growth speed at extremely low concentrations, about 10 minutes 

since the treatment application. This amplification can be done by taking action 

over an enzyme as an allosteric effect or by stimulating their biosynthesis. [1] 

Elongation as an effect of auxin action can be caused firstly by the 

permeability modification of the cellular membrane. The growth induced by the 

auxin depends on the biosynthesis of structural substances, on the protein 

biosynthesis. Auxins are active in every stage of the plant’s growth and 

development. Auxins stimulate the germination, having a contribution in 

forming the plant’s organs, playing a role in some agrotechnical applications 

(such as seedlings make) by stimulating the root’s kneading. 

The high content of auxins from some organs keeps the tree’s budges, the 

potatoes tuber in a latent state. The auxin’s natural structure is illustrated in 

picture 1. [4] 

Fig.1: The structure of some natural auxins 

Indole – 3 – acetic acid Indole – 3 – propionic acid Indole – 3 – butiric acid 

During spring the auxin content in plans is reduced, under the stage of 

latency, causing the tuber germination, the budges appearance etc. In the case 

when plants blossom, the treatment with auxins stimulates this phenomenon. The 

sex of the flowers is influenced by the auxin-gibberellin ratio. 

96



The treatments with auxins increase the osmotic pressure of the cellular 

juice, the absorption of water and some ions, the Brownian movement. Auxins 

stimulate the hydrolisis of polyglucids and proteins, increase activity of 

peroxidase, invertase, phosphatase, phosphorylase by stimulating the ATP to 

splint into ADP and phosphoric acid. Auxins stimulate photosynthesis, migrating 

of the elaborated pith from the leaves to other organs of the plants. [1] 

Gibberellins are located in different cellular parts, in tissues and organs, 

being spread in all superior and inferior plants. Gibberellins are formed in large 

quantities in apical budges, young leaves, flowers and seeds, embryo and during 

seeds germination. Gibberellins biosynthesis in superior plants is a complex 

process which uses, at least in the first stages, common forerunners that are 

necessary for the biosynthesis of other terpenic substances. In picture number 2 

is presented the structure of the gibberellinic acid. [4] 

Fig.2 : 

The structure of gibberellinic acid 

Gibberellin 

Gibberellins influence the intensification of perspiration; stimulate the 

seed’s respiration during germination; they favorably influence photosynthesis 

by stimulating the phosphorylation and forming the phosphoric esters reactions, 

decrease the plant’s resistance in drought and intense heat conditions; play a 

role in delaying the ageing process in seeds and vegetal tissues; stimulate the 

content of asparaginase, methionine, tryptophan. [2] 

The biosynthesis of cytokinins takes place in the meristem tissues on the 

top of the roots of superior plants. Cytokinins appear to result from the 

intercellular condensation of adenine with a donor where the amine group is 

tied to the C-6 of the purinic nucleus. The reaction of condensation takes place 

under the influence of a specific enzymatic system. Considering the functions 

of the cytokinins, the regulation of the metabolic processes of growth and the 

development of vegetable organisms are due to the role played by cytokinins in 

the metabolism of nucleic acids, in the protein biosynthesis and in the activity 

of some enzymes. Cytokinins have an important role in the morphogenesis 

processes of plants, large concentrations stimulating the development of sprouts 

and budges, roots, the acceleration of development in floral organs, the 

alteration of the ratio between the female flowers and the male ones, 

97



fructification and the ripening of fruits. Plant ageing symptoms are closely 

connected to the diminution of cytokinin and of nitrate compounds. This is the 

way that cytokinins accomplish the inhibition of nucleic acids, proteins and 

chlorophylls. The chemical structures of common cytokinins are illustrated in 

picture 3.[4] 

Fig 3: Isoprenoid 


In biotechnological practice, the phytohormones are used in small 

quantities – by order of ppm – having a pronounced effect on plants’ growth 

and development processes, especially on young organisms, if they are applied 

during some specific phenomena and climate conditions. These characteristics 

will confer to phytohormones an important place in the agriculture of the future. 

Plant hormones are signal molecules produced within the plant, and occur in 

98



extremely low concentrations. Hormones regulate cellular processes in targeted 

cells locally or in other location in the plant. 

In the same time they have the ability of annihilating the effects of 

possible repressors that intervene in the growth mechanisms of plants Auxins 

represent the most used class of phytohormones in plant practice (picture 4). 

Fig 4 : The effect mechanism of auxin Fig 5: The mechanism action of 

auxin in plants 

In picture 5 is present the mechanism action of auxin in cell, cell wall and 

plasma membrane. 

Plants, unlike animals, lack glands that produce and secrete hormones. 

Plant hormones shape the plant, affecting seed growth, time of flowering, the 

sex of flowers, senescence of leaves and fruits. They affect which tissues grow 

upward and which grow downward, leaf formation and stem growth, fruit 

development and ripening, plant longevity and even plant death. Hormones are 

vital to plant growth and lacking them, plants would be mostly a mass of 

undifferentiated cells. 

Conclusion 

Under the chemical aspect, phytohormones are highly heterogenic 

micromolecular substances, similar to vitamins and animal hormones. They are 

composed of cyclical rings (indol, purine, iononic, gibanic and others), contain 

etherical bounds and different functional groups. They are largely spread in 

nature and they are found in the different tissues and organs of superior plants, 

99



in dregs, funguses, algae and numerous microorganisms both in a free form and 

in associations with proteins. 

● Regarding superior plants they are taken into consideration the main 

hormonal groups: auxins, gibberellins, cytokinin, abscisic acid and ethylene. 

Auxins, gibberellins and cytokinin are growth promoters and the abscisic acid 

and the ethylene are growth inhibitors. 

● Phytohormones cause plant growth by the intensification of cell 

division and by the elongation of existing cells. The mechanism of the growth 

of plants is influenced by the nature of the phytohormones. 

● Phytohormones influence the growth process and the morphogenesis, 

regulates the physiological processes that take place in different tissues and 

plant organs. They are synthesized by the cytoplasm of young cells and are 

accumulated in the growth areas of the stems and roots, seeds, pollen, budges, 

young tissues and other parts. 

● The hormones that control the processes of growth and reproduction in 

plants can be used by humans to produce rappidely large numbers of plants by 

stimulating the growth of roots from cuttings, regulate the ripening of fruits on 

the plant and during transport to consumers, and kill weeds by disrupting their 

normal growth patterns. 

● Growth phytohormones increase the efficiency of using fertilizers, 

therefore some specialists claim the superiority of the organic crops 

management under the influence of bioregulators against the use of chemical 

fertilizers, because phytohormones do not contribute to the pollution of the 

environment. 

References 

1. Davis, J.P. – Plant Hormones and Their Role in Plant Growth and Development 

- Routlege Introduction to Environment Science London, 1987 

2. Elliot & Elliot, - Biochemistry and Molecular Biology – Oxford University Press, 

1997. 

3. Ory, R.; Ritting, F., - Bioregulators – Chemistry and Uses – American Chemical 

Society, Washington, 1984. 

4. Paselk, R. – Biochemical Pathway Diagrams – Humboldt State University , 

International Student Edition, 1997. 

5. Prakash, C.S. - The Biotehnology and Development Monitor. - University of 

Amsterdam, 1994. 

6. Purchit, S. Editor, - Hormonal Regulation of plant Growth and Development - 

Routlege Introduction to Environment Science London, 1985. 

7. Wright, J. – Environmental chemistry - Routlege Introduction to Environment 

Science, London, New York, Routlege, 2003. 

100



A CONTRIBUTION TO INSIGHT OF THE MOST 

IMPORTANT ETIOLOGICAL FACTORS WITH 

INFLUENCE OF FARM ANIMAL HEALTH IN SERBIA 

BOJKOVSKI*, B.RADOJIČIĆ*, T.PETRUJKIĆ**, S. BOROZAN*** 

Abstract: In this lectures we represented results of our research from 1994 to 2008 

year.Our research done on dairy farms, sheep farms and swine farms. We have monitored 

presence of biological environmental contaminants (pathogenic bacteria), chemical 

environmental contaminants (heavy metals) and their influence on health status of animas on 

the large dairy cow, pig and sheep farms over the prolonged period of time. Also we monitored 

metabolic and reproduction disoders at dairy farms. Heavy metals are particularly hazardous 

for the living organisms, since their reacting with organic molecules leads to alteration of their 

structure and function. Heavy metals penetrate into the organism through the respiratory tract, 

gastrointestinal tract and skin.The results of a years-long study indicate presence of the risk of 

animal feed contamination by heavy metals and their deposition within the animal organism as 

well as their influence on reproductive capacity of the domestic animals.Toxicity of heavy metals 

generally leads to formation for free radicals through inhibition of the antioxidative defense 

enzyme activity as well as glutathione oxidation and production of malondialdehyde (MDA) as 

an oxidative stress marker. Their toxicity is also a result of their valiability to make covalent 

bonds with sulfhydryl groups of the biomolecules or displacement of certain cofactors, thus 

inhibiting activity of certain enzymes.Another part of our reserach was to find out if there was a 

change on hereditary bases in animals which lived in an enviroment with evidence of a high 

environmental polution. In achieving this main task, we exemined 161 bovines and 15 miscaried 

calf fetuses,with 40 bulls for breeding included in artificilal insemination,16 cows with 

identifieds 2 miscarriages,44 cows with reproduction disoders and inication sterility,21 cows of 

these cows offspring, 33 cows with transformed karyotype and 28 cows lived on localities with 

out contamination.We also examined karyotypes of 66 pigs,among which, there were 40 boars, 5 

maiden gilt, and 21 sows for breeding. Our recommendations for the industrial scale farms 

include application of measures aimed at reduction of risk associated with the effects of different 

pathogenic microorganisms, toxins, presence of certain physical and chemical environmental 

contaminants through introduction of multi-step monitoring of raw material and finished 

2 * Jovan Bojkovski,PhD professor, Biljana Radojičić,PhD,professor,Department of Farm Animal 

Disease. 

** Tihomir Petrujkić,PhD,professor,Department of Reoproduction, Fertility, and Artificial 

Insimination 

*** Suncica Borozan,PhD, Department of Chemistry, Faculty of Veterinary Medicine, Belgrade, 

Serbia. E-mail bojkovski@vet.bg.ac.yu 

Supported by Ministry of Science and Technological Development, project no. TP20110. 

101



products quality, as well as application of appropriate protectors against toxic effects of 

different agents. 

Key words: farm animals, pathogenic bacteria, metbolc disodres, 

reproductive disoders, heavy metals, hereditary bases, living environment 

Introduction 

Contemporary technology of farm animal breeding on large agglomerations 

has caused a large number of health-related problems (Bojkovski et.al 2006; 

Bojkovski and Radojičić, 2008). 

The paper is aimed at presenting the results of our studies carried out in the 

period 1994-2008. The studies performed in the above period were focused at 

monitoring of health status of calves, heifers in advanced stage of pregnancy, dairy 

cow breeds, sheep and swine. The second part of the study was aimed at 

determining whether the hereditary base of the farm animals living in the highly 

polluted environments was changed. The above studies included the analysis of 

karyotypes of high production dairy cows and swine originating from the highly 

contaminated terrains and terrains in which environmental pollutants were not 

evidenced. 

Health status of calves 

Diarrhea and respiratory diseases were the most commonly evidenced health 

problems in calves. On the controlled farms, the major problem during the winter 

season was related to digestive complications in suckling calves. Development of 

calf scour i.e., calf diarrhea was recorded. The most common etiological factors in 

the calves aged 15-20 days were E. coli. For example, out of the total of 1,469 

calves born on a farm during the single calendar year, 631 calves were treated for 

diarrhea during the whole year. Cl. perfringens was also evidenced on the same 

farm in calves above 20 days of age. Enterotoxemia is a peracute disease with 

frequently fatal outcome due to the exceptionally abrupt onset and short course 

(Ivanov et.al.2001, Bojkovski and Radojičić,2007.). The second health problem 

permanently present on our farms during the winter season is respiratory diseases. 

They mostly affect calves aged above 2 months. However, in one specific case 

respiratory organ disease was diagnosed during the winter season in calves aged 

only 20 days. 

Namely, respiratory diseases are rather frequent disorders in calves during 

their initial several months of life. In large number of cases they develop as a 

consequence of inadequate zoohygienic conditions, keeping conditions and 

102



complex synergistic effects of microorganisms, which become particularly 

prominent in case of reduced resistance of the calf organism to infections. The 

most common causative organisms on the dairy cow and cattle farms are BHV-I, 

Pi-3, BRSV, BVDV, P. multocida, Mannhemia haemolytica, 

Arcanobacterium pyogenes, and Haemophilus somni. In our specific case, 

we have isolated P. multocida, Staphylococcus aureus, E. coli, 

Pseudomonas aeruginosa and Aspergillus fumigatus. Introduction of adequate 

therapy and improvement of inadequate hygienic conditions led to elimination of 

the respiratory diseases during the following months (Bojkovski and Radojičić, 

2008). 

As for the technology of calves breeding, their alimentation during the 

initial several days of their life is exclusively based on colostrum and thereafter on 

milk. Thereafter, other types of feed are introduced in their alimentation to 

discontinue milk from their diet after three months. Colostrum is the only feed of 

calves in the initial days of their life. In addition to basic organic components, 

colostrum contains biologically active substances (numerous growth factors) as 

well as the substances such as lactoferrin, transferrin and certain hormones. In the 

prepartal period colostrum secretion concentrations of some ingredients and 

biologically active substances is significantly increased and may be higher than in 

maternal blood. Colostrum samples obtained before and after calving are used for 

determination of protein, lipid, lactose, calcium and phosphorus concentrations. 

Additionally, dry matter and electrochemical reaction were also determined in the 

colostrum samples. The obtained results evidenced absence of major deviations of 

concentrations of the studied parameters in the colostrum samples obtained before 

and after calving. The only difference that was evidenced was related to protein 

concentration, which was on the borderline of the statistical significance 

(x=138.54 +/-25.13:113.87+/-41.10g/L). Individual protein concentration values in 

the colostrum after calving vary more extensively in comparison to those 

evidenced before calving. Since the values of the majority studied parameters did 

not change significantly in the colostrum in the peripartum period, further studies 

should be focused on dynamics of variations of concentrations of individual 

fractions in the colostrum, however, it should be preferable for the studies to be 

performed on larger samples (Bojkovski et.al. 2005). 

Health status of dairy cows in advanced stage of pregnancy 

Current breeding technology of cattle on the large agglomerations has 

caused large number of health problems (Bojkovski and Radojičić, 2008, Fratrić 

103



et.al.2007). Most of the farms have the tie stall barn method of keeping of dairy 

cows, they are restrained and kept in the conditions with variable and inadequate 

dietary regimen. In such conditions, highly complex clinical picture with major 

health problems was present in all the controlled farms. Ketosis is one of the major 

health problems (Šamanc et.al.2001; Bojkovski and Borozan, 2007). 

Ketosis is a metabolic problem appearing in high-production dairy cows, 

most commonly during the third or fourth lactation, in the course of the initial 

calvings, i.e., in early phase of lactation (Djoković etl. al.2007a, 2007 

b).Development of ketosis is influenced by a number of factors, however in 

addition to physiologically low glycemia, inadequate energy intake necessary for 

early stage of lactation is a basic cause. Blood glucose is the major source of 

energy for a cow. However, glucose is easily fermented in the rumen. In case of 

insufficient energy, fat reserves are mobilized and excess of ketonic bodies is 

accumulated at the quantities that may induce disorders in the organism. In such 

cases, signs of ketosis develop: loss of appetite, body mass loss, reduced milk 

production, as well as nerve symptoms in more severe cases (Šamanc et.al. 2000, 

2001, 2005).Understanding of physiological and metabolic processes, as well as 

particular metabolic properties of ruminants that take place during pregnancy and 

lactation are of the particular significance for the science and alimentation 

practice, since in normal conditions, the food itself is a medium through which the 

organism is supplied with necessary nutritive substances necessary for meeting of 

the increased demands of the organism in the course of the above-mentioned 

physiological conditions. Therefore, the feed for high-production dairy cows must 

provide above all sound health and fitness of the animals, lactation for the period 

of approximately 300 days as well as greater number of lactations during the 

period of exploitation, maximum quantity of milk of the optimal chemical 

composition and birth of healthy and vital calves each year. In order to fulfill the 

above-requirements, dairy cow keeping and care conditions as well as health status 

and above all nutrition, must be adjusted to the maximum possible extent to the 

needs of the organism (meal adjusted with milk production) and brought to almost 

ideal level within the possibilities of the contemporary cattle raising (Radojičić 

et.al 2001,2007.). 

It has been well known that mistakes made in the last trimester of 

pregnancy become clearly visible in the course of early puerperium. 

Loss of energy associated with ketonic bodies (75% of energetic value) 

additionally contributes to energetic deficit. Therefore, the focus is currently 

placed on prevention of ketosis, particularly in case of inadequate diet. 

Summarizing the above considerations, it would be necessary to place the 

focus on alimentation owing to its significance in prevention and treatment of the 

104



metabolic disorders. Indeed, these conditions may be monitored by regular followup 

of the metabolic profile parameters that include certain analysis of the liver cell 

functional status assessment (glucose concentration, AST activity, total bilirubin 

and albumin) and based on valid interpretation of the obtained results, the liver 

may be protected using appropriate hepatoprotective agents and ketosis may be 

prevented (Radojičić et al., 2001; Radojičić et al., 2007). 

In case of higher milk production, which is the objective of dairy cow 

keeping, it would be necessary to provide to the animals material substrate from 

which biosynthesis of the milk ingredients will be made, which means dietary 

application of more expensive and quality concentrated feeds. 

Adjustment of the bulky and concentrated parts of the meal is an important 

moment in planning of cow alimentation, particularly in dry period and early 

lactation phase. Exceptionally high demands of high production dairy cows 

necessitate administration of the larger quantities of the concentrated feeds with 

consequential reduction of the raw fiber content. 

High quality hay (meadow hay, leguminose, mixtures) is a feed of choice 

that may be offered in quantities as desired by animals while concentrated part of 

the meal adjusted to production status should be divided in several parts in order to 

achieve more even carbohydrate intake into the rumen and their decomposition 

under the influence of microflora as well as to avoid or reduce the possibility of 

onset of rumen acidosis with all its consequences. This type of diet avoids onset of 

glycemic with concentrated feeds. 

Adjustment of the content of certain types of carbohydrates ingested by 

the animal with the feed is a particular problem in planning of the meals. The 

parameter that must be taken into account is daily consumption of feed, which is 

particularly problematic in stress conditions and drastic physiological changes in 

the course of advanced pregnancy, partus and early lactation . Generally, the meals 

should be tasty and attractive for the animal with preserved organoleptic 

properties, safe from the hygienic point of view and free of noxious admixtures. 

Unfortunately, application of rotten feeds or feeds that cannot be used in 

monogastric animals is frequently encountered in the practice. The control 

mechanism includes short-term control (conditioned by dilatation of the reticulum, 

rumen content pH value, quantity of volatile fatty acids and levels of some 

hormones such as insulin, glucagon and gastrin) and long-term control of 

consumption (physiological condition, nitrogen status, external environmental 

factors, photoperiodicity and seasonal variations, degree of production and total 

energy demands). 

However, abundant, imbalanced nutrition in the prepartal period leads to 

accumulation of the excess of the nutrients in the body deposits and the so-called 

fatty liver syndrome. In case of energetic deficit and consequential accelerated 

105



mobilization of the deposited fat, which is rather frequent in fattened cows, 

accumulation of free fatty acids in the blood and their depositing in the liver are 

rather rapid. High concentration of free fatty acids in the blood leads to loss of 

appetite, that is, the animal reacts with decreased consumption of feed, which 

results in energetic deficit with rapid wasting of the animals and even possible 

lethal outcome. Fatty acids are accumulated in the liver in the form of fatty 

infiltrations or hepatocyte degeneration. With this additional burden, the liver 

looses its functional activity, which contributes to onset of ketosis, that is, 

reparation and restitution processes in the hepatocytes are inhibited since complete 

cure is achieved only when the liver is released from the excessive fat, which is 

frequently very slow and long-lasting process. 

The condition is designated as puerperal hepatic coma and it is 

characteristic for the over-fattened animals in the prepartal period (Šamanc et al., 

2001). 

“Fatty liver syndrome” is therefore an example of energetic imbalance 

caused by excessive feed/energy intake and increased depositing of fats in the 

hepatocytes as well as in other tissues such as subcutaneous tissue, and therefore 

the term “fat cow syndrome” is frequently used. When the cow consumes highenergy 

meals in the course of the last lactation period and dry period, the fats are 

deposited. The condition influences difficult calving, placental retention or even 

development of metritis. When loss of appetite becomes manifest, accelerated 

mobilization of fats from the body reserves takes place followed by consequential 

formation of the ketonic bodies. The common characteristics of all breeding herds 

fed in this way are problems related to fertility, which are reflected in prolonged 

service periods and reduced conception rates. Breeding herds with long intervals 

between calvings, usually at the time of calving are found in cows in fattening 

conditions. Ketosis is in such situations one of the secondary diseases developing 

in such conditions, which necessitates certain therapeutic regimen (parenteral 

administration of glucose and glucocorticosteroids), which represents additional 

economic burden of the milk production. Therefore, metabolic profile should be 

determined at least two times a year – in the phase of advanced pregnancy and in 

early lactation, as a measure aimed at detection of subclinical ketosis (Šamanc et.al 

2000, 2001: Djoković et.al.2007a,b). 

The next health problem found on our cattle-breeding farms was 

fermentation disorder in the rumen (acidosis ruminis). In addition to the wellbalanced 

nutrition as an important factor, nutrition of the microorganisms in the 

rumen is also highly important. Amino acid and energy demands of the 

microorganisms as well as range of pH values in the rumen (physiological cutoff 

value rages from 5.5 to 6.8) should be also taken into account upon formulation of 

the best meals for the high-production dairy cows in lactation. Acidosis resulting 

106



from the excessive accumulation of the lactic acid is a fermentative disorder 

manifested in several forms depending on the extent of imbalance. Basically, 

rumen acidosis develops as a result of diet based on highly soluble carbohydrates, 

i.e., when the hay is rapidly decomposed in the rumen under the influence of 

microorganisms. If the animals are fed with this type of feed, i.e., energetic meals, 

for long period of time, acidosis may lead to lesions of the ruminal mucosa, that 

will enable to the secondary bacteria to cause ruminitis. The former may produce 

complications such as peritonitis, liver defect caused by penetration of the 

infectious agents into the circulation and consequential laminitis. Less important 

symptoms may also develop in the form of feed rejection that may be followed by 

overfeeding and subsequent development of atony of the rumen and accumulation 

of excessive fluid in the rumen. The former together with the excessive fluid in the 

rumen results in signs such as dehydration, reduced appetite, reduced milk 

production, decreased kidney contractions, occasionally dry dung that may be 

followed by diarrhea. 

Our aim should be prevention and establishing of balance of the 

microorganisms in the rumen content. This may be achieved by certain regimen of 

nutrition with defined quantity of feed offered in determined time intervals with 

avoidance of sudden changes to high-energy meals. Adequate quantities of the 

concentrate and quality roughages are necessary in order to fulfill the objectives 

(Bojkovski et.al.2006). 

Laminitis is aseptic inflammation of the hoof corium. In addition of 

mechanical overloading of the hoof, toxic causes and allergic etiology are also 

suggested as caused influencing development of the disease. Prolonged 

consumption of easily digestible concentrated feed, development of acidosis in the 

rumen, abrupt change of feed particularly to diet based on green barley, oats, 

freshly mown young leguminoses and intake of rotten feed may lead to the 

disease. 

Laminitis is frequently result of influence of numerous factors, such as 

metabolic and digestive disorders, puerperal stress, mastitis, metritis, absence of 

litter or insufficient litter, lack of mobility, over-fattening and poor management of 

nutrition. The meal that leads to acidosis also leads to laminitis, and it is hard to 

correct when the feed is mostly composed of carbohydrates. It is believed that 

vasoactive substances (histamine) that come into the blood stream from the rumen 

lead to lesions of the hoof corium, sparing of the leg due to pain and occasionally 

forced laying down. It is also believed that in addition to histamine, bacterial 

endotoxins, lactic acid and other biologically active substances contribute to onset 

of the disease. Quantity of the concentrated feed ingested by the animal in a meal, 

occasionally low pH value of the rumen content and onset of locomotory disorders 

all have common etiopathogenetic background (Šamanc et.al.2005). 

107



Reproductive disorders in high-production dairy cows 

The following reproductive disorders were evidenced: miscarriages after 

day 150, lack of estrus, small ovaries, cysts, inactive ovaries for more than 60 days 

postpartally and endometriosis. The so-called syndrome of infertility has been 

recently evidenced on the dairy cow farms. It has been known that increased need 

for insemination and prolongation of the cycle between the two calvings may 

become necessary in cows fed with feed rich in easily soluble proteins (17% of 

proteins with 75% solubility), which is also called syndrome of infertility. 

Increased content of ammoniacal nitrogen in the milk, urine and other body fluids 

is the result that needs increased number of inseminations. 

The recommendations should include reduction of accumulation of 

ammoniacal nitrogen as a consequence of nutrition with excessive quantities of 

proteins. Therefore, feed with high protein content, particularly easily soluble 

proteins, should be avoided and necessary quantities of energy should be assured 

(adjusted protein : energy ratio), which is a basic objective of the norms on which 

well adjusted nutrition is based (Petrujkić et.al 2001,2007.) 

Health condition of sheep 

In order to determine the influence of heavy metals on health condition of 

small ruminants, we have analyzed the content of heavy metals primarily in the 

feed consumed by the animals, as well as in the soil from which the feed was 

prepared. Ten sheep of Ille de France breed were randomly included in the 

experiment and they were kept on the farm in the vicinity of the industrial zone. 

The control group included sheep of the same breed kept at a farm out of the 

industrial zone (n=10). 

Concentrations of lead and cadmium in the feed and soil on the farm 

located in the vicinity of the industrial zone were the following: soil concentration 

of lead and cadmium: Pb = 16.7±0.02 mg/kg DS; Cd = 20±1.0μg/kg DS; 

concentration of lead in the feed was Pb = 2.5 ± 0.02 mg/kg DS while cadmium 

concentration in the feed was Cd = 20 ±1.0 μg/kg. Small quantities of arsenic and 

mercury were also evidenced (< 3 μg/kg DS). 

Presence of heavy metals, primarily cadmium, was also evidenced in blood sera 

of the sheep fed with the contaminated feed: Cd = 5.98 μg/L, while the sera of the 

control sheep contained significantly lower concentrations of the heavy metal – Cd 

= 1.08±0.28 μg/L. Toxic effects of the heavy metals was monitored based on the 

total activity of lactate dehydrogenase (LDH) as well as the activity of 

isoenzymatic form of LDH5. 

The total enzyme activity of LDH in the experimental sheep was 1176± 63 

U/L, while the total activity of the enzyme in the control groups was proved to be 

108



352±59 U/L. Statistically significant difference was established between the 

groups at the level of p



industrial zone was Ca = 3.04±0.07 mmol/L. The obtained values indicate onset of 

calcium absorption disorder and increased loss of calcium via the urine due to 

tubular lesion caused by cadmium. The mechanism of cadmium toxic effects on 

calcium metabolism in the bones has not been completely elucidated yet, however 

it is supposed that cadmium may have adverse effects on it. It is not clear whether 

these effects of cadmium on calcium metabolism are the result of renal 

dysfunction or the result of direct effect on calcium pathways in the kidneys and 

digestive tract (Borozan et al., 2004 a,c). In such conditions, reduced calcium 

reabsorption, bone demineralization and osteomalacia may develop as a result of 

renal defect. 

Increased cadmium concentration in the feed leads to kidney dysfunction, 

liver function disorder, lipid membrane lesions as well as to development of severe 

diarrhea (Borozan et al., 2005c) with carbohydrate and mineral metabolism 

disorders and reproductive disorders. Its presence leads to teratogenic, 

carcinogenic and mutagenic changes (Bojkovski and Borozan, 2007b). 

Health condition of swine 

On the intensive breeding swine farm of Landras breed located in the vicinity 

of the industrial zone we have monitored presence of heavy metals in feed 

samples, serum, parenchymatous organs (kidney, liver, spleen, heart, lungs) and 

boar semen. 

Presence of heavy metals (As, Cd, Pb, Ni, Cr, Hg) was established in both 

feed and other studied samples in different concentrations. Presence of the metals 

was determined in the sera of sows, boars, weaned pigs and pigs immediately 

before death. The contents of arsenic (22.4±2.4 nM/L), cadmium (90.05±25.13 

nmol/L), chromium (1.29±0.05 μmol/L) and mercury (8.38±2.15 nM/L) were 

approximately the same in all studied groups of animals (p>0.1), while lead 

content was different, being 1.84±0.23 μmol/L in sows, 4.83 ± 0.25 μmol/L in 

weaned pigs and 6.76 ± 0.9 μmol/L in pigs immediately before death. Targeted 

organs for the studied heavy metals were kidneys and liver in most of the cases. 

Difference in accumulation of heavy metals was evidenced depending on the 

animal age, as well as the risk for reproductive capacity of boars (Borozan et al., 

2002).The obtained results indicate that the metals were transported from 

circulation into the reproductive organs in boars, mostly lead (0.36 mg/kg), 

cadmium (0.013 mg/kg) and mercury (0.0021 mg/kg) (Borozan et al., 2003). 

Analysis of karyotype of bulls and high production dairy cows 

Our investigations related to assessment of health condition of cattle and swine 

also included karyotype analysis. Karyotype was history of miscarriages, 15 

110



aborted calf fetuses, 44 cows with reproductive disorders and signs indicating 

development of sterility and 21 calves to these cows, 33 cows with evidenced 

karyotype transformation and 28 cows originating from the regions free of 

environmental pollutants. Trisomy was evidenced in the analyzed aborted calve 

fetuses. Karyotype was analyzed in cattle with conception difficulties, 

miscarriages, delivery of defective offspring as well as with disorders of other 

physiological and productive characteristics. Presence of translocations and 

chromosomal inversions was evidenced in cows with proven karyotype 

transformation. Translocations 1/29 and 1/13 were evidenced in high- production 

dairy cows originating from regions contaminated with environmental 

pollutants(Bojkovski, 1994). 

Identification of chromosomal aberration carriers will indicate their 

exclusion from the reproduction program. Carriers of the hereditary anomalies 

most commonly have balanced karyotype changes, they are heterozygotic and 

thus, the aberrations are not observed on the phenotype and the consequences are 

observed on the offspring in the form of different disorders related to physiological 

and production characteristics. Karyotypes were analyzed in total of 66 swine, out 

of which 40 were breeding boars, 5 gilts and 21 breeding sows. Transformed 

karyotypes were evidenced in swine and they were characterized by presence of 

aneuploid cells and cells with structural chromosomal aberrations of the 

monochromatid type. The analyzed swine originated from the regions 

contaminated with environmental pollutants and they had the signs in the form of 

conception difficulties, miscarriages, delivery of defective offspring and disorders 

of other physiological and production characteristics. 

Cytogenetic methods enable detection of carriers of hereditary anomalies 

with normal phenotypes and the changes are spreading in the population. 

Detection of the carriers is particularly important within the artificial insemination 

programs (Bojkovski and Petrujkić, 1998; Bojkovski et.al. 1999). 

Conclusions 

The objective of the prevention of the fatty liver syndrome and ketosis is 

provision of adequate meals not excessively rich in energy in order to prepare 

microorganisms in the rumen for meals that will follow in the period of lactation. 

Accordingly, cows in the dry period should be offered 2-3 kg of the feed two 

weeks before calving. After calving, the concentrate quantity should be increased 

by 1 kg/day for the purpose of reduction of fluctuation of microorganisms that 

may appear in the course of change of concentration of feed as a result of high 

demands in early period of lactation. It would be desirable to maintain the interval 

of 12-13 months, i.e., one year/calf, between calvings, to separate cows in dry 

111



period from the lactating heads in order to reduce the possibility of onset of the 

“fatty liver syndrome” and maintain high lactation. It is also necessary to perform 

regular follow-ups of the metabolic profile parameters in order to control 

neuroendocrine metabolic balance and functional status of the animal. 

Our recommendation for the industrial type farms is to apply measures 

aimed at reduction of risk of adverse effects of heavy metals, to introduce 

multilevel monitoring of row material and finished products as well as to apply 

appropriate protectors against toxic effects of these agents. 

Currently, veterinary service has a highly important role, particularly from 

the environmental point of view. We are constantly faced with the question how to 

produce the highest possible quantity of the food, but safe food intended for 

human consumption. Therefore, health protection program of farm animals more 

based on prevention than therapeutical measures may lead to fulfillment of the 

concept “from field, through barn to table”, that will include profitable production 

as well as multilevel control of health, particularly with respect to possible toxic 

agents 

References 

1. Bojkovski,J.: Envrionmental influence of karyotype variations in mamals. 

Doctoral disertation, Faculty of Veterinary Medicine, Universtiy of Belgrade, 

1994. 

2.Bojkovski, J., Petrujkić, T. : Cytogenetic analyses of cows from Velika Plana 

and Kopaonik regions, Rev.Rom.Med.Vet. 8, 1, 1998, p.79-82 . 

3.Bojkovski,J., Dobrić, Dj.,Erski-Biljić Milanka,Palševski,B., Zakarija Dolores.: 

The infulence,of polluted environment on diffrent types of translocations and 

chromosome fragments cows with reproductive disoders , Macedonian Journal of 

reproduction, 5,1, 1999, p.85-96. 

4.Bojkovski,J.,Sunčica,Borozoan.,I.Jožef.,H.Šamanc.:Colostrum ingredients 

befeore and after calving in Holstein-Frisian Cows, Veterinary Record, 

4;156(23):2005, p.744-5 . 

5.Bojkovski,J.,Radojičić Biljana,Petrujkić,B.: Recent aspects in diagnostics and 

therapy of upbringing diseases of pigs, Proceedings workshop „Clinica 

veterinaria“Ohrid, 3-7.9.2006, p. 251-257. 

6.Bojkovski,J.,Djoković,R.,Borozan Sunčica,Pudlo,P.: Contribution to the 

knowledge klinical pathology rumen high yielding dairy cattle,Contreproary 

Agriculture, 56,3-4, 2006.p.80-86 

112



7.Bojkovski,J., Borozan Sunčica.: Temperature values by dairy cows in 

puerperium, Conteproary Agriculture, 56, 3-4, 2007a, 75-79. 

8.Bojkovski,J.,Borozan Sunčica.: Influence of heavy metals on healthy condition 

of domestic animals(sumary of research).Vetrinary Journal of Republic of Srpska, 

7,1, 2007b,p.12-19. 

9.Bojkovski,J.,Radojičić Biljana .: Health and Health status of farm 

animals.Veterinary Journal of Republic of Srpska.vol. 8,br. 1, 2008,p. 34-43. 

10.Bojkovski,J.,Radojičić Biljana.:The most common pathogenic causes of 

diseases in dairy breed cattle, Book of abstracts 2 

113 

nd Congress of veterinariens of 

the Republic Srpska (Bosnia and Herzegovina) with international 

participation,2007, p.85-87. 

11.Borozan,Suncica.,Bojkovski,J.,Matić Valerija.: Influence of heavy metals on 

health status weaned piglets. Metal elements in environmrnt, medicine and 

biology tom V 2002,p. 103-105 . 

12.Borozan Sunčica,Gadjanski-Omerović Gordana, Bojkovski,J.: Nephrtoxic 

effects of heavy metals in small ruminantas, Metal Elements in Enviromernt 

Medicine and Biology, Tome VI 2004a,p 149-156. 

13.Borozan,S.,Gađanski-Omerović Gordana,Bojkovski,J.,Stajković,S.: 

Clinical aspects of the effects of ROS-caused impairments of hepatocites, 

The 5 Midddle-Europian Buiactrics Congress.XV. Magyar Buiatrikus Kogresszus, 

Jun,2-5,2004b,p.551-555. Hajduszoboszlo,Hungary. 

14.Borozan,S.,Matić,V.,Bojkovski,J.,Vujanac,I.: Heavy metals nephrotoxicity, The 

5 Midddle-Europian Buiactrics Congress.XV. Magyar Buiatrikus Kogresszus, 

Jun,2-5, 2004c, p. 556-561. Hajduszoboszlo,Hungary. 

15.Borozan Sunčica, Bojkovski, J.,Janković,D.,Valerija Matić.:Presence of heavy 

metals,blood and semen in boars, Conteproary Agriculture, 52, 3-4, 2003, p.195- 

199. 

16.Djoković,R., Šamanc,H.,Bojkovski,.J.,Borozan Sunčica,Bošković- 

Bogosavljević Snežana .: Morphological and functional condidtions of 

hepatocytes by dairy cows in early lactation.Conteproary Agriculture, 56, 3-4, 

2007a, 92-97. 

17. Djoković,R., Bojkovski,J., Borozan Sunčica.:Laboratories and clinical method 

for diagnostic of liver diseases in dairy cowsVeterinary Journal of Republic 

Srpska,vol.VII,no2, 2007b, p.257-263. 

18. Fratrić Natalija, Ilić, Vesna, Bojkovski,J: Complex in the blood sera from 

leucotic cattle, Veterinary Journal of Republic of Srpska,vol.VII, no2, 2007, 227- 

229. 

19.Ivanov,I., Janković, D.,Šamanc, H., Bojkovski, J.:(2001)New treatment of the 

therapy and prophilaxis of calves diarhea.The third symposium Animal Clinical



Pathology and Therapy,Clinica Veterinaria, Budva, 11-15, jun, 2001.Book of 

abstract p. 137-141. 

20.Petrujkić, T., Bojkovski, J., Vuković, D., Šamanc, H., Raketić, V.:Cytogenetic 

studies of aborted bovine fetuses and bovine reproductive disturbances carried out 

in six regions in Serbia, Timsora Symposium ''Progress in Veterinary Pathology'' 

organized at Faculty of Veterinary Medicine. Timsora, 2-24 May,1997. Romania. 

21.Petrujkić,T.,Bojkovski,J.,Mrvoš,G.: Fertility control through the observation of 

reproduction parameters and puerperium in cows.Veterinary Journal of Republic 

of Srpska,vol.1, no. 3, 2001. p.119-123. 

22.Petrujkić,T.,Bojkovski,J.,Radojičić Biljana, Petrujkić,B.:Control of 

reproductive and health status of high productive swine in intensive breeding. 

Veterinary Journal of Republic of Srpska,vol. 7, no. 1, 2007. p.20-29. 

23. Radojičić Biljana, Bojkovski,J., Janković,D.: Some biochemical parameters in 

metabolism of high quality dairy breed cows, Veterinary Journal of Republic of 

Srpska no.1.2001.p.31-35. 

24.Radojičić Biljana, Djuričić,Bosiljka, Matarugić,D., Kasagić,D. : The 

importans of haemotologiy-biochemical analyses in the differential diagnostic of 

dairy cattle II Congress veterinarians of Republic of Srpska, Veterinary Journal 

of Republic of Srpska, Vol.VII No 2. 2007, p..128-133. 

25.Šamnc,H.,Nikolić,Anna,J.,Djoković,R.,Kovačević,Mira.,Damnjanović,Z.,Ivano 

v, I., Bojkovski,J.: Relation Between peripheral hormone levels and liver 

morphology in healthy and ketotic postpartal cows. Lucari Stientifice,Medicina 

veterinaria, Vol. XXXIII, 2000, p. 25-28. Timisoara 

26.Šamanc, H., Bojkovski, J., Ivanov, I., Damnjanović, Z., Janković, D., Pavlović, 

D. The influence of Predef 2x on glycemia and thiamine status in ketotic cows. III 

Middle - European Congress for Buiatrics Health. Problems in Ruminants, Ceska 

Republika. Book of Reports,2001,p.131-133. 

27. Šamanc H., Adamović,M., Vujanac,I, Bojkovski,J: Role of acid indigestion 

in ethiopathogenesis of aseptic pododermatitis in cattle, Symposium “Nutrition, 

Reproduction and Healthcare of Bovine”, 2005,p. 307-313. Subotica. 

114



DIFFERENTIAL DIAGNOSTIC OF NEUROLOGICAL 

DISORDERS TO SUPPORT SURVEILLANCE PASSIVE 

PROGRAMME OF TRANSMISSIBLE SPONGIPHORM 

ENCEPHALOPATHIES (TSE) IN THE RUMINANTS 

BILJANA RADOJIČIĆ, J. BOJKOVSKI, B. DIMITRIJEVIĆ 

Abstract: Regulation (EC) No 999/2001 lays down the rules of the monitoring for TSEe 

within the European Community based on active and passive surveillance which included 

a screening procedure using rapid tests. In preparation for the new call for an expression 

of interest for TSE test to be launched by the EC the EFSA was requested to update the 

current protocols for such evaluation, taking into account the experience in past 

evaluation rounds. The first protocol for a field trial for evaluation of BSE test for live 

animals adopted in July 2004. (EFSA, 2004), for one ante-mortem test. In the meantime 

the European epidemic of BSE entered a significant decline, but review of TSE 

surveillance programmes may now be envisage. For the second half of 2007, the EC 

plans to launch a new open call for expressions of interest for companies to submit tests 

for evaluation and potential approval to be used within the framework of EU wide TSE 

monitoring. These developments present serious challenges to the further evaluation and 

approval of live-animals test, is intended to provide guidelines for test developers for the 

conduct of the preliminary stages of an evaluation process, prior to submission for 

formal evaluation. The intended use of diagnostic test is very important as the key 

parameter for risk management is the predictive value of a test, is a function of 

prevalence and its diagnostic sensitivity and specificity. The predictive value of a positive 

test is determined by diagnostic specificity which is the key parameter to define in low 

prevalence situations such as screening for TSE monitoring and surveillance purposes. 

The criteria established for the evaluation of live animals especially with critical 

neurological sign (clinically-affected animals, BSE or scrapie), in cattle materials is 

fluids: serum, plasma, whole blood, buffy-coat, urine and CSF, but in sheep fluids/tissues 

serum, plasma, whole blood, buffy-coat, urine and biopsies of lymphoid tissue 

(pharyngeal tonsil or recto-anal mucosal lymphoid tissue, for differential diagnostics for 

thorough test determination of test potential. In this away in our several cases in the 

cattle Holstein breed, with neurological signs we are determined secondary 

encephalopathies (metabolic or toxic origin, and two cases of Listeriosis). Defined 

performance criteria should ensure that such test could be of sufficient interest for their 

potential consideration as tool that could be integrated in the global strategy for TSE 

monitoring, important for market and for good collaboration especially between in the 

neighbor countries. 

Key words: Transmissible spongiform encephalopathies (TSE), Bovine spongiform 

encephalopathy (BSE), passive surveillance, ruminants 

Prof. dr Biljana Radojičić; Assoc. prof. Jovan Bojkovski; DVM Blagoje Dimitrijević, Departman for 

ruminants and swine diseases, Faculty of veterinay medicine, Belgrade, Serbia , e-mail 

biljanar@vet.bg.ac.yu 

115

Introduction 

Most the BSE cases have been diagnosed in 4 to 6 years old cows, more freqent 

in dairy cattle but this may reflect the differences in feeding practices and life span. 

The main risk factor for BSE is still belived to be the feeding of contaminated 

feedstuffs. 

Defined performance criteria should ensure that such test could be of sufficient 

interest for their potential consideration as tool that could be integrated in the 

global strategy for BSE monitoring. In the meantime the European epidemic of 

BSE entered a significant decline. As stipulated in the TSE Road map (EC 2004) a 

review of TSE surveillance programmes may now be envisage. 

Appropriate negative controls it is not always possible to acces samples from 

appropriate control animals. Actuelly, parallel of BSE and new variant Creutzfeldt 

Jacob disease (BSE/vCJD) is very significant for human health, especially in the 

countries with high risk about BSE (Zeindler, Ironside 2000). 

Such control include uneexposed animals, and this is particularly important for 

time-course studies where tests may otherwise be detecting changes arising from 

ageing or metabolic disturbance. In such circumstances breed, management and 

sample collection positive donors. It is also important that where test materials 

have been stored prior to use storage conditions for positive and control animlas 

should be identical or as close as is practicable in order to avoid the effects of 

detorioration while in store. 

Live animal test means any test that can be applied to tissue or fluid collected 

from an animal while still alive and tested to establish its infections status. This 

may be at clinical stage of disease or at any stage of incubation from infection to 

clinical onset. 

In the cases of neurological disorder with clinical picture (senso-motoric signs) 

have pattern-muching models for recognized or excluding BSE in the live animals. 

That blood, blood serum, urine and CSF as set-test model (Radojičić Biljana, 

Bosiljka Đuričić 2001; Radojičić Biljana, Dimitrijević 2006). In Serbia, yet we not 

have good monitoring about BSE in live animals, but we have intenssive import of 

pregnance heifers in the countries witch high level risk of BSE. However, we must 

fast provided passive control especially into imported animals, as achevied strong 

measures of active control in the cases with neurological signs. In periods between 

10 investigated years, several cases with neurological signs we postulated 

secondary encephaloptahy, and two cases of Listeriosis in the cattle, for decide 

diagnosis in the part of monitoring of BSE (Radojičić Biljana, J. Bojkovski 2005; 

Radojičić Biljana, Dimitrijevic 2006).



Clinical picture of BSE 

In the clinical signs of BSE must be changes ruminantion, decrease in milk yield, 

decreased senzitivity to xylasine (Braun et al., 1999), heart rate and blood pressure 

changes, paradoxical bradycardia 46 to 50 per minute (Austin AR. at al., 1999). In 

the extitatio or stress with tachycardia and very different neurological sensomotoric 

signs, entitled neurological syndrome was expressed (Austin AR, et al., 

1993). 

Cockrcoft PD. (1999) postulated pattern muching model for recognising critical 

clinical neurological sign, with high percentages to established diagnosis of BSE. 

Also, Braun et al. (1999) improved certain changes of behaviour, senzitivity and 

locomotion in clinical examination in the cattle for recognised BSE case . 

Development of clinical picture is rapid, and day by day increased intenssive 

respond (applied touch, sound and light), in clinical examination in live animals, 

how significant important for determined status of prevalence or suspect diagnosis 

about BSE. Postural and locomotion disturbances are often mild or absent in aerly 

BSE case (Braun et al., 2004). 

The exact onset of BSE may be difficult to determine because of the unspecific 

nature of the prodromal and early clinical signs. BSE typically begins insidiously 

and the progression from prodromal signs to overt clinical disease my take weeks 

to months. In the early stages of BSE needed observation several days: seaparation 

from the herds, dullness, and bullying are also best seen during observation of the 

animals. 

Another factor that impacts on the detection of BSE is the degree of awareness 

of the clinical signs of BSE. In spite of the large overall number of cases seen over 

the years BSE remains a sporadic and rare disease that is encountered only rarely 

(if at all) by individual farmers and veterinarians. Such adverse changes might be 

an unmanageable behaviour (kicking in the milking parlour), weight loss, decrease 

milk production, or recumbency (the latter likely to have resulted from an injury in 

a fall caused by an undetected neurological deficit). Challenges that may enchance 

the expression of the clinical signs of BSE are any procedures that are not familliar 

to the animal such as restraint or confinement in handling stocks for examination, 

blood sampling or movement to unfamilliar territory. Ii some case this can be even 

achieved by exposing the animal to an enexpected object in its familliar 

environment. 

Also the stresses of transportation, parturition or concurrent illnesses may 

precipitate the onset and/or the progression of BSE. Early in the epidemic stages it 

was shown that at least one of the three most typical signs of BSE, apprehension, 

hyperaesthesia or ataxia was identified in 97 % of 17,15 cases (Wilesmith et al., 

1992)



The hyper-reactivity of BSE cases to certain enviromental clues or external 

stimuli often described under term „hyperaesthesia“ and with used tactile stimuli 

and Stick test (head or neck) is touched and decrease caudally. Also quick and 

forceful „ballistic“ kicking of the hind limbs wich sometimes repetitive and often 

leads to early drying off. Excessive and asymmetrical ear movements, head and 

neck shaking, sneezing, snorting, excessive nose licking, bruxism (tooth grinding), 

tremors, agitated beheviour, excessive vocalisation, unusual hiding, over reaction 

to visual and auditory stimuli, sudden jerking movements to limbs, body parts or 

whole body (startle). 

The unpredicatable kicking anu other exaggerated reaction of BSE cases make 

them difficult and often dangerous to handle. Unfamiliar surroundings or handling 

in particular when accompanied by suden movements may provoke panic reaction. 

Animals may also stop startle, tremble or become nervous when coming to cross a 

previously familiar line on the ground. BSE cases may also display unprovoked 

aggression towards other cattle. Ataxia and hypermetria, may be present in addition 

to spasticity. Progressive neurogenic gait deficits may eventualy lead to 

recumbency. 

Neurological disease that may be confused with BSE 

That several disease of CNS: hypomagnesiemia, nervous acetonemia, leads 

poisoing, listeriosis and chlamidiosis and baiut liste infectious disease od CNS 

how secondary encephaloptahy (passive control of BSE) is very important for 

differential diagnosis and monitoring of BSE (Radojicic Biljana et al., 1997; 

Radojičić Biljana 1998; Radojičić Biljana, Dimitrijević 2006). The today as many 

countries was postulated suspect diagnosis or prevalence of BSE in this away 

(EFSA 2007). 

Metabolic disorders: 

hypomagnesaemia, hypocalcaemia, nervous ketosis, hepatic encephalopathy, 

Nutritional: 

polioencephalomalacia or thiamin (vitamin B1) deficience, copper deficience, 

Viral: 

MCF, Rabies, Borna disease, Tick encephalitis, Aujeszky disease: 

Bacterial diseases: 

Listeriosis, Chlamidiosis, abscess, Salmonellosis, 

Parasitic: 

cyst of migration (sarcocystis, coenuriasis), 

Fungal: 

aspergillosis, cryptococcosis, ext.



Toxic syndromes: 

Tetatuns, Botulism, Micotoxicoses, Mercury poisoing, Lead poisoing, Salts 

poisoing 

Other: 

Traumatic injuries and Degenerative disorders 

Ancillary tests 

No changes has been identified in BSE cases on routine haematology, 

biochemistry or citology of the blood, urine and CSF. But several anlaysis may be 

relevant for excluding or recognised BSE in earlyer stage. That analysis of 

bilirubin, magnesium in the blood sera, acetobodies in the urine, and complet 

haemogram is very important for differential diagnosis of three some frequence 

secondary encephalopathy (hypomagnesiemia, nervous ketosis, and leads toxic) in 

relationship of BSE case (Radojičić Biljana 1998; Radojičić Biljana, Dimitrijević 

2006; Radojičić Biljana 2008). 

Special test on CSF have been the object of various studies the CSF not yet clier 

for diganosis of BSE, did not appear to distinguish between healthy cattle and 

cattle displaying early signs of BSE (Scott et al., 1990; Green et al., 1999). 

Differential diagnosis 

It is well knovn that abscence of a diagnostic test to confirm BSE in live 

animals, BSE suspects must be killed to proceed post mortem diagnosis. But in 

aerly BSE cases clear neurological signs may be absent or clinical signs may be 

common to BSE an many other diseases. Treatment of other potential causes of 

illness may take place. Teststing and blanket therapy may be indicated depending 

on the severity of signs and prognosis for recovery, a list of main neurological 

diseases and extraneural diseases. Once a suspicion of BSE has arisen, the BSE 

suspect must be placed under restriction and monitored for a progression of the 

signs. Restriction is maintanied until the animal either fully recovers (from another 

diesease than BSE ) or killed and tested for BSE. 

Clinical diagnosis criteria 

Estimation of BSE or pevalence and assessment ot the BSE status in a 

country is largely influenced by the degree of surveillance for BSE. Cattle 

displazing neurological disease or cattle with condition tha require emergency 

slaughter belong to ther highest risk group for BSE and it is important that these 

cattle are examined for presence of signs associated with BSE. 

Also, this away is important for threed countries, especially thay have imoprt in 

the countries with high BSE risk how cases is with Serbia (Radojičić Biljana 2006; 

2008) 

Cases reported as supsects 

Various clinical procedures have been proposed to detect BSE in live cattle. 

Generally that cattle exhibit signs of behavioural, senzory as well as locomotor



abnormalities are most likely to have BSE. The presence of changes in only one or 

two categories (animal that has become nervous without other signs; an ataxtic 

animal that is easy to handle) makes the clinical diagnosis more difficult. In these 

cases testing the response to external stimuli may be useful to support the clinical 

suspicion of BSE. Cattle with BSE are more likely to respond abnormally to a least 

two or four tests to hyper-reactivity (Konold et al., 2004). 

BSE may be more difficult to diagnosis in recumbent cattle beacuse the gait 

cannot be evaluated and over reactivity to external stimuly may not be evident, in 

particular in endsatge disease where cattle may be dull or stuporous. In this cases 

the clinical history is extremly imoprtant beacuse behavioural or locomotor 

changes may have existed prior to recumbency (recumbent and causalty of 

slaughter cattle). 

Conclusions 

The predictive value of a positive test is determined by diagnostic 

specificity which is the key parameter to define in low prevalence situations such 

as screening for TSE monitoring and surveillance purposes. The criteria established 

for the evaluation of live animals especially with critical neurological sign 

(clinically-affected animals, BSE or scrapie), in cattle materials is fluids: serum, 

plasma, whole blood, buffy-coat, urine and CSF, but in sheep fluids/tissues serum, 

plasma, whole blood, buffy-coat, urine and biopsies of lymphoid tissue (pharyngeal 

tonsil or recto-anal mucosal lymphoid tissue, for established differential 

diagnostics for thorough test determination of test potential. Also, any recumbent 

animal with abnormal positioning of the limbs should be treated as BSE suspect, in 

particular if they display over-reactivity to external stimuli. Cattle presenting with 

at least four of the seven signs aggressiveness, tooth grinding, staring eyes, 

reduced rumination, recumbency or difficulty getting up and over-reactivity should 

be regarded as BSE suspects. In the cases of other neurological diseases 

(Listeriosis, Chlamidiosis ext.) and disorders (secondary encephalopathies) is 

possible defined performance criteria should ensure that such test could be of 

sufficient interest for their potential consideration, as tool that could be integrated 

in the global strategy for TSE monitoring, with high importance for market and for 

good collaboration especially between in the neighbor countries. 

References: 

1. Austin, AR., Simmons, MM.: Reduced rumination in bovine spongiform 

encephalopathy and scrapie, Vet. Rec. 1993, 132:324-325. 

2. Austin, AR., Simmons, MM., Wells, GAH.: Pathological temperament in bovine. Irish 

Vet. Journal 1997, 50:304-308.



3. Braun, U., Pusteria, N., Schicker, E.: Bovine spongiform encephalopathy: Diagnostic 

approach and clinical findings. Comp. Cont. Educ. Pract. Vet. 1998, 20:S270-S278. 

4. Braun, U., Abgottspon, S., Gubler, E., Schweizer, T.: Decreased sedation by xylasin 

and high blood pressure in cows with BSE. Vet. Rec. 1999, 141:352-357. 

5. Braun, U., Gerspach, C., Ryher, T., Hauri, S.: Pacing as a clinical sign in cattle with 

bovine spongiform encephalopathy. Vet. Rec. 2004, 155:420-422. 

6. Bruce, ME., Boyle, A., Cousens, S., McConnell, I., Foster, J., Goldmann, W., Fraeser, 

H.: Starin characterization of natural sheep scrapie and comparison with BSE . J. 

Gen. Virol, 2002, 83: 111-122. 

7. Cockcroft, P.D.: Pattern-matching models for the differential diagnosis of bovine 

spongiphorm encephalopathy. Vet. Rec., 1999, 144, p 607-10. 

8. EC (European Commission) European Commission, DG Health and Consumer 

Protection, DG Sanco. TSE road map: a reflection paper providing an outline of 

possible future changes to EU measures on BSE in the short, medium and long-term, 

EC 2004. 

9. EFSA: Scientific Report of the European Food Safety Authority on Transmissible 

Spongiform Encephalopathy (FSE) on a request from the European Commision on the 

evaluation of rapid ante mortem BSE test. The EFSA Journal 2006, 1-14. 

10. EFSA: Scientific Report on the Design of a Field Trial Protocol for the Evaluation of 

BSE Tests for Live Cattle, The EFSA Journal, 9, 1-8, 2004. 

11. EFSA: Protocol for a preliminary evaluation af ante-mortem TSE tests for ruminants, 

The EFSA Journal 2007, 540, 1-12. 

12. Green, AJE, Jakman, R., Marshall, TA, Thompson, EJ.: Increased S-100b in the 

cerebrospinal fluid levels of 14-3-3 in predicting neurodegeneration in confirmed BSE 

symptomatic cattle. Vet. Rec. 1999, 145:107-109. 

13. Konold, T., Bone, G., Ryder, S., Hawkins, SAC., Courtin, F., Berthelin-Baker, C.: 

Clinical findings in 78 suspected cases of bovine spongiform encephalopathy in Great 

Britain, Vet. Record, 2004, 155:659-666. 

14. Radojičić Biljana, Bosiljka Djuričić, S. Marković: Advanced of bovine spongiform 

encephalopathy in clinical diagnostic. Proceeding 4. Savetovanje veterinara Republike 

Srpske, Teslić, Banja Vrućica, 10-14 juni, 1997, 143-47. 

15. Radojičić Biljana: Differential diagnosis of bovine encephalopathy, 6th Congress of 

Mediterranean Federation for Health and Productione of Ruminants, Postojna, 

Slovenija, Proceeding Programme and book Abstract, 1998, 10/2-0. 

16. Radojičic Biljana, Djuričič Bosiljka: Epidemiological importance of prion infectious 

control, Veterinary Journal of Republic of Serpska, 2001, No 1, 1-2, p 30-34. 

17. Radojičić Biljana, J. Bojkovski: Aetiopathogenesis and diagnostics of diseases of 

central nervous system in ruminants especially with emphasis of Bovine Spongiform 

Encephalopathy. Veterinarski glasnik, Vol. 59, 2005, 1-2, 201-209. 

18. Radojičic Biljana, B. Dimitrijević: Diagnostic reliability of clinical examination for 

recognising or excluding of Bovine Spongiform Encephalopathy (BSE). 7th MEB 

Congress, Radenci, Slovenia, Slovenian Vet. Research , 29. 03. to 01. 04. 2006. Suppl. 

10, Vol 43, p 105-108.



19. Radojičić Biljana: Clinical diagnostic of cloven footed domestic animals „Naučna 

KMD“ Beograd, 2006; 2008 ( I and II ed.) ISBN 978-86-84153-76-2. 

20. Scott PR., Aldrige BM., Clarke M., Will RG.: Cerebrospinal fluid studies in normal 

cows and cases of bovine spongiform encephaloptahy, Br. Vet. Journal, 1990, 146: 88- 

90. 

21. TSE EU Community Reference Laboratory, august 2007. p 1-23. 

22. Wilesmith, JW., Hoinville, LJ., Ryan, JB., Sayers, AR.: Bovine spongiform 

encephalopathy aspects of the clinical picture and analyses of possible changes 1986- 

1990. Vet. Rec., 1992 130: 197-201. 

23. Zeidler, M., Ironside, J.W.: The new variant of CJD. Revieu Scientifique et Technique 

de L Office International Epizooties, 2000, 19, 98-120. Acknowledgement: This 

study was supported by Ministry of Science and Technology of Serbia, TP- 20142



EFFECT OF LACTIC BACTERIA ON CORN STEEPING 

M. MIRONESCU ∗ , C. GEORGESCU 3 , V. MIRONESCU ∗∗∗ 

Abstract: In this research, the influence of the addition of lactic bacteria in small 

quantity (0.2 g/l) on the steeping parameters (pH, acidity and soluble substances in 

steep water and dry substance in grains) is investigated. The Jointec B and Jointec E 

starter culture (Streptococcus thermophillus ST and Lactobacillus delbrueckii ssp. 

bulgaricus LDB in different rapports) are used for these investigations. The results 

show that the addition of lactic bacteria starter culture has a small, but significant 

influence on the steeping parameters, depending on the two cultures used. The 

results obtained at the analysis of pH variation during steeping indicates that the 

main difference between the two cultures used could be the rapport between the two 

component bacteria: Jointec B has a larger amount of LDB and gives a higher 

increase of pH, whereas Jointec E (with more ST) shows no significant changes 

compared with the blind sample. At the use of Jointec B, water uptake inside the 

grains is more difficult, but the elimination of soluble substances in steep water is 

better as the blind sample and at the use of Jointec E. 

Keywords: corn, steeping, lactic bacteria 

Introduction 

At the starch production, corn grains are first digested during steeping to soften 

and swell them for the separation of germ from the other components in the next 

step, at wet milling (Ji et al., 2004). This step is capital-intensive and timeconsuming 

(24 to 52 h). The efficiency of the steeping operation depends on the 

rate of diffusion of steep water and on the disintegration rate of the protein network 

around the starch granules (Pérez-Carrillo and Serna-Saldívar, 2006). The 

industrial solution is to realise the steeping in dilute aqueous SO2 solution at subgelatinization 

temperature (45–55°C). Traditionally, steep water contains 0.1-0.2% 

sulphur dioxide to promote starch-protein separation and high starch yields, and to 

control microbial growth (Ruar et al., 2004). 

∗ Dept. of Food Biotechnology, Faculty of Agricultural Science, Food Industry and Environmental 

Protection, “Lucian Blaga” University of Sibiu, Romania, e-mail: monica.mironescu@ulbsibiu.ro 

3 Dept. of Chemistry, Faculty of Agricultural Science, Food Industry and Environmental Protection, 

“Lucian Blaga” University of Sibiu, Romania, e-mail: Cecilia.georgescu@ulbsibiu.ro 

∗∗∗ Dept. of Food Biotechnology, Faculty of Agricultural Science, Food Industry and Environmental 

Protection, “Lucian Blaga” University of Sibiu, Romania, e-mail: vionela.mironescu@ulbsibiu.ro



Another important parameter in steeping is pH, which must be maintained at acid 

values (4 to 5), because it seems to help the breaking down of the protein matrix 

which embeds the endosperm, rich in starch (Mironescu, 2005). Naturally, lactic 

bacteria (with Lactobacillus sp. as main components) exist on the surface of grains 

(Hull et al., 1996) and produce fermentation with production of lactic acid which 

inhibits the survival and multiplication of bacterial pathogens as Shigella sp. or 

Escherichia coli (Sefa-Dedeh et al., 2004). 

The role of lactic acid in corn steeping is not well understood. Because this acid 

is known to improve wet-milling starch yields and steep water contains a large 

amount of proteinaceous material, one of the effects of lactic acid in steeping could 

be to help break down of the endosperm protein matrix and protein dissolution 

(Dailey et al., 2000). Significantly greater amounts of protein are released in the 

presence of lactic acid than in its absence, with the greatest amounts found when 

steeping is performed with both lactic acid and SO2. Also, higher starch yields are 

obtained from corn steeped in sulphur dioxide solution with lactic acid (Perez et 

al., 2001). 

Lactic acid can be directly added at the corn steeping (Haros et al., 2004). 

Another solution could be to add lactic bacteria, as producer of lactic acid. In this 

research, the influence of the addition of a starter culture of lactic bacteria in 

various concentrations on the kernels and steep water characteristics is analysed. 

The water acquirement by the kernels and the protein content (expressed as soluble 

substances), acidity, and pH in steep water during steeping are measured. 

2. Materials and methods 

2.1. Materials 

Undamaged semi-dent corn grains were used. 

Two starter cultures of lactic bacteria (Streptococcus thermophillus ST and 

Lactobacillus delbrueckii ssp. bulgaricus LDB), Jointec B and Jointec E (Jointec- 

CSL, Milano, Italy) were used. No information about the differences between the 

two types of products was available. 

2.2. Steeping 

100 g corn grains were distributed in glass bottles, together with water warmed at 

50°C and SO2 solution 8% in the rapport grains: steep water: SO2 8% =1: 2: 0,025 

and then sealed in order to avoid the evaporation of sulphur dioxide. Because in 

the steeping process the moisture content of grains rises from 15% to approximate 

45% and their volume more than doubles, larger bottles (500 g) were used. The 

bottles were maintained in thermostat at 50°C without agitation (Singh and 

Eckohff, 1996).



A set of bottles was used as blind sample. In two other sets, the starter culture of 

lactic bacteria was added, in quantity of 0.2 g/l. Each set consisted on seven 

bottles; for each analysis, a bottle from each set was used. This solution was chosen 

in order to maintain the SO2concentration constant during the experiment. 

2.3. Analyses 

The grains dry weight (DW) was determined by thermogravimetry, on a 

analytical balance, after drying the milled kernels at 120°C for 4 h. The proteins 

extracted in the steep water were measured as total soluble substances (TSS) by 

densitometry. Acidity of the steep water was considered to provide from the lactic 

acid fermentation and was determined as ml of NaOH 0.1 n necessary to neutralise 

the acids present in water, in the presence of phenolphthalein. pH was measured 

with a pH-meter. SO2 was deter-mined by titration with I2 0.02n. in the 

presence of starch. 

Measurements were started after 24 hours of steeping and were realised every 2-3 

hours in the following 24 hours. 

3. Results and discussions 

The initial value of DW was 86.4329 g/100 g. During steeping, grains 

accumulate water which decreases DW as Fig. 1 presents. Compared with the blind 

sample, the addition of starter culture Jointec B allows a slower addition of water 

inside the grains and, as results, higher values of DW and a slighter slope during 

steeping. Contrary, at the use of the culture Jointec E grains accumulate a larger 

quantity of water as the blind sample and as the corn treated with Jointec B, having 

a smaller DW during steeping and at the end of the experiment. 

This result indicates that the addition of the starter culture Jointec B modifies the 

permeability of the membranes, making difficult the absorption of water inside the 

grains. 

Fig. 2 presents the variation of pH in steep water during the steeping process. The 

variation follows a logarithmic curves for all analysed cases. pH increasing is due 

to the formation of alkaline compounds, the increase being dependent of the type of 

starter culture added. At the addition of Jointec E, pH is maintained at lower values 

as the blind sample, whereas the use of Jointec B give higher pH in steep water. 

This result could indicate the difference between the two starter culture used, 

namely the rapport between the two lactic bacteria types. ST needs a lower pH for 

optimal growth (around 4.5), whereas LDB grows better at pH around 5. So, the 

increase of pH in the case of using the culture Jointec B could be explained by the 

formation of non-protein nitrogen with alkaline character (Mironescu, 2005) by 

Lactobacillus in order to acquire the optimal pH for growing (around 5).

Acidity, degre 


USAMV Bucharest, Romania, 

2008 

DW, % 

80 

75 

70 

65 

60 

55 

50 

45 

40 

24 27 30 33 36 39 42 45 

Fig. 2. Variation of pH 

in steep water during 

steeping 

0,7 

0,65 

0,6 

0,55 

0,5 

0,45 

0,4 

Acidity, degree 

Steeping time, h 

pH 

5,2 

5 

4,8 

4,6 

4,4 

4,2 

4 

Blind 

B 0.2 

E 0.2 

Linear (Blind) 

Linear (B 0.2) 

Linear (E 0.2) 

Fig. 1. Variation of grains dry 

weight (DW) during steeping 

24 27 30 33 36 39 42 45 


0,35 

0,3 



24 27 30 33 36 39 42 45 


Blind 

B 0.2 

E 0.2 


DW, % 

Blind 

B 0.2 

E 0.2 

Log. (Blind) 

Log. (B 0.2) 

Log. (E 0.2) 

Fig. 3. Variation of 

acidity in steep water 

during steeping



TSS, g/ml 

SS 

2,50 

2,30 

2,10 

1,90 

1,70 

1,50 

1,30 

B 0.2 

1,10 

E 0.2 

0,90 



0,70 

0,50 


24 27 30 33 36 39 42 45 


Fig. 4. Variation of total soluble substances (TSS) in steep water during steeping 

TSS extraction during steeping is improved at the addition of Jointec B, 

compared with the blind sample and the use of Jointec E, as Fig. 4 shows. Further 

investigations are necessary to analyze and explain the different action of the two 

cultures. 

SO2, % 

% 

SO2, 

0,036 

0,034 

0,032 

0,03 

Blind 

0,028 

Blind 

0,026 

B 0.2 

E 0.2 

0,024 


0,022 

0,02 



24 27 30 33 36 39 42 45 


Fig. 5. Variation of sulphur dioxide concentration during steeping 

The concentration of SO2 during steeping is presented in Fig. 5. Even the 

experiment was designed to maintain the values of sulphur dioxide at a constant 

level (see point 2.2.), the measurements show a small variation of this parameter, 

between 0.0282% and 0.0332%. For the blind sample and the samples treated with 

Jointec E, a small ascendant slope of SO2 concentration during steeping is 

obtained. In the case of samples treated with Jointec B a descendent slope is 

observed. This result could indicate a different diffusion of SO2 to the grains



compared with water, by modification of the membranes permeability during 

steeping (Mironescu, 2005). As in the case of acidity, further investigations are 

necessary. 


Depending on the type of component bacteria, the use of starter cultures with 

lactic bacteria in small amounts modifies the characteristics of grains and steep 

water during steeping. The cultures used, Jointec B and Jointec E, show a different 

action on the grains water uptake; at the use of Jointec E, grains have similar 

behaviour as the blind sample, whereas the addition of Jointec B worse the water 

acquirement. 

The analysis of pH and acidity variation during steeping indicates that the main 

difference between the two cultures used could be the rapport between the two 

component bacteria. Jointec B has a larger amount of LDB and gives higher values 

of pH and acidity, whereas Jointec E (with more ST) shows no significant changes 

compared with the blind sample. 

A better extraction of soluble proteins, deetrmined as soluble substances, from 

the grains is obtained at the addition of small amount of Jointec B. 

The variation of SO2 content indicates a modification of membranes 

permeability, but further analyses are necessary to clear this behaviour. 

References 

1. Dailey, O., Dowd, M., Mayorga, J.: Influence of Lactic Acid on the 

Solubilization of Protein during Corn Steeping. In J. Agric. Food Chem. , 

2000, 48 (4), 1352 -1357 

2. Dan, V.: Microbiologia produselor alimentare, Ed. Accademica, 2000 

3. Haros, M., Perez, O., Rosell, C.: Effect of steeping corn with lactic acid on 

starch properties. In Cereal Chemistry, 2004, 81(1), 10-14 

4. Hull, S., Yang, B.Y., Venzke, D., Kulhavy, K., Montgomery, R.: Composition 

of Corn Steep Water during Steeping. In J. Agric. Food Chem, 1996., 44 (7), 

1857 -1863 

5. Ji, Y., Seetharaman, K., White, P.J.: Optimizing a small-sclae corn-starch 

extraction method for use in the laboratory. In Cereal chemistry, 2004, 81(1), 

55-58 

6. Mironescu, V.: Tehnologia amidonului, 2005 

7. Pérez, O. E., Haros, M. Suarez, C.: Corn steeping: influence of time and lactic 

acid on isolation and thermal properties of starch. In Journal of Food 

Engineering, 2001, 48( 3), 251-256 

8. Pérez-Carrillo, E., Serna-Saldívar, S.: Cell Wall Degrading Enzymes and 

Proteases Improve Starch Yields of Sorghum and Maize. In Starch/Stärke, 

2006, 58, 338–344



9. Ruan, R., Hanwu, L., Chen, P., Shaobo, D., Xiangyang, L., Yuhong, L., 

Wilcke, W., Fulcher, G.: Ozone-aided corn steeping process. In Cereal 

chemistry, 2004, 81 (2), 182-187 

10. Sefa-Dedeh S., Cornelius, B., Amoa-Awua, W., Sakyi-Dawson, E., Ohene 

Afoakwa, Emmanuel .: The microflora of fermented nixtamalized corn. In 

International Journal of Food Microbiology, 2004, 96, 97– 102 

11. Singh, R., Eckohff, S.R.: Wet Milling of Corn-A Review of Laboratory-Scale 

and Pilot Plant-Scale Procedures. In: Cereal chemistry, 1996, 73(6), p. 659- 

667



FATTY LIVER INCIDENCE ON DAIRY COW FARMS IN 

SERBIA AND ROMANIA 

D. KIROVSKI, H.ŠAMANC, H. CERNESCU, 

M. JOVANOVIĆ, I. VUJANAC 4 

Abstract: Fatty liver incidence during peripartal period in high yielding cows on dairy 

farms in Romania and Serbia was studied. Liver samples were taken by percutaneous 

needle biopsy. The degree of hepatic lipidosis was determinated by both semi quantitive test 

using copper sulphate of different specific gravity and pathomorphologically using 

stereometric method. 

Our results indicate that the highest fatty liver incidence was on dairy farms with 

cows that had highest milk production (more than 8000 L per lactation period) and highest 

body condition score during late lactation and dry period. In Serbia, more than 40 % of 

cows on three observed dairy farms had severe fatty liver, due to the fact that BCS in late 

lactation and dry cows was more than 4.5 and that difference between BCS during those 

and early lactation period was more than 1. On three dairy farms that were observed in 

Romania, fatty liver incidence was significantly lower than on the farms in Serbia, 

probably due to the fact that cow milk production was significantly lower, too. 

Key words: fatty liver, incidence, cows 

Introduction 

The transition period between late pregnancy and early lactation (also 

called the periparturient period) is the most critical stage of productivereproductive 

cycle in cows. It is period that last 3 wk before parturition to 3 wk 

after parturition. Most infectious diseases and metabolic disorders occur during this 

time. Fatty liver is one of the most frequent diseases during transition period (Bobe 

et al. 2004). 

The success of the transition period effectively determines the profitability 

of the cow during the lactation. Nutritional or management limitations during this 

time may impede the ability of the cow to reach maximal milk production. The 

primary challenge faced by cows is a sudden and marked increased of nutrient 

requirements for milk production, at the time when dry matter intake (DMI), and 

4 D. Kirovski, H. Šamanc, M. Jovanović, I. Vujanac: Faculty of Veterinary Medicine, University of 

Belgrade, Belgrade, Serbia; H. Cernescu: Faculty of Veterinary Medicine Timisoara, Banat`s 

University of Agricultural Science and Veterinary Medicine, Timisoara, Romania; Corresponding 

author: dani@vet.bg.ac.yu



thus nutrient supply, lags far behind. This situation leads to negative energy 

balance (NEB), followed by excessive lipid mobilization from adipose tissue. 

Cows with “fat mobilization syndrome” in early lactation deposit lipids mainly in 

liver. Extreme rates of lipid mobilization that usually happened in obese cows lead 

to increased uptake of non-esterified free acids (NEFA) by liver and increased 

triglyceride mobilization. If this lipid infiltration becomes severe, the syndrome of 

the hepatic lipidosis or fatty liver may occur (Mazur et al., 1992). 

Data from literature clearly show that dairy cows with excessive fat 

reserves or over-condition at calving may have a greater risk of increased 

metabolic disorders, such a fatty liver during early lactation. Nevertheless, it is still 

open question if obesity during dry period is only etiological factor that contribute 

to occurrence of fatty liver in cows (Mulligan et al. 2008). 

Body condition scoring (BCS) is an effective way to measure, by sight and 

touch, the amount of metabolic energy stored as subcutaneous fat and muscle on an 

animal (Houghton et al., 1990). The technique for BCS evaluation involves 

palpation of the back bones and lumbal processes, feeling their sharpness and 

covering with muscle and fat, scoring the animals on a scale of 1 (emaciated) to 5 

points (obese), with quarters or half points in the middle. However, to take BCS 

more practical and for situations where it is not possible to palpate the animals, 

evaluation can be done visually. In dairy cows, this technique has been widely 

recommended as a method for evaluating their nutritional management (Gillund et 

al., 2001; Šamanc et al., 2008). 

Nutritional management can be estimate by determination of degree of 

hepatic lipidosis during early lactation period in cows, when negative energy 

balance with excessive lipomobilisation is expected. Degree of lipid accumulation 

in liver can be determinate by histopathological technique after sampling of liver 

tissue by biopsy. 

Incidence of fatty liver on dairy farms was high in European Union 

countries during 1970s to 1980s. Thereafter, incidence was reduced, due to the 

changes in farm managing that were made (Bobe et al., 2004). 

Aim of this study was to analyze fatty liver incidence on farms in Serbia 

and Romania in order to recommend changes in feeding system if need and in 

order to compare metabolic diseases incidence in those two neighboring countries. 


Animals 

This study was done on 3 mini dairy farms in Serbia (Farms A, B and C) 

and 3 mini dairy farms in Romania (Farms D, E and F). Body condition scoring 

(BCS) was done on at least 20 percent of cows from each dairy farm. Liver biopsy 

for determination of degree and incidence of hepatic lipidosis was done in 90 cows



in total (20 per each dairy farm in Serbia and 10 per each dairy farm in Romania). 

All cows involved in study were from 1 st to 5 th lactation. Average milk production 

per lactation period were 8000 L on Farms in Serbia and 6 000 L on farms in 

Romania. Cows were in tide system of handling in Serbia, and in open stall system 

in Romania. Cows were fed twice a day with total mix ratio (TMR) in accordance 

to stage of lactation. 

Body condition scoring 

Body condition scoring (BCS) was done by system described in Elaco 

Animal Health Buletin Al 8478. According to that system animals are scored in a 

range from 1 (emaciated) to 5 points (obese), with quarters or half points in the 

middle. One point represents 55 to 75 kg in body mass. Average BCS for every 

phase of productive-reproductive cycle of cows (dry period, puerperium, early and 

late lactation) was calculated as well as difference between different phases of 

cycle. 

Fatty liver determination 

Liver samples were collected from cows by percutaneous needle biopsy on 

day 10 to 15 postpartum by method described by Gaal (1983). The degree of 

hepatic lipidosis was determinated by both semi quantitive test using copper 

sulphate of different specific gravity and pathomorphologically using stereometric 

method. 

The lipid content of bovine liver was found to be highly correlated with its 

specific gravity. Biopsy specimens of liver were submerging into water and copper 

sulphate solutions with specific gravities of 1.05 and 1.055. On the basis of 

buoyancy in these liguids, bovine liver samples were classified accurately as 

containing grater than 35 % (severe hepatic lipidosis), 15 to 35 % (moderate fatty 

liver) and less than 15 % (mild fatty liver). 

Table 1. 

Morphological and chemical classification of the degree of hepatic lipidosis 

Hepatic lipidosis 

degree 

Fat droplets volume 

(µm 3 /100µm 3 ) 

Tryglicerides (g 

per kg of liver 

tissue) 

Total lipids (g 

per kg of liver 

tissue) 

Mild 0 – 20 40 >100 >200 

Liver samples were fixed in paraformaldehyde solution, cut and stained 

with hematoxylin and eosin. Thereafter, histopathologic analysis of hepatic



specimens was performed. Accordin to Gaal's classification there are three stages 

of hepatic lipidosis presented in table 1 

Results and Discussions 

Results of BCS as well as differences between different stages of 

productive-reproductive cycle are shown in Tables 2 and 3. 

Table 2. 

Body condition score (BCS) of cows in different stages of productive-reproductive 

cycle 

Average BCS in different stages of productive- Average BCS for all 

Farm of reproductive cycle 

stages of investigation 

cows dry Puerperium Sixty day of Late 

period 

lactation lactation 

Farm A, 

Serbia 

3.9 2.6 2.5 2.8 2.9 

Farm B, 

Serbia 

4.1 3.0 2.2 4.1 3.4 

Farm C, 

Serbia 

4.5 2.9 2.5 3.6 3.3 

Farm D, 

Romania 

3.4 3.0 3.2 3.0 3.1 

Farm E, 

Romania 

3.9 3.6 3.3 3.7 3.6 

Farm F, 

Romania 

3.7 3.3 3.1 3.7 3.4 

Results presented in Table 2 indicate that there is no significant difference 

in BCS between different stages of productive-reproductive cycle in cows at Farms 

D, E and F, while these difference are very accentuate in cows at Farms A, B and 

C. According to literature, that difference should not be more than 0.7 point 

(Šamanc et al., 2008). Data from Table 3 present that differences between some 

phases of productive-reproductive cycle are more than 1 point on farms A, B and 

C. These differences are especially high between dry period and sixty day of 

lactation (1.4 point at farm A; 1.9 point at farm B and 2.0 point at farm C). These 

results indicated on possibility of excessive and uncontrolled lipomobilisation 

during puerperal and early lactation period. 

Table 3. 

Differences between average body condition scores (BCS) in different stages of 

productive-reproductive cycle of cows



Farm of 

cows 

Dry period/ 

puerperium 

Dry period/ 

sixty day of 

lactation 

Dry 

period/late 

lactation 

Puerperium/ 

sixty day of 

lactation 

Late 

lactation/ 

sixty day of 

lactation 

Farm A, 

Serbia 

1.3 1.4 1.1 0.1 0.3 

Farm B, 

Serbia 

1.1 1.9 0.0 0.8 1.9 

Farm C, 

Serbia 

1.6 2.0 0.9 0.4 1.1 

Farm D, 

Romania 

0.4 0.2 0.4 0.2 0.2 

Farm E, 

Romania 

0.3 0.6 0.2 0.3 0.4 

Farm F, 

Romania 

0.4 0.6 0.0 0.2 0.6 

Data related to fatty liver incidence and degree of hepatic lipidosis is 

shown in table 4. 

Table 4. 

Incidence and the degree of hepatic lipidosis at examined farms 

Cows with deferent degrees of 

hepatic lipidosis (number/percent) 

Cow Cows without Cows 

number lipidosis(number/percent) with Mild Moderate Severe 

Farm 

lipidosis 

(number/ 

percent) 

Farm A, 

Serbia 

20 8/40.00 12/60.00 2/10.00 2/10.00 8/40.00 

Farm B, 

Serbia 

20 7/35.00 13/65.00 5/25.00 1/5.00 7/35.00 

Farm C, 

Serbia 

20 8/40.00 12/60.00 4/20.00 0/0.00 8/40.00 

Farm D 

Romania 

10 7/70.00 3/30.00 2/20.00 1/10.00 0/00.00 

Farm E 

Romania 

10 8/80.00 2/20.00 1/10.00 1/0.00 0/00.00 

Farm F 

Romania 

10 6/60.00 4/40.00 2/20.00 2/20.00 0/00.00 

Data show higher fatty liver incidence on farms A, B and C compared to 

farms D, E and F. Our data show that problem exist at dairy farm in Serbia, where 

average milk production is 8000L, while on mini dairy farms in Romania with 

average milk production of 6000 L problem do not exist. Fatty liver problem on



dairy farms in Serbia is probably related to inadequate feeding during dry period, 

as well as insufficient exercise, which leads to overfeeding of these cows. 

Immediately after calving, significant increase of milk production and energy 

demand can not be assured only by feeding. Exceed lipomobilisation occurs 

followed by fatty liver. 

Our preliminary research shows that on dairy farms observed in Romania, 

fatty liver incidence was significantly lower than on the farms in Serbia. Lower 

incidence of fatty liver in cows in Romania is probably due to the fact that cow 

milk production is significantly lower at farms in Romania, since feeding system is 

very similar. 

If metabolic disorder, like fatty liver, occurs in higher incidence in mini 

dairy farm it is recommended to eliminate potential risk factors. There are several 

general management practices that can help prevent fatty liver. Feeding cows a 

balanced ration according to the dietary requirements in the periparturient period is 

recommended. Treating cows immediately and aggressively in the periparturient 

period for infectious and metabolic disorders is recommended. A clean stall that is 

ventilated well with fresh air, sufficient space and exercise, and fresh, high quality 

feed are all important to prevent diseases. 

The primary approaches to prevent fatty liver are to counteract oxidative or 

cytotoxic damage to the liver, bacterial endotoxemia, and ruminal acidosis and, 

most importantly, to improve the metabolic state of cows in the peripartal period by 

supplying an extra source of blood glucose and by decreasing mobilization of 

NEFA from adipose tissue. The glucose supply can be increased by injections of 

hormones. Possible options are glucagons, insulin, ACTH, glucocorticoids, and 

growth hormone (Nafikov et al., 2002; Furll et al., 1993). Oral drenches of 1L/d of 

propylene glycol for the last 10 d prepartum have been demonstrated to prevent 

fatty liver by increasing plasma glucose and insulin concentrations and decreasing 

plasma BHBA and NEFA concentrations (Studer et al., 1993; Duffilend, 2000). 

Nontoxic dosages of sodium borate have prevented fatty liver but are less 

researched (Basoglu et. al., 2002) Promising alternatives to the currently reported 

fatty liver preventatives are dietary administration of monensin (Duffield et al., 

2000; Duffield et al., 2003) and glucose precursors such as glycerol and propionate 

salts. Administration of ammonium and calcium propionate orally and 

administration of 1 kg/d of glycerol to the diet in the periparturient period 

decreased plasma beta- hydroxybutyric acid (BHBA) and NEFA concentrations, 

respectively (DeFrain et al., 2003; Šamanc et al., 1994). Overall, the effectiveness 

of compounds to prevent fatty liver depends on factors that differ for each 

compound. Therefore, the choice of preventative depends on the specific nutrition 

and management program of the farm. A primary target group for prevention is 

made up of cows that are at a higher risk of developing fatty liver in the early



postparturient period such as cows that are obese or do not eat well, had calving 

difficulties or twins, have metabolic or infectious diseases, or quickly lose BCS. 

Treatment of fatty liver depends on the extent of lipid infiltration and the 

etiology. General management practices that can treat mild and moderate fatty liver 

are similar to those for prevention of fatty liver (Furll., 1988; Bobe et al., 2003). 

Nevertheless, in order to obtain cow industry profitable for Serbian and Romanian 

dairy farmers, it is more important to focus on fatty liver prevention rather than 

fatty liver treatment. 

References 

1. Basoglu, A., Sevinc, M., Birdane, F.M., Boydak M.: Efficacy of sodium borate in 

the prevention of fatty liver in dairy cows, J Vet Intern Med, vol. 16, 2002, p. 732-735. 

2. Bobe, G., Ametaj, B.N., Young, J.W., Beitz, D.C.: Potential treatment of fatty liver 

with 14-day subcutaneous injections of glucagons, J Dairy Sci, vol. 86, 2003, p. 3138- 

3147. 

3. Bobe, G., Young, J.W., Beitz, D.C.: Invated review: pathology, etiology, 

prevention and treatment of fatty liver in dairy cows, J Dairy Sci, vol. 87, 2004, p. 

3105-24. 

4. DeFrain, J.W., Hippen, A.R., Kalscheur, K.F., Jardon, P.W.: Feeding glycerol to 

transition dairy cows; effects on dry matter intake, milk production, and blood 

metabolites, J Dairy Sci, vol. 86, 2003, p. 185. 

5. Duffilend, T.F.: Subclinical ketosis in lactating dairy cows, Vet Clin North Am 

Food Anim Pract, vol. 16, 2000, p. 231-253. 

6. Duffilend, T.F., LeBlanc, S., Bagg, R., Leslie, K.E., Ten Hag, J., Dick, P.: Effect of 

monensin controlled release capsule on metabolic parameters in transition dairy cows, 

J Dairy Sci, vol. 86, 2003, p. 1171-1176. 

7. Furll, M., Furll, B.: Glucocorticosteroid (prednisolone) effects on various blood, 

urine and liver parameters in cows in the second post partum week, Tieraerztl. Prax. 

Ausg. G Grosstiere Nutztiere, vol. 26, 1998, p. 262-268. 

8. Gaal, T., Reid, I.M., Collins, R.A., Roberts, C.J., Pike, B.V.: Comparation of 

biochemical and histological methods of estimating fat content of liver of dairy cows, 

Res Vet Sci, vol. 34, 1983, p. 245-248. 

9. Gillund, P., Reksen, O., Grohn, Y.T., Karlberg, K.: Body condition related to 

ketosis and reproductive performance in Norweigan dairy cows, J Dairy Sci, vol. 84, 

2001, p. 1390-1396. 

10. Houghton, P.L., Lemenager, R.P., Hendrix, K.S., Moss, G.E., Stewart, T.S.: Effect 

of body composition, pre and postpartum energy intake and stage of production of 

energy utilization by beef cows, J Anim Sci, vol. 68, 1990, p. 1447-1456.



11. Mazur, A., Ayrault-Jarrier, M., Chilliard, Y., Rayssiguier, Y.: Lipoprotein 

metabolism in fatty liver dairy cows, Diabete Metab, vol. 18, 1992, p. 145-149. 

12. Mulligan, F.J., Doberty, M.L.: Production diseases of the transition cow, Vet J, 

vol. 176, 2008, p. 3-9. 

13. Šamanc, H., Nikolić, J.A., Damjanović, Z., Stojić, V., Begović, J., Đoković, R.: 

The influence of sodium propionate on blood glucose and serum cortisol 

concentrations in healthy and spontaneosly ketotic lactating cows, Acta Veterinaria, 

vol. 44, 1994, p. 203–214. 

14. Šamanc, H., Stojić, V., Kirovski, D., Jovanović, M., Cernescu, H., Vujanac, I., 

Prodanović, R.: Influence of body condition on incidence and the degree of hepatic 

lipidosis in cows, Veterinarski glasnik, vol. 62, 2008, in press. 

15. Studer, V.A., Grummer, R.R., Bertics, S.J., Reynolds, C.K.: Effect of prepartum 

propylene glycol administration on periparturient fatty liver in dairy cows, J Dairy Sci, 

vol. 76, 1993, p. 2931-2939.



MONITORING OF DRINKING WATER QUALITY IN 

INTENSIVE PIG PRODUCTION CONCERNING ANIMAL 

WELFARE 

A. TOFANT*, Ž. PAVIČIĆ*, M. OSTOVIĆ*, M. MIKULIĆ** 

Abstract: The present study was conducted on the intensive pig farm. Organoleptic, 

physicochemical and bacteriologic parameters of drinking water samples were compared 

between control, healthy appropriate well ground water, which supplies watering system 

and the water samples from drinkers in farrowing, nursery and fattening units. The study 

results showed the water quality from drinkers to be deteriorated according to organoleptic 

and chemical parameters, but water was still healthy acceptable. Bacteriologic parameters 

showed a significant (P



water quality guidelines are aiming to define health and performance of animals 

but are also developed for the protection of the consumer of animal products. 

The aim of his study was to determine the hygienic drinking water quality used 

for particular pig categories as well as the possible influence of installed watering 

piping system and drinkers. 


The research was carried out on the intensive pig farm. The watering system 

consists of 70 m deep well from which the underground water is pumped in the 

elevated tank and then by gravidity flow through piping system supplies the 

drinkers in farrowing, nursery and fattening unit. 

Grab bottle samples were taken every second week, during three months of 

spring period from the tap of supply system (control) and others were collected 

from drinkers in farrowing, nursery and fattening swine unit. 

Organoleptic, physicochemical and bacteriologic parameters were analyzed for 

drinking water quality assessment in accordance with standard methods using 

titration and photometric procedures on HACH DREL/4000 chemistry/apparatus 

module and HACH conductivity/TDS meter and microbial plate count cultivations. 

Statistical analysis was performed by use of the statistical software STATISTICA 

7.1, StatSoft, Inc. The results are presented as mean ± SD (n =6 in each group). 

Data were analyzed using Analysis of Variance (One-way ANOVA) with the 

Tukey HSD test for the post-hoc analysis. 


All investigated parameters were determined using standards methods. Results 

are presented in Table 1. as mean values of six investigations and in Fig. 1. and 2. 

The need for water is one of the basic motivating forces for all animals, so 

watering is an important factor in livestock breeding as are the mode of housing 

and correct nutrition (8). 

According to the regulations in force in Croatia the drinking water for animals 

should be of identical quality as for men, and therefore, it is evaluated according to 

the Rules on health safety of drinking water (6). In many countries this rule has 

been changed because of unavailability of sufficient quantities of drinking water 

and different criteria have been established, according to which water for watering 

of different species and categories of livestock is evaluated as “hygienically 

acceptable”. Water quality refers to the suitable and unsuitable physical, chemical 

and biological characteristics that dictate whether it is acceptable for livestock



(4).Usually the water quality guidelines prescribe the maximum limit and 

acceptable concentrations of all nutrients and substances that are potentially toxic 

to common types of livestock. Beside the problem of deteriorated water sources the 

additional concerns for livestock are watering systems with their sources, 

reservoirs, pipes and specially drinkers (3). 

Table 1 

Parameter 

(n = 6) 

Mean ± SD 

Well water 

(control) Farrowing unit Nursery unit Fattening unit 

Colour (mg/L PtCo) 5 ± 4 8,6 ± 3,3 30,1 ± 32,3 19,7 ± 12,6 

Turbidity (NTU) 0,5 ± 0,5 0,17 aa ± 0,41 4,5 aa ± 4,4 2,5 ± 2,3 

pH 7,1 ± 0,2 6,7 ± 0,3 6,7 ± 0,1 6,7 ± 1,2 

COD – Mn (mgO2/L) 2,3 ± 0,5 3,4 ± 1,2 4,2 ± 1,76 3,9 ± 1,2 

Electric conductivity 

(µS/cm) 329 ±10 333 ± 4 339 ± 7 334 ±13 

Ammonium NH4 + (mg/L) 0,05 a ± 0,04 

Nitrite NO2 2- (mg/L) 0,06 aa ± 0,08 

0,08 bb ± 0,04 0,11 ± 0,11 0,18 a,bb ± 0,05 

0,04 b ± 0,03 0,25 aa,b ± 0,17 0,10 ± 0,03 

Nitrate NO3 2- (mg/L) 7 ± 2 7 ± 3 11 ± 4 8 ± 3 

Chloride Cl - (mg/L) 12 ± 2 13 ± 2 13 ± 2 12 ± 2 

Total Hardness (ºdH) 11,7 ± 0,7 12 ± 2 12,3 ± 1,54 12,1 ± 1,7 

Phosphate PO4 3- (mg/L) 0,25 ± 0,09 0,32 ± 0,21 0,33 ± 0,16 0,38 ± 0,18 

Sulfate SO4 2- (mg/L) 

Total dissolved solids TDS 

13,8 ± 5,3 19,9 ± 4,6 20,2 ± 4,6 17,8 ± 2,4 

(mg/L) 

Mesophilic bacteria (cfu/ml) 

161,6 ± 7,9 166,5 ± 2,4 169,2 ± 3,6 167 ± 18 

37 °C 4 a,b ± 2 

817 a,c ± 577 107 c,d ± 148 902 b,d Mesophilic bacteria (cfu/ml) 

± 318 

22 °C 6 a,b ± 3 

1005 a ± 672 381 c ± 235 1681 b,c Coliform bacteria (MPN/100 

± 515 

ml) 5 a,bb,c ± 3 

202 a ± 95 162 bb ± 122 240 c ± 0 

a,b,c,d Means in the raw with the same letters are significantly different P



bacteria which are detected occasionally after the rain period. It must be mentioned 

that the disinfection process was not performed. The investigation showed the pig′s 

drinking water quality from drinkers to be deteriorated according to organoleptic 

and chemical parameters but under MPL. Bacteriologic parameters, mesophilic and 

coliform bacteria, showed a significant change from the control sample and cause 

drinking water samples unacceptable. Reviewing the total hardness of water 

samples are classified as medium hard. Based on the study results it can be 

concluded that acceptability of drinking water in drinkers, with respect to chemical 

parameters, chloride, phosphate, sulfate, ammonium, nitrite and nitrate, was not 

brought into danger, so the best measure of water quality for livestock, based on 

amounts of total dissolved solids (TDS



other additives. In the present investigation this is the case in nursery unit where 

the additives and medicines are put in additional tank in watering system, what is 

obvious from the results for the colour, turbidity and number of bacteria. 

It could be concluded that the Good Management Practice for livestock watering 

system on investigated farm should be applied considering housing conditions i.e. 

adequate animal density, protection of drinkers from contamination by manure, 

sewage and runoff as well as considering the height of drinkers. Periodical 

disinfection of watering system with ecologically and healthy acceptable oxidising 

compounds which do not leave residues could be recommended (5). 

References 

Coliform bacteria (MPN/100 ml) 

350 

300 

250 

200 

150 

100 

50 

0 

a,bb,c 

a 

Well water (control) Farrowing unit Nursery unit Fattening unit 

Mean Mean±SE Mean±SD 

Fig. 2. Total coliform bacteria in well water and drinkers 

1. Agriculture and Agri-Food Canada: Livestock and water Quality. In: Water 

quality matters. AAFC. PFRA. Ottava, WQR-109, 2000. 

2. Halverson, M.: Farm animal welfare: Crisis or opportunity for 

agriculture? Paper P91-1, 1991. 

3. Ledux, L.: A film in the drinker line. In: Pig International, vol.33 (10), p. 

13-14. 

4. Marjanović, S., Tofant, A.: Cattle drinking water quality - welfare 

indicator. In: Meso 10 (2), 2008, p.127-131. 

bb 

c



5. Pavičić, Ž., Ostović, M., Tofant, A., Balenović, T., Ekert Kabalin A.: 

Značenje higijene pojilica u suvremenom svinjogojstvu (Role of drinker 

hygiene in modern pig production). In: Stočarstvo 62 (4), 2008, p.317-322. 

6. Pravilnik o zdravstvenoj ispravnosti vode za piće (Croatian standards for 

drinking water). Narodne Novine 47, 2008. 

7. Webster, J.: In: Animal Welfare: A Cool Eye Towards Eden. Wiley- 

Blackwell, 1995. 

8. Zakon o zaštiti životinja (Animal protection act). Narodne novine 135, 

2006. 

Acknowledgment 

The shown results are conducted from the scientific projects “Water Quality and 

Sanitation Measures in Ecologic Food Production” (053-0531854-1865) and “Influence of 

the Biotechnological Procedures on Health, Reproduction and Welfare of Pigs” (053- 

0532265-2242) financed by the Ministry of Science, Education and Sports of the Republic 

of Croatia.

THE USE OF NEW PROBIOTIC PREPARATION FOR 

INACTIVATION OF OCHRATOXIN A IN FODDER FOR 

POULTRY 

ŚLIŻEWSKA KATARZYNA * 

Abstract: conducted with the use of a probiotic preparation on the reduction of 

ochratoxin A concentration. After 6-hour fermentation with the addition of probiotic 

cultures, in case of low concentration ochratoxin A (1 mg/kg) the amount of ochratoxin 

A decreased by 73%. In case of high concentration (5 mg/kg) the loss of ochratoxin A 

was lower and equaled about 55%. This tendency was sustained during the following 

hours of incubation (12 th and 24 th hour). 

Introduction 

Keywords: ochratoxin A, probiotic preparation, biological 

degradation. 

Mycotoxins are contaminants present in food industry raw materials and products 

as well as feeds and food of animal origin. They are mainly produced by moulds in 

the process of storing and transporting plant raw material. However, they may also 

appear during various phases of food production, during vegetation already on the 

fields and during harvest. Synthesis of mycotoxins conducted by moulds is 

conditioned genetically, but it is also determined by environmental factors that 

include the following elements: substrate composition, its consistence, humidity, 

temperature and the presence of competitive microflora (3, 4, 6, 8). 

The data published by FAO in 2001 shows that 25% of agricultural products are 

contaminated with mycotoxins and their kind and level are to a great extent 

dependable on the climatic zone. In spite of the fact that in Europe we can observe 

less favorable conditions for synthesis of mycotoxins than for instance in North 

America or Asia, the problem of the presence of mycotoxins in grains is a very 

important issue also for numerous European countries (primarily the Scandinavian 

countries, the southern parts of Germany as well as Austria and Italy) (5, 7). 

Therefore, contamination of animal feeds with mycotoxins is considered to be a 

world-wide problem (1, 2). 

* 

Institute of Fermentation Technology and Microbiology, Technical University of Lodz, Poland, email: 

slizewska@poczta.onet.pl




The aim of this study was to determine the influence of spontaneous fermentation 

conducted with the use of a probiotic preparation on the reduction of ochratoxin A 

concentration and the microflora pattern during fermentation. 

The probiotic preparation is a natural product containing bacteria resistant to 

gastric juice and bile: Lactobacillus casei/paracasei ŁOCK 0920, Lactobacillus 

brevis ŁOCK 0944, Lactobacillus plantarum ŁOCK 0945, as well as live yeast 

cultures Saccharomyces cerevisiae ŁOCK 0140 of a high fermenting ability. 

Bacteria of Lactobacillus strains that are the most important component of the 

preparation were selected by The Pure Cultures Collection of Industrial 

Microorganisms (ŁOCK 105), Technical University of Lodz due to their following 

properties: they are antagonistic towards pathogenic microflora, they are resistant 

to low pH and high concentrations of bile salt, they survive the process of feed 

thermal treatment, they increase the feed digestibility by means of producing 

glycolytic and proteolytic enzymes and, finally, they show resistance to admissible 

coccidiostatics. 

We conducted spontaneous fermentation and another one with the use of 

probiotic bacteria and yeast in previously optimized conditions (37oC, 24h). In 

order to show that detoxication is a result of the activity of microorganisms, we 

used, as a control sample, typical mixed feed for broiler chickens previously 

subject to radiation sterilization to which we added some doses of ochratoxin A. 

The control sample was incubated at the same conditions as those that 

accompanied fermentation. 

The fermentation medium was feed for broiler chickens mixed with water in 1:1.5 

proportion. Ochratoxin A was added to the medium in the amount of 1 and 5 mg/kg 

(ppm). 

Mycotoxin reduction was estimated after 6 hours (the time of intestine passage in 

case of chickens), as well as after 12 and 24 hours of fermentation with the use of 

the immunoenzymatic method (ELISA). The sample was analyzed for ochratoxin 

A presence using OchraQuant ® tests (Tigret Sp. z o.o., Poland) after extraction 

with 70/30 methanol – water solution. 


It was stated that after 6-hour fermentation the decrease of ochratoxin A 

concentration in the control sample, where the fermentation process did not take 

place, equaled from 15 to 18%. After 12 and 24 hours the loss of ochratoxin A was 

comparable, both in case of its low and high concentration in flour (Fig. 1a). 

145



After 6-hour fermentation with the addition of probiotic cultures, in case of low 

concentration ochratoxin A (1 mg/kg) the amount of ochratoxin A decreased by 

73%. In case of high concentration (5 mg/kg) the loss of ochratoxin A was lower 

and equaled about 55% (Fig. 1b). This tendency was sustained during the following 

hours of incubation (12 th and 24 th hour). 

During spontaneous fermentation the loss of mycotoxins was lower, and after 6hour 

fermentation we observed a decrease of ochratoxin A concentration of 20% in 

relation to the concentration observed in the control sample. When the fermentation 

process finished the decrease of ochratoxin A was comparable and equaled 27% in 

comparison with the medium where fermentation did not take place. It should also 

be emphasized that after 6-hour fermentation a greater decrease of ochratoxin A 

was noticed in case of higher concentration of the toxin in the medium (5 mg/kg). 

After 12 and 24 hours this tendency was reversed. A higher decrease of the toxin in 

question was found in the medium with a lower concentration level of ochratoxin 

A (Fig. 1c). 

a) 

80 

60 

40 

20 

1mg/kg 5mg/kg 

0 

6h 

] 80 

12h [% 

60 

tion 

c 40 

u 

ed 20 

R 0 

124h mg/ kg 

b) 

c) 

Reduction [%] 

5mg/kg 

6h 12h 24h 

Fig. 1. Reduction of ochratoxin A in the sample: 

a) without fermentation 

b) during fermentation with the use of probiotic bacteria and yeast 

c) during spontaneous fermentation without any additive 

146 

Reduction [%] 

80 

60 

40 

20 

0 

1mg/kg 5mg/kg 

6h 12h 24h 

Ochratoxin in medium



Biological degradation of mycotoxins in food, raw products, mixed protein 

feeds and also in human and animal organisms is a novum and a very promising 

method as well. Among the organisms that have been used in scientific research to 

eliminate mycotoxins we should enumerate: Acinetobacter calcoaceticus bacteria, 

Aspergillus niger moulds, lactic acid bacteria of Lactobacillus strains and 

Saccharomyces yeasts9). Ŝtyriaka et al. (11) examined 10 yeast strains of 

Saccharomyces, Kluyveromyces and Rhodotorula concerning biodegradation of 

ochratoxin A. It was proven that some species of yeasts of Saccharomyces strains 

were characterized with the highest capability of ochratoxin biodegradation. Scott 

et al. (10) showed a decrease of the amount of ochratoxin A equaling 21% in malt 

wort during fermentation of yeasts, namely Saccharomyces cerevisiae var. 

carlsbergensis. 

Conclusion 

The probiotic preparation containing bacteria of Lactobacillus strains and yeasts 

Saccharomyces cerevisuae was conducive to inactivation of ochratoxin A in a 

typical mixed feed for chickens. 

References 

1. Akande K.E., Abubaker M.M., Adegbola T.A., Bogoro S.E.: Nutritinal and 

health implications of mycotoxins in animal feeds: a review. In: J. Nutr., vol. 

5(5), 2006, p. 398-403. 

2. Andersen B., Thrane U.: Food-borne fungi in fruit and cereals and their 

production of mycotoxins. In: Adv. Exp. Med. Biol., vol. 571, 2006, p. 137- 

152. 

3. Batish V. K., Uptal R., Ram L., Sunita G.: Antifungal attributes of lactic acid 

bacteria – a review. In: Crit. Rev. Biotechnol. vol. 17(3): 1997, p. 209-225. 

4. Bullerman L.B., Shroeder L.L., Kun-Young P.: Formation and control of 

mycotoxins in food. In: J. Food. Prot., vol. 47(8), 1984, p. 637-646. 

5. FAO/WHO: Safety evaluation of certain mycotoxins in food. In: Joint 

FAO/WHO Expert Committee on Food Additives, 56 th Meeting, Geneva, 6-15 

February, 2001. 

6. Fink-Gremmels J.: Mycotoxins: their impact on human and animal health. In: 

Vet. Quart., vol. 21, 1999, p. 115-120. 

147



7. Gareis M., Bauer J., Enders C., Godek B.: Contamination of cereals and food 

with Fusarium mycotoxins in European Countries. Editura Fusarium, 

mycotoxins, taxonomy and pathogenicity. Elsevier, 1989. 

8. Gourama H., Bullerman L. B.: Antimycotic and antiaflatoxigenic effect of 

lactic acid bacteria: a review. In: J. Food Prot., vol. 57(11), 1995, p. 1275- 

1280. 

9. Piotrowska M., Żakowska Z.: The biodegradation of ochratoxin A in food 

products by lactic acid bacteria and baker's yeast. Editura Food 

Biotechnology. Elsevier, 2000. 

10. Scott P.M., Kanhere S.R., Lawrence G.A., Daley E.F., Farber J.M.: 

Fermentation of wort containing added ochratoxin A and fumonisins B1 and 

B2. In: Food Addit. Contam., vol. 12(1), 1995, p. 31-40. 

11. Ŝtyriak I., Čonková E., Kmet V., Böhm J., Razzazi E.: The use of yeast for 

microbial degradation of some selected mycotoxin. In: Mycotoxin Res., vol. 

174(2), 2001, p. 24-27. 

148



REVIEW AND FUTURE POTENTIAL FOR 

UTILIZATION 

OF BIOMASS BYPRODUCTS IN ANIMAL FEED 

J. LEVIĆ,* S. SREDANOVIĆ,* O. DJURAGIC, * Lj. LEVIĆ** 

Abstract: In the future, because of population pressures, environmental 

concerns, liability issues and cost of waste treatment, the various biomass 

byproducts need to be utilized rather than treated as waste. There is great 

potential for adding value to biomass byproducts and using them as animal 

feed. This review cover major kinds of agricultural and food processing 

byproducts, their current uses and future potential for higher value animal 

feed products. 

Keywords: Biomass, byproducts, animal feed, processing 


By 2050 the human population may exceed nine billion. That is 50 % more 

people than we have on the planet Earth today. But demand for food will increase 

at a faster pace in undeveloped countries as living standards rise and population 

demand more meat, milk, eggs and fish in their diets. In order to meet these 

enormously growing needs it is necessary to increase not only food production, but 

to permanently develop and improve animal feed production processes, in 

particular recycling of biomass byproducts into animal feed. In the past, 

byproducts have been largely discarded or used in arbitrary ways. In the future, 

because of population pressures, environmental concerns, liability issues, and cost 

of waste treatment, the various byproducts need to be utilized rather than treated as 

waste. 

Through research work focused on recycling of biomass byproducts into animal 

feed, decrease in environmental pollution, increase in food production and 

reduction of the cost of animal production would be achieved. 

2. Biomass byproducts 

Agriculture and all branches of the food industry produce byproducts concomitant 

with the processing of raw materials to end products. These byproducts represent a 

very heterogeneous group of plant residues. They come from different plant 

149



families and botanical origin (cereals, tubers, roots, fruits, hulls…) and are during 

the processing steps exposed to a wide variety of different physical and chemical 

treatments for the extraction of the economically important component [1, 20]. 

Most of biomass byproducts are characterized by its high proportion of organic 

material and disposing of this waste can be difficult for the following reasons: 

• Biological stability and the potential growth of pathogens: Many types of waste 

materials either already contain large numbers of microbes and/or will be altered 

quickly through microbial activity. If regulations concerning infectious disease 

are not properly observed, than hygienically unacceptable conditions can arise, 

e.g., through maggots or molds. The breakdown of protein is always 

characterized by the evolution of strong odors. 

• High water content: The water content of some wastes lies au to 90% by mass. 

High water content increases transport costs of the waste. Mechanically 

removing the water through use of a press can lead to further problems with 

waste disposal, due to the high levels of organic material in the water 

• Rapid autoxidation: Waste with a high fat content is susceptible to oxidation, 

which leads to the release of foul-smelling fatty acids. 

• Changes due to enzymatic activity: In many types of waste arising from 

vegetables and fruits, enzymes are still active, which accelerate or intensify the 

reactions involved in spoilage [15]. 

Specific amounts of some biomass byproducts defined as the mass of byproduct 

divided by the mass of the saleable agricultural product or food industry raw 

material is listed as the specific indexes in table 1. [3] 

Great part of these products is wasted even in the fields due to plowing (straw, 

cornstalk, sugar beat tops and leaves) or burnt (cornstalk, straw) and only a small 

part of these products are used in animal feeding [21]. These byproducts differ in 

their composition and quality, depending on the raw materials and on the 

technological processing involved. The average chemical composition of some 

feedstuffs produced from biomass byproducts of agriculture and food industry 

origin are summarized in table 2. [1, 7]. 

As shown in tables 1 and 2, both the quantity and quality of the byproducts are 

notably high in terms of their nutritional values and amount produced. 

Huge amounts of these feedstuffs obtained from agricultural and food industry 

byproducts could be used as an important source of nutritients for animals [2, 5, 9, 

10, 23, 24, and 25]. Some byproducts from food industry represent quality protein 

feedstuffs with crude protein content of 28.00 % in brewery spent grain to 44.00 in 

soybean meal or even more than 50% in corn gluten. 

150



Agricultural byproducts contained lignocelluloses-like materials which give them 

poor palatability and low bulk density, i.e. low 

Concentration of nutritive materials as measured by their total volume but in spite 

of these disadvantages they represent the significant feed source for ruminants [24]. 

Crude fiber content in these products varied between 10.94% in sugar beat tops and 

leaves and 39.77% in soybean straw. 

Table 1. 

Specific ratio of biomass byproducts in agriculture and food industry production 

Type of biomass byproducts Origin Specific 

index 

Straw (wheat, barley, oats) Agriculture 0.800 

Soybean dry straw Agriculture 1.000 

Cornstalk Agriculture 1.800 

Sugar beat tops and leaves Agriculture 0.700 

Sunflower heads Agriculture 1.200 

Molasses Sugar production 0.045 

Beet pulp dry Sugar production 0.060 

Beet tails and fragments Sugar production 0.060 

Wheat bran Wheat milling 0.180 

Middling’s Wheat milling 0.100 

Soybean meal Edible oil production 0.800 

Soybean hull Edible oil production 0.060 

Sunflower meal Edible oil production 0.400 

Sunflower hull Edible oil production 0.150 

Rape seed meal Edible oil production 0.600 

Brewers spent grain Beer production 0.250 

Brewers yeast dry Beer production 0.025 

Malt sprouts Malt production 0.035 

Distiller’s dried grains with soluble Distillery industries 0330 

(DDGS) 

Apple pomace Juice production 0.250 

Tomatoes pomace Juice production 0.150 

Corn gluten Starch production 0.060 

Corn steep Starch production 0.065 

151



Cellulose is insoluble in water, but soluble in a number of solvents, including 

concentrated acids and inorganic solvent solutions. Cellulose itself is among the least 

degradable natural polymers due to its high molecular weight, high degree of 

structural order, insolubility and low surface area. Its association with lignin and 

hemicelluloses makes the plant materials more stable to chemicals and enzymes. 

Extensive pretreatment is often required to encourage degradability of the natural 

cellulose [6]. The advantage of these plant materials is that during the harvesting 

season they have low moisture content, which enables long processing times with 

low energy expenditure, as well as the possibility of obtaining large quantities of 

feed for ruminants without taking up extra fertile soil [1, 11, and 12]. 

Table 2. 

Chemical composition of some feedstuffs produced from biomass byproducts of 

agriculture and food industry origin 

Chemical composition [%] 

Feedstuffs Moisture Crude Crude Crude Ash 

protein fiber fat 

Straw (wheat, barley, oats) 9.90 3.20 37.40 1.50 7.30 

Soybean dry straw 9.74 4.72 39.77 1.75 6.76 

Cornstalk 12.03 5.05 33.22 2.42 4.41 

Sugar beat tops and leaves 10.44 12.50 10.94 3.19 15.33 

Sunflower heads 10.47 7.88 20.86 5.49 5.55 

Molasses 22.00 10.00 - - 8.00 

Beet pulp dry 12.61 7.65 18.44 1.42 3.52 

Beet tails and fragments 12.32 8.43 7.70 1.47 7.47 

Wheat bran 12.00 15.50 4.00 10.00 5.50 

Middling 12.00 15.50 4.50 8.00 4.50 

Soybean meal 

Soybean hull 

11.35 44.00 6.30 1.50 5.70 

Sunflower meal 9.00 37.50 1.50 18.00 7.00 

Sunflower hull 10.00 5.00 4.00 47.00 6.00 

Rape seed meal 10.00 35.50 2.50 11.00 7.00 

Brewers spent grain 7.00 28.00 13.00 7.00 4.00 

Brewers yeast dry 7.00 45.00 1.00 1.50 8.00 

Malt sprouts 4.60 25.80 14.80 2.10 7.40 

Distiller’s dried grains with soluble 

(DDGS) 

11.00 30.00 8.60 10.40 5.00 

Apple pomace 4.00 7.80 28.38 4.86 1.20 

Tomatoes pomace 9.15 17.05 11.40 24.80 4.52 

Corn gluten 10.00 50.30 2.00 3.00 2.55 

Corn steep 50.00 24.00 - - 9.00 

152



3. Utilization and upgrading of biomass byproducts 

The increasing costs and pressures associated with byproducts disposal stress the 

need for a reappraisal of the utilizations of byproducts, either directly (as a diet 

ingredient, such as corn gluten or sunflower meal) or indirectly, upgrading by 

micro-organism for livestock and poultry feeding. 

Most of feedstuffs produced from agricultural and food industry byproducts are 

used for the feeding of ruminants but there is a growing interest in exploiting the 

possibility of using these byproducts for pigs, sows and poultry. Due to the high 

crude fiber content in most of the byproducts a question, the potential of including 

the byproducts in diets for growing pigs is limited due to the bulky nature and 

limited capacity to ferment fiber in growing finishing pigs. For sows, however, the 

situation is somewhat different as bulky feed potentially can influence the rate of 

gastric emptying, makes the digest materials more bulky which could be of 

nutritional advantage as it prolongs the feeling of satiety and thereby reduces the 

period of hunger and probably aggressiveness and stereotypes in group housed 

sows [4, 13, 14, 18, and 20]. 

There is great potential for adding value to biomass byproducts and using them 

as animal feed. The scarcity of protein-rich food and global existence of 

impoverished millions of people have forced mankind to search for new protein 

sources. 

The following give some examples of how the feed value of byproducts can be 

increased. Four types of degradation have been characterized, namely hydrolytic, 

oxidative, microbial and mechanical degradation. The addition of NaOH prior to 

thermal pretreatment often enhances the degradability of wastes by disrupting 

lignin and lignocelluloses structures, which might physically restrict the 

extracellular hydrolyzing enzymes of microorganisms. Pretreatment of cellulosic is 

done to increase the rate and the extent of microbial digestion. Also, enzyme action 

on cellulose releases chemically bound lignin. Alkali or petrochemical treatment, 

electron irradiation, and ball milling to a fine particle size increase the enzyme 

activity and biodegradability of cellulose by various fungi. Cellulose can be 

pretreated and swollen by some strongly electrolytic solvents, acids, etc. 

Microorganisms can grow on cellulosic substrates for their biomass production in 

view of their use as or in foods, feeds, the production of enzymes, single cell 

protein (SCP), amino acids, lipid, carbohydrates and organic acids. Pretreatments 

of the cellulolytic waste from crop residues and other agriculture waste with acid 

alkali or enzymes are effective to release a variety of fermentable sugars [6]. 

153



154 

Production of Protein-Rich Feed by Solid State Fermentation 

Crop-residues represent a potential source of dietary energy to ruminants but 

their utilization as an animal feed is limited because of their high levels of cell wall 

components (e.g. cellulose, hemicelluloses, lignin and silica) and low levels of 

protein and minerals. Although these are essentially energy feeds, their energy 

yield is quite inadequate even to meet the maintenance needs of ruminants. Low 

digestibility, low protein content, poor palatability and bulkiness of crop wastes 

discourage their use as the sole source of feed. Hence, treatment of these materials 

becomes essential to improve the feed value. Such processing is energy intensive 

and expensive at large scale. On the other hand, biological treatment using solid 

state fermentation (SSF) is inexpensive and is capable of enriching the feed by 

increasing the protein content and digestibility [19]. 

Various researchers have used different agricultural lignocelluloses and 

agroindrustrial byproducts for the production of protein-rich feed [8, 16, 17,]. 

Some examples of the numerous microorganisms used for this purpose in SSF are 

as follows. 

• Canola meal: Aspergillus carbonarius 

• Apple pomace: Candida utilis, Kloeckera apiculata Saccharomyces 

cerevisiae, Candida utilis, C. tropical is, T. viride, A. niger 

• Coffee pulp: Penicillium verrucosum 

• Sugar beet pulp & molasses: Fusarium oxysporum, Chaetomium 

cellulolyticum, Trichoderma reesei,Trichoderma viride 

• Wheat straw: P. ostreatus,Candida utilis; coprinus species; T.resei; 

Endomycopsis fibuliger; Ch.Cellulolyticum; 

• Corn Stover: Chaetomium cellulolyticum, Candida utilis 

• Corn cob: A. niger 

3. 2. Production and Use of Feed Enzymes 

The use of filamentous fungi for the production of commercially important 

products has increased rapidly over the past half century and the production of 

enzymes in submerged fermentation (SmF) has long been established. Recently 

research interest in solid state fermentation (SSF) has increased [16]. 

The following gives some examples for using biomass byproducts for the 

production of different feed enzymes by solid state fermentation [6, 16, and 17]: 

• Wheat bran: Cellulose, xylanase and polygalactouronase, xylanase, 

pectinases, proteolytic enzymes



• Celluloses: Cellulase and amylase 

• Starch: Cellulase and amylase 

• Lignocellulosics: Various enzymes 

• Corn cobs: Cellulase, beta-glucosidase 

• Agro wastes: Cellulase, xylanase, beta-glucosidase, carboxy methyl cellulase 

• Sugar beet pulp: Polysaccharide degrading enzymes, beta-glucosidase 

• Wheat straw: Carboxymethyl-cellulase. Beta-glucosidase, cellulase 

• Soy bran:Pectinases 

• Rapeseed meal: proteolytic enzymes 

Virtually all enzymes employed in the animal-feed industry are hydrolases, these 

being used directly as feed additives to achieve any, or all, of the following 

objectives: 

1. Supplementation of the endogenous digestive activities of the host animal, 

including proteases and amylases [2, 4, 11]. 

2. Removal of antinutritional factors such as β-glucans and phytic acid from 

problematic feedstuffs [2, 6, 22, 26, 27]. 

3. To render certain nutrients more-readily available for absorption and to 

enhance the energy value of cheaper feed ingredients [4, 11]. 

4. Conclusion 

This review cover major kinds of agricultural (corn stalks, wheat straw, soybean 

straw and hulls, sunflower stalks and tops, sugar beet leaves and tops ect.) and food 

processing (sugar beet molasses, pulp, tails and fragments, DDGS, corn germ meal, 

corn gluten meal, corn steep liquor, tomato meal, apple pomace, brewer’s spent 

grains, yeast and sediment, sunflower meal etc.) byproduct their current uses and 

future potential for higher value animal feed products. The application of the 

adequate technological procedures improves their physical and biochemical 

properties and in combination with other feedstuffs it is possible to obtain quality 

feeds for certain species and categories of animals. As a consequence, there can be 

a reduction in the use of traditional feed ingredients such as corn, wheat an 

soybeans, which can be consumed by humans. 

References: 

1. Delic. I., Levic, J., Lazor,M., Ristic,M., Kormanjos, S.: Studija: Makroprojekat 

proizvodnje stocne hrane animalnog i biljnog porekla na bazi domacih izvora 

sirovina, Tehnoloski fakultet Novi Sad, Institut za tehnologiju stocne hrane, 

Novi Sad, 1986, p.1-191. 

155



2. Denek, N., Can, A.: Feeding value of wet tomato pomace ensiled with wheat 

straw and wheat grain for Awassi sheep, Small Rum. Res. 65, 2006, p.260–265. 

3. Djuragic, O., Sredanovic, S., Levic, Jovanka: Possible uses of Food Industry 

Byproducts Aimed at Increased Food Production and Environmental 

Protection, 1 st International Symposium „FOOD in the 21 st CENTURY“ Book 

of Proceedings, Subotica, 2001, p.239-243. 

4. El Boushy, A.R., Van der Poel, A.F.B.:Formulating feed from waste and 

byproducts,World Poultry, 17, 9, 2001 p.34-36. 

5. Fadel, J.G.: Quantitative analyses of selected plant by-product feedstuffs, a 

global perspective. Animal Feed Science And Technology, 1999, 79, p.255-268. 

6. Himanish, D. and Sudhir, K., S.: Usefull byproducts from Cellulosic Wastes of 

Agriculture and Food Industry- a Critical Appraisal Critical reviews in Food 

Science and Nutrition, 44: 2004, p.77-89. 

7. Hutcheson, D.: The Aplication of DDGS in Animal Nutrition (Ruminant and 

Monogastric), Afma matrix, 12, 2007, p.16-22. 

8. Jecu, L.: Solid State Fermentation of Agricultural Wastes for Endoglucanase 

Production. Industrial Crops And Products, 7, 1, 2000, p.l-5. 

9. Koster, H.: Dry Milling Ethanol Byproducts for Animal Feed(Part 1),Afma 

Matrix, 3,2007, p.33-38. 

10. Koster, H.: Dry Milling Ethanol Byproducts for Animal Feed(Part 2),Afma 

Matrix, 6,2007, p.30-32. 

11. Levic,J., Klahorts, S., Shoemaker, S.:Reviev and Future Potential for 

Utilization of Biomass and Animal Byproducts in Animal Feed, UC Davis, 

CIFAR, 2001, p.1-44. 

12. Levic,J., Sredanovic,S., Levic,Lj.: Brewing By-products and Possibilities for 

Utilization in Feed, 4 th International Conference of food Science and 

Technology, Wuxi, Jiangsu, China. October 17 to 20, 2000, p.454-463. 

13. Lević, J., Sredanović, S., Đuragić O.: New feed from brewery by-products for 

breeding layers, Second International Congress on Food and Nutrition “Food 

for Future”, Istanbul, 24-26 October 2007, p.79. 

14. Lević, J., Sredanović, S., Đuragić, O.: Sunflower Meal Protein as a Feed for 

Broilers, Acta Periodica Technologica 36, 1-262, 2005, p.3-10. 

15. Russ., W. And Meyer-Pittroff R.:Utilizing waste Products from the Food 

Production and Processing Industries, Critical reviews in Food Science and 

Nutrition, 44, 2004, p.57-62. 

16. Pandey, A., Soccol, C.R., Mitchell,D.: New developments in solid state 

fermentation: I-bioprocesses and products. Process Biochemistry, 35, 10, 2000, 

p.1153-1169. 

17. Papagianni, M., Nokes, S.E., Filer, K.: Production of phytase by Aspergillus 

156



niger in submerged and solid-state fermentation. Process Biochemistry, 35, 3-4, 

1999, p.397-402. 

18. Pirmohammadi, R., Rouzbehan, Y., Rezayazdi, K., Zahedifar, M.: Chemical 

composition, digestibility and in situ degradability of dried and ensiled apple 

pomace and maize silage. Small Rum. Res. 65, 2006, p, 150–155. 

19. Sandhu.D.K. and Joshi,V.K.: Solid state Fermentation of Apple Pomace for 

Concomitant Production of Ethanol and Animal Feed, Journal Of Science & 

Industrial Research, 56,1997, p.86-90. 

20. Serena., A., and Bach Knudsen., K. E.: Chemical and Physicochemical 

characterisation of co-products from the vegetable food and agro industries, 

Animal Feed Science and Technology, 139, 2007, p. 109-124. 

21. Sredanovic, S., Djuragic, O., Levic, J.: Possibilities of Processing Agricultural 

Byproducts for Animal Feed, PTEP, 5, 1-2, 2001, p.26-29. 

22. Sredanovic, S., Levic, J.: Phitase as the factor of the Environmental Protection 

and the Improvement of the Nutritive Value of Sunflower Meal,1 st , International 

Symposium „FOOD in the 21 st CENTURY“ Book of Proceedings, Subotica, 

2001, p.743-747. 

23. Sredanović, S., Lević, J., Đuragić, O.: Increasing the yield and quality of 

sunflower meal protein fractions by different preliminary treatments before 

fractionation, Second International Congress on Food and Nutrition “Food for 

Future”, Istanbul, 24-26 October 2007, p.208. 

24. Vasta, V., Nudda, A., Lanza, M., Priolo, A.: Alternative Feed Resources and 

their Effects on the Quality of Meal and Milk from Small Ruminants, Animal 

Feed Science and Technology, 147, 2008, p.223-246. 

25. Ziggers, D.: Wheat dictates DDGS supply in Europe, Feed Tech, 11, 8, 2007, 

p.18-20. 

26. Živkov-Baloš, M., Kovačević, M., Mihaljev, Ž., Lević, J: Efikasnost 

mikrobijalne fitaze u poboljšanju iskoristljivosti kalcijuma i fosfora u ishrani 

živine, 2. Kongres veterinara Republike Srpske sa međunarodnim učešćem, 

Banja Luka 24.-27. 10, 2007, p. 155. 

27. Živkov-Baloš, M, Mihaljev, Ž, Lević, J.: Fitaza u ishrani brojlera (pregled), 

Savremena poljoprivreda, 1-2, 2008, p.171-180. 

157



ACHIEVEMENT OF A FORTIFYING FRUIT PRODUCTS 

ENRICHED WITH IRON 

Adriana VOICU * , Gheorghe CAMPEANU ** 

Abstract: In this paper the experiments related to achievement of a fortifying fruit 

products enriched with iron are presented. Iron is an essential constituent of the body, 

being necessary for haemoglobin formation and for the oxidative processes of living tissue. 

The ferrous sulphate is widely used iron salt in the treatment of iron-deficiency anaemia. In 

the experiments were used apricots and peaches with a high content of nutrients. Ascorbic 

acid and organic acids contents in this fruit are very important because they are promoters 

in bioavailability of iron in human organism. At the laboratory level many variants of 

experiments were carried out with different levels of fortification with iron as a variable 

factor, in order to obtain two fortifying products: „Apricot cream fortified with iron” and 

„Peach paste fortified with iron” 

Keywords: fortifying products, iron, ferrous sulphate, apricot, peach, bioavailability 

Introduction 

According the studies carried out by the World Health Organization the 

deficiency of iron affects almost 2 billion people. The most severe consequence of 

iron deficiency anemia is the asiderotic anemia (diminution of hemoglobin and 

hematocrit) that determines a state of accentuated physical fatigue stressed, 

children growth and development disorders, fall of vitality, reduction of immunity 

of the body, diminution of intellectual and memory performance, a tendency of 

suffocation etc. (1). 

In Romania, according the studies carried out by UNICEF, Ministry of 

Health and Family and The Institute of Mother and Child Care “Alfred Russescu”, 

almost 50% of children up to 2 years old and approximately 30% of those up to 5 

years old have asiderotic anemia (determined by the iron deficiency). Also, 

according the same studies, almost 25% of the pregnant women and approximately 

32% of the women who breast-feed children have iron deficiency and asiderotic 

anemia (2). 

* 

Ministry of Agriculture and Rural Development, Bucharest, 24 Carol I, 3 Bucharest, Romania, email: 

voicuadriana@gmail.com 

**University of Agronomic Sciences and Veterinary Medicine, Bucharest, 59 Marasti, 1 Bucharest, 

Romania 

158



The dietotherapy of iron deficiency has a priority role in the latent 

deficiencies of this mineral and in prophylaxis as well (3). 

In food industry, for achieving the fortified products, the big companies, 

well known in this field, follow two main directions: 

- use of raw materials with a high content of nutritive principles and application of 

optimum processing technologies to preserve within the finite product a high share 

of these nutritive principles; 

- fortifying of the finite product by adding vitamins (A, C, E, etc.) and mineral 

elements (Fe, Ca, Mg) (4). 

Addition of a nutritional component must be carried out based on scientific 

studies, so that its concentration in the product to be optimum to rectify the 

nutritional deficiency, but, at the same time, not to determine alteration of the 

sensorial properties (aspect, taste, flavor, color) of the product (5). 

Although, comparing with meat products, the processed fruit have a 

smaller content of iron, the nutritionists recommend them in dietotherapy of iron 

deficiencies. The studies carried out by the nutritionists underline the fact that the 

value of a food product as iron source is influenced more by the chemical status of 

this element than of the total content of iron. High solubility, easy ionization and 

state of ferrous valence are properties increasing the degree of assimilation of the 

iron. In case of fruit, due to the content of ascorbic acid, the trivalent iron is 

reduced to bivalent iron, which favors its bioavailability in human body (6). 

Two products processed from fruit, fortified with iron were achieved: 

“Apricot cream fortified with iron” and “Peach paste fortified with iron”, 

considering these aspects, in the studies carried out at laboratory level. 

Materials and Methods 

The experiments were carried out at the Research-Development Institute 

for Processing and Marketing of Horticultural Products – HORTING Bucharest 

within the frame of the Laboratory of Research – Processing of Horticultural 

Products. 

In the experiments, the following raw materials and auxiliary materials 

were used: fruit (apricots - cultivar “The best of Hungary” and peaches - cultivar 

“Redheaven”), sugar, ascorbic acid, ferrous sulphate (FeSO4xH2O), jars (220 ml 

Twist-off). 

In order to obtain the fortifying fruit products the following stages were 

crossed: 

- characterization from the sensorial and biochemical point of view of the raw 

materials: apricots and peaches (7); 

159



- set up of the technological flow sheets and of the experimental variants in lab 

conditions; 

- ensorial, biochemical and microbiological analysis of experimental variants (7); 

- definitization of recipe and processing technology for optimum variant; 

At the laboratory level, some experimental variants were carried out with 

different levels of fortification with ferrous sulphate as a variable factor, in order to 

obtain two fortifying products: 

o M - not fortified with iron; 

o V1 – 2 mg Fe/100g; 

o V2 – 4 mg Fe/100g; 

o V3 – 6 mg Fe/100g. 

In order to increase the bioavailability of iron in the body, in the 

composition of products was added a dose of 30 mg/100 g finite product acid 

ascorbic. 

Both the ferrous sulphate and the ascorbic acid were dissolved in water and 

were added in the final phase of the technological process of obtaining the two 

products processed from fruit. 

The technological flow sheet for the product “Apricot cream fortified with 

iron” included the following stages: qualitative and quantitative checking, sorting, 

washing, cleaning, cutting, boiling for 3 minutes, crushing - refining, 

homogenization with sugar under pressure at 150-180 A, heat treatment with 

ascorbic acid and ferrous sulphate, de-aeration under vacuum at about 40°C, filling 

jars, hermetic sealing, pasteurization at 100°C for 20 minutes, cooling at 40°C, 

labeling and storage (8). 

Table 1. 

Sensorial analyses of apricot cultivar „The best of Hungary” 

Sensorial 

Apricot 

properties 

Aspect Medium and large fruit with height of H = 45 -53 mm, 

diameter D = 45 -57 mm, weight W = 45 – 48 g, globe, 

based on slightly truncated. 

Pulp thick, juicy, strong flavored. 

Apricot stone is right of large, ovoid, dished. 

Taste and flavor Good, strong flavor specific cultivar “The best of Hungary” 

Color Intense orange 

The technological flow sheet for the product “Peach paste fortified with 

iron” included the following stages: qualitative and quantitative checking, sorting, 

160



washing, cleaning, cutting, boiling for 5 minutes, crushing - refining, 

homogenization with sugar under pressure at 150-180 A, thermal concentration 

with ascorbic acid and ferrous sulphate, de-aeration under vacuum at about 40°C, 

filling jars, hermetic sealing, pasteurization at 100°C for 20 minutes, cooling at 

40°C, labeling and storage (8). 


Fresh fruit were analyzed from the sensorial and biochemical point of 

view, the results being presented in the tables 1, 2 and 3. 

The results of the biochemical analyses for the used raw material shows 

that the apricots have a high content of glucides (12.80 mg/100g), vitamin C (14.35 

mg/100g) and β-carotene (2.45 mg/100g) and the peaches have a high content of 

iron (0.61 mg/100g). Ascorbic acid and organic acids contents in this fruit are very 

important because they are promoters in bioavailability of iron in human organism. 

The two fortified products processed from fruit, were analyzed from the 

sensorial, biochemical and microbiological point of view (tables 4, 5). 

Table 2. 

Sensorial 

properties 

Sensorial analyses of peach cultivar „Redhaven” 

Peach 

Aspect Middle-sized fruit with the height of H = 48 - 61 mm diameter D 

= 48 -57 mm, weight W = 130 - 150 g, sphere, slightly flattened at 

the two ends. 

Pulp consistent, juicy, aromatic. 

Peach stone is middle, oblong and asymmetric. 

Taste and flavor Nuttiness, balanced sweet - tart, specific flavor cultivar 

“Redhaven” 

Color Epidermis: yellow - orange, covered with fine red lit, mottled or 

checkered over the entire surface; 

Pulp: yellow – orange and red around stone 

Following the sensorial and qualitative analysis, the optimum variant of 

the fortifying products was selected, namely the variant V2. The used fortifying 

agent - ferrous sulphate - 4 mg Fe/100g finite product in these fortifying fruit 

products does not determine changes of the sensorial proprieties (aspect, color, 

taste and flavor). 

Following the biochemical analysis it was found that the two products: “Apricot 

cream fortified with iron” and “Peaches paste fortified with iron” have a complex 

161



composition, due to glucides content simple, easy to be assimilated, vitamin C 

(16.75 - 17.85 mg/100g) and iron (4.45 – 4.56 mg/100 g). 

Table 3. 

Biochemical composition of raw materials 

Biochemical indicators Apricot Peach 

Glucides (%) 12.80 11.45 

Lipids (%) 0.08 0.10 

Proteins (%) 0.80 0.58 

Pectic substances (%) 0.50 0.55 

ß – carotene (mg/100g) 2.45 0.75 

Vitamin C (mg/100g) 14.35 12.85 

Minerals (%) 0.59 0.52 

Ca (mg/100g) 15.10 6.35 

Fe (mg/100g) 0.52 0.61 

Na (mg/100g) 1.62 2.10 

P (mg/100g) 305.85 245.55 

Mg (mg/100g) 8.25 8.90 

Cellulose (%) 0.27 0.32 

Organic acids (mg/100g) 0.88 0.60 

The two fortified products were microbiologically analyzed registering the 

absence of aerobe and anaerobic, mesophile and thermophile bacteria, as well as 

the absence of yeasts and moulds. 

Table 4. 

Sensorial analyses of fortifying fruit products enriched with iron 

Sensorial properties Apricot cream fortified Peach paste fortified 

with iron 

with iron 

Aspect Homogeneous composition in Homogenous paste, weak 

162 

the form of cream 

Taste and flavor Nuttiness balanced sweet-tart, 

with intense flavor, specific 

apricots 

gelified 

Color orange dark - orange 

Nuttiness balanced sweet-tart, 

flavored with specific 

peaches. 

Based on the studies carried out on international level, it was found that 

use of ferrous sulphate in the fortifying process presents several advantages: 

- it does not grant any dislikable taste, flavor or color to the products; 

- it does not provoke the degradation of the products during storage; 

- dissolves well in watery environment and is bioavailable in human body.



Fortifying the food products is proclaimed by the Regulation (CE) N o . 

1925/2006 of the European Parliament and of the Council of 20 December 2006. In 

this document the following are specified: 

- requirements regarding the vitamins and minerals addition; 

- restrictions regarding the addition of vitamins and minerals; 

- vitamins and minerals resources that can be added into foods. 

Also, Directive 2006/125/CE of the Commission of the European 

Community from 5 December 2006 regarding the products made of cereals and 

food for children, baby, and small children, impose a maximum limit of iron 

addition for fortifying purposes: 3mg Fe/100kcal. 

Table 5. 

Biochemical composition of fortifying fruit products enriched with iron 

Biochemical indicators Apricot cream fortified Peach paste fortified 

with iron 

with iron 

Glucides (%) 21.15 58.85 

Lipids (%) 0.06 0.08 

Proteins (%) 0.70 0.48 

ß – carotene (mg/100g) 2.15 0.57 

Vitamin C (mg/100g) 17.85 16.75 

Minerals (%) 0.53 0.42 

Ca (mg/100g) 13.50 4.96 

Fe (mg/100g) 4.45 4.56 

Na (mg/100g) 1.41 1.85 

P (mg/100g) 265.35 192.87 

Mg (mg/100g) 7.40 7.03 

Conclusions 

1. Two products processed out of fruits, fortified with iron, “Apricot cream 

fortified with iron” and “Peaches paste fortified with iron”, were achieved in 

laboratory. It was used the ferrous sulphate as fortifying agent (4 mg Fe/100g final 

product). 

2. The used fortifying agent (ferrous sulphate) does not determine changes of the 

sensorial features (aspect, color, taste and flavor), comparing with the control 

products (not fortified with iron). 

3. The two products “Apricot cream fortified with iron” and “Peach paste fortified 

with iron” have a complex composition, standing out by its content of simple 

glucides, easy to be assimilated, vitamin C and iron. 

163



4. The achievement of these products processed from fruits, fortified with 

iron, represents a necessity because iron deficiency and asiderotic anemia 

have a raised incidence among the vulnerable groups of population (small 

children, teenagers, pregnant women, etc.). 

References 

1. ACC/SCN: Third report on the world nutrition situation. Geneva: World Health 

Organization, 1997. 

2. UNICEF, I.O.M.C. “Alfred Russescu”: Statusul nutritional al femeii gravide, al 

copiilor cu varsta sub 5 ani, al scolarilor in varsta de 6-7 ani. Romania 2005 

3. Yip, R.: Iron deficiency: Contemporary scientific issues and international 

programmatic approaches. J Nutr. 124, 1994, p. 79-90. 

4. Mehansho, H.: Eradication of iron deficiency anemia through food fortification: 

The role of the private sector, J. Nutr. 132, 2002, p. 831S - 833S. 

5. Hurrell, RF.: Preventing iron deficiency through food fortification. Nutr Rev. 55, 

1997, p. 10-22. 

6. Mehansho, H.: Iron fortification technology development: New approaches. J. 

Nutr. 136, 2006, p 1059-1063. 

7. Colectia de Standarde pentru Industria Conservelor de legume şi fructe. vol. I, 

Ministerul Industriei Alimentare, 1990. 

8. Gherghi A.: Prelucrarea şi industrializarea produselor horticole. Vol. III, Ed. 

Olimp Bucureşti,1999. 

164



AN APPLICATION OF STATISTICAL MODELING 

TO A PROBLEM OF THE PREDICTIVE MYCOLOGY 


M.VARGA *, F.RADOI-MATEI ** 

Abstract: The prevention of the food product contamination with toxinogenic 

moulds depends mainly on the understanding of the fungal alteration 

phenomenon during the processing, conditioning and keeping. Consequently it is 

necessary to have precise diagnostic methods in order to predict and describe in 

detail the dynamic of the alteration. One of the useful tools in the predictive 

mycology is the statistical modeling, used in this paper in order to describe the 

mycelia growth of two moulds isolated from Romanian food. 

This article presents aspects of using mathematical and statistical modeling in 

predictable microbiology. They are listed as found in literature, theoretical 

concepts relating to current mathematical models used in the study of biological 

processes, statistical analysis techniques involved in establishing the model 

primary by mycelia growth, examples are presented for some experimental data, 

calculations been made using Excel software and Slide Writer. 

Keywords: predictive mycology, statistics, modeling. 

The prevention of the food product contamination with toxinogenic moulds 

depends mainly on the understanding of the fungal alteration phenomenon during 

the processing, conditioning and keeping. Consequently it is necessary to have 

precise diagnostic methods in order to predict and describe in detail the dynamic of 

the alteration. One of the useful tools in the predictive mycology is the statistical 

modeling, used in this paper in order to describe the mycelia growth of two moulds 

isolated from Romanian food. 

This research belongs to a national project regarding the prevention of the 

mycotoxin contamination in feed and food. 

* 

Dept. of Mathematics, Faculty of Biotechnology, USAMV Bucharest, Romania, e-mail: 

vargamioara@yahoo.com 

** 

Dept. of Microbiology, Faculty of Biotechnology, USAMV Bucharest, Romania, e-mail: 

flore_radoi@hotmail.com 

165



At the very beginning of the project there have been isolated and identified the 

main species involved in the alteration of food products of intermediary activity. 

Finally, 54 moulds strains have been insolated, belonging to the following genders: 

Aspergillus, Alternaria, Fusarium, Penicillium, Rhizopus, Cladosporium, 

Macrosporium. 

The strains have been screened for their toxinogenic activity (aflatoxins, 

ochratoxin and deoxynivalenol production) by on-plate method and the toxins were 

quantified by Elisa Immunologic tests. 38 of those moulds showed toxinogenic 

activity under laboratory tests. 

From this toxinogenic collection, two strains (Fusarium graminearum MI 113 and 

Penicillium crysogenum MI 210) have been studied for their growth and mycotoxin 

(DON and OTA) production from a predictive point of view. 

2. Material and Method 

* Strains: toxinogenic filamentous fungi Penicillium chrysogenum MI 208 and MI 

210; Fusarium graminearum MI 107 and MI 113. 

Before use, all strains were activated by successive passages on the average PDA 

for 7 days of culture at 27 ° C. The spores were harvested in a solution of water 

physiologic sterile (9 g / l of NaCl) going from the two strains of Penicillium sp. 

and Fusarium sp., through the scrapeing light area of colonies with a Pasteur 

pipettes. 

The inoculation was done in the center of boxes with Petri Czapek-Dox in 

duplicate for each strain taken in work. On environment Czapek-Dox, it tried to 

follow mycelia growth (growth in cm.), for a strain of Penicillium crysogenum (MI 

210) and one of Fusarium graminearum (F. graminearum MI113). 

* Collecting and processing data 

As noted above, any mathematical model contains a number of parameters to 

be estimate, to compare the data with empirical prediction. This estimate takes 

place after the collection and processing of experimental data. Synthetic are 

presented below, the mathematical elements that characterize this process. The 

purpose of introducing the mathematical processes in an experimental research is 

to find a convenient result, allowing the phenomenon analyzed forecasts. 

The collection of experimental data is done in most cases on a population of 

selection. Because the results from the survey research data to be relevant to the 

entire population statistics, the poll must be representative, that is, must meet the 

following conditions: 

166



-the statistical units which consists of evidence are chosen through a random 

process; 

-each individual statistical population must have the same opportunity to 

participate in the survey; 

-the selection structure to be as closer to the general population; 

-the volume selection to be higher. 

In this case, the experimental data that are the subject of statistical analysis 

that follows so conduct, it refers to evolution (growth in cm.) Over 14 days for a 

strain of Penicillium crysogenum, one of Fusarium graminearum. 

* The growth rate was measured under different temperature conditions (4°, 

12°,16°, 20°, 26°, 30°,33°,36°C). 

The experimental data to determine the available indicators poll of evolution. 

Thus, the appropriation of quantitative studied X, stalk growth is measured in 

moments of time equidistance (measurements are made at a time of 24 hours). In 

these circumstances, we calculate: 

The chronological mean : 

x1 + ... + xn−1 

X C = , (1) 

n −1 

x x are the values of survey recorded. 

where 1 ,..., n 

The pace of evolving environmental value : 

xn − x1 

D = , (2) 

n −1 

In the case of multiple measurements (2 when analyzed for Penicillium 

crysogenum and 2 for Fusarium graminearum), these indicators are calculated 

sampling progress for each temperature, which was conducted experiment. If 

X C , X are the chronological means for the first copy studied respectively for 

1 C2 

the second, Penicillium crysogenum, then, 

The timeline global mean is determined by the formula : 

X1+ Xn + 2 ( X2 + ... + Xn−1) 

X C = 

, (3) 

2( n −1) 

which X i means the arithmetic averages of data obtained from observation points 

i, 1 ≤i≤n, ie. 

167



x1i + x2 

i X i = , 1≤i≤ 

n. 

2 

The global average rate will be calculated in this case by the formula: 

X n − X1 

D = , (4) 

n −1 

The mean overall poll is determined by applying the formula : 

1 

X = ( XC + ... + X ) , 

1 

C n 

n 

(5) 

The global standard deviation is calculated by applying the formula : 

S = 

1 

2 

⎡( XC − X) + ... + ( X 

1 

Cn 

n ⎢⎣ 2 

−X 

⎤ ) ⎥⎦ 

(6) 

* The models are only a first step in studying the biological process of determining 

the mycelia growth rate, because the analysis of such a phenomenon should be 

taken and random physical aspects involved, which argues about the character of 

these models. It is logical for this purpose and involvement stochastic models, in 

which certain elements of equations are partially known, doubtful or fluctuating. It 

is known that the value of a given model is the extent to which it tally with reality. 

Therefore, since the stages of preparing a model, should be taken to maintain a 

rational balance between the precision required and the information held primary. 

3. Results and Discussions 

In order to establish some conclusions regarding the growth model to 

determine which estimates best the studied situation, are made appropriate graphics 

corresponding to the development strains of Penicillium crysogenum and Fusarium 

graminearum during the 14 days that measurements were made, at certain 

temperatures. It is originally indicated, in accordance with graphics obtained, 

mathematical curves that estimates best studied phenomenon, namely primary 

model. 

It made such a development for Penicillium crysogenum, at temperature T = 30 

°, as indicated rate of growth within 24 hours. 

In the next step is verified the growth model's plausible for the species 

Pencillium crysogenum. 

Because the analysis period, the evolution phenomenon presents a continuous 

growth, the empirical points curve presents a form that can be estimated depending 

logarithmical function, the model that can be used for the evolution of the 

168



phenomenon is an approximation of the form: 

y t = f ( t) 

+ ut 

where: 

y t = the recorded values during the period examined phenomenon 

f (t) 

= the trend component that can be described with a logarithmical 

functions: Yt = f ( t) 

= a + b ∗ ln t u t = the residual variable. 

In making the calculations easier, it notes xt = ln t . The model turns in one 

straightforward: y t = a + b ∗ xt 

+ ut 

After conducting calculations it was resulted the following system of 

equations: 

⎪⎧ 

14 ⋅ aˆ 

+ 25, 

19122 ⋅ bˆ 

= 689 

⎨ 

⇒ 

⎪⎩ 25, 

19122 ⋅ aˆ 

+ 53, 

1185 ⋅ bˆ 

= 1373, 

177 

⎧aˆ 

= 18, 

39919 

⎨ 

ˆ 

⎩b 

= 17, 

12546 

The estimate of the residual variable will result in the following 

relationship: 

uˆ 

= y − Yˆ 

t 

t 

In order to test the parameters and significance of the model will calculate: 

The residual variation of dispersion: 

ˆ 41, 

64805 

3, 

47067 

1 12 

2 

2 

ˆ = = = 

− − 

∑u t 

s 

⇒ u s 

t 

uˆ 

t 

T k 

= 1, 

8629 

s 

bˆ 

= 

The average square deviations of the two estimators: â and bˆ = 

2 

sˆ sˆt 

u a 

2 

suˆ 

t 

∑ ( t − t ) 

⎡ 

2 

2 

1 t ⎤ ⎡ 1 1, 

799373⎤ 

∗⎢ 

+ 

3, 

47067 

= 1, 

3001 

2 ⎥ = ∗⎢ 

+ ⎥ 

⎢⎣ 

T ∑( t −t) 

⎥⎦ 

⎣14 

7, 

790094⎦ 

2 

= 

3, 

47067 

7, 

790094 

= 

0, 

6674 

Because the number of terms of the series is less than 30, the estimators 

testing will be done using the test "t" - Student. The Student distribution table for a 

threshold of significance α = 0, 

05 and the number of degrees of freedom 

t 

169



ν = n − k −1 

= 12 , to take value t = 2, 

179 . 

t 

c 

170 

aˆ 

= 

saˆ 

18, 

39919 

= = 14, 

152 > t0, 

05; 

12 

1, 

3001 

= 2, 

179 

bˆ 

tc 

= 

s 

17, 

12546 

= = 25, 

659 > t 

0, 

6674 

bˆ 

0, 

05; 

12 

= 

2, 

179 

0 , 05; 

12 

So, for significance threshold of 5% the both estimators are significantly 

different from zero. 

The correlation report correlation value: 

R = 

2 

∑uˆ t 

( y − y) 

1− 2 

t 

∑ 

= 

41, 

64805 

1− 

= 

2326, 

357 

0, 

991008 

The testing correlation report is made by Fisher- Snedecor test: 

2 

T − k −1 

R 

Fc = ∗ 2 

k 1− 

R 

12 0, 

98209 

= ∗ = 658, 

38435 

1 0, 

0179 

The table distribution Fisher-Snedecor, for a threshold of 

significanceα = 0, 

05 and the number of degrees of freedomν 1 = k = 1 

andν 2 = T − k −1 

= 12 , it takes the value F0 

, 05; 

1; 

12 = 4, 

76 

If Fc = 658 , 38435 > F0 

, 05; 

1; 

12 = 4, 

76 , 

the correlation report is significantly different from zero, for a threshold of 

significanceα = 0, 

05 . 

With a view to verifying the independence of residual variable values will be 

used Durbin-Watson test, which consists of calculating the amount of: 

d = 

n 

∑ 

t= 

2 

( uˆ 

− uˆ 

t 

n 

∑ 

t= 

1 

uˆ 

2 

t 

t−1 

) 

2 

72, 

45473 

= = 1, 

7396 

41, 

64805 

From the distribution table Durbin-Watson, a threshold of significance 

α = 0, 

05 , depending on the number of observationsT = 14 and on the number of 

variables exogenous k = 1 , it takes the values (over the case n = 15 ): 1, 

08 ; d 

1 =



Because d 2 = 1, 36 < d = 1, 

73 < 4 − d 2 = 2, 

64 it can accept the hypothesis of 

independence 

residual variables. 

4. Conclusions and Perspectives 

The correlation determining if the rate of growth for F. graminearum strains and 

the temperature factor is calculated a value of the experimental correlation 

coefficient, which compares the standard value. Similar precede determining 

correlation in the case of P. crysogenum strains. These values lead to the 

conclusions that for these strains there is a linear correlation of the growth rate and 

the temperature in time. Same result was found by other authors using applying 

growth models as the logistical function, the Gomperts model. The primary results 

were tested by the Durbin-Watson test and a good correlation for the residual 

dispersion variation was found. Because these moulds are proved to be 

toxinogenic, further tests will be done in order to obtain models of the mycotoxin 

evolution during the storage. 

References 

1. Almann, E., Rhodes, J.- Mathematical Models in Biology, London, 2003 

2. Bausic, F. - Fundamentals of modeling, Bucharest, Matrix Rom, 2001. 

3. Dantigny, P., Audrey, G., Radoi, F. Bensoussan, M., - Modeling the effect of 

ethanol on growth rate food spoilage moulds, Int.J. Food Microbiol, Feb 15, 98 

(3) :261-9, p. 2005. 

4. Feller, W. - An Introduction to Probability Theory and its Applications, vol.II., 

John Wiley & Sons, Inc., New York, London, 1996. 

5. Ross Sheldom, M. - Introduction to probability models, Amsterdam, Boston, 

London. Academic Press, 2003. 

171



172 

ASPECTS REGARDING APPLICATION OF 

TRACEABILITY 

IN THE PROCESS OF MANUFACTURING LIQUID 

HOP YEAST USED IN BAKING INDUSTRY 

IULIANA BRATU * CECILIA GEORGESCU* 

Abstract: This paper describes how the concept of traceability can be applied within the 

food safety and quality assurance system/HACCP with application in the processing 

chain of liquid yeast for bakery. Unique product identification must be held under control 

and recorded in order to ensure its tracking and finding again throughout its circulation 

in cases of non-compliance, customer complaints or legal responsibility for the product. 

The infrastructure for conformity assessment and registration process, is established, the 

product in different stages in terms of traceability; tools and stages of execution. 

Keywords: traceability, food safety, food quality assurance, HACCP 

Traceability in food quality assurance 

This paper describes some of the requirements for product conformity 

assessment from traceability point of view, instruments and stages for achieving 

traceability. Traceability systems must be able to document product history and/or 

to localise a product along the food chain. They contribute to discover the cause of 

nonconformity and the ability to recall products if necessary. Any traceability 

system must be designed as part of a large management system. Its properties 

should be the result of balancing several requirements, technical and economical 

feasibility. 

Based on the flow chart and graphic representation of certain technological 

aspects regarding production chain of liquid hop yeast for baking industry, entry 

elements from traceability system for product safety achievement are given as 

examples. Record types found along the flow chart and specific to the evaluated 

area with high hazard occurrence jeopardising product safety are mentioned. 

Unique product identification ensures tracing and finding of any product 

during its circulation in case of nonconformity, client complaints and legal 

responsibility for the particular product. 

* University ”Lucian Blaga” from Sibiu, e-mail: ibratu_sb@yahoo.com



The paper presents instruments and levels of traceability, defines traceability 

and what it must achieve. 

H.A.C.C.P. (Hazard Analysis and Critical Control Points) is a system that 

identifies, evaluates and controls significant hazards for food safety. H.A.C.C.P. 

integrated traceability ensures transparency over the route taken by the product 

from manufacturer, through supplier to consumer, proving compliance with 

regulations, quality and product specification requirements, this way winning 

customer trust as well as drawing financial benefits to the producer. 

The objective of this system is dropping the number of nonconformities and 

defects generated by inappropriate traceability and identification. Food products 

traceability must be set in all stages along the food production chain: 

manufacturing-processing-distribution. 

Traceability means transparency along entire food industry. 

Traceability (unique identification)= univocal association of an entity with the 

record that states its (non)conformity, source, history. It applies to certain entities 

(medicines for example) where traceability is a specified requirement and its 

presented as a unique serial number/lot number, manufacturing date/expiry date. It 

is necessary in situations of nonconformity, client complaints, product recalls. 

1. Traceability outline 

Food manufacturing companies developed several levels and types of traceability. 

They set the body, depth and precision of traceability, depending on production 

process characteristics and traceability objectives. 

Traceability body: describes the level of gathered information and it is set 

depending on balance of costs and benefits. 

Traceability depth: In order to obtain safe products, traceability depth depends 

on the points where risks may penetrate producer network. Critical Control Points 

(C.C.P.) are set along the processing chain. 

Traceability precision: reflects the degree of assurance used by traceability 

system in order to precisely determine product characteristics or changes. 

2. Stages of traceability 

Application of H.A.C.C.P. in a company requires on one side input of correct and 

appropriate data, and on the other side storage of this data. Practically, everything 

that was done for the H.A.C.C.P. system, product or process related, system 

managing procedures, recordings that result from its application, comprise the 

documentation that needs activation and regular updating 

173



The existence of a record storage system fulfils one of the most important system 

requirements “product traceability”. This represents the possibility of 

reconstruction of product route at any manufacturing stage using the recorded data. 

Creation of prescription type documents (that may be modified over time) and 

creation of record type documents (that contain data and cannot be modified over 

time) are the main stages of traceability. 

Prescription type documents may be: 

• Flow chart diagrams; 

• C.C.P. monitoring procedures; 

• H.A.C.C.P. checking procedures; 

• H.A.C.C.P. analysis and revision procedures; 

• H.A.C.C.P. audit procedures. 

Record type documents may be: 

• Reports/minutes of the team in charge; 

• Monitoring records; 

• Records related to C.C.P. identification; 

• Records related to deviations occurred and corrective actions taken; 

• Audit reports. 

Record types that may be kept are relate to: 

1) Raw materials and ingredients, for example: 

• Type, source and quality of raw materials; 

• Supplier certification; 

• Inspection results and tests performed on raw materials during reception; 

• Audit records performed at suppliers; 

• Temperature records and/or humidity for storage areas for raw materials 

and environment sensitive ingredients. 

2) Product safety: 

• Records related to efficiency of preventive measures enforced to ensure 

product safety; 

• Records related to expiry dates. 

3. Traceability in manufacturing of liquid hop yeast 

Traceability specifies the manner in which identification process is achieved inside 

the organisation. It is relevant to products /personnel/ organisation/ product status 

following inspections and testing/ nonconformities. It is applied by all departments 

and staff members involved in processes, as with duty chart. 

174



Traceability can be performed in both directions, from the finite product to raw 

materials (following product history), or following the normal manufacturing 

process flux from raw material to finite product. 

In this paper processes were identified and traceability diagrams were shown as 

examples. Because traceability is based mainly on records, for every identified 

process main elements were exemplified (records) from the base of the traceability 

chart. 

Process traceability was sketched using a tree like diagram. 

4.1 Elements of traceability processes 

Elements that are part of traceability system regarding quality assurance/product 

safety at supplier, include: procedures for selection and accept from suppliers, 

procedures for supplier performance monitoring, raw material specifications, etc., 

reception procedure and reception records. 

Process traceability and processing of hop involves control procedures, 

technological procedures and audits. 

4.2 Application of traceability to technological process 

In the flow chart of the technological flux, coding was used to in order to suggest 

the concept of traceability of records. To achieve traceability, each element that is 

part of the system should be encoded. 

Record types that are found in the technological process are: 

• Complete records of manufacturing process; 

• Records related to C.C.P. monitoring; 

• Records of process or procedure modifications; 

• Records related to cleaning and hygiene. 

• Records related to calibration/checking of monitoring and measuring 

equipment. 

• Records involving machinery and equipment maintenance. 

4.3 Traceability inside process control system and C.C.P. (Critical Control 

Points) 

Traceability is achieved through a bar code system following the route starting 

from sampling to the final result also performing statistical analysis of the process. 

Traceability of hop reception involves orders to accepted suppliers involving 

deliveries, status of the raw material, contracts, payments, transport information. 

Qualitative and quantitative reception traceability contains: 

175



• entry and weighting records (reception notes). 

• analysis certificate records 

• declaration of conformity from supplier; 

• internal analysis and conformity records (internal analysis certificates); 

• receipt/note records ( digital storage); 

• audits (involving prior formation and training of audit teams). 

Deliveries to consumers also involve transportation and reception, involving 

qualitative and quantitative checking. 

Storage traceability (main warehouse or factory) is performed using stock lists 

and purchasing orders. 

Fig 1. Example of external traceability diagram from hop producer to beneficiary. 

Figure 1 shows a schematic representation of the interacting elements of 

external traceability. An example of forms that are used in reception process 

traceability is given in table 1. 

Elements that are part of the traceability system ensuring equipment safety 

include the following: 

• hygiene audits; 

176



• records and schedules for maintenance of greasing used equipments 

(ensuring equipment safety); 

• hygiene and maintenance schedules, requirements for materials and 

equipment. 

Traceability for hygiene assurance contains: 

• Procedures and cleaning schedules. 

• Procedure for storage of washing agents. 

• Records of hygiene and cleaning 

• Specifications of cleaning agents 

• Risk analysis for cleaning agents. 

Table 1 

Example of traceability form for supplier certification; 

Traceability of supplied product: hop. 

Supplied Supplier Identification Certification Certification Audit report 

product name code 

type 

date at supplier 

Hop Name ***XXX HACCP dd/mm/yyyy mm/yyyy 

Reception date 

Order number 

dd/mm/yyyy number/ 

dd/mm/yyyy 


Receipt number 

Quality/conformity 

certificate number 

Analysis certificate 

NIR 

number number Letters/number *** 

Traceability is a record storage system that improves production management, 

facilitates monitoring of quality and food safety, differentiate and identifies 

177



food product with subtle and less obvious characteristics; it also ensures 

wining customer trust in food products. 

Implementation of traceability system at all stages of food manufacturing 

process, “from farm to fork” should be capable to identify suppliers for raw 

material and the necessary ingredients for their processing profile and also 

product destination. 

Traceability system is a good practice for risk management in business and 

those organisations that implemented a traceability system may reduce their 

potential losses, as well as those of other collaborators ahead and behind. 

Other advantages of a traceability system are: 

they provides a certificate of conformity for the quality of the supplied product 

ensuring quality control at delivery and batch transparency for safer 

processing and products. 

References 

178 

1. Anghel, I. s.a. Biotehnologia si Tehnologia Drojdiilor. vol. II 

(Biotechnology and Technology of Yeasts), Editura Tehnica, Bucuresti, 

1981; 

2. I. Bratu – Asigurarea calitatii si sigurantei produselor alimentare, (Food 

quality assurance and product safety), Ed. Univ. Lucian Blaga, Sibiu 2001; 

3. Rotaru G., Moraru C., HACCP – Analiza riscurilor. Punctele critice de 

control, (H.A.C.C.P. - Risk analysis. Critical control points), Editura 

ACADEMICA, Galati, 1997; 

4. Banu C. (coordonator) s.a. Manualul inginerului de industrie alimentara, 

vol., (Food science engineering handbook), Editura Tehnica, Bucuresti, 

1998; 

5. Banu C (coordonator) s.a. Manualul inginerului de industrie alimentara, 

vol. II, (Food science engineering handbook), Editura Tehnica, Bucuresti, 

1999; 

6. SR EN ISO 9001:2001 – Sisteme de Management al Calităţii – Cerinţe. 

(Quality management systems –Requirements); 

7. www.codexalimentarius.net 

8. http://europaa.eu.int/comm/food/index_en.html;



BIOLOGICAL ACTIVITY OF SOME SELECTIVE 

EXTRACTS OBTAINED FROM Rosmarinus officinalis L. 

Georgeta NEAGU-CARAENE * , Cornelia NICHITA*, 

Virginia VULTURESCU*, Nicoleta BADEA ** , Cristina BAZDOACA*, 

Georgeta RADULESCU*, Radu ALBULESCU* 

Abstract: The aim of this study was the evaluation of antioxidant activity of some 

selective extracts obtained from Rosmarinus officinalis L. The samples were physically 

and chemically characterized (through chemiluminescence, determination of 

flavonoids, polyphenols and polyphenolcarboxilic acids content) and finally 

biologically tested by quantifying the ability of different concentrations of selective 

extracts to inhibit lipid peroxidation. 

The results revealed a correlation between antioxidant activity (in vitro and ex vivo 

tests) and phenolic/flavonoidic content. The tested selective extracts exhibit a high 

antioxidant activity, which suggest their potential application for prophylaxy and 

therapy of various free radical related diseases. 

Keywords: Rosmarinus officinalis, polyphenols, chemiluminescence, antioxidant activity. 

Introduction 

Many vegetal extracts show a strong antioxidant activity that is linked to the 

presence of substances arising from the secondary metabolism, and whose 

functionality in the plant is not always known. Some species belonging to the 

Labiatae family are good examples; among them rosemary (Rosmarinus 

officinalis), is much appreciated for its aromatic, antioxidant, antimicrobial or 

antitumoural properties [1]. 

The antioxidant activity of plant extracts is due mainly to phenolic compounds, 

which in rosemary extracts belong to three groups: phenolic diterpenes of an 

abietic acid related structure, flavonoids and phenolic acids. Carnosic acid and 

carnosol, abietanes diterpenes, and rosmarinic acid, a hydroxycinnamic acid ester, 

are the main antioxidant compounds present in rosemary. These compounds, 

together with others isoprenoids (mono- and diterpenes, tocopherols, carotenoids 

etc) play a photoprotective role and are considered as bioactive constituents [2,3]. 

* 

National Institute for Chemical-Pharmaceutical Research and Development, Bucharest, Romania, 

e-mail: getabios@yahoo.com 

* 

University POLITECHNICA of Bucharest, Romania, email: nicoleta.badea@gmail.com 

179



The work presents the quantitative determination of flavonoids, polyphenols 

and polyphenol-carboxylic acids and their spectral investigation in IR (4000-400 

cm -1 ) and UV-VIS-NIR (190–2300 nm) domains, in correlation with the 

antioxidant activity in order to assess their potential applications for prophylactic 

and therapeutic purposes. 


Plant material. The rosemary samples (Rosmarinus officinalis L.) consisted of 

dried rosemary leaves obtained from S.C. Fitoterapia S.A., Romania. 

Chemicals. All solvents and standards used (rutin, quercetin, gentisic acid, 

caffeic acid, syringic acid, gallic acid, rosmarinic acid, ascorbic acid) were 

purchased from Sigma-Aldrich. 

Instruments. A chemiluminometer Turner design TD20/20 was used for 

chemiluminescence measurements, a spectrometer V-570 Jasco, Japan - 

spectroscopy UV-VIS-NIR on 190-2300 nm domain, was used for diffuse 

reflection ILN-472, for quantitative determination of flavonoids, polyphenols and 

polyphenol-carboxilic acids and for pharmacological studies. Spectroscopy in 

infrared FT-IR in 4000-400 cm 

180 

-1 domain was performed using a spectrophotometer 

FT-IR 620 Jasco, Japan. 

Extraction of plant material. The selective extracts (RO1, RO2, RO3, RO4) 

were obtained by a succession of technological stages consisting in the first stage 

in the solid-liquid extraction in a Soxlet installation. Following the extraction 

procedure, the vegetal material was removed and the obtained filtrates were 

processed by vacuum concentration until obtaining a residue which was passed 

through successive precipitation with polar and non-polar solvents, centrifugation, 

filtering at low pressure and purification. 

Chemical analysis of the extracts. The samples were characterized by spectral 

techniques (IR, UV-VIS-NIR) and chemiluminescence. The quantitative 

determination of the flavonoids, polyphenols, polyphenolcarboxilic acids and the 

evaluations of the specific physical-chemical indicators were done according to the 

FR X and the European Pharmacopeea [4,5,6]. 

Antioxidant activity. Antioxidant activity of the four fractions (RO1, RO2, RO3, 

RO4) and of the reference substances (ascorbic acid, gallic acid and caffeic acid) 

was evaluated by quantifying the ability of different concentrations of the samples 

to suppress CCl4-induced lipid peroxidation in rat liver homogenates. 

Liver homogenates were prepared from male Wistar albino rats weighing 

250±10g, intoxicated with carbon tetrachloride (CCl4) (2ml/kg/p.o. 20% v/v in 

sunflower oil) or treated only with the vehicle. Liver homogenates from untreated 

animals served as control.



Rats were sacrificed 24 hours after, followed by excision of the liver, its washing 

in ice-cold 0.15 saline and cutting into small pieces using scissors before 

homogenization in ice-cold 0.1 M phosphate buffer, pH 7.4, at 4ºC with a Potter- 

Elvehjem glass homogenizer. 

Aliquots of liver homogenates were incubated with 10 and respective 20 µg 

sample/ml in a termostat at 37 ºC for 1 hour. The incubation was stopped by adding 

ice-cold 20% trichloroacetic acid and the incubates were centrifugated at 1000 g 

for 10 min. The assessement of the extent of lipid peroxidation relied on individual 

determinations of MDA contents in sample supernatants by performing the TBARS 

assay [7]. 

MDA is an end product of peroxidative decomposition of polyenoic fatty acids in 

the lipid peroxidation process and its acumulation in tissues is indicative of the 

extent of lipid peroxidation. TBARS reagent (1 ml) was added to a 0.5 ml of 

sample and the sample was heated for 15 min at 100 ºC [8]. 

The amounts of peroxides formed in liver homogenates during incubation were 

determined spectrophotometically by measuring absorbance at 535 nm. The 

inhibition of lipid peroxidation as percentage was calculated by following equation: 

⎛ T − M ⎞ 

% protection = ⎜1− 

⎟x100 , 

⎝ I − M ⎠ 

where “T” was the absorbance in the presence of the sample, “M” was the 

absorbance of the positive control reaction and “I” was the absorbance of the 

negative control reaction . 

High absorbance was an indication of a high concentration of formed peroxides. 

Table 1. 

Physical-chemical characteristics of the samples 

Samples RO1 RO2 RO3 RO4 

Ash % 2.17 2.33 2.51 2.98 

Humidity % 4.25 3.68 4.11 3.84 

Flavonoids, mass % (as rutin) 5.03 4.37 2.36 2.54 

Polyphenols, mass % (as gallic acid) 3.94 3.38 3.36 1.92 

Polyfenolcarboxilic acids, mass % 

(as caffeic acid) 

2.63 2.04 1.75 0.83 

Hydroxicinnamic derivates, % (as rosmarinic acid) 1.44 0.95 0.85 0.79 


The variation of the operational parameters, respective the fine degree of the 

plant, the solvent, the used plant/solvent ratio, the time of extraction, the 

181



temperature, the type of concentration, precipitation and purification, resulted in 

obtaining of four yellow, non-hygroscopic fine samples: RO1, RO2, RO3 and 

RO4. 

The results of the quantitative determination of the flavonoids, polyphenols, 

polyfenolcarboxilic acids and specific physical-chemical indicators is shown in 

table 1.The spectra FT-IR of the samples (RO1, RO2, RO3, RO4) are presented in 

figure 1 and their assignment in table 2. 

182 

FT-IR data of the samples 

ν (cm -1 ) Assignment 

3440 - 3420 ν OH / ν NH 

2950 – 2850 νCH /ν CH2 

ν CO (acids COOH and COO - 1730 – 1688 

) 

1608 -1611 aromatic structure 

1280 – 1030 δ OH (aromatic) + δ OH (aliphatic) 

1000 – 750 Substituted aromatic ring 

Fig. 1. IR spectra of the 

selective extracts 

Table 2. 

Comparing the spectra of the vegetal bio-products (RO1, RO2, RO3) with the 

spectra of the standards (rutin and quercetin), we noted the presence of common 

bands, specific for phenolic and flavonoidic structures.



UV-VIS characteristics of the samples. The samples in ethanolic solvent have 

similar electronic spectra, which come from structures with an extended 

conjugation (table 3). 

In case of concentrated solutions the bands from 410 to 445 were also noticed in 

accordance with their light yellowish color, assessed to conjugated systems of 

polyphenol and/or flavonoid compounds. 

UV-VIS-NIR characteristics of solid samples. The solid fractions were tested by 

diffuse reflectance in UV-VIS-NIR domain (table 4 and figure 2). 

Table 3. 

UV-VIS data of the samples in EtOH 

Domain 

Sample 

λ(nm) 

RO2 

Identification 

RO1 

RO3 RO4 

210 - 215 212 211 211 211 π → π * transition 

π → π * 275 - 285 282 283 278 280 (u) transition 

340 - 350 344 341 343 349 conjugated structures 

Spectral characteristics in UV-VIS-NIR 

Samples λ, nm 

RO1/RO2 245 

291 

339 

RO3/RO4 245 

289 

331 

417 

455 

487 

535 

417 

459 

501 

539 

613 

671 

615 

671 

1195 

1461 

1711 

1195 

1461 

1722 

1821 

1931 

2063 

1851 

1941 

2069 

Table 4. 

Fig. 2. UV-VIS-NIR spectra of 

the samples 

The bands in UV-VIS 

domain are assigned to the 

same transition bands 

discussed for the tests in 

ethanol solution, but in 

addition the bands from 612 to 

183



672 nm appear assessed conjugated systems extended with more than 

four aromatic 

cycles. 

The bands in NIR domain can be assigned to harmonics and combination of 

valence and deformation 

vibrations of CH2/CH3 groups and OH existent in 

polyphenol structures. 

Chemiluminescence test. The antioxidant activity of the selective extracts 

was 

evaluated 

through chemiluminescence. The results are reported in table 5. 

184 

Chemiluminescence characteristics of the samples 

Table 5. 

No. Sample code k (s -1 ) vi (s -1 ) AA(%) 

1 RO1 0.094 307.2 97.05 

2 RO2 0.097 121.02 92.17 

3 RO3 0.091 184.51 93.21 

4 RO4 0.073 607.00 79.51 

5 Rutin 0.094 293.40 78.40 

6 Quercetin 0.100 118.84 92.80 

7 Gentisic acid 0.108 476.20 59.80 

8 Caffeic acid 0.071 318.00 82.90 

9 Rosmarinic acid 0.051 285.60 89.20 

10 Syringic acid 0.063 808.00 64.00 

11 Gallic acid 0.113 166.46 85.70 

The antioxidant activity of the samples RO1, RO2 and RO3 was comparable to 

that of quercetin (92.8%) and higher than that of other polyphenols and 

polyphenolic acids. 

The qualitative and quantitative content in phenolic and flavonoidic constituents, 

confirmed by spectral analysis and chemiluminescence determinations, explain 

the 

high value of the antioxidant activity of the samples, especially for the RO1. 

Inhibition of Lipid Peroxidation Assay. The results of lipid peroxidation assay 

(fig. 1) showed that different fractions of the Rosmarinus officinalis extract have a 

very strong antioxidant activity, successfully attenuating the effects of CCl4, in a 

concentration-dependent manner. At concentrations of 20 μg/ml homogenate, two 

from the four fractions were more potent (98.2% and respective 91,1%) than 

ascorbic acid (90,8% ), gallic acid (80,3%) and caffeic acid (78,4%) in their 

antioxidant activity.



A correlation between antioxidant activity and phenolic 

content was observed for 

the all four fractions. 

100 

90 

80 

70 

60 

AA % 50 

40 

30 

20 

10 

0 

therapeutic purposes. 

Conclusions 

Inhibition of lipid peroxidation 

RO1 RO2 RO3 RO4 Caf. 

Ac. 

Samples 

Gal. 

Ac. 

Asc. 

Ac. 

Fig. 3 . The results of 

lipid 

peroxidation assay 

Both series of ex vivo 

an in vitro tests for 

evaluation of antioxidant 

activity suggest 

the use of 

selective extracts obtained 

from Rosmarinus 

officinalis L. for 

prophylactic and 

The extractive processes conducted to the obtaining of four selective extracts 

from Rosmarinus officinalis L. 

Spectral investigations (IR, UV-VIS-NIR) of the samples emphasized the 

presence of some 

phenolic and flavonoidic structures, also confirmed by 

quantitative determination of the flavonoids, polyphenols and polyphenolcarboxilic 

acids. 

The results of the pharmacologic ex vivo tests revealed that the selective extracts 

obtained from Rosmarinus officinalis L. exhibit high antioxidant activity, being in 

accordance with the values 

provided by chemiluminescence in vitro tests and thus 

suggesting 

their potential application for prophylaxy and therapy of various free 

radical 

related diseases. 

Note: 

Study supported by National Authority for Scientific Research – Project 

PNCDI2 61-014/2007. 

References 

1. Lo, A.H., Liang, Y.C., Lin-Shiau, S.Y., Ho, C.T., Lin J.K.: Carnosol, an 

antioxidant in rosemary, suppresses inducible nitric oxide synthase through 

down-regulating nuclear factor-kappaB in mouse macrophages. In: 

Carcinogenesis, vol. 23(6), 2002, p.983-91. 

2. Almela, L., Sanchez-Munoz, B., Fernandez-Lopez, J.A., Roca, M.J., Rabe, V.: 

Liquid chromatograpic-mass spectrometric analysis of phenolics and free 

185 

10 µg 

20 µg



radical scavenging 

activity of rosemary extract from different raw material. In: 

Journal of Chromatography A, vol. 1120, 2006, p.221-229. 

3. Mahmoud, A.A., AL-Shihry, S.S., Son, B.W.: Diterpenoid quinines from 

Rosemary (Rosmarinus officinalis L.). In: Phytochemistry, vol 66, 2005, p.1685- 

1590. 

4. Farmacopeea romana, ed.a X-a, Bucuresti, Ed. Medicală, 1993, p 335. 

5.***European Pharmacopeea, ed.6.0, Monographia Rosemary leaf, p. 2840; 

6. Balaban, A.T., Banciu, M., Pogany, I.: Applications of physical methods in 

organic chemistry, Bucuresti., Ed. Stiinţifică- Enciclopedică, 

1983, p23. 

7. Draper, H.H., Hadley, M.: Malondialdehyde determination as an index of 

lipid peroxidation. In: Methods Enzymol., vol. 186, 1990, p.421-31. 

8. Ljubuncic, P., Dakwar, S., Portnaya, I.: Aqueous Extracts of Teucrium polium 

posses remarkable antioxidant activity in vitro. In: eCAM, vol. 3(3), 2006, 

p.329-338. 

186



CENTAUREA CYANUS L.-HERBA, 

CHEMICAL COMPOSITION AND THERAPEUTICAL 

POTENTIAL 

L. PÎRVU 1 , A. ARMATU 1 , I. RAU 2 , 

S. ŞCHIOPU 3 , D. COPREAN 3 

Abstract: Intense utilization of Centaurea cyanus 

L. in the cosmetics 

industry is generally du e to its vessel tonic, antimicrobial and 

antioxidant/anti-inflammatory properties of the contained anthocyanins, 

flavones, phenolcarboxilic acids and polysaccharides. Although 

all these 

properties make po ssible the obtaining of many other new pharmacologicalactive 

products, literature indicates mildly utilization of species in the 

pharmaceutic industry. Consequently, this paper aims at proving gastroprotective 

potential of one selective plant extract containing polysaccharide 

and, respectively, polyphenol fractions obtained from Cyani-herba. 

Keywords: Centaurea cyanus L.-herba, gastro-protective potential 


Centaurea cyanus L. (Asteraceae), also called blue cornflower or bachelor 

button, is spread all over in Europe and Western Asia, especially in the 

corn fields. 

As interest compounds, literature data report flavonoids and phenolcarboxylic 

acids. 

Among flavonoids are listed: centaurocyanin 

(cyanidin-3-succinylglucoside-5glucoside), 

rutoside, cosmosiin (apigenin-7-glucoside), apiin (apigenin-7-Oapiosyl-glucoside), 

hispidulin (5-methoxy-apigenine), rhamnetin and izorhamnetinglycosides, 

kaempferol-glycosides, luteolin-glycosides, quercetin and naringin [1- 

3]. 

Centaurocyanin (I) 

Referring to phenolcarboxylic acids content, G.S. studies mention 23 acids: 

chlorogenic, cis- and trans-caffeic, p-hydroxybenzoic, p-coumaric, vanillic, 

syringic, ferulic, salicylic, p-hydroxy-phenylacetic, o-hydroxyphenylacetic, 

benzoic, cis- and trans-sinapic and another 9, less known, phenolcarboxylic acids 

1 National Institute for Chemical Pharmaceutical R&D, Calea Vitan 112, Bucharest, 

Romania 

2 POLITEHNICA University, Polizu 1, Bucharest, Romania 

3 OVIDIUS University, Mamaia 124, Constanţa, Romania 

187



[4]. In the flower head part have been found neochlorogenic and izochlorogenic 

acid, also [5]. 

Besides polyphenols compounds, analytical 

studies mention amino acids [3], sugars (glucose, 

fructose, zaharose, raffinose) [5] and coumarins 

(scopoletin, umbelliferone) presence [6]; in some 

species of Centaurea, but not in C. cyanus, have 

been found toxic sesquiterpene lactones [7]. 

Intense utilization of Centaurea cyanus L. in the 

cosmetics industry, especially flower 

head part, is generally due to its vessel tonic, 

antimicrobial and antioxidant/anti-inflammatory 

properties of the contained 

anthocyanins, flavones, phenolcarboxilic 

acids and polysaccharides. 

Although all these properties recommend C. cyanus for the obtaining of many 

other new drugs, food supplements 

or medicines, literature data indicates only 

mildly utilization of species in 

the pharmaceutical industry. 

Consequently, this paper aims 

at proving gastro-protective potential of one 

selective plant extract containing two fractions, polysaccharide and, respectively, 

polyphenol fractions, isolated from indigenous Cyani-herba. 

2. Material and Methods 

Reagents 

o Methanol, ethanol and distilled water as dissolving/extraction solvents. 

o Hexan, ethyl acetate, formic acid, acetic acid and distilled water (p.a.) as TLC 

developants; 

Test ed products/extracts: 

o Centaurea cyanus L.-herba/Cyani-herba, 

o Selective extract obtained from Cyani-herba based on two active fractions,, 

polisaccharide 

and polyphenol fractions; 

Reference compounds: 

o Analitical studies 

have been fulfilled using 15 reference compounds (Sigma, 

Aldrich) such as: quercetin, 

rutin, quercitrin, isoquercitrin, hyperoside, 

apigenine, cosmosiin, vitexine, isovitexine, 

luteoline, luteolin-7-glucoside, 

caffeic, chlorogenic and rosmarinic acids and umbelifferone. 

o Antioxidant activity (AA%) have been measured 

in vitro, chemiluminescence 

method, comparatively to a commercial drug based on green tea total extract 

containing 7% epigallocatechin 

gallates; 

188



o In vivo gastro-protective activity have been tested on two groups of Wistar 

rats with stress-induced ulcer. 

Selective plant extract obtaining 

Selective plant extract obtained from Cyani-herba was designed to contain two 

fractions: 

-one major fraction reach in polysaccharides described [8] with high bio-adhesive 

properties at the level of damaged gastric mucosa 

and 

-one major fraction reach in specific polyphenols, flavones with two -OH groups 

at phenyl ring and caffeic acid derivates, 

able to reduce acid secretion and gastric 

inflammation 

[9-19]. 

In this respect, Cyani-herba have been extracted first with water and second with 

ethanol at reflux in order to isolate polysaccharide and, resp. polyphenol fractions. 

Resulted 

fractions, grey powders, have been combined such a way to obtain one 

standardized selective plant extract with 4.2 % total 

flavones expressed as 

izoquercitrin 

and 1.8% total phenols expressed as caffeic acid. 

Analitical studies 

Qualitative analyses for flavones and phenylcarboxilic acids were carried out 

using standard TLC methods [20]. 

Quantitative analyses for flavones, phenol-carboxilyc acids and polisaccharides 

have been fulfilled using FR X methods [21]. 

Mineral content measured by AAS technique. 

Pharmacological studies 

In vitro antioxidant properties have been studied using chemiluminescence’s 

method 

(system: luminol-H2O2, TRIS-HCl 0.2N, pH=8.6) [22] and antioxidant 

activity calculated as percents (AA% ). Were tested solutions of 0.2% solved into 

distilled 

water (mass). 

In vivo gastro-protective activity was studied on Wistar rats with stress-induced 

ulcer. 

Apparatus 

o Extraction system - KPG glass and stirrer – Jena (Germany). 

o Spectrophotometer Helios γ (Thermo Electron Corporation). 

o A.A.S. - Vario 6, Analityk Jena (Germany) 

o UV lamp – Camag (Switzerland). 

o Ultra-sounds bath (US bath) – Sonorex Super RK103H 


Qualitative analyses for flavones and phenylcarboxylic acids 

have been 

performed according TLC Atlas - Plant Drug Analyses 

[20]: 

Adsorbent: Silica gel 60F254 – precoated TLC plates (Merck, Germany); 

189



Solvent system: Ethyl acetate-formic acid- acetic acid gl.– distilled water 

(100:11:11:26); 

Reference compounds: Sigma/Aldrich 

polyphenols prepared as standard 

-3 

solutions 10 M solved into methanol p.a. - 10 to 20μl of these standard solutions 

applied at the starting line. 

Identification: pulverization with NP/PEG (natural products reagent) and 

exposure 

at 366nm. 

Obtained chromatograms revealed at least 15 fluorescent (fl.) spots attributed as 

following: 

-Rf~0.13 

/ Rf~0,19 - two orange fl. spots attributed to some quercetin 

polyglycosides; 

-Rf~0.4 – an orange fl. spot attributed to rutoside; 

-Rf~0.49 

/ Rf~0.55 - two blue fl. spots attributed to chlorogenic and neochlorogenic 

acids. 

-Rf~0.51- 

dark-green spot attributed to naringine; 

-Rf~0.67- major 

red-orange fl. zone attributed to a mix of quercetin-7-glucoside 

and quercetin-3-glucoside (izoquercitrin) 

fl. spot attributed to an apigenin monoglycoside (cosmosiin or 

5-0.99 – caffeic acid blue fl. spots; 

main polyphenols compounds present in indigenous Cyani-herba and 

4 ; 

-Rf~0.75 - green 

vitexine); 

-Rf~0.83 - orange spot attributed to quercetin-3-rhamnoside (quercitrin); 

-Rf~0.9 

-Rf~0.98 – umbeliferone indigo fl. spot; 

-Rf~0.99 – yellow-orange fl. spot attributed to quercetin, apigenine and naringenine 

aglicones. 

Thus, TLC studies revealed quercetin, apigenin and caffeic acid derivatives as 

being the 

consequently selective extract. 

Apigenin Quercetin Caffeic acid 

4 

Presence of these two quercetin monoglycosides is sustained by three major 

arguments: spot colour, (orange colour is specific for flavones having two free -OH groups 

at B ring), Rf value (7-monoglycosides have Rf values higher than omologues 3monoglycosides) 

and spectral analyses made on methanolic extracts obtained from this spot 

treated with AlCl3 in base medium (λmax.=430nm). 

190 

HO 

OH 

COOH



Quantitative analyses of flavones and total phenols from Cyani-herba and 

obtained selective plant extract have been fulfilled using standard 

spectrophotometric methods. 

Obtained results are presented in Table 1. 

Quantitative composition of tested products 

Tested products Flavones 

(%) mass (%) 

a 

Total phenols b 

mass 

Cyani-herba 1. 6 0.4 

Selective extract 3.2 2.8 

a 

expressed as isoquercitrin/quercetin-3-glucoside. 

b 

expressed as caffeic acid 

Table 1 

Referring A.A.S. investigations, Cyani-herba and resulted selective extract 

revealed the following mineral composition: 

- Centaurea cyanus L.-herba collected from Fundulea region contains: K 5.75%, 

Ca 2,46%, Mg 

0. 27%, Na 0.02%, Fe 0,0175, Mn 0.0061% and Zn 0. 0052% 

(mass); 

- selective extract 

contains: K 15.49%, Ca 5.21% , Mg 0.76%, Na 0.11%, Fe 0.02, 

Mn 0.017% and Zn 0. 014% (mass). 

No heavy metals have been found (Cr, Cd, Pb, Co, Cd). 

Pharmacological results 

Antioxidant activity of this selective plant extract obtained from Cyani-herba 

have been measured in vitro, using chemiluminescence’s method – system 

luminol/H2O2. 

Studies fulfilled face to one commercial drug based on Camellia sinensis L. 

(green 

tea) total extract containing 7% epigallocatechin gallates, 

ones of the most 

powerful natural 

antioxidants. 

In vitro studies shown a high 

antioxidant activity of this selective plant extract 

(AA=96%), similar to that shown of reference drug based on green tea total extract 

(AA=98%). 

In vivo gastr o-protective potential of this selective plant extract fulfilled on 

Wistar rats with stress-induced ulcer. 

Gastric lesions have been obtained by immobilization and immersion of rats, four 

hours into cold water. 

Wistar rats have been grouped as following: 

- group 1 - exposed-untreated group – animals have been stressed four hours in 

cold water. After 

this, animals have been killed and the length and type of each 

gastric lesions were measured; 

191



- group 2 - exposed-treated group – one hour before stress experiment animals 

received 500mg of selective extract obtained 

from Cyani-herba per kg body/p.o. 

Four 

hours later, animals killed and the length and type of each gastric lesions have 

been measured. 

Gastro-protective activity (expressed as protection 

percent/±P%) was calculated 

by measuring the total length of the superficial, medium and deep gastric lesions of 

the exposed-treated group comparatively to exposed-untreated group. 

Table 2 presents obtained results. 

Table 2 

Gastro-protective potential of tested product 

N ote: 

X ± ES = standard deviation, 

n = animals, 

t; p< Student's 

t test; 

± P% = protecti on percent 

Thus, in vivo pharmacological studies shown this selective 

plant extract obtained 

from Cyani-herba as giving protection pe rcents ( ±P%) of 100%, 88% and, 

r espectively , 80% (p



Active compounds are: anthocyanins, flavones, phenolcarboxilic acids and 

polysaccharides. 

Intense utilization of species, especially flower head part, is generally 

due to its 

vessel 

tonic, antimicrobial and antioxidant/anti-inflammatory properties. 

Although all these biological properties are very useful for many other natural 

products, 

corn flower is less utilized in pharmaceutical industry. 

Consequently, it was proposed the obtaining of one selective plant extract 

enriched 

in polysaccharides with bioadhesive properties and polyphenols able to 

reduce gastric acid 

secretion and inflammation proces, in the final purpose of 

demonstrating 

of gastro-protective potential of Cyani-herba. 

In this respect, have been obtained one standardized selective plant extract 

with 

4.2 

% total flavones expressed as izoquercitrin and 1.8% total phenols expressed as 

caffeic acid. 

Qualitative analytical studies made on Cyani-herba and correspondingly selective 

standardized plant extract shown at least 15 active compounds: quercetin-3glucorhamnoside, 

apigenin-7-glucoside, quercetin-7-glucoside, quercetin -3glucoside, 

apigenin-8-C-glucoside or apigenin-7-glucoside, quercetin, apigenin, 

naringenine, 

caffeic, chlorogenic and neochlorogenic acids, as well as, 

umbeliferone. 

A.A.S studies 

revealed indigenous Centaurea cyanus L.-herba as containing: K- 

5.75%, 

Ca-2,46%, Mg-0.27%, Na-0.02%, Fe-0,0175, Mn-0.0061% and Zn- 

0.0052%. Selective plant extract have been shown as containing: K-15.49%, Ca- 

5.21%, Mg-0.76%, Na-0.11%, Fe-0.02, Mn-0.017% and Zn-0.014% (mass). 

No heavy metals have been found. 

Chemiluminescence’s studies revealed this selective plant extract as having an 

antioxidant activity 

similar to that of one commercial drug based on green tea total 

extract 

containing 7% epigallocatechin gallates, ones of the most effective 

antioxidant coming from plant world. 

Pharmacological studies carried out on Wistar rats with stress-induced ulcer 

shown a very gastro-protective activity (protection percents over 80%) of 

this 

selective plant extract, confirming thus 

our former suppositions referring to gastroprotective 

potential of indigenous Centaurea cyanus L.-herba. 

References 

1. Takeda Kosaku, Tominaga Satoko, 

Bot. Mag. 1983, 96(1044), p359-363; 

2. Hodisan Viorica, Tamaş M., Meşter Ileana, Clujul Medical 1985, 58(4), p378- 

381; 

3. LitvinenkoV.I., Bubenchikova V.N., Khim. Prir. Soedin. 1988, 6, p792-795; 

4. Swiatek Lucjan, Zadernowski Ryszard, Acta Acad. Agric. 

Tech. Olstenensis 

Technol Aliment. 1993, 422(25), p231-239; 

193



5. 

Muravieva D.A., Bubenchikova V.N., Khim. Prir. Soedin. 1986, 1, p107-108; 

6. Bubenchikova 

V.N., Khim. Prir. Soedin. 1990, 6, p829-830; 

7. Nowak Gerard, Holub Miroslav, Acta Soc. Bot. Pol. 1989, 58(1), p95-102; 

8. Schmidgall J., Schnetz E., Hensel A., Planta Med 2000 feb; 66(1), p48-53; 

9. Parmar 

N.S., Int. J. Tissue React. 1983, 5(4), p415-420; 

10. Martin M.J, Motilva V., Alarcon DE LA Lastra C., Phytother. Res.1993, 7(2), 

p150-153; 

11. Parmar N.S., Ghosh Manindra N ., Eur. J. Pharmacol 

1981, 69(1), p25-32; 

12. Martin M.J., Marhvenda E., Pharmacology 1994,49(3), p144-150; 

13. Alarcon DE LA Lastra C., Martin M.J., Motilva V., Pharmacology 

1994,48(1), 

p56-52; 

14. Hope William C., Welton Ann F., Fielder NASY Christa, Biochem. 

Pharmacol. 1983, 32(3), 367; 

15. Barnaulov O.D., Manicheva O.A., Yasinov R.K., Yakovlev G.P., Rastit. Resur. 

1985, 21(1) , p85-90; 

16. Barnaulov O.D., Manicheva O.A., Khim. Farm. Zh. 1984, 18(8), p935-941; 

17. Barnaulov O.D., Manicheva O.A., Komissarenko N.F., Khim. Farm. 

Zh. 1983, 

17(8), p946-951; 

18. Zhang Mingfa, 

Shen Yaquin, Liu Xiaoping, Tiannan Chanwu Yanjiu Yu Kaifa 

1991, 3(1), p40-44; 

19. Hudson E.A., Dinh P.A., Kokubun 

T., Simmonds M.S., Gescher A., Cancer 

Epidemiol Biomarkers Prev, 2000, 9(11), p1163-70; 

20. Wagner H., Bladt S., Plant 

Drug Analysis, Second Edition, 1996, p195-245; 

21. FRX, VIII, p335, IX.D.9, P1063; 

22. Megea A., Iftimie N., Giurginca M., Papadopoulos K., Revista de chimie, 54, 

nr.11, 2003, p885-887; 

194



CORRELATION BETWEEN ACTIVE PRINCIPLES 

NATURALLY PRESENT IN SOME VEGETAL 

PRODUCTS AND SEDATIVE ACTIVITY 

S. COLCERU-MIHUL 5 , A. ARMATU 1 , S. NITA 1 , N. 

MANAILA 1 , M. PANTELI 1 , I. RASIT 1 , M. ICHIM 6 

Abstract: Classes of vegetal compounds like triterpenic acids, polyphenols 

or microelements exhibit sedative activity. In this study, by processing of a 

mixture of three vegetal species or their active fractions (Achillea millefolium 

L., Lavandula angustifolia Mill., Melissa officinalis L., Origanum vulgare L., 

Crataegus sp.), some bioactive products were obtained. These products were 

physico-chemical characterized. The sedative action was tested by using the 

grip strength test assessing neuromuscular function in rodents. Depending on 

chemical composition, the bioactive products showed various effects – 

obvious, weak or absent . 

Keywords: vegetal extracts, sedative. 

In the latest years there are an increase of nervous system diseases reflected by 

insomnia, headaches, depressions, anxiety. The main causes are stress, inadequate 

diet, diseases, traumas, noise and pollutants. 

The possibility to treat CNS disorders with medicinal plants traditionally used in 

ethno-medicine is now confirmed by modern medicine through researches 

concerning the therapeutic potential of some vegetal species based on chemical 

composition. 

Our research objective was the obtainment of phytotherapeutical products with 

sedative activity by processing a vegetal material mixture of three of the following 

species : Lavandula angustifolia Mill. (lavender), Melissa officinalis L. 

(lemonbalm), Origanum vulgare L.(marjoram), Achillea millefolium L. (yarrow) si 

Crataegus monogyna Jacq + Crataegus oxyacantha L. (hawthorn) or by combining 

three selective fractions obtained from the above species, traditionally used in our 

country as remedies for central and vegetative nervous system disorders. 

Lavender oil is used as sedative and antidepressant agent (1), lemonbalm is 

recommended in neurasthenia, headaches and nervous gastropathy, yarrow has 

5 National Institute for Chemical-Pharmaceutical Research and Development, Bucharest, ROMANIA 

6 SC BIOING SA 

195



antiseptic action, marjoram has antispastic and sedative action (on central nervous 

system – CNS and especially on brainstem respiratory centres) and 

also 

antidepressant, anxiolytic and antiepileptic activities(2). Hawthorn is recommended 

for mild-to-moderate 

anxiety disorders (3). 

The above mentioned species contain several classes of compounds with benefic 

effects on central 

and vegetative nervous system: 

-Millefolii flos flavones have spasmolytic and anxiolytic effects due to periferic 

arteries dillatation.(4) Quercetin and relat ed flavonoids (myricetin, fy setin, luteolin) 

have a pronounced neuroprotective capacity 

extended on glial cells and capillary 

also ( 5) ; 

-Triterpenic compounds (ursolic and oleanolic acids rich extracts of Lavandulae 

flos, Melissae folium, Origani herba, Crataegi flores cum folium) have benefic 

effect in cognitive 

deficiencies 

by 

acetylcholinesterase 

inhibition and thus they could 

be used in Alzheimer 

treatment (2,6). Also, 

triterpenic compounds 

together with other active 

principles from the vegetal 

species show sedative activity 

(7); 

-Microelements like Ca and 

Mg from Lavandulae flos, 

Mg from Melissae folium, 

Ca, Mg K, Zn from Origani 

herba and Millefolii flos, Ca, 

Zn from Crataegi flores cum 

folium show sedative, 

antidepressant, anxiolytic, 

antiepileptic, 

antihyperkinetic, spasmolytic 

activities, therefore they are used as adjuvants in neurosis, headaches, insomnia, 

depressions, 

anxiety, epilepsy and Alzheimer's disease therapy (8). 

1. Material and Methods 

Vegetal material consists of: 

- dried and grounded 

Lavandula angustifolia Mill. flowers (Lavandulae flores) 

196



-dried and grounded Melissa officinalis L. leaves (Melissae folium) 

-dried and grounded Origanum vulgare L. aerial parts (Origani herba) 

- dried and grounded Achillea milefolium L. flowers (Millefolii flores) 

- dried and grounded Crataegus sp. flowers and leaves (80% Crataegus 

monogyna 

Jacq.+ 20% Crataegus oxyacanta L.)(Crataegi folium cum flores). 

– Lavandulae flos, Melissae folium and Millefolii flos; 

vegetal material/ solvent rate - 1/10 m/v at the boil 

for 1 hour under continuous stirring. After filtrati 

concentrated under reduced pression (72-74 mmHg) and 

material/ aqueous extract rate = 1/1 m/v 

-2 x ethyl alcohol extraction of active principles fro 

after water extraction, vegetal material/ solvent rat 

temperature of the solvent for 1 hour under continuo 

reunited alcoholic solutions were concentrated und 

mmHg) and 30-35 o C to a vegetal material/ alcoholic 

-water and alcoholic extracts blending for 10-20 mi 

-separation of a wet precipitate by filtration under reduced pressure; precipitate 

drying in an oven at 40 o Methods for the products obtainment, according to technologic scheme 1: 

Products P1-P3 were obtained by: 

-water extraction of active principles from different mixtures: 

P1 

P2 – Lavandulae flos, Melissae folium, Crataegi folium cum flores; 

P3 – Lavandulae flos, Origani herba, Crataegi folium cum flores; 

ing temperature of the solvent 

on, the aqueous solution was 

50 

C and ; after grinding, the fi 

were obtained. 

o C to a vegetal 

m the vegetal material resulted 

e - 1/10 m/v at the boiling 

us stirring. After filtration, the 

er reduced pression (72-74 

extract rate = 1/1 m/v. 

nutes under continuous stirring 

nal products as fine powders 

Products P4-P6 were obtained by: 

-water extraction of active principles from each species and aqueous solution 

concentration to aqueous extract in the same conditions 

as in above method 

-repeated ethanol extraction, reunification and extractive 

solutions concentration 

in the same conditions as in above method 

-blending of aqueous and alcoholic extract from each species, 

precipitate 

separation, drying and grinding in the same conditions 

as in above method and 

obtaining of selective fractions as fine powder 

-selective fraction mixing as followed: P4 (Lavandulae flos, Melissae 

folium, 

Millefolii flos selective fractions), P5 (Lavandulae flos, Melissae folium, Crataegi 

folium cum flores selective 

fractions), P6 ( Lavandulae flos, Origani herba, 

Crataegi folium cum 

flores selective fractions). 

197



Analitical methods 

Identification of flavones and polyphenolic acids by thin layer chromatography 

using Silica Gel 60F254 as stationary phase and a mixture of ethyl acetate-formic 

acid-acetic acid-water (100:11:11:27) for chromatographic elution, identification 

in 

UV 

at 254nm and 360nm. 

Identification of triterpenic saponins by thin layer chromatography using Silica 

Gel as stationary phase and a mixture 

of benzene-chloroform-methanol (30:16:16) 

as developing solvents and 10% sulphuric acid methanolic solution 

as identification 

reagent. Ursolic acid appear at Rf=0.64 as pale violet spot and oleanolic acid at 

Rf=0.69 as dark violet spot. 

The quantitative analysis of flavones was made using a colorimetric 

method 

based on their property of forming stable yellow compounds with Al 

roperty of forming with nitric acid nitron 

: a 

X-th Ed., cap IX C17. 

3+ . Rutoside 

and quercetin were used as reference substances. 

The quantitative analysis of o-dihydroxy phenols was made using a 

colorimetric method based on phenol’s p 

compounds or oximes that, due to their weak acid nature, can be dissolved in 

alkaline solution giving red colors. Caffeic acid was used as reference substance. 

The quantitative analysis of triterpenic saponins was made using a UV 

spectrophotometric method. The spectra measurements of sapogenols were made 

using a solution of sulphuric acid revealed three regions of absorbtio 

frequency region at about λ= 280-285, λ=302-320nm and another frequency region 

between 405-410nm. Ursolic acid was used as reference substance. 

The quantitative analysis of minerals was made according to Romanian 

Pharmacopoeia, 

Pharmacological methods for sedative 

activity asessement 

Grip strength test assessing muscular strength or neuromuscular function 

in 

rodents influenced by sedative drugs, muscle relaxant compounds or toxic agents 

(9, 10). The test was adapted to accomplish 

the plant extracts. Male mice with an 

average weight of 22 g were used. The animals were selected for their normal 

reactivity (the ability to catch a horizontal thin threat or metallic wire suspended 

about 30 cm into the air with the hind limbs and 

to climb up within 5 sec.). After 

oral administration of the extracts (25 mg/kgbw – in repeated doses), the animals 

were tested for their ability every 15 min. The animals were observed for their 

behavior in the cages. Because their behavior and motility in the cage seemed to be 

normal, the disturbance of the grasping reflex 

was be considered as caused by 

198



central relaxation. The 

percentage of animals loosing the catching reflex was 

calculated 

and expresses the sedative action by: 

-obvious effect: mean grasping time more than 20 sec 

-weak effect: mean grasping time 5-20 sec 

-absent effect: mean grasping time up to 5 sec 


By processing 200g vegetal material – mixture of three species or mixture of 

three selective fraction from each 

species – were obtained: 

-15.4g bioactive product P1 



-21g bioactive product P4 

-24g bioactive product P5 

-23.7g bioactive product P6. 

Flavones, o-dihydrophenols and triterpenic compound were identified in all 

bioactive products. 

The results regarding flavonoid content expressed as rutoside, o-dihydrophenols 

content expressed as caffeic acid and triterpenic compounds content expressed as 

ursolic acid are presented in Table 1. 

Active principles content 

of P1-P6 products 

Table 1 

Sample Flavones % o- Dihydro- Triterpenic compounds Minerals % 

phenols % % 

P1 1,03 0,05 0,104 23,59 

P2 0,33 0,02 0,074 12,70 

P3 0,25 0,01 0,132 10,11 

P4 0,57 0,04 0,029 17,10 

P5 0,54 0,04 0,064 14,90 

P6 0,50 0,03 0,089 11,6 

Pharmacological results of sedative effect by grip strength test are presented in 

Table 2 and Figure 1. During tests, only muscular relaxation was observed, without 

CNS modifications signs. 

199



graspi ng tim 

e (sec) 

30 

25 

200 

Mean grasping time and sedative effect 

Sample Mean grasping time 

(sec) Effect 

P1 27.89 Obvious 

P2 5.74 Weak 

P3 22.39 Obvious 

P4 5 Absent 

P5 5 Absent 

P6 9.87 Weak 

SEDOCALM 5 Absent 

SEDATIVE EFFECT OF BIOACTIVE PRODUCTS 

Figure 1 

Table 2 

20 

15 

Chemical composition analysis 

and pharmacological results of 

bioactive products P1-P6 revealed 

10 

that: 

5 

0 

P1 P2 P3 P4 

Sample 

P5 P6 SEDOCALM 

• Highest amount of active 

principles was fiind in P1: 

1.03% flavones expressed as 

rutoside, 0.05% o- 

dihydrophenols expressed as 

• 

caffeic acid, 0.104% triterpenic compounds expressed as ursolic acid and 

2 3.58% minerals. This product show an obvious sedative effect ( mean 

grasping time 27.89 sec.) 

Product P2 contains 0.074% triterpenic compounds expressed as ursolic acid; 

also, the other principles quantity is lower 

than in P1 product. This product 

show a weak sedative effect (mean grasping time 5.74 sec.) 

• P3 product has the highest amount 

of triterpenic compounds expressed as 

ursolic acid (0.132%), but the other active principl es content is low. This 

product show an obvious sedative effect ( mean grasping time 22.39 sec., 

lower than in P1) 

• P4-P5 products contain less than 0.07% triterpenic compounds expressed as 

ursolic acid, 0.57-0.54% 

flavones expressed as rutoside, 0.04% o- 

Mean



dihydrophenols expressed as caffeic acid and 17.1-14.9% minerals and do not 

have sedative activity 

(mean grasping time 5 sec.) 

• P6 product contains 0.089% triterpenic compounds expressed as ursolic acid 

and even if the other active principles cont ent is lower (0.5% flavones 

expressed as rutoside, 0.03% o-dihydrophenols expressed as caffeic acid and 

11.6% minerals), the sedative activity is weak (mean grasping tim e 9.87 sec.). 

In the same conditions, the reference product 

– SEDOCALM – did not 

show 

sedative effect. 


The aim of the 

research was to establish a correlation 

between active principles 

content in 6 products 

and their sedative activity. 

We can conclude that bioactive products with more than 0. 1% triterpenic 

compounds 

content show an obvious sedative activiy but the correlation is not 

strict, because the other active principles contribute 

to mice muscular relaxation 

displayed by mean grasping time determination. 

References 

1. Cavanagh HM, Wilkinson JM – Biological activities of lavender essential 

oil – Phytother Res., 16(4), 2002, p. 301-8 

2. V. Istudor – Farmacognozie, fitochi mie, fitoterapie, vol. I, II – Ed. Medicală, 

2001. 

3. Hanus M, Lafon J, Mathieu M – Double-blind, randomised, placebo- 

controlled study to evaluate the efficacy 

and safety of a fixed combination 

containing two plant extracts (Crataegus 

oxyacantha and Eschscholtzia 

californica) and magnesium in mild-to-moderate 

anxiety disorders – Curr Med 

Res Opin, 20(1), 2004, p. 63-71 

4. Molina-Hernandez M, Tellez-Alcantara NP, Diaz MA, Perez Garcia J, 

Olivera Lopez M, Jaramillo T – Anticonflict actions of aqueous extracts of flowers 

of Achillea millefolium L. Vary according to the estrous cycle phases in Wistar 

rats – Phytotherapy research, vol. 18, issue 11, 2004, p. 915-920 

5. Dajas F, Rivera-Megret F, Blasina F, Arredondo F, Abin-Carriquiri 

JA, Costa 

G, Echeverry C, Lafon L, Heizen H, Ferreira M, Morquio A – Neuroprotection by 

flavonoids – Braz J Med Biol Res, vol. 36(12), 2003, p. 1613-1620 

6. Kennedy DO, Scholey AB, Tildesley NT, Perry EK, Wesnes KA – 

Modulation of mood and cognitive performance 

following acute administration of 

Melissa officinalis (lemon balm) – Pharmacol Biochem Behav, 72(4), 2002, p. 

953-64 

201



7. Colceru-Mihul S., Nita S., Panteli M., Armatu A., Ocnaru D., Manaila N., 

Bazdoaca C., Rasit I., Ichim M. - Preliminary studies regarding 

the obtainment of 

different fractions from indigenous vegetal species with a high content in active 

principles 

possessing sedative action - Roumanian Biotechnological letters, 

12( 10), 2007, p. 3045-3057 

8. www.ars-grin.gov/duke/ 

9. Della Loggia R., Tubaro A., Redaelli C – Evaluation of the activity on the 

mouse CNS of several 

plant extracts and a combination of them – Riv Neurol, 

51(5), 

1981, p. 297-310 

10. H. G. Vogel, W.H. Vogel- Drug Discovery and Evaluation, Pharmacological 

Assays, Springer-Verlag Berlin Heidelberg, 1997. 

202



DYNAMICS OF GALANTHAMINE AND LYCORINE 

CONTENTS IN LONG-TERM IN VITRO CULTURES OF 

LEUCOJUM AESTIVUM L. (AMARYLLIDACEAE) 

M. STANILOVA ∗ , E. MOLLE**, Y. BOGDANOVA*, L. 

HRISTOVA***, B. PANDOVA***, S. YANEV***, M. BURRUS**** 

Abstract: Clones of Leucojum aestivum cultured four years under equal 

conditions on agar MS medium supplemented with BAP and NAA kept their 

inherent alkaloid profiles. However the contents 

of the main alkaloids 

galanthamine and lycorine varied in the course of time. The dynamics were 

studied in 12 clones for at least 24 months (HPLC analyses every three 

months). Clones differed in the way of the changes of their alkaloid content. 

Different correlations were proved, using R, between the fluctuations of 

galanthamine, lycorine and cultures’ dry matter of some clones and between 

clones. 

Introduction 

Keywords: alkaloids, fluctuations, clone specificity, summer 

snowflake 

In vitro production of secondary metabolites is an attractive alternative to the 

gathering 

of rare medicinal plants from the wild. Nevertheless, the scale-up of the 

process 

is often hampered by the low biosynthetic capacity and its gradual 

attenuation 

in long-term in vitro cultures. 

The herbage of Leucojum aestivum L. is a valuable source of the alkaloid 

galanthamine 

(Gal) – a strong acetylcholinesterase inhibitor used for treatment of 

neurological 

diseases, including Alzheimer’s syndrome. Bulgarian natural 

populations 

of the species are endangered due to overutilisation and habitat 

destruction 

(Gussev et al., 2003). 

Earlier investigations revealed the chemical heterogeneity of the Bulgarian L. 

aestivum 

populations and the seasonal variation of the galanthamine content in 

∗ 

Institute 

of Botany, Bulgarian Academy of Sciences, Sofia, Bulgaria 

C orresponding author: M. Stanilova, E-mail: maris@bio.bas.bg 

** University of Sofia “St. Kl. Ohridski”, Faculty of Biology, Sofia, Bulgaria 

** * Institute of Neurobiology, Bulgarian Academy of Sciences, Sofia, Bulgaria 

** 

** Université P. Sabatier, UMR 5174 EDB, CNRS, Toulouse, France 

203



plants growing under open-air conditions in situ or on the field (Poulev et al., 1993; 

S tefanov, 1990). The alkaloid concentration was supposed to depend on the 

g eographical location. However, our previous studies proved that in vitro clones of 

L. aestivum kept their inherent features for 3 years cultivation on equal medium 

and under the same conditions (Bogdanova et al., in press). 

Seaso nal variations of secondary metabolites were reported for many species 

g rowing in situ or under controlled conditions, attributable to sexual exhaustion 

and seasonally varying 

biotic interactions or abiotic parameters (Alali et al., 2006; 

Elgorashi et al., 2002; 

Pereira et al., 2001 ). However we didn’t find in the literature 

database 

on alkaloid fluctuations of in vitro plant cultures. 

The present investigation deals with the dynamics observed in the alkaloid 

biosynthesis of long-term in vitro cultures of L. aestivum and their clone 

specificity. 

2. Material 

and methods 

Sho s and bulblets from 12 in vitro obtained clones of L. aestivum were 

used in the experiments. Clones were initiated in 2003, each one originating from a 

single mo otany- 

BAS in Sofia (Bogdanova et al., in press). The collection including bulbs from 27 

Bulgarian populations was set up in 2001. According to their main alkaloids, the 

ere of galanthamine (Gal) type (four Gal-type clones: La-3.9, La- 

.45, La-5.2 and La-14), lycorine (Lyc) type (two Lyc-type clones: La-9.6 and La- 

5.7, agar solidified (6 g/L Plant agar, 

nd illumination of 20.25 µmol m 

204 

-2 s -1 ot-clump 

ther bulb gathered from the living collection near the Institute of B 

tested clones w 

4 

12), mixed Lyc-Gal type (four mixed type clones: La-6.31, La 7.6, La-7.73 and La- 

7.26), and other main alkaloid (two “Danube” type clones: La-10.4 and La-11.3). 

Cultures were multiplied on MS based medium (Murashige and Skoog, 1962) with 

a 10-fold increased Thiamine-HCl, pH 

Duchefa, NL) and supplemented with 2 mg/L BAP, 0.15 mg/L NAA, and 3 % 

sucrose. Transfer on fresh medium was performed every month and larger bulblets 

with diameter 6-8 mm were subcultured. Cultivation conditions were equal during 

the experiment: Vitro Vent containers (Duchefa, NL) with 125 ml medium, 

23±2°C, 16/8 h light/dark period a 

. 

Alkaloid content of L. aestivum shoot-clumps was determined every three 

months for at least 24 months, each analysis in 2 repetitions. Alkaloids extraction 

and chromatographic analysis (Waters HPLC system, PDA detector) were carried 

out as described in Bogdanova et al. (in press). Determination was done for 

galanthamine, lycorine and four other related alkaloids: 

norgalanthamine, 

homolycorine, galanthaminone, and ungiminorine. 

Estimation of relationships between different clone parameters was done using 

R: fluctuation periodicity in course of the time was studied 

by auto correlation



function (ACF); biosynthetic synchronism was tested by correlations between Gal 

content, Lyc content and culture dry matter; while the detail month 

correspondences between pairs of clones were verified and illustrated by pairscattered 

graphics. Other graphics were done using EXCEL. 

3. 

Gal 

[mg/g DW] 

Lyc [mg/g DW] 

Results and discussion 

4.0 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0. 0 

Nov 

04 

6.0 

5.0 

4.0 

3.0 

2.0 

1.0 

0.0 

Nov 

04 

Jan 

05 

Apr 

05 

Jul 

05 

Oct 

05 

Jan 

06 

Apr 

06 

Jul 

06 

Oct 

06 

La-3.9 La-4.45 La-5.2 La-14 

Jan 

05 

Apr 

05 

Jul 

05 

Oct 

05 

Jan 

06 

Apr 

06 

Jul 

06 

Oct 

06 

La-9.6 La-12 La-10.4 La-11.3 

Lyc [mg/g DW] 

4.5 

4.0 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

Nov 

04 

Jan 

05 

Apr 

05 

Jul 

05 

Oct 

05 

Jan 

06 

Apr 

06 

Jul 

06 

Oct 

06 

La-6.31 La-7.6 La-7.73 La-7.26 

Fig. 1. Dynamics of the main alkaloids’ content during 2 years: galanthamine in 

four Gal-type clones (A); lycorine in two Lyc-type and two Danube-type clones 

(B); galanthamine (C) and lycorine (D) in four mixed type clones 

Although L. aestivum clones kept the alkaloid profile of the mother plants they 

manifested fluctuations in the alkaloid content throughout the experimental period. 

Stefanov (1990) reported maximal Gal content during flowering stage of L. 

aestivum natural populations in April and sharp decrease in early May. In contrast, 

in vitro cultures expressed clone-specific dynamics of the main alkaloids, often 

Gal [ mg/g DW] 

1.5 

1.0 

0.5 

0.0 

Nov 

04 

Jan 

05 

Apr 

05 

Jul 

05 

Oct 

05 

Jan 

06 

Apr 

06 

Jul 

06 

Oct 

06 

La-6.31 La-7.6 La-7.73 La-7.26 

205



with maximum deviating from spring or with two maximums yearly (Fig. 1). 

However, no pronounced periodicity of Gal and Lyc changes was proved because 

of the quite different harmonic components in ACF established by R (Fig. 2). 

Fig. 2. ACF of galanthamine content in four Gal-type clones illustrate different 

behavior regarding periodicity for a period of two years. The dashed lines show 

206 

ACF 

0.0 

ACF 

0.5 

-0.5 

1.0 

0.5 

0.0 

-0.5 

1.0 

Clone La-3.9 Clone La-4.45 

1.0 

0 2 4 6 8 

the level of significance that the harmonic components must reach, so that their 

presence is regarded as systematic and not as random. 

Alteration of the dry matter suggested a tendency to increase in winter (Fig. 3). 

Correlation was found between the fluctuations of the dry matter of most of the 

clones (Tables 1 and 2-A). Linear dependencies were often based on some 

scattered 

points: (La-3.9, La-5.2), (La-4.45, La-5.2), (La-4.45, La-14), which 

explains the absence of periodicity (Fig. 4). 

More detailed investigations revealed correlations between the DW/FW ratio and 

the content of Gal or/and Lyc in clones La-3.9, La-6.31, La-7.6 and La-7.73 

(Tables 1 & 2-A). 

ACF 

0.5 

0.0 

-0.5 

0 2 4 6 8 

Lag Lag 

Clone La-5.2 1.0 Clone La-14 

0 2 4 Lag 6 8 

ACF 

0.5 

0.0 

-0.5 

0 2 4 6 8 

Lag



Dry matt er 

30% 

25% 

20% 

15% 

10% 

5% 

0% 

Correlations between Gal 

and DW/FW of one and 

the same clone 

Nov Jan Apr Jul Oct Jan Apr Jul Oct 

04 05 05 05 05 06 06 06 06 

Fig. 3. Fluctuations in DW/FW ratio 

of all tested L. aestivum clones 

Table 1 

Correlations between Gal conte nt of each clone pair 

Clone La-3.9 La-4.45 La-5.2 La-14 

La-3.9 0.876 *** 0.604 * 0.329 0.566 * 

Correlations between 

DW/FW ratio of each 

La-4.45 0.991 *** 0.264 0.887 *** 0.482 

clone pair 

La-5.2 0.866 *** 0.861 *** -0.186 0.472 

La-14 -0.485 -0.466 -0.299 -0.149 

* p ≤ 0.05; ** p < 0.01; ***p < 0.001 

Table 2-A 

Correlations between dry 

matter and Gal (u p) or 

Lyc (down) content of 

one and the same clone 

Correlations between DW/FW ratios of each clone pair 

Clone La-6.31 La-7.6 La-7.73 La-7.26 

La-6.31 

0.559 * 

-0.229 

0.922 *** 0.973 *** 0.973 *** 

La-7.6 

0.814 ** 

0.577 * 

0.942 *** 0.854 *** 

La-7.73 

0.600 * 

-0.668 * 

0.926 *** 

La-7.26 

0.226 

-0.263 

* p ≤ 0.05; ** p < 0.01; ***p < 0.001 

207




Gal and Lyc content of 

one and the same clone 


Lyc contents of each 

clone pair 

208 

Fig. 4. Pair-scattered 

graphics depicting the 

relationships between 

Gal contents and 

DW/FW ratios of four 

Gal-type L. aestivum 

clones 

Table 2-B 

Correlations 

between Gal contents of each clone pair 

Clone La-6.31 La-7.6 La-7.73 La-7.26 

La-6.31 -0.344 0. 675 * 0.676 * 0. 237 

La-7.6 -0.233 0.685 * 0.776 ** 0.561 * 

La-7.73 -0.1 83 -0.194 -0.613 * 0. 158 

La-7.26 -0.168 -0.174 0.782 ** 

-0.194



Correlations in the mixed type clones were diverse. In clone La-7.6 for example 

fluctuations of Gal, Lyc and dry matter correlated positivel y while in clone La-7.73 

correlation between Gal and dry matter was positive but those between Gal and 

Lyc and between Lyc and dry matter were negative (Tables 

2-A & B, and Fig. 5). 

Alkaloid [mg/g DW] 

Alkaloid 

[mg/g DW] 

4.5 

4.0 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

Nov 

04 

Jan 

05 

Apr 

05 

Jul 

05 

Oct 

05 

Although Lyc predominated in clone La-7.6 during the whole period of two 

years, the proportion of the two alkaloids varied due to the different amplitude of 

their dynamics. 

Clone La-7.73 appeared most confused during the first tests. Because of the 

209 

Jan 

06 

Apr 

06 

Jul 

06 

Oct 

06 

30 

25 

20 

15 

10 

Gal Lyc Dry matt er % 

Nov 

04 

Jan 

05 

Apr 

05 

Jul 

Oct Jan Apr Jul 

05 05 06 06 06 

Oct 

06 

5 

0 

30 

25 

20 

15 

10 

Gal Lyc Dry matter % 

Fig. 5. Dynamics of Gal, Lyc and dry matter of clone La-7.6 (up) and clone 

La- 

7.73 (down) 

5 

0 

W% 

DW/F 

DW/FW%



negative 

correlation between Gal and Lyc dynamics, it seemed as though it 

changed permanently its alkaloid profile: from mixed type with predominance of 

Lyc in November 2004, to Gal-type in winter and spring of 2005, back to mixed 

type in July 2005, followed by Lyc-type in October 2005, and again mixed type till 

the end of the experiment but with different proportions of the two main alkaloids. 

Continuous studies clarified however that these changes didn’t concern the alkaloid 

profile of the clone and reflected only the opposite dynamics of Gal and Lyc 

contents. 

Alkaloids [mg/g DW] 

A 

Alkaloids [mg/g DW] 

B 

4.0 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

Nov Jan 

04 05 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

Feb 

04 

Jul 

04 

Apr 

05 

Nov 

04 

Jul 

05 

Apr 

05 

Oct 

05 

Jan 

06 

Apr 

06 

Jul 

06 

Gal NorGal 

Jul 

05 

Oct 

05 

Jan 

06 

Apr 

06 

Gal NorGal 

Oct 

06 

Jul 

06 

Feb 

07 

Oct 

06 

Fig. 6. Dynamics of Gal content in clones La-5.2 (A) and La-14 (B) for a period of 

33 months, and related alkaloids in the first months of test 

The differences in alkaloid dynamics of clones La-7.6, La-7.73 and La-7.26 

which originated from one and the same population confirmed once more that plant 

features 

were individual and stable even under long-term in vitro cultivation. 

In spite of the alkaloids’ fluctuations in some clones 

the alkaloid contents seemed 

to have descending tendency, like Gal in clones La-3.9, La-4.45 and La-5.2 (Fig. 1- 

A & 6-A), Lyc in La-6.31 (Fig. 1-D), Gal and Lyc in La-7.6 (Fig. 5-A). However, 

in clones La-9.6, La-12 and La-11.3 (Fig. 1-B) Lyc reached higher concentrations 

during the second 

year. In clones La-6.31 (Fig. 1-C) and La-7.73 (Fig. 5-B) the 

maximal 

values of Gal in the two years were similar, as well as the maximal values 

210 

Apr 

07 

Jan 

07 

Jul 

07 

Apr 

07



of Lyc in clone La-10.4 (Fig. 1-B). Even in case of abrupt decrease of the alkaloid 

content it would be hastily to conclude that the biosynthetic capacity has been lost. 

Temporary alkaloid disappearance was followed by its accumulation in shootclumps 

in significant quantity as it was noticed for Lyc in clones La-6.31, La-7.73 

and La-7.26 (Fig. 1-D & 5-B) and for Gal in clone La-14 (Fig. 6-B). The interval of 

three months between the analyses is very likely to have been quite long and we 

probably missed some possible rapid changes of the alkaloids’ contents, and peaks 

that might occur between the months of test. 

In contrast, some related alkaloids were found only in the first months of the in 

vitro cultivation. Norgalanthamine was detected in clones La-5.2 and La-14 (Fig. 

6), La-9.6 (0.76 mg/g DW on January 2005), La-6.31 (1.14 mg/g DW on April 

2005). Similarly, ungiminorine was found in lower quantities (between 0.09 and 

0.56 mg/g DW on January and on April 2005) in clones La-10.4 and La-11.3. After 

the first two years of in vitro cultivation (spring 2005), the related alkaloids were 

no more produced. 

In L. aestivum plants growing in situ and on the field there were found clear 

relations between alkaloid content and vegetation phase (Stefanov, 1990). Seasonal 

variations in the alkaloid content of open-air growing plants were noticed also for 

other species: glaucine was detected in Croton echinocarpus only in January and 

June and showed a maximum between June and October for C. hemiargyreus 

(Pereira et al., 2001); colchicine varied in Colchicum brachyphyllum and C. 

tunicatum during different growth stages (Alali et al., 2006); crinine, crinamidine 

and 1-epideacetylbowdensine in Crinum macowanii showed significant seasonal 

variation (Elgorashi et al., 2002). In some cases as in the production of four 

pyridoacridine alkaloids of the purple morph of the ascidian Cystodytes sp. a 

temporal variation with a high degree of intercolony variability was observed 

although the variation was no seasonally determined (Lopez-Legentil et al., 2006). 

The biosynthesis of alkaloids was expected to be permanent under in vitro 

conditions 

(unchangeable temperature, illumination regime, and nutrient medium). 

Actually, the “missing of seasons” caused some disorders in the alkaloid dynamics 

of L. aestivum cultures; however the biosynthetic manifestation kept its 

irregularity. 

It is quite possible that the influence of other factors, unforeseen and 

less important than the temperature and the illumination regime, became detectable 

and remained the only ones acting upon the metabolism of the plant cells. 

Galanthamine content in shoot-clumps of L. aestivum frequently surpassed the 

industrial requirement of 1 mg/g DW (Fig. 1-A & C). Since the dynamics of the 

alkaloids’ contents were diverse in the tested clones and correlations were found 

out between some of them, additional studies are necessary for good understanding 

of the processes. In any case, dynamics of alkaloid biosynthesis under long-term in 

vitro conditions and their clone specificity should be considered in selection of 

211

212 



high productive clones as well as in all future experiments aiming increase of 

galanthamine or lycorine content of L. aestivum liquid cultures. 

4. Acknowledgements 

This research was sponsored by the NATO Scientific Affairs Division, within the 

framework of the Science for Peace Programme 

(Project SfP 974453- 

Bioproduction). 

References 

1. Alali, F.Q., El-Alali, A., Tawaha, K., El-Elimat, T. Seasonal variation of 

colchicine content in Colchicum brachyphyllum and Colchicum tunicatum In: 

Nat. Prod. Res. vol. 

20 (12), 2006, p. 1121-1128. 

2. Bogdanova, Y., Stoeva, T., Yanev, S., Pandova, B., Molle, E., Burrus, M., 

Stanilova, M. Influence of plant origin on propagation capacity and alkaloid 

biosynthesis during long-term in vitro cultivation of Leucojum aestivum L. In: In 

Vitro Plant Dev., in press. 

3. Elgorashi, E.E., Drewes, S.E., Van, Staden, J. Organ-to-organ and seasonal 

variation in alkaloids from Crinum macowanii, In: Fitoterapia, vol. 73 (6), 2002, 

p.490-495. 

4. Gussev, Ch., Uzunov, D., Bosseva, Y., Stoeva, T., Stanilova, M., Burrus, M. 

Conservation of Leucojum aestivum (Amaryllidaceae) in Bulgaria. In: Bocconea 

vol. 16(2), 2003, p.815-821. 

5. Lopez-Legentil, S., Bontemps-Subielos, N., Turon, X., Banaigs,B. Temporal 

variation in the production of four secondary metabolites in a colonial ascidian 

In: J. Chem. Ecol. vol. 32 (9), 2006, p. 2079-2084. 

6. Murashige, T., Skoog, F. Revised medium for rapid growth and bioassays with 

tobacco tissue cultures. In: Physiol Plant, vol. 15, 1962, p. 473-497. 

7. Pereira, A. d. S., Amaral, A.C.F. d. Silva, M. d. A., Neto, F.R. d. A. Seasonal 

variation of the chemical constituents from Croton species. In: Z.Naturforsch. 

vol. 56c, 2001, p. 357-362. 

8. Poulev, A., Deus-Neumann, B., Zenk, M.H. Enzyme immunoassay for the 

quantitative determination of galanthamine. In: Planta Med. vol. 59, 1993, p. 

442-446. 

9. Stefanov, Zh. Ecobiological and phytochemical investigations of natural 

populations and introduced origins of summer snowflake (Leucojum aestivum L.) 

in Bulgaria, 1990, PhD thesis NIHFI, Sofia.



EFFECT OF SELENIUM ON MORPHOLOGY AND 

ACTIVITY OF THE GENUS LACTOBACILLUS 

I. MOTYL ∗ 

Abstract: The effect of selenium on morphology and activity of bacteria of the genus 

Lactobacillus was determined. An optical microscope was used in studies on the effect of 

selenium on cell morphology 

characteristics such as cell length and shape coefficient. A 

scanning 

microscope was used to find if selenium has an adverse impact on these cells. 

The effect of selenium 

on the appearance of bacterial shields was examined by means of 

a transmission microscope and a fluorescence microscope enabled determination of the 

activity of bacteria. Selenium was found to affect both cell morphology (length, shape 

coefficient, characteristics of cell shields) and their activity 

Keywords: Lactobacillus, selenium 

Introduction 

Factors like the polluted natural environment, stress and an improper life 

style increase the risk of development 

of civilization diseases. Prevention and 

treatment of these illnesses have been recently achieved not only through 

pharmaceutical preparations and medicines but also through health promoting diet. 

A particularly important role is ascribed to such diet ingredients as lactic acid 

bacteria, antioxidants and numerous microelements. Lactic acid bacteria enriched 

with selenium constitute the potential supplement of diet. Probiotic bacterial strains 

have a beneficial impact on human 

organisms, protect them from attack of toxic 

microorganisms and positively affect the natural intestinal microflora by providing 

its balance. Besides, bacterial cells enriched with selenium can be a good source of 

selenocysteine which plays some important physiological 

roles. Its presence in 

human diet stimulates immune system and it is believed to display the anticancer 

activity. 

An objective of this study was determination of the effect of selenium on 

morphology 

and activity of bacteria of the genus Lactobacillus. 

*Institute 

of Fermentation Technology and Microbiology, Technical University of Lodz, Faculty of 

B iotechnology and Food Sciences, Lodz, Poland. 

213

214 



Material 

and methods 

The examined material comprised 8 strains of Lactobacillus casei and 

Lactobacillus paracasei deposited in the pure culture collection ŁOCK 105. All 

these strains met the in vitro requirements for probiotic bacteria of FAO/WHO [1, 

2] and displayed the high capacity in selenium accumulation. They were classified 

on the basis of sequences of genes encoding their ribosomal RNA (16S RNA). 

To determine the effect of selenium on cell morphology of the examined 

Lactobacillus strains they were grown at 37°C in MRS culture medium either 

supplemented with 2.5μg Se/ml or not (control) for 24 h. 

Four different types of microscopes (optical, scanning, transmission and 

fluorescence) were used to determine the influence of selenium on morphology of 

bacterial cells. 

Optical 

microscope observations 

Live cells were harvested by centrifuging, suspended in physiological 

saline and this suspension was used to prepare the microscopic preparation. Cell 

morphology 

was observed under immersion by using the optical microscope 

(magnification of 100-fold). The surface area of randomly selected 100 cells was 

determined by using the computer program Image J and the shape coefficient was 

computed from the following equation: shape coefficient = cell width /cell length. 

Transmission microscope observations 

Cells harvested by centrifuging were fixed in 4% glutardialdehyde in 

cacodylic buffer and next in 1% osmium tetraoxide. These preparations were 

dehydrated through increasing concentration of ethyl alcohol and propylene oxide. 

Anhydrous preparations were kept for 24 h in a mixture of propylene oxide and 

epone. Then they were entrapped in epone blocks and ultra-thin sections of the 

latter were prepared. These preparations were stained with a drop of uranyl acetate, 

washed with water, stained again with lead citrate, washed again and observed 

under transmission 

microscope (Jeol Jem!) CX, Japan). 

Scanning microscope observations 

Cells were fixed in 2.5% glutardialdehyde in cacodylic buffer 

and then in 1% 

osmium tetraoxide. The preparations were dehydrated through increasing 

concentration of ethyl alcohol and propylene oxide. The fixed cells were sprayed 

with gold in Ion Sputter JFC 1100. The preparations were analyzed by using the 

scanning microscope JSM 35C (Jeol). Dead 

cells and cells deprived of the shields 

were 

counted under magnification of 6600 x. 

Fluorescence microscope observations



Bacterial 

cells were pelleted by centrifuging, suspended in physiological saline and 

mixed with acridine orange. 

They were harvested again by centrifuging (the 

supernantant 

was discarded), resuspended in physiological saline and this 

suspension 

was used to obtain the preparation of live cells. Cell morphology was 

observed under immersion by using the fluorescence microscope BX 41 

(magnification of 100 x). Their images were recorded by using Color View 1 (Soft 

Imaging System) camera. The number of cells stained with acridine orange was 

determined by using the computer program Image J. 

3. Results 

Supplementation of the culture medium with selenium rendered the 

Lactobacillus cells longer and narrower. This effect was proportional to duration of 

cultures and concentration 

of selenium (Fig.1). However, an average cell length did 

not exceed 4.0 μm, which is the maximum 

one for Lactobacillus casei according to 

Bergey’ s Manual of Systematic Bacteriology [3]. 

The presence of selenium in the culture broth changed an appearance of cell 

envelopes. They became thicker and more folded. The most advanced changes 

were observed in 4 strains: ŁOCK 0904, 0908, 0910 and 0915 (Tab. 1 and Fig. 2). 

Selenium had a deleterious impact on structure of bacterial cells. The number of 

broken cells was strain-dependent and varied between 1.0% and 51.6% while the 

number of broken cells in the reference, selenium-free medium was not higher than 

8.6% (Tab. 

2). 

Without Se 

+2,5μg/ml Se +10μg/ml Se 

Fig 1. Lactobacillus paracasei ŁOCK 0919 

Strains of Lactobacillus paracasei were more susceptible to the harmful 

effect of selenium than the strains of Lactobacillus casei. 

Staining with acridine orange enabled to distinguish between active cells (become 

green) and inactive ones (become orange). Supplementing culture medium with 

selenium reduced the number of active cells of 5 of the examined strains: ŁOCK 

0904, 0906, 0908, 0910 and 0915 (Fig. 3). 

215

216 



Without Se +2,5μg/ml Se 

Fig. 2. Lactobacillus casei ŁOCK 0910 

The effect of selenium on the structure of bacterial shields 

Table 1. 

APPEARANCE OF BACTERIAL SHIELDS 

Strain 

Bacteria cultured in the absence Bacteria cultured in the medium 

of Se 

supplemented with 2.5μg Se/ml 

ŁOCK 0900 

Bacterial shields 

uniform 

thickness 

with the Irregular thickness of bacterial shields, 

thicker than in selenium-free medium 

ŁOCK 0904 

Shields with 

thickness 

the irregular Shields thicker and more folded than in 

selenium-free medium 

ŁOCK 0906 Shields with regular thickness 

Shields thicker than in selenium-free 

medium 

ŁOCK 0908 Shields with regular thickness 


medium, folded 

ŁOCK 0910 Thin, smooth shields 


medium, folded 

ŁOCK 0915 Thin shields, broken in many Shields thicker and more folded than in 

cells 

selenium-free medium 

ŁOCK 0919 Regular thickness of shields Irregular thickness of shields 

ŁOCK 0920 Regular thickness of shields Irregular thickness of shields



Without Se +2,5μg/ml Se 

Fig. 3. Lactobacillus casei ŁOCK 0910 

Number 

of bacterial cells that underwent lysis in the presence of selenium 

Strain 

Number of 

cells 

visible 

under the 

microscope 

medium without Se medium with 2.5μgSe 

Number of 

lysed cells 

Percentage 

of lysed 

cells 

Number of 

cells 

visible 

under the 

microscope 

Number 

of 

lysed cells 

Table 2. 

Percentage 

of lysed 

cells 

ŁOCK 0900 279 19 6.91 197 60 9.28 

ŁOCK 0904 308 2 0.65 245 4 1.63 

ŁOCK 0906 216 2 0.93 200 2 1.00 

ŁOCK 0908 220 19 8.64 269 57 21.19 

ŁOCK 0910 251 21 8.37 206 36 17.48 

ŁOCK 0915 264 13 4.92 286 59 20.63 

ŁOCK 0919 249 19 7.63 268 75 27.98 

ŁOCK 0920 171 10 5.85 186 96 51.61 

References 

1. FAO/WHO (2001) Health and nutritional properties of probiotics 

in food 

including powder milk with live lactic acid bacteria. Report of a joint 

FAO/WHO Expert Consultation. Cordoba, Argentina. 

2. FAO/WHO (2002) Guidelines for the eval uation of probiotics in food. 

Report 

of a joint FAO/WHO Working Group, London Ontario, Canada 

3. 

Sneath P. H. A., Holt J. G., Mair N. S., Sharpe M. E.: Bergey’s Manual of 

Systematic Bacteriology. 1986, Volume 2, Copyright Baltimore, str. 1418-143. 

217

218 



EFFECTS OF DIETARY OLIGOFRUCTOSE 

ON THE CHILDREN GUT FLORA 

MARZENA KORDYL * , ZDZISŁAWA LIBUDZISZ*, KATARZYNA 

ŚLIŻEWSKA* 

Abstract: Funcional foods provide a new way of expressing healthiness in food 

choices. A food, as well as a food ingredient, can be regarded as functional "if it is 

satisfactorily demonstrated to affect beneficially one or more target functions in the 

body, beyond adequate nutritional effects". Interesting functional ingredients 

in this 

respect are fructooligosaccharides (FOS) water-soluble carbohydrates which 

are 

distinguished in fructans groups (10, 11). 

Introduction 

Keywords: prebiotic 

preparations, oligofructose, gut microbiota 

In nutritional sciences 

there is much interest in dietary modulation of the 

human gut. The gastrointestinal tract, particularly the colo n, very heavlly populated with bacteria. 

Most bacteria are be nign, however, certain gut species are 

pathogenic and may 

be involved 

in the onset of acute and chronic disorders (6,8). 

Bifidobacterium and lactobacilli are thought to be beneficial and are co mmon 

targets for dietary 

int ervention. Prebiotic is a non-viable food ingredient selectively metabolised by beneficial intestinal bacteria (3). Dietary modulation of the gut 

microbiota by prebio tics is designed to improve health by stimulating numbers and/or acti vities of bifidobacteria and lactobacilli. Diet can modulate immune functions in multiple ways and affect host resistance 

to infections (7,9). Besides the 

essential nutrients, 

non-essential food constituents 

such as non-digestible 

carbohydrates oligofructose may also have an im pact on the immune system, 

especially 

in the area of the gut-associated lymphoid tissue (GALT). Oligofructose 

is a subgroup of inulins, which consists of polymers with degree of polymerisation 

(DP) less than 10 (13). Oligofructose are not degraded or adsorbed in the stomach 

or in the small intestine and can reach the colon, here promote the proliferation of 

human colon flora, with constitute a significant portion of the intestinal microflora 

(12). Considered as functional food ingredients since they affect the physiological 

and biochemical processes in human beings, resulting in better health and reduction 

in the risk of many diseases. It is a carbohydrate polymer derived from fructose 

polymers commonly found in plants and vegetables including onions, bananas,



garlic and chicory (14). Oligofructose displays a sweet, pleasant flavour and is 

highly soluble, 

without raising insulin or blood sugar levels after consumption (15). 

Materials 

and Methods 

The aim of this study was to estimate the ability of intestinal bacteria to 

metabolise ingredients of commercial prebiotic preparations: Beneo 

P95 by Orafti 

comapny 

and Frutalose®L85 by SENSUS company. 

Bacterial strains of Lactobacillus, Bifidobacterium, Enterococcus, 

Clostridium 

and Escherichia coli were isolated from faeces of healthy children (1 

and 8 years old). Growth on glucose, Beneo P95 and Frutalose®L85 was analyzed 

for Lactobacillus 10 strains and Bifidobacterium 10 strains or Enterococcus 5 

strains, Clostridium 5 strains and Escherichia 

coli 5 strains from each of the 

children. This study conducted 

on 70 bacteria strains. 

Ten grams of a fresh fecal sample was suspended in 90 ml 

of a 0,85% 

NaCl 

solution (pH 7.0) to give a final concentration of 10% (w/v). Diagnostic was 

confirmed by plating 

on a selective medium such as a Raffinose – bifidobacterium 

agar, 

Rogosa agar (Difco), Bile Aesculin Azide Agar (Merck), Tryptose Sulfite 

Cycloserine (TSC) Agar ( Merck) and Chromocult® Coliforn Agar (Merck). 

Beneo P95 (oligofructose) is a commercial powder produced through 

enzymatic hydrolysis of chicory inulin. The powder contains oligofructose ( 95%) 

with a little glucose, fructose and sucrose (5%). Frutalose®L85 contains 

oligofructose ( 99%) with a little glucose, fructose and sucrose (1%). The average 

degree of polymerization (DP) this prebiotic preparations is DP

220 



preparations Beneo P95 and Frutalose®L85. All the strains isolated from 1 and 8 

years old were similar grew on Beneo P95 and Frutalose®L85. Lactobacillus, 

Bifidobacterium, 

and Enterococcus strains isolated from 1 year old grew well on 

Frutalose®L85 than Beneo 

P95. However Lactobacillus, Bifidobacterium and 

Escherichia coli grew well on Beneo P95 than Frutalose®L85. All bacterial strains 

grew higher on glucose. Bifidobacterium, Lactobacillus, Enterococcus strains had 

higher grew on both all prebiotic preparations than Escherichia coli, 

Clostridium.After 24 hours of cultivation the number 

of Lactobacillus and 

Bifidobacterium cells was f rom 2,0x10 

idifying properties showed 

8 to 3,5x10 8 cfu/ml, Enterococcus of about 

1,5x10 8 cfu/ml and the number of Escherichia coli and Clostridium cells from 

2,0x10 7 to 8x10 7 cfu/ml (Fig. 1). There were no significant differences observed 

between strains isolated from the faeces of children of various age. 

PH of the cultures depended on the bacterial species and the source of carbon did 

not influence significantly on the effect. The best ac 

Lactobacillus, Bifidobacterium, Enterococcus and Escherichia coli strains. In case 

of Clostridium strains the lowest acidifying properties were observed (Table 1). 

There were no significant differences observed between strains isolated from the 

faeces of children of various age. 

Table 1 

Beneo P95 Frutalose®L85 Glucose 

Bacterial strains 

age 

1 8 1 8 1 8 

0h 24h 0h 24h 0h 24h 0h 24h 0h 24h 0h 24h 

Lactobacillus 6,53 4,04 6,53 4,14 6,55 3,50 6,53 4,06 6,58 4,04 6,58 4,22 

Bifidobactrium 6,52 4,44 6,52 4,08 6,53 4,41 6,56 3,99 6,52 4,13 6,52 3,87 

Enterococcus 6,55 4,09 6,55 4,24 6,51 4,00 6,54 4,04 6,55 4,01 6,55 4,12 

Escherichia coli 6,52 3,87 6,52 4,03 6,51 3,87 6,53 4,06 6,52 4,15 6,52 4,01 

Clostridium 6,59 6,2 6,59 6,31 6,55 6,18 6,56 6,32 6,59 6,2 6,59 6,23



log cfu/ml 

9 

8,5 

8 

7,5 

7 

6,5 

Lactobacillus 

Bifidobacterium 

one year old 

Enterococcus 

Escherichia coli 

Clostridium 

Glucose 

Beneo P95 

Frutalose®L85 

Fig. 1 Growth of bacteria in the medium with Beneo P95, Frutalose®L85 and 

glucose after 24h of cultivation 

References 

1. Bengmark S., Martindale R.: Prebiotic and synbiotics in clinical medicine. In: 

Nutr. Clini. Pract., vol. 20, 2005, p. 244-261. 

2. Bourlioux P., Koletzko B., Guarner F., Braesco V.: The intestine and 

its 

microflora are partners for the protection of the 

host: report on the Danone 

Symposium. "The Inteligent Intestine", In: Am. J. Clin. Nutr., vol. 78, 200 3, p. 

675-683. 

3. Cummings J.H., Macfarlane G.T., En glyst H.N .: Preb iotic digestion and 

fermentation . In: Am. J. Clin. N utr. , vol. 73, 2001, p. 415-420. 6. Gibson G.R., Probert H.M., Van Loo J., Rastall R. A., Roberfroid M.B.: Dietary 

modulation o f the human colonic microbiota: updating th e concept of prebiotic. In: Nutr. Res. Rev. , vol. 17, 2004, p. 259-275. 

7. Gibson G.R., McCar tney A.L., Rasta ll R .A.: Prebiotic an d resistanc e to 

gastrointestinal infection. In: B r. J. Nutr., vo l. 93( 1), 200 5, p. 31-34. 

8. Guraner F., Malagelada J.R.: Gut flora in health and disease. In: Lancet, vol. 

361, 2003, p. 512-519. 

9. 

Hooper L.V., Gordon J.I.: Commensal host-bacterial relationships in the gut. 

In: Ecol. Evol. Infect., vol. 292, 2001, p. 1115-1118. 

10. Roberfroid M.B.: Prebiotics and probiotics: are they functional foods? In:. Am. 

J. Clin. Nutr., vol. 71, 2000, p. 1682-1687. 

11. Roberfroid M.B.: Concepts and strategy of food science: the European 

perspective. In: Am. J. Clin. Nutr., vol. 71, 2000, p.1660-1664. 

221



12. Roberfroid M.B.: Functional foods: concepts and application to inulin and 

oligofructose. In: Br. J. Nutr., vol. 2, 2002, p.139-143. 

13. Roberfroid M.B.: Introducing inulin-type fructans. In: Br .J. Nutr., vol. 93, 

2005, p. S13-S25. 

14. Rodriguez R., Jumenez A.: Dietary fibre from vegetable products as source of 

functional ingredients. In: Tr. Food Sci. Technol., vol. 17, 2006, p. 3-15. 

15. Waligora-Dupriet A.J.: Effect of oligofructose supplementation on gut 

microflora and well-being in young children attending a day care centre. In: J. 

Food Microbiol., vol. 113, 2007, p. 108-113. | 

16. Wynne A.G., McCartney A.L., Brostoff J.: An in vitro assessment of the 

effects of broad-spectrum antibiotics on the human gut microflora and 

concomitant isolation of a Lactobacillus plantarum with anti-Candid a 

activities. Anaerobe, vol. 10, 2004,0, 165-169. 

222



EFFECTS OF JASMONIC ACID ON GALANTHAMINE 

CONTENT IN LEUCOJUM AESTIVUM LONG-TERM 

CULTURES 

Y . BOGDANOVA*, B. PANDOVA**, S. YANEV**, E. MOLLE** *, M. 

BURRUS****, M. STANILOVA ∗ 

Abstract: Shoot-clumps of two Leucojum aestivum clones were investigated 

for their ability to produce galanthamine in liquid MS based medium 

supplemented with 2/0.2 mg/L BAP/NAA. Clones differed from one another in 

their growth index and galanthamine content. The addition of 0.5 mg/L jasmonic 

acid led to increase of galanthamine in the biomass of the two clones up to 1.55 

and 2.21 mg/g DW respectively while the alkaloid release in the medium 

remained relatively low. However the effect of the elicitor was found to depend 

on the clone inherent biosynthetic dynamics manifested in long-term cultures. 

Keywords: elicitation, alkaloids, biosynthetic dynamics, clone specificity, 

summer snowflake. 

Introduction 

Exposure to biotic or abiotic elicitors as stress factors in plants usually leads to 

growth 

retardation, reduction of the fresh weight and seed or fruit production and 

frequently 

induces also the synthesis of secondary metabolites. Elicitors, which 

affect 

positively the release of active substances, represent a valuable 

biotechnological 

strategy (Swiatek et al., 2003; Spollansky et al., 2000). 

Jasmonates are signal transduction molecules that trigger increases in secondary 

metabolism 

in a variety of plant species. Jasmonic acid (JA) is a plant hormone 

which 

affects negatively plant growth. Several authors reported increased 

secondary 

metabolite production in cell and organ cultures of different plant 

∗ 

Institute of Botany, Bulgarian Academy of Sciences, Sofia, Bulgaria; 

Corresponding author M. Stanilova, E-mail: maris@bio.bas.bg 

* * Institute of Neurobiology, Bulgarian Academy of Sciences, Sofia, Bulgaria 

* ** University of Sofia “St. Kl. Ohridski”, Faculty of Biology, Sofia, Bulgaria 

* *** Université P. Sabatier, UMR 5174 Evolution et Diversité Biologique, CNRS, 

Toulouse, 

France 

223



sp ecies by exogenous addition of JA (Biondi et al., 2000; Lee-Parsons and Royce, 

2006). 

Leucojum aestivum L. is one of the most promising sources of the alkaloid 

galanthamine (Gal) which exhibits a valuable pharmacological 

activity and has 

beneficial therapeutic effects in the treatment of poliomyelitis, paresis, progressive 

muscular dystrophy and Alzheimer's disease (Marco et al., 2006). Currently, the 

natural resources of L. aestivum in Bulgaria are extremely 

limited due to 

destruction of habitats an d as a result of anthropogenic activities (Gussev et al., 

2007). In this context, attempts 

have been made for in vitro cultivation and Gal 

production by different types of L. aestivum in vitro cultures (Stanilova et al., 1994; 

Pavlov et al., 2007; Bogdanova et al., in press). In vitro biosynthesis of Gal was 

also studied in other species (Alexandrova et al., 1994; Codina, 2002). 

In this study we aimed to stimulate the biosynthesis of galanthamine in liquid 

organ cultures of selected high productive L. aestivum clones by treatment with 

jasmonic acid. Galanthamine accumulation was desirable rather in the biomass 

than in the medium. 

Material 

and methods 

Plant material: Two high productive galanthamine type in vitro clones of L. 

aestivum were used in the treatments: La-5.2 and La-7.80. Cultures were initiated 

in 2003 from bulbs originating from two wild populations, and planted in the living 

collection 

near the Institute of Botany in Sofia (Bogdanova et al., in press). Plant 

material was multiplied by subcultivation of in vitro bulblets with diameter larger 

than 6-8 mm: vertical cutting to four sectors, passage on fresh medium every 

month. Shoots appeared between the scales of the explants and formed shootclumps. 

They were separated from the explants and used as inoculum 

for the 

establishment 

of liquid organ cultures. 

Nutrient media and cultivation conditions: Plants were multiplied on MS based 

medium (Murashige and Skoog, 1962) with a 10-fold increase of Thiamine-HCl, 

agar solidified (6 g/L Plant agar, Duchefa, NL) and supplemented with 30 g/L 

sucrose, 2 mg/L BAP and 0.15 mg/L NAA. The control liquid medium was with 

the same composition without agar. The medium used for elicitation differed from 

the control medium only in the presence of 0.5 mg/L jasmonic acid. All media 

were adjusted to pH 5.7 and autoclaved 20 min at 121°C under 

1 atm. Cultures 

were grown at a temperature of 23±2°C and under 16/8 h light/dark photoperiod, 

-2 -1 

light intensity of 40.5 µmol m s . Shoot-clump multiplication and maintenance 

have been performed in Vitro Vent containers (Duchefa, NL) with 125 ml 

agar 

medium. Two types 

of vessels were used for cultivation in liquid medium: one 

litter 

flatways glass bottles of 1 L with 250 ml medium and plastic containers 

224



Magenta (Phytotechnology Labs, USA) with 125 ml medium, both without 

agitation. 

The inoculum was 1.5 w/v % and 3 w/v % in the bottles and in the 

containers, 

respectively. 

Experimental design: Two consecutive experiments were performed: first one 

aiming to compare the effects of elicitation in clones La-5.2 and La-7.80; second 

one focused on the dynamics of Gal accumulation in the biomass and in the 

medium, during the period of elicitation. Treatments with JA lasted one month, 

preceded by one or two months cultivation in control liquid medium, transfer in 

fresh medium every month. 

First experiment: after 2-month cultivation of shoot-clumps in control medium 

(bottles with 1.5 w/v % inoculum), they were transferred to medium with JA: two 

repetitions for each of the clones, with 1.5 w/v % inoculum. Elicitation 

began on 

th 

26 of January 2006. Gal content in the biomass was determined at the start and 

after the end of the elicitor application while its release in the liquid medium was 

checked on the 3 

: 24 repetitions each of 3.75 g FW shoot-clumps were grown 

ne month in control medium in Magenta containers (3 w/v % inoculum), then 

f the cultures continued in medium with JA (variant with 

licitation) while the rest twelve cultures were used as controls (control variant). 

D 

evaporation with liquid nitrogen, the total 

m 

rd , 10 th , 24 th , and 31 st day of the treatment. 

Second experiment 

o 

cultivation of the half o 

e 

uring the treatment with elicitor, starting on 12 th of March 2007, cultures of three 

containers from each variant were terminated on the 10 th , 17 th , 24 th and 31 st day of 

cultivation and Gal contents were determined in the biomass as well as in the 

media. 

Determination of galanthamine: The content of Gal was determined in the 

biomass as well as in the liquid medium. Shoot-clumps were dried (65˚C) and 

powdered and samples of 50 mg were macerated with methanol (3 ml) in ultrasonic 

bath, 3 times for 30 min every 8 h at 25˚C. After filtration (FILTRAK 390∅), 

centrifugation at 9500g for 10 min and 

ethanol extract was diluted with a mixture of 2.5% methanol and 1.7% acetonitril 

in water, and filtrated through a 0.45 µm filter (Waters). The medium alkaloids 

content was determined after direct injection in the chromatograph. Analyses were 

carried out on Waters HPLC system supplied with quaternary pump 600E and PDA 

996 detector; Alltech Ultrashere-Octyl RP-C8 column (150 × 4.6 mm i.d., 5 µm) 

protected by a Symmetry Guard Column C8 (20 × 3.9 mm i.d., 5 µm). The mobile 

phase consisted of acetonitril/methanol/water (containing 7.5 mM triethanolamine, 

pH up to 6.9 with phosphoric acid) (20/15/65); column temperature: 35°C; flow 

rate: 1.0 ml/min; injection volume: 20 µl). Data acquisition and analysis were made 

by Empower chromatographic software. 

225



Statistics: The growth index was calculated after the formula: GI=(FWfinal – 

FWinitial)/FWinitial. Correlation coefficients were calculated in Excel. Excel ANOVA 

Single Factor and Two-Factor 

Replication were used to compare variants. 


The two tested clones were selected in our previous investigations for their 

morphological features, propagation coefficient and high Gal content when 

cultured on solid medium (Bogdanova 

et al., 2008). We also found that well shaped 

shoot-clumps 

were the best type of inoculum in liquid culture and that the most 

appropriate auxin/cytokinin combination was NAA/BAP (Stanilova et al., 2008-a). 

In the present study we noticed a great difference between the growth of the two 

clones in control liquid medium which confirmed once more the stable inherent 

clone specificity of L. aestivum cultures. The fresh biomass of clone La-7.80 

increased much faster than that of clone La-5.2 while the percentages of their dry 

matter 

were similar (Table 1). The higher Gal content of clone La-5.2 didn’t 

compensate its slow growth and the quantity of the alkaloid was twice more in the 

culture of clone La-7.80 at the end of the second month of cultivation. 

Table 1 

Clone 

226 

GI 1 

Dec 05 

GI 2 

Jan 06 

DW/FW 

% 

Gal in biomass 

[mg/g DW] 

Gal in medium 

[mg/L] 

Total Gal 

[mg/L] 

% of Gal 

in biomass 

La-5.2 2.47 3.18 10.1 1.09 2.46 9.38 73.7 

La-7.80 3.45 9.11 11.9 0.79 4.88 18.91 74.2 

According to our previous tests of several L. aestivum clones (August-October 

2004), La-5.2 among them, the amounts of alkaloids (galanthamine and/or 

lycorine) decreased when the shoot-clumps were transferred to liquid medium with 

equal composition (Bogdanova et al., 2008). This tendency was confirmed in the 

present study when shoot-clumps from the two clones were cultured on solid and in 

liquid medium in parallel. All cultures were tested for alkaloids in January 2006. 

Shoot-clumps of La-5.2 and La-7.80 cultured on agar medium produced 1.42 and 

1.40 mg/g DW Gal respectively while those grown in liquid medium contained 

1.09 and 0.79 mg/g DW Gal. These differences were due to the release of about ¼ 

of the alkaloid amount in the liquid medium (Table 1). Alkaloid passage from 

biomass to liquid medium was reported as well by other authors (Pavlov et al., 

2007; Codina, 2002). 

The presence of jasmonic acid in the medium during the third month of 

cultivation didn’t affect the biomass growth. The shape of the shoot-clumps 

remained normal and the percentages of their dry matter didn’t change a lot: 10.4 

% for clone La-5.2 and 10.1 % for clone La-7.80.



Clones retained their features concerning biomass accumulation (Fig. 1-A). The 

elicitor stimulated the biosynthetic capacity in both clones however the effects of 

the treatment were different (Fig. 1-B). Gal content in the shoot-clumps of clone 

La-7.80 

increased almost three times reaching 2.21 mg/g DW. The increase of Gal 

in the shoot-clumps of clone 

La-5.2 was much less (Table 2). The alkaloid release 

to the medium was however similar for both clones, about 20 % (Table 2 and Fig. 

2). 

The yield of Gal in the biomass at the end of the third month should amount to 

7.9 mg for clone La-5.2 and 39.9 mg for clone La-7.80 if the whole quantity of 

shoot-clumps obtained at the end of the 2-month cultivation in control medium was 

used as inoculum. The great difference between the two clones regarding their Gal 

yields is due to both higher growth index of clone La-7.80 and higher Gal 

concentration in its shoot-clumps at the end of the treatment with JA. 

1.5 

1.2 

0.9 

GI 

0.6 

0.3 

0.0 

L a-5.2 La-7.80 

GI DW/FW% 

14 

12 

10 

8 

6 

4 

2 

0 

DW/ 

FW% 

Gal 

[mg/L] 

Total 

14 

12 

10 

8 

6 

4 

2 

0 

La-5 .2 La-7.80 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 


[ mg/g DW] 

Total Gal [mg/L] Gal in biomass [mg/g DW] 

Fig. 1. Main parameters of clones during the 3 rd month of cultivation, in liquid 

medium containing JA: Left: Growth index (GI) and dry matter (DW/FW%) of 

shoot-clumps; Right: Concentration of Gal in the shoot-clumps [mg/g DW], and 

total Gal in the culture: shoot-clumps and medium [mg/L]. 

Clone 


[mg/g DW] 

Gal in 

biomass 

[mg/L] 

Gal in 

medium 

[mg/L] 

Total Gal 

[mg/L] 

% Gal in 

biomass 

Table 2 

Theoretical yield of 

Gal in biomass, end 

of 3 rd month [mg] 

La-5.2 1.55 ± 0.15 3.66 ± 0.01 1.03 4.69 ± 0.01 77.8 7.9 

La-7.80 2.21 ± 0.12 7.97 ± 0.62 1.91 9.88 ± 0.62 80.7 39.9 

Keeping of the clone specific growth rates seemed to be normal. However the 

quite different degrees of biosynthetic stimulation caused in the two clones by the 

elicitor could be understood only in the light of the dynamics of alkaloids’ 

227



Gal [mg/L] 

Gal [mg/g DW] 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

4.0 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

0.19 

0.23 

0.41 

0.29 

1.01 

0.67 

Fig. 2. Dynamics of the 

release of Gal from the shootclumps 

to the liquid medium 

supplemented with 0.5 mg/L 

th th 

JA (26 Jan 06 – 25 Feb 06). 

Fig. 3. Dynamics of Gal 

contents in shoot-clumps of 

clones La-5.2 and La-7.80 for 

a period of 18 months 

(cultivation on control agar 

medium). 

production that we had observed in many L. aestivum clones for a period of 2 

years in vitro 

cultivation (Stanilova et al., 2008-b). 

The fluctuation of Gal biosynthesis in clones 

La-5.2 and La-7.80 for a period of 

18 months is presented on Fig. 3. A negative correlation was established between 

the dynamics of Gal contents of the two clones for the period Ju ly 2005 - April 

2006 ( correlation coeffi cient 

-1.51, that corre 

sponds to p = 0.065 

and is close to 

statistical significance of p= 0. 05) . The 2-month cultivation in control liquid 

medium corresponded to the period of descent of Gal cont ent in clone La-5.2 while 

the 

alkaloid biosynthesis was in ascension in clone La-7.80. The start of the 

treatment with elicitor (January 2006) coincided with the moment of equalization 

of the Gal content in the two clones. Actually, the stimulation effect of JA was 

pronounced only in clone La-7.80. The content of Gal in its shoot-clumps was 

0.79 

mg/g DW in the beginning of the treatment and reached 2.21 mg/g DW on 

228 

1.91 

1.03 

29th Jan 4th Feb 18th Feb 25th Feb 

April 

'05 


July 

'05 

1.81 

1.22 

Oct 

'05 

1.42 

1.40 

Jan 

'06 

2.05 

0.76 

April 

'06 

July 

'06 


Oct 

'06



February 2006 in spite of the release of about 20 % of 

the alkaloid in the medium. 

This was the highest concentration of Gal determined 

ever in this clone. 

In contrast the elicitor as though did not influence the biosynthetic activity of 

clone La-5.2 taking in consideration the relatively slight increase of Gal content 

(from 1.09 to 1.55 mg/g DW) and the fact that at t he time of the experiment its 

dynamics studied on solid control medium entere d upon a phase of ascent. 

Moreover, much higher concentrations of the alkaloid 

were determined in this 

clone before and after the time of the elicitation experiment. The effectiveness of 

the elicitation appeared to depend on the clone specific dynamics of Gal 

biosynthesis. The start of the experiment seemed to coincide with an extremum for 

each of the tested clones. Obviously, the addition of JA at the minimum of Gal 

content was useless, as it was in the case of clone La-5.2. Conversely, starting the 

elicitation treatment at the maximum Gal content as in clone La-7.80 was most 

appropriate. 

Gal [mg / container] 

4.0 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

10th day 17th day 24th day 31st day 

Fig. 4. Dynamics of Gal 

accumulation in the culture 

with JA and in the control 

culture. 

The relationship between the 

effectiveness of the elicitation 

and the dynamics of the 

alkaloid biosynthesis was 

confirmed during an additional 

experiment carried out with 

Control biomass Control medium 

clone La-5.2. Dynamics of 

JA biomass JA medium 

accumulation of Gal in the 

biomass and in the medium 

were studied in parallel (Table 3 and Fig. 4). The contents of Gal remained higher 

in the biomass compared to those in the media till the end of the experiment. This 

difference was significant in the culture with jasmonic acid (p = 0.01) as well as in 

the control culture (p < 0.05). 

The increase of Gal in the medium was very slight and no relation was found 

with Gal accumulation in the shoot-clumps. However the percentage of Gal in the 

medium increased significantly in course of the month which was due to the drastic 

decrease of the alkaloid in the shoot-clumps during the second part of the month. 

229



The correlation between the decreases of Gal in the control and in the variant 

with JA (correlation coefficient 2.09, p



times 

more than those reported by Pavlov (2007). It was also higher than Gal 

determined in April 2007 in shoot-clumps cultured on agar, evidently because we 

miss sometimes the precise points of the extremums and determine them only 

approximately because of the sharp changes of the alkaloid content in the biomass. 

The understanding of the relation between the dynamics of Gal biosynthesis and 

the effectiveness of the elicitation, as well as the accumulation of over 90 % of Gal 

in the biomass of clone La-5.2 are important prerequisite for further investigations 

toward the use of L. aestivum biomass as a source for stable in vitro Gal 

production. 


This research was sponsored by the NATO Scientific Affairs Division, within the 

framework of the Science for Peace Programme (Project SfP 974453- 

Bioproduction). 

References 

1. Aleksandrova, IV, Gordonova, IK, Tulakin, VG Strain of cultivable Ungernia 

victoris U-1 cells. , 1994, Russ ian patent № 1806188 2. Biondi, S., Fornalé, S., Oksm an-Caldentey, K.M., Eeva, 

M., Agostan i, S., 

Bagni, 

N. Jas monates induce over-accumulation 

of methylputrescine 

and conjugated polyamines in Hyoscyamus 

muticus L. root cultures In: Plant Cell Reports 

vol. 19, 

2000, p. 691-697. 

3. Bogdanova, 

Y., S toeva, T., Yanev, S., Pand ova, B., Molle, E., Burru s, M., 

Stanilova, M. Influence of plant origin on propagation ca pacity and alkaloid biosynthesis during 

long-term in vitro cultivation o f Leucojum aestivum L. In: In 

Vitro Plant Dev., in press. 

4. Bogdanova, Y., Pandova, B., Yanev, S., Stanil ova, M. Biologically active 

alkaloids in liquid cultures of summer snowfl ake (Leucoju m aestivum L.) In: 

Proceedings of VII National Scientific Conf erence Ecology and Health, April, 2008, 

Plovdiv, 

Bulgaria 

5. Codina, C Production of galanthamine by Narcissus tissues in vitro. In: Hanks 

GR 

(ed) Narcissus and Daffodil. Tailor & Francis, London New York, 2002 p. 215-241. 

6. Gussev, Ch., Bosseva, Y., Pandova, B., Yanev, S., Stanilova, M. Resource 

assessment of Leucojum aestivum L. (Amaryllidaceae) populations in Bulgaria. In: 

Bocconea vol. 21, 2007, p. 405-411. 

7. Lee-Parsons, C.W.T., Royce, A.J. Precursor limitations in methyl jasmonateinduced 

Catharanthus roseuscell cultures. In: Plant Cell Rep. vol. 25, 2006, 607- 

612. 

8. Marco, L., Carreiras, M.C. Galanthamine, a Natural Product for the Treatment of 

Alzheimer’s Disease. In: Recent Patents on CNS Drug Discovery, vol. 1 (1), 2006, 

p.105-111. 

231



9. Murashige, T., Skoog, F. Revised medium for rapid growth and bioassays with 

tobacco tissue cultures. In: Physiol Plant, vol. 15, 1962, p. 473-497. 

10. Pavlov, A., Berkov, S., Courot, E., Gocheva, T., Tuneva, D., Pandova, B., 

Georgiev, V., Yanev, S., Burrus, M., Ilieva, M Galanthamine production by 

Leucojum aestivum in vitro systems. In: Process Biochem, vol. 42, 2007, p.734-739. 

11. Spollansky, T.S., Pitta-Alvarez, S.I., Giulietti, A.M. Effect of jasmonic acid and 

aluminium on production of tropane alkaloids in hairy root cultures of Brugmansia 

candida. In: Electronic J. of Biotechnology, vol. 3 (1), 2000, p.72-75. 

12. Stanilova, MI, Ilcheva, VP, Zagorska, NA Morphogenic potential and in vitro 

micropropagation 

of endangered plant species Leucojum aestivum L. and Lilium 

rhodopaeum Delip. In: 

Plant Cell Rep. vol. 13, 1994, p. 451-453. 

13. Stanilova, M., Bogdanova, Y., Ivanova, T., Pandova, B., Yanev, S. Galanthamine 

biosynthesis and biomass production of liquid organ cultures of Leucojum aestivum 

L. (Amaryllidaceae). In: Proceedings of 5 

ublic. 

4 Stanilova, M., Molle, E., Bogdanova, Y., Hristova, L., Pandova, B., Yanev, S., 

Dynamics of galanthamine and lycorine contents in long-term in vitro 

nology” USAMV 20-21 Nov. 

D thesis NIHFI, Sofia 

th CMAPSEEC, 2-5 September 2008-a, 

Brno, Check rep 

1 . 

Burrus, M. 

cultures of Leucojum aestivum L. (Amaryllidaceae) In: Proceeding of the 

International Symposium “New research in biotech 

2008-b, Bucharest, Romania 

15. Stefanov, Zh. Ecobiological and phytochemical investigations of natural 

populations and introduced origins of summer snowflake (Leucojum aestivum L.) in 

Bulgaria, 1990, Ph 

16. Swiatek, A., Azmi, A., Witters, E., Van Onckelen, H. Stress messengers Jasmonic 

acid and Abscisic acid negatively regulate plant cell cycle. In: Bulg. J. Plant physiol., 

Special Issue 2003, p. 172-178. 

232



EVALUATION OF ANTIOXIDANT AND FREE RADICAL 

SCAVENGING POTENTIAL AND DETERMINATION OF 

BIOACTIVE COMPOUNDS OF VARIOUS PLANT 

EXTRACTS 

A. ARMATU 7 , S. COLCERU-MIHUL 1 , L. PIRVU 1 , 

N. MANAILA 1 , M. ICHIM 8 

Abstract: The in vitro antioxidant and free radical scavenging properties of 

seven vegetal extracts (Verbascum phlomoides L, Inula helenium L, Apium 

graveolens L, Fagopyrum esculentum Moench, Rosmarinus officinalis L, Salvia 

officinalis L and Populus nigra L.) were studied by luminol-enhanced 

chemiluminescence assay and DPPH free radical scavenging assay. The content 

of specific active principles was determined and correlated with antioxidant 

activity. This study proves that some extracts exhibit considerable antioxidant 

properties, expressed either by their capability to scavenge DPPH or reactive 

oxygen species . 

Keywords: vegetal extracts, antioxidant, scavenger. 

Introduction 

A literature search revealed that the number of publications on antioxidants and 

oxidative stress has nearly quadrupled 

in the past decade (1684 in 1993; 6510 in 

2003). [1] 

Oxygen is required by prokaryotic and eukaryotic cells for energy production, 

often via the electron transport chain in the mitochondria in the latter. In 1954 it 

was suggested for the first time that these radicals are important players in 

biological environments and responsible for deleterious processes in the cell. These 

metabolites are now considered major players in biochemical reactions, cellular 

response, and clinical outcome. The organism must confront and control the 

presence of both prooxidants and antioxidants continuous and that is why the 

balance between these is tightly regulated and extremely important for maintaining 

vital cellular and biochemical functions. This balance, often referred to as the redox 

potential, is specific for each organelle and biological site, and any interference of 

7 National Institute for Chemical-Pharmaceutical Research and Development, Bucharest, ROMANIA 

8 SC BIOING SA, Bucharest, ROMANIA 

233



the balance in any direction might be deleterious for the cell and organism. 

Changing the balance towards an increase in the prooxidant over the capacity of 

the antioxidant is defined as oxidative stress and might lead to oxidative damage. 

[2] 

The vegetal kingdom is a rich source of natural medicines. Among them, 

phenolic compounds such as flavonoids, tannins and phenolic acids appeared to be 

strong antiradical 

and antioxidant phytochemicals.[3] 

For example, buckwheat is recognized as a health food by the 

Japanese, because 

it is a invaluable source of natural phenolic compounds especially 

rutin. [4] 

Rosmarinic acid is a naturally occurring hydroxylated compound widely 

distributed in Labiatae herbs, such as rosemary and sage and appears to be a 

substance of considerable interest because it has a broad range of applications, 

from food preservatives to cosmetics, and has medicinal use because of its 

antimicrobial 

and antioxidant activity. [5] 

The study of biological and pharmacological activity has revealed that both 

iridoids 

and seco-iridoids exhibit a wide range of bioactivity, including the 

antioxidant 

effect.[6] 

Triterpenic acids like oleanolic and ursolic 

acids also exhibited a dose-dependent 

effect in superoxide anion scavenging activity, chelating effect, xanthine oxidase 

inhibition 

activity, and reducing power.[7] 

Acteoside, a phenylethanoid glycoside, protects the cell from 

oxidative stress and 

that scavenging 

of free radicals could be a key mechanism contributing to the 

cytoprotective 

effect of this compound.[8] 

In this study we intended to show the antioxidant potential of seven herbs 

traditionally used as medicines or as food-stuff (Apium graveolens L – celery, 

Apiaceae family, Verbascum phlomoides L – orange mullein, Scrophulariaceae 

family, Inula helenium L – elecampane, Asteraceae family, Fagopyrum esculentum 

Moench – buckweat, Polygonaceae family, Rosmarinus officinalis L – rosemary, 

Lamiaceae family , Salvia officinalis L – sage, Lamiaceae family and Populus 

nigra L – poplar, Salicaceae family) rich in different classes of chemical 

compounds, emphasizing the correlation between chemical composition and 

biological effect but also the relationship between active principles themselves. 

Chemicals: Folin-Ciocalteu’s phenol reagent, 2,2-Di(4-tert-octylphenyl)-1- 

picrylhydrazyl (DPPH), luminol, rosmarinic acid, ursolic acid, gallic acid, 

quercetin and rutin were purchased from Sigma Chemical Co. Acteoside and 

aucubin were obtained from Phytoplan Diehm & Neuberger GmbH. Dried vegetal 

234 

2. Materials and methods



material was purchased from a local drugstore (Verbasci flos) or it was supplied by 

SC Hofigal SA (Rosmarini herba, Salviae folium, Fagopyri fructus, Inulae radix, 

Populi gemmae and Apii folium). 

Preparation 

of plant extract: 0,25 g of dried and grounded vegetal material were 

macerated in 25 mL 50% methanol solution (g/v) at room temperature for 3 days 

with occasional shaking. After filtration, extractive solutions were evaporated to 

dryness and dissolved in 50% methanol solution to reach 

10mg/mL concentration. 

Each extract were further series diluted into 1mg/mL, 50μg/mL and 1μg/mL with 

50% methanol. 

Determination of flavones: Quantitative analysis for flavones was made using a 

visible spectrophotometric method based on their property of forming stable yellow 

compounds with Al 

ing gallic acid as a standard. (10) 

acid, nitro-compounds that spontaneously isomerise into 

itative analysis of triterpenic acids was 

temperature for 2 hours. After cooling 

termination of iridoids: Quantitative analysis of iridoids was 

sing aucubin as standard.(13) 

Chemiluminescence assay: The assay contained sodium carbonate buffer (0.1 M, 

3+ , having the maximum of absorption at 450nm. (9) 

Determination of total phenolics: Total phenolics content was determined 

according to the Folin-Ciocalteu method us 

Determination of rosmarinic acid: Quantitative analysis of rosmarinic acid was 

made using a visible spectrophotometric method based on phenols capacity of 

forming with nitric 

isonitro-compounds or oxymes. Based on their weak acid nature, these compounds 

can be dissolved in alkaline solution giving red colors. (11) 

Determination of triterpenic acids: Quant 

made using a UV spectrophotometric method. 

1ml vegetal extract was mixed with 50mL distilled water and 2mL concentrated 

HCl and kept on a water bath under reflux 

and filtration, triterpenic compounds from the solution were separated by liquidliquid 

extraction with chloroform. 0,5mL of chloroformic extract was further 

evaporated on a water bath, mixed with 5mL concentrated H2SO4 and maintained at 

70°C for 2 hours in an oven. The absorbance was m Fig. 4. Dynamics of Gal 

accumulation in the culture with JA and in the control culture. 

easured at 317nm and the results were plotted on a standard curve of ursolic acid. 

Determination of phenylethanoids: Quantitative analysis f phenylethanoidic 

compounds was made using a visible spectrophotometric method using acteoside 

as standard, according to British Pharmacopoeia (12) 

De 

spectrophotometrically made u 

pH 7.8), 8mM luminol together with 5mM hydrogen peroxide and the respective 

plant extract or standard compound (quercetin and rutin). The chemiluminescence 

(CL) was measured on a Turner Biosystem 20/20 Analyzer and related to the 

chemiluminescence of the control without the herbal drugs (corresponding 100%). 

235



DPPH assay: In each reaction, 50μL vegetal extract of different concentrations 

was mixed with 2950μL of 0.0025g/ L DPPH at room temperature for 30 min. 50% 

methanol solution was used as control. 

The reduction of the DPPH free radical was 

measured by reading the absorbance at 517nm. Quercetin and rutin were used as 

positive controls. Inhibition ratio (percent) was calculated from the following 

equation: 

% inhibition = absorbance of control – absorbance of sample x 100 

absorbance of control 


Table 1 

Phytochemical composition of the species 

236 

Total polyphenols 

expressed as gallic acid 

Vegetal extract (%) 

Flavones expressed as 

rutin (%) 

Rosmarinus officinalis 1,53 0,02 

Salvia officinalis 2,55 0,26 

Populus nigra 3,07 0,15 

Fagopyrum esculentum 0,81 0,09 

Apium graveolens 0,83 0,11 

Inula helenium 1,15 0,1 

Verbascum phlomoides 1,33 0,13 

Table 1 shows the percent of total phenolics (expressed as gallic acid) and the 

percent 

of flavonoids (expressed as rutin) for all the tested species. 

Table 2 

Polyphenols Flavones Phenyl- Iridoids Triterpenic 

(rosmarinic (apigenin) ethanoids (aucubin) acids (ursolic 

Vegetal extract acid) (%) (%) (acteoside) 

(%) 

(%) acid) (%) 

R. officinalis 0,47 0,05 

S. officinalis 0,85 0,04 

P. nigra 

F. esculentum 

A. graveolens 1,05 

I. helenium 

V. phlomoides 1,23 0,22



Table 2 presents the percent of specific phytochemicals for each species 

(polyphenols expressed as rosmarinic and triterpenic acids for Salvia officinalis and 

Rosmarinus officinalis, phenylethanoids and iridoids for Verbascum phlomoides 

and flavones expressed as apigenin for Apium graveolens). 

Populus nigra has the richest composition in total phenolics while Fagopyrum 

esculentum is the most scarce. As for the flavones expressed as rutin, Salvia 

officinalis has the greatest value, 

0,26%. 

Luminol-induced 

chemiluminescence assay 

Chemiluminescence assay is a widely used method for investigating 

free radical- 

scavenging e ects of various compounds. Oxygen free radicals 

are produced by 

the reaction between hydrogen 

peroxide and luminol. 

Figure 1 

F igure 3 Figur e 

4 

Figure 2 

237



Figures 1-4 show that all extracts scavenged oxygen free radicals in a dose- 

dependent manner. The antioxidant effect of the extracts followed this order: 

Populus nigra > Rosmarinus officinalis > Salvia officinalis > Verbascum 

phlomoides > Inula helenium > Fagopyrum esculentum > Apium graveolens. 

Polyphenols abundant species are the most effective in scavenging 

free radicals. 

For Rosmarinus officinalis, the biological effect is probably due not only to 

polyphenolic content but also to other phytochemicals like triterpenic acids or 

diterpenic compounds. As for Verbascum 

phlomoides, synergic activity of 

polyphenols, phenylethanoids 

and iridoids leads to the antioxidant effect. 

DPPH is a stable free radical containing an odd electron in its structure and 

usually is used for detecting radical scavenging activity in chemical analysis. The 

free radical scavenging activity of different 

concentrations of the seven vegetal 

species was evaluated by the colorimetrical decrease in absorbance of DPPH due to 

the chemical trapping of the 

unpaired electron. The results are given in Fig. 5-8. 

238 

DPPH Radical Scavenging Activity 

Figure 5 

Figure 6 

Figure 7 Figure 8



Figures illustrate a decrease in the concentration of DPPH radicals due to the 

dose-dependent scavenging ability of the extracts. The rosemary and poplar 

extracts showed a significantly stronger DPPH scavenging activity, even at 1μg/mL 

concentration, although lower than standard compounds, quercetin and rutin. At the 

same concentration, the celery extract had almost no scavenging effect. 


Many of antioxidant compounds are already used as preservatives in various 

products (as in fats, oils, food products, 

and soaps for retarding the development of 

rancidity, 

in gasoline and other petroleum products for retarding gum formation 

and other undesirable changes, and in rubber for retarding aging). In biochemistry 

and medicine, antioxidants are capable of counteracting the damaging effects of 

oxidation in animal tissues (1) 

Reactive oxygen species are not only strongly associated with lipid peroxidation, 

leading to food deterioration, but are also involved in development of a variety of 

diseases, including cellular aging, mutagenesis, carcinogenesis, coronary heart 

disease, diabetes and neurodegeneration, that is why the development of 

antioxidant intervention strategies leading to reduction in diseases associated with 

oxidative stress is essential. (2) 

In this study we showed the antioxidant potential of seven vegetal species 

traditionally used as medicines or as food-stuff by two methods: luminol-enhanced 

chemiluminescence and DPPH assay. A strong and effective scavenging activity on 

oxygen and DPPH radicals had Populus nigra and Rosmarinus officinalis extracts. 

The antioxidant activity was correlated not only with total phenolic content but also 

with other specific compounds. Apium graveolens extract showed the lowest effect 

in both tests, despite of the good flavonoid content, expressed as apigenin. 

This study proves that some extracts exhibit considerable antioxidant properties, 

expressed either by their capability to scavenge DPPH or reactive oxygen species. 

References 

1. Huang, D., Ou, B., Prior, R.: The Chemistry behind Antioxidant Capacity 

Assays. In: Agric. Food Chem. 53, 2005, 1841−1856; 

2. Kohen, R., Nyska, A.: Oxidation of Biological Systems: Oxidative Stress 

Phenomena,Antioxidants, Redox Reactions, and Methods for Their Quanti 

cation. In: Toxicologic Pathology, vol 30, no 6, 2002, p. 620– 650 ; 

239



3. 

Sroka, Z.: Antioxidative and Antiradical Properties of Plant Phenolics. In: Z. 

Naturforsch. 60C, 2005, 833Ð843; 

4. Mukoda, T., Sun, B., Ishiguro, A.: Antioxidant Activities of Buckwheat Hull 

Extract toward Various Oxidative Stress in Vitro and in Vivo. In: Biol. Pharm. 

Bull. 24(3), 2001, p. 209—213; 

5. Kang, M., Yun, A., Won, J.: Rosmarinic acid inhibits Ca2 -dependent 

pathways 

of T-cell antigen receptor-mediated signaling by inhibiting the PLC- 1 and Itk 

activity. In: Blood 

;101, 2001, p. 3534-3542; 

6. 

Dinda, B., Debnath, S., Harigayn, S.: Naturally Occurring Secoiridoids and 

Bioactivity of Naturally Occurring Iridoids and Secoiridoids. A Review, Part 2. 

In: Ac, Chem. Pharm. Bull. 55(5), 2007, p. 689—728; 

7. Yin, M., Chan, K.: Nonenzymatic antioxidative and antiglycative effects of 

oleanolic acid and ursolic acid. In: J Agric Food Chem. 55(17), 2007, p. 

7177-81; 

8. Chiou, W., Lin, W., Chen, C.: Acteoside protects endothelial cells against free 

radical-induced oxidative stress. In: J Pharm Pharmacol. 56(6), 2004, p.743-8; 

9. Farmacopeea Română Editia X, p259-260; 

10. Winyard, P., Blake, D., Evans, C.: Free radicals and inflammation. In: Ed. 

Birkhauser, 2000, p.11-14; 

11. Ciulei, I., Istudor, V., Palade, M., Albulescu, M., Gard, C.: Analiza 

farmacognostică şi fitochimică a produselor vegetale, 1, 1995, p79-80; 

12. British Pharmacopoeia, vol.II, 2005, p.1601; 

13. Shen, Y., Chen, C.: Additional secoiridoid glucosides from Fraxinus uhdei. In: 

Planta Med 61(3), 1995, p. 281-3. 

240



EVOLUTION OF THIAMIN, RIBOFLAVIN, NIACIN 

AND ASCORBIC ACID CONTENT DURING 

GERMINATION OF SOYBEAN SEEDS (GLYCINE MAX.) 

GRATZIELA-VICTORIA BAHACIU 9 

Abstract: This work was focused on the evolution of the vitamins in soybean 

after germination in controlled conditions (temperatures of 15, 20 and 25°C for 

2, 3, 4, 6 and 8 days). The samples were analysed to determine the thiamine, 

riboflavin, niacin and ascorbic acid, by HPLC method. The germination 

process determines the increasing of the vitamins and “de novo” synthesis of the 

ascorbic acid: the crude soybean seeds don’t contain ascorbic acid but this 

vitamin reached 

76,98mg/100 g d.w after 3 days of germination (25°C). It was 

also registered a spectacular growth of the riboflavin content during the first 

days of germination and an important increasing of all vitamins with the 

germination time. The germination temperature 

has a smaller effect on the level 

of accumulated vitamins in germinated soybean seeds (the most efficient 

germination was at 25°C). 

Keywords: ascorbic acid, germination, niacin, riboflavin, soybean, thiamine. 

Introduction 

The quality of soy protein was the subject of many intense studies for the past 

several 

decades due to the fact that soybean represents a very good food resource 

for 

humans. Thus, the soybean seeds are rich in proteins, minerals and biologic 

active 

compounds which have real benefic effects on health. Meantime the 

presence 

of the antinutritional factors in crude soybean determines the researchers 

to find a way to inactivate these compounds that decrease the value and utilization 

of 

soybean. The traditional Asian products offered the methods for improving the 

nutritional 

and sensorial quality of soybean seeds; these methods are germination 

and 

fermentation in controlled condition of soybean seeds. 

The improving of the soybean nutritional and sensorial qualities represented the 

main 

purpose of many research papers. These scientific papers have analyzed the 

influence 

of dehulling, soaking, cooking, gamma irradiation, germination on the 

chemical 

and nutritional composition of beans and soybean particularly (Mansour, 

2002). 

9 

University of Agronomical Sciences and Veterinary Medicine, Bucharest 

241



The effect 

of germination on the chemical composition of soybean seeds depends 

on the seeds variety and the germination conditions (temperature, moisture, and 

light 

and germination time). 

The aim of this work is to determine the effect of germination for 2, 3, 4, 6 and 8 

days at 15, 20 and 25°C on the level of certain vitamins (thiamin, riboflavin, niacin 

and ascorbic acid). 

2. Material 

and methods 

Germination 

The soybean seeds were obtained from the local market; the seeds were washed 

and soaked in tap water for 12 hours. Seeds were drained, washed and the imbibed 

seeds were germinated by layering them on a moist filter paper continuously 

wat ered by capillarity. The germination process was conducted separately at 15, 

20 

and 25°C for 2, 3, 4, 6, or 8 days. 

Chemical 

determination 

Raw and germinated soybeans were ground to a fine powder. Weighed (2- 3 g) 

powder samples were 20 ml of 

0,1 M hydrochloric acid and digested by heating at 

121°C for 30 min. The pH of the cooled sample was adjusted to 4,0-4,5 using 2,5 

M sodium acetate mixed with 1,0 ml takadiastase solution (100 mg takadiastase 

in 

1,0ml of 2,5 M sodium acetate) and incubated in a shaking water-bath at 45°C for 

25 

min. The solution 

was then mixed with 2,0 ml of 45% (w/v) trichloroacetic acid 

and heated for 5 min in a water-bath at 55°C. The medium was centrifuged 2500g 

for 10 min at 15°C, and filtered The volume was made up to 50 ml with water and 

an aliquot was placed in a 5-ml amber glass vial for HPLC analysis using a 

UV/VIS spectrophotometer with double fascicle JASCO V530PC. 


The evolution of thiamin with the temperature and time germination is showed in 

figure 1. 

Regarding the thiamin content of germinated soybean seeds, this reaches 28.76% 

for samples germinated at 25°C for 2 days and 58% for germination for 4 days at 

the same temperature (data compared to control sample, ungerminated soybean 

seeds). The most effective germination conditions regarding the thiamin evolution 

are 8 days at 25°C, when its content reaches 4.27 mg/100g d.w., which represents 

233,59% 

compared to control samples. 

242



mg/100 

g d.w 

Thiamin, 

The evolution of thiamin with the germination time 

and temperature 

4.5 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

15 C 

20 C 

25 C 

Fig. 1. The evolution of thiamin 

with the germination time and 

temperature 

The influence of the germination 

temperature on the thiamin 

content of soybean seeds is not so 

0 

obvious for the accumulation of 

0 2 3 4 6 8 

thiamin. It was observed that for 

Germination time,days 

germinated seeds in the optimum 

conditions the level is with 

12.67% higher than for germination at 15°C, for the same time period. 

Riboflavin has a very spectacular 

increasing during 

germination. This increasing 

is mainly due to the germination time and in a smaller 

measure of germination 

temperature. 

It can be observed that the initial level of riboflavin was 0.210 mg/100g d.w., but 

after only two days of germination, this increases 0.986 mg/100g d.w. which means 

369.52% and after 8 days of germination to 2.321 mg/100g d.w. (eleventh times 

fold increasing). 

The spectacular increasing of the riboflavin is registered in the first 2-3 days of 

germination. Continuing the germination process up to 8 days determines a smaller 

increasing of the thiamin level (a media of 10% increasing for each supplementary 

day of germination). 

Riboflavin,mg/100g 

d.w 

The evolution of riboflavin with the germination time 

and temperature 

2.500 

2.000 

1.500 

1.000 

0.500 

0.000 

0 2 3 4 6 8 

Germination time, days 

15 C 

20 C 

25 C 

Fig. 2. The evolution of 

riboflavin with the 

germination time and 

temperature 

243



Niacin is following the same increasing trend as thiamin and riboflavin were 

following during germination (figure 3). Thus, in the first 2 days of germination 

at 

25°C, the niacin level increases from 2.76 mg/100 g d.w. for the control samples up 

to 9.543 mg/100g d.w. which represents 240% increasing compared to the 

ungerminated seeds. 

For the following days of germination, the niacin level is slowly increasing and 

reaches 10.321mg/100g d.w. (with 263% more than 

the control samples). 

The influence of the germination temperature is not so important; the biggest 

accumulation of niacin is registered for 25°C. 

The crude soybean seeds do not contain ascorbic acid but by germination, 

important quantities of vitamin C are accumulating. It can be observed from figure 

4 that the level of the ascorbic acid has an increasing trend with the germination 

time and temperature, reaching the maximum for samples germinated for 3 days at 

25°C, 76.98 mg/100g d.w. The quantity of the ascorbic acid for 4, 6 and 8 days 

germinated samples is decreasing for all three germination temperature (15, 20 or 

25°C). It is also observed that the temperature of germination is not so important 

for accumulation of the ascorbic acid in germinated soybean seeds. The “de novo” 

synthesis of the ascorbic acid is due to the redox processes, which are very intense 

in germination and need the vitamin C for activation. 

244 

Niacin, 

mg/100g d.w. 

The evolution of niacin with the germination time and 

temperature 

12 

10 

8 

6 

4 

2 

0 

0 2 3 4 6 8 


15 C 

20 C 

25 C 

Fig. 3. The evolution of 

niacin with the germination 

time and temperature



Ascorbic 

acid, 

mg/100g d.w. 

80 

70 

60 

50 

40 

30 

20 

10 

0 


The evolution of ascorbic acid with germination time and 

temperature 

Fig. 4. The evolution of the 

ascorbic acid with the 

germination time and 

temperature 

The germination process starts at low temperature but it is slow. The optimum 

germination temperature for a good accumulation of vitamins is 25°C. 

The explanation of the spectacular increasing of the riboflavin during the first 

days of germination could be related to the fact that in the first stages of 

germination, the intensity of physiological plant activity is very intense in these 

first stages of germination which need greater quantities of biological compounds. 

The level of investigated vitamins B in germinated soybean seeds is clearly 

superior to ungerminated soybeans. This accumulation is associated with the 

intense 

metabolic processes specific to germination. These processes need an 

important amount of enzymes which have as cofactors the specific vitamins, 

investigated in this work (thiamin, riboflavin, niacin). 

It has to be underlining the fact that during the germination, the respiration 

process in very intense in the first days (stages) and it needs biologic active 

compounds that participate to the biochemical and physiological activities. 

The ascorbic acid is synthesized “de novo” in soybean seeds by germination. 

It can be concluded that germination is a very good process to increase the level 

of vitamins in soybean seeds. 

References 

0 2 3 4 6 8 


1. Burzo, I., ş.a., Fiziologia plantelor de cultură. Procesele fiziologice din 

plantele de cultură, vol. I, Chişinău. Întreprinderea Editorial-Poligrafică 

Ştiinţa, 1999a. 

15 C 

20 C 

25 C 

245



2. Burzo, I., ş.a., Fiziologia plantelor de cultură. Procesele fiziologice din 

plantele de cultură, vol. I, Chişinău. Întreprinderea Editorial-Poligrafică 

Ştiinţa, 1999b. 

3. Kwok, KC, Shiu, YW, Yeung, CH, a.a. Effect of Thermal Processing on 

Available Lysine,Thiamine and Riboflavin Content in Soymilk, J Sci Food 

Agric, 77, 1998, p. 473-478. 

4. Lebiedyińska, A, Szefer, P.: Vitamins B in grain ans cereal-grain food, soyproducts 

and seeds, Food Chemistry, 95(1), 2006, p.116-122 

5. Macrae, R., Robinson, RK., Sadler, MJ. Encyclopaedia of Food Science, Food 

Technology and Nutrition, Academic Press, 1993, p. 4216-4230. 

6. Mansour, E.H., Khalil, A.H., 1998. Reduction of Raffinose Oligosaccharides in 

Chickpea (Cicer arietinum) Flour by Crude Extracellular Fungal a- 

Galactosidase, J Sci Food Agric, 78, 175-181. 

7. Neamţu, G., Biochimie vegetală, Bucureşti, Editura Ceres, 1981. 

8. Sarkar, P.K., Morrison, E., Tinggi, U., ş.a. B-Group Vitamin and Mineral 

Contents of Soybeans during Kinema Production, J. Sci. Food Agric., 78, 

1998, p. 498-502. 

9. Segal, R., Biochimia produselor alimentare, Galaţi, Editura Alma, 1999. 

10. Segal, R., 2002. Principiile nutriţiei, Editura Academica, Galaţi. 

11. Szyniarowski, G.A., Ostrowska P.K, Kozik A, Rapala-Kozik M,. Thiamine 

binding and metabolism in germinating seeds of selected cereals and legumes. 

Plant Physiol Biochem., 2004, 42(3), p.187-95. 

12. Urbano, G., Lopez-Jurado, M., Frejnagel, S., ş.a., Nutritional assessment of 

raw and germinated pes (pisum sativum L.) protein and carbohydrate by in 

vivo and in vitro techniques, Nutrition, 21, 2005, p.230-239. 

13. Wang, TL., Domoney, C., Hedley, C., ş.a., Can We Improve the Nutritional 

Quality of Legume Seeds?, Plant Physiol, 131, 2003, p. 886-891 

246



FOOD PROCESSING BY OHMIC HEATING APPLIED 

TO MEAT PRODUCTS 

A. MITELUŢ , P. NICULIŢĂ*, R. CRAMARIUC , M. 

* , M. POPA* 

GEICU*, M. GHIDURUŞ*, M. TURTOI*, I. VĂTUIU***, 

D. VĂTUIU***, A. POPA**** 

Abstract: Producing safe food is involving in most of the cases a thermal 

heating. Normally heating methods are external for the product and are 

transmitted through conduction and convection phenomena. In this case important 

nutritional and sensory quality loss occurs, moreover 

the process involves high 

energetic consumption and releases large quantities of waste water. 

The 

technological solution in this case is to develop an alternative heating process by 

means of ohmic heating where the heat is transmitted to the product by passing the 

electric current through 

it as a consequence of the product electrical resistance. In 

this case the possibility of overheating is eliminated and the nutritional and 

sensory properties of the product are being maintained. This process ensures 

an 

antimicrobial treatment of the product as well. In ohmic heating process, the 

energy used to produce heating is released directly into the mass of the product, 

instead of being released at the surface, and thanks to this, the process is strikingly 

efficient. 

Developing a modern technology for meat processing based on ohmic heating 

process increase the competitiveness of the meat products not only from the 

nutritional point of view but also from energy consumption and environmental 

point of view, and represents the main objective of the presented work. 

Keywords: ohmic heating, meat products, food processing 

Introduction 

Ohmic heating (OH) (also called Joule heating, electrical resistance heating, 

direct 

electrical resistance heating, electroheating or electroconductive heating) is 

defined 

as a process where electric currents are passed through foods to heat them. 

* 

Faculty of Biotechnology, University of Agronomic Sciences and Veterinary Medicine Bucharest, 

Romania, 

amalia@agral.usamv.ro 

** Electrotechnologies Research Center Bucharest, Romania, raducramariuc@yahoo.com 

** * Institute of Food Research Bucharest, Romania, i.vatuiu@ccai-ro.com 

** 

**Newcastle University, UK, alexandrapopa1@gmail.com 

** 

247



Heat is internally generated due to electrical resistance. OH is distinguished from 

other electrical heating methods by the presence of electrodes contacting the foods 

(if microwave and inductive heating electrodes are absent), the frequency applied 

(unrestricted, 

except fo r the specially assigned radio or microwave frequency 

range), and waveform (also unrestricted, although typically sinusoidal). 

The OH concept is well known, and various attempts have been made to use it in 

food processing. Like application of electricity in food processing was developed 

th 

in the 19 century the milk pasteurization technology. These 

applications were 

abandoned because the high processing cost. Research on OH applications in fruits, 

vegetables, meat products and surimi has been undertaken by several food 

researchers more recently. This process is based on reactions that reduce the level 

of bacterial spores with lower activation energy than ones responsible for the loss 

of quality 

(e.g. reduction in vitamins, colour and aroma degradation). 

The products treated by OH are of a superior quality to those processed by 

conventional 

technologies. 

National 

Plan II for scientific research. 

248 

Fig. 1. Principle diagram of 

the ohmic treatment device 

The potential applications 

are very wide and include 

blanching, evaporation, 

dehydration, pasteurization 

and sterilization. 

The purpose of this work is 

to prove the effect of ohmic 

treatment on the 

microbiological charge in 

some meat products (minced 

meat and burger paste), 

using an experimental 

laboratory for ohmic 

treatment, developed within 

the research 

contract no 51- 

030/2008 (OHMIC),



Materials 

and methods 

Principle diagram of the ohmic treatment device is presented in Fig. 1. 

According to this principle diagram, it was designed (Fig. 2) and realised the 

experimental pattern presented in Figures 3, 4. 

Fig. 3. Ohmic treatment device – 

experimental pattern 

1 – Laboratory pattern for ohmic 

treatment equipment 

2 – Power source, A.C. 50 Hz, 0 – 

200 V 

3 – Tension measurement 

4 – Current intensity measurement 

5 – Temperature measurement 

6 – Inferior electrode 

7 – Device for food ohmic treatment 

8 – Superior electrode 

Fig. 2. Design of the ohmic 

treatment device – experimental 

pattern 

1 – main part 

2 – inferior cover 

3 – superior cover 

4 – piston 

5 – pressing handle 

Experimental pattern was realised using a polycarbonate 

cylinder with internal 

diameter of 80 mm, heights of 280 mm and thickness 

of 4 mm. The 2 detachable 

electrodes which are maintained in the cell with the meat 

sample were made from 

stainless steel with high titanium. The superior electrode 

has an opening of 0.5 mm 

for air evacuation from treatment chamber. 

Temperature measurements were 

249



realised using thermocouples 

constantan - cooper of 1.6 mm thickness, covered 

with Teflon (OMEGA Engeneering, Stamford, CN). 

250 

Fig. 4. Ohmic treatment 

chamber 

The thermocouples were inserted through 6 openings realised in the 

perior half of the cylinder. 

ted to the electrodes endings. Voltage was of 220 

18 A and was adjust manually. The source was an 

utotransformer. 

ents consisted of applying the ohmic treatment in 

in electric tension up to 71 o C in the products 

ning it 5 minutes at this temperature; 

in electric tension up to 81 o su 

Tension source was adjus 

VAC, 50 Hz and 

a 

The laboratory experim 

two ways: 

Method I: 10 minutes increase 

thermal centre and maintai 

Method II: 10 minutes increase 

C in the products 

thermal centre and maintaining 

it 

5 minutes at this temperature; 

The assessment of 

the effectiveness 

of the ohmic treatment was carried out 

through the following microbiological 

determinations: 

- Coliforms in accordance 

with STAS 

ISO 4831-1992; 

- Total Plate Count in accordance with SR EN ISO 4833 – 2003. 

- We tested two meat products: minced meat and burger paste. 

To assess the efficacy of microbiological ohmic treatments the following 

work has been undertaken: 

- preparing samples to be subjected to the ohmic treatment; 

- preparing the treated samples for the microbiological determinations; 

- sowing the tested samples on the specific culture environments;



- incubating the sowed samples at different temperatures: 35 – 37 

incubating the microorganisms for 48 h; 

- the interpretation of results. 

o C for the 

coliforms and 30 o C for the Total Plate Count; 

- 


Minced Meat ohmic treated 

In the Table 1, the samples from 1 to 6 are repetitions of the same ohmic 

treatment by method I. 

Table 1 

Experimental trial 

Coliforms 

10 ml 10 -1 10 -2 

10 -3 10 -4 

Total Plate Count/g 

CONTROL + + + + + 6,0 x 10 5 

SAMPLE 1 + + + - - 5,0 x 10 3 

SAMPLE 2 + + + - - 4,0 x 10 

3 

SAMPLE 3 + + + - - 5,0 x 10 3 

SAMPLE 4 + + + - - 4,0 x 10 

3 

SAMPLE 5 + + + - - 4,5 x 10 3 

SAMPLE 6 + + + - - 5,0 x 10 3 


treatment by method II. 

Table 2 


Coliforms 

10 ml 10 -1 10 -2 

10 -3 10 -4 


+ 6,0 x 10 5 

CONTROL + + + + 

SAMPLE 1 + + - - - 3, 0 x 10 2 

2, x 10 2 

SAMPLE 2 + + - - - 0 

SAMPLE 3 + + - - - 2,0 x 10 

2 

SAMPLE 4 + + - - - 3,0 x 10 2 

SAMPLE 5 + + - - - 

2,8 x 10 2 

SAMPLE 6 + + - - - 2,0 x 10 2 

Burger paste ohmic treated 

251



In the Table 3, the samples from 1 to 6 

treatment by Method I. 

252 

are repetitions of the same ohmic 

Table 3 


Coliforms 

10 -1 10 -2 

10 -3 


10 ml 

CONTROL + + + + 1,6 x 10 5 

SAMPLE 1 + + - - 6,0 x 10 2 

SAMPLE 2 + + - - 

2 

6,0 x 10 

SAMPLE 3 + + - - 6,0 x 10 2 

SAMPLE 4 + + - - 6,0 x 10 2 

SAMPLE 5 + + - - 

5,0 x 10 2 

SAMPLE 6 + + - - 5,0 x 10 2 


treatment by Method II. 

Table 

4 

E xperimental 

Coliforms 

Total 

Plate 

trial 10 ml 

-1 

10 

-2 

10 

-3 

10 Count/g 

CONTROL + + + + 1,6 x 10 5 

SAMPLE 1 - - - - 1,0 x 10 2 

SAMPLE 2 - - - - 1,0 x 10 2 

SAMPLE 3 - - - - 1,0 x 1 2 

0 

SAMPLE 4 - - - - 1,0 x 10 2 

SAMPLE 5 - - - - 1,0 x 10 2 

SAMPLE 6 - - - - 

2 

1,0 x 10 

Conclusions 

Minced 

Meat 

Minced Meat Contro l – colifo rms were present until the dilution 10 otal 

5 

-4 and T 

Plate Count was 6.0x10 .



After the ohmic treatment by method for all samples (1-6) – coliforms were 

pr 

as 5.0x10 , so it decreased with 2 logarithmic degrees. 

After the ohmic treatment by method II for all samples (1-6) – coliforms number 

was reduced from the dilution 10 -4 to the dilution 10 -1 and Total Plate 

ecreased from 10 5 to 10 2 I 

esent in the dilution 10 

. Both microbiological indicators decreased with 3 

s through ohmic 

-2 , so the number decreased with 2 logarithmic degrees, 

3 

and Total Plate Count w 

Count 

d 

logarithmic degree treatment. 

Burger 

Paste 

I Burge aste Control – coliforms we 

dil d after ohmic treatment b ethod I coliforms w the 

dil fter th hmic treatment b ethod II coliform tally 

des 

T te Coun as 1.6x 5 n the case of r P re present in control in the 

ution 10 

in control, 6.0x10 after the oh ment 

2 

y 

s based on thermal effect of electrical current. 

-3 , an the y m as only in 

ution 10 -1 . A e o y m s were to 

troyed. 

2 

he Total Pla t w 10 

mic treat 

b method I and 1.0x10 after the ohmic treatment by method II. 

The conclusion of the experimental study is that the effect of ohmic treatment on 

microorganisms growth i 

References 

1. Antonio Augusto Vicente, Ines de Castro and Jose Antonio Teixeira, Ohmic 

Heating for Food Pro cessing, T hermal Food Processing, edited by da-Wen 

Sun, (2005) 

2. Castro, I., Te ixeira , J . A., Salengke, S., Sastry, S. K., and Vicente, A. A., 

Innovative Food Science and Emerging Technologies 5, 27 (2004). 

3. Parrott, D. L. , Food Technol. 46, 68 (199 2). 

4. Leizerson, S. and Shim oni, E., J. Agric. Food Chem. 53, 3519 (2005). 

5. de Halleux, D., Pie tte, G., Buteau, M.-L., and Dostie, M., Canadian Biosystems 

Engineering/ Le génie des biosystèmes au Canada 47, 3.41 (2005). 

6. Todaro, M., Scatassa, M. L., and Giaccone, P., Ital. J. Anim. Sci. 4, 403 

(2005). 

7. Kondyli, E. 

and Katsiari, M. C., Int. J. Dairy Technol. 55, 57 (2002). 

8. 

Icier, F. and Ilicali, C., Food Res. Int. 38, 1135(2005). 

253



254 

FRUIT WINES POLYPHENOLS AND S.CEREVISIAE 

YEAST INTERACTIONS 

A. CZYZOWSKA, E. POGORZELSKI 

Abstract: Four S. cerevisiae strains were use 

to produce blackcurrant wines. 

The experimental wines obtained were analyzed for the total polyphenols and 

anthocyanins 

content. Yeasts were analyzed for betaglucosidase and sorption 

activity. A decrease from 13% to 23% of total polyphenols and from 35 to 41% 

of total anthocyanins was observed. All yeast analyzed showed small 

betaglucosidase activity. Delphinidin-3-rutinoside was the most adsorbed 

anthocyanin. 

Keywords: yeast, polyphenols, anthocyanins, adsorption. 

Introduction 

Fruits are rich source of polyphenols. Anthocyanins are phenolic 

plant 

metabolites responsible for red wine colour, an important quality factor. 

Anthocyanin 

profile of wine depends on anthocyanin content of fruits and how 

anthocyanin profile is modified during vinification, storage and ageing. 

It is well known that polyphenols primarily interact as colloids with proteins by 

van der Waals bonds (Haslam et al. 1992). For example, tannic acid, precipitates or 

complexes with many different macromolecules, such as polysaccharides and 

proteins with H-bond acceptors (Salmon, 2006). Wine yeasts are included among 

the causes that could reduce the anthocyanin content 

of fermenting musts, 

owing to 

an anthocyanin adsorption by yeast cell walls (Morata et al., 2003, Vasserot 

et al., 

1997, Czyzowska, 2007). Some works also demonstrated that wine yeasts are 

producers of betagucosidases with anthocyanase activity (Delcroix et al. 1994, 

Manzanares et al, 2000, Sanchez-Torres et al., 1998, Zoecklin et al, 1999). 

The aim of this work was to investigate the reactions between polyphenols, 

especially anthocyanins and wine yeasts in blackcurrant wines. 

2. 


Four S. cerevisiae strains: Pisport (Ł33), Brusznica 7 (WK3), Madeira 

(W46) 

and Zeltinger were use to produce blackcurrant wines. 

The 

experimental wines obtained were analyzed for the total polyphenol (using the 

Folin-Ciocalteau 

reagent according to Singleton and Rossi (1965) and total



antho cyanins content according to Di Stefano et al.(1989). Anthocyanins were 

analyzed 

by HPLC method. Chromatograms were recorded at 520nm with spectra 

(210-600) taken continously. Yeasts were analysed for betaglucosidase 

(Rossi et al. 

1994) and sorption activity (Morata et. al , 2003). After fermentation 

was complete, 

yeast were harvested by centrifugation and washed 3 times with 

formic acid: 

metanol solution (10:90) to be available for sorption measurements. 

3. Results 

Concentration of total phenols in musts and wines is shown in Figure 1. 

The smallest decrease in total phenols, compared to the unfermented control, was 

obtained 

for strain Pisport (13%), while the largest loss was found for strain 

Madeira (23 % decrease). 

] 

3 

m 

/d 

g 

[m 

ls 

o 

n 

e 

h 

p 

ly 

o 

p 

l 

ta 

to 

1200 

1000 

800 

600 

400 

200 

0 

1062 

1006 

824 827 

1068 

Fig. 1. Total polyphenols concentration in blackcurrant musts 

and wines 

Total anthocyanin concentration 

before (in musts) and immediately after 

alcoholic 

fermentation for the wines obtained with different yeast strains is shown 

in Figure 2. A decrease from 35 to 41% in anthocyanins concentration was 

observed. The smallest decrease in total anthocyanins, compared to the 

unfermented control, was also obtained for strain Pisport (35%), while the largest 

loss was also found for strain Madeira (about 41% decrease). 

920 

1068 

880 

255



256 

total anthocyanins [mg/dm3] 

700 

600 

500 

400 

300 

200 

100 

0 

582 

Madeira must 

Madeira wine 

618 

239 230 

Zeltinger must 

Zeltinger wine 

Pisport must 

553 553 

Pisport wine 

Fig. 2. Total anthocyanins concentration in blackcurrant musts and wines 

196 

Brusznica 7 must 

Brusznica 7 wine 

The main group observed in blackcurrant musts were the anthocyanins. Four main 

pigments were observed in juices and wines (Figure 3), the order being as follows: 

delphinidin-3-glucoside (Dp3-G), delphinidin-3-rutinoside (Dp3-R), cyanidin-3glucoside 

(Cy3-G), cyanidin-3-rutinoside (Cy3-R). 

Table 1 shows results of the concentration of pigments in musts and wines obtained 

during fermentation conducted by selected yeast strains. Delphinidin-3-rutinoside 

occurred in the largest quantities in musts and wines studied, irrespective of strain 

used. Its content in wines ranged from 43,3 (for the wines obtained with the use of 

Brusznica 7 strain) to 64,7 mg/L (for the wines obtained with the use of Zeltinger 

strain). 

Delphinidin-3-rutinoside was also the most stable anthocyanin studied. The second 

major 

pigment was cyanidin-3-rutinoside. 

The maximum content of monomeric anthocyanins was found, when Zeltinger 

strain was used to the fermentation process, while the largest loss was found for 

strain Brusznica. 

Our observation also shown that during fermentation process delphinidins were 

more stable than cyanidins, and rutinosides than glucosides. 

222



Fig. 3. Chromatogram of blackcurrant anthocyanins measured at 520nm 

Delphinidin-3-rutinoside occurred in the largest quantities in musts and wines 

studied, irrespective of strain used. Its content in wines ranged from 43,3 (for the 

wines obtained with the use of Brusznica 7 strain) to 64,7 mg/L (for the wines 

obtained with the use of Zeltinger strain). 

Delphinidin-3-rutinoside was also the most stable anthocyanin studied. The second 

major pigment was cyanidin-3-rutinoside. 

The maximum content of monomeric anthocyanins was found, when Zeltinger 

strain was used to the fermentation process, while the largest loss was found for 

strain Brusznica . Our observation also shown that during fermentation process 

delphinidins were more stable than cyanidins, and rutinosides than glucosides. 

All yeast analysed showed small betaglucosidase activity (data not shown). 

Table 2 shows results of the adsorption activity of strains used. Yeast adsorbed 

from 1,2 (for Zeltinger strain) to 2,7 mg/L (for Brusznica strain) of anthocyanins. 

Delphinidin-3-rutinoside was the most adsorbed anthocyanin. The second one was 

the delphinidin-3-glucoside. 

257



Madeira 

must 

Madeira 

wine 

Zeltinger 

must 

Zeltinger 

wine 

Pisport 

must 

Pisport 

wine 

Brusznica 

7 must 

Brusznica 

7 wine 

Delphinidin- 

3-glucoside 

Delphinidin- 

3-rutinoside 

Table 1 

Cyanidin-3- 

[mg/dm 

glucosideCyanidin-3rutinoside 

Total 

3 ] [mg/dm 3 ] [mg/dm 3 ] [mg/dm 3 ] [mg/dm 3 ] 

27,9 128 9,0 71,3 236,2 

9,36 55,0 1,9 30,73 96,99 

28,6 134 10,6 77,9 251,1 

12,10 64,7 6,98 38,30 122,08 

26,5 122 9,5 71,9 229,9 

10,37 63,9 2,89 34,37 

26,5 122 9,5 71,9 

7,97 43,3 1,83 23,40 

111,53 

229,9 

The efficiency of adsorption of the free anthocyanins on yeast cell walls seemed 

related to their polarity (by decreasing polarity order: delphinidin, cyanidin, 

petunidin, peonidin and malvidin). 

Table 2 

Delphinidin- 

3-glucoside 

Delphinidin- 

3-rutinoside Cyanidin-3- 

strain [mg/dm 

glucosideCyanidin-3rutinoside 

Total 

3 ] [mg/dm 3 ] [mg/dm 3 ] [mg/dm 3 ] [mg/dm 3 ] 

Madeira 0,506 0,568 0,029 0,326 1,429 

Zeltinger 0,42 0,492 0,051 0,229 1,192 

Pisport 0,704 0,792 0,053 0,299 1,847 

Brusznica 0,573 1,345 0,122 0,62 2,66 

References 

1. Czyzowska, A.: Wpływ procesu fermentacji na zawartość polifenoli w winach 

In: Przeciwutleniacze w żywności, Ed. WNT, Warsaw, 2007, p.452-457 (in 

Polish), 

2. Delcroix, A, Gunata , Z., Sapis, J.C., Salmon, J.M., Bayonove, C.: Glycosidase 

activities of three enological 

yeast strains during winemaking: effect of terpenol 

content of muscat wine. American Journal of Enology and Viticulture, 1994, 

vol.45, p.291-296. 

3. Di Stefano, R., Cravero, M.C., Gentilini, N.: Metodi per lo studio dei polifenoli 

dei vini. L'Enotecnico,1989,p.83-89 

258 

76,5



4. Haslam, E., Lilley, T.H., Warminski, E., Liao, H., Cai, Y., Martin, 

R.: 

Polyphenol complexation 

In: Phenolic c ompounds in food and their 

effects on 

health, Wa shington DC: 

A merican Chemists 

Society, 

1 992, p.8-50. 

5. Manzanares, 

P., Rojas, V., Genov es, S., Valles, S.: A prelimi nary search for 

anthocyanin-β-D-glucosidase 

activity in non-Saccharomyces wine yeast. 

International 

Journal of Food 

Science and Technology, 2000, vol.35, p. 95-103 

6. Morata, 

A., Gomez-Cordoves, 

M.C., Suberviola, J. , Bartolome, 

B., Colomo, 

B., Suarez 

, J.A. : Adsorption of anthocyanins by yeast cell walls during the 

fermentation 

of red wines, Journal of Agriculture and Food Chemistry, 2003, 

vol.51, p.4084-4088. 

7. Rossi, 

I., Vinella, M., Domizio, P.: Characterization of b-glucosidase activity 

in yeast 

of enological origin, Journal of Applied Bacteriology, 1994, 

vol. 77,p.519-527. 

8. Salmon, 

J.M.: Interactions between yeast, oxygen and polyphenols 

during 

alcoholic 

fermentations: Practical implication. Review LWT, 2006, vol. 39, 

p.959-965. 

9. Sanchez-Torres, 

P., Gonzalez-Candelas, L., Ramon, D.:Journal of Agriculture 

and Food C hemistry , 1998, vol. 46, p.354-360 

10. Singleton, 

S.L., Grape and wine phenolics: background and prospects.In: 

Webb AD (ed) Proc.Symp.Grape and Wine Centennial., University of California, 

Davis, 1982, p.215. 

11. Vasserot, Y., Caillet, S., Maujean, A.: Study of anthocyanin adsorption by 

yeast lees. Effect of some physicochemical parameters. American Journal of 

Enology and Viticulture 1997, vol.48, 

p.433-437. 

12. Zoecklein, B.W., Hackney, 

C.H., D uncan, S.E., 

Marcy, J.E.: 

.Journal 

of 

Industrial Microbiology and Biotechnolo 

gy, 1999, vol.2 

2, p.100-107. 

259

260 



FUNCTIONAL YOGHURT CONTAINING 

ENCAPSULATED Lactobacillus acidophilus 

A. STOICA * M. STROESCU, M. FERDES, I. JIPA, T. OFITERU 

Abstract: The aim of this paper is to present an experimental study concerning 

the viability of free and encapsulated cells of Lactobacillus acidophilus in different 

environmental conditions to simulate gastrointestinal milieu. The influence of pH, 

sugar and salt was studied for free and encapsulated cells. A simple mathematical 

model was used to simulate the free bacteria growth. 

Keywords: yoghurt, functional food, encapsulated bacteria, Lactobacillus 

acidophilus 

Intrduction 

Probiotics are defined as cultures of live microorganisms that, applied to 

animals 

or humans, improve properties of indigenous microflora. Advantages of 

probiotic bacteria are to improved digestibility, nutritional value and lactose 

utilization. 

They have also antagonistic action towards enteric pathogens, present 

anticarcinogenic effect, hypocholesterolemic action and 

immune modulation [1-2]. 

One of the most widely used way to increase the numbers of advantageous 

bacteria 

in the intestinal tract is the direct consumption of food containing 

live 

bacteria. 

Probiotic strains must survive under industrial conditions during yoghurt 

manufacture and also during storage as frozen, freeze-dried or dried culture. The 

probiotic strains should also survive the gastrointestinal stress factors and maintain 

their functionality within the host. The ability of microorganisms to survive and 

multiply in the host strongly influences their probiotic benefits. 

Encapsulation methods can be applied to increase the survival and delivery of 

bacterial cultures. Several methods have been developed for the encapsulation of 

bacteria for use in fermentation, as well as for incorporating into products. These 

encapsulation techniques can be classified into two groups: extrusion (droplet 

method) and emulsion or two phase system [3]. 

The aim of this paper is to present experimental results obtained for 

Lactobacillus acidophilus survival in different environmental conditions to 

* Dept. of Chemical Engineering, UPB Bucharest, Romania, e-mail: astoica@mt.pub.ro



simulate gastrointestinal milieu. The influence of pH, sugar and salt was 

studied 

for free and encapsulated cells. A simple mathematical model was used to simulate 

the free bacteria 

growth. 

2. Experimental 

ks 

con re 

harv in 

at 2 a 

refr acterial counting viable cell 

sam ally diluted 10 -1 to 10 -3 Lactobacillus acidophilus was grown aerobically in 750 ml conical flas 

taining MRS broth on a rotary-shaker incubator at 34 

in peptone water (0.1%) and 0.1 ml 

of t r. 

Via unt, performed in duplicate, was determined after 48-72 hours 

incubation at 37°C. For every sample two separate dilutions were enumerated and 

he viable cell count. 

o C (100 rpm). Cells we 

ested during the late exponential growth phase (24h) by centrifugation (20 m 

500g) and then washed three times with deionized water, and stored at 4 o C in 

igerator before being used in experiments. For b 

ples (1g) were seri 

he samples from the appropriate dilutions were spread plated onto MRS aga 

ble cells co 

averaged for t 

Technique for encapsulation of bacterial cells 

In this work emulsion technique was used. A small volume of the cell-agar 

system was added to a large volume of vegetable oil (sunflower oil). The mixture 

was homogenized to form water in oil emulsion at 40 0 C. By decreasing the 

temperature of the emulsion to 25 0 C, agar becomes a gel which entrapped the 

cells. The particles are then separated by filtration. The size of the beads is 

controlled by the speed of agitation [4]. 

3. Modeling bacterial growth 

Modeling microbial growth is very complex and necessarily it results in over 

simplifications. For example, there are segregated and non-segregated models. 

When a microbial population is considered as individual cells with different 

characteristics, the model is segregated. Conversely, non-segregated models 

consider microbial population as lumped into a biophase. Another classification 

considers two types of models: unstructured and structured models. Unstructured 

models consider microbial population as an entity or a single component while 

structured models consider individual or groups of reactions occurring within the 

cell or multiple cell components. 

From the models proposed in literature the Luedeking-Piret model was chosen for 

growth associated and non-growth associated lactic acid production and which 

belongs to the unstructured models [5]. The Luedeking-Piret model is given as: 

261

262 



dx 

= μx 

(1) 

dt 

dp dx 

= α + βx 

(2) 

dt dt 

When this is modified to include the effects of lactose limitations and inhibitions, 

as well as lactate inhibitions the model will contain the following equations: 

a) cell growth: 

dx ⎛ S 

n 1 

e ( ) e 

( P K ip 

μ 

) ⎞ 

S K i 

m 

Kd ⋅ x 

dt ⎜ 

− / 

− / 

= 

⋅ ⋅ − 

K s S 

⎟ 

(3) 

⎝ + 

⎠ 

b) substrate utilization: 

dS ⎡ X 

= −⎢ 

dt ⎢⎣ YXS ⎛ S 

n1 

( ) ( ) ⎞ 1 

⎜ 

− S / K − P / K 

μm 

e i 

ip ⋅ e − Kd 

⎟ + ms 

X + 

⎝ K S + S 

⎠ YPS 

dP ⎤ 

⎥ 

dt ⎥⎦ 

(4) 

c) product formation: 

dP ⎡⎛ 

S 

n1 

( ) ( ) ⎞ ⎤ 

⎢ ⎜ 

− S / K − P / K 

= X μ α e i 

ip 

m 

⋅ e − Kd 

⎟ + β⎥ 

dt ⎢⎣ 

⎝ K S + S 

⎠ ⎥⎦ 

(5) 

The kinetic parameters are given by Bizar et al. [6]. 

The model basic differential equations 

were solved numerically by means of 

Runge-Kutta 

method. 


To examine the survival of the free and encapsulated L. acidophilus in 

different conditions which can be encountered in the human gastro-intestinal tract, 

experiments were done in presence of HCl, NaCl and sucrose solutions for free and 

encapsulated cells. 

In a preliminary experiment, reported elsewhere [4] NaCl solutions at 

concentration of 1, 2, 3 and 5% where 

used to test the viability of free cells of L. 

acidophilus. The NaCl solutions containing L. acidophilus were then stored at 5°C 

for 1 week. The free cell viability was decreased till 15% in the presence of NaCl 

solution 5%. 

The next substance tested was sucrose.



For this, sterile sodium 10, 15, 20 and 25 

% were tely 10 7 sucrose solutions at concentrations of 5, 

added to test tubes containing approxima cfu/mL L. acidophilus 

and then plated immediately (time 0) on MRS agar. Serial dilutions were made 

using distilled water and 0.1% peptone. The sucrose solutions containing L. 

acidophilus were then stored at 5°C for 1 week. The viable counts of free cells of 

L. acidophilus were determined daily by sampling the contents of individual tubes. 

The results obtained are depicted in figure 1. Only at the highest concentration of 

sucrose (25%) one can observe a substantial decrease of free cell viability. For the 

other sucrose concentrations the decreasing is not appreciable. The experiment 

for 

encapsulated cells 

was done only for one sucrose concentration (10%). The 

encapsulation medium was 1% agar solution. Free cells culture was subjected to 

the same conditions to serve as a control. The results are presented in figure 2 for 

free and encapsulated cells. As it can be seen the same milk acidity is obtained. 

Fig. 1. Free cells viability in 

solutions of different sucrose 

concentrations 

Fig. 2. The influence 

of sucrose solution (10%) on 

the activity of encapsulated 

cells in comparison with free 

cells 

263

264 



The results obtained in the batch experiments for yoghurt preparation 

confirm that sucrose can be added in milk without to decrease the cells activity 

even there are free or encapsulated ones. More interesting are the results obtained 

for cell viability in HCl solution, because to simulate gastrointestinal conditions 

HCl is the most important substance. For the beginning, free cells of L. acidophilus 

were added in sterile solutions of HCl at different pH and maintained for 4 hours. 

The viable counts of free cells of L. acidophilus were determined each hour 

by sampling the contents of individual tubes. The results are presented in figure 3. 

The viability of free cells decreases dramatically in HCl solutions. For this 

reason the experiment with encapsulated cells was done only for pH=3. The results 

are presented in figure 4. 

Fig.4. Milk acidity versus time for free 

and encapsulated cells after acidic 

treatment for encapsulated cells 

Fig. 3. Free cells viability 

in solutions of HCl at 

different pH.



In figure 

4 one can observe that the agar beds protect Lactobacillus acidophilus 

cells against 

HCl influence. However, this protection is not entirely because we can see that the 

milk acidity is increasing slowly for encapsulated cells kept 4 hours in acidic 

solution then for free cells, which were not stressed in acidic conditions. From our 

point of view only the cells which are on the agar beds surface can be destroyed by 

acidic solution, 

while the cells which are entrapped in the agar beds are protected 

and in properly conditions they can diffuse to the surface and to start lactose 

fermentation. 

The model which describes 

cell growth can be used only for free cells. For this 

reason only the experiments with free cells were compared with model simulation. 

The experimental data are presented in figure 5. As it can 

be seen from figure 5 a 

good agreement between experimental data and model s imulation was obtained. 

For encapsulation cell the model are more complicated and mass transfer 

consideration must be taken into account. 

Fig. 5. Experimental and 

predicted lactic acid 

concentration during batch 

fermentation of milk 

5. Conclusion 

Experimental data on milk fermentation 

were presented for free and 

encapsulated L. acidophilus cells. The 

influence of pH, salt and sucrose on the 

viability of the bacteria cells was studied. 

The most aggressive factor which can 

stress bacterial cells is pH. For this reason the cell encapsulation can be regarded as 

a possibility to enhance cell viability under acidic conditions, which can be 

encountered in gastrointestinal tract. 

265

266 



References 

1. Shanahan, F.: Probiotics in inflammatory bowel disease—therapeutic rationale 

and role. In: Advanced Drug Delivery Reviews, vol. 56, 2004, p. 809– 818. 

2. Prasad, J., Gill, H.S., Smart, J., Gopal. P.K.: Selection and characterisation of 

lactobacillus and bifidobacterium strains for use as probiotics. In: International 

Dairy Journal, vol 8, 1998, p. 993–1002. 

3. Krasaekoopt W., Bhandari, B., Deeth, H.: Evaluation of encapsulation 

techniques of 

probiotics for yoghurt. Review. In: International Dairy Journal, 

vol. 13, 2002, p. 3-13. 

4. Ferdes, M., Vulpe, M., Stoica, A., Stroescu, M., Sandu, I.: Survival of 

Lactobacillus acidophyllus in simulated gastro-intestinal conditions. In: 

Proceeding of National Symoposium of Chemical Engineering, Cluj-Napoca, 3 

iulie, 2006, p. 75-77, Editura Accent, Cluj-Napoca. 

5. Boonmee, M., Leksawasdi,N., Bridge, W., Rogers, L.P.: Batch and continuous 

culture of Lactococcus lactis NZ133: 

experimental data and model 

development. In: Biochemical Engineering Journal, vol. 14, 2003, p. 127-135. 

6. Bizar, J., Tango, M., Babolian, E., Islam, R.: Solution of the kinetic modeling of 

lactic acid fermentation using Adomian decomposition 

method. In: Applied 

Mathematics and Computation, vol. 144, 2003, 

p. 433-439. 

Acknowledgement 

This work was financial supported by CNCSIS research grant CH45-06-11.



IMPROVEMENT 

OF BIOMASS PRODUCTION AND 

DNA EXTRACTION FROM FILAMENTOUS FUNGI 

I. VATUIU*, D. VATUIU*, B. GILEA*, L. DEJAN**, C. VOAIDES**, 

C.P. CORNEA**, F. MATEI** 

Abstract: The dynamic of the fungi growth, against the east or bacteria one, it is 

limited in a very characteristic 

way, to the end of the free extremity of the hyphen. It 

can continue by the peripheral hyphen extension, as long as there are nutrients in the 

medium. Cultivation conditions (solid or liquid media, with or w/o shaking) have an 

important influence on the final biomass. Experimental data proved that the 

cultivation in liquid media, under shaking conditions, at 25 o C during 3 to maximum 5 

days, lead to an optimum biomass characteristics. The wall cell disruption for mould 

is an important step and the used of the white quartz sand and the addition of Helix 

pomatia extract improved the results. An adapted method of the genomic DNA 

extraction has been developed. 

Keywords: 

mould cultivation, biomass production, DNA extraction 

troduction 

acid extraction from biomass depends on many factors, 

o have 

n improved extraction the growth way and the characteristics of this material 

ould be well known. 

The moulds colonies growth on solid and liquid media in surface or 

bmerse cultivation conditions with a different speed depending on the strain, the 

edium content and the environmental conditions (temperature, pH, aeration, 

gitation, osmotic pressure, etc.). 

For the non-fragmented fungi, the mycelia elongation arrives to 3mm/hour 

n 25 o In 

The nucleic 

starting from the initial material (plants, animal, microorganism). In order t 

a 

sh 

su 

m 

a 

o C. 

In the liquid media, under static conditions, fungi form a mycelium surface 

scab 

and different parts of the culture are under different aeration grade. 

In the industrial biotechnological processes, where it is necessary to have an 

abundant and equal development of the fungi, it is used in practice to cultivate it by 

mechanical agitation which conducts to a mycelia dispersion accompanied by the 

formation of spherical microcolonies. 

* CCAI Bucharest, Laboratory of Microbiology, Romania, e-mail: i.vatuiu@ccai-ro.com 

** USAMV Bucharest, Faculty of Biotechnology, Romania, e-mail: florentina.matei@bioteh.usab.ro 

267

268 



The dynamic of the fungi growth, against the east or bacteria one, it is limited 

in a very characteristic way, to the end of the free extremity of the hyphen. It can 

continue by the peripheral hyphen extension, as long as there are nutrients in the 

medium. This process has been described in details mainly for the non-fragmented 

mycelia. 

The growth of a mycelium starting from spores inoculums 

or from a 

fragment, goes through a successions, as follow: 

- the initial lag phase, which takes a few hours and is characterized by spores 

germination 

processes or by the hyphen regeneration use d as inoculum; 

- th e linear growth phase corresponds to the time when on the medium surface 

app ears a circular colony which grows in a linear way versus the time. The growth 

spe ed is maintained constant on the colony margins, while the central zone has a 

slower 

or even stopped growth. The surface growth of the colony it is not 

corr elated cu its weight growth. In low nutrient content media, the speed extension 

is h igher and the hyphen network is very thin, while on rich media the diameter 

growth 

is slowly and the mycelium is thicker. 

- th e older phase it is characterized by the slower growth speed, as long as the 

colony is closer to the mechanical obstacle 

of the margins and it comes actually 

from the inhibitory effect of the secondary metabolites produced by the fungal 

mycelia. 

This process is even stronger when the moulds are in rich media and when 

they are cultivated 

under optimal or supra-optimal temperature, when the 

secondary metabolites are faster accumulated. 

Regarding the fungal DNA extraction, numerous reports have described 

different procedures. Many of these are modifications of the CTAB method 

originally developed for 

plant tissue extraction (Saghai-Maroof, et. al. 1984) or 

employ 

direct sample extraction with organic solvent as the principal means of 

denaturing and 

eliminating contaminating protein (Blin and Stafford 1976). Whereas the CTAB 

method is considered superior at 

removing unwanted carbohydrate from DNA 

preparations, 

procedures that use organic solvents directly in the extraction buffer 

often can be performed more rapidly. Despite the range of techniques available for 

the preparation 

of fungal DNA, some fungal mycelia and most fungal spore 

samples remain intractable to extraction by these procedures. 

Material and Method 

Fungal strains 

In the experiments have been taken moulds strains isolated previously form 

intermediary humidity food products and kept in the collection of 

USAMV



Bucharest, 

as follow: Aspergillus flavus MI 138, Fusarium graminearum MI113, 

Penicillium crysogenum MI 218. 

Fungal cultivation method 

o 

The fungal strains have been cultivated at 25 C on Czapek-Dox media, both 

on solid 

and liquid one (figure1). For the liquid media the cultivation method was 

with or w/o agitation (figure 2). 

Fig. 2 – Aspects during the fungal 

cultivation on liquid Czapek-Dox medium 

under shaking conditions (Unimax 1010, 

500 rpm) 

Fig. 1 – Aspects during the fungal 

cultivation on solid and liquid Czapek-Dox 

medium 

After 5 days of cultivation the mycelium has been recovered in order to be 

use for the DNA extraction. 

Fungal DNA extraction 

Fungal mycelia were either scraped directly from the surface of an agar culture The 

mycelia was placed side up onto a large absorbent paper towel to wick away as 

much liquid as possible. The final mycelial mat was weighed before placing it into 

a mortar. Dry rust and mildew spores were weighed and added directly to the 

mortar. NOTE: Doubling 

of the liquid volumes and mass amounts of sand is 

advised 

as a starting point for application of the procedure to dry rust and mildew 

spores. 

White quartz sand was added to the tissue at a ratio of 3 g of sand per gram 

of tissue. For an optimal cell disruption it has been added 1 ml extract of Helix 

269

270 



5 M NaCl and 1% sodium dodecylsulfate] was 

dded to the mortar so that the sand/mycelia mixture became saturated, but no 

.4 ml of buffer per gram of sand). A mixture of buffer 

satura 

vigorously for ~30 sec with a pestle to form a 

thick paste. Two milliliters of extraction buffer and 1 ml of buffered phenol/CHCl3/ 

isoamyl alcohol per 0.5 g of starting tissue were then added and the solution was 

mixed thoroughly. A 1 ml plastic micro-pipette tip was cut with scissors about 1 

cm from the tip and the mixture was transferred into several icrofuge tubes using 

this tip and a micropipettor. The microfuge tubes were capped and centrifuged at 

16,000 x g for 5 min at room temperature; tissue debris and the sand pelleted to the 

bottom of the tube. The aqueous pha 

mixed with 0.6 vol of isopropanol. (If needed, the sam e extracted with 

phenol/CHCl3/ isoamyl alcohol one more time followed by centrifugation as above 

before precipitation with isopropanol.) Samples were incubated at room 

temperature for 10 mi and centrifuged at 4 o C for 15 min at 16,000 x g to recover 

the precipitate. After rinsing the pellets with 95% EtOH, the pellets were allowed 

to air resuspended in 340 ul of TE (10 mM Tris- 

H ribonuclease A at 20 ug/ml. Samples 

w ere then extracted with 0.3 ml of 

phenol/CHCl3/ is hol. The aqueous phase (~300 ul) was transferred to a 

new tube and 1/2 volume of 7.5 M ammonium acetate and 2.5 vol of EtOH were 

added and mixed, and the samples were incubated for 30 min at -20 o C. The 

samples were then centrifuged at 4 o pomatia (10 mg/ml KCl 1,2 M). Sufficient extraction buffer [100 mM Tris- HCl 

(pH 8.0), 20 mM Na2 EDTA, 0. 

a 

excess liquid was present (~0 

ted phenol/CHCl3/isoamyl alcohol was added at a ratio of 0.5 ml per gram of 

tissue. 

The mixture was ground 

m 

se was transferred to a new tube and was 

ple can b 

n 

dry briefly and were subsequently 

Cl, 1 mM Na2EDTA, pH 8.0) containing 

ere incubated at 37 

C for 15 min at 16,000 x g. The pelleted DNA 

was rinsed with 95% EtOH, air dried and resuspended in 100 ul of TE. 

Q 

ion to agarose gel electrophoresis and UV 

tively. 

o C for 30 min w 

oamyl alco 

uality and quantity of the DNA obtained were determined by subjecting a 

portion of the preparat 

spectrophotometry, respec 


Yields varied from ~10 ug to 50 ug of DNA recovered from 1 g of tissue to 

~100 ug of DNA obtained from 1 g of rust or mildew spores. A fraction of the 

DNA preparations were subjected to gel electrophoresis before (Figure 3). 

After spectrophotometric quantification, samples were adjusted to a DNA 

concentration 

of ~50 ug/ml and 10 ul of each sample was loaded onto a 1% agarose 

gel (1X Tris- acetate electrophoresis buffer). One- half microgram of the 1 kb 

ladder (BRL- Life Sciences) was loaded into the "Marker" lane.



Af Af Fg Pc Fg Pc 

Fig. 3 - Agarose gel electrophoresis of a 

subset of the DNA preparations. The lanes 

are labelled according to the tissue source 

(Af –Aspergillus flavus; Fg – Fusarium 

graminearum; PC – Penicillium 

crysogenum). 

Conclusions and Perspectives 

As the data showed, it is recommended in the case of genomic DNA extraction 

for the philamentous fungi to cultivate the fungi in liquid media, under shaking 

conditions at 27 o C. 

The weight of the biomass is an important issue, but is more efficientt to work 

with a 3 days culture, than a 5 days culture, in order to have a better cell wall 

disruption. 

The addition of Helix pomatia extract (10 mg/ml KCl 1,2 M) improved the cell 

wall disruption, arriving to ~100 ug of DNA obtained from 1 g of rust or mildew 

spores. 

The obtained DNA will be subject of further investigations regarding the 

expressions of genes involved in toxinogenesis. Primers design should be done in 

order to perform moulds identification and specific genes amplifications. 

References 

1. Dantigny, P., Audrey, G., Radoi, F. Bensoussan, M. - Modeling the 

effect of 

ethanol on growth rate food spoilage moulds, Int.J. Food Microbiol, Feb 15, 98 

(3) :261-9, p. 2005. 

2. Judet Daniela, Florentina Matei-Radoi, 

Stefana Jurcoane, M.Bensoussan - 

Studies on Aspergillus flavus growing and toxicity. Rom. Biotech. Lett., vol 11, 

nr.1(2006); 

3. Loeffler 

J., Henke N., Hebart H., Schimdt D., Hagmeyer L., Schumaher U., 

Einsele H. Quantification of fungal DNA by using fluorescence resonance 

energy transfer and the light cycler system, J. Clin. Microbiol. 38(2) 

: 219- 

225(2000); 

4. Talbot, Nick - Molecular and Cellular Biology of Filamentous Fungi: A 

Practical Approach, Academic Press, 2001. 

5. Weiland John J. - Rapid procedure for the extraction of 

DNA from fungal 

spores and mycelia. FGSC, USA. 

271

272 



INFLUENCE OF LASER IRRADIATION 

ON SEED 

GERMINATION: 

case study Stevia rebaudiana 

IRYNA SMETANSKA*, 

YAROSLAV SHEVCHENKO 

Department Methods in Food Biotechnology, Institute for Food Technology and Food Chemistry, 

Berlin University of Technology, Königin-Luise-Str.22 

14195 Berlin GERMANY 

*E-Mail: iryna.m.smetanska@tu-berlin.de 

Stevia rebaudiana occurs ubiquitously in many regions of Latin America. The 

plant possesses a potential to become a major source of sweeteners for food 

industry in the years to come. 

A reliable propagation technique developed to 

satisfy the needs of both direct stevioside extraction as well as initiation of callus 

culture for the purposes of stevioside biosynthesis study. 

The objectives were to study the role of laser irradiation on dormancy of stevia 

seeds. The design of the experiments included the randomized controlled factorial 

trials with seeds and micro-clones of Stevia rebaudiana. 

Different compositions of nutrient medium have been used for root development 

and shoot development of stevia plant. At the same time, comparison of different 

growing mediums shown that 10-fold increase of vitamin concentration in MSmedium 

and complete absence of enzymes provides optimal conditions for 

microclonal 

propagation of stevia. 

Application of external stress factors produced stimulating effect in braking of 

seed dormancy. It was established that plants with longer germination period (3-4 

days) had better reaction on laser irradiation. Different exposure time to laser 

irradiation 

with 640 nm wave length proved to increase the onset of the callus 

formation 

of stevia. A relation between time of callus initiation and exposure to 

2 

laser irradiation was studied and expressed in terms of Pearson correlation (R = 

0,90). 

We concluded that laser irradiation (P=15 mW) can be used as a potent tool for 

braking seed dormancy 

and at the same time, can be applied for callus initiation 

of plant material of Stevia rebaudiana. 

The germination 

of the seeds of may plant species can be suppressed 

physically or physiologically due to the hard seed coatas the structures surrounding 

seed embryos. The treatment with laser irradiation, we used to improve the ability 

of seeds 

to germinate, is uniform for each seed, do not damage the seed embryo, 

improves the seed germination in a stable manner without any loss. This method 

can be applied in agriculture, gardening and food industry. 

The mechanism of this treatment ist he following: 

the laser beam irradiate a 

part of the seed coat of a plant seed and perforate a part of the seed coat to thereby



overcome physical or physiological factors causing the suppression of germination, 

such as gas permeability and water permeability to seed embryo. 

the experiments we selected different plant, but then concentrated 

our 

attention most on the Stevia rebaudiana. This plant occurs ubiquitously in many 

regions 

of Latin America (Nultsch, 2001) and possesses a potential to become 

a 

major source of the sweeteners for the food industry in the years to come. Due to 

the significant amount of spurious fruits being generated by S. rebaudiana the 

seeds of this plant possess very low germination rate (Nultsch, 2001). A reliable 

propagation 

technique has been developed to improve the grade of seed 

germination. The hypothesis of the study was that the application of the certain 

external stress factor, particularly laser irradiation on the plant seeds can induce an 

array of different biological effects such as precipitated germination of seeds, 

induction of physiological and biochemical growth processes, etc. (Wilkins, 1995). 

These 

effects depend on two factors: the time of application and a value of the 

factor 

being applied. 

Materials 

and methods 

Ob ject of studies. Calibrated and non-calibrated seeds of stevia plant (S. 

rebaudiana) were selected for the studies. The experiments were provided as 

randomized controlled factorial trials with seeds of S. rebaudiana. 

Laser irradiation. A diode laser was used for comparable study of the laser 

irradiation influence on the germination process of stevia seeds. The diode laser 

possesses following characteristics: Type LFD650-15-3(12x30.5), wave length 650 

nm, optical output power 15 mW, laser class 3B. The influence of the laser 

irradiation is researched on with the seeds of different agricultural plants (stevia, 

cabbage, radish, alfalfa, cress, mustard) with irradiation time of 15 seconds per 

seed. The growth of the stevia explants was monitored by measuring their stem 

length, 

root length and counting of leaf number after the 18th day of vegetation. 

The results of the measurements were analyzed 

by means of the ANOVA method. 


Application of the external stress factors has a potential to trigger an array 

of metabolic processes in seeds of different plants (Richter, 1980). Laser irradiation 

of the different seeds of different plants showed different effects in comparison 

with non-treated seeds (Fig.1). As a result of the experiment seeds of Stevia 

rebaudiana Bertonni showed high response in terms of quantity 

of germinated 

seeds after 

treatment. 25 seeds out of 30 available in the experiment had 

germinated by the end of the experiment. The response for the treatment was tested 

on the seeds of other plants showed in the Figure 1. 

273

274 



The seeds of mustard, cabbage and radish showed statistically significant 

reaction on stress factor whereas seeds of alfalfa (Medicago sativa) and cress 

(Lepidium 

sativum) did not respond to the treatment in comparison to their 

respective variants that were not treatment. The different reaction pattern of the 

seeds as a response to the laser treatment accounts for the dormancy braking 

rapidity of each particular cultivar. The shorter the natural germination period is 

the lesser effect of laser irradiation on the seeds. It is possible that stimulatory 

effects produced as a result of the laser irradiation do not contribute to 

synchronized seed dormancy break in those seeds with a very short germination 

period of 1–2 days. On the other hand, this stimulation effect can play a decisive 

role in germination enhancement for plants which are light-dependent in their 

germination, such as stevia itself. 

Examples of alfalfa with a germination period of 3 days and cress with 1–2 

days illustrate this explanation. The application of external stress factor in the form 

of laser irradiation has 

two dimensions: time and power of irradiation. The 

hypothesis 

stated above was substantiated by the results in Figure 2. 

Fig1. Influence of laser irradiation (15 mW) on seeds germination of different 

plants. Different letters mean there is a statistically significant difference. 

Statistics: t-test. (Comparison between treatments of the same plant).



The research into the length of laser treatment of the explants and the onset 

of the callus formation on them showed that laser irradiation with 15 mW power 

tends to hamper the genesis of unstructured cell mass (callus) of S. rebaudiana. 

The narrow correlation pattern (R 

tion. Both of these variables were tested in this 

experim 

2 =0.90) showed in Figure 2 illustrates the 

negative response of Stevia explants on the increase of the treatment duration 

(protraction). Application of 15 mW of laser irradiation for 5 seconds leads to 

callus induction in 4 days whereas an increase of the treatment to 20 seconds 

extends the callus induction period 5-fold. The same laser power being applied for 

35 seconds increases the callus induction period to 21 days. As mentioned above, 

the stress factor can be characterized it terms of the amount of the factor being 

applied as well as time of applica 

ent. Different authors describe different optimal times of the callus 

induction in Stevia rebaudiana. 

Conclusion 

The application of external stress factors produced stimulating effect in braking of 

seed dormancy. It was established that plants with longer germination period (3–4 

days) had better reaction on laser irradiation. Different exposure time to laser 

irradiation with 640 nm wave length proved to increase the onset of the callus 

formation of S. rebaudiana. Laser irradiation (P=15 mW) is a potent tool for 

braking seed dormancy of S. rebaudiana. 

References 

1. Mohammed, S.U., Mohammad, S. H., Chowdhury, M. Muoztaba, M. H., 

Mohammad, B.U. and Romel, A. 2006. In vitro propagation of Stevia 

rebaudiana Bert in Bangladesh. African Journal of Biotechnology : 5 (13), 

1238-1240. 

2. Nultsch, W. 2001. Allgemeine Botanik. Georg Thieme Verlag, Stutgart, 

New York, 332-335. 

3. 

Richter, G. 1980. Stoffwechselphysiologie der Pflanzen. Thieme Verlag, 

234-238 

4. Wilkins, M. 1995. Physiologie der Pflanzen. Kosmos Verlag, 155-159. 

275

276 



INFLUENCE OF PULSED ELECTRIC FIELDS ON 

MICOTOXIGENIC FUNGI GROWTH 

M. GEICU * P. NICULITA * M. POPA * 

R. CRAMARIUC ** M. TURTOI * 

Abstract: The use of Pulsed Electric Fields (PEF) is a new, mild preservation 

technology to improve the shelf life of products. A PEF treatment consists of 

applying a high voltage difference over a food product, which kills the bacteria. 

PEF as a continuous treatment causing only a minor increase in temperature, so 

that taste and vitamins initial content are not very much affected. 

The investigation was undertaken to study “in vitro” inactivation of some 

Aspergillus micotoxigenic strains. 

A significant inactivation of fungi growth was 

observed to the samples treated for 6 minutes and 12 minutes with pulsed electric 

field, after 6 hours of inoculation time compared with 24 hours and 48 hours. 

Introduction 

Keywords: pulsed electric field, treatment, fungi. 

On account of a growing consumer demand towards foods that are safe, but 

retain the characteristics of fresh or freshly-prepared foods, mild preservation 

technologies 

are gaining more and more importance. Examples include high- 

pressure 

processing, pulsed electric fields (PEF) treatment, light technologies, cold 

plasma and use of biopreservatives. The introduction of novel preservation 

methods 

stimulated 

research in microbiology, technology and food processing. 

Application 

of PEF treatment causes membrane permeabilisation, allowing loss of 

cell content or intrusion of external media. It involves disruption of cell 

membranes, leading to formation of either temporary or permanent pores. 

PEF treatment 

relies on the microbial action of intense electrical impulses on a 

microsecond 

time scale. When an electrical impulse is applied, the osmotic balance 

of the micro-organisms present is disturbed. If processing conditions are chosen 

* 

Faculty of Biotechnology, Dept. of Industrial Biotechnologies, USAMV Bucharest, Romania, email: 

mihaela_geicu@yahoo.com 

** 

Electro-technologies Research Center – Bucharest, Romania, e-mail: raducramariuc@yahoo.com



correctly, micro-organisms are inactivated. A single pulse can establish reductions 

in plate 

counts exceeding 5 orders of magnitude. 

It was shown that application of the pulsed electric fields with a typical field 

strength E of 5–50 kV/cm and microsecond duration cause creation and growth of 

pores (electroporation) and the damage of the cell membranes. The electroporation 

theory describes the mechanism of the creation and growth 

of pores in the 

membranes. 

At field strengths in the order of 15-30 kV/cm, microbial cells are 

inactivated by electroporation of their membranes without any considerable 

temperature rise and without changes in the chemical or physical composition of 

the food material. For adequate processing, a number of short pulses (1-100 μs) are 

used. 

The critical potential of the membrane damage is of order um 0.2–1 V. A 

high electric field can also cause the local overheating of membranes and very fast 

transmembrane electroosmotic flow through the cell walls. Electroporation 

efficiency is very sensitive to distribution of the electrical fields on a cell surface. 

This distribution 

may be influenced by the inter-cells aggregation, cell-on-surface 

adhesion 

and formation of biofilms, which are important 

for biological 

suspensions. 


2.1. Biological Material 

Two culture stock of Aspergillus flavus T 3.88 and Aspergillus niger T 3.200 

were used in this study. These cultures come from Laboratory of Microbiology of 

The Company of Applicative Research and Investment – Institute of Food 

Research, Bucharest, Romania. These fungi were incubated at 22 

on solid 

inoculation moment the samples were treated with Pulsed Electric Field. 

o C, on Malt 

Extract Agar medium. 

The suspensions were prepared by mixing fungi cells, cultivated 

medium, with 10 ml of distilled water. One series of dilutions were prepared using 

distilled water. A quantity of 2 µl spores suspension was inoculated on Petri dishes 

with Malt Extract Agar medium. After 6 hours, 24 hours and 48 hours from the 

2.2. PEF Treatment 

The samples were treated with pulsed electric fields for 3 minutes, 6 minutes and 

12 

minutes. 

277

278 



The PEF generator provided monopolar pulses of near-rectangular shape. The 

trains of pulses were used for PEF treatment. There 

was a pause after each train 

and then polarity of the next train was changed to the opposite. 

In order to avoid the Joule heating effects, a longer inter-train pause time was used 

between PEF trains. 

The temperature inside the electroporation cuvette was controlled only in the 

inter-train period 

by a thermocouple and during the PEF application the 

thermocouple 

was removed from the electrode gap. 

Main characteristics of PEF generator are the following: processing voltage 

(20– 30 kV, with continuous adjustment); polarity (positive and negative); voltage 

variation (< ± 5% for 0,5-2kV; < ± 3% for 2-30 kV); electrodes shape (corona 

discharge); 

working mode (no repetitive, pulse by pulse, and repetitive, with a 

maximum frequency of 800 Hz); pulse shape (rectangular); pulse front (50-200 ns) 

and pulse duration (1 µs). 

2.3. Fungi diameter measurement 

The samples treated with PEF were incubated at 22 

g 3 weeks after PEF treatment. During the incubation diameter (cm) 

f fungi colonies was measured after 1 day, 3 days, 5 days, 7 days, 10 days, 15 

o C and fungi diameter was 

recorded durin 

o 

days, 18 days and 21 days. 


The PEF treatment applied on Aspergillus flavus T 3.88, after 6 hour from the 

inoculation moment, for 12 minute have an important inhibitory effect (figure 1) 

compared with 3 minutes and 6 minutes of treatment. 

The samples treated for 12 minutes was inhibited with 83,75 %, respectively 2,5 

% for the 6 minutes PEF treated samples and 15 % for the 3 minutes PEF treated 

samples, compared with the control. 

A significant inhibitory effect of Aspergillus flavus T 3.88 growth was observed 

to the samples treated with PEF, after 6 hour from the inoculation moment 

compared with PEF treated samples after 24 hours (figure 2) and 48 hours (figure 

3) 

from the inoculation moment. 

Figure 2 shows that 12 minutes of PEF treatment, applied to Aspergillus flavus 

after 24 hours from the inoculation moment, reduce the fungi growth with 45,56 %, 

respectively 20 % for 6 minutes of PEF treatment and 5,56 % for 3 minutes of PEF 

treatment.

Proceeding of the International Symposium BIOTECHNOLOGY 

2008, USAMV 


In the third figure it can be observed a reduction with 9,41 % for 3 minutes of 

treatment, respectively 10,58 % for 6 minutes and 96,47 % for 12 minutes of PEF 

treatment, applied on the samples after 48 hours from the inoculation 

moment. 

The Aspergillus niger T 3.200 colony diameter measurement during three weeks 

of recording showed that 

a 6 minutes and 12 minutes of PEF treatment applied on 

this fungi strain, after 6 hour from the inoculation moment, inhibit completely the 

fungi diameter growth (figure 4). 

The Aspergillus niger inhibition growth in this case 

was 100 % for 12 minutes 

and 6 minutes of PEF treatment and 13,53 % for 3 minutes. 

A 6 minutes respectively 12 minutes of PEF treatment applied to Aspergillus niger 

T 3.200 has an important inhibitory effect of colony growth after 6 hours (figure 4), 

24 hours (figure 5) and 48 hours (figure 6) from the inoculation moment. 

In figure 5 it can be observed the reduction of Aspergillus niger inhibition with 

27,65 % (3 minutes of treatment), 

respectively 32,94% (6 minute of treatment) and 

34, 

94% (12 minutes of treatment). 

During the 3 weeks of recording, Aspergillus niger, treated with PEF after 48 

hours 

has showed a reduction of fungal growth with 36,47% after 12 minutes of 

treatment, respectively 19,41% after 6 minutes of treatment. 

The results obtained 

Influence of PEF treatment on Aspergillus flavus T 3.88 strain showed that Aspergillus 

after 6 hours from the inoculation moment 

flavus T 3.88 strain was 

9 

more resistant to the 

8 

PEF treatment than 

7 

Aspergillus niger T 

6 

Control 3.200. 

Diameter 

(mm) 

5 

4 

3 

2 

1 

0 

0 5 10 15 20 25 

Time (days) 

PEF 3 min 

PEF 6 min 

PEF 12 min 

Fig. 1 Influence of PEF 

treatment on 

Aspergillus flavus T 

3.88 strain after 6 hours 

from the inoculation 

moment 

279

Diameter 

(mm) 

280 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 



Influence of PEF treatment on Aspergillus flavus T 3.88 strain 


0 

0 5 10 15 20 25 

Time (days) 

Fig. 3 Influence of PEF treatment 

on Aspergillus flavus T 3.88 strain 

after 48 hours from the 

inoculation moment 

Diameter (mm) 

9 

8 

7 

6 

5 

4 

3 

2 

1 

Diameter (mm) 

9 

8 

7 

6 

5 

4 

3 

2 

1 

Control 

PEF 3 min 

PEF 6 min 

PEF 12 min 


treatment on Aspergillus 

flavus T 3.88 strain after 24 

hours from the inoculation 

moment 

Influence of PEF treatment on Aspergillus flavus T 3.88 strain 


0 

0 5 

Influence of PEf treatment on Aspergillus niger T 3.200 strain 

after 6 hours from inoculation moment 

0 

0 5 10 15 20 25 

Time (days) 

Control 

PEF 3 min 

PEF 6 min 

PEF 12 min 

10 

Time (days) 

15 20 25 



niger T 3.200 strain after 6 


moment 

Control 

PEF 3 min 

PEF 6 min 

PEF 12 min

Diameter (mm) 

9 

8 

7 

6 

5 

4 

3 

2 

1 



Influence on PEF treatment on Aspergillus niger T 3.200 strain 


0 

0 5 10 15 20 25 



niger T 

3.200 strain after 48 hours from 

the inoculation moment 

Conclusions 

Time (days) 

Diameter (mm) 

9 

8 

7 

6 

5 

4 

3 

2 

1 

A significant inactivation of fungi growth 

was observed to the samples treated, 

for 6 minutes and 12 minutes with pulsed 

electric field, after 6 hour from the 

inoculation time compared with 24 hours and 48 hours from the inoculation 

moment. 

This results depends on the type of cell studied, the 

PEF treatment time applied 

to the samples and the inoculation moment for the 

samples treated with PEF. 

The most resistant samples to the PEF treatment were those samples inoculated 

with 48 hours before the PEF treatment. 

After three weeks of fungi growth monitoring we can conclude that Aspergillus 

flavus was more resistant to the PEF treatment than Aspergillus niger and a PEF 

Control 

PEF 3 min 

PEF 6 min 

PEF 12 min 



niger T 3.200 strain after 24 


moment 

Influence of PEF treatment on Aspergillus niger T 3.200 strain 

after 48 hours from inoculation moment 

0 

0 5 10 15 20 25 

Time (days) 

Control 

PEF 3 min 

PEF 6 min 

PEF 12 min 

281

282 



treatment applied for 6 minutes and 12 minutes has been an efficient treatment for 

the inactivation of these micotoxigenic strains. 

References 

1. C. Ferrer, D. Rodrigo, M.C. Pina, G. Klein, M. Rodrigo, A. Martínez, The 

Monte Carlo simulation is used to establish the most influential parameters on 

the final load of pulsed electric fields E. coli cells, Science Direct, available 

online 11 July 2006. 

2. F. Sampedro, A. Rivas, D. Rodrigo, A. Martínez, M. Rodrigo, Pulsed electric 

fields inactivation of Lactobacillus plantarum in an orange juice–milk based 

beverage: Effect of process parameters, Science Direct, available online 10 

October 2006 

3. G. Donsì, G. Ferrari, G. Pataro, Inactivation kinetics of Saccharomyces 

cerevisiae by pulsed electric fields in a batch treatment chamber: The effect of 

electric field unevenness and initial cell concentration, Science Direct, 

available online 24 January 

2006. 

4. H. El Zakhem, J.-L. Lanoisellé, 

N.I. Lebovka, M. Nonus, E. Vorobiev, 

Behavior of yeast cells in aqueous 

suspension affected by pulsed electric field, 

Science Direct, available online 

25 April 2006. 

5. M. Amiali, M.O. Ngadi, J.P. Smith and, G.S.V. Raghavan, Synergistic effect of 

temperature and pulsed electric field on inactivation of Escherichia coli 

O157:H7 and Salmonella enteritidis in liquid egg yolk, Science Direct, 

available online 5 April 2006. 

6. 

S.F. Aguilar-Rosas, M.L. Ballinas- Casarrubias, G.V. Nevarez-Moorillon, O. 

Martin-Belloso, E. Ortega-Rivas, Thermal and pulsed electric fields 

pasteurization of apple juice: Effects on physicochemical properties and 

flavour compounds, 

Science Direct, available online 11 January 2007.



Introduction 

INFLUENCE OF PACKAGING METHOD ON 

BACTERIAL FLORA OF MEAT PRODUCTS 

A. NOWAK * A. RYGAŁA * 

Abstract: The aim of the investigation was to determine the participation of 

Brochothrix thermosphacta in the spoilage of meat products. Five meat 

products manufactured at the local meat plant were stored at 4 

here and vacuum. Before and after 7 days of storage, the total 

o C in normal, 

modified atmosp 

count of microorganisms growing at 30 o C, the total count of psychrotrophic 

bacteria and count of Brochothrix thermosphacta were determined. The 

bacterial flora was gradually selected towards B. thermosphacta in the vacuum 

and in the normal atmosphere. This species wasn’t observed among 

predominated microflora in the meat products stored in the modified 

atmosphere. 

Keywords: Brochothrix thermosphacta, meat products, MAP, VP 

Meat and meat products are a good support for the growth of microorganisms 

including spoilage microflora. According to Regulation (EC) 178/2002 of the 

European 

Parliament and of the Council laying down the general principles of food 

law, 

food shall be deemed to be unsafe not only if it is injurious to health but also if 

it is unfit for human consumption. Currently, modified atmosphere (MA) 

and 

vacuum packaging are generally in use to prolong the shelf-life of meat products. 

Composition of the spoiled meat products microflora is strongly influenced by 

package parameters. Spoilage is the outcome of the imposed environmental 

conditions and the microbial interaction. Aerobically stored meat products are very 

often spoiled by Pseudomonas sp. This genus is effectively inhibited by 20% or 

more carbon dioxide enriched atmospheres. The storage of the products in MAP or 

VP restricts the growth of Pseudomonas sp. so that lactic acid bacteria (LAB), 

Brochothrix thermosphacta and Enterobacteriaceae become the major components 

of the spoilage microflora [5, 6, 7, 8]. 

* 

Institute of Fermentation Technology and Microbiology, Technical University of Lodz, e-mail: 

anowak@p.lodz.pl 

283

284 



The aim of our investigation was to determine the participation of Brochothrix 

thermosphacta in the sp oilage of MA, vacuum packaged and unpackaged meat 

products. 

Brochothrix thermosphacta was first isolated from pork sausage by Sulzbacher 

and McLean [10]. This is gram-positive, nonsporeforming, nonmotile bacteria. It is 

facultatively anaerobic but better growth is achieved by Brochothrix 

ther mosphacta aerobically. In aerobiosis, glucose is mainly degraded by 

Brochothrix thermosphacta into lactic acid but small amounts of acetic, propionic, 

iso- butyric, n-butyric, iso-valeric and n-valeric acids were also produced. In 

anaerobiosis Brochothrix thermosphacta produces mainly lactic acid and ethanol 

[3]. 

2. Materials and m ethods 

2.1. Samples 

Five meat products (“Wiejska” sausage, “Swojska” sausage, frankfurters, bacon, 

ham), manufactured at the local meat plant according to standard practices, were 

stored at 4 o C in normal, modified (80% CO2+20% N2) atmosphere and vacuum. 

Before (time zero) and after 7 days of storage, the total count of microorganisms 

growing at 30 o C (TCM), the total count of psychrotrophic bacteria (TCP) and 

count of Brochothrix thermosphacta were determined. 

2.2. Bacterial enumeration 

The total count of microorganisms growing at 30 o C and psychotrophic bacteria 

were determined on Plate Count Agar (PCA, Merck), incubated at 30 o C for 72 h 

and at 6 o C for 6 days, respectively. Brochothrix thermosphacta was determined on 

STAA medium (Oxoid), incubated at 22 o C for 72h. The lowest detection limit of 

the above enumeration techniques was monitored at 10 cfu/g. 

2.3. Bacterial identification 

The bacteria 

isolated from STAA agar were determined using Bergey’s manual 

criteria. Gram staining, oxidase and catalase tests were performed using standard 

procedures. 

Oxidation or fermentation of glucose was examined in Hugh Leifson 

(HL) medium (BTL, Poland) after incubation for 72h. Gram-positive, catalase 

positive 

and oxidase-negative 

bacilli were identified to the species level using API



50CHL tests (Bio Mérieux,). Identification of an organism was recorded as 

uncertain when the probability of identification was less than 60%. 

2.4. Lipolytic and proteolytic activity 

e capacity of Brochothrix thermosphacta to hydrolysis of casein and gelatin 

as determined at 4 and 30 o Lipolytic activity of Brochothrix thermosphacta was determined at 4 and 30 

C using minimal media with casein and gelatin 

spectively. 

o C, 

using Spirt Blue Agar (Difco). 

Th 

w 

re 


Meat product Packaging 

Storage 

time 

TCM TCP 

Table 1 

B. 

thermosphacta 

days cfu/g 

0 2,3 x 10 4 35

286 



The initial taste, colour, texture and odour were typical for the product. The 

total count of mesophile (TCM) was from 4,4 x 10 

to 1,9 x 10 cfu/g. The participation of B. 

d 10 -10 cfu/g in MA, after 7 storage days. The storage of products 

caused an increase in the population num acteria from 2 to 

f meat product aging systems. The bacterial 

Brochothrix thermosphacta in the 

(from 2 to 67% of spoilage flo n the normal atmosphere (from 

i ies n’t ob 

predominated microflora in the m roducts stored in the ie 

The largest increase of s wa d in the product m from 

un corned . Probably the b g roduct ess 

was the source of m ontam tion. A g to t al. [4] brines can 

harbor large popula f spoilage bact ar portan of 

contamination for meat products. 

2 to 2,3 x 10 4 cfu/g, 

2 

psychrotrophs (TCP) from 5 

thermosphacta in the spoilage microflora was under 1%. The total count of 

mesophiles increased to the level 10 3 -10 8 cfu/g in normal atmosphere, 10 5 -10 7 cfu/g 

3 7 

in vacuum an 

bers of psychrotrophic b 

6 log, according to kind o 

s and pack 

flora was gradually selected towards vacuum 

ra) and i 42 to ca. 

100% of spoilage flora) (Fig. 1). Th s spec was served among 

eat p modif d atmosphere. 

microorganism s observe ade 

fragmented, meat rine usin during p ion proc 

icrobial c ina ccordin Greer e 

tions o eria and e an im t source 

e 

g 

ta 

n 

e 

rc 

e 

p 

100 

80 

60 

40 

20 

0 

time 0 7 days, NP.7 days, MA P 7 days, 

VP 

Wiejska sausage 

Swojska 

sausage 

frankfurters 

Fig. 

1. Percentage of B. thermosphacta in spoiled mesophile microflora of the meat 

products 

Products packaging in modified atmosphere (80% CO2+20% N2) protected 

against excessive growth of B. thermosphacta. According to Borch et al. [1] lactic 

acid bacteria are predominant group of spoilage organisms in meat products 

packaged in MA without oxygen. B. thermosphacta dominates in product



packaging 

in high oxygen-MA. In a vacuum-pack the composition of gaseous 

phase changes during storage. The concentration of oxygen decreases while that of 

carbon dioxide increases. The microflora of VP product is gradually selected 

towards CO2- tolerant organisms e.g. LAB, B. thermosphacta. It was observed 

during our investigations. The largest number of B. thermosphacta was detected 

after 7 days of non-packaged products storage. Initially specific spoilage 

microflora of meat and meat product stored in normal atmosphere consist mainly of 

Pseudomonas sp. During storage the change in spoilage profile is observed, other 

species e.g. B. thermosphacta, appear among spoilage organisms [5]. 

Eleven strains of Brochothrix thermosphacta were isolated from investigated 

products. The probability of identification for all strains was very high (99,0 – 

99,9%). It attest to selectivity of STAA medium using for enumeration of this 

species. 

The proteolytic activity of B. thermosphacta wasn’t observed. Any proteins 

(casein, gelatin) weren’t degraded neither at 30 

] identified peptidolytic activity of Brochothrix 

thermosphacta. 

Table 2 

Casein hydrolysis Gelatin hydrolysis Lipolysis 

o C nor at 4 o C (tab. 2). The lack of 

protease activity was confirmed by Labadie [5]. On the contrary, Sutherland et al. 

[11] and Braun & Sutherland [2 

4 o C 30 o C 4 o C 30 o C 4 o C 30 o C 

strai 

n 

1 - - - - - + 

2 - - - - - + 

3 - - - - + + 

4 - - - - + + 

5 - - - - - + 

6 - - - - - + 

7 - - - - - + 

8 - - - - - + 

9 - - - - + + 

10 - - - - + + 

11 - - - - - + 

Lipids hydrolysis was provided by all investigated 

strains at 30 o C, but only four 

o 

of these were capable to hydrolyze glycerol esters at 4 C. Labadie [ 5] 

describes 

that B. thermosphacta possesses a glycerol ester hydrolase which is principally 

active on short chain fatty acids. According to Papon and Talon [9] B. 

thermosphacta synthesizes lipases best at a temperature above 20 o C. Braun and 

Sutherland didn’t detect lipase activity within the range of 2 – 20 o C. Our 

287



observation suggest that B. thermosphacta may produce lipase in meat stored at 

chilling temperatures. It is very important in the context of spoilage. 


This research is financially supported by the grant of the Ministry of Science and 

Higher Education No N N312 160834 (2008-2009) 

References 

1. Borch, E., Kant-Muermans, M.L., Blixt, Y.: Bacterial spoilage of meat and 

cured meat products. In: International Journal of Food Microbiology, vol. 33, 

1996, 103-120. 

2. Braun, P., Sutherland, J.P.: Predictive modelling of growth and measurement 

of enzymatic 

synthesis and activity by a cocktail of Brochothrix thermosphacta. 

In.: International Journal of Food Microbiology, vol. 95, 2004, 169-175. 

3. Cayre, M.E., Garro, O., Vignolo, G.: Effect of storage temperature and gas 

permeability of packaging film on the growth of lactic acid bacteria and 

Brochothrix thermosphacta in cooked meat emulsions. In.: Food Microbiology, 

vol. 22, 2005, 

505-512. 

4. Greer, G.G., Nattress, F., Dilts, B., Baker, L.: Bacterial contamination of 

recalcula ting brine used in the commercial production of moisture-enhanced pork. In: Journal of Food Protection, vol. 67, 2004, 1 85-188. 

5. Labadie, J.: Consequences of packaging on bacterial growth. Meat is an 

ec ological niche. In: Meat Science, vol. 52, 1999, 299-305. 

6. M olin, G., Ternstro m, 

A.: Numerical taxonomy of psychrotrophic 

Pseudomona s. In: Journal of General Microbiology, vol. 12 8, 1982, 1249- 

1264. 

7. Nowak, A., 

Rygała, A.: Brochothrix thermosphacta jako organizm 

odpowiedzia lny za psucie produktów mięsnych. In: Kalejdoskop Mięsn y, vol. 

4, 2006, 54-57. 

8. N ychas, G.J.E., Skandamis, P.N., Tassou, C. C., Koutsou manis, K.P. : Meat 

spoilage during distributi on. In: Meat Science, vol. 78, 2008 , p. 

77-89. 

9. Popon, M., Talon, R.: Factors affecti ng growth and lipase 

production by meat 

lactobacilli strains and Brochothrix thermosphacta. In.: Journal of Applied 

Bacteriology, vol. 64, 1988, 107-115. 10. Sulzbacher, W.L., McLean, R.A.: The bacterial flora of fresh pork sausage. In: 

Food Technology, vol. 5, 1951, 7-8. 

11. Sutherland, J.P., Patterson, J.T., Gribbs, P.A., Murray, J.G.: Some metabolits 

and biochemical characteristics of representative microbial isolates from 

vacuum packaged beef. In.: Journal of Applied Bacteriology, vol. 39, 1975, 

239-249. 

288



INVESTIGATION OF THE COMPOSITION OF 

RHODODENDRON 

KOTSCHYI SIMK. VOLATILE 

OIL BY 

GC-MS 

C. GEORGESCU ∗ , I. BRATU ∗ , M. 

TĂMAȘ ∗∗ 

MIRONESCU ∗ , M. 

Abstract: It was studied the anatomy of the leaf and there were described 

the secretor glands of peltate type, where the volatile oil was 

microhistochemically identified with Sudan III. There were presented the 

results of the quantitative and qualitative analysis of the volatile oil. Through 

GC-MS there were noted 39 peaks in the volatile oil extracted from leaves 

and 81 peaks in the volatile oil from flowers. 

Keywords: volatile oil, Rhododendron kotschyi, leaf, flower, secretor 

gland, microhistochemically, GC-MS, peaks, retention indices. 

Introduction 

Knowing 

the importance of volatile oils in phytotherapy, their antimicrobial, 

fungicide, insecticide etc. action, we made a study of the volatile oil from the 

Rhododendron kotschyi Simk native species. 

Rhododendron 

kotschyi belongs to the Rhododendroideae subfamily, the 

Ferruginea subsection of the Ericaceae family, popularly known as rose bay. It is a 

bush that vegetates in the inferior alpine storey, where it also forms characteristic 

associations, 

being a Dacian-Balkanic endemism spread in the Eastern Carpathians, 

absent in the Western Europe mountains [16]. 

Its 

hard, resisting, elastic, ovate-elliptical leaves have a green-shiny colour on 

the superior side, presenting scaled brown-rust-colored glands on the inferior side. 

These glands are also present on the petiole, on young stems and on fruits. The 

flowers 

are big (1.5 cm), purple red or bright pink. The fruit was a loculicide 

∗ 

University ”Lucian Blaga” of Sibiu, cecilia.georgescu@ulbsibiu.ro. 

∗∗ 

University 

of Medicine and Pharmacie, Cluj-Napoca. 

289

290 



capsule. The leaves, just like the flowers and the fruits emit, when crushing 

a 

characteristic aromatic odor. 

Gyorffy [8] has published a very comprehensive study on the anatomy of the 

Rhododendron kotschyi leaves, describing the scaled 

glands of peltate type on the 

inferior side of the leaves and showing their physiological importance. Have 

presented the characteristics of the Rhododendron ferrugineum and Rhododendron 

hirsutum 

laves [12]. 

The volatile oil extracted from Rhododendron 

kotschyi has not been studied 

until 1974 [15], when M. Tămaş and R. Ciupe have published a study concerning 

the volatile 

oil obtained from leaves and fruits of Rhododendron kotschyi. The 

conclusion they drawn is that leaves contain 0.44% - 0.75% volatile oil and fruits 

0.20% - 0.25%. 

In the same study, through thin layer chromatography were observed 12 spots, 

and through gas chromatography 14, being identified α-pinene, β-pinene, borneol 

and linalool. 

In species belonging to the Ericaceae family, the following components of the 

volatile oil were determined: α-terpineol, borneol, α and β-pinene, camphene, 

limonene, 

α-caryophylene [6, 7, 10]. 

Fournier [4] has shown the medical importance of some Rhododendron species 

while Belova [ 1] has presented data on the chemical composition of these species. 

Literatures 

mention 

that some Rhododendron species are toxic because of the 

andromedotoxine they contain [3, 5, 10]. 

2.Materials and methods 

For the anatomical and phytochemical study of this species we have used 

vegetal material harvested from the Făgăraş and Cindrel Mountains in May, June 

and September 2007-2008 (Table 1). 

2.1. Leaf Anatomy 

Studying the leaf anatomy, we have noticed that it presents a bifaciale structure, 

having the cuticule of the superior epidermis well-developed (16μ), and on the 

inferior side there are scaled secretor glands of peltat type (fig. 1). 

These are ranged in small depressions on the inferior side of the leaf and they 

are inserted with by means of a pluricellular little leg, from where there start in a 

radial direction several secretory cells leaving between them intercellular spaces. 

On the external side, the whole gland is covered by a cuticule 

that becomes 

bulging in the case of a large quantity product secretion. 

On surface a secretory



gland presents three concentric zones that correspond to the number of cellular 

layers that form the gland. 

Fig. 

2. Microhistochemical identification 

of volatile oil by secretory gland of Rh. 

Kotschyi; p – oil drops 

Fig. 1. Transversal section through the 

leaf of Rh. kotschyi, presenting a scaled 

secretor gland of peltat type 

2.2. The microhistochemical assessment the glands volatile oil 

From the leaf inferior side we have extracted by means of a spatula needle 

several glands that were introduced in a plate containing Sudan III [17]. After 

keeping them for 30 minutes we washed the 

glands with water and we transferred 

the preparation into glycerin. Examined at the microscope, the glands presented a 

yellow-brown color, and in the interior there can be seen many drops of volatile oil 

colored in bright red, due to the incorporation of the colorant by the volatile oil 

(fig. 2). 

2.3. Quantitative determination of the volatile oil 

For obtaining and dosing of the volatile oil we have used dried leaves and 

flowers from which we have extracted the volatile oil through steaming for five 

hours [17] using a neo-Clevenger equipment modified as by Moritz, and the 

content was compared to the moistureless vegetal material. 

291

292 



2.4. Qualitative analysis of the volatile oil 

The volatile oil was analyzed 

through by gas chromatography. The analysis has 

been performed with a Hewlett Packard 5890 III gas chromatograph equipped with 

a Mass detector MS 5972. 

The chromatographic column we have used was a HP5-MS capillary column 

made of quartz, with a non-polar stationary phase consisting of 95% methyl and 

5% phenyl polysilloxan. The constructive characteristics 

of the column are: 

• Length 30 m 

• Interior diameter 0.25 mm 

• Thickness of the stationary phase 0.25 μm 

As carrier gas it was used helium (1:1 mL/ min). The injection temperature was 

being 

60°C, incrementing with 3°C/min to 240°C. 

To identify the components it was used the Chem. Information, 

Library Wiley 

275 

program. These have been identified through the comparison 

of the mass 

spectrum 

with the one existing in the database of the computer. In parallel there 

have also been calculated the relative 

retention indices for the separated 

compounds [11]. 


The results obtained by the quantitative analysis of the volatile oil are presented 

in Table 1. Fr om their 

analysis it can be concluded that the leaves have a higher 

content of volatile oil than the flowers. As for the vegetation period concerns the 

results have shown that in september the volatile oil content is smaller that than of 

June. The volatile oil presents a white-yellowish color, with a characteristic flavor 

i.e. 

slightly aromatic. 

Table 1. 

The content of volatile oil in Rh. kotschyi leaves and flowers. 

Harvesting Date Vegetal Organ Harvesting Place 

Content of volatile oil 

mL/100g 

2007 (V) Leaves Făgăraş Mountains 0.6 

2007 (VI) Leaves Făgăraş Mountains 0.6-0.75 

2007 (VI) Flowers Făgăraş Mountains 0.16 

2007 (IX) Leaves Făgăraş Mountains 0.4-0.44 

2008 (V) Leaves Cindrel Mountains 0.5 

2008 (VI) Leaves Cindrel Mountains 0.5-0.65 

2008 (VI) Flowers Cindrel Mountains 0.15



By GC-MS analysis there were obtained 

the chromatograms presented in 

figure 

3, for the volatile oil from the leaves and figure 4, for the volatile oil from 

the flowers, respectively. 

Fig. 3. Chromatogram of the volatile oil in leaves of Rh. Kotschyi 

It can be seen from there chromatograms that the volatile oils have a great 

number of components. For their identification, besides the comparison 

of the 

spectra of the separated components with the computer spectrum library [ 13] , there 

have also be en calculated the Kováts indices or the relative retention indices, 

according to the formula (1) [14]: 

⎛ t −t 

⎞ 

R R 

I 

n n 

⎟ 

⋅100 

(1 

t 

+ 

) 

R 

= 

⎜ 

⎜ 

R 

⎟ 

⎝ n+ 

1 ⎠ 

Where: 

IR – the relative retention indices (RRI) of the analyzed component; 

t R – retention time of the analyzed component; t R - retention time of the hydrocarbon having same number of carbon atoms 

as the 

n 

component whose retention indices is to be determined; 

293

t 

R 

n+ 

1 

294 



- retention time of the hydrocarbon with a carbon atom more than that of the 

analyzed component; 

n – the number of carbon atoms 

of the component. 

Fig. 4. Chromatogram of the volatile oil in flowers of Rh. kotschyi 

Table 2. 

Identified component in the volatile oil in Rhododendron kotschyi leaves. 

Peak 

No. 

tR Area % RRI 

RRI 

literature 

Component Qual 

1 6.561 42.42 994 933 α-Pinene 96 

2 6.714 1.683 949 946 Camfene 

97 

3 7.458 5.133 972 976 β-Pinene 

96 

7 9.096 2.82 1021 1027 Limonene 97 

18 19.771 1.183 1294 1284 Bornyl acetate 96 

24 29.468 27.666 1526 1485 β-Selinene 99 

25 29.805 13.466 1534 1485 α-Selinene 99 

33 35.874 1.370 1685 1494 Sesquiterpenic alcohol 99 

95.741 Sum of identified components



The calculated indices are specific to each type of equipment 

(chromatographic column) 

and to the working conditions [2]. In Table 2 and 3 

there are presented the identified compounds of the 

two oils, with the calculated 

parameters. 

Table 3. 

Identified components in the volatile oil in Rhododendron kotschyi flowers. 

Peak 

No. 

tR Area % RRI 

RRI 

literature 

Component Qual 

2. 6.512 14.453 942 933 α-Pinene 97 

3. 6.646 0.216 946 946 Camfene 87 

4. 7.566 4.486 976 976 β-Pinene 97 

8. 9.055 0.759 1020 1027 Limonene 92 

21 20.026 0.684 1300 1284 Izobornyl acetate 83 

22. 20.324 0.611 1307 1284 Bornyl acetate 72 

29. 25.962 1.331 1441 1418 Trans-Cariofilene 96 

30. 30.780 44.602 1558 Selinene 99 

31. 30.995 4.836 1563 Selinene 99 

32. 31.188 2.161 1568 Selinene 99 

33. 31.281 2.986 1570 Selinene 99 

34. 31.531 1.947 1576 1523 δ-Cadidene 99 

35. 31.834 0.193 1584 α-Calcorene 94 

36. 32.033 0.052 1588 1580 Cariofilen oxide 80 

67. 46.549 0.475 1975 Di-butyl ester of benzene 

1.2-dicarboxylic acid 

93 

71. 48.476 0.405 2033 Palmitic acid 92 

81. 59.521 0.318 2402 2400 Tetracosane 87 

80.515 Sum of the identified components 

4. Conclu sions 

The leaves of Rhodod endron kotschyi contain volatile oil in the scaled 

secretor glan ds on the inferi or side. 

The volatil e oil from the glands has been identified 

through a 

 

microhistochemical mean using Sudan III. 

The oil con tent in the dried leaves is 0.4-0.75 mL % and in flowers of 

0.15-0.16 mL 

%. 

Through gas chromatography there were separated 81 components in the 

volatile oil extracted from the flowers and 39 

components in the volatile 

oil obtained the leaves. 

295

296 



In the 39 components separated from the leaves there were identified 8, αpinene 

and β-selinene representing the greatest majority. 

In the 81 components separated from the flowers there were identified 14, 

α-pinene, 

selinene and β-pinene representing the greatest majority. 

As it can be seen from the above-presented data, α-pinene, β-selinene and 

β-pinene are components majority in both studied oils. 

By analyzing for the first time the volatile oil obtained from Rh. Kotschyi 

through by GC there have been identified, also for the firs time, the 

following compone nts: camphene, limonene, bornyl acetate, 

β-selinene, 

sesquiterpenic alcohol. 

References 

1. Belova N.V., Khimiceskii issledovania rastenii roda Rhododendron L. In: Rastit. Res, 

4 (2), 1968, 258. 

2. Davi es N. W . J of Chromatography, 503, 1 990, p.1-24. 

3. Ellen 

horn M.J. 

“Ellenhorn’s M edical Toxic ology”, 

Diagnosis and Treatment 

of Human poisoning, 

Second 

Edition, 

Williams & Wilkins, Baltimore, 1997, p. 1862- 1863. 

4. Fournier P. Le livre des plantes medicinales et veneneuses de France, vol III, Ed. P. 

Lech evalier, Paris , 1948. 

5. Gessner O., Gift ind Arzneipflanzen von mitteleuropa, Carl Winter Universitätsverlag, 

Heidelberg, 197 4, p. 341-342. 

6. Gild emeister E., H offman F. Die äetherischen Ole, vol I (1 956), vol II (1960), vol IIIa 

(1960), vol IIIb (1962), Akademie Verlag, Be rlin. 

7. D’G uillen M., Cabo N. In: J. Sci. Food Agr ic., 70, 

1996, p. 

359-363. 

8. Györffy 

I., A Rhododendron myrthifolium es 

a Rh. Ferrugineum physiologiai, 

anatomiai 

viszonyirol 

rendzertany 

valo 

relyzetükre tekintettel, Ph. D. Thesis, 1904, 

Cluj- Napoca. 

9. Hammerschmidt 

F.J., Clark A.M., Soliman F.M. In: Planta Med., 59(1), 1993, p. 68- 

70. 

10. Hegna uer R., Chemotaxonomie der Pfkanzen, vol IV, 

Ed. Birkhauser Basel, 

Stuttgart,1966. 

11. Henning P., Steinbon A., Engewald W. In: Chromatographia, 38(11-12), 1994, p. 689- 

393. 

12. Metcalfe C.R.,Chalk L., Anatomy of the Dycotyledons, 

Clarendon Press, Oxford, 1957. 

13. Oprean I., Spectrometria de masă a compuşilor organici, Editura Dacia, Cluj-Napoca, 

1974. 

14. Oprean R., Separarea, detecţia şi determinarea cantitativă a unor componenţi 

bioactivi din uleiurile volatile prin cuplajul GC-MS, Ph. D.Thesis, Cluj-Napoca, 2000. 

15. Tămaş M., Ciupe R. In: Farmacia, 22(1), 1974, p. 49-55. 

16. *** Flora R.P.R., vol.VII, Editura Academiei R.P.R., Bucharest, 1965. 

17. *** Farmacopeea Română, Ediţia X-a, Editura Medicală, Bucharest, 1998.



BIODIVERSITY CONSERVATION 

BY PROMOTING ALTERNATIVE CROPS 

D. I. MARIN ∗ , N. BABEANU ∗ , O. POPA ∗ 

Abstract: Biodiversity is an extremely complex concept referring to all living 

organisms that form the biosphere. Biodiversity includes Genetic diversity, Species 

diversity, Ecosystem biodiversity, Landscape diversity, Human culture diversity. 

Biodiversity conservation has become a priority of the contemporary world due to 

the negative pressure of the anthropic factor upon the environment. 

Human beings use approximately 150 plant species of the total existing today; of 

these, only several species are of great concern (wheat, maize, rice, potato, 

soybean). The low concern with numerous species results in an increasing risk of 

extinction. 

Promoting alternative crops – of food and non-food use – is a method of biodiversity 

conservation and, thus, of diversified production. 

By their high nutritive value, some species known as pseudograins (Amaranthus 

Buckheat, Quinoa) and the rustic varieties of the Triticum, Hordeum, Secale species 

have become more interesting for consumers; thus, they lead to an increase in the 

cultivated areas and diversification in the varieties grown, which has a positive 

impact upon biodiversity. 

Keywords: Biodiversity conservation, alternative crops, Amaranthus sp. 

Biodiversity is a global concept, strongly promoted by the United Nations 

Conference on Environment and Development held in Rio de Janeiro in 1992. 

Biodiversity refers to the variety of life on earth, including the genetic, specific, 

ecosystemic diversity, as well as their ecological processes, together with the 

ethnocultural diversity. 

Ecological sustainability and biological diversity, in all its forms, are essential for 

humankind. 

Biodiversity is extremely important for numerous economic sectors: agriculture, 

forestry, animal sciences, tourism, etc. 

∗ USAMV Bucharest, Romania, e-mail: dorumarin@yahoo.com



Agrobiodiversity is an important component of biodiversity. Owing to their 

genetic and specific diversity, the plants and animals involved in production can 

bring their contribution to the entire biodiversity conservation and development. 

Nevertheless, the mainly economic concern of humans with the growth and 

cultivation of a limited number of species, and particularly certain highly 

productive varieties (breeds, varieties, hybrids), has resulted in an actual decrease 

in agrobiodiversity. 

Biological diversity benefits from the development of the sustainable agriculture 

system focusing on more diverse crop structure, alternative crops and technologies, 

better soil use and conservation, biodiversity conservation, as well as the market 

demand of new produce. 

Some plant species that were grown for food thousands of years ago 

(Amaranthus, Quinoa, Buckeat, etc.) have become important again for agro-food 

production and non-food sectors (biomass, biofuels, natural dyes, medicines, etc.). 

Among the alternative crops, Amaranthus is a very well represented plant of high 

genetic and specific diversity, and is grown for food (as a pseudocereal plant), 

feeding and ornamental purposes. 

From a taxonomic point of view, Amaranthus belongs to the Genus Amaranthus, 

Family Amaranthacea, Order Caryophyllales (Chenopodiale), Class 

Magnoliopsida, Division Magnoliophyta. 

Genus Amaranthus includes a large number of species (over 60) that are spread 

worldwide, predominantly in the temperate, subtropical and tropical areas. 

Phytocoenological research emphasize the following Genus Amaranthus species 

existing in Romania: A. caudaus; A. quitensis; A.cruentus; A. hybridus; A. 

hypochondriacus; A. powellii; A.retroflexus; A. blitum; A. emarginatus; A. albus; 

A. blitoides; A. graecizans;Amaranthus crispus. 

Among the numerous Amaranthus species, three are important to the seed 

production for food: Amaranthus caudatus (L), Amaranthus hypochondriacus (L) 

and Amaranthus cruentus (L). 

Callen (1967) called the cultivated Amaranthus species “the first cereals of the 

New World”, as they have existed from time immemorial. 

These species are also known as “pseudocereals”. 

The concern with growing Amaranthus species results from their particular seed 

quality and high production. 

The carbohydrate, protein and fats content of the seeds is equal with and even 

higher than the cereals. 

The protein content of the seeds is higher by 13.6-18% than many other cereals 

(barley 13-17%, maize 9.4-14,2%, rice 7.5%, rye 9.4-14%, wheat 14.7-17%). 

Table 1 (after A. Svirskis, 2003), presents the nutritive value of the Amaranthus 

seeds compared to several traditional cereals.



Protein quality is higher than the common cereals, whereas the content in the 

main aminoacids is extremely high. 

The essential aminoacids content of the Amaranthus seeds (g/100 g seeds) is 

shown in Table 2, (after A. Svirskis, 2003). 

The fats, cabohydrate and minerals content is also higher than the other cereals 

(Flores and Teutonnico 1986). The total content in fats and fatty acids are variable, 

i.e. between 6 and 8 of dry weight. The fiber content also varies between 3-6% 

compared to cereals whose highest value is 2% (Pederesen et al. 1990). 

Starch content can increase over 60%. 

Table 1 

Nutritional values of Amaranthus, millet, barley and 

wheat (100 g) - after A. Svirskis, 2003 

No. Nutrients Unit of 

measurement 

Amaranthus Millet Barley What 

1. Water g 9.84 8.67 9.44 10.94 

2. Energy kcal 374 378 354 339 

3. Energy kj 1.565 1.582 1.481 1.418 

4. Proteins g 14.45 11.02 12.48 13.68 

5. Fats g 6.51 4.22 2.30 2.47 

6. Ash g 3.04 3.25 2.29 1.78 

7. Carbohydrates g 66.17 72.85 73.48 71.13 

8. Fibers g 15.2 8.5 17.3 12.0 

9. Calcium mg 

Minerals 

153 8 33 34 

10. Iodine mg 7.59 3.01 3.60 3.52 

11. Magnesium mg 266 114 133 144 

12. Phosphorus mg 455 285 264 508 

13. Potassium mg 366 195 452 431 

14. Sodium mg 21 5 12 2 

15. Zinc mg 3.18 1.68 2.77 4.16 

16. Copper mg 0.777 0.750 1.943 0.553 

The introduction of alternative crops leads to the diversification of the 

agricultural ecosystems by the production of new agrocenoses and, consequently, 

the development of biodiversity. 

Romania has extremely favourable pedoclimatic conditions for the growth of the 

species Amaranthus. 

Therefore, in 2005-2006, we initiated several experiments on 10 varieties 

belonging to the species Amaranthus hypochondriacus (L) and



Amaranthus cruentus (L), (v1-Alegria, v2-Mercado, v3-Amont, v4-Golden, v5- 

Chihuahan, v6-Intense Purple, v7-Opopeo, v8-Plenitude, v9-Hopy Red Dye, v10- 

MT3), grown on the reddish preluvosoil of south-southeastern Romania. 

Analysis was comples, focussing on ecological adaptability, biomass production 

and quality, biodiversity analysis within the new agroecosystem. 

Table 2 

Seed content in essential aminoacids in Amaranthus, millet, barley and wheat 

(g/100 g) - after A. Svirskis, 2003 

No Nutrients Unit of 

measurement 

Amaranthus Millet Barley Wheat 

1. Tryptophan g 0.181 0.119 0.208 - 

2. Threonine g 0.558 0.353 0.424 0.366 

3. Isoleucine g 0.582 0.465 0.465 0.533 

4. Leucine g 0.879 1.400 0.848 0.934 

5. Lysine g 0.747 0.212 0.465 0.303 

6 Methionine g 0.226 0.221 0.240 0.221 

7. Cysteine g 0.191 0.212 0.276 0.286 

8. Phenylalanine g 0.542 0.580 0.700 0.508 

10. Tyrosine g 0.329 0.340 0.358 0.357 

11. Valine g 0.679 0.578 0.612 0.594 

12. Arginine g 1.060 0.382 0.625 0.483 

13. Histidine g 0.389 0.236 0.281 0.322 

14. Alanine g 0.799 0.986 0.486 0.427 

15. Aspartic acid g 1.261 0.726 0.779 0.617 

16. Glutamic acid g 2.259 2.356 3.261 4.743 

17. Glycine g 1.636 0.287 0.452 0.495 

18. Proline g 0.698 0.877 1.484 1.453 

19. Serine g 1.148 0.644 0.527 0.667 

The 10 Amaranthus varieties recorded total biomass between 6,550 and 8,120 

kg d.m./ha, the highest values recorded in the Golden variety, whereas seed 

production recorded over 2,500 kg/ha in four varieties belonging to the species A. 

cruentus (MT3, Chihuahan, Amont, Alegria), and one variety belonging to A. 

hypocondriacus (Golden),(Fig. 1). 

The highest record of seed production was observed in the MT3 variety (2,896 

kg/ha), followed by the Chihuahan variety (2,834 kg/ha).



kg/ha - 

3100 

2800 

2500 

2200 

1900 

1600 

1300 

1000 

Alegria 

2548 

Mercado 

2146 

2514 2615 

Amont 

Golden 

2834 

Chihu ahan 

1986 

Intense 

purple 

2210 

Opopeo 

Plenitude 

2711 

2095 

Hopi Red 

Dye 

2896 

Fig.1. Seed production (kg/ha -1 ) in cultivated Amaranthus varieties, 

Moara Domneasca, 2005-2006 

Photo. 1. Cultivated varieties of Amaranthus species 

MT3



The results obtained so far are proof that the Amaranthus growth stimulates 

biodiversity, and particularly entomofauna both by means of biomass and its role 

as main 

species in agrocenosis. 

Entomofauna was predominantly represented by species belonging to the 

following orders and families: Ord. Acari; Ord. Coleoptera (Fam. Curculionidae, 

Fam. Coccinelidae); Ord. Heteroptera (Fam. Pentatomidae, Fam. Reduviidae); 

Ord. Homoptera (Fam. Aphididae); Ord. Hymenoptera (Fam. Formicidae); Ord. 

Neuroptera (Fam. Chrysopida). 

Given its specific activities, agriculture can actively participate in biodiversity 

preservation by means of diversifying the structure of the agricultural crops and 

maintaining and diversifying the Romanian animal breeds. 

The introduction of new plant species into cultures in certain areas is a measure 

that will result in increased biodiversity, diversified producers and new trophic 

relationships. 

The cultivated A. cruentus and A. hipocondriacus varieties have recorded a 

good evolution in south-southeastern Romania, as five varieties recorded a seed 

production that exceeded 2,500 kg/ha between 2005 and 2006. 

The newly-created phytocenosis is attractive for the entomofauna, since the 

latter have high balanced diversity between the phytofagous and entomofagous 

species. 

Owing to their high ecological adaptability and the quality of the biomass 

produced, Amaranthus crops is one of the alternative crops that can contribute to 

increased biodiversity and, consequently, to biodiversity preservation on the whole. 

References 

1. Anthony, K.R.M., J. Meadley, and G.Robbelen: New crops for temperate 

regions. 1st ed. Chapman & Hall, London, New York, 1993. 

2. Calen E.O.: The first New World cereal. American antiquity, 32, 1967. 

Kauffman, C.S., and Haas, P.W.: Grain amaranth: A crop with low water 

requirements and high nutritional value. 

In "Environmentally Sound Agriculture" ed. W. Lokeretz, Praeger Press, New 

York, 1983. p. 299 

3. Svirskis, A.,: Investigation of amaranth cultivation and utilization in Lithuania. 

Agronomy Research. 1(2), 2003 

4. Legea nr. 58/1994 pentru ratificarea Convenţiei privind diversitatea biologică, 

adoptată la Rio de Janeiro, 1992.



CONTRIBUTIONS TO THE CHEMICAL 

CHARACTERIZATION OF SOME VEGETAL 

PRODUCTS WITH INSECTICIDAL ACTIVITY 

OBTAINED FROM CHRYSANTHEMUM 

CINERARIAFOLIUM L. ACCLIMATIZED IN 

CONSTANTA 

L. PÎRVU 1 , A. ARMATU , D. COPREAN 2 

Abstract: Chrysanthemum cinerariaefolium L. (Asteraceae), also called 

pyrethrum, is the major source of natural insecticides pyrethrins. Due to 

environmental advantages of the utilization of these natural insecticides have been 

proposed studies regarding chemical and biological characteristics of pyrethrum 

acclimatized in Constanta. Also, paper aims at studding polyphenols profile of this 

vegetal species in order to evaluate the possibility of the extension of pyrethrum 

utilization in chemical-pharmaceutical industry. Obtained results indicate a very 

reach content in flavones with high antioxidant / anti-inflammatory potential 

(quercetin, luteolin and apigenin derivatives) and levels of pyrethrins that 

recommend commercial cultivation of pyrethrum in Dobrogea regions. 

Keywords: chemical and biological characteristics of pyrethrum acclimatized in 

Dobrogea, Romania 


Pyrethrum is a tufted perennial herb with white-yellow flower heads. 

Even though of temperate origin, it is cultivated mainly in the tropical countries 

such as Kenya, Ecuador, Tanzania or Rwanda at high altitudes (1600-3000m). 

Active compounds, pyrethrins, are founded predominantly in the flower heads, 

but smaller quantities are founded in aboveground parts, too. 

Pyrethrins are chrysanthemic and phyretric esters (Figure 1 and Table 1). 

Fig. 1. Chemical structure of pyrethrins 

1 

National Institute for Chemical Pharmaceutical R&D, Calea Vitan, no.112, Bucharest; 

2 

OVIDIUS University, B-dul Mamaia, no. 124, Constanta;



Pyrethrins classification 

Active compound R1 R 

Cinerine I -CH3 -CH3 

Jasmoline I -CH3 -CH2-CH3 

Piretrine I -CH3 -CH=CH2 

Cinerine II -COO-CH3 -CH3 

Jasmoline II -COO-CH3 -CH2-CH3 

Piretrine II -COO-CH3 -CH=CH2 

Table 1 

Pyrethrins are non-polar volatile oils, insoluble in water, soluble in non-polar 

solvents with high sensibility at the air and sunlight. Acid, as well as base medium, 

rapidly hydrolyzes ester bonds [1]. 

Powder or extracts obtained from pyrethrum are usually characterized using 

HPLC/GC methods and the six active compounds are detected mainly on specific 

UV spectra [2]. 

Table 2 

Pyrethrins UV bands in usual solvents 

Active compounds 

Λmax. 

MeCN-Tris, 80:20 Hexan 

Cinerine I 226 219 

Jasmoline I 226 220 

Piretrine I 226 222,5 - 223 

Cinerine II 234 229 

Jasmoline II 234 229 

Piretrine II 234 227 - 228 

Beside these methods, literature data indicate a quantitative colorimetric method 

based on the transformation of pyrethrins in 2,4-phenylhidrazones [3]. 

Also, literature data indicate one relationship between the production of 

pyrethrins and some vegetal pigments such as carotenoids and flavonoids. 

Moreover, flavones content have been reported as being directly related with the 

concentration of pirethrins [4]. 

Among flavonoids are mentioned apigenin, acacetin (4'-methyl apigenine), 

luteolin, diosmetin (4'-methyl luteoline) and eriodictyol derivates, occurred mainly 

as 7-O-glucosides, 7-O-malonyglucosides,7-O-glucuronides or 7-O-rutinosides [5]. 

Due to an increased attention of these natural non-toxic insecticides, this work 

aims at investigating chemical and biological characteristics of C. cinerariaefolium 

L. acclimatized in Constanta but, since literature data reveal one quantitative 

relationship between pyrethrins and flavones classes, being well known flavonoids



antioxidant/anti-inflammatory potential, paper aims at studding polyphenols profile 

of the acclimatized pyrethrum, also. 

Final purpose of all these studies is to evaluate the possibility of the extension of 

pyrethrum utilization in chemical-pharmaceutical and cosmetic industry. 

2. EXPERIMENTAL 


Reagents 

o Methanol, ethanol and distilled water as dissolving/extraction solvents. 

o Hexan, ethyl acetate, formic acid, acetic acid and distilled water (p.a.) as TLC 

developants; 

o 2,4-phenylhydrazine reagent (DPH) for quantitative studies. Reagent 

obtaining: 0,4g 2,4-phenylhydrazine + 2ml sulphuric acid 98% + 3ml 

distilled water + 10ml ethanol 95% (w). 

Tested products/extracts: 

o Chrysanthemum cinerariaefolioum L: 

crop 2006 (herba cum flores) collected from Agricultural Research Center 

- Fundulea and, 

crop 2007 (herba ) acclimatized in Constanta. 

Reference compounds: 

o Pyrethrum pale extract (DKSH Switzerland) 50% in hexan (w/w); 

o polyphenols, flavonoids and phenyl-carboxilic acids Sigma, Aldrich, such as: 

rutine (quercetin-3-glucorhamnoside), quercitrin (quercetin-3-ramnoside), 

isoquercitrin (quercetin-3-glucoside), hyperoside (quercetin-3-galactoside), 

quercetin, cosmosiin (apigenin-7-glucoside), vitexine (apigenin-8-Cglucoside), 

isovitexine (apigenin-6-C-glucoside), apigenine, luteolin-7glucoside, 

luteoline, caffeic, chlorogenic, proto-catechic and gallic acid, 

umbelifferone. 

Methods 

Qualitative analyses of pyrethrins, flavones and phenylcarboxilic acids were 

carried out using standard TLC methods [6, 7]. 

Quantitative analyses of pyrethrins performed by adapting one standard 

spectrophotometric method used at the determination of carbonyl compounds with 

2,4-phenylhydrazine reagent [8] (see Results and Discussion). 

♣ Note: Pyrethrum acclimatization started up in the spring of 2007. 

♣ Qualitative analyses were fulfilled only on acclimatized pyrethrum.



Polyphenols and flavones analyses done using standard spectrophotometric 

methods, FR X [9]. 

Biological activity of acclimatized pyrethrum (crop 2007) and consequently 

aqueous extracts have been realized using “house fly test”. 

Apparatus 

o Spectrophotometer Helios γ (Thermo Electron Corporation). 

o UV lamp – Camag (Switzerland). 

o Ultra-sounds bath – Sonorex Super RK103H (Germany). 

3. RESULTS AND DISCUSSION 

3.1. Qualitative analyses 

Qualitative analysis (TLC) of pyrethrins has been performed as following: 


Solvent system: hexan - ethyl acetate, 90:10; 

Reference compound: 0.1 grams of standard pyrethrum pale extract (DKSH 

Switzerland) constitute from a mix of the main insecticidal compounds, pyrethrine 

I and pyrethrine II, solved into 100ml methanol p.a.; 10μl of diluted solution 

(x100) used for TLC; 

Tested sample: 0,5g dried and minced Chrysanthemum cinerariaefolium L.herba, 

crop 2007, was extracted with 5ml methanol, 10 min, at room temperature. 

Resulted extract was filtered on Watman paper and 15-30μl applied at the starting 

line; 

Detection: exposure at 254 and, resp., 366nm when pyrethrins appear as black 

zones on the green, fluorescent plate and, respectively, as blue-fluorescent zones on 

the black non fluorescent plate. 

Resulted chromatograms shown the following: 

- reference compound developed two major spots, one at Rf~0,07 and, 

respectively, another one at Rf~0,23 corespondigly to the two major pyrethines, 

pyrethrine I and pyrethine II; 

- tested sample developed two spos at Rf~0,07 and Rf~0,23, also ; 

- besides these two major spots, both, reference and tested samples, revealed few 

very small spots at Rf>0,3 likely belonging to the other four minor pyrethrins. 

TLC analysis regarding polyphenols profile performed according Plant Drug 

Analyses [7]: 


Solvent system: Ethyl acetate-formic acid- acetic acid gl. –distilled water 

(100:11:11:26);



Reference compounds: Sigma/Aldrich phenols prepared as standard solutions 10 - 

3 

M solved into methanol p.a. 10 to 20μl of these standard solutions applied at the 

starting line; 

Tested samples: 1g dried and minced pyrethrum were extracted with 10ml 

distilled water, methanol and hexan, 5 min at 60ºC, separately. 20-40μl of these 

filtered extracts used for TLC studies. 

Identification: pulverization with NP/PEG (natural products reagent) and 

exposure at 366nm 

Obtained chromatograms revealed the following general aspects: 

- many orange, yellow, green or green-blue fluorescent (fl.) spots attributed to 

flavonoids (quercetin, luteolin and apigenin derivatives); 

- two major blue, fl. zones atributted to caffeic acid derivates and 

- two indigo, fl. spots atributted to coumarin derivates. 

Relied on 1) literature data, 2) reference compounds TLC characteristics (Rf and 

colour) and some 3) spectral analyses made on methanolic extracts obtained from 

each separated spot (have been used relationship between flavones structure and 

consequently λmax. of the resulted extracts after treating with AlCl3 in base 

medium), were obtained the following qualitative results: 

a) Chrysanthemum cinerariaefolioum L. - herba cum flores, crop 2006, contains: 

o Rf~0.10 – green-blue fl. spot attributed to a diosmetin polyglycoside; 

o Rf~0.20/0.30 – two yellow fl. spots attributed to luteolin polyglycosides; 

o Rf~0.40 - indigo fl. spot attributed to a coumarin derivate; 

o Rf~0.42 - orange fl. spot attributed to rutine; 

o Rf~0.50 – chlorogenic acid blue fl. spot; 

o Rf~0.53-0.55 – two fl. spots, yellow and red-orange, attributed first to a 

luteoline glycoside, possible orientin, and the second to an eriodictyol 

glycoside; 

o Rf~0.68 – orange fl. spot attributed to quercetin-7-monoglycoside; 

o Rf~0.73 – green-kaki fl. spot attributed to apigenin-7-monoglycoside; 

o Rf~0.82 – major green-blue fl. spot attributed to a diosmetin monoglycoside; 

o Rf~0.95-0.99 – caffeic acid blue fl spots; 

o Rf~0.97 – scopoletin dark-blue fl. spot; 

o Rf~0.98 – protocatechic acid indigo fl. spot; 

o Rf~0.98-0.99 – one yellow-orange fl. spot attributed to quercetin-luteolin 

aglicones. 

b) Chrysanthemum cinerariaefolioum L. – herba, crop 2007, contains: 

o Rf~0.10 - blue-green fl. spot attributed to diosmetin polyglycoside; 

o Rf~0.30 – yellow fl. spots attributed to a luteolin polyglycoside; 

o Rf~0.40 - indigo fl. spot attributed to a coumarin derivate;



o Rf~0.50 – blue fl. spot attributed to chlorogenic acid; 

o Rf~0.53-0.55 – two fl. spots, yellow and red-orange, attributed to luteoline 

glycoside, possible orientin, and eriodictyol glycoside; 

o Rf~0.65 – green-kaki fl. spot attributed to isovitexine; 

o Rf~0.68 – orange fl. spot attributed to a quercetin-7-monoglycoside; 

o Rf~0.82 – major green-blue fl. spot attributed to a diosmetin monoglycoside; 

o Rf~0.95-0.99 – caffeic acid blue fl. spots; 

o Rf~0.98 – protocatechic acid indigo fl. spot; 

o Rf~0.98-0.99 – yellow-orange fl. spot attributed to quercetin and luteolin 

aglicones. 

Thus, first of all, TLC studies revealed Chrysanthemum cinerariaefolium 

acclimatized in Constanta as being very reach in flavones, quercetin, luteolin and 

apigenin derivatives, with powerful antioxidant/anti-inflammatory potential. 

Also, TLC studies revealed only few chemical differences between blossom and 

non-blossom pyrethrum: blossom pyrethrum contain three new flavonoids 

derivatives and higher quantities of coumarin derivatives. 

Second, have been noticed a very large solubility of the polyphenols fraction; 

have been obtained identical chromatograms for water, methanol and hexan 

pyrethrum extracts. 

Consequently, have been concluded that this large solubility of polyphenols 

fraction, as well as, high content of flavones with powerful antioxidant activity 

(high hydroxylated species) explain the capacity of pyrethrum to produce and store 

compounds with strong sunlight sensibility. 

Quantitative analyses 

Quantitative analyses of pyrethrins realized by adaptation a spectrophotometric 

method usually used at the measuring of carbonyl compounds with 2,4phenylhydrazine 

reagent (DPH). 

The adaptation of this method have began with the establishing of work 

methodology (properly combination of reagents) in order to obtain one specific 

spectra of the resulted phenylhydrazones. 

Once obtained one clear UV-VIS spectra have been realized the calibration curve 

of the reference compound; have used standard pyrethrins pale extract 0,1g% 

solved into methanol p.a. 

For further explanations see Table 3 and Fig.2.



Nr 

crt 

Standard 

solution (ml) 

Methanol p.a. 

(ml) 

Work methodology 

Pyrethrin 

content / 

sample (mg) 

DPH 

(ml) 

Table 3 

Λmax at 

277nm 

0 0 2,4 0 0,1 Blank 

1 0,1 2,3 0,1 0,1 0,13 

2 0,2 2,2 0,2 0,1 0,24 

3 0,3 2,1 0,3 0,1 0,35 

4 0,4 2,0 0,4 0,1 0,46 

5 0,5 1,9 0,5 0,1 0,56 

DOmax. 

0,6 

Fig. 2. Standard pyrethrin 

calibration curve 3 

Since plant extracts are 

R 

very reach in compounds 

with carbonyl groups 

belonging to very different 

classes, first it was necessary 

to separate volatile carbonyl 

compound (among them are 

enumerating pyrethrins class) of non-volatile species. Thus, volatile carbonyl 

2 0,5 

0,4 

0,3 

0,2 

= 0,9998 

0,1 

0,1 0,2 0,3 0,4 0,5 

compounds have been separated using Neoclevenger installation. 

Fractions of about 5ml were collected at every 2 minutes in the first 10 minutes 

and, after these, fractions of 5ml at every 5 minutes next 20 min. 

Using the same methodology presented for standard pyrethrum solution, collected 

fractions were analysed and resulted λmax. have been extrapolated at the 

calibration curve. 

Obtained results are presented in Table no. 4 

Referring to polyphenols fraction, have been measured the content of flavones 

and total phenols using two standard spectrophotometric methods [FRX]. 

In both cases, quantitative studies fulfilled on two type of raw material: 

pyrethrum-herba fresh and, respectively, pyrethrum-herba dried and minced, crop 

2007. 

Final chemical composition of the tested products is presented in Table 4. 

3 All points of the calibration curve are due as triplicate.



Tested products 

Pyrethrum - fresh herba, 

crop 2007 

Pyrethrum - dried and 

minced herba, crop 2007 

Chemical composition of tested products 

Volatile carbonyl 

compounds 

expressed as 

pyrethrins 

(%) 

Flavones 

expressed as 

rutine 

(%) 

Table 4 

Total phenols 

expressed as 

gallic acid 

(%) 

0.39 1.50 0.64 

0.38 4.47 2.10 

Obtained results indicated contents of volatile carbonyl compounds similar with 

that described in the literature for pyrethrum-herba pyrethrins. 

In the specific case of polyphenols, analytical results indicate a very high content 

of polyphenols, particularly flavones. 

Also, have been revealed drying loss of polyphenols as being smaller than drying 

loss of volatile carbonyl compounds. 

4. Biological activity of the acclimatized pyrethrum - “house fly test” 

“House fly test” have been fulfilled on Chrysanthemum cinerariafolium L.-herba 

dried and minced, crop 2007, and another seven aqueous extracts as following: 

- two extracts obtained by extraction at room temperature, 15 minutes at Sonorex 

bath (US), extraction rate 1:50 and, respectively, 5:50 w/v; 

- two extracts obtained by extraction at 60ºC, 15 minutes at US, extraction rate 

1:50 and, respectively, 5:50 w/v; 

- three extracts obtained by extraction at reflux, 15 minutes at US, extraction rate 

1:50, 2.5:50 and, respectively 5:50 w/v. 

Pyrethrum powder, as well as, resulted seven aqueous extracts have been 

pulverized on house flies disposed into seven glass boxes of about 250ml capacity. 

Biological activity of the tested products is presented in the Table 5. 

Pharmacological studies, “house fly test”, emphasized Chrysanthemum 

cinerariafolium L. acclimatized in Constanta as having certain insecticidal activity 

but must be recalled the fact that “house fly test” have been realized on pyretrumherba 

crop 2007. Consequently, chemical, as well as, biological studies will 

continuate with pyrethrum-flores, crop 2008.



Table 5 

Biological activity of acclimatized pyrethrum and its aqueous extracts - 

“House fly test” 

Nr. Crt. Tested product/extract Result Observations 

1 Pyrethrum powder 

(Chrysanthemum 

cinerariafolium L.-herba, 

dried and minced, crop 

2007) 

2 Aqueous extract obtained at 

room temp., 

1:50-w/v. 


room temp., 

5:50-w/v 


60ºC, 1:50-w/v 


60ºC, 5:50-w/v 


100ºC, 1:50-w/v 


100ºC, 

2.5:50 - w/v 


100ºC, 5:50-w/v 

9 Pyrethrins pale extract 

standard solution 0,1g% 

Active House flies paralyzed in about 2 minutes 

after pulverization. 

Removed from glass-box to fresh air , 

house flies suffered a process of 

“mummification” (loss of volume) and 

died after 3 hours. 

Non active House flies walked and tasted pyrethrum 

extract without any negative 

consequences. 



consequences. 



Slightly 

active 

consequences. 

House flies paralyzed in about 10 

minutes after treatment. 

Active House flies paralyzed in maximum 2 

minutes after pulverization. 


minutes after pulverization. 


minutes after pulverization 

Very active House flies paralysed in about 1 minute 

after the treatment. 


Chrysanthemum cinerariaefolium L., also called pyrethrum, is the major 

source of natural insecticides pyrethrins. 

Due to an increased attention of these natural non-toxic insecticides, this 

work aims at investigating chemical and biological characteristics of 

Chrysanthemum cinerariae-folium L. acclimatized in Dobrogea regions, e.g. 

Constanta. 

♣ 

It was observed that increasing levels of pyrethrum modified the intensity of process and not beginning 

time of paralysis.



Also, paper aims at studying polyphenols profile of the acclimatized 

pyrethrum in order to evaluate the possibility of the extension of pyrethrum 

utilization in chemical-pharmaceutical and cosmetics industry. 

Pyrethrines TLC studies emphasized pyrethrum acclimatized in Constanta 

as having two major spots accordingly to the two major pyrethrins: pyrethrine I and 

pyrethrine II. 

Besides these, tested samples revealed another few very small spots likely 

belonging to the other four minor pyrethrins. 

TLC analysis of polyphenols, flavonoids and phenolcarboxilic acids, 

shown Chrysanthemum cinerariafolium acclimatized in Dobrogea as being very 

rich in flavones (quercetin, luteolin, and apigenin derivatives) known with 

powerful antioxidant / anti-inflammatory potential. 

Qualitative analytical studies revealed only few differences between 

blossom and unblossom pyrethrum: blossom pyrethrum have been associated with 

some new luteoline and quercetine derivates and higher quantities of coumarine 

derivates 

TLC studies also shown identical chromatograms for water, methanol and 

hexan pyrethrum extracts and, consequently, have been concluded that large 

solubility of polyphenols fraction, as well as, high antioxidant flavones content 

could explain the capacity of this species to protect pyrethrins of sunlight oxidative 

stress. 

Quantitative analyses of pyrethrins shown contents of volatile carbonyl 

compounds similar with that currently reported for pyrethrum herba. 

Also, quantitative analytical results indicated a high content of 

flavones, drying loss of phenols being much more decreased than drying loss of 

volatile carbonyl compounds. 

Biological activity of pyrethrum herba powder, as well as, 

consequently aqueous extracts have been studied using “house fly test”. 

“House fly test” revealed pyrethrum powder and extracts obtained at reflux 

temperature as being with certain insecticidal activity. 

Consequently, arid regions from Dobrogea have been concluded as being 

properly for commercial cultivation of pyrethrum. 

Also, based on lack of toxicity proved of tested pyrethrum extracts, further 

studies will be considered in order to evaluate the possibility of the utilization of 

some selective pyrethrum extracts in chemical-pharmaceutical and cosmetics 

industry.



References 

1. Viorica Istudor – Farmacognozie Fitochimie, Fitoterapie, vol.II, 1998, Editura 

Medicală, p. 144-148; 

2. C.W. Henry III et al. – J. Chromatogr. A., 2001, 905,p.319-327; 

3. S.W. Head - Journal of the Science of Food and Agriculture, 1992, vol. 15, 6, 

p. 390-395; 

4. Wenwa A., Odinga A., Charles A. - African Journal of Science and 

Technology, 1999, vol. 4, 2, p.116-123; 

5. Schwinn K.E., Markham K.R., Given N.K. – Phytochemistry, Oxford, Oxford- 

Elsevier Science Ltd., 1994, 35(1), p. 145-150; 

6. I. Ciulei, Viorica Istudor, Madelena Palade, Elena Niculete, Cerasela-Elena 

Gârd - Analiza Farmacognostică şi Fitochimică a produselor vegetale/Lucrări 

practice, UMF “Carol Davila”, Facultatea de Farmacie, 1995, vol. II, p. 307; 

7. Hildebert Wagner, Sabine Bladt - Plant Drug Analysis, A Thin Layer 

Chromatography Atlas, Second Edition, Springer, 1996, p. 195-245; 

8. Chimie organică practică/PRACTICUM, Ed. Ştiintifică şi Enciclopedică 

Bucureşti, 1982, cap. 7.19; 

9. Farmacopeea Română Editia a X-a (FR X), VIII, pg. 335; IX.D.9, p. 1063.



“EFFECT OF THE GENOTYPE-ENVIRONMENTAL 

INTERACTION ON THE PHENOTYPE VARIATION OF 

THE BUNCH WEIGHT IN WHITE WINE VARIETIES” 

SIVCEV, B. * , PETROVIC, N. * , RANKOVIC-VASIC, Z. * , 

RANKOVIC, D. ** VUKOVIC, A. * 

Abstarct: Between 5000 and 6000 varieties distributed in the moderate and moderatecontinental 

climate have been recorded nowadays. The information of around 1100 

varieties is usually mentioned (Dettweiler, et al., 2000). Only some forty wine varities 

occupy the largest areas planted with vine, and in France around 20 varieties cover 87% of 

vineyard reyons. The variety list 4 of Serbia is also simple, and only around ten varieties are 

predominant. 

The objective of this paper is to establish interaction of phenotypical variations between the 

characteristics of some important wine varieties and external factors in the Danube region 

in Serbia. 

Keywords: yield grape, bunch weigh, numer bunch, phenotype varietion, white wine 

varieties 

Interoduction 

Grapevine is considered to be one of the major fruit crops in the world based on hectares 

cultivated and economic value (Bouquet et al., 2006, Conde et al., 2007). In 2005, 

66,901,419 tons of grapes (FAO, 2007) were produced in 7,488,196 hectares of 

vineyards. The citrus production is the only production exceeding the grapes production 

2000 and 2005, being 105 million of tons (FAO, 2007). The share of wine grape 

varieties in comparison to table and seedless varieties changed during the last twenty 

years. The latest data show that the surfaces under table varieties (26.7%) and seedless 

varieties (7%) have increased in comparison to wine varieties (65.7%) 5 . This is mostly 

due to the contribution of countries with the continental and partially in subtropical 

climate zone in the south hemisphere, as well as new scientific findings about fresh and 

*Dept. of Viticulture, Belgrade University, Faculty of Agriculture, Serbia, bsivcev@agrifaculty.bg.ac.yu 

*Dept. of Viticulture, Belgrade University, Faculty of Agriculture, Serbia, npmeteor@agrifaculty.bg.ac.yu 

*Dept. of Viticulture, Belgrade University, Faculty of Agriculture, Serbia, zoricarv@agrifaculty.bg.ac.yu 

** Dept. of Mathematics, Belgrade University, Faculty of Agriculture, Serbia, macura@agrifaculty.bg.ac.yu 

• Dept. of Viticulture, Belgrade University, Faculty of Agriculture, Serbia, ana@agrifaculty.bg.ac.yu 

4 The Ministry of Agriculture, Forestry and Water Management of Serbia http://minpolj.sr.gov.yu link List of 

varieties of agricultural and forest plants 

5 OIV http://www.oiv.int



dry grapes, grape juice and wine as particularly quality food. There is also increasing 

interest in the health benefits of certain grape-derived anti-oxidant compounds (e.g. 

polyphenols, resveratrol) and these compounds are being investigated and used in the 

food additive, cosmetic, and pharmaceutical industries (Carmona et al., 2008). The data 

speaking about around sixty species as Olmo (1979) stated was reduced to around fifty 

species of vine originating in variety of genus Vitis (Judd, 1999). Worldwide, wine is 

produced from the varieties originating in the variety of Vitis vinifera L., which is 

naturally located in the region south of the mountain of Caucasian and the Caspian Sea 

(De Lattin, 1939, Kunke and Goswell, 1996). The morphological characteristics in 

different types of the variety Vitis vinifera L. resulted in the definition of three subtypes: 

ssp. sylvestris, ssp. caucasica and ssp. sativa, which are still subject to 

controversial interpretations (Galet, 1988, Mullins et.al., 1992). The latest researches 

indicate that the types of the variety Vitis vinifera L. are represented with 146,075 

ESTs 6 of sequences and are included in the database of the National Centre for 

Information Bio-technology (NCBI) 7 (Goes et al., 2005). The majority of these 

sequences have been isolated from different varieties originating in Vitis vinifera l., and 

it has been estimated that they consist of 25,746 single, similar sequences including the 

transcription in different tissues and development phases during the biotic and abiotic 

stress (Goes et al., 2005). The eighty-eight percent of those sequences has been isolated 

from Cabernet Sauvignon and Chardonnay, the most important varieties worldwide. The 

remaining sequences have been directed to the varieties of regional significance, e.g. 

Pinot Noir, the leading variety in Burgundy. The changes in biotic and abiotic 

conditions have a significant share in the order of ESTs sequences, over 45% (Monterio 

at al., 2003). Thus it may be concluded that the ecological stability and plasticity of the 

variety in different ecological conditions have a significant influence (Bradshaw, 1965). 

The researches and obtained results, according to Howell, (2001) during the last 

century, have been shown to encourage and instigate the discussion: balance of grape 

yields, development of vine and leaf surface. The yield and components of yield-quality 

of the processed grapes are equally important economic indicators. Yield is a complex 

feature consisting of quantities components, polygenetic in character (Sivcev et al., 

2000). As early as in 1927 Sartorius indicated a negative correlation between yield and 

sugar content of must. According to Eibaich (1990), as reported by Bäder, the 

correlation between quantity and quality is not identical for each grapevine variety, the 

correlation is more expressed between sugar content of must and bunch weight 

6 

ESTs Expressed Sequence Tags 

7 

NCBI Natinal Center for Biotechnology Information, datebase as of September 30, 2003 

http://www.ncbi.nlm.nih.gov



compared to sugar content and number of bunches per vine. We tend to create 

conditions for sustainable production and we are focused on vine and its capacity for 

abiotic and biotic stress phases. The offered methods for achieving the balance will be 

different in macro-climate conditions, particularly in cold climate conditions in the north 

hemisphere. Wine quality largely depends on the vineyard and on the vine grower. 

Most of the wine compounds are produced by the plant itself, leaves (sugar and acids), 

and in berry (acids and phenols), (Conde at all., 2007). 

The continental climate with the appropriate and moderate precipitations offers ideal 

conditions both for fragrant white wines with good structure and acidity, and for wellbalanced 

red wines with a high potential of aging (Dominé, 2004). 

The present study has set the aim of establishing the expressiveness of the genes 

interacting with the environment and their influence on the phenotype values of 

variability, changeability, stability and adaptive capacity of the number of bunch, bunch 

weight, yield, content of sugar and acids in must characteristics in the white wine 

varieties. 


The trials were conducted in twenty-one white wine varieties grafted on 

Kober 5 BB rootstocak at the „Radmilovac” ampelographic collection, Faculty of 

Agriculture, Belgrade University. The vineyard is situated south-east of Belgarde in the 

Grocka grape growing area (ϕ=44° 77" N, λ=20° 35" 18′, H=124 m, Sumadia - Velika 

Morava vinegrape region). It is continental climate with the annual mean temperature 

11.2°C, and sesonal mean temperature of 16.6°C, and 401 mm of rainfull during the 

growing season, and total anuual rainfull 646 mm (for period 1980-2006). The 

plantation is registrated gene bank for grapevines with the international organizations 

O.I.V. and IBGR (Aleweld and Detweiller, 1986). The vineyard on a south-facing slope, 

with rectangular arrangement of vine: 3m between roud and 0.75 cm in the roud. The 

traning system is of cordon type and mixed-type pruning is practiced. phenological 

observation included bud burst-shoot growth, flowering, verasion and full ripeness. The 

number of days (Pheno), sum of active (Active) and effective (Efective; t>10°C) 

temperatures were established for each phelogical stage (Pheno1-number of days 

between bud burst and fluorescence; Pheno2-number of days between fruorescence to 

vérasion; Pheno3-number of days between vérasion to full repainig, Pheno4-period 

between bud burst to full repaing), 12 features in totals. The features such as the lenght 

of vegetative period from bud burst to full ripeness (Pheno4) and sum of active 

temperatures for the same period (Active4) were crucial importance for the classifation 

of varieties. The parameters of fertility and yield were established based on three 

replication in each variety in the period 1991-1993. The number of buds per vine was



averaged thitry. Grape yield was established by measurerment done at the time of grape 

techological ripeness per vine. Concurrently, the number of bunch (bunch/vine) and 

mean bunch weight (weight g) were also established. Calculations of mean yield per 

vine and per unit area (yield kg/m 2 ) were done too. Contents of sugar and total acids 

were deterermined by standard methods applied to the sample taken for each variety. 

The data were teated with the aplication of mathematical-statistical method (program 

STATISTICA5) factor analysis, multufactor ANOVA analusis, the variety, grape yield, 

bunch waight, number of buch per vine, and must quality (sugar content and total acids) 

are being the basis for comaprision. 

For the methorolocal data the authors used from Experimantal Station 

„Radmilovac” and analysed the trends of temperature for mean year temperatures (tyear), 

and mean temperature for the period April-September (tveg). Trends evaluation was done 

by the Kendal test (WMO, 1961), where trend of 95% on the level of confidence is 

accepted. This test is recommended for the time series (Malisic, 2002). Trend’s 

conspicuousness don’t gratifying for sum precipitations and efective air temperature in 

any one ege in year. 

Results and Discusion 

The adaptability of a variety is based on its genetical variability and 

phenotype adaptability. It is general rule that the wine variety of wide adaptability has a 

high genetical potential and that it gives high yield in favorable ecological conditions, 

and lower yield in unfavorable condidtions. Therefore, the survey of the influence of 

climate on the grape growing is significant (Petrovic and Todorovic, 1991, Cvetkovic, 

et.al., 1999). Observing the features in multidimensional area, our aim was to decrease 

the original group of data to investigate a part of variations which is common to all 

variables. The phenological features having the primary significance for all the 

investigated varieties are defined in our case. Factor analisis approbated that poit of 

departure. We uncluded in environment conditions the nine indexis: Active2, Active4, 

Pheno2, Pheno3, Pheno4, sugar content, bunch weight, yield and total acids. Factor 

analisis pointed to variation between the experimantal featuers that are common to all 

the genotypes-varieties included in our investigation. There factors have been singled 

out: the first factor couples mean air teperetaure (Active2, Active3), and number of days 

(Pheno2, Pheno3 and Pheno4), i.e. they are highly positively correlated. The second 

factor lincs values according to genotype caracteristic: sugar content and total acids in 

must. The results show that if sugar content declines the total acids increase. Daves and 

Robinson, (2000) showed that stricking change in gene expression at vérasion indicates 

that much of transition into ripening is driven by chages in gene transcription. Both 

structural genes and the controling genes that affect their transcription are involved 

(Boss and Daves, 2001). The potential to improve grape quality and productivity we 

could adopt by understanding repening via modified cultural practices or plant breeding.



The theard factor connects two quantuty characteristics: bunch weight and total yield. 

The table 1 shows that equations which estimate the common factors after rotation has 

been performed. Rotation is performed in order to simplify the explanation of the 

factors. The first rotated factor has the equation where the values of the variables in the 

equation are standardized by subtracting their means and dividing by their standard 

deviations. It also shows the estimated communalities, which can be interpreted as 

estimating the proportion of the variability in each variable attributable to the extracted 

factors. 

Factor Loading Matrix After Varimax Rotation 

Factor Factor Factor 

1 2 3 

Activ2 0,94308 -0,0069859 0,0233745 

Activ4 -0,442227 0,800222 0,180074 

Pheno2 0,932085 -0,00307501 0,029248 

Pheno3 -0,67697 0,537082 0,120362 

Pheno4 -0,46248 0,78669 0,171133 

Sugar Content 0,233962 -0,334611 -0,690092 

Bunch Weight 0,20501 0,0495489 0,868985 

Yield Grape -0,014547 -0,150901 0,790569 

Total 

Acids 

0,194071 0,670473 -0,137036 

Tab. 1 

Grape quality and vineyard managment tecniques include the genetic control of 

garpevine reproduction and yied. The seasonal variations in yield are usually by 

>15% and ofen >35% (Antcliff et al., 1965; Fanizza, 1979; Clingeleffer, 1984; 

Bramley and Hamilton, 2004; Keller et al., 2004, Fanizza et al., 2005, Clingeleffer, 

2006). In our results, we performed a multifactor analysis of variance for yield 

(kg/m 2 ), number of bunch (per vine), bunch weight, and content of total acids (g/l) 

and fuctors: varieties (A) and year (B). Enviromental, genotype, and managment 

treatmens are major influence on the final yield (kg/m 2 ) from inflorescence 

initiation within the latent bud to final harvest of the grape. For the yield 

calculation it is clear that it is bunch number per vine is the major determinant of 

yield (Keller et ak., 2004; Clingeleffer, 2006). On the other side, the extreme 

differences in climate and managment treatments on the global level, it is difficulte 

to be specific when discussing factors affecting yield. Accomplished results in the 

tab.1 - factor 3, approbated axiom that bunch number per vine with bunch weigth 

(suggested to represent berries per bunch) is the mayor effect on yield component. 

Clingeleffer (2006) accents that bunch number per vine explained 58-88% of



seasonal variation, with bunch weight acconting for 11-13%. On average, grape 

yield amounted to 0,76 kg/m 2 (Traminer gris) to 2,5 kg/m 2 (Ugni blan). Slight 

variation and high level of yield homogeneus of indoors variety are characteristic 

for this two varieties and varieties Dymiat and Kladovka. Apsolute amount of this 

data is extrem, but it is all of them genotype characteristic. Most varieties (43%) 

are caracterized with low yield homogeneus. Betwen ourseves there are Traminer 

rot, Pinot blanc, Chardonnay, Savagnin, Muscat Ottonel, Muscat blanc, Mueller- 

Thurgau and Baghrina. Disparting Bagrhina, ancesstry from Dardagan-Romania, 

with femle tipe of flowers, all other varieties are wide spred in the winegrowing 

areas. This feature explanes high level of genotype-enviromental adaptability. We 

included 21 varieties with the same number of bunc per vine in winter pruning, and 

closured that yield compositions ware different. Major efect on latent bud 

ftuitfulness with varieties differences observed by the number of fruitful canes, 

number of bunches per cane and node position of the bunch on the cane. The 

number of investigated varieties which produced grape of better yield composition 

was high, 17 in total. Only four varieties were characterised with medium level of 

sugar conten in must: Dymiat, Ugni blanc, Baghrina and Mueller-Thurgau. This 

characteristic has not statistically significant effect. Concerning total acids content 

of must, differences between varieties were prominent (Tab.2 and Tab.3). All 

effects: variety-A, year-B and interactions AB were observed. Carmona et al. 

(2008) exert that indefinable‚ quality’ term has crept into some part of the grape 

scientific literature. The term‚ grape ‚composition’ is more appropriate for 

scientific studies and would be a valuable starting point to characterize wine grape 

‚quality’ as the metabolite composition of grape and wine can be measured and 

quantified. Grapevine varieties are highly heterozygous (Thomas and Scott, 1993) 

and show a large variation in bunch size, bery size, and colour (Galet, 1988; This et 

al., 2006). 

Tab. 2 

Analysis of Variance for 

YieldKg/m2 Numer of Bunch BunchWeight TotalAcids g/l 

Source 

MAIN EFFECTS 

F-Ratio P-Value F-Ratio P-Value F-Ratio P-Value F-Ratio P-Value 

A:Variety 12.87 0.0000 6.81 0.0000 91.22 0.0000 9241.39 0.0000 

B:Year 

INTERACTIONS 

0.99 0.3730 0.88 0.4190 10.29 0.0001 224928.2 

5 

0.0000 

AB 

RESIDUAL 

TOTAL 

(CORRECTED) 

3.85 0.0000 3.58 0.0000 3.80 0.0000 2207.89 0.0000



Tab. 3 

Multiple Range Tests by Variety with 

Yield kg/m 2 Nume ofrBunch BunchWeight TotalAcids 

g/l 

Contrast Sig. Difference Sig. Difference Sig. Difference Sig. Difference 

Riesling Italico - Aligote * -0.514444 * -11.6833 9.44444 * 0.566667 

Riesling Italico - Baghrina 0.07 * -12.99 * 79.5556 * -1.6 

Riesling Italico - Chardonnay * -0.424444 -1.16444 * -23.0 * 0.611111 

Riesling Italico - Dymiat - 0.254444 * -16.6133 * 136.444 * 1.63333 

Riesling Italico - Godominka 0.183333 -4.98444 * 34.1111 * -0.866667 

Riesling Italico - Kladovka - 0.317778 -0.196667 * 20.2222 * 0.933333 

Riesling Italico - Mueller- 

Thurgau 

0.113333 -3.13222 * 19.1111 * -1.03333 

Riesling Italico - Muscat Ottonel -0.24 2.5 * -26.7778 * -1.36667 

Riesling Italico - Muscat blanc -0.272222 * -10.8233 * 31.3333 * 0.333333 

Riesling Italico - Pinot blanc * -0.442222 -3.43889 * -18.5556 * -0.1 

Riesling Italico - Riesling * -0.722222 * -9.94 * -20.8889 * -0.466667 

Riesling Italico - Sauvagnin 0.35 3.02111 12.1111 * -0.366667 

Riesling Italico - Semillion 0.147778 * 8.40889 * -23.4444 * 0.733333 

Riesling Italico - Tamjanika 0.137778 * 10.1533 * -38.0 * 1.33333 

Riesling Italico - Tokay 0.0333333 -1.92222 7.0 * 0.0333333 

Riesling Italico - Traminer blanc * 0.527778 -0.503333 * 33.0 * -1.23333 

Riesling Italico - Traminer gris * 1.09889 * 9.19 * 55.1111 * - 

0.0333333 

Riesling Italico - Traminer 

guewerz 

* 0.665556 -3.45 * 51.7778 * 0.0666667 

Riesling Italico - Traminer red * 0.784444 4.96667 * 40.1111 * -0.733333 

Riesling Italico - Ugni blanc * -0.703333 * 7.30333 * -93.5556 * -1.43333 

Climatic changes on global level have consequences in changing meteorological 

and climatological conditions on existing wine regions and in Grocka vinegrowing 

area to. Air temperature has increasing trend for all the examined periods during 

the year, but trends are significant on the level of 95% only in autuum period, 

clearly in June, July, August and October (Fig. 1). The dimension of sesonal 

variation for accurate yield prediction is prior for harvest. The increased awareness 

of climate change and potential effects on yield and yield composition could help 

us to understand response between actons genotype x interaction and development 

of genotype in the worldwide wine varieties.



Conclusion 

t mean ( o C) 

t mean ( o C) 

t mean ( o C) 

13.5 

13 

12.5 

12 

11.5 

11 

10.5 

10 

t mean = 10.1013 + 0.079274*t 

9.5 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

25 

24 

23 

22 

21 

20 

19 

18 

17 

16 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

25 

24 

23 

22 

21 

20 

19 

t mean = 18.2849 + 0.10055*t 

18 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

t mean ( o C) 

19.5 

19 

18.5 

18 

17.5 

17 

16.5 

16 

15.5 

t mean = 15.8755 + 0.081153*t 

15 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

t years mean t veg mean 

t mean ( o C) 

25 

24 

23 

22 

21 

20 

19 

t mean = 19.7954 + 0.11752*t 

18 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

t June mean tJuly mean 

t mean = 19.6439 + 0.09475*t 

t mean ( o C) 

15 

14 

13 

12 

11 

10 

9 

8 

1980 

t mean = 10.6171 + 0.088462*t 

1985 1990 1995 2000 2005 2010 

t (years) 

t August mean t October mean 

Fig. 1. Trend of mean air temperature for June, July, August and October 

(Radmilovac, 1980-2006) 

Observing the features in multidimensional area, our aim was to decrease the 

original group of data to investigate a part of variations which is common to all 

variables. The phenological features having the primary significance for all the 

investigated varieties are defined in our case. 

Factor analisis approbated that poit of departure. We uncluded in environment 

conditions the nine indexis: Active2, Active4, Pheno2, Pheno3, Pheno4, sugar 

content, bunch weight, yield and total acids. There factors have been singled out: the 

first factor couples mean air teperetaure (Active2, Active3), and number of days



(Pheno2, Pheno3 and Pheno4), i.e. they are highly positively correlated. The second 

factor lincs values according to genotype caracteristic: sugar content and total acids 

in must. The results show that quality declines with increaseing of total acids. 

On average, grape yield amounted to 0,76 kg/m 2 (Traminer gris) to 2,5 kg/m 2 (Ugni 

blan). Slight variation and high level of yield homogeneus of indoors variety are 

characteristic for this two varieties and varieties Dymiat and Kladovka. Apsolute 

amount of this data is extrem, but it is all of them genotype characteristic. Most 

varieties (43%) are caracterized with low yield homogeneus. Between ourseves 

there are Traminer rot, Pinot blanc, Chardonnay, Savagnin, Muscat Ottonel, Muscat 

blanc, Mueller-Thurgau and Baghrina. 

The number of investigated varieties which produced grape of better quality was 

high, 17 in total. Only four varieties were characterised with medium level of sugar 

conten in must: Dymiat, Ugni blanc, Baghrina and Mueller-Thurgau. This 

characteristic is not statistically significant effect. Concerning total acids content of 

must, differences between varieties were prominent. All effects: variety-A, year-B 

and interactions AB were observed. 

References 

1. Aleweldt, G., and Erika Detweiler: Ampelographic studies to characterize 

grapevine varieties. ATT del 4th Symposium Internationale di genetica della 

Vite. Vignevigi. Anno XIII, 56-59, Verona: 1986. 

2. Antclif, A.L.: Compararison of croping levels in the Sultana. Vitis 5:1’9, 1965. 

3. Bouquet A, Torregrosa L, Iocco P, Thomas MR: Grapevine (Vitis vinifera L.).: 

Methods Mol Biol.;344:273-85:2006. 

4. Boss, P.K., Daves, C.: Molecular biology of sugar and anthocyanin 

accumulation in grape berry. K.A. Roubelakis-Angelakis (ed), Molecular 

Biology & Biotechnology of the Grapevine, 1-33, Kluwer Academic 

Publishers. 2001. 

5. Bradshaw, A.D.: Evolutionary significante of phenotypic plasticity in plants. 

Advance in Genetics, vol. 13, 115-155: 1965. 

6. Bramly R.G.V. and Hamilton, R.P.: Understanding variabilitz in wine grape 

production szstem 1. Within vinezar variation in zield over several vintage. 

Austarlian Journal of Grape and Wine research 10: 32-45, 2004. 

7. Carmona M. J., Chaïb J., Martínez-Zapater J.M., Thomas R.M.: A molecular 

genetic perspective of reproductive development in grapevine. Journal of 

Experimental Botany, 59 (10): 2579-2596, 2008. 

8. Clingeleffer P.R.: Production and growth of minimal pruned Sultana vines. 

Vitis, 23:42-54, 1984. 

9. Clingeleffer, P.R.: Management practices for Sunmuscat (Vitis vinifera L.): a 

new drying variety.. Austarlian Journal of Grape and Wine research 12: 128-



134, 2006. 

10. Conde, C., Paulo, S., Fontes, N., Dias, C.P. A., tavares, R.M., Sousa, M.J., 

Agasse, A., Delrot, S., Geros, H. Bichemical change thourghout grape berry 

development and fruit and wine quality. In: Food Global Scinece Book, 

2007. 

11. Cvetkovic, D., Sivcev, B., Stankovic, S., Joksimovic, J.: Effect of altitude on 

grape yield and quality in the cultivar Muscat Hamburg grown under the 

conditions of Toploca grape growing subregion. Journal of Agriculture 

Sciences. Belgrade, Vol. 44, No2, 145-151: 1999. 

12. Daves, C., Robinson, S.P.: Differential screening indicates a dramatic change 

inmRNA profilsduring grape berry ripening. Cloning and characterization of 

cDNAs encoding putative cell wall and stress responses. Planr Physiol. 122; 

803-812, 2000. 

13. De Lattin, G. On the origin and distribution of grapes (in German). Zücher12, 

1939, p.217-225. 

14. Dominé, A.: Wine of the world. In : Dominé A. (Ed) Wine, konemann, 

Germany, 142-150,:2004. 

15. Galet, P. : Cépages et vignobles de France, Tome 1, Les vignes Américaines, 

2d ed. Déhan, Montpellier, 1988. 

16. Eibach, R. :Investigation about the influence of some physiological and 

phonological characteristics on the quality and their heredity. Proceeding of 

the 5 th International Symposium on Grape Breeding, Vitis, Special Issue, 

149-158., 1990. 

17. Fanizza, G.: Genotypic and phenotypic variation and correlation on wine-grape 

varieties(Vitis viniferaL.) grow in Apulia (Italy): Genetic Agraar. 3: 37-44, 

1979. 

18. Fanizza, G., Lamaj, F., Constantini, L., Chaabane, R., Grando, M.S.: QTL 

analysis for fruit zield components in table grapes, (Vitis vinifera L.). 

Theoretical and Applied Gnetics, 111:658-664, 2005. 

19. Goes da Silva, F., landolino, A., Al-Kayal, F., Bohlmann, M.C., Cushman 

M.A., Lim, H., Ergul, A., Figueroa, R., Kabuloglu, E. K., Osborne, C:, 

Rowe, J., Tattersall, E., Laslie, A., Hu, J., Beak, J.M., Cramer, G.R., 

Cushman, J.C., Cook, D.R.: Characterizing the grape trnscriptomr. Anlysis 

of Expressed sequence tags from multiple Vitis species and development of a 

compendium of gne expression durinf berry development. In:plant 

Physiology, 139(2): 574-597, 2005. 

20. Howell, G.S.: Sustainable Grape Productivity and the Growth-Yield 

Relationship: A Review, Am. J. Enol. Viticulture.52:3:165-174: 2001 

21. Judd, W.S.: Plant systematics: a phylogenetic approach, Sunderland, MA: 

Sinauer Association: 1999.



22. Keller, M., Mills, LJ.Wample, R.L., Spad, S.E.: Crop load management in 

concord grapes using different pruning techniques. American Journal of 

Enology and Viticulture, 48:323-327, 1997. 

23. Malisic, J.: Vremenske serije. Metemeticki fakultet, Univerzitet u Beogradu, 

304> 2002. 

24. Monterio, S., Picarra-Pereira M.A., Teixeira A.R., Lourerio V.B., Ferreira 

R.B.: Enviromental conditions during vegetative growth determine the major 

proteins that acumulate in mature grape. J. Agric Food Chem51:4046-4053: 

2003. 

25. Mullins, M. G., Bouquet, A., Williams, L.E.: Biology of the grapevine. 

Cambridge Univ. Press, 1992. 

26. Olmo, H.P.: Grapes. In Evolution of Crop Plants. Simmonds, 1979. London 

27. Petrovic N., and Todorovic, N.: Effect of basic meteorological elemente on the 

yield and quality of grape of the variety Riesling Italico grown on different 

rootstocks. Journal of Scientific Agricultural research. Belgarde, Vol. 52, No 

186, 156-161:1991. 

28. Sivcev, B., Zunic, D., and Jovic, S.: Production-tecnological characteristics of 

some promising grapevine seedligs in the condition of Experimantal Station 

«Radmilovac». Journal of Agricultureal Sciences, Vol. 45, 2, 93-99, 2000. 

29. This,P., lacombe, T., Thomas M.R.: Historicak origins and geneticdiversity of 

wine grape. Treds in Genetics, 22:511-519, 2006. 

30. Thomas, M.R., Scott, N.S.: Microsatellite repeats in grape reveal DNA 

polymorphisms when analyzed as sequence-target sites (STSs). Theoretical 

ana Applied Genetics, 86:985-990, 1993. 

31. WMO: Climatic Change. Tech Note, No 79:1966, WMO Geneva. Kendal and 

Stuat, 79:1966.



EX SITU CONSERVATION IN GENTIANA LUTEA L. 

THROUGH SOMATIC EMBRYOGENESIS 

I. HOLOBIUC, R. BLINDU, A. BREZEANU * 

Abstract: Somatic embryogenesis successfully induced started from 

fragments of organs collected from aseptic germinated seedlings or 

using aggregates or somatic embryos produced in a first culture cycle. 

For maturation of the embryos, were used media supplemented with 

osmolites. Among these, mannitol presence allowed the best response. 

During the in vitro culture in absence of the hormones, secondary 

somatic embryogenesis was induced that significantly contributed to 

the increasing of the production. Healthy and viable plants can be any 

time regenerated. 

Key words: Gentiana lutea, in vitro cultures, somatic 

embryogenesis, osmolites, mannitol. 

Introduction 

The conservation of the plant genetic resources involves two main directions: in 

situ conservation (strategy applied in the natural habitats) and ex situ conservation 

performed in collections (classical or field collections), botanic gardens, gene 

banks. 

The medicinal plants have an important role in the alternative medicine, but the 

alteration or the natural habitats destroying, the major climatic changes and 

overexploitation determined that a lot of medicinal plants to become rare and 

vulnerable. 

Our study had the objective to induced somatic embryogenesis for ex situ 

conservation of the rare, medicinal plant Gentiana lutea L. This species represents 

a priority one in the list of the ECPGR Working Group on Medicinal and Aromatic 

Plants for the conservation of the genetic resources. 

In "The Critical List of Vascular Plants from Romania" (Oprea et al., 2005) the 

species is considered critically endangered. 

The gentian roots can be harvested after 5-7 years, containing several actives 

compounds such as gentiopicroside and amarogenin, the oligosaccharides 

gentianose, gentiobiose, phenolic acids, polysaccharides, tannin, tritherpenes, 

* Dept. of Plant Citobiology, Institute of Biology, Romanian Academy, Bucharest, e-mail: 

biologie@ibiol.ro



xhantones. These compounds are also used for anorexia and gastric atonia 

treatment, with stimulatory gastric, sialagogue and cholagogue effects. It also has 

anti-helminthic, anti-inflammatory, antiseptic, febrifuge effects, stimulates the liver 

and stomach functions and fight against the debility. 

The development of an efficient conservation technology involves the 

maintenance of living plant material during different time interval (Wenyuan, et al., 

2005). In vitro tissues cultures per se ensure the short-term preservation, while the 

medium-term conservation of the plant samples can be done in an active collection 

(active gene bank) based on regeneratives cultures in slow-growth conditions. For 

every plant species of scientific and of economic importance, it is necessary the 

elaboration of a specific in vitro preservation methodology. For in vitro 

conservation of Gentian species have already been paid much attention and 

concern (Skrzypczak et al., 1993), in yellow gentian Momčilović, et al.(1997) 

studied the micropopagation through morphogenesis. 

The successful somatic embryogenesis(SE) induction and the recovery of viable 

plants is not a routine for the majority of species being necessary extensive studies 

for the establishment of the protocol. 

Somatic embryogenesis has many advantages over organogenesis: allow the 

production of a large number of regenerants with the presence both of root and 

shoot meristems(among 60.000 and~1.000.000 somatic embryos in liquid medium; 

can be originated from single cell and are less variable than regenerants derived 

from organogenesis (Osuga et al., 1999); somatic embryos are intolerant to 

mutations(so more genetic stable)owing to numerous genes necessary for a 

successful development (Ozias Akins& Vasil, 1988). The vegetative meristems are 

more tolerant to mutations and epigenetic changes (Merkle et al., 1990) those are 

less suitable for conservative purposes. 


Fragments of hypocotyls and roots from aseptic germinated seedlings were used 

for indirect somatic embryogenesis induction in a first regeneration cycle. In a 

previous work (Holobiuc & Blindu, 2008), the benneficial effect of 2,4,5-T alone 

or associated with other growth factors for the somatic embryogenesis in G. lutea 

was proved. Fragments of embryos agregates of 0.5 cm diameter were cultured in 

the second regeneration cycle on different media variants based on MS formula 

(Murashige & Skoog, 1962)supplemented with Gamborg vitamins (Gamborg et al., 

1968), sucrose 30 g/l (0,087 M), solidified with Plant agar 8g/l and pH adjusted at 

5.8, for direct somatic embryogenesis induction (table 1). Different growth factors 

were used: dichlorophenoxiacetic acid(2,4-D), 2,4,5,- trichlorophenoxiacetic acid 

(2,4,5-T), kinetin (kin) and indole-butylic acid( IBA).



We have the aims to maintain the regenerative capacity of the cultures, to slow 

the elongation rate for the easier in vitro conditions preservation and to sustain the 

somatic embryos germination. 

Four media variants based of the same MS formula and added besides the usual 

sucrose content (0.087 M) with other osmolites (mannitol, sorbitol and a 

supplementation of sucrose) at 0,16 M concentration and PEG 4000 at 

6%(0.015M) concentration were tested (table 2). The tissues cultures were kept at 

25 0 C, with 16h/day photoperiod and 80µmol/m 2 /s illumination.The subcultures 

were perfomed at 4-6 weeks. 

The embryogenic response (the mean number of embryos/explant for 3 replicates 

x 5 explant/Petri dish), the rate of germination of the embryos were registered after 

2 months of culture. In the case of osmolites supplemented media, the survival of 

explants rate (recorded from 4 repetitions /variant after 6 weeks) was determined. 

The growth of the explants (cm) was also measured and expressed as the ratio 

between the explant and the tissues diameter after 6 weeks. 

For cytological analysis, to prove the development of somatic embryos, the fresh 

embryogenic aggregates were analyzed using a Light Docuval Microscope. 

Table 1.Media variant used for somatic embryogenesis induction in Gentiana lutea L. 

Media 

Growth factors (µM) 

variants 2,4-D 2,4,5-T IBA Kin 

I1 10 - - - 

I2 10 - - 1 

I3 10 - 4.9 1 

I4 - 10 - - 

I5 - 10 - 1 

I6 - 10 4.9 1 

Table 2. Media variants tested for the maintenance of regenerative response and 

maturation of somatic embryos in G. lutea 

Media variant M1 M2 M3 M4 

Basal mineral salts MS MS MS MS 

Type and Carbon sources 0.087 0.087 0.087 0.087 

concentration of (sucrose) 

osmolites (M) Sucrose 0.16 - - - 

Mannitol - 0.16 - - 

Sorbitol - - 0.16 - 

PEG 4000 - - - 0.015




Somatic embryogenesis is the most proper way to regenerate healthy and stable 

plants. In this process, in most cases diploid, but also haploid cells develop in 

bipolar structures which undergo a similarly development as zygotic embryos. 

They have no vascular connection with parental tissue and are characterized by 

continue growth resulting from the absence of developmental arrest (Jimenez, 

2001). 

In the presence of 2,4,5–alone (3,8 µM)-fig.3a, the indirect somatic 

embryogenesis was induced from seedlings explants in a primary culture with 80- 

100 %, with a medium of 24 embryos/callus, but the development of the embryos 

occurred with low rate, about 2-3 % (fig.3 a). On the variant supplemented with 2, 

4, 5-T and indole-butylic acid 0.49 µM (IBA) and kinetin (1 µM), the mean 

number of somatic embryos (SE) reached at about 40/explant but the maturation 

and conversion into plants also occurred with low rate (between 2-6 %) after 40 

days of culture 

Using fragments of embryogenic aggregates of 0.5 cm diameter as second 

explants source, direct somatic embryogenesis was induced on all 6 media tested, 

the mean number of new developed embryos/ inocullum trough secondary 

embryogenesis varied between 13 ( on I5) and 28 on I4 variant, supplemented with 

2,4,5-T at 10 µM level (fig.1). 

On variants I2 and I5 (both having added kinetin at 1µM concentration), the 

induction of roots was observed. The secondary embryos developed occasionally 

directly on these roots. 

35 

30 

25 

20 

15 

10 

5 

0 

I1 I2 I3 I4 I5 I6 

1 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

I1 I2 I3 I4 I5 I6 

Fig.1-The second culture cycle: the mean number of somatic neo-formed 

embryos/explant; 2-The rate of somatic embryos germination. 

2



The maintenance of embryogenic cultures on the same media during two 

passages allowed the embryo germination with rate between 12.6(on I3) and 75% 

(on I4) despite of the presence of exogenous synthetic auxins in the medium 

(fig.2). 

The improved embryos germination rate on auxin supplemented media in the 

second culture cycle can due to the different origin of the explants (in the first case, 

were used fragments of seedlings organs and in the second cycle were used 

fragments of somatic embryos aggregates produced in the first culture cycle, with a 

certain level of endogenous hormones and embryogenic competence). High level 

of free IAA (indole-acetic acid) could be determinant in the establishment of the 

embryogenic competence (Jimenez, 2001). Generally, SE developed after the 

diminution or exclusion of the auxin from the culture medium, but in our case the 

behavior of the cultures was different. Even in the primary embryogenic cultures, 

this fact did not help the embryo maturation and conversion in a satisfactory rate. 

A great limitation of the embryogenic process is the maintenance of the 

embryogenic competence and the limited rate of conversion into plants. An usual 

method for the maturation of somatic embryos mostly used in the gymnosperms or 

woody plants is the decreased of the osmotic water potential by adding different 

osmolites as carbohydrates or other compounds such as PEG which have the role to 

increase the desiccation tolerance and synthesis of storage compounds (Yeung, 

1995). 

For the embryogenic capacity maintenance and embryo conversion, in a 

preliminary experiment, the cultures were transferred on auxin-free medium, on 

variants added with gibberelic acid or supplemented with mannitol as osmolite 

(Holobiuc & Blindu, 2008). Only mannitol supplemented medium showed a 

positive effect on maturation and germination of the embryos and allowed the 

prolonged secondary embryogenesis process (fig.3 e). 

In our experiment, we used other 3 variants added with other osmolites (sorbitol, 

PEG 4000 and a supplementation of sucrose) at 0,16 M concentration to compare 

their action with the mannitol beneficial effects. 

Sorbitol and mannitol have a similarly structure and molecular weight being 

common sugar alcohols, sucrose is a disaccharide needed in the culture medium as 

carbon source but also is an osmotic compound and PEG is a non-plasmolysing 

agent which cannot penetrate the cell wall but induced water stress and desiccation 

(Atree &Fowke, 1993). 

In our case, the survival rate of the cultures, the growth rate and the embryo 

development was different on variants supplemented with osmotic factors (table 3, 

table 4). Mannitol and sorbitol (added in M2 and M3) determined a good effect 

both on maturation and maintenance of embryogenic cultures, even stimulating the


USAMV Bucharest, Romania, 

2008 

a b 

c 

e f 

i 

g 

h 

j 

d 

Figure 3.a. Primary somatic 

embryogenesis (SE) induced on I4 

medium starting from seedlings 

organ fragments; b. secondary SE 

induced on embryo aggregates 

fragments cultured on I4 variant; 

c.d, globular, heart, torpedo SE 

stages induced on 2,4,5-T 

supplemented medium (x 800); e. 

the maturation and the germination 

of de novo SE induced on I4 

medium transferred on mannitol 

supplemented variant; 

f. secondary somatic embryogenesis 

induced on embryogenic aggregates 

fragments cultured on M2 variant;g. 

embryogenic aggregates fragments 

cultured on PEG 4000 

supplemented variant -detait; 

h. embryogenic aggregates 

fragments cultured on sorbitol 

supplemented medium; i. SE arrest 

and phenolic compounds synthesis 

followed by necrosis on M1 sucrose 

added variant after 6 weeks of 

culture; 

j. detail of SE cultured on M1 

sucrose supplemented medium with 

phenolic compounds synthesis (X 

800).



secondary embryogenesis and growth of culture (fig.3.f,h).The root development is 

stimulated. In presence of additional sucrose at the same osmolarity (0.16M), until 

30 days, are developing somatic embryos in early stages, but subsequently, after 40 

days appeared an accumulation of phenolic compounds that anticipate the cellular 

death and the necrosis of the cultures (fig.3i, 3j). 

The total concentration of the sucrose was 247 mM and this level did allow 

neither maturation nor germination of the SE, or the growth and the maintenance of 

the regenerative cultures. The survival rate of the tissues cultures was low 

(between 17,39 and 22.2) In a previous study, was observed that the normal 

sucrose content added in the cultures media (2-3%) did not sustain alone the 

maturation and germination of the SE in G. lutea (Holobiuc, Blindu, 2008). 

Table 3. The survival rate of the embryogenic cultures on media supplemented with 

different osmolites after 40 days. 

Media variants The mean survival rate 

Isolated somatic embryos Aggregate of somatic embryos 

M1 17.39 22.2 

M2 90 100 

M3 25 90.9 

M4 12.5 88.8 

Similarly results were found by other authors especially in studied concerning the 

maturation of SE in woody species and gymnosperms. 

In Quercus robur L. (Concepción Sánchez et al., 2002), found that sorbitol and 

mannitol improved the conversion rate more efficiently than sucrose, the highest 

rate, 32 %, being achieved by medium with 6 % sorbitol and 3 % sucrose. 

Corredoira et al., (2003) showed that in Castanea sativa, carbon source and 

concentration had a marked influence on maturation and subsequent germination 

ability somatic embryos. Plantlets conversion was achieved in embryos matured on 

media with 6 % sucrose, and on 3 or 6 % maltose. The highest rate, 32 %, was 

achieved by medium with 6 % sorbitol and 3 % sucrose 

In our experiment, using PEG 4000 at 6% concentration, an increased of the 

diameter of embryogenic cultures was observed, but also the induction of 

adventitious shoots on the explants and abnormal structures was favored despite to 

the high proliferative rate of 3.6 X(Fig. 3 g).



Table 4. The influence of osmolites added in culture media on the growth rate and 

embryo development after 6 weeks of exposure. 

Media variants The growth Length of Observations 

rate (cm) regenerants (mm) 

M1 2 X 0.1-0.2 Secondary somatic 

embryogenesis, activation 

of phenolic compounds 

synthesis, arrest of embryo 

development, necrosis 


embryogenesis, green 

normal developed embryos 


embryogenesis, green 

normal developed embryos 

M4 3.6 X 0.5-0.7 Elongation, abnormal 

organogenesis 

Also an elongation of embryos and adventive shoots in presence of PEG was 

observed compared to other osmolites supplemented variants. Although, these 

structures did not develop the roots meristems, for this reason their conversion into 

plants is more difficult. 

In Pinus pinaster Ait, Tereso et al., (2007) concluded that the addition of PEG to 

the basal maturation medium resulted in a low yield of cotyledonary somatic 

embryos that generally showed incomplete development and anatomical 

abnormalities such as large intercellular spaces and large vacuoles. 

High concentrations of maltose also induced large intercellular spaces in the 

somatic embryonic cells, and 263 mM sucrose produced fewer and less developed 

cotyledonary somatic embryos compared with 175 mM sucrose. 

The authors concluded that that the effect of carbohydrate source is partially 

osmotic and the presence of additionally sucrose in high level (over 200 mM) 

didn’t sustain the embryo development. 

On the other hand, in another case, the inclusion of polyethylene glycol (PEG) in 

the maturation medium of Picea glauca can improve the number and quality of 

embryos produced (Stasolla et al., 2003). 

From the regeneratives cultures on mannitol and sorbitol supplemented media, 

can be detached germinated somatic embryos that on hormone free MS ½ reduced 

salts developed normal plants.



Conclusions 

Somatic embryogenesis (SE) in G. lutea can be de novo induced starting from 

aseptic seedlings organ fragments, but the maturation and conversion of the SE 

undergo on mannitol (optional sorbitol)MS supplemented medium at moderate 

concentration (0.16M) associated with a normal sucrose content (3%). 

Starting from embryogenic aggregates fragments as additional explant source for 

in vitro cultures, secondary SE develops, somatic embryos conversion has a better 

rate even on auxins supplemented media. 

Using different osmotic factors for the embryos maturation and conversion, the 

sugar alcohols had the best effects. PEG 4000, despite of the improved growth rate 

and SE secondary induced, abnormal structures appeared. 

Sucrose in high concentration despite its use as carbon source and its osmotic 

effect, did not favored the embryos development and the cultures survival; the 

arrest of embryos growth and phenols synthesis and finally necrosis were observed. 

A high regeneration rate and the maintenance of the regeneration capacity based 

on biotechnological methods have important applications in the rare or economical 

important species: SE can be used for large scale multiplication, for in vitro 

preservation, for synthetic seeds production or for cryopreservation. 

Reference 

1. Attree, S.M., Fowke, L.C: Embryogeny of gymnosperms: advances in 

synthetic seed technology of conifers, Plant Cell Tiss. Org. Cult., 1993, 

p.35:1-35. 

2. Concepción, Sánchez, M. Martínez, M., T., Valladares, S., Ferro, E., 

Viéitez, A.M.: Maturation and germination of oak somatic embryos 

originated from leaf and stem explants: RAPD markers for genetic analysis 

of regenerants. J.of Plant Physiology, (160), 6, 2003, p. 699-707 

3. Corredoira, E., Ballester, A., Vieitez, A. M.: Proliferation, Maturation and 

Germination of Castanea sativa Mill. Somatic Embryos Originated from 

Leaf Explants Annals of Botany, 92, 2003, p. 129-136. 

4. Gamborg, O., L, Miller, R., A., Ojima, K.: Nutrient requirements of 

suspension cultures of soybean root cells. Exp. Cell. Res., 50, 1968, p. 

151-158. 

5. Holobiuc, I., Blîndu, R.: In vitro culture of the protected rare species 

Gentiana lutea L. for conservative purpose, Contributii Botanice, XLIII, 

2008, Gr. Bot. Al. Borza, Cluj- Napoca (in press).



6. Jimenez, V.M.: Regulation of in vitro somatic embryogenesis with 

emphasis on to the role of endogenous hormones. R. Bras. Fisiol. Veg., 

3(2), 2001, pp. 196- 223. 

7. Merkle, S.A., Parrot, W.A., Williams, E.G., Application of somatic 

embryogenesis and embryo cloning. In: BHOJWANI, S.S. ed. Plant Tissues 

Applications and Limitations. Amsterdam, Elsevier, 1990, p.67-101. 

8. Momčilović, I., Grubišić, D., Nešković, M.: Micropropagation of four 

Gentiana species (G. lutea, G. cruciata, G. purpurea and G. acaulis). Plant 

Cell Tissue and Organ Culture, 49, 1997, pp. 141-144. 

9. Murashige, T., Skoog, F.: A revised medium for rapid growth and bioassay 

with tobacco tissue culture, Physiol.Plant, 15, 1962,p. 473-497. 

10. Oprea, A.: Lista Critica a Plantelor Vasculare din Romania, ed. Univ.” Al. 

Ioan Cuza”, 2005,Iasi. 

11. Ozias-Akins P., Vasil I. K.: In vitro regeneration and genetic manipulation 

of grasses. Physiologia Plantarum, 1988, 73 (4), 1988, p. 565 – 569. 

12. Osuga, K.; Masuda, H., Komamine, A.: Synchronization of somatic 

embryogenesis at high frequency using carrot suspension cultures: 

model systems and application in plant development. Methods in 

Cell Science, 21, 1999, p.129-140. 

13. Skrzypczak, L., Wesołowska, M., Skrzypczak, E.: Gentiana species: in 

vitro culture, regeneration and production of secoiridoid glycosides. 

Biotechnology in agriculture and forestry. Bajaj YPS [ed.], vol. 21. 

Medicinal and aromatic plants IV, 1993, p. 172-186. Springer, Berlin, 

Heidelberg, New York. 

14. Stasolla, C, van Zyl, L., Egertsdotter, U., Craig, D., Liu, W., Sederoff RR.: 

The effects of polyethylene glycol on gene expression of developing white 

spruce somatic embryos. Jan; 2003, 131(1):49-60 

15. Tereso, S., Zoglauer, K., Milhinhos, A., Miguel, C., Oliveira, M.M.: 

Zygotic and somatic embryo morphogenesis in Pinus pinaster: 

comparative histological and histochemical study, Tree Physiol. May; 

27(5), 2007, p. 661-669 

16. Wenyuan, G., Jia W., Xianfu, G., Wang, R., Peigen, X.: In vitro culture 

and cultivation of Chinese medicinal plants for industrial utilisation and 

genetic resource conservation. Plant Genetic Resources: characterization 

and utilization, 3, (2), 2005, p. 116-126(11). 

17. Yeung, E.C.: Structural and developmental patterns in somatic 

embryogenesis. In: Thorpe TA Ed. In vitro embryogenesis in plants. 

Dordrecht: Kluwer Academis publisher, 1995, p. 205-247.



FERMENTATION PROFILES OF YEAST STRAINS 

CULTIVATED ON APPLE POMACE 

Introduction 

CZYZOWSKA A., KREGIEL D., AMBROZIAK W. * 

Abstract: In the preliminary research on utilization of wastes or byproducts 

from fead industry, the strains of yeast, belonging to 

fermenting, fodder, deacidifying and xylose fermenting yeast, were 

cultivated on apple pomaces. The cultivation took place in conditions 

of limited access of oxygen. The main fermentation by-product was 

glycerol followed by succinic acid, lactic acid and acetic acid. 

Keywords: apple pomace, yeasts, fermentation profiles 

Apple pomaces are the example of the by-product belonging to fruit-processing 

residues. This residue arises after production of apple juices, ciders and is 

composed of left solids like pulp, peels, core, calyx, stems and seeds. So far, the 

major portions of apple pomace have been simply thrown away implementing the 

ecological problems. However, since the material is rich in high-value components 

and is highly biodegradable, its utilization is essential from both economical and 

environmental point of view. The main trend is to obtain high value products by 

their extraction from pomaces or by cultivation of microorganisms in order to 

obtain the fermentation products of higher nutritional value. 

According to literature data, the principal sugars present in apples are fructose 

[53.9 g/l], glucose [33.8 g/l] and saccharose [24 g/l]. Malic acid, in turn, is the 

only organic acid existing in apples in bigger amounts [4.61 g/l] [Wu et al., 2007]. 

The proportions of the compounds present in apple pomaces should be similar to 

their amounts in fresh apples. From the broad range of compounds, theoretically 

present in the apple pomaces, the following can be identified: monosaccharides 

(glucose, fructose), malic acid, citric acid and other compounds, e.g. 

polysaccharides or pectins [Gullón et al., 2008]. The aim of the experiment was to 

* 

Technical University of Lodz, Institute of Fermentation Technology and Microbiology; email: 

czyzowsk@p.lodz.pl



determine the most suitable yeast strains that are able to ferment on apple pomaces 

producing ethanol in the most efficient way. 


During this study, 11 strains of yeast, belonging to fermenting i.e. S. cerevisiae, 

fodder (i.e. Candida utilis, Candida tropicalis), deacidifying - 

Schizosaccharomyces pombe and xylose fermenting yeasts (Pichia stipitis, 

Pachysolen tannophilus, Metchnikowia pulcherrima), were cultivated on apple 

pomaces. The cultivation took place at room temperature under the conditions of 

limited access of oxygen. The composition of fresh and fermented pomaces was 

analyzed by HPLC method. The analysis was performed on the SpectraSystem 

chromatograph with the computer equipped with ChromQuest software. The 

conditions of the analysis were the following: column Aminex HPX 87H + 

(BioRad), RI, DAD detector, 5 mM H2SO4 as the mobile phase with flow of 0.6 

ml/min, at 60°C of column temperature. The compounds were identified by 

comparison of retention time with standard substance, and UV spectrum in the 

case of organic acids and retention time in the case of sugars and other 

fermentation products. The course of fermentation was additionally monitored by 

controlling the amount of CO2 released. 

3. Results 

Pomace produced by small farm operation contained glucose with fructose 

and malic acid. They made up 72% of all compounds present (figure 1a). 

The selection of yeast strains used in fermentation trials was based on the 

yield of biomass production. The following selected yeast strains were 

further used in the experiments involving the determination of their 

fermentation abilities: Candida utilis ŁOCK 0021, S. cerevisiae ŁOCK 

0132 and Pichia stipitis ŁOCK 0047. The figure 1 presents the 

chromatograms obtained for fresh apple pomace (a) and after the 

fermentation conducted by three different yeast strains. The chromatogram 

that differs from the others is the chromatogram of Pichia stipitis ŁOCK 

0047 (d). As it can be seen, the last peak with retention time about 22,5 min, 

responsible for the ethanol is much smaller than the corresponding peaks for 

other strains. 

The dynamic of fermentation process is presented on the figure 2. The both 

Saccharomyces strains and Candida utilis ŁOCK 0021 were able to initiate the



fermentation very quickly with the rapid weight loss in first two days of the 

fermentation, and then the changes in amount of escaping CO2 were small. 

Fig. 1. The chromatograms of fresh apple pomace (a) and after fermentation by: 

Candida utilis (b), Saccharomyces cerevisiae (c) and Pichia stipitis (d) 

The concentrations of ethanol and other compounds in g/100 mL obtained 

by the cultures of yeast strains are gathered in table 1. It can be clearly seen that 

Candida utilis and S. cerevisiae were the strains that produced the highest amount 

of ethanol. The second main fermentation product was glycerol. Here, 

Saccharomyces cerevisiae strain was the most efficient. The other fermentation 

products i.e. succinic acid, lactic acid and acetic acid were produced in minor 

quantities.

Weight loss of CO 2 [g/ 

fermentation sample] 



1,4 

1,2 

1 

0,8 

0,6 

0,4 

0,2 

0 

-0,2 

0 1 2 3 4 5 6 7 8 

Days of fermentation 

C.utilis Cu/1 S.cerevisiae Ł0132 Pichia stipitis 

Fig. 2. The dynamic of fermentation conducted by selected yeast strains 

Yeast strain Ethanol Citric acid 

Candida utilis 

ŁOCK 021 

Saccharomyces 

cerevisiae ŁOCK 

132 

Pichia stipitis ŁOCK 

047 

4. Conclusion 

1.27 

0.93 

0.47 

0.074 

0.054 

0.061 

Succinic 

acid 

0.029 

0.009 

0.026 

Lactic 

acid 

traces 

0.009 

0.003 

Glycerol 

0.207 

0.249 

0.007 

Table 1 

Acetic 

acid 

0.063 

0.026 

traces 

The fresh apple pomaces contain the high proportion of monosaccharides 

that can be utilized by yeast. The analysis of the composition of the apple pomaces



showed that this substrate apart from glucose, fructose, malic and citric acid 

contains a high proportion of compounds that are not utilized by yeast in tested 

conditions. The main fermentation by-product was glycerol followed by succinic 

acid, lactic acid and acetic acid. Candida utilis demonstrated the ability to produce 

the highest amounts of ethanol. However, the results for Saccharomyces cerevisiae 

strains, which are the typical fermenting yeast, are also satisfactory. 

References 

1. Wu, J., Gao, H., Zhao, L., Liao, X., Chen, F., Wang, Z., Hu, X.: Chemical 

compositional characterization of some apple cultivars. Food Chemistry, 2007, 

103, p.88-93. 

2. Gullón, BV, Yáñez, R., Alonso, J. L., Parajó, J.C., L-Lactic acid production 

from apple pomace by sequential hydrolysis and fermentation. Bioresource 

Technology, 2008, 99, p.308–319.



FLUORESCENT METHODS FOR EVALUATION OF 

CYTOTOXIC ACVTIVITY BASED ON HIGH 

PERFORMANCE TECHNIQUES. 

Virginia VULTURESCU * , Georgeta NEAGU-CARAENE * , Lucian 

ALBULESCU ** 

Cornelia NICHITA*, Radu ALBULESCU*. 

Abstract: The aim of this study is to develop fluorescent methods for quantitative 

evaluation with high sensitivity using high performance fluorescence techniques: 

fluorescence intensity, fluorescence polarization, real time fluorescence and sorting of 

different cells populations marked with specific fluorochromes, together with florescence 

microscopy data and processes analyzing such as: cells respiration, cellular apoptosis, 

cytotoxicity and identification of specific reaction drug-receptor. 

All these techniques have high potential and significant applications in testing 

biocompatibility of biomaterials and in the field of preclinical pharmacology. 

Introduction 

Keywords: Fluorescence, fluorochroms, citotoxicity 

Fluorescence-based techniques are valuable tools for studying cellular 

structure and function, and interactions of molecules in biological systems. 

Fluorescence is also important in detection and quantitation of nucleic acids and 

proteins in gel electrophoresis, microarrays, and fluorescence spectroscopy [1]. 

Fluorescence is a property of some substances that "glow in the dark". A 

large variety of fluorescent chemicals were synthesized and modified to 

specifically interact with cellular structures in order to make them detectable in 

many different colors. With sophisticated microscopes and instruments, it is 

possible to detect, image, and measure the amount of fluorescence in samples as 

small as individual cells, and with multiple fluorescent colors. The combination of 

specialized fluorescent chemicals and instruments has given us an unprecedented 

detailed view of cells [2]. 

* 

National Institute for Chemical-Pharmaceutical Research and Development, Bucharest, 

Romania, email: virginiavulturescu@yahoo.com 

** 

Victor Babes National Inatitute for research and development in Pathology and 

Biomedical Science Bucharest, Romania, email: unlache@yahoo.com



Fluorescent probes enable researchers to detect particular components of 

complex biomolecular assemblies, including live cells, with exquisite sensitivity 

and selectivity. The purpose of this introduction is to briefly outline fluorescence 

techniques for newcomers in the field. 

Fluorescence is the result of a three-stage process that occurs in certain 

molecules (generally polyaromatic hydrocarbons or heterocycles) called 

fluorophores or fluorescent dyes. (Stage 1 : Excitation, Stage 2 : Excited-State 

Lifetime, Stage 3 : Fluorescence Emission). 

A fluorescent probe is a fluorophore designed to localize within a specific 

region of a biological specimen or to respond to a specific stimulus. The most 

straight forward way to enhance fluorescence signals is to increase the number of 

fluorophores available for detection. Fluorescent signals can be amplified using 1) 

avidin–biotin or antibody–hapten secondary detection techniques, 2) enzymelabeled 

secondary detection reagents in conjunction with fluorogenic substrates or 

3) probes that contain multiple fluorophores such as phycobiliproteins and 

Molecular Probes' FluoSpheres fluorescent microspheres. 

Cell viability, cell proliferation and many important live-cell functions — 

including apoptosis, cell adhesion, chemotaxis, multidrug resistance, endocytosis, 

secretion and signal transduction — can be stimulated or monitored with various 

chemical and biological reagents. Many of these processes lead to changes in 

intracellular radicals, free-ion concentrations or membrane potential that can be 

followed with appropriately responsive fluorescent indicators. 

Fluorescence-based cell viability and proliferation assays are generally less 

hazardous and less expensive than radioisotopic techniques, more sensitive than 

colorimetric methods and more convenient than animal testing methods. Unlike 

51 Cr-release assays, fluorescence-based assays of cell-mediated cytotoxicity do not 

require large samples, which can be difficult to obtain from patients. Furthermore, 

fluorescence-based protocols are more convenient than the trypan blue–based 

exclusion assay. 

Fluorescent dye–based assays for cell viability and cytotoxicity are reliable 

and easy to perform. 

The diversity of live cells and their environments makes it impossible to 

devise a single viability or enumeration assay applicable to all cell types. Because 

viability is not easily defined in terms of a single physiological or morphological 

parameter, it is often desirable to combine several different measures, such as 

enzymatic activity, membrane permeability and oxidation–reduction (redox) 

potential. Each assay method has inherent advantages and limitations and may 

introduce specific biases into the experiment; thus, different applications often call 

for different approaches.



Apoptosis research is a burgeoning field in which fluorescent probes are having a 

major impact. Consequently, focuses on probes for monitoring apoptosis, including 

reagents for selectively detecting apoptotic cells based on their cell-permeability 

properties, as well as some exclusive conjugates of annexin V phosphatidylserinebinding 

protein [4]. 

Citotoxicity testing of implantable biomaterials is mandatory in safety 

assessment. In the last years the intensity of research on implantable 

biomaterials and their application in regenerative medicine is rapidly 

increasing. 

In vitro models may provide answers regarding several aspects, including 

cell viability (cytotoxicity of implant material or extractables), proinflammatory 

effects and alteration of cell response to signaling molecules 

[5]. 

Our investigations were oriented towards the evaluation of cytotoxicity in 

the presence of either implant material or extraction fluids of such material 

using high performance fluorescence techniques. 

Materials and Method 

Cytotoxicity assay 

A testing protocol using Balb/C 3T3 cells was used in order to evaluate the 

cytotoxicity of the implantable biomaterials (uncoated silica wafers and wafers 

coated with diamond like (DLC)/carbon zero stress (CS0) films (provided by 

National Institute of Plasma and Radiation Physics, Bucharest, Romania), and 

titanium implants – uncoated and hydroxyapatite coated (provided by National 

Institute for Microtechnologies, Bucharest, Romania. In each set of samples, 

specimens of constant shape and size were used [6, 7, 8]. 

The experiment involves measuring cellular viability by a method which 

uses FDA (Fluorescein di-O-acetate). 

Viable cells, both mammalian and, in many cases, bacterial, have the 

capability to incorporate the nonpolar, nonfluorescent compound fluorescein di-Oacetate 

(FDA) and rapidly hydrolyze it using acetyl esterase activity to fluorescein, 

a polar, fluorescent compound which is retained within the cell. Nonviable cells no 

longer have esterase activity and will not be fluorescently stained. Furthermore, 

nonviable cells are susceptible to DNA staining with compounds such as ethidium 

bromide or propidium iodide, and can therefore be easily counterstained to 

differentiate them from viable cells in a fluorometric assay. On the basis of these 

principals, FDA can be easily used in a double staining procedure in combination



with propidium idodide to determine cell viablility in cell suspension. After 

staining, cell viability can be assayed using slide preparations or FACS analysis. 

Viable cells fluoresce bright green, while nonviable cells are bright red. 

A.) Stock Solutions. A stock solution of 5mg/ml FDA was prepared using 

acetone or DMSO. This solution has been stored at -20°C. Stock solutions of 

propidium iodide (PI) was prepared in phophate buffered saline (PBS). 

B.) Staining. Staining of mammalian cells in suspension 2,3. Cells has been 

suspended in PBS or HBSS and kept on ice. Staining is performed with final 

concentrations of FDA from .5 - 10 µg/ml, and PI from 3 - 50 µg/ml. A ratio of 

1x10 6 cells per 1 µg FDA and .3 µg PI works well. After incubation at room 

temperature for up to 30 min, cells has been placed on ice until analysis. Then cells 

has been analyzed using FACS or slide preparations. 

A. Cell cultures 

a. The cell line 3T3 (fibroblast murine cells) was used as the test culture. 

b. The stock culture was prepared in a 25 cm 2 Roux (Falcon) tube, using 

DMEM-F12 medium containing 10% foetal calf serum. Inoculation of the flasks 

was made at the cell density of 10 6 cells/mL, 1 mL/flask and was supplemented up 

to 5 mL with growth medium. 

c. Culture sampling and preparation of test cultures. 

d. The growth medium was removed and the cell layer washed with PBS. In 

addition, the monolayer was treated for 2 minutes with 2 mL trypsin-EDTA reagent 

(diluted 1:100 in PBS). 

e. After detaching the monolayer, 1 mL of foetal calf serum was added, and 

the mix was stirred for cell dispersion. The cell suspension was collected in a 

centrifuge tube and centrifuged at 1500 RPM for 5 minutes. The cell pellet was 

resuspended in 5 mL of DMEM-F12 lacking serum and separated by 

centrifugation. Finally, the cells were suspended in DMEM-F12 containing 10% 

foetal calf serum, counted, and cell viability was determined. Cell density was 

adjusted at 10 6 cell/mL, and than a dilution 1:1 using DMEM-F12 containing 10% 

foetal calf serum was made. 

f. The test cultures were distributed onto 96 well plates; The cells were 

aliquoted at a cell density of 10 5 cells/mL, 0.1 mL/well. After adhesion of the cells 

to the wells, the media were removed and new media (0.1 mL) was added. 

Assays were performed in triplicate, two techniques were applied in parallel, 

extraction and contact. 

B. Testing 

a. The cells were incubated under standard conditions for 24 h. 

b. After 24 h, the media was removed and the tested sample was added. The plates 

were incubated for another 24 h in the presence of the test - biomaterials.



c. After 24 h, the media was removed and replaced with fresh media. Cell 

viability was determined by method which use FDA (florescein di-O-acetate). Test 

cultures incubated in the presence of standard media under the same conditions and 

on the same plate, were used as control. 

d. Cytotoxicity was estimated based on t-test calculations for each series, 

according to a classification scale as follows: p >0.01 highly cytotoxic, 0.01 

0.05 cytotoxic, 0.050.1), 

while “hypothesis 1” (non-toxic vs. reference group “Positive Control”) was 

confirmed (p



Based on cytotoxicity assays in 3T3 cells the Silica wafers, both, coated and 

uncoated are classified as “practically non-cytotoxic”. Results of 3T3 cytotoxicity 

test - Titanium implants are presented in figure 3 (contact assay) and figure 4 

(extraction assay). 

% viability 

100 

80 

60 

40 

20 

0 

Cytiotoxicity testing - Titanium 

implants - contact method 

Control Ti-HA Ti Pos.Ctrl 

samples 

Fig. 4 Cytotoxicity testing of titanium 

implants (extraction test, cultivation 24 

Hrs) on 3T3 cells (Ti-HAhydroxyapatite 

coated, Titanium 

uncoated coated, control: negative 

control, pos. control: SDS 0,1 % 

% viability 

Fig. 3 Cytotoxicity testing of 

titanium implants (contact test, 

cultivation 24 Hrs) on 3T3 cells (Ti- 

HA-hydroxyapatite coated, 

Titanium uncoated coated, control: 

negative control, pos. control: SDS 

0,1 % 

Cytiotoxicity testing - Titanium 

implants - extraction method 

The graphs (fig 3 and 4) are 

0 

revealing very small changes in cell 

Control Ti-HA Ti Pos.Ctrl 

viability. These changes suggest that 

samples 

there is no important impact on cell 

viability from the exposure to the samples. 

Further statistical interpretation of recorded 

data was performed on 2 hypotheses: 

“hypothesis 0” (toxicity vs. reference group “Control”) was not confirmed (p>0.1), 

while “hypothesis 1” (non-toxic vs. reference group “Positive Control”) was 

confirmed (p



pre-treated surface to provide increased attachment of cell, while hydroxyapatite 

coat also offering an improved adhesion surface. 

The design of the experiments needs optimization; 

a balance between the number 

of concentration points and their multiplicity to reduce the need to handle large 

amounts of sample materials while preserving the relevance of the assay. 

The use of Fluorescein diacetate as cell viability probe, ass well as the approach 

of 

a combined assay of signal mediated citotoxicity offers a significant improvement 

to the cytotoxicity assay. 

Note 

Study supported 

by National Authority for Scientific Research - project PN- 

06060206/2007. 

References 

1. Fisz, J.,J.: Fluorescence polarization spectroscopy at combined high-aperture 

excitation and detection: application to one-photon-excitation fluorescence 

microscopy.In: J Phys Chem A., vol. 111(35), 2007, p. 8606-21. 

2. Luk, K.,C., Hyde, E.,G., Trojanowski, J.,Q., Lee, V.,M.: Sensitive 

fluorescence polarization technique for rapid screening of alpha-synuclein 

oligomerization/fibrillization inhibitors. In: Biochemistry, vol. 46(44), 2007, 

p. 12522-9. 

3. Demos, S. G., Wang WB, Alfano RR, Imaging objects hidden in scattering 

media with fluorescence polarization preservation of contrast agents. Appl Opt., 

37(4):792-7, 1998. 

4. Kenis, H., Hofstra, 

L., Reutelingsperger, C.,P.: Annexin A5: shifting from a 

diagnostic towards a therapeutic realm. In: Cell Mol Life Sci., 2007, vol. 64(22), 

p. 2859-62. 

5. Lomas, R.J, 

Gillian, H.L., Matthews, J.B., Ingham, E., Kearney, J., N. An 

evaluation of the capacity of differently prepared demineralised bone matrices 

(DMB) and troxic residuals of ethylene oxide (EtOx) to provoke an inflammatory 

response in vitro. In: Biomaterials; vol. 22(9), 2001, p. 913-921. 

6. Liebsch, H., M., Spielmann, H.: Balb/c 3T3 Cytotoxicity test. In: Methods Mol 

Biol., 1995, vol. 43, p. 177-78. 

7. Liebsch, M., Spielmann, H.: Balb/C 3T3 Cytotoxicity assay (Invittox protocol 

No. 46) 2006, In: European Centre for the Validation of Alternative methods 

http://ecvam-dalb.jrc.ec.europa.eu. 

8. Kirkpatrick, C., J., Peters, K., 

Hermanns, M., I., Bittinger, F., Krump- 

Konvalinkova, V., Fuchs, S., Unger, R., E.: In vitro methodologies to evaluate 

biocompatibility: status quo and perspective. In: ITBM-RBM, 2005, vol. 26, p. 

192-199.



GENOTYPING OF WILD RASPBERRY (RUBUS IDAEUS 

L.) ACCESSIONS WITH RAPD MARKERS 

J. P V. 

BALIUCKAS , J. LABOKAS , V. KLEIZAITĖ , V. RANČELIS 1 

ATAMSYTĖ 8 , D. ŽVINGILA 1 , L. BALČIŪNIENĖ 9 , 

10 11 1 

Abstract: RAPD method was used for the management of wild raspberry 

collection of Vilnius University (Lithuania). Wild raspberry (Rubus idaeus L.) is 

an important source of genes for breeding commercial raspberry cultivars. We 

have used the RAPD method to genotype 49 samples of R. idaeus from the wild 

raspberry collection. Six primers showed clear reproducible and polymorphic 

banding patterns. A total of 48 polymorphic RAPD markers were identified in the 

studied forty nine accessions. The analysis of RAPD patterns generated using 

single primer showed insufficient DNA polymorphism for the discrimination of all 

samples. The genotyping of studied accessions can be done using two selected 

primers. No correlation was observed between RAPD polymorphism of studied 

plants and edaphic characteristics of sample collecting sites. 

Keywords: Rubus idaeus, raspberry, RAPD, genetic resources, genotyping, 

collection 

Introduction 

The genus Rubus 

is a complex group of hundreds of widely distributed species. 

One 

of the most important 

representatives of this genus in Lithuanian flora is wild 

raspberry Rubus idaeus. R. idaeus is highly polymorphic species that shows 

considerable variability of quantitative and qualitative characters, ecological 

adaptation and DNA polymorphism [1, 2]. The range of phenotypes found in 

raspberry is believed to have developed as a result of adaptation to the 

environments in which it is found [3, 4]. Such locally adapted plants may serve as a 

source of useful genetic information which has the potential to be used in breeding 

programs. To identify genetic material that may contain useful traits for germplasm 

enhancement, a systematic evaluation of genetic diversity is needed to understand 

relationships between accessions and their collecting site environments [5]. 

8 

Department of Botany and Genetics, Vilnius University, Lithuania, e-mail: 

jolanta.patamsyte@gf.vu.lt 

9 

Botanical Garden of Vilnius University, Lithuania 

10 

Department of Forest Genetics and Reforestation, Lithuanian Forest Research Institute, Lithuania 

11 

Laboratory of Economic Botany, Institute of Botany, Lithuania



Molecular technologies now are routinely used to assess and monitor 

biodiversity. They facilitate critical decisions on what should be conserved 

and 

increase 

utilization through more efficient screening of germplasm [6]. In addition, 

molecular markers are used to define core collections within gene banks [7-9]. The 

clonal germplasm collection of wild raspberry at the Botanical garden of Vilnius 

University was established in 2001 and consists of samples collected from different 

parts of Lithuania [10]. Exploitation of R. idaeus genetic resources for red 

raspberry improvement requires knowledge on the range and structure of the 

genetic variability present in the wild raspberry R. idaeus gene pools. 

In our study the molecular (RAPD) markers were used for the evaluation of 

genetic diversity in the ex situ clone collection of wild raspberry of Vilnius 

University. 

The main objectives of the work were: 1) the genotyping of wild 

raspberry accessions and assessment of genetic diversity in the collection; 2) 

establishment of the most perspective primers; 3) determination of relationships of 

RAPD polymorphism with some ecological characteristics of sample collection 

sites. 


Plant material. 49 wild raspberry 

samples from Vilnius University Botanical 

Garden 

collection were studied (Table 1). Soil properties of the sample collecting 

sites were evaluated as described earlier [2]. 

RAPD analysis. Genomic DNA was extracted from samples of young leaves (0.1 

g) taken from the upper part of floricanes (usually third-fifth leaves) using 

Genomic DNA purification kit (Fermentas) as described previously [2]. DNA 

concentration was measured using BioPhotometer (Eppendorf). DNA samples 

were diluted to 50 ng/μl. Preliminary selection of suitable oligonucleotide primers 

was performed on 20 genotypes to select informative and suitable primers for the 

RAPD-PCR analysis [2]. Six primers were chosen to analyze 49 wild raspberry 

genotypes for RAPD variation. RAPD-PCR was performed as described earlier 

[11]. 

Data analysis. RAPD data were scored as the presence (1) or absence (0) of a 

given amplification product in each accession. Resulted binary matrix was used to 

calculate genetic distance coefficient (GDNL) to estimate genetic diversity among 

studied genotypes [12]. The genetic distance matrices were computed from 

polymorphic RAPD bands. The UPGMA dendrogram based on molecular data 

(GDNL) was constructed using the computer program TREECON [12]. SAS 

procedure GENMOD (generalized linear models) with model options of link 

function ‘logit’ and the binomial distribution variance function was used for



estimation of locus band presence or absence effect for RAPD data and soil 

characteristics. 

Only polymorphic 

fragments were used for the evaluation of data (SAS V8 

package). 

The method of principal components in factor analysis was applied to 

analyse the data from RAPD fingerprints by the FACTOR procedure [13]. The 

Pearson correlation and its p-value were calculated to relate the factor analysis 

results to the soil characteristics (CORR procedure). 

Table 1. Rubus idaeus accession numbers, collecting site coordinates and soil 

characteristics 

Collecting coordinates DNA Access. 

number number Longitude, N Latitude, E pHKCl 

Soil characteristics of collecting site 

Total Free P ee K 

Humus, 

% 

2O5, Fr 2O, 

nitrogen, 

% mg/kg mg/kg 

1 JL01 23°40‘ 54°17‘ 7,12 6,20 0,48 123,30 130,70 

2 JL02 24°13‘ 54°21‘ 4,12 5,90 0,23 106,70 112,60 

3 JL04 22°51‘ 56°06‘ 6,14 5,75 0,37 116,30 230,10 

4 JL05 23°47‘ 55°24‘ 7,02 7,48 0,42 59,20 132,20 

5 JL22 23°32‘ 54°28‘ 3,56 4,32 0,20 24,60 53,80 

6 JL36 23°24‘ 55°25‘ 4,01 28,52 1,93 90,10 708,20 

7 JL45 23°46‘ 54°13‘ 4,85 1,80 0,13 145,50 103,00 

8 JL18 21°07‘ 55°35‘ 4,75 0,97 0,02 65,70 28,50 

9 JL52 25°29‘ 54°43‘ 3,42 24,74 1,10 158,80 428,20 

10 SS01 26°06‘ 55°41‘ 6,78 9,57 0,73 386,90 416,0 

11 JL03 24°45‘ 54°20‘ 5,46 3,94 0,26 95,00 254,10 

12 JL06 24°42‘ 54°33‘ 5,48 3,33 0,22 64,60 136,80 

13 JL08 24°32‘ 55°24‘ 5,62 8,12 0,58 252,50 101,60 

14 JL09 24°05‘ 55°37‘ 6,60 4,58 0,22 129,20 260,80 

15 JL10 24°09‘ 54°32‘ 4,01 5,06 0,28 59,60 80,20 

16 JL11 25°18‘ 54°45‘ 5,15 7,48 0,48 25,40 53,00 

17 JL12 24°28‘ 54°48‘ 5,97 2,78 0,24 68,60 67,90 

18 JL14 25°08‘ 54°28‘ 4,75 28,96 3,06 161,00 238,60 

19 JL15 25°27‘ 54°47‘ 4,02 1,80 0,04 130,50 22,30 

20 JL16 25°12‘ 54°51‘ 3,05 5,28 0,13 17,80 55,40 

21 JL35 25°35‘ 55°12‘ 5,58 7,35 0,38 27,00 63,50 

23 JL37 23°47‘ 55°02‘ 5,76 6,41 0,40 190,60 347,20 

25 LB01 23°45‘ 54°46‘ 4,28 7,93 0,40 309,30 251,10 

27 JL07 25°24‘ 54°43‘ 4,69 3,07 0,15 192,40 238,90 

30 JL41 23°57‘ 55°51‘ 6,96 7,75 0,50 121,50 54,50 

32 JL43 23°12‘ 54°44‘ 4,94 3,30 0,20 90,60 103,50 

33 JL44 23°12‘ 54°37‘ 3,20 25,17 1,24 133,00 225,50 

35 JL34 23°25‘ 54°26‘ 7,05 4,58 0,24 95,30 175,60 

37 JL47 26°40‘ 55°12‘ 7,20 7,33 0,38 327,00 237,20 

40 JL54 24°33‘ 55°03‘ 4,36 27,96 1,83 108,70 279,20 

41 JL56 24°50‘ 54°54‘ 7,71 3,36 0,11 180,90 64,80



44 JL61 24°51‘ 54°24‘ 4,40 7,20 0,51 54,80 67,00 

46 LB02 25°02‘ 55°48‘ 4,64 29,30 2,30 117,40 724,50 

47 JL64 22°38‘ 55°32‘ 4,81 8,52 0,58 18,70 356,3 

49 JL65 22°13‘ 55°24‘ 4,65 7,62 0,43 13,00 150,10 

54 JL72 24°49‘ 56°20‘ 3,80 27,57 2,31 127,10 597,20 

56 JL76 25°05‘ 55°39‘ 5,23 8,17 0,85 70,80 70,80 

73 JL13 25°21‘ 54°41‘ 5,09 3,06 0,17 91,50 77,90 

74 JL17 20°58‘ 55°17‘ 3,12 8,76 0,41 250,00 169,80 

75 JL19 22°44‘ 55°18‘ 4,45 2,67 0,16 178,00 158,50 

76 JL20 24°02‘ 54°51‘ 3,60 4,36 0,11 41,90 61,10 

77 JL23 25°41‘ 54°34‘ 3,39 5,35 0,23 28,80 64,40 

78 JL25 25°27‘ 54°43‘ 4,59 1,46 0,04 151,30 55,10 

79 JL32 22°33‘ 55°19‘ 5,20 3,49 0,25 22,20 137,20 

80 JL33 21°31‘ 55°39‘ 3,56 6,04 0,31 9,90 99,50 

81 JL42 24°34‘ 55°31‘ 5,81 8,30 0,41 118,00 118,50 

82 IŽ01 26°07‘ 55°36‘ 4,10 8,23 0,22 461,90 176,90 

83 JL39 23°03‘ 55°59‘ 5,45 8,26 0,50 56,20 74,50 

84 JL40 23°40‘ 55°46‘ 7,35 5,49 0,28 69,90 70,20 


Six primers out of 36 tested in the previous study were applied on a larger 

number 

of accessions [2]. The results obtained for each primer are presented in 

Table 2. A total of 48 polymorphic RAPD bands from six primers, 8 markers per 

primer, were obtained in the studied forty nine accessions. The size of the scorable 

RAPD bands ranged from 390 bp to 3100 bp. The amplification products of wild 

raspberry genomic DNA were highly polymorphic. The average number of 

polymorphic DNA fragments amplified per primer was 77.83%, ranging between 

64% (Roth 270-6) and 89% (MP4). On the basis of these 48 RAPD markers it was 

revealed 49 RAPD patterns for the tested 49 germaplasm accessions. The 

reproducibility of the RAPD patterns of different samples was tested by repeating 

the RAPD-PCR at least twice for each primer and good reproduction of RAPD 

bands was obtained with all six primers. The most distant RAPD patterns 

(accessions JL43 and JL40) were differentiated by 25 markers while the most 

similar ones (accessions JL06 and JL14) were differentiated by 7 markers (data not 

shown). The next step in this study was the establishment the minimal set of 

primers suitable for genotyping all studied plants. The analysis of RAPD patterns 

generated using single primer showed insufficient DNA polymorphism for the 

discrimination all genotypes. The best results were obtained with primers MP4 and 

Roth 470-8.



Table 2. Number of RAPD bands and RAPD patterns determined per 

primer on 49 accessions of R. idaeus 

RAPD primer 

Total analyzed 

DNA bands 

Polymorphic 

DNA bands 

RAPD 

patterns* 

Polymorphism, 

% 

Size of analyzed 

DNR bands (bp) 

A3 10 8 22 80 450-1800 

MP4 9 8 38 89 550-2500 

Roth 270-6 14 9 30 64 500-2900 

Roth 380-3 12 9 28 75 390-2100 

Roth 470-8 11 8 36 73 440-3100 

Roth 470-9 7 6 20 86 750-2000 

Average 1 0.5 8 20.6 7 7.83 

Total 63 48 

∗ The number 

of RAPD patterns obtained per primer in 

RAPD-PCR analysis of 49 raspberry accessions. 

Using these primers were identified 38 and 36 patterns respectively (Table 2). 

When 

RAPD markers generated by two different primers were joined together the 

number of generated patterns for some primer combinations was sufficient to 

genotype all studied accessions (Table 3). Four combinations of primers are 

suitable for this purpose (270-6 and 470-8; 270-6 and MP4; 470-8 and MP4; 470-9 

and 470-8). Figure 1 shows the genetic differences among studied raspberry 

accessions revealed by two primers (470-8 and MP4). So, to distinguish all 49 

genotypes at least two RAPD-PCR analyses have to be carried out with each 

sample of this collection. 

Table 3. The number of RAPD patterns obtained in RAPD-PCR 

analysis using corresponding primers in separate reactions 

RAPD primer Roth 270-6 Roth 380-3 Roth 470-8 MP4 Roth 470-9 

Roth 380-3 47 

Roth 470-8 49 47 

MP4 49 48 49 

Roth 470-9 48 47 49 47 

A3 45 44 46 47 44 

In this study we also assessed possible correlation between genotype specific 

RAPD patterns and soil characteristics of sample collecting sites. The chemical 

properties of soil are very important for plant growth and survival. The principal 

component method in factor analysis was used to find possible correlation between 

molecular and ecological variables of studied genotypes. The distribution of alleles 

of 48 RAPD loci among 49 accessions was compared with the following soil 

variables: nitrogen, humus, phosphorus, potassium content and soil acidity. No



correlation was found between RAPD polymorphism of studied plants and edaphic 

characteristics of sample collecting sites. In spite of this the variation of seven 

RAPD loci showed correlation with the variation of some soil characteristics 

(Table 4). 

246 

0.4 

0.3 

0.2 

238 

382 

206 

0.1 

376 

200 

341 

248 

555 

563 

IŽ01 

JL65 

JL17 

JL19 

JL18 

JL20 

JL56 

JL12 

JL07 

JL06 

JL37 

JL10 

JL04 

JL05 

JL54 

JL45 

JL16 

JL44 

JL39 

JL41 

JL02 

JL33 

JL34 

JL61 

JL14 

JL42 

JL08 

JL52 

JL72 

JL47 

JL13 

JL35 

LB01 

JL40 

JL23 

LB02 

JL64 

JL15 

JL25 

SS01 

JL03 

JL22 

JL11 

JL76 

JL43 

JL09 

JL32 

JL36 

JL01 

Fig. 1. Dendrogram of wild raspberry accessions based on the genetic distance 

matrix from RAPD markers established with primers Roth 470-8 and MP4. The 

bootstraps are given in bold numbers.



Table 4. RAPD loci significantly contributing to soil properties differentiation of the 

collecting site 

Soil properties 1 

Acidity (pH) Phosphorus Potassium 

RAPD loci 

Roth 270-61400 * * * 

Roth 380-3490 * 

Roth 470-8920 ** 

Roth 470-82500 * * 

MP4850 * 

MP4820 * 

Roth 470-92000 1 

Soil properties refer to those shown in the Table 1. 

* p



This discrepancy may be explained by the much smaller number of RAPD loci 

identified in the larger set of accessions (49 instead of 20) tested in this study and 

used in the factor analysis. So in this case the smaller part of genome was analyzed 

and probably adaptively important loci were not included in this analysis. 

In this study we identified a set of RAPD markers suitable for genotyping of R. 

idaeus germplasm collection. These markers are not environmentally affected and 

allow the quantification of the genetic similarity of the studied accessions. On the 

basis of these data new accessions may be included in the collection and the cases 

of mislabeling and duplications can be detected. 


This work was supported by Grant T-43/05 of Lithuanian State Science and 

Studies Foundation ant the Lithuanian State program ,,Genefund”. 

References 

1. Graham, J., Squire, G.R., Marshall, B, Harrison, R.E.: Spatially dependent 

genetic diversity within and between colonies of wild raspberry Rubus idaeus 

detected using RAPD markers. In: Molecular Ecology, vol. 6, 1997, p. 1001-1008. 

2. Patamsytė, J., Žvingila, D., Labokas, J., Baliuckas, V., Kleizaitė, V., 

Balčiunienė, L., Rančelis, V.: Assessment of diversity of wild raspberies (Rubus 

idaeus L.) in Lithuania. In: Journal of fruit and ornamental plant research, vol. 12, 

2004, p. 195-205. 

3. Marshall, B., Harrison, R.E., Graham, J., McNicol, J.W., Wright, G., Squire, 

G.R.: Spatial trends of phenotypic diversity between colonies of wild raspberry 

Rubus idaeus. In: New Phytologist, vol. 151, 2001, p. 671-682. 

4. Graham, J., Marshall, B., Squire, G.R.: Genetic differentiation over a spatial 

environmental gradient in wild Rubus idaeus populations. In: New Phytologist, 

vol. 157, 2003, p. 667-675. 

5. Steiner, J.J., Garcia de los Santos, G.: Adaptive ecology of Lotus corniculatus L. 

Genotypes: I. Plant morphology and RAPD marker characterizations. In: Crop 

Science, vol. 41, 2001, p. 552-563. 

6. Barlow, B., Tzotsos, G.T.: Biotechnology. Global Biodiversity Assessment, 

edited by V.H. Heywood and K. Gardner. Cambridge: Cambridge University Press, 

1995. 

7. Gepts, P.: Genetic markers and core collections. Hodgkin T., Brown A.H.D., 

van Hintum Th.J.L, Morales EAV (eds), Core collections of plant genetic 

resources. Wiley, New York, 1995, p. 127-146.



8. Khadari, B., Breton, C., Moutier, N., Roger, J.P., Besnard, G., Berville, A., 

Dosba, F.: The use of molecular markers for the germplasm management in a 

French olive collection. In: Theoretical and Applied Genetics, vol. 106, 2003, p. 

521-529. 

9. Fu, Y.-B.: Geographic patterns of RAPD variation in cultivated flax. In: Crop 

Science, vol. 45, 2005, p. 1084-1091. 

10. Balčiūnienė, L., Labokas, J., Radaitienė, D.: Primary evaluation of field 

collection of wild Rubus idaeus. In: Botanica Lithuanica, vol. 11 (1), 2005, p. 3-15. 

11. Žvingila, D., Patamsytė, J., Kleizaitė, V., Labokas, J., Baliuckas, V., 

Balčiūnienė L., Rančelis, V.: A study of genetic variability and adptation in wild 

Rubus idaeus L. using molecular markers. In: Biologija, vol. 3, 2004, p. 21-26. 

12. Nei, M., Li, W.H.: Proceedings of the National Academy of Sciences (USA), 

1979, vol. 76: p. 5269-5273. 

13. SAS Institute Inc. SAS/STAT ® , Cary, NC, USA, 1999. 

14. Owuor, E.D., Fahima, T., Beiles, A., Korol, A., Nevo, E.: Population genetic 

response to microsite ecological stress in wild barley, Hordeum spontaneum. In: 

Molecular Ecology, vol.6, 1997, p. 1177-1187.



INFLUENCE OF MICROBIAL BIOPRODUCTS ON 

AGRICULTURAL CROPS 

Narcisa BABEANU 12 , O. POPA 1 , D.I. MARIN 13 , A. VAMANU 1 , E. 

VAMANU 1 , Marina PAMFIL 14 , N. DINCA 15 

Abstract: The main objective of this work was to obtain and test the efficiency of 

microbial inoculants with biostimulatory activity. We have isolated several strains of 

Azotobacter chroococcum, Bacillus subtilis and Trichoderma sp from wheat straw and soil 

samples in order to obtain biomass to be further used as biofertilizer. The bioproducts 

obtained from bacterial/fungal biomass, were tested in field conditions. The best results 

were obtained using B1+B2+T1. AT1 based bio-product could represent an alternative due 

to its increasing biological activity in comparison with the control sample.Our work was 

sponsorised by a CEEX research contract. 

Keywords: Bacillus spp., Trichoderma spp., Azotobacter spp., bio-products, wheat 

Introduction 

The use of chemical fertilizers, high yielding varieties and agricultural practices 

have resulted in tremendous development in the agricultural sector. There is no 

doubt that use of chemical fertilizers has increased food grain production, but their 

excessive use is now leading to a decrease in crop yield, imbalance of nutrients in 

the soil, and an adverse effect on the soil's physicochemical properties. Also the 

use of chemical fertilizer leads to ecological disturbances and environmental 

pollution. 

The most important constraint limiting crop yields among resource-poor farmers 

is soil infertility. Unless the fertility is restored, farmers will gain little benefit from 

the use of improved varieties and more productive cultural practices. Soil fertility 

can be effectively restored through adopting the concept of integrated soil fertility 

management, encompassing a strategy for nutrient management-based on natural 

resource conservation, biological nitrogen fixation and increased efficiency of the 

inputs. 

12 

Faculty of Biotechnology, University of Agronomical Sciences and Veterinary Medicine, Bucharest 

– Romania. 

13 

Faculty of Agriculture, University of Agronomical Sciences and Veterinary Medicine, Bucharest 

14 

National Institute for Chemical Pharmaceutical Research and Development - ICCF Bucharest, 

Romania. 

15 

R&D department of SC Monden COM SRL.



Microbial inoculants are those preparations containing living microorganisms 

which enhance crop productivity through improving the nutrient supplies and their 

crop availability. Such inoculants may help in increasing crop productivity by the 

way of increased nitrogen fixation, increased availability or uptake of nutrients 

through solubilization or increased absorbtion, stimulatory of plant growth through 

hormonal action or antibiosis, or by decomposition of organic residues. 

Materials and methods 

The ecological bio stimulators and bio fertilizers were obtained in 2005-2006 

based on isolated micro organisms from dried cereals, green weeds and soil. 

Among the isolated strains there are 2 bacteria strains which proved good results: 

Bacillus subtilis isolated from the weeds (quack grass) – B1; Bacillus subtilis 

isolated from dried cereals (straw wheat) – B2, which were vegetative preserved on 

tubes with nutritive gelose at + 40 C and in lyophilized condition, 1 strain 

Trichoderma sp.- T1 which was vegetative preserved on medium of potatoglucose-agar 

(CGA) and lyophilized, 1 strain of Azotobacter (AT1), isolated from 

soil samples on Burk media, using mannitol as carbon source. 

For these, there were established the conditions for the bioprocess control and the 

optimum composition of the culture medium. Fermentation conditions: cultures 

were grown at 31°C in a 15-liter New Brunswick bioreactor equipped with pH, 

dissolved-oxygen, temperature, and foam probes. (7 L working volume). The 

medium contained (per liter) 25 g glucose, 10 g corn steep liquor (51% D.M.W.), 2 

g Na NO3, 0.5 g MgSO4 × 7 H2O, 0.2 MnSO4×H2O, CaCl2×2H2O; initial pH: 6.6, 

aeration: 0.5 v.v.m, agitation: 300-350 r.p.m. (Bacillus subtilis). 

For Trichoderma harzianum, the cultures were grown at 27°C, in a medium with 

the following composition (g per liter): 17 g glucose, 15 g corn steep liquor (51% 

D.M.W.), 2 g KH2PO4, 1 g MgSO4×7 H2O, 1 g FeSO4 ×7 H2O. We used the same 

bioreactor with the following parameters: pH 4.8, agitation 150-200 r.p.m., aeration 

0,5 v.v.m. 

During cultivation, the growth was controlled at various time intervals, by 

measuring optical density at 660 nm for bacterial cultures (1 unit O.D. = 0.32 

D.C.W.) and by dry cell weight measurements for fungal cultures. Glucose was 

enzymatically estimated using F-kit Glucose (Boehringer Mannheim Co.Ltd, 

Mannheim, Germany). 

The cultivation conditions in bioreactor for Azotobacter chroococcum were: 

temperature 28 o C; aeration 0,5 v.v.m.; agitation 100 r.p.m.; inoculum’s volume 

5,5%. 

Starting with 2006 there were performed tests in the field (on wheat crop) in a



farm belonging to SC Monden Com SRL, Racari, Dambovita county, placed on a 

field red preluvosol soil, with pH -6.2, Ct. -1.05, Nt -0.153, P Al -17 ppm, K Al – 

180. The experimental variants were: V1–N0P0, V2-N60 P30, V3-AT1, V4-T1, V5- 

B1+B2+T1, V6-B1+B2. The experiment was mono factorial, with 2 controls: V1 

and V2. It was worked in three rehearsals. 

The phosphorus was applied in autumn, before plouwing, and nitrogen, in two 

stges, half in autumn and half in spring, on the first days of March. 

The vital activity of the soil was evaluated through two biotic tests: the 

respiration (mg CO2/100 g soil d.s.) and cellulosolytic activity (g enzymatically 

hydrolyzed cellulose/100 g soil d.s.). There were selected three enzymes from 

pedo-enzymes assortment (adsorbed enzymes on the organic-minerals components) 

with an important role in the cycle of the elements in the nature: saccharidase 

activity (mg enzymatically hydrolyzed saccharide/100 g soil d.s.; carbon cycle), 

urease activity (mg NH4 + /100 g soil d.s.; nitrogen cycle) and phosphatase activity 

(mg P/100 g soil d.s.; phosphorous cycle). Catalase soil activity was added to the 

others (cm 3 O2/100 g soil d.s.), this analysis offering information regarding the 

oxidation processes in the soil. 

Based on both biotic and enzymatic tests, there were calculated two modular 

indicators: VPAI% (Vital Potential Activity Indicator) and EPAI% (Enzymatic 

Potential Activity Indicator) and one synthetic indicator BSI% (Biological 

Synthetic Indicator). The calculation methodology for these indicators represents a 

numerical taxonomy variant, which recognizes an equal importance of each test for 

fertility soil level (Stefanic et al., 1999). 

In order to calculate the energy balance we used the methodology applied by the 

Institute of Agricultural Economics from the ASAS (Teşu şi Baghinschi, 1986). 


1. Bio-products obtaining 

The development of the Bacillus spp. strains is shown in Fig. 1. From this figure 

it can be observed that the maximum concentration is 16 g/L DCW. During 

experiments, there were no significant differences for growth rate and final 

biomass concentration between the tested strains of Bacillus. 

For Trichoderma spp. strains the fermentation profile, shown in Fig. 2, presents a 

maximum biomass concentration (13,5 g/l) after 76 h of cultivation. 

For Azotobacter spp. strains the greatest concentration was obtained at 72 h 

cultivation (1,0 – 1,3×10 9 CFU/mL). No significant differences between strains 

were observed in this case (Fig. 3). 

Bacillus spp. and Trichoderma spp. biomass was immobilized on seeds using



pullulan like 

polysaccharide (5×10 7 –2×10 8 CFU/seed); 

Azotobacter biomass was applied on soil before sowing time as solution with 

1×10 9 CFU/mL concentration, pH = 7,2 (Babeanu et al., 2007). 

2. The influence of the bio-products on soil vital activity 

The application of biological products as well as of nitrogen fertilizers led to the 

improvement of the soil biological activity, as estimated using BSI%. 

The Biological Synthetic Indicator (BSI %) includes both soil vital activity 

(VPAI %) and soil enzymatic activity (EPAI %). 

The increasing is between 8,6% and 34,98%, in comparison with control sample 

(without bacteria and without fertilizer). 

The best results were obtained using B1+B2+T. 

AT1 based bio-product could represent an alternative due to its increasing 

biological activity comparative to the control sample (Table 1). 

Table 1. 

The influence of bioproducts and nitrogen fertilizers on soil biological 

activity 

Treatment IPAV % IPAE % BSI% 

V1. Control – without 

bacteria, without fertilizer 

c 20,88 f 19,09 d 19,98 

V2. NPK b 23,41 e 22,89 b 23,15 

V3. AT1 c 20,29 d 23,11 c 21,70 

V5. B1+B2+T1 a 27,35 b 25,41 a 26,38 

DL 5% -2,398* DL 5% - 0,496* DL 5% - 1,369*



3. The influence of bio products on the wheat yield (Table 2) 

The production of grains for the wheat culture in the conditions of the 

agricultural year 2006-2007 registered a decrease against the previous year (3200 

kg/ha in the same farm, these being between 1692 kg/ha (V1) - 2393 kg/ha (V5). 

The increase of production assured by the chemical fertilization of the soil was of 

444 kg/ha (2007) and 997 kg/ha (2008). Between the variant V3 and the variant V5 

there are no significant differences (55 kg/ha -2007 and 141 kg/ha -2008). It must 

be remarked that the bio products based on Bacillus and Trichoderma conducted to 

the production increase against the variant not fertilised, but not also against the 

DCW (g/L), Glucose (g/L) 

30 

25 

20 

15 

10 

5 

0 

0 4 8 12 

time (h) 

16 20 24 28 

DCW (g/L), glucose (g/L) 

18 

16 

14 

12 

10 

8 

6 

4 

2 

0 

DCW (g/L) 

Glucose (g/L) 

pH 

Fig.1. Fermentation profile for Bacillus subtilis 

DCW (g/L) 

Glucose (g/L) 

0 20 40 60 80 100 

time (h) 

Fig.2. Fermentation profile for Trichoderma harzianum 

8,5 

8 

7,5 

7 

6,5 

6 

pH



O.D. 

25 

20 

15 

10 

5 

0 

AT1 (O.D) AT2 (O.D) 

AT1 (O.D) AT2 (O.D) 

0 12 24 36 48 60 72 84 96 108 

time (h) 

Fig.3. Fermentation profile for Azotobacter chroococcum 

control V2 (the differences between these are not significant). 

Table 2 

The influence of the technological elements on the grains production of wheat 

culture 

Variants Yield 

2007 

kg/ha 

Relative 

yield 

% 

Difference 

kg/ha 

Yield 

2008 

kg/ha 

Relative 

yield 

% 

Difference 

kg/ha 

V1 1692 100 C1 3778 100 C1 

V2 2136 126 444*** 4775 126 997*** 

V3 2338 138 646*** 5214 138 1436*** 

V4 2119 125 427*** 4563 142 785*** 

V5 2393 141 701*** 5355 121 1577*** 

V6 2037 120 345*** 4750 126 972*** 

DL 5% = 129 

DL 5%=277 kg 

DL 1% = 207 

DL 1%=420 kg; 

DL 0.1% = 251 

DL 0,1%=483 kg. 

4. The influence of the bio products on the production of biomass. 

Analyzing the data from the table 3 it can be observed that in 2007, for the 

variants V3, V4 and V5 the quantity of biomass realized by the



culture plants are showing significant differences against the variant V1.The 

increments against this control were between 14-33%. In 2008 production of 

biomass was between 11781 kg/ha at V5 and 7528 kg/ha at V1. 

Table 3 

The influence of the bio fertilizers on the total wheat culture biomass 

Variants 

Total biomass 

2007 

kg/ha 

Difference 

kg/ha 

Total 

biomass 2008 

kg/ha 

Difference 

kg/ha 

V1 3342 C1 7528 C1 

V2 3915 573 10505 2977 

V3 4474 1132 10949 3421 

V4 4134 792 10039 2511 

V5 4211 869 11781 4253 

V6 3804 462 9975 2447 

DL 5%= 244 

DL 5%= 590 

DL 1% = 351 

DL 1% = 850 

DL 0,1% = 449 

DL 0,1% = 1085 

Table 4 

Influence of the technological elements applied to the wheat crop on energy 

Vari 

ants Yield pr. –kg/ha 

consumption, energy production and net energy in 2007 

Yield sec. 

kg/ha 

Energy 

consumption 

(kWh/ha) 

Energy 

production 

(kWh/ha) 

Net energy 

(kWh/ha) 

V1 1692 1650 2164 14542 12378 

V2 2136 1779 4581 17070 12489 

V3 2338 2136 2331 19484 17153 

V4 2119 2015 2244 17994 15750 

V5 2393 1818 2231 18381 16150 

V6 2037 1768 2256 16581 14325



5. Energy Balance of technology culture. 

The energy balance (in 2007) shows the insignificant difference between V1 and 

V2. Net energy oscillated between 12378 kWh/ha (V1) and 17153 kWh/ha (V3) - 

Table 4. In 2008, year favorable for wheat crop, it was obtained the largest yield 

with over 2 t/ha against the previous year, under similar consumption of energy. 

The produced energy oscillated between 32750 (V1) and 51130 kWh/ha (V5). In 

the chemical fertilizers variant (V2), the total quantity of biomass obtained and, 

consequently, the produced energy was 45592 kWh/ha, with 12842 kwh/ha over 

the control variant (significant difference). 

Table 5 

Influence of the technological elements applied to the wheat crop on energy 

consumption, energy production and net energy in 2008 

Energy 

Energy 

Yield pr. – Yield sec. consumption production Net energy 

Variants kg/ha kg/ha (kWh/ha) 

(kWh/ha) (kWh/ha) 

V1 3778 3750 2164 32750 30586 

V2 4775 5730 4581 45592 41011 

V3 5214 5735 2331 47571 45240 

V4 4563 5476 2256 43569 41313 

V5 5355 6426 2231 51130 48899 

V6 4750 5225 2244 43339 41095 

Conclusions 

1. The application of the microbial bio-products determines the stimulation of 

the vital activity (11,73% - 30,98%) as well as of the enzymatic activity (19,90% - 

40,44%) of the red preluvosol soil. 

2. The biological activity of the red preluvosol soil, using BSI%, increased with 

8,6% - 34,98%, due to the application of the bacteria strains; the best results were 

obtained using two bio-products variants, AT1 and Bacillus spp 1 + Bacillus spp. 

2 + Trichoderma spp; 

3. In the two years of experiments the greatest productions were obtained with 

the variants V3 and V5 to which there were applied microbial bio fertilizers. 

4. The microbial bio-products, in conditions of prolonged drought and high 

temperatures (agricultural year 2006-2007) contributed to significant increases of 

production against the control.



5. The bio-products consist of microbial biomass of bacteria and fungi (B1 + B2 

+ T1) having together a more powerful effect as biofertilizer than the case of 

separately used microbial biomasss. 

6. The best conversion of the resources was realized with the variants V3 and 

V5. Energy balance (as two years average) for variants with microbial inoculants 

(V3 and V5) show better results ( 2196.5 kWh/ha, respectively 3424.5 kWh/ha) 

than chemical fertilizers variant (V2). 

References: 

1. Băbeanu Narcisa., O. Popa, D. Marin, A. Vamanu, Marina Pamfil, Oana 

Livadariu, E. Vamanu: The influence of conditioning type upon the 

biological features of microbial inoculations, Lucrări ştiinţifice, Facultatea 

Agricultură, XXXIX, Timişoara, Ed. Agroprint, 2007, p.129-132. 

2. Motsara, M. R., Bhattacharya, P. and Srivastava, B.: Biofertilizer 

technology, marketing and usage. A source book-cum-glossary, Fertilizer 

Development and Consultation Organization, New Delhi, 1995. 

3. Muhammad K., Zahir Ah., Waseem A., Muhammad A.: Azotobacter and 

L-tryptophan Application for Improving Wheat Yield, Pakistan Journal of 

Biological Sciences, vol. 2, 1999, p 739-742. 

4. Ozturk A., Ozcan Caglar, Fikrettin Sahin: Yield response of wheat and 

barley to inoculation of plant growth promoting rhizobacteria at various 

levels of nitrogen fertilization, Journal of Plant Nutrition and Soil Science, 

Volume 166, Issue 2, 2003, p. 262 – 266. 

5. Ştefanic G., Mirela Emilia Orzan, Niculina Gheorghiţă: The possibility to 

estimate the level of soil fertility by modular and synthetic indices, 

Romanian Agricultural Research, nr. 15/2001, p. 59 – 64. 

6. Ugoji E.O., M.D. Laing and C.H. Hunter: An investigation of the shelf-life 

(storage) of Bacillus isolates on seeds, South African Journal of Botany 

Volume 72, Issue 1, 2006, p. 28-33. 

7. Wilmar C. Da Luz: Evaluation of plant growth-promoting and 

bioprotecting rhizobacteria on wheat crop, Fitopatologia Brasileira, 2001, 

p. 26:597-600.



INFLUENCE OF THE LIQUEFACTION CONDITIONS 

ON THE COMPOSITION IN SUGARS OF THE 

LIQUEFIED STARCH 

V. MIRONESCU ∗ , A. TRIFAN, I. D. MIRONESCU ∗∗∗ 

Abstract: The enzymatic liquefaction of starch is an important stage for the 

obtaining of the starch hydrolysates. A good liquefaction is generally appreciated by 

a small concentration of products with very small degree of polymerization (DP) (as 

maltose with DP2 and glucose with DP1) and other products with DP higher as 7. 

The main goal of this research is to establish the influence of the treatment time in 

jet-cooker, correlated with the quantity of enzyme Thermamyl L120 used, on the 

composition in sugars of the liquefied starch. The treatment is realized with 

liquefaction times in the limit 4-10 minutes and enzyme concentrations between 0.6- 

1.2 kg/t dry weight. The DP degree is measured using RP-HPLC. In order to 

determine the optimal rapport enzyme/time, a 2 2 full factorial experimental design is 

used. The results show that higher concentrations of enzyme and smaller liquefaction 

time increase the quantity of products with DP≤3, whereas smaller quantities of 

enzyme and higher time increase the proportion of products with DP>7. The full 

factorial design shows that the optimal point for the liquefaction is found in the 

intersection area of the optimal values for three functions obtained for products with 

DP>7, 3



pressure, starch concentration and treatment time (Baks et al., 2007a,b; Bauer and 

Knorr, 2005; Douzals et al., 2001; Knorr et al., 2006). 

After gelatinisation, starch can be hydrolysed. During the first hydrolysis stage, 

called liquefaction, the viscosity of the gelatinised starch mixture is reduced due to 

partial hydrolysis of the carbohydrate polymers. The second aim of this operation 

is to prevent the retrogradation of large polymers (DP=25-100) on further 

processing (Alan Reeve, 1992). The properties of the product formed during 

enzymatic hydrolysis of starch can be varied by using different enzymes and 

conditions (Guzman-Maldonado and Paredes-Lopez, 1995; Van der Maarel et al., 

2002). It is demonstrated that despite the fact that the enzyme employed reacts in a 

random endoacting manner, the product distributions are non-random. The results 

are explained in part by a multimerization process whereby the polymeric substrate 

molecules preferentially associate, forming intermolecular aggregates. These 

aggregates are either a consequence of the manner in which the material is 

deposited into the native granular structure of starch or due to intrinsic physical 

chemical properties of the polysaccharide.. (Rollings et al., 1984). 

In the low temperature liquefaction process (LT), gelatinisation and a partial 

liquefaction are often carried out simultaneously by adding the enzyme before jet 

cooker. The variable process parameters are: quantity of enzyme and time of 

maintaining at 105 0 C; other parameters are constant. Besides the degree of 

gelatinisation, the activity and stability of the enzyme in these conditions are also 

very important. The activity and stability of α-amylase are affected by temperature, 

pressure, pH, substrate concentration and additives (De Cordt et al., 1994; Fitter et 

al., 2001; Raabe and Knorr, 1996; Weemaes et al., 1996). 

Although the individual behaviour of starch and α-amylase in aqueous 

solutions has been studied over a broad range of pressures and temperatures, the 

behaviour of a system that consists of both starch and α-amylase has received less 

attention. The relevance of such a combined system emerges when the relation 

between starch gelatinisation and enzymatic hydrolysis is investigated. The effects 

of high pressure gelatinisation and high temperature gelatinisation on the glucose 

production rate, the hydrolysis yield, and the enzyme activity during enzymatic 

hydrolysis at atmospheric pressure have been investigated before (Hayashi and 

Hayashida, 1989; Selmi et al., 2000; Stute et al., 1996; Tester and Sommerville, 

2001). However, the effects of these gelatinisation conditions on the hydrolysate 

composition were not determined. 

The aim of this research is to establish the influence of the enzyme dose and 

gelatinisation time on the sugar composition of the liquefied product and to 

determine the optimal conditions to obtain a liquefied product adequate for 

saccharification, in order to obtain various types of final products. The process 

quality is appreciated by measuring the Degree of Polymerisation (DP) using High-



Pressure Liquid Chromatography (HPLC) which allows the analysis to maximal 

DP=14 (1992). 



Corn starch with the characteristics presented in Table 1 and the enzyme 

Thermayl 120 L from Novozymes. were used 

Table 1. Characteristics of corn starch 

CHARACTERISTIC VALUE MEASURE UNIT 

Dry substance (DS) 13 % 

Protein content 0,35 % DS 

Fat content 0,7 % DS 

Ash 0,1 % DS 

Table 2. Rotatable experimental design 

EXP. 

NO. 

X0 X1 X2 X1X2 X1 2 

X2 2 

1 1 1 1 +1 +1 +1 

2 1 -1 +1 -1 +1 +1 

3 1 +1 -1 -1 +1 +1 

4 1 -1 -1 +1 +1 +1 

5 1 +1,41 0 0 2 0 

6 1 -1,41 0 0 2 0 

7 1 0 +1,41 0 0 2 

8 1 0 -1,41 0 0 2 

9 1 0 0 0 0 0 

10 1 0 0 0 0 0 

11 1 0 0 0 0 0 

12 1 0 0 0 0 0 

13 1 0 0 0 0 0 

where: 

x1- gelatinisation time 

x2- enzyme dose 

The parameters variation limits are given in Table 3. 

2.2. Liquefaction



Experiments were realised on an industrial installation working on the LT 

principle. The working parameters were: 

- pH=6 

- Concentration of calcium ions 70 ppm 

- Suspension conductibility 400μS/cm 

- Gelatinisation temperature (in jet cooker) 110 0 C 

- Final liquefaction temperature 95 = C 

- Liquefaction time 2 ore 

- Concentration of starch suspension 30% 

2.3. Experimental design 

Experiments were realised following a rotatable experimental design (Table 2). 

PARAMETER 

Table 3. Parameters variation limits 

LEVEL 

-1.41 -1 0 +1 +1.41 

x1,(minutes) 3 4 7 10 11 

x2, (kg/t DS) 0.48 0.6 0.9 1.2 1.32 

2.4. Analysis 

The quality of the liquefaction process was differently assessed in time. As all the 

products resulted at the starch hydrolysis, the liquefaction products are 

characterised by Dextrose Equivalent (DE); a wide range of products can be 

formed, with DE varying between 10 and 30 (Fullbrook, 1984). These products can 

be used directly (as maltodextrins) or are intermediary materials going to 

saccharification. As intermediary products, they have to contain maltodextrins with 

DP smaller as 25; this condition is verified by the iodine test or the osmometric 

method. 

Actually, the quality control of the products obtained through hydrolysis is based 

on the composition in sugars measured with HPLC. DE, which still defines these 

products, is calculated from the composition in sugars with specific formula 

(Benetti, 1992), but not correlation between the composition in sugars and DE 

exists. Taking into account the conditions imposed by saccharification (the action 

of enzymes on maltodextrins), in this work we propose as quality criterion for the 

appreciation of liquefaction the obtaining of a liquefaction product with reduced 

content of dextrines with DP higher as 7 and sugars with DP1 and DP2. 

Sugars composition was determined using HPLC, as described in (Mironescu et 

al., 2007).



2.5. Assessments 

Based on the experimental design presented in Table 2, evolution models for 

two groups of sugars (with DP>7 and DP≤2) were made. The obtained functions 

are presented graphically in the analysed interval and the parameters for which the 

function is minimised are assessed. The optimal conditions for the process 

command are found at the intersection of the zones where the functions are 

minimal. 


In Table 4 is presented the composition in sugars of the liquefied products, 

cumulated on the three types of sugars. 

EXPERIMENT 

Table 4 Sugar composition in the liquefied starch 

PERCENTAGE COMPOSITION IN SUGARS 

NO. DP>7 7 > ΔP >3 DP≤2 

1 7 92 1 

2 28 70.7 11.3 

3 80 16.75 3.25 

4 40 50.5 9.5 

5 4 95.2 0.8 

6 50 34.4 15.6 

7 11 85.6 3.4 

8 18 75.2 6.8 

9 16 76 8 

10 10 82.5 7.5 

11 15 78.5 6.8 

12 8 63.8 8.2 

13 11 83 6 

The results were obtained by considering that dextrin’s with DP>7 result from 

the peaks obtained after 5-8 minutes of elution, the maltodextrin s from the peaks 

which eluted from 8-11 minutes and mono- and disaccharides after 11-15 minutes. 

The model for the hydrolytic process was considered as a polynomial function of 

second degree. The functions obtained after data processing and applying the 

coefficient signification test are:



y1 = 14.62 + 4.275 x1 . x2 + 4x2 2 

y2 = 7.18 – 1.11 . x2 + 0.37 . x1 2 – 1.025 . x2 2 

The analysis of the two functions shows that beside the two analysed parameters, 

the process is considerable influenced by other parameters, too, which appear in the 

free term. In both cases, the quantity of enzyme has a higher influence as the 

gelatinisation time. 

The two functions are represented in Fig. 1 and 2. 

time,s 

740 

580 

420 

260 

100 

1,3 

1,1 

0,9 

0,7 

0,5 

enzyme 

concentration, 

kg/tDS 

20 

15 

10 

5 

0 

35 

30 

25 

polysaccharide 

concentration,% 

30-35 

25-30 

20-25 

15-20 

10-15 

5-10 

0-5 

Fig. 1. Variation of dextrin’s content with enzyme concentration and gelatinisation 

time 

The analysis of the graphical representation of function 1 (Fig. 1) allow to establish 

that in the analysed interval the function has a minimum placed between two 

extremes, one for small enzyme concentration and small treatment time and the 

other for high treatment time and high enzyme concentration. Minimal values for 

the dextrin’s with high polymerisation degree are obtained in a large interval of 

time and enzyme concentration, but which have to be correlated. For example, at 

340 seconds the concentration can vary in the limits 0.8-1.2 Kg/t DS and at 700 

seconds between 0.5-0.8 kg/t DS. If the behaviour in the first two zones can be



explained on the basis of the literature data, the behaviour in the third zone seem to 

be a paradox; at long treatment times and high enzyme concentrations, the quantity 

of dextrin’s attire a maximal value. The explanation could be a retrogradation of 

the molecular fractions with DP higher as 25, which makes them less accessible. 

For the quantity of mono- and disaccharides from the liquefied product (Fig. 2), 

the function is complex. A minimum can be obtained at enzyme quantity of 1.0- 

1.2 kg/t DS and treatment time of 340-700 seconds. 

TSS, g/ml 

700 

580 

460 

time,s 340 

Fig. 2. Variation of mono- and disaccharides content 

with enzyme concentration 

and gelatinisation time 

Only in a very thin area, the two conditions proposed for the assessment of 

liquefaction 

can be attired: at time 340 seconds and enzyme concentration 1.0-1.1 

kg/t 

DS. 

4. 

Conclusions 

220 

100 

1,2 

1 

0,8 

0,6 

1. Quality of the liquefied products 

varies very much in the variation interval 

analysed for the two parameters. 

0,4 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

enzyme 

concentration, 

kg/tDS 

di and 

monosaccharide 

concentration,% 

8-9 

7-8 

6-7 

5-6 

4-5 

3-4 

2-3 

1-2 

0-1



2. The correlation of the two parameters is necessary for the obtaining of products 

with high quality. 

3. Because other factors influence the process 

in a considerable proportion, the 

working regime must be determined for each installation and enzyme type (if 

we take into 

account the known factors). 

References 

1. Baks T, Ngene IS, Van Soest JJG, Janssen AEM, Boom 

RM.: Comparison of 

methods to determine the degree of gelatinisation for both high and low starch 

concentrations. Carbohydr Polym, 2007a. 67:481-490. 

2. Baks T, Bruins ME, Janssen AEM, 

Boom RM.: The effect of pressure and 

temperature on the gelatinisation of starch at various starch concentrations. 

2007b. Submitted for publication. 

3. Bauer BA, Knorr D.: The impact of pressure, temperature and treatment time 

on starches: pressure-induced 

starch gelatinisation as pressure time 

temperature indicator for high hydrostatic pressure processing. J Food Eng 

2005. 68:329-334. 

4. Douzals 

JP, Coquille JC, Gervais P, Perrier-Cornet JM.: Pressure-temperature 

phase transition diagram for wheat starch. J Agric Food Chem. 2001. 49:873- 

876. 

5. De Cordt S, Hendrickx M, Maesmans G, Tobback P.: The influence of 

polyalcohols and carbohydrates on the thermostablity of α-amylase. Biotechnol 

Bioeng 1994.43:107-114. 

6. Fitter J, Herrmann R, Dencher NA, Blume A, Hauss T.: Activity 

and stability of 

a thermostable α-amylase compared to its mesophilic homologue: mechanisms 

of thermal adaptation. Biochemistry 2001. 40:10723 - 10731. 

7. Guzman-Maldonado H, Paredes-Lopez O.: Amylolytic enzymes and products 

derived from starch: a review. Crit Rev Food Sci 

Nutr 1995. 35:373 

8. Hayashi R, Hayashida A.: Increased amylase digestibility of pressure-treated 

starch. Agric Biol Chem 1989. 53:2543-2544. 

9. Knorr D, Heinz V,Buckow R.: High pressure application for food biopolymers. 

Biochim Biophys Acta, 2006. 1764:619-631. 

10. Mironescu V., Mironescu M., Trifan A., Mironescu 

I.D.: Extension of the 

decision support system “ENZYSSYS” at the obtaining of starch hydrolysis 

products used in confectionery, SIPA 2007, 341-344 

11. Raabe E, Knorr D.: Kinetics of starch hydrolysis with Bacillus 

amyloliquefaciens α-amylase under high hydrostatic pressure. Starch/Stärke. 

1996.48:409-414.



12. Reeve A: Starch hydoilysis products, VCH Publishers,Inc,New York, 1992 

13. Rollings J.I, Thompson RW.: Kinetics of enzymatic starch liquification 

Simulation of the high molecular 

weight product distribution,Biotechnol. 

Bioeng. ,Dec, 1984, 12, 1475-84 

14. Selmi B, Marion D, Perrier Cornet JM, Douzals JP, Gervais P.: 

Amyloglucosidase hydrolysis of high-pressure and thermally gelatinized corn 

and wheat starches. J Agric Food Chem. 2000. 48:2629-2633. 

15. Van der Maarel MJEC, Van der Veen B, Uitdehaag JCM, Leemhuis H, 

Dijkhuizen L.: Properties and applications of starch-converting 

enzymes of the 

α-amylase family. J Biotechnol. 2002. 94:137-155. 

16. Weemaes C, De Cordt S, Goossens K, Ludikhuyze L, Hendrickx M, Heremans 

K, Tobback P.: High pressure, thermal, and combined pressure-temperature 

stabilities of α-amylases from Bacillus species. Biotechnol Bioeng. 1996.



INVESTIGATION OF THE ADHESION CAPABILITIES 

OF AEROMONAS HYDROPHILA TO DIFFERENT 

POLYSILOXANE CARRIERS 

D. KREGIEL ∗ , A. RYGALA ∗ , W. AMBROZIAK ∗ , U. 

MIZERSKA ∗∗ , 

W. FORTUNIAK ∗∗ , J. CHOJNOWSKI ∗∗ 

Abstract: The paper presents the results of experiments carried out on different 

engineered polysiloxane surfaces. Aeromonas hydrophila rods belonging to 

opportunistic pathogens were used as the model microorganism. The engineered 

polysiloxane polymers showed strong antiadhesive properties. 

Introduction 

Keywords: biofilm, adhesion, Aeromoas hydrophila, polysiloxane 

surfaces. 

Bacterial adhesion on surfaces is a very important undesirable phenomenon, 

since it is a determinant for the overall biofilm formation. Biofilms consist not only 

microbial cells, but also their extracellular polymeric substances and adsorbed 

organics. The presence of biofilms can be both beneficial or detrimental. The 

examples of biofilms can be found in microbial corrosion, hospital infections, 

biofouling in food processing equipment, cosmetic and pharmaceutic industry. 

Aeromonas is a genus of bacteria that is present in all types of water worldwide 

as well as food and soil. Aeromonads are known to occur widely in fresh water, 

and they have been recovered from both unchlorinated and chlorinated water 

supplies [Massa et al., 2001]. In clean rivers, lakes, and storage reservoirs, 

concentrations of Aeromonas sp. have been found to typically be around 1×10 2 

CFU/mL. Groundwaters generally contain less, with fewer than 1 CFU/mL. As 

aeromonads can occur in large numbers in some water sources, particularly in 

lowland rivers and reservoirs, there is potential for them to enter distribution 

systems if water treatment is ineffective [Holmes et al., 1996]. Studies using a 

∗ 

Technical University of Lodz, Institute of Fermentation Technology and Microbiology; email: 

dkregiel@p.lodz.pl 

∗∗ 

Centre of Molecular and Macromolecular Studies in Lodz, Polish Academy of Sciences



drinking-water isolates of Aeromonas sp. demonstrated its ability to utilize a 

variety of organic compounds at low concentrations (10 mg/L) [van der Kooij, 

Hijnen, 1988; van der Kooij, 1991]. These results demonstrate that aeromonads are 

capable of growth in the presence of the low concentrations of nutrients that would 

be available from biofilms and sediments within different water distribution 

systems. [Payment et al., 1988; U.S. Chauret et al., 2001]. 

The genus Aeromonas includes at least 13 genospecies, among which are the 

mesophilic A. hydrophila, A. caviae, A. sobria, A. veronii, and A. schubertii, and 

the non-motile, psychrophilic A. salmonicida. The motile species A. hydrophila, A. 

caviae and A. sobria have been linked to two major groups of human diseases; 

septicemia and gastroenteridis [Merino et al., 1995; Massa et al., 2001]. The 

gastroenteritis caused by Aeromonas, is most frequently observed in young 

children under 5 years of age and older adults over 60 years of age. Additionally 

people with compromised immune systems and individuals suffering from 

leukemia, carcinoma, diabetes, hepatitis, and cirrhosis or those being treated with 

immunosuppressive drugs or who are undergoing cancer chemotherapy may be 

susceptible to infections caused by Aeromonas sp. Drinking water has been 

identified as a significant risk factor for Aeromonas sp. diseases, although the 

mechanism of enteropathogenicity is not fully understood. These bacteria can 

produce enterotoxins, hemolysins, cytotoxins, potentially acting as virulence 

factors [Kregiel, Rygala, 2007]. 

This work starts from a series of experiments carried out on different 

engineered 

surfaces with special antyadherent properties, limiting formation of biofilms. 

The examples of this kind of surface can be polysiloxanes contained long 

hydrocarbon chain with quaternary ammonium salts groups (QAS). 

The aim of this study was verification of adherence abilities of gramnegative 

bacteria Aeromonas hydrophila, frequently isolated from 

water distribution systems, to different polysiloxane carriers. 


Two types of polymers were synthesized: polysiloxane A with pendant 3chloropropyl 

groups and B with 3(N,N-dimethyl-N-octyl)propyl groups. 

Commercial polydimethylsiloxane (PDMS) with –OH endgroups 

(Mn=33 000, Mw/Mn= 2,8) were mixed with polymer A and B and 

crosslinked on the glass plate with 100 μm thickness of layer [Fortuniak i 

in., 2001].



Aeromonas hydrophila strain isolated from water distribution system was used 

as biological material [Kregiel, Rygala, 2007]. 

The strains were cultured in 100 ml of 1000-times diluted buffered peptone 

water (Merck) at 22°C for 24 h without shaking. The samples of polymers with 

average from 1600 to 1650 mm 2 were soaked in fresh sterile medium during 2 

hours and than were incubated with bacterial suspensions (10 3 cells per mL) during 

10 days at 22 o C. After exposure to the bacterial suspension, the polysiloxane pieces 

were gently rinsed in sterile Ringer solution. Three pieces from each series were 

studied luminometrically (Hy-Lite2, Merck) by measuring ATP of adhered 

bacterial cells expressed in relative light units (RLU).The another samples from 

each series were dried in air at room temperature and stained with fuchsin for 5 

min. The adhering bacterial cells were observed under Olympus BX41 microscope 

equipped with an image analysis system. Additionally the microscopic studies with 

Olympus BX41 microscope were also employed. 

Results 

Figure 1 shows the results of microscopic observations of bacterial adhesion 

tested on different polymer surfaces. The main results are here summarized: the 

microcolonies of Aeromonas hydrophila were visible on PDMS surface, but no 

one was observed on modified polysiloxane A and B carriers, therefore the 

polysiloxane polymers A and B showed strong antiadhesive properties. 

1 

2 3 

Fig. 1. Adhesion of Aeromonas hydrophila cells on different polysiloxane surfaces 

after 10 days incubaction; 1- PDMS, 2-PDMS with polymer A; 3-PDMS with 

polymer B 

The results of microscopic observations were confirmed by luminometric method 

(Figure 2). The RLU level indicating adhesion of bacterial cells on A and B 

polymers was 30-times lower than RLU of commercial polydimethylsiloxane 

(PDMS).



Presented results of preliminary studies on the effects of chemical modifications 

of surfaces and bacterial adhesion are very promising and will be continued under 

the grant from Ministry of Science and High Education. 

1600 

1400 

1200 

1000 

800 

600 

400 

200 

0 

PDMS PDMS with PDMS with 

polymer A polymer B 

RLU 

Fig. 2. Adhesion of Aeromonas hydrophila cells (bioluminescence in RLU units) 

after 10 days incubaction; RLU – relative light unit 

References 

1. Chauret C., C. Volk, R. Creason, J. Jarosh, J. Robinson and C. Warnes. 2001. 

Detection of Aeromonas hydrophila in a drinking-water distribution system: a 

field and pilot study. Can. J. Microbiol. 47: 782-786. 

2. Fortuniak W., Chojnowski J., Sauvet G. Controlled synthesis of siloxane 

polymers and siloxane-siloxane block copolymers with 3-chloropropyl groups 

pendant to the siloxane chain. Macromol. Chem. Phys. 2001, 202, 2306-2313. 

3. Holmes P., L.M. Niccolls and D.P. Sartory. 1996. The ecology of mesophilic 

Aeromonas in the aquatic environment. pp. 127-150. In: Austin B., M. 

Altwegg, P. Gosling, and S. Joseph (eds). The genus Aeromonas. John Wiley 

and Sons, London. 

4. Kregiel D., Rygala A. Adhesion of Aeromonas sp. strains isolated from water 

distribution system. Central European Symposium on Industrial Microbiology



and Microbial Ecology “Power of Microbes in Industry and Environment” 

Zadar, Croatia, 19-22 September 2007, P58. 

5. Massa S., C. Altieri and A. D′Angela. 2001. The occurrence of Aeromonas 

spp. in natural mineral water and well water. Int. J. Food Microbiol. 63: 169- 

173. 

6. Merino S., X. Rubires, S. Knochel and J.M. Tomas. 1995. Emerging 

pathogens: Aeromonas spp. Int. J. Food Microbiol. 28: 157-168. 

7. Payment P., F. Gamache and G. Paquette. 1988. Microbiological and 

virological analysis of water from two water filtration plants and their 

distribution systems. Can. J. Microbiol. 34: 1304-1309. 

8. van der Kooij D. 1991.Nutritional requirements of aeromonads and their 

multiplication in drinking water. Experientia. 47: 444–446. 

9. van der Kooij D. and W.A. Hijnen. 1988. Nutritional versatility and growth 

kinetics of an Aeromonas hydrophila strain isolated from drinking water. Appl. 

Environ. Microbiol. 54: 2842–2851.



METABOLITES WITH BIOTECHNOLOGICAL 

POTENTIAL SYNTHESIZED BY PSEUDOMONAS 

BACTERIAL STRAINS 

A. VOICU * , M. M. LĂZĂROAIE, M. ŞTEFĂNESCU 

Abstract: The performed researches aimed at investigating the capacity of some 

bacterial strains isolated from natural environments contaminated with oil 

residues, characterized and assigned to the Pseudomonas genus, to synthesize 

secondary metabolites belonging to the tensioactive compounds and 

exopolysaccharides, used for remediation of oil or metallic ions polluted 

environments. The microbial tensioactive compounds enhance the bioaccessibility 

of oil hydrophobic pollutants by multiple mechanisms. Some exopolysaccharides 

contain in their structure functional groups which play an important role in 

binding and stabilizing metallic cations. 

Introduction 

Keywords: bioremediation, bacterial emulsifying agents, oil 

products biodegradation, bacterial exopolysaccharides. 

Microorganisms possess complex genetic mechanisms which allow a relative fast 

adaptation to various environmental conditions, including the use of different 

categories of polluting hydrocarbons as carbon and energy sources (1, 18). From 

this reason, among the environmental rehabilitating technologies, one alternative is 

represented by the biologic ones, based on the use of either microorganisms or their 

metabolites for degrading various categories of polluting chemical contaminants. 

Bioremediation is a complex process based on the bacterial transformation or 

degradation of the contaminants from the environment into non-toxic compounds, 

lowering thus the pollution degree, without affecting the safety of the 

circumambience (4, 11, 19). 

Biodegradation of oil and its derivates is a process whose evolution depends on 

the nature and the relative proportion of the different oil contaminants, the structure 

of microorganisms communities, characteristics of the natural environments, as 

* 

Center of Microbiology, Institute of Biology, Romanian Academy, Spl. Independentei 296 

Bucharest, Romania, 

e-mail:anca.voicu@ibiol.ro



well as on several environmental factors which influence their activity. Generally, 

bacteria used for bioremediation are selected based on some physiological and 

biochemical characteristics, an important part being held by synthesis of some 

surface active compounds that favor degradation of polluting hydrocarbons (6, 9, 

20, 21). 

Microbial emulsifying agents belong to two main groups: low molecular weight 

(glycolipids, fatty acids, phospholipids, lipopeptids) and polymeric emulsifiers, 

which contain polysaccharides. These tensioactive substances play an important 

role in different processes that take place at interface level and involve 

emulsification, wetting, detergence, dispersion and solubilization. 

Many bacteria secrete on their surface slimy or gummy materials as secondary 

metabolites. The bacterial exopolysaccharides express differently depending on 

species, medium conditions and precursors. The biotechnological value of 

microbial polysaccharides resides in their rheological properties, in their capacity 

for altering the rheological properties of aqueous solutions, by the alteration of 

their flow characteristics (16). The structures of exopolysaccharides may be either 

homopolymers or complex heteropolymers. Some of them may be complex with 

various functional groups attached to the saccharides, which can play an important 

role in binding and stabilizing heavy metals from contaminated waters and wastes 

(5, 7, 8). 

These two categories of bacterial metabolites offer several advantages over 

chemical compounds such as: various structures, low toxicity, good 

biodegradability and ecological acceptability. Their synthesis and properties might 

be enhanced by applying metabolic engineering techniques (10, 15). 

The performed researches aimed at investigating the capacity of some bacterial 

strains isolated from natural environments, characterized and assigned to the 

Pseudomonas genus, to synthesize secondary metabolites belonging to the 

tensioactive compounds and exopolysaccharides, used for remediation of oil or 

metallic ions polluted environments. 


The bacterial strains under study, isolated from various terrestrial and aquatic 

natural environments polluted with oil residues, were characterized 

microbiologically (cellular and colonial morphology, mobility, spore formation, 

Gram staining, growth on species specific media, respiratory type, production of 

diffusible pigments), biochemically and physiologically (metabolisation of 

glucides, proteins and lipids, synthesis of several catabolic enzymes, such as 

oxydase, catalaze, celulazes, amylases, proteazes, lipases, estherases, urease, 

dezaminases). Based on these complementary techniques, all 9 bacterial strains



were assigned to the Pseudomonas genus, out of which 6 were identified down to 

the species level: Pseudomonas aeruginosa (4 strains) and Pseudomonas 

fluorescens (2 strains). 

Testing the capacity of synthesizing tensioactive compounds: the selected 

strains were aerobically cultivated for 90 hours, at 28° C, on MSM medium 

containing 3.0% succhrose as carbon source. The quantitative determination of the 

synthesis output was assessed dynamically within the 24-90 hours interval of 

cultivation. Following the centrifugation of the cultivation liquid (20 minutes at 

15.000 rpm), the surfactant was extracted from the supernatant with carbon 

tetrachloride at a 1:1 ratio in the first step and 1:0.75 ratio in the second step. The 

obtained tensioactive compounds were characterized as for the following aspects: 

kerosene emulsifying percent (%), kerosene emulsifying intensity (emulsifying 

units/ml), dry substance content (g%), total glucides content (g%), and ionic 

character. The ionic character of solid biosurfactant and exopolysaccaride 

preparations was assessed by a colorimetric test using methyl orange and sodium 

methavanadanate in the presence of citric acid and benzidine. 

Testing the capacity of degrading several oil products: oil products (Euro 

Premium gasoline, Super Euro Diesel fuel, S1 black fuel, various fractions from oil 

cracking and crude oils from different classes) were used at a 5% (v/v) 

concentration, as sole carbon source in mineral MM medium (3) supplemented 

with 0.05% FeSO4, the biodegradation process being experimented under aerobic 

conditions, during a 10 days period, at 28° C. Determination of the total 

hydrocarbons content, initially and finally, was performed by extraction with 

methylene chloride, the results being reported as compared to non-inoculated 

controls. 

Testing the capacity of synthesizing exopolysaccarides: was done in dynamics 

over the 90 hours cultivation period, under aerobic conditions (stirring at 200 rpm), 

at 28° C, using 3 biosynthesis media (M1, M2, M3), various nitrogen sources 

(organic or mineral), but the same carbon source – 3.0% glucose. After 

centrifugation of the cultivation liquid (20 minutes at 15.000 rpm), the 

exopolysaccarides were extracted from the supernatant with isopropanol, purified 

by re-dissolution and re-precipitation with solvent. In solid products, the ionic 

character was assessed. 

Testing the role of exopolysaccarides in reducing the metallic ions 

concentration from an industrial effluent: was performed in Erlenmeyer flasks 

under continuous stirring (150 rpm), at 28° C, following a 10 hours contact. The 

concentration of metallic ions was determined by means of specific Merck kits.




Bacteria are the most important microorganisms involved in the natural 

degradation of hydrocarbons. Some of the most appropriate sources for their 

isolation are the oil residues polluted soils and/or waters, such as: oil polluted 

sediments (P. aeruginosa ST14), paraffin deposits (P. fluorescens DP1), oil sludges 

(P. aeruginosa SlP10), aquifer (P. aeruginosa AcP8), brine from oil fields (P. 

aeruginosa AS8), sea water (P. fluorescens AM1). 

The results concerning the biosynthesis of some bacterial surfactants analyzed in 

dynamics are presented in fig. 1. The bacterial tensioactive compounds were 

synthesized with maximum output (1.781-3.340 g% active substance) after 

cultivation for 72 hours, exhibiting cationic or anionic characters (table 1). 

The emulsifying properties of the bacterial tensioactive agents are shown in table 

1. As it can be seen, the percent of kerosene emulsifying varied between 75.0- 

100%, with an intensity of 1.244-3.244 units of emulsifying activity per milliliter 

(U/ml). One emulsifying unit is equal to the absorbency of the emulsion at 660nm 

under the testing conditions, against a control sample tested under the same 

conditions, but without the hydrocarbon component (12). With an increased 

content of total glucides (53.0-68.0 g%) in their structure, the tensioactive 

compounds can be included in the polymeric tensioactive category (table 1). 

Biosurfactants gain an increasing interest as substitutes of synthetical surfactants in 

many applications, including remediation of oil contaminated sites. 

The isolated bacterial strains showed (table 2) a good degradation capacity under 

aerobic conditions for a large variety of frequently used oil products which, 

accidentally or chronically are spilled into the environment (22-94%). Addition of 

iron (0.05% FeSO4) in the used mineral media stimulated the growth of 

hydrocarbon-oxidizing bacteria, iron being a component of oxygenases which 

catalyse the metabolisation of hydrocarbons present as sole carbon and energy 

source. 

The oil is extracted together with brine water, rich in salts, NaCl being prevalent. 

The mixed pollution phenomenon, with oil and salty water is extremely serious, the 

phenomenon being reported in Romania on 64.3% of the drillings polluted areas 

(17). In areas with mixed pollution the situation becomes more serious due to 

inhibition of the biodegrading activity of soil indigenous microorganisms, 

increasing the time necessary to bioremediate the soil (13, 14). 

The results obtained with the tested bacterial strains cultivated in the presence of 

waxy-paraffinic crude oil as sole carbon source, under saline stress conditions 

(0.85-2.55M NaCl) are presented in table 3. Supplementation of the mineral 

medium with 0.85M NaCl induced a stimulation of the aerobic oil biodegradation, 

the output ranging between 84-92%. Under more increased salinity conditions



(2.25M NaCl), 4 halotolerant bacterial strains were selected, capable of degrading 

crude oil at a rate of 54-83%. 

Three bacterial strains belonging to Pseudomonas genus isolated from oil 

polluted soil samples, proved a satisfactory capacity to synthesize anionic 

exopolysaccharides, reaching a peak after 90 hours of cultivation (3.08-3.34 g% 

dried product). The results of biosynthesis analyzed in dynamics are presented in 

fig. 2, 3 and 4. 

Exo po ly sacch aride ca nt it y (g 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

0 

M 1 

M 2 

M 3 

24 48 72 90 

Cultivation hours 

Fig. 3 The dynamics of 

exopolysaccharide biosynthesis 

by Pseudomonas sp. Ps2 

Exop olisaccha rid e ca ntity (g% 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

0 

M 1 

M 2 

M 3 

24 48 72 90 




by Pseudomonas sp. Ps6 

% of metallic ions and 

SO4 removal 

0 10 20 30 40 50 

Fe 

total 

Cu 

Fig. 5 The efficacy of 

Peudomonas exopolysaccharide 

in removal of some metallic ions 

from an industrial effluent 

Among these three bacterial strains, two isolates exhibited the same growing 

capacity, with strong mucoid aspect of colonies on medium with 3.0% dextrose, 

rhamnose and glycerol as carbon sources (table 4). 

The efficacy of bacterial exopolysaccharides in lowering the concentration of 

a 

) 

Biosurfa ctant cant it y (g% 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

0 

SŢ14 

AcP8 

AS8 

24 48 72 90 


Fig. 1 The dynamics of biosynthesis of surfactants by some 

Pseudomonas strains: ST4, AcP8, AS8 (a);SlP10, DP1, AM1 (b) 

b 

Bios urf acta nt ca nt it y (g % 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

0 

ŞlP 1 0 

DP 1 

AM 1 

24 48 72 90 


Exopolysaccharide cantity (g% 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

0 

Zn 

Al 

SO 4 

M 1 

M 2 

M 3 

24 48 72 90 

C ultivation hours 



by Pseudomonas sp. Ps1



some metallic ions (Fe, Cu, Zn, Al) and SO4 2- from an industrial effluent varied 

between 26.5-46.0% (fig.5). In our laboratory tests, mining waste water collected 

from Roşia Poieni copper mining area, (2) with acid pH (pH=2.5) and high content 

in metallic ions and SO4 2- (6 705 ppm total Fe, 941.2 ppm Cu, 288.4 ppm Zn, 2 

619.8 ppm Al, 40 000 ppm SO4 2- ) was used. 

Table 1 

Indicatives 

of 

bacterial 

strains 

emulsifying 

kerosene 

percent 

(%) 

emulsifying 

kerosene 

intensity 

(U/ml) 

dried 

active 

substance 

content 

(g%) 

total 

glucides 

content 

(g%) 

ionic 

character 

SŢ14 75.0 1.307 3.340 53.0 cationic 

AcP8 100.0 3.244 1.781 61.7 cationic 

AS8 85.0 1.878 2.177 59.5 cationic 

ŞlP10 75.0 2.301 1.840 62.0 cationic 

DP1 100.0 1.244 3.240 68.0 anionic 

AM1 100.0 2.608 1.983 65.0 anionic 

Table 2 

Capacity of oil products degradation (%): 

Indicatives 

of bacterial 

euro 

strains 

premium 

gasoline 

super 

euro 

diesel 

fuel 

distillation fractions 

crude oils: 

from: 

fuel waxy 

oil S1 paraffinic 

oil (250- 

300 0 paraffinnaphthenearomatic 

oil 

C) 

(400-450 0 paraffin- 

waxy 

light naphthene 

paraffinic 

aromatic 

C) 

SŢ14 93 91 73 94 89 85 89 78 

AcP8 65 82 22 86 78 69 82 68 

AS8 91 89 66 91 88 84 88 79 

ŞlP10 82 86 71 91 78 83 90 69 

DP1 92 91 72 93 90 80 91 78 

AM1 76 85 58 86 75 78 88 65



Indicatives 

of 

bacterial 

Table 3 

% of oil biodegradation in mineral medium with waxy-paraffinic 

oil as sole carbon source (5%), supplemented with NaCl in 

concentrations of: 

strains 0.85M 1.70M 2.55M 

SŢ14 91 88 83 

AcP8 84 80 74 

AS8 85 76 44 

ŞlP10 92 88 73 

DP1 84 72 43 

AM1 90 79 54 

Bacterial strains 

Pseudomonas sp. 

Ps1 


Ps2 


Ps6 

Conclusions 

Table 4 

Intensity of mucoid aspect of colonies grown on media 

with: 

Dextrose Rhamnose Glycerole 

++++ +- +++ 

+++ +++ ++++ 

+++ +++ ++++ 

The bioaccesability of hydrophobic oil products is enhanced due to some 

secondary metabolic products synthesized by the bacterial strains under study, 

tensioactive products exhibiting either cationic or anionic character. Their 

increased content in total glucides could be indicative for their assignment to the 

lipopolysaccharides as concerns the chemical composition. The optimum 

biosynthesis interval is 72 hours of cultivation. 

The bacterial strains belonging to the Pseudomonas genus isolated from 

polluted natural environments have shown to be adapted to the aerobic utilization 

of various oil products as sole carbon and energy sources, products of wide use, 

which, accidentally or chronically, are spilled into the environment. Refined 

products, such as Euro Premium gasoline, Super Euro Diesel fuel and fractions 

resulted from crude oil cracking are more accessible to biodegradation, 

comparatively with black fuel and crude oils from various classes, with a very 

complex composition.



The halotolerant bacterial strains capable of degrading crude oil under 

saline stress conditions (1.70 or even 2.55 M NaCl), proved to be those isolated 

from natural environments possessing a certain degree of salinity, such as: aquifer, 

oil drillings co-produced water, sea water, oil and salty water polluted soils. These 

halotolerant hydrocarbon-oxidizing strains could be useful in bioremediation of 

mixed pollution presented in many drilling fields. 

The exopolysaccharides synthesized by 3 bacterial strains isolated from oil 

contaminated soils assigned to the Pseudomonas genus were produced at a 

maximum output after 90 hours of cultivation. Among the used biosynthesis media, 

the most suitable variant was the one containing 2.0% corn extract as nitrogen 

source and 3.0% glucose as carbon source (M3). The obtained exopolysaccharides 

exhibit an anionic character, and the intensely mucous aspect of the bacterial 

colonies grown on the medium with glucose or rhamnose could indicate their 

assignment to the heteropolymers category, possibly with the 2 sugars in their 

structure. 

Besides their use as jellifying and stabilizing agents, anionic 

exopolysaccharides can adsorb metallic cations from an industrial effluent due to 

electrostatic attraction and the functional groups present in their structure. 

References 

1. Abed, R.M.M., Safi, N.M.D., Koster, J., de Beer, D., El-Nahhal, Y., Rullkotter, 

J., Garcia-Pichel, F.: Microbial diversity of a heavily polluted microbial mat 

and its communing changes following degradation of petroleum compounds. 

In: Appl. Environ. Microbiol, 68, 2002. 

2. Dumitrescu, I.: Pollution with heavy metals and their effects on the 

environmental factors, Case Study–Roşia Poieni Quarry. Part I, Buletin 

Resurse Minerale, vol. 3, No. 1, 2007, p. 51-56. 

3. Foght, J.M., Westlake, D.W.S.: Degradation of polycyclic aromatic 

hydrocarbons and aromatic heterocycles by a Pseudomonas species.In: Canad. 

J. Microbiol., 34, 1988, p. 1135-1141. 

4. Genske, D.D.: Investigation, remediation and protection of land resources. 

Whites Publishing, CRC Press, Taylor & Francis Group UK, Atheaeum Press 

Ltd, Gateshead, Ireland, ISBN: 978-1870325-87-5, 2007, p. 292. 

5. Hussein, H., Ibrahim, S.F., Kandeel, K., Moawad, H.: Biosorption of heavy 

metals from waste water Pseudomonas sp.. In: Environmental Biotechnology, 

vol. 7, No. 1, 2004, p. 13-22.



6. Jacobucci, D.F.C., Vasconcelos, C.K., Matsuura, A.B., Falconi, F.A., Durrant 

L.R.: Degradation of diesel oil by biosurfactant-producing bacterial strains. 

AEHS Contaminated Soil Sediment and Water, August, 2001, p. 31-34. 

7. Jang, L.K., Geesey, G.G.: Modifications of metal binding properties of 

biopolymers. In: Biohydrometallurgical Technologies, vol. II – “Fosil Energy 

Materials, Bioremediation, Microbial Physiology”, Eds. A.E. Torma, M.L. 

Apel, C.J. Brierley, The Minerals, Metals and Material Society, 1993, p. 75- 

84. 

8. Kim, D., Petrişor, I.G., Yen, T.F.: Evaluation of biopolymer – modified 

concrete systems for disposal of cathode ray tube glass. J. Of the Air & Waste 

Management Association, 55, 2005, p. 961-969. 

9. Kokub, D., Shafeeq, M., Khalid, Z.M., Malik, K.A.: Isolation, screening and 

characterization of biosurfactant producing bacteria. In: Biotechnology for 

Energy, Faisalabad, Pakistan, 1991, p. 221-232. 

10. Lee, S.Y.: Systems metabolic engineering strategies and applications. In: 

Abstract Book of XII International Congress of Bacteriology and Applied 

Microbiology, 5-9 August 2008, Istambul, BPL-13, 2008, p.11. 

11. Luptakova, A.: Bioremediation and environment. In: Proocedings of the 

10 th Conf. on Environment and Mineral Processing, Part II, 22.06.2006, VSB- 

TU OSTRAVA, Czech Republic, 2006, p. 29-32. 

12. Navon-Venezia, S., Zosim, Z., Gottlieb, A., Legmann R., Carmeli, S., Ron, 

E.Z., Rosenberg, E.: Alasan, a new bioemulsifier from Acinetobacter 

radiresistens. In: Appl. Environ. Microbiol., 61, 9, 1995, p. 3240-3244. 

13. Plotnikova, E.G., Altyntseva, O.V., Kosheleva I.A., Puntus, I.F., Filonov, A.E., 

Gavrish, E.I., Demakov, V.A., Boronin, A.M.: Bacteria-degraders of 

polycyclic aromatic hydrocarbons, isolated from soil and bottom sediments in 

salt-mining area. Mikrobiologiia, 2001, 70, p. 61-90. 

14. Sabirova, I., Zaripova, S., Naumova, R.: The use of halotolerant 

microorganisms for remediation of crude oil polluted sites in Russia. In: 

Summeries Book of Fifth Int. Symp. And Exhibition on Environmental 

Contamination in Central and Eastern Europe, Prague, Abstract 283, 2000, 

p.139. 

15. Sayler, G.S., Ripp, S.: Field applications of genetically engineered 

microorganisms for bioremediation processes. In: Curr. Opinion Biotechnol., 

11, 2000, p. 286-289. 

16. Sutherland, I.W.: Novel and established applications of microbial 

polysaccharides. Trends Biotechnol., 16 (1), 1998, p. 41-46. 

17. Toti, M., Dumitru, M., Căpitanu, V., Dracea, M., Constantin, C., Crăciun, C.: 

Poluarea cu petrol şi apa sărată a solurilor din România. In: Ed. Inst. de 

Cercetări pentru Pedologie şi Agronomie, 1999, p. 227.



18. Vetrova, A., Ovchinnikova, A.: Influence of catabolic plasmids on the 

efficiency of crude oil hydrocarbons biodegradation by Gram-negative 

bacteria. In: Abstract Book of XII International Congress of Bacteriology and 

Applied Microbiology, 5-9 August 2008, Istambul, BP-122, 2008, p.100. 

19. Voicu, A., Dobrotă, S., Ştefănescu, M., Lăzăroaie, M.M., Lazăr, I., Petrişor, 

I.G.: Stimulation of environmental polluting oil residues degradation by 

microbial associations. In: Contaminated Soils, Vol. 8, Chapter 25, eds. 

Calabrese E.J., Kostecki P.T., Dragun J., Amherst Scientific Publisher, 

Amherst, Massachusetts, ISBN:1-884940-30-7, 2003, p. 335-342. 

20. Voicu, A., Lăzăroaie, M.M.: Microbiological characterization of some 

bacterial strains isolated from hydrocarbon polluted natural environments. In: 

Prooceedings of the Institute of Biology, vol. V, Ed. of Romanian Academy, 

2003, p. 405-416. 

21. Yilmaz, E.S., Sidal, U.: Rhamnolipid production from Pseudomonas sp.. In: 

Abstract Book of XII International Congress of Bacteriology and Applied 

Microbiology, 5-9 August 2008, Istambul, BP-62, 2008, p.74.



MODELLING STARCH STRUCTURE FOR THE 

SIMULATION OF THE ENZYMATIC HYDROLYSIS 

I.D. MIRONESCU, V. MIRONESCU 

Abstract: The article presents a model of starch structure suitable for the 

simulation of the enzymatic hydrolysis trough concurrent processes that writes and 

reads from a relational database. The modelling was achieved trough the 

representation of the molecular chains interlinking as a relation in a relational 

database. A procedure for the generation of random starch molecules of different 

origins was implemented. The structure of the random generated starch samples in 

the database, the graphical representation constructed from this structure and 

results of test hydrolysis simulation are presented. 


Keywords: starch structure model, hydrolysis, enzymatic reaction 

simulation. 

The classical modeling of the enzymatic hydrolysis processes using 

kinetic equation is limited to reaction with few possible products. In the case 

of hydrolysis of macromolecular products with branched structure like 

starch the high number of possible products makes the use of this approach 

impossible. The only feasible method is a Monte Carlo simulation of the 

hydrolysis process [1]. Because of the high amount of data implied by such 

type of simulation we propose the use of a Data Base Management System 

(DBMS) for the storage and manipulation of the models of the starch 

molecule and of the hydrolysis products. 

1 Department of Food Engineering, Faculty of Agricultural Science, Food Industry and Environmental 

Protection,“Lucian Blaga” University of Sibiu, Romania, e-mail: imirod@yahoo.co.uk 

2 Department of Food Biotechnology, Faculty of Agricultural Science, Food Industry and 

Environmental Protection,“Lucian Blaga” University of Sibiu, Romania, e-mail: 

vionela.mironescu@ulbsibiu.ro

Proceeding of the International Symposium BIOTECHNOLOGY 2008, 

USAMV 


Model architecture and implementation 

The generally accepted cluster model [2] for the structure of amylopectin was 

transposed in a relational database scheme. The linear chains of (1-4) linked D 

glucose residues are considered as atomic values stored in the database. The (1-6) 

glucosidic links between these linear chains are represented as tuples in a 

relation. This makes possible the expression of inspection and modification of the 

structure trough relational operators. 

An open source DBMS PostgreSQL was used for the implementation of the 

structure model. The choice of the database was determined by two of its feature 

[3]: 

- PostgreSQL has a handler for the Scheme language that allows the writing of 

stored procedures in this programming language. This facilitates the 

implementation of the procedures responsible for the building of the random starch 

molecules. 

- PostgreSQL has an event system that supports the interprocess communication. 

This is useful for the implementation of the enzymes as concurrent processes 

working on the same database. 

A table corresponding to the interlinking relation is created for each starch 

molecule participating to the simulation. Each row of the table contains the 

information related to a linear chain. To facilitate the processing, the structure of 

the chains is stored as a Scheme list of pairs. Each pair contains a string and a 

number to represent one or more dextrose residues. Details of the representation 

can be followed on basis of an example in Table 1. 

For each chain a unique ID, the DP, and the ID of the “parent” chain is also 

stored. 

The structure for a amylopectin molecule is generated by a stored Scheme 

procedure that uses the production rules of an L-systems grammar. 

In each derivation step this procedure selects randomly the production rule to 

apply. By interrogating the structure constructed so far the procedure tests if the 

rule can be applied without violating the imposed structural constraints (maximal 

DP, chain maximal DP, chain length distribution, cluster size and distribution).If 

the rule pass the test it is applied and the result added to the structure This assure 

the automatic generation of an random structure that is in accordance with the data 

from literature. 

A procedure was implemented for the simulation of the hydrolysis process. This 

procedure selects randomly a chain from the table, tests its suitability for the 

hydrolysis. If the hydrolysis is possible the procedures determines the point of 

chain breakage and updates the database according to the results of hydrolysis. The 

procedure is applied repeatedly until it finds no more suitable hydrolysis points.


USAMV 


By creating multiple processes that interact with the database and use this 

procedure the simulation of the hydrolysis process was parallelized reducing so the 

computing time. The implicit and explicit row locks assure that only one process 

(corresponding to one enzyme molecule) access a certain linear chain at a time. 

A query on the database at the end of this process gives the DP distribution of the 

final product. 

The final results where the average of 20 simulation (random amylopectin 

generation and hydrolysis). 

Results 

Table 1 

id_c dp_c id_m chain 

id_p 

7 18 2 (("R") ("G" 6) ("BL" 136) ("G" 3) ("BR" 149) ("G" 6)) 

(("B" 8) ("G" 6) ("BL" 137) ("G" 17) ("BL" 139) ("G" 17) 

0 

136 73 2 ("BL" 141) ("G" 29)) 7 

137 23 2 (("B" 8) ("G" 2) ("BL" 138) ("G" 19)) 136 

138 10 2 (("B" 4)("G" 9)) 137 

139 23 2 (("B" 26) ("G" 2) ("BL" 140) ("G" 19)) 136 

140 9 2 (("B" 4)("G" 8)) 139 

141 23 2 (("B" 44) ("G" 2) ("BL" 142) ("G" 19)) 136 

142 21 2 (("B" 4) ("G" 2) ("BL" 143) ("G" 3) ("BR" 148) ("G" 13)) 141 

143 19 2 (("B" 4) ("G" 2) ("BL" 144) ("G" 3) ("BR" 145) ("G" 11)) 142 

144 13 2 (("B" 4)("G" 12)) 143 

145 16 2 (("B" 8) ("G" 2) ("BR" 146) ("G" 12)) 143 

146 20 2 (("B" 4) ("G" 2) ("BR" 147) ("G" 16)) 145 

147 14 2 (("B" 4)("G" 13)) 146 

148 10 2 (("B" 8)("G" 9)) 

(("B" 12) ("G" 6) ("BR" 150) ("G" 17) ("BR" 153) ("G" 17) 

("BR" 157) ("G" 3) ("BL" 165) ("G" 17) ("BR" 171) ("G" 3) 

142 

149 85 2 ("BL" 175) ("G" 15)) 7 

Table 1 presents a fragment of a database table that stores the representation of a 

randomly generated amylopectin molecule. A string representation was generated 

by traversing the tree like structure trough queries on the table and is depicted in 

Figure 1. This representation is enough for a general appreciation of the generated 

structure. For a detailed inspection a graphical representation encoded in SVG was 

produced with the help of the stored Scheme procedures. A fragment is reproduced


USAMV 


in Figure 2. Both representations show that the generated structure is in accordance 

with the visual representation given by several authors [4][5]. 

The performed simulations have shoved the multiple benefits that come from the 

use of the DBMS: 

the elimination of the common memory limitation imposed to an conventional 

computer program so that multiple very large molecules can be represented 

simultaneous 

(("B" 4)("G" 6)) 

| 

(("B" 8) ("G" 2) ("BR" 151) ("G" 3) ("BL" 152) ("G" 9)) 

| | 

| (("B" 8)("G" 10)) (("B" 8)("G" 6)) (("B" 26)("G" 13)) 

| | | 

| (("B" 26) ("G" 6) ("BR" 154) ("G" 17) ("BR" 155) ("G" 3) ("BL" 156) ("G" 5)) 

| | | 

| | (("B" 30)("G" 8)) 

| | 

(("B" 12) ("G" 6) ("BR" 150) ("G"---------------------------------17) ("BR" 153) ("G" -----------------------------------------------------------------------17) 

| 

(("R") ("G" 6) ("BL" 136) ("G" 3) ("BR" 149) ("G" 6)) 

| 

(("B" 8) ("G" 6) ("BL" 137) ("G"--------------------17) ("BL" 139) ("G"-----------------------17) ("BL" 141) ("G" 29)) 

| | | 

(("B" 8) ("G" 2) ("BL" 138) ("G" 19)) (("B" 26) ("G" 2) ("BL" 140) ("G" 19)) (("B" 44) ("G" 2) ("BL" 142) ("G" 19)) (("B" 8)("G" 9)) 

| | | | 

(("B" 4)("G" 9)) (("B" 4)("G" 8)) (("B" 4)("G" 2)("BL" 143)("G" 3)("BR" 148)("G" 13)) 

| 

| 

| 

(("B" 4) ("G" 2) ("BL" 144)("G" 3) 

| 

(("B" 4)("G" 12)) 

Fig.1. String representation of the generated amylopectine structure 

Fig.2. Graphical representation of the generated amylopectine structure

50 

40 

30 

20 

10 

0 


USAMV 


Experiment 

Simulation 

glucose DP1 maltose DP2 maltotriose DP3 maltopentose/maltotetrose 

DP4/DP5 

Fig.3.Comparison between the real and the simulated hydrolysis 

maltohexose/maltoheptose 

DP6/DP7 

• the possibility to access, alter and investigate the modeled structure during 

the simulation without supplementary programming costs. 

• the possibility to use parallelism without the burden of explicit parallel 

programming of particularly interest for the simulation of process that are 

inherently concurrent like the enzymatic hydrolysis with multiple 

participating enzymes 

• the possibility of rapidly modifying the processing structures by 

constructing them from standard queries and stored interpreted procedures 

• the possibility of efficient statistical evaluation of the results needed by 

Monte Carlo Simulation 

For the simulation each individual molecule structure was stored in its own table. 

The hydrolysis products were stored during the running simulation in the same 

table. For the amount of data used in the test simulation this was a sufficiently 

balanced solution to efficiently use the DBMS. Further increase in the molecule 

dimensions and number and especially in the type and number of concurrent 

processes accessing the data will impose an optimization of the database both at the 

logical and the physical level. 

During the whole simulation, the changing set of data reflecting the structure 

modification was accessed without restriction with a standard database client. This 

allowed direct interaction with the running simulation. By using database 

interrogations, “snapshots” of the hydrolysis process where taken.


USAMV 


The results of the simulated hydrolysis where compared with the results from an 

industrial level performed liquefaction using Thermamyl 120 L on corn starch, and 

are presented in Figure 3. The graph shows a qualitatively similar trend in the 

resulted fraction from both the real and the simulated hydrolysis. The higher levels 

of products with DP from 5 to 7 obtained in simulation are the results of the fact 

that the “virtual molecules” are more accessible to enzyme attacks in the middles 

of the chains as their real counterparts are. 

Conclusion and overlook 

The use of a database for the model storage has proven to be an efficient tool for 

representing and processing a large and branched structure like amylopectin. 

The chosen internal representation can be easily transformed in a graphical 

representation suitable for display and analysis. 

The expression of hydrolysis processes as operation in the relational database is a 

good basis for the formal description and automat code generation for the 

simulation. 

Further investigations are needed for the adjusting of the parameter that describes 

the elementary interaction between the enzymes and the elementary chains so that 

the model fits better on the elementary data. 

The further research will also concentrate on the simulation of multiple enzyme 

systems acting concurrently on the same starch substrate. 

References 

1. Marchal, L.M., Ulijn, R.V., Zondervan, J., Bergsma, J., Gooijer, C.D. de, 

Tramper, J., Monte Carlo simulation of the α-amylolysis of amylopectin potato 

starch. Part I : modeling of the structure of amylopectin Bioprocess and 

biosystems engineering 2001, vol. 24, n o 3, pp. 163-170 

2. Eliasson, A.-Ch., Starch in food: Structure, function and applications, 

Cambridge, Woodhead Publishing, 2004 

3. Douglas K., Douglas S., PostgreSQL (2nd Edition) (Developer's Library), 

Sams Publishing, London, 2005 

4. Hizukuri, S., Starch analytical aspects. In: Eliasson, A.-Ch., (ed) 

Carbohydrates in food, Marcel Dekker , New York ,p 347-429,1996 

5. Gaillard, T., (ed), Starch: Properties and Potential, John Wiley & Sons, New 

York, 1987



MOLECULAR TECHNIQUES USED FOR 

EVALUATION OF THE ROMANIAN HONEYBEES 

GENOFOND IN ORDER TO ESTABLISH THE PURITY 

OF LOCAL RACE FOR CONSERVATION AND 

AMELIORATION 

D. USURELU ∗ , E. CAUIA ∗∗ , L. M. MAGDALENA ∗ , D. 

CIMPONERIU ∗ , P. APOSTOL ∗ , A. HOLBAN ∗ ∗ ∗ 

, A. SICEANU 

Abstract: The research intends to rehearse same of the techniques used by international 

scientific community, and also in our country, for characterizing the honeybee’s genes 

fond. We present in here the RAPD, RFLP on mtDNA and microsatellite analysis. The 

RAPD technique was used for accomplishing a complete genetic map of the honeybee. 

The RFLP on mtDNA proved to be very important techniques for evolutionary and 

differentiation studies on honeybees’ population. The microsatellite studies were used 

on honeybee for studying molecular evolution. Using, for the first time in Romania the 

RAPD and RFLP techniques we characterized the Romanian honeybees population and 

we determined that the Romanian honeybees are still a homogeneous population 

belonging to the phylogenetic lineage C of A. mellifera. 

Keywords: honeybee, RFLP on mtDNA, RAPD, microsatellite analysis. 

Introduction - Review on the techniques used to discriminate the honeybees’ 

populations. The evolution history of Apis mellifera was firstly described based 

on morphometry studies and multi-variance analyses made on a very large number 

∗ University of Bucharest-Institute of Genetics, e-mail:usurelud@yahoo.com 

∗∗ Institute for Beekeeping Research and Development-Bucharest, e-mail: elizacauia@yahoo.com



of honeybee samples collected from very different geographical areas (Ruttner F., 

1978, 1988). According to these studies the European honeybees are originated 

from Asia and extended to Africa and Europe, thus establishing three evolutionary 

distinct branches: A lineage in South and Central Africa, M lineage in west-north 

of Europe and C lineage in South-East of Europe. Subsequently a new lineage (O) 

was established in the Middle and Near East, and more recently, on genetic basis a 

fifth lineage in Africa (Ethiopia), lineage Y (Franck P.2001) was identified. The 

morphometric, behavioural and biological characters were also the basis in order 

to identify the 24 existing races of honeybees belonging to A. mellifera. Thus, the 

four distinct evolution lineages include the following races: 

Lineage A (A.m. litorea, scutellata, monticola, adansonii, yemenitica, lamarckii, 

capensis, unicolor, sahariensis); 

Lineage M (A.m. sahariensis, major, intermissa, cypria, adami, sicula, mellifera, 

iberica); 

Lineage C (A.m.carnica, ligustica); 

Lineage O (A.m. anatolica, meda, caucasica, remipes, syriaca); 

Despite the fact that the morphometry techniques are very laborious, they are still 

used. One reason for this is that the morphometric techniques have been 

permanently improved because new computational and imagistic techniques and 

software appeared. In parallel with the genetics and the molecular biology 

progresses from the last decades, new investigation tools such us molecular 

markers were developed. Some of them are used in genetics of populations, in 

order to carry out phylogeny studies. The main molecular markers are studied at 

enzymatic level and also at ADN level (mtDNA, nuclear DNA). These techniques 

that use the PCR (Polymerase Chain Reaction) amplification are: RAPD (Random 

Amplified Polymorphic DNA), RFLP (restriction fragment length polymorphism), 

AFLP (Amplified Fragments Length Polymorphism), SSR (Single Sequences 

Repeat)-microsatellites, DAF (DNA Finger printing), SCAR (Sequence- 

Characterised Amplified Region), EST (Expressed Sequence Tag). These tools 

used to establish the genetic variability can be used for a large number of different 

organisms, including the insects. Nowadays, the genetic markers are largely used 

for studying the biogeography of A. mellifera races and for establishing the degree 

of introgression of other non local races. A lot of studies were done in this field but 

the main works were conducted by Garnery L. and Frank P in France, Moritz R. in 

Germany, Pilar de la Rua in Spain, Collet T. in Brasilia, Harizianis P. in Greece, 

and Sheppard in USA. The recent major advances and discoveries in the genetics 

of honeybees’ population were connected with the accuracy of techniques and



methods based on molecular markers used to discriminate the populations. These 

techniques involve studies on: 

I. Mitochondrial DNA (mtDNA). The mtDNA proved to be a very useful material 

for evolutionary studies and differences between the honeybees populations 

(subspecies). As mtDNA is generally maternal inherited, without recombination, it 

allows the accurate detection of foreign haplotypes in a population. The mtDNA of 

honeybees contains 37 genes from which the most studied in phylogeny are: rRNA 

16S (the gene for ribosomal RNA 16S), COI and COII (the gene for the great 

subunities of the cytochrom C oxidase), the intergenic region COI-COII, Cyt B (the 

gene for cytochrom B). The performed studies on mtDNA confirmed the 

morphometrical hypothesis that A. mellifera evolved in three distinct branches 

which were differentiated with one million years ago. The contact regions between 

branches are the introgression areas where coexisted two haplotypes of mtDNA. 

An example of this is the progressive transition of A lineage to M lineage in the 

Northern part of Spain. Regarding the confirmation of the forth lineage in the Near 

East, the first signs were noticed when was established a general phylogenetic tree 

of mt DNA haplotypes, based on a very large number of samples that included 

some Egyptian honeybees samples. According to Ruttner A. m. anatoliaca and A.m 

meda (from Turkey) belongs to O lineage. Some researches carried out on mt DNA 

of samples collected from Turkey show that all these have the haplotype of C 

lineage. A similar conclusion was drawn out in studying the samples of A.m. 

caucasica subspecies. Therefore, in order to confirm the existence of the forth 

lineage by mtDNA there are necessary supplementary studies. 

a. The RFLP technique (Restriction Fragment Length Polymorphism) is the 

technique that is frequently used in order to study the genetic variance at the 

mtDNA level. The RFLP technique is based on the enzymatic restriction in a first 

phase followed by the electrophoresis in gels (agarosis and acrylamide) in order to 

analyse the variance at the restriction sites level recognized by specific restriction 

enzymes. If there are differences between the individuals the restriction enzyme 

will generate different size fragments, these being known as restriction fragments 

length polymorphism. These fragments can be separated by electrophoresis and 

viewed by different methods. Crozier (1992) established a test that uses the 

amplification of the fragments of gene for cytochrom B and their digestion with Bg 

l II enzyme. Using this test it was possible to differentiate the African lineage 

(including the Africanized bees from the American continent) from M and C 

lineages. A very discriminatory test (COI-COII test) was established by Garnery L, 

1993, this using the restriction only with DraI enzyme after the PCR amplification. 

Other recent studies (Kandemir I., 2003) analysed the Cyprus populations by



amplification the genes for Cyt B, COI and COI-COII intergenic regions using the 

restrictions with endonucleasis: Hinf-I, Bg l II and DraI of the amplified fragments. 

The test for COI-COII region is a very reliable test. This region can have several 

variants of length which are explained by the combination of three sequences of 

different sizes: Po (67 bp); P (54 bp) and Q (192-196 bp) - (figure 1). The variants 

that can be obtained are: PoQ, PoQQ, PoQQQ, PoQQQQ, PQ, PQQ, PQQQ, 

PQQQQ and Q. The three lineages of honeybees correspond to the three types of 

combinations of the three mtDNA sequences: Po and Q (A lineage), P and Q (M 

lineage) and only Q (C lineage). So, the haplotypes of C lineage contain only the Q 

sequence (192-196pb), and the haplotypes of A and M lineage can contain from 

one to four of Q sequence. 

II. Nuclear DNA. 

a. The RAPD technique (Random Amplified Polymorphic DNA) – This 

technique was successfully used to build a genetic map of 300 loci (Hunt and Page, 

1994) and also determine the structure of a bee colony (Fondrk et al. 1993). This 

technique is also based on PCR amplification of DNA sequences randomly taken 

out, that are unknown by the technician. The used primers in this reaction contain 

an arbitrary Figure sequence 1: The of 10 COI-COII base pairs intergenic and the region resulted after amplification the test with products DraI are 

separated enzyme. One in agarosis can notice gel. the P Because sequence in of A the lineage difficulty (Po), in to M lineage design (P), the and informative in C 

primers, lineage these is markers absent. are The not Q sequence too much is present used in in population all lineages genetics. C, A and M. 

b. The sequencing technique for microsatellites markers. The microsatellites 

(SSRs) are composed by simple sequences of nucleotides (2-5), that are repeated in 

tandem: (AC)n, (AG)n or (AT)n.. They express a very high level of polymorphism 

probably due to the replication errors of DNA, dispersion and evolution 

preservation in eukaryotes genome, being used to identify the individual genotype



for phylogeny and genomes mapping. As they are in a very large number and have 

a great intra and inter-specific variability these markers were introduced in studies 

that aim to identify the degree of relatedness between populations. The technique 

has also the advantage that by means of a single amplification reaction it is 

obtained a very high polymorphism so that it is necessary a reduced number of 

specific primers to obtain the discrimination between the genotypes that are 

phylogenetic related. 

Beside the very informative results the technique has another advantage is that the 

DNA reaction is very stable and repeatable. Till now, the microsatellites were 

firstly used in A. mellifera in evolutionary studies (Estoup, 1993, 1995b), for 

theoretic models of mutations. (Estoup & collab. 1995a; Cornuet and Luikart 

1997), and also in studying the reproduction behaviour and socio-biology (Estoup 

et al. 1994). As these markers have also a high rate for mutation they can have a lot 

of alleles, being very useful for genome mapping and paternity studies. 

The three evolutionary lineages of A.mellifera that were confirmed by 

morphometry and mt DNA analyses (Smith 1991; Garnery and collab 1992; Arias 

and Sheppard 1996) were also confirmed by a study made on 7 microsatellites loci 

(Estoup et al. 1995a). This study was done also on the Iberian honeybees in order 

to investigate the evolution of M lineage (Frank et al. 1998). 

Researches on Romanian honeybees –Geographically, Romania belongs to the 

area of the A.m. carnica ssp. A series of older researches in Romania (Fisteag 

1930, Fotii 1965) used morphometric criteria to show differences to the A.m. 

carnica race, the authors included the race in a standalone race – A.m. carpatica. 

This race was not confirmed by Ruttner (1978), who considered it part of A.m. 

carnica race and A.m. macedonica in the South-East part of the country. It is true 

that in the ‘30s, in the Western part of the country – in Banat – a distinct bee 

population was identified both with respect to its colour – yellow (having no 

phylogenetic relations with A.m. ligustica) and in terms of its production potential, 

under the name of A.m. banatica and recognized also by Ruttner (1975). Recent 

research on the Romanian bee at the Beekeeping Research-Development Institute 

within the National Programme for Breeding of the Romanian bee showed that the 

A.m. banatica race is no longer to be found in the bee population in Banat area, 

and the morphophysiological parameters of the Romanian bee at national scale 

justify considering the Romanian bee as a race in itself rather than as a variety of 

the A.m. carnica, being called by specialists A.m. carpathica. Also, a series of 

inter-zone morphological and behavioral differences were identified with result in 

a series of ecotypes of the A.m.carpathica: the ecotype in the West Plains, in 

Moldova Plateau, Transylvania Plateau, mountain and steppe areas. The



preservation of local bee races is very important both for the preservation of 

biodiversity and for apiculture in general and is not incompatible with the 

obtaining of improved races, that are more productive. Honey bee populations are 

variable, and through the selection of the best bee colonies, one favours the 

selection of the characteristics that are wanted in the local race. At present, 

experiments have not ceased to aim at obtaining supervaluable bees to serve man’s 

interests, often not taking into account long term effects of cross-breeding of races, 

hybrids polluting the local genetic structure that is better adapted, and leading to 

irreversible disappearance of local bee populations. Consequently, the introduction 

of foreign bee biologic material, from outside the space in which these have 

adapted in millions of years, may have negative effects, sometimes disastrous 

effects upon species’ adaptability and upon beekeeping practice; it is more than 

adaptability to climate and flora conditions, it is about transferring diseases and 

pests. To avoid these problems, through the National Programme for Breeding of 

the Romanian bee it was established that in Romania no other race but the local 

race A.m. carpathica will be kept, selected and bred, although there were 

registered many attempts to introduce various races of interracial hybrids. 

The implementation of molecular techniques in order to characterize the 

Romanian honeybees. In order to have a deeply analyse of the Romanian 

honeybee it was necessary to assimilate and implement the necessary technique. 

Thus, in 2006, a research collaborative project (Ceex Programme, module 2) was 

initiated by the Institute for Beekeeping Research and Development -Bucharest and 

Genetics Institute of University-Bucharest. The researches were approached by 

implementation of RAPD and RFLP techniques (the test COI-COII). 

2. Materials and Methods 

Honeybees samples collections. A number of 17 samples of bees were 

collected from different regions for RAPD technique implementation and 55 

samples for applying RFLP technique. The honeybees samples were collected from 

different apiaries located in the following Romanian counties: for RAPD- Valcea, 

Dambovita, Tulcea, Salaj, Alba, Bihor, Arad, Iasi, Bucuresti, and for RFLP - 

Brasov, Dolj, Bistrita, Gorj, Iasi, Prahova, Hunedoara, and Constanta. From each 

county there were collected honeybee samples, using a specific protocol for 

collecting and preserving the honeybees, according to the literature (Garnery, 

1993). 

The implementation of RAPD technique. The technique was applied on the 17 

honeybee samples, using Wizard Genomic DNA purification kit for DNA



isolation and Ready-to-Go RAPD Analysis Beads kit for amplification of targeted 

sequences, having in composition the following primers randomly selected: P4: 5’- 

AAGAGCCCGT-3’/P5: 5’- AACGCGCAAC-3’si P6:5’-CCCGTCAGCA-3’. The 

PCR products were checked in agarose gel electrophoresis. 

The implementation of RFLP technique by the COI-COII test. 

The DNA was extracted from the heads of the collected honeybees using the 

Wizard Genomic DNA purification kit for animal tissue (Promega). The 

amplification of CO I - CO II region by PCR was done using two sets of primers: 

the first set of primers is: 

E1:5’GATCAATATCATTGATGACC3’ / H1: 5’TCTATACCACGACGTTATTC3’ 

(Hall and Smith, 1991) and the second set of primers is: E2: 

5’GGCAGAATAAGTGCATTG3’ / H2: 5’CAATATCATTGATGACC3’. (Garnery, 

1993). 

The two sets of primers were necessary to cover different borders of the COI-COII 

region, which increases the possibility to found polymorphisms, revealing different 

Romanian honeybee’s ecotypes. The PCR fragments were checked in a 2% agarose 

gel electrophoresis in order to determine the size of the amplified fragments. The 

amplified fragments were digested with Dra I restriction enzyme, for 12 hours at 

37 o C. Restricted DNA fragments were separated using a 10% acrylamide gel, 

stained with ethidium bromide. 


RAPD technique. Following the PCR amplification with P5 and P6, the 

obtained RAPD pattern after electrophoresis shown uniform strips without any 

difference between the DNA samples. The most informative RAPD pattern was in 

the case of the primer P4 where, there were noticed differences in two DNA 

samples (4 and 16) as compared with the rest of the samples. Taking into account 

these results, as these differences are not confirmed by all the primers, one can say 

that these variations were the result of the lack of specificity of the selected primers 

for honeybees. 

RFLP technique- the COI-COII test. By using the first set of primers, the 

PCR reaction revealed amplification fragments with the same molecular size 

(800bp) for all the samples. Moreover, the Dra I restriction, checked in 10% PAGE, 

showed that the DNA restriction fragments have the same molecular size. In this 

way, by using the first set of primers, no differences between the samples were 

identified and we couldn’t observe different honeybee ecotypes on selected 

Romanian areas. The obtained results using the 2 nd set of primers show PCR



products having similar size and similar pattern of migration for the collected 

samples. Performing the restriction reaction using Dra I enzyme on E2H2 

amplified fragments we didn’t notice a different electrophoresis pattern between 

the samples. 

For the first set of primers we couldn’t compare our data with those existing in 

the literature because almost all the works done in the field were done on M and A 

lineage of A. mellifera. In Romania this is the first molecular study performed on 

local honeybee. Based on our preliminary results regarding the molecular 

polymorphism in the COI-COII region (for the E1H1 amplicons) we determined 

that Romanian honeybees are still a homogeneous population. 

Using the second pair of primers we noticed that the obtained amplified 

fragments have a molecular size (536 bp) comparable with the ones often reported 

by Garnery et al. (1993, 1998, 2000, and 2001) for C lineage. In their studies there 

are investigated samples from France and other countries, neighbouring to 

Romania (i.e. Bulgaria, Slovenia, Hungary), which have the C lineage of 

honeybees. In the same way, our results obtained after Dra I restriction on E2H2 

amplicons could be compared with those determined by Garnery and collaborators 

(41 bp, 47 bp, and 65 bp) (Garnery et al., 1993). Thus, based on our preliminary 

results and also on the literature data it is feasible to affirm that the Romanian 

honeybees belong to the C lineage of honeybees. 

Despite the geographical and ecological variations of the collection sites (plain, 

mountain, hill and delta) the analyzed Romanian honeybees samples didn’t express 

population variation differences at the mtDNA level (i.e. different ecotypes). 

Conclusions 

• The RAPD technique was optimized (using the Ready-to-Go RAPD Analysis 

Beads kit) for 17 honeybees samples and the results shows that the used 

primers were not informative for honeybees so it could be improved by 

designing new primers for A. mellifera. 

• the RFLP technique was implemented and optimized for the COI-COII test, in 

order to characterize the local honeybees; 

• Our preliminary molecular investigations of the polymorphism from the COI- 

COII mitochondrial DNA region (with bought sets of primers) showed that 

Romanian honeybees are still a homogeneous population 

• Performing the COI-COII test, based on mt DNA fragment size, it was 

scientifically established on genetic markers that Romanian honeybees belong 

to C lineage of Apis mellifera;



• The used techniques didn’t highlight intra-racial differences that could establish 

the existence of ecotypes formed by the geographic diversity of the Romanian 

regions. 

References 

1. Bouga M, Harizianis P, Killias G (2005) – Genetic divergence and phylogenetic 

relationships of honeybee Apis mellifera (Hymenoptera :Apidae) populations 

from Greece and Cyprus using PCR-RFLP analysis of three mtDNA segments. 

Apidologie 36. 335-344. 

2. Cauia E, Usurelu D, Magdalena L., Cimponeriu D., Apostol P, Siceanu A, 

Holban A, Gavrila L. (2008) Preliminary researches regarding the genetic and 

morphometric characterization of honeybees (A. mellifera L.) from Romania. 

Lucrări Stiinţifice Zootehnie şi Biotehnologii, vol. 40 (2007), Timişoara. 

3. Cornuet J. M., Fresnaye J.(1975).Discrimination et classification des 

populations d’abeilles a partir des characteres biometrique. Apidol 6: 145-187 

4. Crozier H.R si Crozier C.Y (1993) –The mitochondrial genome of the 

honeybee Apis mellifera: Complete Sequence and Genome Organization. 

Genetics 133:97-117, 1993. 

5. A. Estoup, L. Garney, M. Silignac, J-M. Cornuet, (1995), Microsatellite 

variation in Honey Bee (Apis mellifera L) Populations: Hierarchical Genetic 

Structure and Test of the Infinite Allele and Stepwise Mutation Models, 

Genetics 140, p. 679-695. 

6. Frank P, Garnery L., Solignac M., Cornuet J.M.(2000). Molecular 

confirmation of a fourth lineage in honeybees from Near East, Apidologie 31, 

167-180. 

7. Garnery L, Cornuet J. M, Solignac M (1992) – Evolutionary history of the 

honeybee Apis mellifera inferred from mitochondrial DNA analysis Mol Ecol: 

145-154; 

8. Garnery L (2004) – Analyse de la biodiversite du cheptel francais de làbeille 

domestique - Raport dàctivite. 

9. Garnery L, Solignac M (1993) – A simple test using restricted PCR - amplified 

mitochondrial DNA to study the genetic structure of A. mellifera L: Experentia 

49: 1016-1021. 

10. Garnery L., Franck P., Baudry E., Vautrin D., Cornuet J-M., Solignac M 

(1998) –Genetic diversity of the west European honey bee (Apis mellifera 

mellifera and Apis mellifera iberica). I Mitocondrial DNA, Genetics, Selection, 

Evolution 30 (suppl. 1 S31-S47)



11. Hall, H.G. and Smith, D.R. (1991). Distinguishing African and European 

honey bee matrilines using amplified mitochondrial DNA. Proc. Natl. Acad. 

Sci. USA 88: 4548-4552. 

12. Kandemir I., Meixner M. (2003)–Morphometric, allozymic and mtDNA 

variation in honeybees (A.m.cypria) population in northern Cyprus. Apiacta on 

line. Selected papers XXXVIII Congress APIMONDIA - Ljubljana – Slovenia. 

13. Kozmus P., Stevanovic J., (2007)-Analysis of mitochondrial DNA in 

honeybees from Serbia- Acta veterinaria (Beograd), Vol 57, no 5-6, 465-476. 

14. Meixner M., Worobik M, Wilde J. Fuchs S, Koeniger N (2007) Apis mellifera 

mellifera in Eastern Europe –morphometric variation and determination of its 

range limits. Apidologie 38, 1-7. 

15. Moritz R. Lodesani M, Costa C. (2005) Beekeeping and conserving 

biodiversity of honeybees -Sustainable bee breeding-Theoretical and practical 

guide, Northern BeeBooks. 

16. Nazzi F (1992) – Morphometric analysis of honeybees from an area of racial 

hybridization in north-eastern Italy, Apidologie 23, 89-96. 

17. P. De La Rúa, J. Galián, J. Serrano, R. F. A. Moritz (2001) Genetic structure 

and distinctness of Apis mellifera L. populations from the Canary Islands, 

Molecular Ecology 10 (7) , 1733–1742; 

18. Ruttner F, Tassencourt L, Louveaux J(1978) Biometrical-statistical analysis of 

the geographic variability of Apis mellifera L., Apidologie 9, 363-381 

19. Ruttner, F (1988)- Biogeography and taxonomy of honeybees.- Springer-Verlag 

Ed, Berlin Germany. 

20. Sinacori, A., T.E. Rinderer, V. Lancaster and W.S. Sheppard. 1998 A 

morphological and mitochondrial assessment of Apis mellifera from Palermo, 

Italy. Apidologie 29:481-492 

21. Susnik S, P Kozmus, (2003) - Molecular characterisation of indigenous A.m. 

carnica Pollman in Slovenia. Apiacta on line – Selected papers - XXXVIII 

Congress APIMONDIA - Ljubljana – Slovenia. http:// 

www.apimondia.org/apiacta/slovenia/en/susnik.pdf 

22. The Honeybee Genome Sequencing Consortium – 2006, Insights into social 

insects from the genome of the honeybee Apis mellifera, Nature, vol 443, 

p.931-947.



ODOR REMOVAL FROM THE ENVIRONMENT 

THROUGH THE ACTION OF MICROORGANISMS 

S. BOROWSKI * B. GUTAROWSKA* 

Abstract: In the following study, the ability of microorganisms to remove odorous 

substances from poultry manure and compost was investigated. Twenty one strains of 

microorganisms derived from natural environments (soil, compost, poultry manure) were 

identified on the basis of their morphological and biological properties using the APItests.It 

was found, that there were 12 strains out of 21 selected bacteria that were capable 

to remove ammonium nitrogen from poultry manure medium, whereas the numbers of 

microorganisms responsible for the removal of sulfides and volatile fatty acids were 18 and 

5 respectively. Biological activity of selected bacteria on compost medium was rather poor. 

In fact, only volatile fatty acids were reduced, and 7 strains were active in that process. It 

was also observed that the reduction rate of malodorous volatile compounds was wide and 

ranged from 7% to 78 % depending on a type of the strain.. 

Background 

. 

Keywords: odor removal, biopreparations, poultry manure, 

composting 

Treatment of organic wastes and animal breeding are associated with odor 

emissions, which often impact environmental health and quality of life. Odor can 

be defined as a physiological stimulus of oflactory cells in the presence of specific 

molecules. The nature and concentration of odors detected by offlactory cells 

varies between individuals and with environmental conditions, such as 

temperature, pressure or humidity [9]. They represent a special kind of air 

pollutant, since the human noce can detect and discriminate odors at concentrations 

much lower than those detectable by gas chromatography. It is estimated that only 

10 8 to 10 9 molecules of odorant vapor in the nose is enough to trigger detection, 

whereas 1 μg of ethyl mercaptan in air constitutes approximately 10 16 molecules, 

* Technical University of Lodz, Department of Biotechnoogy and Food Science, Institute of 

Fermentation Technology and Microbiology, Lodz 90-924, Wolczanska no. 171/173, e-mail: 

sebastian.borowski@p.lodz.pl



10 7 or 10 8 times the amount necessary for detection [8,9]. Representative odors 

related to pig and poultry breeding as well as organic waste processing include 

ammonia and its derivatives, sulfuric compounds, volatile fatty acids (VFAs) and 

phenolic compounds [4,6,11,12]. 

Due to its volatility and the high concentrations of nitrogen-containing compounds 

in poultry manure and sludge, ammonia is one of main odorous compounds found 

in polluted air discharged from compost bioreactors or poultry farms. Ammonium 

nitrogen is mainly produced from urine and nitrogenous compounds like proteins 

and amino acids. Not only is ammonia malodorous compound but it can create 

health problems to both the animals and workers in a confined facility. Moreover, 

ammonia has a direct effect on the trees in the surrounding and could cause 

eutrophication of water. Apart from annomia, other nitrogen-containing 

malodorous compounds - volatile amines (dimethylamine, trimethylamine, 

diethylamine, and triethylamine), and phyrazines - are found in polluted air derived 

from agricultural operations as well as food and chemical industries [3,8]. 

Volatile sulfur compounds have been identified as predominant odorants in the bioindustry 

(wastewater treatment plants, composting plants), food industry or 

agricultural operations. They include hydrogen sulfide (H2S), methyl mercaptan 

(CH3SH), dimethyl sulfide (DMS, Me2S), dimethyl disulfide (DMDS, Me2S2), 

dimethyl trisulfide(DMDS, Me2S3), methanethiol (MeSH), and carbon disulfide 

(CS2). These compounds are produced by microbial degradation of sulfurcontaining 

amino acids such as methionine, cysteine, they are also present in some 

natural gases, crude oils and coal tars. Although sulfuric odorous compounds are 

generated in lower abundance that NH3, they contribute substantially to the total 

odorous nuisance because their odor treshold limits are very low [2,4,6,7,8,10]. 

The last group represents volatile fatty acids (VFAs), which belong to major 

products of microbial decomposition of any organic wastes. They were therefore 

regarded as useful indicators of offensive odors emanating from manure, biosolids 

as well as compost piles. The nature of VFAs progresses from pungent odors of 

formic and acetic acids to the distincly unpleasant and offensive odors of valeric 

and caproic acids. Although the short chain acids are present in much higher 

concentrations and have larger volatility, the VFAs with higher carbon numbers 

have lower odor detection treshold thus are more offensive in nature. Therefore the 

high concentration of VFAs in manure or compost may not necesarily cause high 

intensity of malodoror [5,8,12,13]. 

The aim of the following study was to determine the ability of microorganisms to 

remove selected odorous substances (sulfides, ammonia, and VFAs) from solid 

poultry manure and compost from green wastes.




Compost and manure 

Solid poultry manure samples were collected from non-litter poultry farming in 

Zgierz breeding 50 thousand layers, whereas compost derived from the Municipal 

Composting Plant in Lodz. Microorganisms were also selected from soil being 

fertilized by organic fertilizers. 

Microorganisms 

Twenty one strains of bacteria and yeasts isolated from soil (11 strains), compost (3 

strains), and poultry manure (2 strains), as well as from the Culture Collection of 

the Institute of Fermentation Technology and Microbiology (5 strains) were 

investigated. The strains were identified on the basis of their morphological and 

biological properties using the API-tests (BioMerieux). The cultures were stored at 

4 0 C on the TSA, MRS agar (for bacteria) and Sabouraud agar (for yeasts), and 

they were transferred every month. 

Cultures 

The organisms were cultivated on a 100 ml liquid medium, which contained 40 % 

of poultry manure (or compost), 4 % of glucose, and distilled water. A 40 % 

concentration of manure or compost used in the investigation was the highest 

possible to obtain, and besides an inhibition in the bacterial or yeast growth over 

that value was evidenced. The cultivation medium was prepared as follows: 

manure and glucose were dispensed into distilled water, and mixed for 30 min. 

Then the medium was centrifuged at 10 000 rpm for 10 min, and autoclaved at 121 

0 C for 20 min. Each medium was inoculated with a 1 ml of micororganism culture 

containing 1-2x10 8 CFU/ml. Cultivations were submerged at 25 0 C for 21 days. In 

the following days of cultivation, the samples were collected for determination of 

ammonium nitrogen, sulfides, and volatile fatty acids. Simultaneously, the same 

procedure was applied for blank samples (without microorganisms). 

Chemical analyses 

Total solids were determined by drying an approximately 10 g of compost or 

manure at 105 0 C to constant mass, which was related to the original weight of the 

sample. Inorganic solids were determined in the same manner except the 

temperature that was set at 550-600 0 C. 

Ammonium nitrogen was determined using modified Nessler method adopted by 

HACH ® . In this method, the Mineral Stabilizer was used in order to complex 

hardness in the sample. Then the Polyvinyl Alcohol Dispersing Agent aided the



color formation in the reaction of Nessler Reagent with ammonium ions. A yellow 

color was formed proportional to the ammonia concentration. For determination of 

total Kjeldahl nitrogen, ammonium and organic nitrogen was converted into 

ammonium salts by the action of sulfuric acid. The solution was then treated with 

sodium hydroxide to liberate free ammonia that was determined as mentioned 

above. 

Hydrogen sulfides were determined using the HACH ® method no. 8131, according 

to which hydrogen sulfide and acid-soluble metal sulfides rect with N,N-dimethylp-phenylenediamine 

oxalate to form methylene blue. The intensity of the blue color 

is proportional to the sulfide concentration. 

The HACH ® method no. 8196 was used to determine volatile fatty acids (VFAa). 

The method is based on esterification of the carboxylic acids present in the solution 

and determination of the esters by the ferric hydroxamate reaction. All VFAs 

present are reported as their equivalent mg/l acetic acid. 

Results 

Chemical analysis of compost and poultry manure used for the 

investigation was depicted in Table 1. It was found, that both compost and manure 

were rich in organic matter, and had a similar pH value. However, the 

concentration of total and ammonium nitrogen was considerably higher in manure 

(around 82 gN/kg and 627 mgN/dm 3 respectively) than in compost. Owing to this, 

the nitrogen form were no longer determined in further investigations. 

The 16 strains in total were isolated from the soil, poultry manure, and compost 

environments, whilst the others derived from the Culture Collection of the Institute 

of Fermentation Technology and Microbiology (mainly lactic bacteria and yeasts). 

Environmental isolates were classified, on the basis of their morphological and 

biological properties (the API-tests), to 9 genera: Bacillus (4 strains), Pseudomonas 

(3 strains), Staphylococcus (2 strains), Streptomyces (2 strains), and Aeromonas, 

Flavobacterium, Achromobacter, Corynebacterium, Micrococcus (1 strain each). 

The strains’ origin source was shown in Tables 2 and 3 (see the legent). 

To evaluate the removal rate of selected volatile compounds from media 

supplemented with poultry manure or compost during microbial, screening of 

microorganisms was undertaken. The maximal reductions of volatile compounds 

by the isolates (compared with blank sample – medium with no additives) were 

given in tables 2 and 3. 

It was discovered that the reduction of volatile compounds in poultry manure 

medium relied mainly on the used microrganism, and varied depending on the



determined chemical (table 2). There were 18 strains out of 21 capable of the 

ammonium nitrogen utilization whereas VFAs were reduced by only 9 strains. 

Moreover, a high sulfide reduction ability was reported since there were as many as 

10 strains that reduced sulfides with efficiency of over 40 %. The removal rates of 

ammonium nitrogen by isolates were lower as only 7 strains were capable to 

reduce this nutrient of over 40 %. However, there were merely 3 isolates which 

could reduce VFAs over that level. The highest removal efficiency of selected 

volatile compounds was associated with the Bacillus and Pseudomonas genera. 

The most active bacterial species included Bacillus licheniformis, Bacillus subtilis, 

Pseudomonas fluorescens, and Pseudomonas sp., which were able to reduce 

ammonium nitrogen and sulfides of around 60-70 %, whereas Pseudomonas 

fluorescens could remove all investigated compounds of over 50 %. Furthermore, a 

high reduction activity towards sulfides and VFAs was found for actinomycetes of 

the genus Streptomyces (45-76 % reduction). A noticeable level of the sulfide 

removal was reported for gram-minus bacteria assigned to the Flavovacterium and 

Achromobacter genera. It is also worth to mention that yeasts of Candida 

incospicua and lactic bacteria of Leuconostoc mesenteroides utilized ammonium 

nitrogen with relatively large efficiency (50-60 %). 

Table 1. Characterization of poultry manure and compost used for the 

investigations 

Material 

Total 

solids, 

TS 

[g/kg] 

Suspended 

solids, 

TSS 

[g/kg] 

Total 

Kjeldahl 

nitrogen, 

TKN 

[mgN/g 

TS] 

Ammonium 

nitrogen 

[mgN/l] 

Sulfides 

[mgH2S 

/l] 

VFAs 

[mg/l] 

Poultry 

manure 

0.3175 0.2403 62.29 627 0.693 530 

6,3 

Compost 0.4490 0.2013 2.81 7.5 0.271 435 5.8 

It was observed, that basically volatile compounds were utilized at varoius time as 

the maximal reduction efficiency for ammonium nitrogen was evidenced in the 

second day of cultivation, whereas in case of sulfides and VFAs the highest 

reduction efficiency was achieved between 7 and 11 day of cultivation. Behavior of 

selected microorganisms in the compost media was significantly different since 

only volatile fatty acids were destroyed (table 3). There were 16 strains out of 21 

responsible for the VFA utilization, and only 5 strains reduced carboxylic acids 

pH



Table 2. Reduction of volatile compounds in cultures cultivated on the poultry 

manure medium 

The maximal percentage of volatile compound reduction 

Microorganisms* 

[%] 

VFAs cultivation cultivation ammonium cultivation 

sulfides 

time [d] time [d] nitrogen time [d] 

Bacillus subtilis 1 48.6 11 58.6 11 26.4 2 

Bacillus 

- - 62.8 11 78.7 2 

licheniformis 1 

Bacillus megaterium 1 - - 24 9 45.8 8 

Bacillus brevis 3 - - - - 42.9 6 

Pseudomonans 

0.3 9 62.8 11 - - 

aeruginosa 1 

Pseudomonans sp 1 26.6 11 68.3 11 26.1 2 

Pseudomonans 

54.2 7 68.4 11 50.6 10 

fluorescens 1 

Aeromonans sp. 1 - - 5.8 7 35.1 2 

Flavobacterium sp. 2 36.3 2 69.7 7 10.8 2 

Achromobacter sp. 1 - - 53.0 7 8.7 2 

Corynebacterium 

- - 37.6 7 22.6 2 

glutamicum 2 

Leuconostoc 

mesenteroides 4 

23.5 11 32.1 9 64.8 2 

Lactobacillus brevis 4 - - 21.5 7 13.6 2 

Lactobacillus 

- - 30.2 11 23.5 2 

delbrueckii 4 

Staphylococcus 

intermedius 2 


hominis 4 


lentus 1 

- - 16.5 9 37.7 2 

- - 65.6 11 - - 

- - - - 22.6 2 

Micrococcus sp. 3 - - - - 59.1 10 

Streptomyces I 1 17.2 11 45.7 11 8.2 2 

Streptomyces II 1 48.5 2 76.1 11 - - 

Candida incospicua 4 13.8 11 34.9 11 50 8



- no reduction 

* the origin of the microorganism: 1 soil, 2 compost, 3 poultry manure , 4 the Culture 

Collection Lock 

with the efficiencies of over 40 %. Moreover, the maximal reduction activity was 

noticed between 6 and 13 day of cultivation. The most active genera and species 

included Bacillus and Pseudomonas as well as Flavobacterium and Staphylococcus 

lentus. Furthermore, there were only two strains (B.licheniformis and L.deblurecki) 

capable for noticeable utilization of sulfides (of 10-27 %). 

Discussion and conclusions 

Chemical analysis of poultry manure and compost confirmed high concentration 

of volatile fatty acids in both environments and large contents of sulfides and 

ammonium nitrogen in poultry manure, thus these compounds could be respinsible 

for the formation of odors. The amount of sulfides and VFAs in poultry manure 

and compost was residual, but these compounds have very low treshold limits, 

which means that human nose can detect even traces of them in the air. Hydrogen 

sulfide can be smelled at concentrations as low as 0.5 ppb [2,4,6,7,8,10]. The 

isolates were classified to 9 genera, and collective strains represented mainly 

bacteria (20 strains): Bacillus, Pseudomonas, Streptomyces, Staphylococcus, 

Aeromonas, Flavobacterium, Achromobacter, Corynebacterium, Micrococcus, 

Lactobacillus, Leuconostos as well as Candida incospicua yeasts. It was observed 

that the reduction level of the selected volatile compounds was mainly dependent 

on the strain type. A considerably high activity resulting in the reduction of volatile 

compounds of over 40 % was reported for 10 isolates. There were 5 strains with the 

highest activity (over 70 % reduction) cultivated on the poultry manure media. 

They include Pseudomonas sp., Pseudomonas fluorescens, Flavobacterium and 

Streptomyces (strain II) mainly repsonsible for sulfide removal as well as Bacillus 

licheniformis capable for ammonia utilization. Moreover, a relatively high potential 

for the selected odor destruction was reported for the following isolates: Bacillus 

megaterium, Bacillus subtilis, Leuconostos mesenteroides, Lactobacillus 

deblurecki, Staphylococcus lentus, Corynebacterium glutamicum, and Candida 

inconspicua. Furthermore, it was noticed that type of environment in which the 

microbes grow and utilize volatile compounds strongly affects the reduction 

efficiency of these contaminants. There were as many as 18 strains out of 21 

capable of utilization of ammonia, sulfides as well as VFAs in the poultry manure 

media cultivations, whereas the isolates tested on the compost media utilized only



carboxylic acids. The isolates of the highest activity should be taken into 

consideration in order to use them for odor removal from the environment. 

Table 3. Reduction of volatile compounds in cultures cultivated on the compost 

medium 

The maximal percentage of volatile compound 

Microorganisms 

VFAs 

reduction [%] 

cultivation time cultivation time 

sulfides 

[d] 

[d] 

Bacillus subtilis 1 8.79 6 - - 

Bacillus licheniformis 1 39.91 13 10.2 8 

Bacillus megaterium 1 40.31 21 - - 

Bacillus brevis 3 8.04 21 - - 

Pseudomonans 

26.54 8 - - 

aeruginosa 1 

Pseudomonans sp 1 52.25 8 - - 

Pseudomonans 

32.09 13 - - 

fluorescens 1 

Aeromonans sp. 1 20.3 13 - - 

Flavobacterium sp. 2 44.34 13 - - 

Achromobacter sp. 1 20.07 13 - - 

Corynebacterium 

30.4 6 - - 

glutamicum 2 

Leuconostoc 

mesenteroides 4 

27.01 8 - - 

Lactobacillus brevis 4 21.33 8 - - 

Lactobacillus delbrueckii 4 37.56 8 27.5 16 


7.23 8 - - 

intermedius 2 

Staphylococcus hominis 4 17.22 6 - - 

Staphylococcus lentus 1 40.25 6 - - 

Micrococcus sp. 3 19.32 21 - - 

Streptomyces I 1 16.86 21 - - 

Streptomyces II 1 - - - - 

Candida incospicua 4 - - - - 

- no reduction* the origin of the microorganism: 1 soil, 2 compost, 3 poultry manure , 4 the 

Culture Collection Lock



Acknowledgement 

This study was financially supported by the grant of the Ministry of Science and 

Higler Education no. PBZ-MEiN-5/2/2006. 

References 

1. Burgess, J., Parson, S., Stuetz, R.. Developments in odour control and waste gas 

treatment biotechnology: a review, In: Biotechnology Advances, vol. 19, 2001, 

p. 35-63. 

2. Busca, G., Pistarino, C.. Technologies for the abatement of sulphide compounds 

from gaseous streams: a comparative overview. In: Journal of Loss Prevention 

in the Process Industries, vol. 16, 2003, p. 363-371. 

3. El Jalil, M.H., Faid, M., Elyachioui, M.. A biotechnological process for 

treatment and recycling poultry wastes manure as a feed ingredient. In: 

Biomass and Bioenergy, vol. 21, 2001, p. 301-309. 

4. Kim, K., Ko, H., Kim, H., Kim, Y., Roh, Y., Lee, C., Kim, H., Kim, C.. Sulfuric 

odorous compounds emitted from pig-feeding operations. In. Atmospheric 

Environment, vol. 41, 2007, p. 4811-4818. 

5. Mao, I-Fang., Tsai, C., Shen, S., Lin, T., Chen, W., Chen, M.. Critical 

components of odors in evaluating the performance of food waste composting 

plants. In: Science of the Total Environment, vol. 370, 2006, p. 323-329. 

6. O’Neil, D., Phillips V.. A review of the control of odour nuisance from livestock 

buildings: part 3, properties of the odorous substances which have beed 

identified in livestock wastes or in the air-round them. In. Journal of 

Agricultural Engineering Research, vol. 53, 1992, p.23-50. 

7. Pinjing, H., Liming, S., Zhiwen, Y., Guojian, L.. Removal of hydrogen sulfide 

and methyl mercaptan by a packed tower with immobilized microorganism 

beads. In: Water Science Technology, vol. 44, 2001, p. 327-333. 

8. Rappert, S., Muller, R.. Microbial degradation of selected odorous substances. 

In: Waste Management, vol. 25, 2005A, p. 940-954. 

9. Rappert, S., Muller, R.. Odor compounds in waste gas emissions from 

agricultural operations and food industries. In: Waste Management, vol. 24, 

2005, p. 887-907. 

10. Ruokojavi, A., Ruuskanen, J., Martikainen, P., Olkkonen, M.. Oxidation of gas 

mixtures containing dimethyl sulfide, hydrogen sulfide, and methanethiol using



a two-stage biotrickling filter. In. Journal of Air Waste Management 

Association, vol. 51, 2001, p. 11-16. 

11. Schiffman, S., Bennett, J., Raymer, J.. Quantification of odors and odorants 

from swine operations in North Carolina. In: Agricultural and Foremost 

Meteorology, vol. 108, 2001, p. 213-240. 

12. Zahn, J., Hatfield, J., Do, Y., DiSpirito, A., Laird, D., Pfeiffer, R.. 

Characterization of volatile organic emissions and wastes from a swine 

production facility. In: Journal of Environmental Quality, vol. 26, 1997, p.1687- 

1696. 

13. Zhu, J.. A review of microbiology in swine manure odor control. In: 

Agriculture, Ecosystems and Environment, vol. 78, 2000, p. 93-106.



PHARMACOLOGICAL EVALUATION OF A TOTAL 

GRAPE SEED POLYPHENOLIC EXTRACT AS 

INGREDIENT IN FUNCTIONAL FOOD PRODUCTS 

COMPLYING WITH EU REGULATION CONCERNING 

NATURAL BIOACTIVE PRODUCTS 

B. BURGHELEA 16 , G. NEAGU-CARAENE ** , R. CAMPEANU *** , L. 

CREMER * V. VULTURESCU ** , G. RADULESCU ** , C. NICHITA ** , 

R. ALBULESCU ** , R. PORUMB ** , A. R. LUPU * , G. SZEGLI * 

Abstract: As mentioned in EU Directive - 1924/2006, grape seed extract, as 

antioxidant functional food ingredient, must be certified as safe and efficient for 

the consumers. The objective of this work was to investigate a total grape seed 

polyphenolic extract (TGSPE) with pharmacological methods approved by EMEA 

(European Medicines Evaluation Agency, the US European Food and Drug 

Administration equivalent). The results show that TGSPE may be considered as 

safe and efficient as ingredient for functional food products. 

Keywords: grape seed extract, functional food, pharmacological evaluation 


In many European countries, the demand for antioxidant products sourced from 

grape seeds has rapidly increased. The main propriety, free radical scavenging 

capacity, is attributed to oligoproanthocyanidins, polyphenols described first by 

Masquelier in 1948. 

They protect the human body from premature aging, disease and decay. 

Polyphenolic extracts from Vitis vinifera are products generally used as dietary 

antioxidants supplements. In the last period they came to be used as functional food 

ingredient, too. 

16 National Research & Development Institute for Microbiology and Immunology-Cantacuzino, Bucharest, 

Romania, e-mail: consbioprep@cantacuzino.ro 

**National Chemical-Pharmacy Research & Development Institute, Bucharest, Romania, e-mail: 

getabios@yahoo.com 

*** Research & Development Institute for Viticulture and Enology Valea Călugărească, Romania, e-mail: 

icdvv@xnet.ro



Since grape and grape seeds are widely different in their polyphenolic 

composition due to the variety or climatic conditions of grapes [4] there is a lack 

of uniformity in the quality of the extracts containing these components. 

There are product-to-product and batch-to-batch variations regarding the 

antioxidant activity [5] and polyphenolic composition, too. Standardization for this 

kind of commercial products is still an unsolved problem. 

As mentioned in CPMP/QWP/2819/00Rev. 1; 30.3.2006 and EU Directive - 

1924/2006, grape seed extract as bioactive product sourced from vegetal masse 

must be certified as safe and efficient for the consumers. 

The objective of this work is to make a pharmacological evaluation of a total 

grape seed 

polyphenolic extract (TGSPE) as antioxidant ingredient used for functional 

foods. 

Folin-Ciocalteu [9], high performance liquid chromatography (HPLC) [3] and 

oxygen radical absorbance capacity (ORAC) [8] are the methods we used in 

concordance with EU regulation. These methods are approved by EMEA 

(European Medicines Evaluation Agency, the US European Food and Drug 

Administration equivalent) for testing grape seed extracts for biochemical 

proprieties and bioactivity. 

Acute toxicity tests and toxicity tests after repeated doses were performed according to 

the legislation in force [2, 10]. 

The safety of the same extract as food ingredient was evaluated according with 

OECD Guide-lines [6] 

Volumetric Karl-Fisher is the methods we used in concordance with 

Pharmacopoeia 2007 [7] for testing the residual water and stability of the extract 

as lyophilized powder. 

The results show that TGSPE may be considered as safe and efficient as 

ingredient for functional food products. 


Grape seed extracts. A Vitis vinifera grape seed extract was used. It was 

obtained with a patented extraction method from dried grape seeds batches resulted 

as a by-product in wineries. 

Folin-Ciocalteu analysis of total polyphenols. 1 ml extract solution (1 mg 

extract powder dissolved in 5 ml distilled water) was mixed with 5 ml of 10% 

Folin-Ciocalteu reagent. The mixture was let sit for 6 min before addition of 4 ml 

of 7, 5% Na2CO3. After 2 hours of incubation at room temperature, the absorbance



of the samples was measured at 740 nm. The total phenol content was expressed as 

gallic acid equivalents (GAE) in milligrams per gram sample. 

HPLC analysis of monomeric polyphenols. The grape seed extract was 

dissolved in hot water (55 0 -60 0 C) and diluted in stabilizing solution. The HPLC 

separation was performed on a Phenyl hexyl, 5 µm, 4,6x250 mm column, using a 

gradient elution with 2 solvents (A - 2% acetic acid, 9% acetonitril in water, by 

volume and B - 80% acetonitril in water, by volume) at 1ml/min. The detection 

was at λ = 278nm. Catechin hydrate, epicatechin and gallic acid monohydrate were 

used as standards. The method was tested for extraction efficiency, linearity, 

precision, accuracy and recovery. 

For Folin-Ciocalteu and HPLC the results were statistically confirmed by 

calculating the relative standard deviation (RSD% not exceeding 10%) and 

correlation factor (R 2 equal or greater than 0.999). 

ORAC analysis of antioxidant capacity. In order to measure the antioxidant 

capacity of the extract against peroxyl radicals, we used a modified and validated 

protocol based on Prior et al. method. 

Fluorescein (marker molecule) was denaturated by peroxyl radicals released by 

2,2'-azobis(2-amidinopropane)dihydrocloride (AAPH), process showed by 

fluorescence intensity decrease over time. Loading of sample dissolved in 

phosphate buffer (pH=7.4) results in inhibition of fluorescein denaturation by 

peroxyl radicals, showed as fluorescent signal maintaining. 

The results were calculated against a Trolox (S)-(-)-6-hydroxy-2,5,7,8 

tetramethylchroman-2-carboxylic acid) calibration curve, by subtracting the blank 

area from the net area under fluorescence decreasing curve in the presence of the 

sample and relating to net area corresponding to 1 μM Trolox. The obtained values 

was multiplied with dillution factor. 

Data were expressed as ORAC units (1 micromoles of Trolox equivalents (TE) 

per mg of lyophilized extract (1 unit =1 μM Trolox/mg sample). For standard curve 

the correlation factor (R 2 ) was equal or greater than 0.95. The variation coefficient 

for each sample was less than 10%. 

Metoda Karl-Fischer (method of semi-micro water determination in 

lyophilized products). Briefly, the extracts were disolved in the solvent and keeped 

for 30 seconds to ambient temperature for water extraction. Simultaneously and in 

the same way was prepared the blank sample. They were titrated in Volumetric 

Karl-Fisher apparatus. The titration measures the volume of titrant reactiv that 

conducts to a voltmetric equilibrium point between sample and environment of 

reaction. This point is attended by adding titrant in the sample-solvent system. 

The reactives were: Hydranal solvent - Riedel de Haen, Hydranal Composite 5 

(the titrant) -Riedel de Haen, Hydranal Methanol Water Standard 5.00 - Riedel de



Haen and Metanol special prepared for Karl Fischer titration. Three measures are 

made. The titration values are accepted if they are in between a 20% interval of 

measured values. 

Acute toxicity. The test was performed on young male and female Swiss mice 

with weights of 18-20 g, and young male and female Wistar rats weighing 80-100 

g. The substance to be tested was administered to the laboratory animals, in a 

unique dose, orally, by gavage. 

The administered doses were of 7000 mg/kgc for the mice and 5000 mg/kgc for the rats. 

They were kept under clinical observation for 14 days, in order to monitor toxic effects 

and death rate. The animals were sacrificed, necropsy being performed in the end of the 

experiment. The doses were chosen so that they may lead to significant values for DL50 

calculation or DMT, DMA (maximum dose which can be administered). 

Toxicity after repeated doses. The test was performed on male and female Wistar 

rats weighing 80-100g. The testing sample was daily administered to three animal 

batches (males and females) in 3 different doses: batch I-1000 mg/kg body, batch II-500 

mg/kg body and respectively batch III-250 mg/kg body. During the observation period, 

the animals were supervised for assessing the toxicity signs. In the end of the experiment, 

the animals were sacrificed, undergoing then necropsy. The study lasted for 28 days. The 

weight was monitored, and the hematological parameters WBC, LYM, GRA, RBC, 

HGB%, PLT, as well as the biochemical parameters: Col, Tgl, GPT, GOT, Gl. 

Macroscopic and microscopic observations were made after necropsy, on the samples 

prelevated from kidneys, liver and heart. 

Both in case of the batches/females and of the batches/males within the test for repeated 

doses, the body weight was monitored during the experiment. 


Polyphenolic content antioxidant activity. Table 1 renders the biochemical 

characteristics and the antioxidant activity assessed when analyzing three extracts obtained 

from different batches of seeds. The concentration of the total polyphenols registers values 

ranging in between 241 and 269, and the concentration of the oligomeric polyphenols 

registers a percentage of 80% - 90%. Catechins, epicatechines and gallic acid are part of 

the monomer composition, in percentages ranging in between 2.6 % and 16.6 %. The 

antioxidant activity of the analyzed extracts registers values ranging in between 3.7 

μMTrolox/mg and 4.4 μMTrolox/mg, being therefore comparable with the commercial 

products on the European market [5]. 

They also show that the antioxidant activity is proportional with the concentration of 

total polyphenols. 

In respect of the physical and other chemical properties, the extract appears as a 

reddish-brown powder, non-hygroscopic and hydrosoluble. For the three batches, the



values of the residual humidity ranged in between 2% and 6%, without exceeding this 

interval after 12 months, under normal temperature and humidity conditions. 

The toxicological studies concerning the products obtained by biotechnologies 

include tests regarding the toxicity after applying the unique dose (acute 

toxicity) and studies of toxicity after applying recurrent doses [1]. 

Acute toxicity. This test evaluates the toxic effects which appeared within 14 

days after the administration of the substance to be tested, in a unique dose, to the 

laboratory animals. When the substance is responsible for the death, the mortality 

dose 50% (DL50) is established. According to the regulations in force concerning the 

toxicity test after using the unique dose, it is not necessary a high level of precision for the 

quantitative evaluation (e.g. DL50). 

After the administration of TGSPE in a unique dose, both in case of mice and 

rats, no phenomena of toxicity were observed, neither spontaneous behavioral 

modifications, nor mortality. The necropsy did not reveal any modifications of the 

parenchyma structure or of the cavity organs. Considering the results obtained inside the 

acute experiment, the acquired information could not help with determining DL50, 

because of mortality absence, even if maximum doses were administered. We may 

conclude that DL50 might register values which are superior to the maximum doses orally 

administrable in this experiment. 

Toxicity after recurrent doses. This test aims to establish the non-toxic dose 

(maximum tolerated dose) of extract. It must emphasize the physiological and/or 

physiopathological modifications induced by the recurrent administration of the 

extract, and to evaluate its effects on the animal organism. 

Batche 

Total 

polyphenols 

mg EAG/g 

Oligomers 

% 

Table 1 

Monomers 

% 

Catechine 

% 

Epicatechine 

% 

Gallic 

acid 

% 

ORAC 

units 

1 241 83.4 16.6 8.4 4.1 4.0 3.7 

2 250 87.7 12.3 6.3 2.9 3.0 4.9 

3 269 86.0 14.0 7.8 3.5 2.6 4.4 

The results of the hematological and biochemical 

analyses of the samples prelevated from the laboratory animals which received 

TGSPE in repeated doses are rendered in Tables 2 – 5. The Tables 2 and 3 present 

the values of the hematological parameters by batch/female and by batch/male 

registered 28 days after the debut of the experiment. 

Their analysis shows that the extract, irrespective of the administered dose, did not cause 

significant modifications when compared to the values of the control batch, after 28 days.



The values of the biochemical parameters by batch/female and by batch/male 28 days 

after the debut of the experiment are rendered in Tables 4 and Table 5. 

Table 2 

Batch WBC LYM GRA RBC HGB% PLT 

I 9.08 5.86 7.64 7.08 14.2 880 

II 8.04 5.64 2.02 18.6 14.2 1115 

III 7.63 4.91 2.23 7.41 14.6 859 

M 5.04 3.21 1.54 7.58 15.0 853 

Normal values 2.10-19.5 2.00-14.1 0.10-5.40 5.30-10.0 14.0-18.0 500-1370 

Table 3 

Batch WBC LYM GRA RBC HGB% PLT 

I 7.62 4.47 3.07 7.66 15.4 847 

II 7.53 5.30 2.12 7.60 14.6 766 

III 6.39 4.16 2.17 7.67 15.0 981 

IV 8.10 5.09 2.36 7.81 15.1 851 

Normal values 2.10-19.5 2.00-14.1 0.10-5.40 5.30-10.0 14.0-18.0 500-1370 

Batch 

GPT 

(U/I) 

GOT 

(U/I) 

Col 

(mg/dl) 

Gl 

(mg/dl) 

Ur 

(mg/dl) 

Table 4 

Tgl 

(mg/dl) 

I 50.2 215 59.5 108 37.5 103 

II 40.4 161 63.0 129 42.5 108 

III 42.8 205 50.8 101 38.0 78 

M 52.7 216 53.3 111 27.5 72 

Normal values 22-49 

33– 

53 

150- 

260 

50-107 15– 50 40-165



Batch 

GPT 

(U/I) 

GOT 

(U/I) 

Col 

(mg/dl) 

Gl 

(mg/dl) 

Ur 

(mg/dl) 

Tgl 

(mg/dl) 

I 43.3 221 68.0 113 33.4 71 

II 50.8 197 61.5 114 33.3 90 

III 49.4 200 64.8 102 51.7 50 

IV 51.3 182 51.5 79 20.6 45 

Normal 

values 

22-49 

33– 

53 

150-260 50 - 107 15 – 50 40-165 

Table 5 

From the analyses of the data, it is noticeable that none of the administered doses caused 

significant modifications of the investigated biochemical parameters, comparatively with 

the values of the control batches. 

When monitoring the body weight, it was noticed that the weight curve of the treated 

batches kept a route paralleling that of the weight curve of the control batches, irrespective 

of the administered dose. 

Fig 1 presents the evolution of the mean values/batch of the female weight, and Fig. 2 

presents the evolution of the mean values/batch of the male weight. 

Grams 

200 

150 

100 

50 

0 

Ponderal growth curve - Females 

0 7 14 21 28 

Days 

Lot I 

Lot II 

Lot III 

Control 

Fig. 1. Evolution 

of weigt body - 

female



200 

150 

Ponderal growth curve - Males 

Fig. 2. Evolution of weigt 

body – male 

The toxicity test after 

Lot II 

100 

recurrent doses did not cause 

Lot III 

50 

mortality. Mortality was not 

Control 

register in case of the control 

0 

batches, either. 

0 7 14 21 28 

Macroscopically, in case of 

Days 

the treated batches, the 

general aspect of all the 

examined tissues and organs was similar to that of the control batch, some light 

stasis 

being observed in lung and liver. Both in case of the control batches and the batches to 

which the extract was administered, it was noticed the absence of necrotic modifications, 

blood 

sub-fusions and arterial-venous fragility. 

Hysto-pathological investigations of the tissue preparations 

obtained from organs of 

animals 

treated by TGSPE for 28 days revealed no significant differences between 

batches treated with different doses and control batches". 

We are able to assume that the substance-test orally administered for 28 days did 

not 

engender metabolic, inflammatory or necrotic disorders during the experiment. 

Grams 


The physico-chemical characteristics of the extract recommend it as being adequate in 

respect of its chemical composition and antioxidant activity. 

TGSPE has a total and monomeric polyphenols content which endows it with 

antioxidant activity comparable with that of similar commercial products. It is 

hydrosoluble, 

having great stability and quite a refined pharmaceutical appearance. 

In the acute toxicity experiment, it did not induce mortality when 

the maximum dose 

was 

administered. 

In the toxicity experiment, when recurrent dose was administered to rats, it did not 

induce toxic phenomena. 

The biochemical and hematological parameters evaluated after 28 days did not show 

significant modifications between the treated batches and the control batches, irrespective 

of 

dose or sex.. 

The weight curve of the treated batches, irrespective of dose, kept a trajectory which is 

parallel with that of the weight curve in case of the control 

batch. 

Lot I



The anatomic, pathologic and histo-pathologic observations made in case of the animals 

sacrificed 

after 28 days emphasized that the extract did not induce pathologic macro- or 

microscopic modifications at the level of the examined organs and tissues. 

TGSPE is going to be tested by clinical studies aiming at establishing the bioavailability 

and the minimum doses which are efficient for the human body. 


This 

research was supported by grant from PNCD (National Plan for Research 

and Development) in Romania (CEEX 33/2005). 

References 

1. Ciulei, I., Istudor V., Palade, M., Albulescu,D. In: Pharmacognostic and 

phytochimic analysis of vegetal productsl, vol I, Ed. Tehnoplast Company SRL, 

1995. 

2. HG nr.490/2002 partea B nr. 7. Testing methods, din Anex 3 

3. Lange M. and LeVanseler K. L., 2003. Determination of flavan-3-ol monomers 

and gallic acid content in grape seed extract by high performance liquid 

chromatography. In: Validation report. Institute for Nutraceutical Advancement 

Methods Validation Program 

4. Mateus N., Proença S., Ribeiro P., Machado J. M., De Freitas V.: 2001. 

Grape and wine polyphenolic 

composition of red Vitis vinifera varieties 

concerning vineyard altitude. In: Cienc. Tecnol. Aliment., 2:102- 

110,2001. 

5. Monagas M., Hernandez-Ledesma B., Garrido I., Martin-Alvarez P-J., Gomez- 

Cordoves C., Bartolome B.:. Quality Assessment of Commercial Dietary 

Antioxidant Products 

From Vitis vinifera L. Grape Seeds. In: Nutrition and 

Cancer, 53, 244-254, 2005 

6. OECD - Principles of Good Laboratory Practice and Compliance Monitoring 

(GLP). 

7. Pharmacopoeia 2007 

8. Prior R. L.; Hoang, H.; Gu L.; Wu X., Bacchiocca M., Howard, L., Hampsch- 

Woodill M., Huang D., Ou B., Jacob R.: Assays for hydrophilic and lipophilic 

a ntioxidant capacity (oxygen radical absorbance capacity (ORACFL)) of 

plasma and other biological and food samples. In: J. Agric. Food Chem., 51, 

3273-3279, 2003. 

9. Singleton, V.L., Orthofer, R., Lamuela-Raventos, R.M., 1999. Analysis of 

total 

phenols and other oxidation substrates and antioxidants by means 

of Folin- 

Ciocalteu reagent. In: Meth. Enzymol., 299: 

152-178. 

10. SR-ISO 9000/2001 - Sisteme de management al calităţii. Principii 

fundamentale şi vocabular



RESEARCHES REGARDING THE INFLUENCE OF 

SOME BIOPREPARATIONS ON THE CONTROL 

OF 

THE PATHOGEN 

BACTERIA FOR Lycopersicon 

esculentum L. AND Solanum melongena L. 

Oana LIVADARIU a 

* , Narcisa BABEANU * , O. POPA * , Mari 

OPREA ** , 

Marina PAMFIL * ** , A. VAMANU * , E. VAMANU * 

Introduction 

Abstract: The involvement of the microbial antagonism in the 

biological control 

of some phytopathogen agents is one of the main 

research directions 

of the modern biotechnologies. By performing 

investigations regarding the laboratory testing of the microbial 

antagonism, our experimental researches 

prove the viability of using 

the biopreparations BSP+BSV and B4 for the biological control of the 

phytopathogen 

bacteria (Xanthomonas campestris pv.vesicatoria, 

Pseudomonas 

syringae pv. tomato and Erwinia carotovora) in the first 

growth stages for Lycopersicon esculentum L. and Solanum 

melongena L. 

Keywords: biopreparation, phytopathogen bacterium, Lycopersicon 

esculentum L., Solanum melongena L. 

The research of the effects generated by the treatments based on the interaction 

between the phytopathogen microorganisms and those used in their biological 

control continues to be a challenge for the biotechnologies aiming at achieving a 

sustainable agriculture. 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: ombioteh@yahoo.com 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: bnarcisa@yahoo.com 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: ovid_popa@yahoo.com 

** 

BIOTEHNOL, Bucharest, Romania, e-mail: marriaoprea@yahoo.com 

*** 

INCDCF – ICCF, Bucharest, Romania, e-mail: maria pamfil@yahoo.com 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: vamanuadrian@yahoo.co.uk 

* 

Faculty of Biotechnologies, USAMV Bucharest, Romania, e-mail: emanuelvamanu@yahoo.com



The biocontrol of the phytopathogen agents by using biopreparations allows the 

promotion of growing plants in conditions superior to those offered by the 

achievement of treatments based on chemically synthesized substances [7]. 

Vegetable plants constitute, together with cereals, the basis of human 

alimentation and they are the main source of vitamins and minerals [8]. But, the 

sensitivity of vegetable plants to the action of the phytopathogen agents is a 

notorious phenomenon 

for vegetable growers. The modern requirements of 

vegetable growing practiced both in protected spaces and in the field requires the 

identification of certain solving modalities which to allow the obtaining of superior 

quality plants at minimum costs [2, 6]. Among the modalities of solving offered by 

the modern biotechnologies, the use of biopreparations allows the reduction or 

elimination of the application of pesticides [7]. Implicitly, by using 

biopreparations, there is generated a sum of advantages, both for the nutritional 

layer in which the vegetable growing takes place, and for the final consumers of 

the respective crop. 

Subject 

to the foregoing, the purpose of this study was directed towards the 

accomplishment of researches 

concerning the protection of tomato plants 

(Lycopersicon 

esculentum L.) and aubergines (Solanum melongena L.) using the 

microbial antagonism with the aim to biologically control the phytopathogen 

agents identified as pertaining to some bacteria stems of Xanthomonas campestris 

pv.vesicatoria, of Pseudomonas syringae pv. tomato and of Erwinia carotovora, by 

further applying treatments containing basic biopreparates of Bacillulus sp. 

obtained at INCDCF-ICCF Bucharest. 


The inoculum source for the preliminary laboratory testing of some 

biopreparations intended to control the pathogen bacteria (Xanthomonas campestris 

pv. vesicatoria, Pseudomonas syringae pv. tomato and Erwinia carotovora) in the 

vegetation stages for Lycopersicon esculentum L. and Solanum melongena L. 

The experiments that 

had as a purpose the laboratory regeneration of the plants of 

Lycopersicon esculentum L. and Solanum melongena L. a had as a primary 

inoculum source seeds purchased, found in the vegetative repose stage and 

obtained by means of conventional horticultural methods [6, 9]. 

The Lycopersicon esculentum L. and the Solanum melongena L. plants obtained 

by laboratory germination and found in the stage with 2-3 real leaves 

were used as 

vegetal starting structures for the stage of inducing the contamination with 

pathogen microorganisms for testing the efficiency of the biopreparations produced 

by INCDCF - ICCF.



The pathogen microorganisms studied were isolated from plants of the 

Solanaceae family. Thus, there were studied the following types of 

microorganisms: Xanthomonas campestris pv. vesicatoria, which produces the 

leaves’ maculation and blistering; Pseudomonas syringae pv. tomato which 

produces the fruits’ pustular maculation and Erwinia carotovora. 

The biopreparations selected in the laboratory, within a previous experiment, for 

the action of inhibition of the development of bacteria, found the following work 

variants: BSP+BSV – isolated from couch grass and medicinal plants; B4 – 

isolated from leaves of leaf-bearing trees in the woods. 

The working materials and methods applied, for the isolation, inoculation, 

cultivation, identification, testing of the virulence and the processing of the 

microorganisms used in this study of preliminary laboratory testing of some 

biopreparations intended for the control of the phytopathogen bacteria, complied 

with the specific working conditions for 

the microbiological field [1, 5]. 

The nutritive substrate used for the germination of seeds and for obtaining the 

plants of Lycopersicon esculentum L. and Solanum melongena L., was peat type 

supplemented with sand (4:1). The nutritive substrat aseptisation was made by 

autoclaving at the tº=180 

germination of seeds and for obtaining the 

of a 

olution ntration of 4%, of 

4x5H2O) 1%. For the control there were 

h plants not treated and infected and one with 

ly, the experimental scheme used for 

ations, regarding the in vitro testing of the 

e for the biological control of the 

0 C, for 3h [4]. 

The culture conditions used for the 

plants of Lycopersicon esculentum L. and Solanum melongena L. The seeds seeded 

were incubated at the temperature of 23 o C ± 2 o C during the lighting period and 

21 o C ± 2 o C during the darkness period, with a photoperiod of 16 h light and a 

luminous intensity of 2500 luxes [3]. 

The preparation of plants for inoculation was made by transferring each plant 

into a plastic cup with nutritive substrate consisting of the peat and sand (4:1). In 

order to create the conditions necessary for the contamination (high humidity), 

plastic cups with plants and nutritive substrate were included in a plastic container 

provided with sterilized distilled water. 

The inoculation of the plants obtained in laboratory was made by applying a 

cotton-wool wad impregnated with bacterial cells suspension (titre 10 7 ufc/ml). The 

bacterial cells suspension was administrated before the appliance 

biopreparation s (BSP+ BSV or B4) with a conce 

antibiotic or copper sulphate (CuSO 

performed two variants, one wit 

plants not treated and not infected. Practical 

performing the preliminary investig 

BSP+BSV and B4 preparations mad 

phytopathogen bacteria (Xanthomonas campestris pv. vesicatoria, Pseudomonas 

syringae pv. tomato and Erwinia carotovora) in the first vegetation stages for



Lycopersicon esculentum L. and Solanum melongena L., was the following: 

V1 – infected plants + B4 (4%) 

V2 – infected plants + BSP+ BSV 4% 

V3 – infected plants + antibiotic 

V4 – infected plants + copper sulphate 1% 

V5 

– infected and not treated plants 

V6 

– not infected and not treated plants. 

For each experimental variant 

there were made 3 repetitions that consisted of 

10 plants. The above mentioned experimental scheme was performed for each 

vegetal species and bacterial stem (2x3). 

The experimental observations were made at 10 and 16 days intervals as from the 

plants’ inoculation with bacterial cells suspensions. There was calculated the attack 

degree, by reporting the telltale not treated and infected, according to the formula 

GA% = (F x I):100. There was also calculated the treatment’s efficiency, express in 

percentages. 


The use of microbial antagonism constitutes one of the primary modalities for 

biological control involved in plant protection in line with the principles of 

sustainable agriculture. The concept of sustainable agriculture requires the 

maintenance of the attack generated by phytopathogen agents under the economic 

harmful level. Nevertheless, this objective is difficult to achieve as phytopathogen 

agents benefit from a genuine capability to continuously adapt under the applied 

control methods. Consequently, there is a clear need 

to identify and permanently 

update the methods targeted for controlling the phytopathogen agents causing 

qualitative and quantitative losses. 

For the investigation regarding the laboratory testing of the BSP+BSV and B4 

biopreparations used in the biological control of the phytopathogen bacteria 

(Xanthomonas campestris 

pv. vesicatoria, Pseudomonas syringae pv. tomato and 

Erwinia carotovora) in the first vegetation stages for Lycopersicon esculentum L. 

and Solanum melongena L., needed the performance of an experimental scheme 

that provides the achievement of laboratory plants. Consequently, there were 

chosen tomato seeds (Lycopersicon esculentum L.) and eggplant seeds (Solanum 

melongena L.) that were germinated in laboratory. 

The Lycopersicon esculentum L. and the Solanum melongena L. plants obtained 

by laboratory germination and found in the stage with 2-3 real leaves were used as 

vegetal starting structures for the stage of inducing the contamination with



pathogen microorganisms for testing the efficiency of the biopreparations produced 

by INCDCF - ICCF. 

The results obtained in the case of treatments applied for the protection of plants 

from the phytopathogen bacteria of the Xanthomonas campestris pv. vesicatoria 

stem (Fig. 1.) 

The tomato plants (Lycopersicon esculentum L.) contaminated with 

phytopathogen bacteria of the Xanthomonas campestris pv. vesicatoria stem have 

benefited of superior phytosanitary protection by applying the treatment with 

antibiotic (E% = 91.7%). The treatments made on the basis of biopreparations B4 

(4%) and BSP+BSV (4%), have generated a good efficiency (88.6% and, 

respectively, 87.2%), because it was at a level close to the efficiency generated by 

the antibiotic and at a level higher than the efficiency generated by the chemically 

treated control (E% = 71.6%). 

The treatments made for the protection of eggplant plants (Solanum melongena 

L.) contaminated with phytopathogen bacteria of the Xanthomonas campestris pv. 

vesicatoria stem have registered the best protection by using biopreparation B4 

(4%) - E% = 83.1%. Through the treatments made on the basis of the antibiotic or 

the biopreparation BSP+BSV (4%) very good values of efficiency were registered 

(E% = 82.9%, respectively E% = 81.9%). While the treatment made on the basis of 

copper sulphate, usually recommended in vegetable growing, has generated an 

efficiency value of only 67.9%. 

The protection 

ability 

of the 

control agents ( %) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

V1 V2 V3 V4 V5 V6 

Experimental variant 

Lycopersicon 

esculentum L. - 

GA% 

Lycopersicon 


E% 

Solanum 

melongena L. - 

GA% 

Solanum 


E% 

Fig. 1. The protection ability of the control agents (biopreparation, antibiotic or 

copper sulphate) from the treatments used against the contamination with



Xanthomonas campestris pv. vesicatoria phytopathogen bacteria on Lycopersicon 

esculentum L.and Solanum melongena L. plants. 


from the phytopathogen bacteria of the Pseudomonas syringae pv. tomato stem 

(Fig. 2.) 

The tomato plants (Lycopersicon esculentum L.) contaminated with 

phytopathogen bacteria of the Pseudomonas syringae pv. tomato stem had a very 

good protection of over 85.0% through the treatments made on the basis of 

antibiotic (E% = 89.4%) or on the basis of biological products, respectively 

biopreparation 

B4 (4%) with E% = 86.1% and biopreparation BSP+BSV (4%) with 

E% = 85.5%. The tomato plants (Lycopersicon esculentum L.) used with the role of 

chemically treated control registered inferior efficiency (E% = 80.1%), compared 

to the values obtained for the treatments on the basis of antibiotic or of 

biopreparations. 

For the eggplant plants (Solanum melongena L.) contaminated with 

phytopathogen bacteria of the Pseudomonas syringae pv. tomato stem the best 

protection was registered as a consequence of applying the treatments based on 

biopreparations. Thus, the treatments made on the basis of biopreparations 

BSP+BSV (4%) and B4 (4%) generated the best values of efficiency (E% = 92.6%, 

respectively 91.6%). While the treatments on the basis of antibiotic or copper 

sulphate generated inferior efficiency values (E% = 82.6%, respectively 72.0%). 

The protect 

ion ability 

of the 

contro 

l agents ( % ) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

V1 V2 V3 V4 V5 V6 


Lycopersicon 


GA% 

Lycopersicon 


E% 

Solanum 


GA% 

Solanum 


E% 


copper sulphate)



from the treatments used against the contamination with Pseudomonas syringae 

pv. tomato phytopathogen bacteria on Lycopersicon esculentum L. and Solanum 

melongena L. plants. 


from the phytopathogen bacteria of the Erwinia carotovora stem (Fig. 3.) 

The treatments made for the protection of tomato plants (Lycopersicon 

esculentum L.) contaminated with phytopathogen bacteria of the Erwinia 

carotovora stem have generated superior experimental results, in case of 

biopreparations B4 (4%) - E% = 89.5% - and BSP+BSV (4%) - E% = 84.8% - 

compared to the antibiotic (E% = 83.5%) or the chemical agent (E% = 74.8%). 

The eggplant plants (Solanum melongena L.) contaminated with phytopathogen 

bacteria of the Erwinia carotovora stem has a similar protection level for three of 

the treatments applied. Practically, the treatments applied generated experimental 

results which had similar values, both in case of using biopreparations B4 (4%) and 

BSP+BSV (4%) - E% = 93.4%, respectively E% = 92.9% - and in case of using the 

antibiotic (E% = 91.4%). The treatment variant which used copper sulphate 

generated the lowest protection level for the eggplant plants (Solanum melongena 

L.), having an efficiency of 82.8%. 

The protection 

ability 

of the 

control 

agents 

(%) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

V1 V2 V3 V4 V5 V6 


Lycopersicon 


GA% 

Lycopersicon 


E% 

Solanum 


GA% 

Solanum 


E% 


copper sulphate) from the treatments used against the contamination with Erwinia 

carotovora 

phytopathogen bacteria on Lycopersicon esculentum L. and Solanum 

melongena L. plants. 

From the correlation of the experimental data registered, by investigating the 

possibilities to control the bacteria from Xanthomonas campestris pv. vesicatoria,



Pseudomonas syringae pv. tomato and Erwinia carotovora stems, it results that 

there is a relation between the type of the element 

used (biopreparation, antibiotic 

or copper 

sulphate) as a control agent and the sensitivity of the phytopathogen 

bacteria to it’s action. 


The preliminary researches regarding the laboratory testing of the BSP+BSV and 

the B4 biopreparations performed for the biological control of the phytopathogen 

bacteria (Xanthomonas campestris pv. vesicatoria, Pseudomonas syringae pv. 

tomato and Erwinia carotovora) in the 

first vegetation stages for Lycopersicon 

esculentum 

L. and Solanum melongena L., lead to some experimental results that 

allow us to draw the following conclusions: 

- the treatments based on the biopreparations tested also presented a 

biostimulating effect on the tomato plants (Lycopersicon esculentum L.) and on the 

eggplants (Solanum melongena L.) treated, by providing them a vigorous aspect 

and by stimulating the resistance effect against the phytopathogen bacteria; 

- in the case of using the biopreparations obtained from stems of the 

Bacillus subtilis bacteria there was found that the precontamination with the 

experimental stems had induced protection at a satisfactory level and comparable 

to both that obtained by using the classical antibiotic (cefotaxime) and the one 

obtained by using the copper sulphate; 

- the protection phenomenon appeared in all the contamination moments 

after 

the application of the biological products tested. Consequently, based on the 

experimental data registered there can be noticed that the biopreparations obtained 

from various Bacillus subtilis stems induced the protection 

of the treated plants 

with a very good efficiency. 

The preliminary researches performed 

by us recommend the application of the 

treatments based on the two biopreparations obtained by INCDCF - ICCF for the 

biological control of the phytopathogen bacteria (Xanthomonas campestris pv. 

vesicatoria, Pseudomonas syringae pv. tomato and Erwinia carotovora), in the 

first vegetation stages for Lycopersicon esculentum L. and Solanum melongena L. 

References 

1. Antoce Arina Oana, Dinu Laura Dorina: Microbiologie - Principii si tehnici de 

laborator, Bucuresti, Ed. CERES, 2002, p. 1-205. 

2. Baicu T., Şesan Tatiana Eugenia: Fitopatologie agricolă, Bucureşti, Ed. 

CERES, 1996, p. 11-316.



3. Brezeanu Aurelia, Cogălniceanu Gina: Caracterizarea electronomicroscopica 

a modificarilor induse de excesul hidric asupra fazelor 

incipiente ale 

dezvoltarii postembrionare la Nicotiana tabacum L. (Cv. xanthi). In: 

Vitroculturile la cormofite: modele experimentale 

în cercetările biologice, Al 

XIII-lea Simp. Naţ. de Cult. de Ţes. şi Cel. Veg., Sighişoara, Editori D. Cachiţă 

- Cosma, A. Ardelean, Satu Mare, Ed. Bion, 2005, p. 19-27. 

4. Franco Marcela, Guevara G., Mesa N., Urueña Gloria: Hardening of 

the 

national flower 

of Colombia, the threatened Cattleya trianae (Orchidaceae), 

from in vitro culture with previous invigoration phase. In: Rev. Biol. Trop., 55 

(2), 2007, p. 681 - 691 

5. 

(http://www.ots.ac.cr/tropiweb/attachments/volumes/vol55-2/31-Franco- 

Hardening.pdf). 

Geamăn Săndulescu Emilia, Geamăn I.: Microbiologie - Lucrări practice, 

Atelierul de tipografie USAMV, Bucureşti, 2001, p. 1-154. 

6. Gheorghieş C., Geamăn 

I.: Bolile plantelor horticole, Bucureşti, Ed. 

UNIVERSITAS Co, 2003, p. 1-325. 

7. Gerhardson B.: Biological substitutes for pesticides. In: Trends in 

Biotechnology, 20 (8), 2002, p. 338 – 343 

8. 

(http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TCW- 

469GJ6P- 

G&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000 

050221&_version=1&_urlVersion=0&_userid=10&md5=71bafeeb9bdc084edd 

403bff106e7fdd). 

Higdon Jane: An Evidence-Based Approach to Vitamins and Minerals, New 

York, Thieme Medical Publishers, 2003, p. 268. 

9. 

Severin V., Iliescu C. H.: Bolile bacteriene ale plantelor, Bucureşti, Ed. 

GEEA, 2006, p. 3-279.



SPATIAL CLIMATE VARIABILITY AND VITICULTURE 

IN THE REGIONS: SOUTH-BANAT, SHUMADIA- 

DANUBE 

AND TIMOC OF SERBIA 

N. PETROVIC * B. SIVCEV * I. TOSIC ** A. VUKOVIC * Z. 

RANKOVIC-VASIC * 

Abstract: The climatic changes in last two decades on global level are 

presenting the fact that the planet 

Earth is warning up. Significant temperature 

increasing on global level has consequences in air temperature changing on even 

smaller proportion. 

The aim of this paper was to analyse variability of air temperature and sum of 

precipitation for three an important resource for the production of grapes and 

wines: Vrsac, Negotin and Radmilovac, to be able to analyze their trends. 

Correction of cultivar list was recommended, considering the obtained trends. 

Introduction 

Keywords: climatic changes, grapevine cultivar list, trends of 

meteorological elements. 

Climatologic investigations were done throughout the world show significant in 

changes values of basic meteorological elements (John, 1991; Moonnen, et al., 

2002; 

Sara, et al., 2005; Soon, et al., 2000). Planet global warming is considered to 

be consequence of human 

factor (Vinikov and Grody, 2003). Variation in solar 

energy 

emission can cause 

climatic changes in the periods of even a few decades 

(Soon et al., 2000). In the temperate zone latitudes, until 2030, increasing of the air 

temperature during the summer months of 3°C is expected, decreasing of summer 

precipitation by 5-15%, and decreasing the soil humidity by 15-25% (John, 1991). 

This meteorological and climatological elements are very important for successful 

grape growing. There 

are needs of selections and introduction of new varieties 

which will be more promising for cultivation in new conditions (Grzesik, 2007). 

* Faculty of Agriculture, Nemanjina 6, 11081 Belgrade-Zemun, Serbia 

** Faculty of Physics, Institute of Meteorology, Dobracina 16, 11000 Belgrade, Serbia.




The autors used meteorological data of representative location for three 

viticulture regions of Serbia with mild-continental climate. Trends evaluation was 

done by the Kendall test (WMO, 1966), where trend of 95% on the level of 

confidence is accepted. This test is recommended 

for the time series analysis 

(Malisic, 2002). 

Trend analysis was done, 

based on the data for an important resource for the 

production of grapes and wines: Vrsac station-Sauth Banat-Pannonia plain, 

Negotin station-Timoc-East Serbia and Radmilovac station-Shumadia Danube 

(H=83m, φ=45 09 N, λ=21°19’ E; H=42m, φ= 44°14’ N, λ=22°33’ E; H=124m, 

φ=44°45’ N, λ=20°35’ E) succeesive. 

The analysis of air temperature was done for: mean year temperature (tyear ), mean 

temperatures for the period April-October (t4-10 ), mean monthly temperature for 

April, May, Jun, July, August, September, October, separately (time series: 1980- 

2006). The analogy was done for Maximum air temperature, Minimum air 

temperature and Amount of precipitation. 


Test results for trends of the time series (1980-2006) are in accordance with the 

results obtain by different team experts (Ventura et al., 2002; Sara et al., 2005; 

Tosic, 2007; Petrovic et al., 2006; Petrovic, 2007; Petrovic et al., 2007). Trend of 

significance for the 95% level of confidence was increasing, for mean annual air 

temperature (Fig. 1) and mean air temperature for the period April-October (Fig. 

2). Based on linear equation, for more exactly trends, the values of mentioned 

meteorological elements, can be predicted. The increase temperature is the best at 

Radmilovac-Shumadia-Danube area, and the smallest increase is at Vrsac-Sought 

Banat-Pannonia plate (Fig. 1, Fig. 2). 

Radmilovac-Shumadia has the significant trends of mean mounthly 

temperature 

(Jun, July, August, October). It will be: 1.0;1.1;0.9;0.1°C, per 10 years, succeesive. 

Negotin area and Vrsac 

area has the les increase of mean mountly temperatures: 

Negotin 

(May-0.9°C, Jun-0.9°C, July-0.9°C, August-1.0°C/per 10 years) and Vrsac 

(Jun-0.9°C, July-0.9°C/per 10 years). It is the consequence of low position 

meteorological 

stations at Vrsac and Negotin (Pannonia plate and East Serbia 

plate). The best position vineyards at that district are up, at the hills with Sought 

(S), Sought-East (SE) exposition. 

Trends of minimal temperatures are significant and increases at Vrsac (for July, 

August and for period of vegetation) and Negotin (for August and for period of



vegetation). Trends of minimal temperatures are not significant for April and May. 

There is a risk of extreme low and high temperatures. 

Based on air trends, it is 

necessary to correct a list of recommended grapevine cultivars. 

Amount of precipitations has high variability. Trends for each of defined periods 

was not at 95% level. 

Conclusion 

The climatic changes in last two decades on global level are presenting the fact 

that the planet Earth is warning up. Significant temperature increasing on global 

level has consequences 

in air temperature changing on even smaller proportion. In 

the temperate zone latitudes, until 2030, increasing of the air temperature during 

the summer months of 3°C is expected, decreasing of summer precipitation by 5- 

15%, and decreasing the soil humidity by 15-25%. 

The autors used meteorological data of representative location for three viticulture 

regions of Serbia with mild-continental climate. Trends evaluation was done by the 

Kendal test (WMO, 1961), where 

trend of 95% on the level of confidence is 

accepted. Test results for trends of the time series (1980-2006) 

are in accordance 

with the results obtain by different team experts (Ventura et al., 2002; Sara et al., 

2005; Tosic, 2007; Petrovic 

et al., 2006; Petrovic, 2007; Petrovic et al., 2007). 

Trend of significance for the 95% level of confidence was increasing, for mean 

annual air temperature (Fig. 1) and mean air temperature for the period April- 

October 

(Fig. 2). 

Negotin 

area and Vrsac area has the les increase of mean mountly temperatures: 

Negotin (May-0.9°C, Jun-0.9°C, July-0.9 °C, 

August-1.0°C/per 10 years) and Vrsac 

(Jun-0.9°C, July-0.9°C/per 10 years). It is the consequence of low position 

meteorological stations at Vrsac and Negotin (Pannonia plate and East Serbia 

plate). The best position vineyards at that district are up, at the hills with Sought 

(S), Sought-East (SE) exposition. 

There is a risk of extreme low and high temperatures. 

Amount of precipitations has high variability. Trends for each of defined periods 

was not at 95% level. 

Based on the air trends, it is necessary to correct a list of recommended grapevine 

cultivars.

t mean ( o C) 

t mean ( o C) 



13.5 

13 

12.5 

12 

11.5 

11 

10.5 

t mean = 11.1659 + 0.038849*t 

13.5 10 

1980 t = 10.1013 1985 + 0.079274*t 

1990 1995 

mean 

t (years) 

13 

2000 2005 

12.5 

12 

11.5 

11 

10.5 

10 

9.5 

1980 

t mean ( o C) 

t mean ( o C) 

19.5 

19 

18.5 

18 

17.5 

17 

16.5 

16 

19.5 

15.5 t = 15.8755 + 0.081153*t 

19 1980 mean 1985 1990 

t (years) 

1995 2000 2005 

18.5 

18 

17.5 

17 

16.5 

16 

15.5 

1985 1990 1995 2000 2005 2010 

t (years) 

t mean = 16.9725 + 0.043223*t 

15 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

t ( o C) 

mean 

10 

1980 1985 1990 1995 

t (years) 

2000 2005 2010 

Fig. 1. Trend of mean annual air 

temperature for: a) Vrsac, b) Negotin 

and 

c) Radmilovac (1980 – 2006) 

Fig. 2. Trend of mean air temperature 

for the period April-October– t (4–10) 

for: a) Vrsac, b) Negotin, and c) 

Radmilovac (1980 – 2006) 

References 

1. John, H.: Scientific Assessment of Climate Change; Summary of the IPCC 

Working Group I Report, pp. 23-45. 

Proceeding of the Second World 

13.5 

13 

12.5 

12 

11.5 

11 

10.5 

t mean ( o C) 

15 

14 

13 

12 

11 

10 

9 

t mean = 10.8134 + 0.0587*t 

t mean = 11.3382 + 0.042247*t 

8 

1980 1985 1990 1995 

t (years) 

2000 2005 2010



Climate Conference.Climate Change:Science, Impacts and Policy. 

Cambridge University press., 1991, pp. 578. 

2. Moonen, A., Ercoli, L., Marioti, M. and Masoni, A.: Climate change in 

Italy indicated by agrometeorological 

indices over 122 years. Agricultural 

and Forest Meteorology, 2002., Vol. 111, Is. 1. pp.13-27. 

3. Sara del Rio, Penas, A.. and Fraile, R.: Analysis of recent climatic 

variations in Castile and Leon (Spain). Atmospheric Research., 2005., Vol. 

73, Is.1-2. pp. 69-85. 

4. Soon, W., Posmentier, E. and 

Baliunas, S.: Climate hypersensitivity to 

solar forcing? Ann. Geophys.-Atm. Hydr, 2000.,18(5). pp. 583-588. 

5. Vinnikov, K. and 

Grody, N.: Global warming trend of mean tropospheric 

temperature observed by satellites. Science, 2003., 302. pp. 269-272. 

6. WMO.: Climatic Change. Tech. Note, No 79. WMO, Geneva, 1966., 

(Kendall and Stuart, 1966), pp. 79. 

7. Soon, W., Posmentier, E. and Baliunas, S.: Climate hypersensitivity to 

solar forcing? Ann. Geophys.-Atm. Hydr., 2000., 18(5). pp. 583-588. 

8. Gryesik, M.: Raport 

from the Workshop Cost Action 858 “Vineyard under 

environmental constraints: Adaptations to climate change”, 18-20. October 

2007 in Lodz, Poland, pp. 5 

9. Mališić, J.: Time series. Faculty of Mathematics, Belgrade University, 

2002., pp. 304. 

10. Ventura, E., Rosso, P. and Ardizzoni, E.: Temperature and precipitation 

trends in Bologna (Italy) from 1952 to 1999. Atmos. Res., 

2002.,61, pp. 

203-214 

11. Tosic, I.: Spatial and temporal variability of winter and summer 

precipitation 

over Serbia and Montenegro. Theor. Appl. Climatol., 2004., 

77, pp. 47-56 

12. Petrovic, N., Tosic, I., Sivcev, B., Cirovic, N.: Air temperature trends in 

the Nis-South Morava vinegrowing area and recommended grapevine 

cultivars. Journal of Agricult. Sciences, Belgrade., 2006., Vol. 51, No 1, 

pp. 61-70 

13. Petrovic, N.: The weather, climate and grapevine. Monofraph, University 

of Belgrade, 2007, F aculty of Agriculture, 2007., 

pp. 83. 

14. Petrovic, N., Tosic, I., Sivcev, B.: Climatic change,quota and quolity 

of 

grapes. Monograph, University of Belgrade, Faculty of Agriculture, 2007., 

pp. 

100.



THE EVALUATION OF STIMULATIVE AND 

PROTECTIVE EFFECT INDUCED BY TREATMENTS 

WITH BIOCONTROL AGENTS ON PLANT 

DEVELOPMENT 

F.E. HELEPCIUC ∗ , E.M. MITOI ∗ , A. BREZEANU ∗ , C.P. 

CORNEA ∗∗ , C.VOAIDES ∗∗ 

Abstract: There are a lot of references [1, 2, 3] which describe the potential use of plant 

associated bacteria as agents that can stimulate plant growth and that can also manage 

microorganisms’ interrelations in soil ecosystem in order to promote plant health. Plant 

growth promoting bacteria (PGPB) are associated with many plant species and are 

commonly present in many environments. The most studied group is plant growth 

promoting rhizobacteria (PGPR) that colonize root surfaces and closely adhere to soilrhizosphere 

interface. This article approaches the involvement of these bacterial strains in 

plant growth promotion. More specifically, the experiments determined the effect of PGPR 

colonization on tomato seed (germination rate) and on tomato plants (length of the root). 

Because reduction of disease incidence and stimulation of plant growth were often 

observed in soil enhanced with Pseudomonas and Bacillus strains, several Pseudomonas 

spp. and some Bacillus licheniformis strains with antagonist activity against a broad range 

of phytopathogens were selected. The bacterial strains used were P7, P14, P18, B40, tB40, 

mB40, while the fungal pathogens were represented 

by Alternaria tenuis and Pythium 

debaryanum. Initially, an inhibition of seed germination was observed among the variants 

treated with bacterial suspension, but in later stages a progressive rate of germination was 

determined. The indole 3-acetic acid (IAA) concentration produced by bacterial strains in 

liquid medium was correlated with plant growth. Thus, the length of the roots and shoots 

from plants treated with bacteria were measured. A difference between the length of the 

roots and the length of the shoots was detected based on these data. An existing small 

correlation between the length of the roots and length of the shoots indicates a low 

dependence of them, suggesting that development of the root was additionally stimulated 

probably by bacterial secreted auxines. 

∗ Institute of Biology, Bucharest, Romania, e-mail: monica.carasan@ibiol.ro 

∗∗ Faculty of Biotechnology, USMV, Bucharest, Romania, pccornea@yahoo.com



Keywords: PGPR, auxin, root colonization, seed germination 

Introduction 

Germinating seeds and growing plants influence the activities of soil 

microorganisms, and subsequently these microorganisms influence rhizoplan 

development and plant growth. Some of the microorganisms (e.g., the so-called 

plant-growth-promoting rhizobacteria) may enhance plant health and productivity 

by synthesizing phytohormones, increasing the local availability of nutrients, 

facilitating the uptake of nutrients by the plants, decreasing heavy metal toxicity in 

the plants, antagonizing plant pathogens, and inducing systemic resistance in the 

plants to pathogens [4]. 

IAA-producing bacteria were initially identified as inducers of tumors in plants 

[5], but consequently production of IAA was also detected in beneficial bacteria, as 

nitrogen-fixing bacteria and PGPR [6]. This work studies the ability of some 

antipathogenic bacterial strains to produce IAA and to promote tomato plant 

growth and development. 


Bacterial and fungal culture 

Cultures of the selected strains (Bacillus licheniformis B40, mB40, tB40 and 

Pseudomonas spp. P7, P14, P18) were grown for four days at 28 0 C on CPM 

medium. Bacterial cultures used were both simple and mixed (mix P – contain all 

Pseudomonas strains). In the case of the pathogens (Alternaria tenuis and Pythium 

debaryanum), a spore suspension was prepared by washing the fungal cultures 

(grown for 7 days in Petri plates with solid Sabouraud medium at 28 0 C) with 10 ml 

of sterile distilled water. 

Tomato seed treatment with bacteria and /or fungal pathogen inoculation 

Tomato seeds were sterilized by immersion for 15 min in a solution of 5% 

sodium hypochlorite and than washed for five times with sterile distilled water. 

They were aseptically transferred in sterile Petri plates and treated with bacterial 

suspension for 15 min. The soil was sterilized in three consecutive days for 60 min 

at 121 0 C. After this treatment, seeds were placed in pots with 450 g of sterile soil. 

At 8 days from seeding each pot was inoculated with 5 ml of fungal pathogen 

suspension.



Morphometrical parameters 

The effect of bacteria and fungi on tomato seeds germination rate was monitored 

daily by counting of seedling for 14 days. For each variant, 15 samples were 

statistical analyzed. The rate of plant growth was determined at 21 days from 

seeding, by roots and shoots length measurement and leaf counting. These data 

were statistical analyzed. 

Quantification of IAA production 

The bacterial strains tested were incubated for 96 hours, at 30°C on NB medium 

suplemented with 500 µg/ml tryptophan. The supernatant resulted by cultures 

centrifugation (10.000 rpm, 15 min) was filtered using a sterile bacteriological 

filter and used for IAA concentration measurement. The method of IAA 

quantification consist in mixing of samples with Salkowski reagent which contains 

0.5 M FeCl3 and concentrated H2SO4 [6], and keeping it at room temperature for 

20 min. Transition of the color to pink indicates a positive reaction. The 

absorbance was measured at 535 nm, and the concentration of IAA in each sample 

was determined using a standard curve. The IAA produced by each strain was 

measured in triplicate. 


The influence of antagonist bacteria on tomato seed germination 

In this part of the experiment the effect of bacterial strains P 14, mix P and B40 

colonization on tomato seed germination was determined. Initially, the results did 

not showed a positive influence on germination rate. 

% 

30 

25 

20 

15 

10 

5 

0 

M B40 P14 mix P 

% of germinated 

seed at 7 days 

from inoculation 

Fig. 1. The effect of treatment 

with bacterial suspension on 

tomato seeds germination.



In early stages, at 7 days after seeding an inhibition of the seed germination 

among the variants treated with bacterial suspension was observed. Moreover, the 

seed pretreated with mixture of three Pseudomonas strains (mixP) were strongly 

inhibited. 

The fungal pathogen infection induced germination rate decreases in both 

variants inoculated with Alternaria tenuis or Pythium debaryanum. 

After 12 days from seeding an increase of the germination rate to all variants was 

observed, some of them having a germination rate even higher than the control. In 

the B40 variants the germination rate increases comparing with the control and 

decreases in variants with pathogen. Moreover, in all pathogen-treated variants the 

rate of germination is lower than that of bacteria-treated variants. 

6 

5 

4 

3 

2 

1 

0 

M A Py B40 B40-A B40-Py P14 P14-A P14-Py P P-A P-Py 

rate of germination after 

7 days from seeding 

rate de germination after 

12 days from seeding 

Fig. 2. The effect of mixed treatment (bacteria and fungi) on germination rate 

after 7 days respectively 12 days from inoculation. 

The germination rate is constant in the case of the control sample during the first 

two weeks of monitoring, while the variants treated with bacterial suspension had a 

progressive rate of germination. In the samples pretreated with P14 bacterial 

suspension the effect of fungal pathogen on seed germination was diminished. 

21 days after, the percent of germinated seeds records a considerable increase 

in the case of the variants treated with P mix. Also, the seeds from the sample 

treated with P14 strain, germinated in proportion of 100%.

cm 



100 

90 

80 

70 

60 

% 50 

40 

30 

20 

10 

0 

M A Py B40 B40- A B40- Py P14 P14-A P14- Py P P- A P- Py 

% germination af ter 7 days 



Fig. 3. Seed germination percent at different intervals from inoculation. 

The effect of bacteria on plant growth promotion and correlation with IAA 

production 

In the last part of the experiment it was determined if bacterial colonization of 

root influences the plant growth, by measuring the length of the roots and shoots. 

The plants treated with mix P had the longest roots, length that was not correlated 

with the length of the shoots. 

12.0 

11.0 

10.0 

9.0 

8.0 

7.0 

6.0 

5.0 

4.0 

3.0 

2.0 

1.0 

0.0 

B40 B40 - A B 40 - Py P14 P14 - A P14 - Py P P - Py PA M 

A B 

cm 

10.0 

9.0 

8.0 

7.0 

6.0 

5.0 

4.0 lungimea 

radiculara 

3.0 

2.0 

1.0 

0.0 

B40 B40 - A B40-Py P14 P14 - A P14 - Py P P - Py PA M 

Fig 4. The length of roots (A) and shoots (B) from tomato plants treated 

with antagonist bacteria and/or inoculated with 

fungal pathogen Alternaria tenuis 

and Pythium debaryanum 

respectively 

The weak correlation between the length of the 

root and shoot shown in Fig. 5 

indicates a low dependence between these two parts of the plant. The highest 

correlation between the length of the root and the shoot was observed in the case of



the control. This indicates that the root development in control was not stimulated 

as the roots of the bacterial treated variants were. 

1 

0.9 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0 

This observation suggested that 

development of the root in case of 

colonization with mix P was 

probably additionally stimulated by 

B40 B40 - A B40-Py P14 P14 - A P14 - P P - Py PA M 

bacterial IAA production. 

Py 

The influence of bacterial 

treatment on plant roots elongation was in correlation 

with the results obtained 

after the quantification of the IAA concentration 

produced by bacteria. The 

greatest quantity of IAA was produced by the P7 strain that has the lowest 

inhibitory activity on the fungal phytopathogens, followed by B40 strain. In P mix 

variant, IAA concentration is the 

same as that produced by P7. In dual cultures of 

B40 and P7 strains, the synthesis 

of IAA was not higher than in monocultures. 

Comparing with other results [7] the quantity 

of IAA produced by the tested strains 

is smaller. 

ed that growth of primary root is stimulated by 

ls of IAA, typically between 10 

ted by higher IAA concentration [6]. 

-9 and 10- 12 However, some studies show 

application of relatively low leve 

M and 

is inhibi 

Fig. 

6. Production of 

IAA 

by selected bacteria in 

monoculture (Pseudomonas 

spp. 

P7, P14 P18 strains and 

Bacillus 

licheniformis B40, 

mB40, t B40 strains) and 

coculture 

(mixed culture of all 

three Pseudomons strains and 

dual 

culture of B40 with P7 

strain). 

ml 

Φg/ 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

Fig. 5. The interrelation between 

length of roots and shoots. 

P7 P 14 P18 B40 t B 40 m B40 P B B 40+P 7



Conclusions 

The seed pretreatment with bacterial suspension induce a delay of germination, 

subsequently the germination rate increasing very fast. 

The administration of pathogen determined a decrease of germination rate, but in 

case of pretreatment with P 14 strain the negative effect was reduced. 

The root length of pretreated plants was probably influenced by the IAA 

produced of bacteria or mixed bacteria. 

References 

1. Cornelis, P., Matthijs, S.: Diversity of siderophore-mediated iron uptake 

systems in fluorescent pseudomonads: not only pyoverdines. In: 

Environmental Microbiology, 

vol. 4 (12), 2002, p. 787–798. 

2. Delany, I., Sheehan, M. M., Fenton, A., Bardin, S., Aarons, S. and O’Gara, 

F.: Regulation of production of the antifungal metabolite 2,4diacetylphloroglucinol 

in Pseudomonas fluorescens 

F113: genetic analysis 

of phlF as a transcriptional repressor. In: Microbiology, vol. 146, 2000, p. 

537-546. 

3. Wang, C., Wang, D., şi Zhou, Q.: Colonization and persistence 

of a plant 

growth promoting bacterium Pseudomonas fluorescens strain CS85, on 

roots of cotton seedlings. In: Can. J. Microbiol. vol. 50, 2004, p. 475–481. 

4. De Bellis, P., Ercolani, G. L.: Growth Interactions during Bacterial 

Colonization of Seedling Rootlets. In: Appl Environ Microbiol., vol. 67(4), 

2001, 

p. 1945–1948. 

5. Comai, 

L., Kosuge, T.: Involvement of plasmid deoxyribonucleic acid in 

indoleacetic 

acid synthesis in Pseudomonas savastanoi. In: Journal of 

Bacteriology, 

vol 143(2), 1980, p. 950-957. 

6. Patten, C. L., Glick, B. R.: Role of Pseudomonas putida Indoleacetic Acid 

in Development of the Host Plant Root System. In: Applied and 

Environmental Microbiology, vol. 68 (8), 2002, p. 3795-3801. 

7. Leveau, J. H. J., Lindow, S. E.: Utilization of the Plant Hormone Indole-3- 

Acetic Acid for Growth by Pseudomonas putida Strain 1290. In: 

Applied 

and Environmental Microbiology, vol. 

71(5), 2005, p. 2365-2371.



TH E SELECTION OF YEAST STRAINS SUITABLE FOR 

GROWTH ON APPLE RESIDUES 

* 

D. KREGIEL , A. CZYZOWSKA, W. AMBROZIAK 

Abstract: The strains of yeast, belonging to fermenting, fodder, deacidifying and 

xylose fermenting 

yeast, were cultivated on apple pomaces and were checked for 

their ability to produce SCP. The strain Candida tropicalis in the efficient way 

produced high amount of protein biomass. In the case of yeasts 

Schizosaccharomyces pombe and Pachysolen tannophilus the amount of the 

reached microbial biomass was the smallest. 

Introduction 

Keywords: apple pomace, yeasts, biomass. 

The production 

of apples is estimated to be 46.1 million tones in 2007. In 

Poland almost 2 million tones of fruits per year is processed. Among this number, 

the apples make 60% and apple pomaces constitute 90% out of all pomaces 

[Nawirska, 2007]. 

Apple pomace is a lignocellulosic substrate. Apart from a high fibre content 

including cellulose, hemicellulose, pectin and lignin, it contains both mono- and 

disaccharides [Villas-Bôas et al., 2002a,b]. Since the material is rich in high-value 

components, its utilization is essential from both economical and environmental 

point of view. 

Apple pomace is nowadays used as an animal feed but several factors make it 

inadequate for that purpose. Firstly, the residue has low digestibility due to high 

lignin/cellulose ratio. Secondly, 

the level of proteins, vitamins and minerals should 

be increased in order the residue have high nutritional level. In addition, the 

problem of animal alcoholaemia exists due to consumption by ruminants of apple 

pomace of high free sugar content. Lastly, apple pomace is a by-product of very 

low acidic pH. 

The aim of the experiment was to determine the most suitable yeast strains 

that are able to grow on apple pomaces in the most efficient way and increase it 

nutritional value. 

* Institute of Fermentation Technology an Microbiology, Technical University of Lodz, Poland, e- 

mail: dkregiel@p.lodz.pl




During this research 11 strains of yeast collected from the Pure Culture 

Collection of the Institute of Fermentation Technology and Microbiology of 

Technical University of Lodz were tested [Stobińska et al., 1999]. 

The studied yeasts belong to four categories: Fermenting yeast (i.e. 

Saccharomyces cerevisiae), fodder yeast (i.e. Candida utilis, Candida tropicalis), 

deacidifying 

yeast (i.e. Schizosaccharomyces pombe) and xylose fermenting yeast 

(i.e. Pichia 

stipitis, Pachysolen tannophilus, Metchnikowia pulcherrima). 

The apple 

pomace was obtained from the Polish winery in Skierniewice. This 

pomace was received by the treatment of the apples pulp with pectinases and 

extraction with water. Not to let the apple pomace spoil, one portion was frozen 

and the second dried and milled into 1 mm diameter particles. 

The yeast strains were cultivated aerobically at 25ºC on apple pomace 

supplemented in 0.3% (NH4)2SO4, 0.1% KH2PO4, 0.05% MgSO4·7H2O and 0.05% 

yeast extract. 

After the incubation, the number of viable cells in the obtained culture was 

determined by the plate count method. 

Results 

The number of live, active yeast cells after aerobic cultivation in pomaces as 

CFU×10 6 /g are presented on the Figure1. All the tested yeast strains were able to 

grow under aerobic conditions. The highest yield of biomass was obtained in the 

case of Candida tropicalis ŁOCK 0003 and Saccharomyces cerevisiae ŁOCK 0133 

Saccharomyces cerevisiae ŁOCK 0132 strains. These strains multiplied with 

similar efficiency. However the smallest yield of biomass was seen in the case of 

all Schizosaccharomyces pombe strains and Pachysolen tannophilus. These strains 

were auxotrophs requiring additional growth stimulators. That, perhaps, could be 

an explanation of the poor number of yeast cells seen after their aerobic cultivation 

in apple pomaces. 

The examples of chromatograms show below presented typical apple pomaces 

before (Fig. 2a) and after aerobic cultivation conducted with yeasts (Fig. 2 bc), 

showing one broad peak that stands for the compounds that are not utilized by the 

yeast. The higher deacidifation properties were seen in the case of Candida sp. 

Althouh Candida sp. strains showed the best deacidification properties.

500 

400 

300 

200 

100 

0 



Candida utilis ŁOCK 

0021 

Saccharomyces 

cerevisiae ŁOCK 0132 

Saccharomyces 

cerevisiae ŁOCK 0133 

Candida tropicalis 

ŁOCK 0007 

Candida tropicalis 

ŁOCK 0003 

Schizosaccharomyces 

pombe ŁOCK 1243 





Pichia stipitis ŁOCK 

0047 

Pachysolen 

tannophilus ŁOCK 

0043 

Metschnikowia 

pulcherrima ŁOCK 

0034 

Fig. 1. The number of yeast cells of different strains (CFU×10 6 /g) after aerobic 

cultivation in apple pomaces. 

Fig. 2a. The composition of pomace before yeast cultivation with 

broad peak 1,2 of 

not identified compounds and peak 5 of fructose and malic acid. 

Fig. 2b. Schizosaccharomyces pombe ŁOCK 0243 - chromatogram after aerobic 

cultivation of yeast in apple pomaces



Fig. 2c. Candida utilis ŁOCK 00021 - chromatogram after aerobic cultivation of 

yeast in apple pomaces 

Conclusions 

The results of experiments confirm that selection of the strains is the 

crucial step in the choosing of the proper yeast strains for effective utilization of 

such specific substrate as apple 

pomace. It can be concluded that the process of 

effective utilization of wastes is economical and probable to be used on larger, 

industrial scale. 

References 

1. Nawirska A., Zagospodarowanie odpadów z przemysłu owocowo- 

warzywnego. Przemysł Fermentacyjny i Owocowo-Warzywny, 2007, 10, 

44-46 (in Polish). 

2. Stobińska H., Kozanecka E., Kręgiel D.Katalog czystych kultur 

drobnoustrojów 

przemysłowych, PŁ, Łódź, 1999 (in Polish). 

3. Villas-Bôas S.G; Esposito E., Matos de Mendonça M., Novel 

lignocellulolytic ability of Candida utilis during solid-substrate cultivation 

on apple pomace. World Journal of Microbiology and Biotechnology, 

2002a, 18, 541–545. 

4. Villas-Bôas S.G; Esposito E., Mitchell D.A., Microbial conversion of 

lignocellulosic residues for production of animal feeds., Animal Feed 

Science and Technology, 2002b, 98, 1–12.



THE SIGNIFICANCE OF NITROGEN-FIXER AS A 

BIOFERTILIZER IN ORGANIC PRODUCTION 

G. CVIJANOVIC * J. SUBIC ** G. DOZET **17 

006-2007. Prior to sowing, 

maize seed is being treated with liquid inoculates of pure species (Azotobacter 

on of humic 

uded that nitrogen fixers had significant influence on maize yield 

hest average yields are being achieved by fertilization with 90 kgN.ha -1 

and 120 kgN.ha -1 (10,23 t.ha -1 ). That is higher for 890 kg.ha -1 Abstract: Nitrogen fixers are various soil bacteria which, except capability to fix 

atmospheric nitrogen, live in association with host plant and stimulate its growth by 

production of biologically active substances which influence on seed germination. 

Nitrogen fixers are very important for sustainable agriculture because their 

application increases soil fertility and soil’s nitrogen balance so that consumption of 

mineral fertilizers can be reduced. This decreases production inputs and in the same 

time enables production of healthy food which is a base of sustainable agriculture. 

This paper work presents the effect of various types of nitrogen fixers on maize yield 

rate (FAO group of maturation 600-700) by fertilization with different amounts of 

mineral nitrogen (6, 90, 120, 150 kgN.ha 

i.e. 860 

-1 -1 -1 

-1 ) in period 2 

chroococcum and Azotobacter vinelandi) and their mixture with additi 

acid. It is concl 

rate. The hig 

(10,26 t.ha -1 ) 

kg.ha than yield rate gained with fertilization of 150 kgN.ha (9,37 t.ha ). 

Consumption of microbiological fertilizers can have very positive effect for 

producers if we consider areas under maize production. In that context we underline 

the following production benefits: yield increase; possibility for reduction of 

mineral fertilizers application; positive effect on soil. 

Keywords: nitrogen fixers, fertilization, yield, maize, economic effect. 

Introduction 

Sustainable agricultural 

production bases on ecological principles, aiming to 

protect 

bio-diversity by using natural disposable resources. The strategic of 

sustainable agriculture had been passed on UN conference in 1992 and had 

represented wide fan of agricultural methodologies, which had for a goal – 

environment preservation. In high-developed countries in the world, where is the 

* Faculty of Biofarming, University Megatrend, Sombor, Serbia, e-mail: cvijagor@yahoo.com 

** Institute of Agricultural Economics, Belgrade, Serbia, e-mail: 

jonel_s@mail.iep.bg.ac.yu 

*** Faculty of Biofarming, University Megatrend, Sombor, Serbia.



highest 

interest for organic products, the organic production is developing in 

accordance with many regulations, laws and international standards. In such a way 

the European Union (by regulatory rules EEC No 2092/91) has issue standards for 

organic products, in Japan was regulated by JAP, and in USA this field was defined 

by NOP standards. 

In organic production, as a part of sustainable technology of agricultural 

production, uses scientific discoveries based on modern way of ecology 

comprehension, and multi-disciplinary 

sciences which promote bio-diversity 

improvement, 

substance circulation and biological activeness of soil. Such are 

scientific discoveries in the field of microbiology and appliance of biological 

fixation of the nitrogen. 

Natural phenomena of atmospheric nitrogen fixation by special group of microorganisms 

got its practical appliance in organic production, aiming at soil 

protection as natural and national resource of every country. 

Harmful substances in the soil are those, which take part in soil and other agroecosystems 

(directly linked to soil) degradation, due to their phytotoxic effect. These 

substances are dissolved forms of almost any biogenic elements, brought in the most 

often through fertilizers, since fertilizing is a basic measurement for increasing yield 

of grown plants. Applying outstanding quantum of mineral nitrogen fertilizers, there 

could come to soil degradation, rinsing nitrate nitrogen into soil solution and 

underground courses, then vaporizing of nitrogenic oxides into atmosphere and other 

side 

effects (D. Kovačević et.al, 2005). 

Nitrogen fixers have significant 

role in nitrogen forms circulation in nature. 

Fixation 

of nitrogen in the cycle of biological fixation is the most important 

component 

in the nature, with its emphasized importance in organic production. 

Wani et al. (1994) find that about 175 million tons of nitrogen fix by biologic 

fixation, thereof 79% are fixing soil systems. Among the nitrogen fixation, they 

stimulate biological substances which decrease number and activity of 

phytopathogenics and thereby help a growth of plants (Jemcev, 2004). Their 

appliance stimulates biological activity of soil, increases the amount of organic 

nitrogen in soil, and thereby feeding order of soil and more complex nutrition of 

plants, which result by increased yield. In such a way comes to appliance reduction 

of expensive mineral fertilizers and achieves significant economic effect. The 

economic effect can be perceived through need of qualitative development by 

limitation of quantitative growth (Milojić, 1991, Bertili, 1992 Kovačević, 2004). 

Material and working method 

The researches 

were implemented on soil of type poorly-carbonated tchernozem in 

period 

2006-2007. All agrotechnical measurements were realized in optimal deadlines



e maize of FAO group maturation 600-700 was done in 

cons tency of 62.111 plants ha -1 and qualitatively. Sowing th 

is 

. Immediately before sowing was done the seed 

inoculation 

by mixture of associative nitrogen fixers. The mixture was in a liquid 

inoculum, whose cells titer was 15 x 10 elected highe 

enic Urea 46%N in 

sp 

8 ml -1 , and was consisted of s 

ffective kinds of various associative nitrogen fixers. The maize seed, before sowing, 

was inoculated with liquid inoculum of pure kinds: Az-Azotobacter chroococcum, 

Az+Av- Azotobacter chroococcum+Azotobacter vinelandi and their mixture with 

humic acids (Az+ humic acids i Av+humic acids). Basic fertilizing was done in 

autumn by complex NPK fertilizers in relation 15:15:15, and nitrog 

ring time. The amounts and kinds of entered nitrogenic fertilizer were expressing 

values of pure nutrients: N60- 60 kgN ha -1 , N90-90 kgN ha -1 N120- 120 kg ha -1 , N150- 

150 kg ha -1 . The effect of applied measurements was studied on level 14% of kernel 

moisture. 


In last few decades of last century, in practice had been more and more present 

researches and appliance of nonsymbiose-associative nitrogen fixers. 

The effect of certain strains or species can hardly be determined by the 

application of inoculates with mixed species or strains of the same species. If such 

inoculates are based on the principles of a natural ecosystem, or if, due to their 

abundance and efficiency, their starting position is better than the position of the 

autochtonous population, then their effectiveness will be great. 

According to results gained by Burns, 1995, Bachan & Levanony, 1990, 

biofertilization with associative nitrogen fixing bacteria showed a positive effect in 

the production of non-leguminous plants: maize; wheat; sugar beet; potato; 

tobacco, as well as other vegetable crops. 

Studies on the application of Azotobacter, Azospirillum, Derxia, Klebsiella, 

Pseudomonas and others in the production of the most important field crops (maize, 

wheat, sugar beet and sunflower) show that they can, depending on the strain, mode 

-1 

and the form of the application, replace from 20 to 60 kgN. ha . Plant inoculation 

with 

associative nitrogen fixing bacteria and phosphorus as mineralisers significantly 

increases yields and biomass of field crops (Govedarica et al., 1997a, 2001) and 

productive and technological quality of sugar beet (Mrkovački et al. 2007) and 

resistance to phytopathogens (Burns, 1995). The application of biofertilisers provides 

plants with an easier intake of phosphorus and potassium, absorption of active 

growth substances and vitamins, auxins, gibberellins produced by biofertilisers, 

hence it is their advantage over chemical fertilisers. This author also gave the greatest 

contribution to studying of their effects on yield and quality of field crops, as well as



on elements of soil biogeny. Inoculation with Azotobacter chroococcum led to the 

increase of maize yield, while the effect 

depended on the strain, hybrids and the 

amount 

of applied NPK fertilizers. Long-term studies point out to a positive effect of 

different stains of Azotobacter chroococcum on grain yield of maize and applied 

rates of 60 kgN.ha 

d to seed have advantage for making association in relation to 

o 

ge, affect to increasing dynamics of bacteria total 

umber, and some systematic and physiologic groups of microorganisms (fungus, 

azotobacter, actinomicet) and total oxydo-reductive processes, i.e. dehydroac 

vić, 

ition arious nce o 

differently iogenic eleme soi ereb ality y of 

(Nemeth The height d a depe mat enetic bas 

on c all and atu appl otec measurem 

esp 

Th ults sho t th was nt p s dependi 

gro-me cal conditio y zing with 120 

-1 , indicating to a possibility of replacement of certain amount of 

nitrogen mineral fertilizers (Cvijanović, G. et al. 2005, 2006). 

Nitrogen fixers applie 

ther micro-flora in soil, while they are in contact with germinating seed. Nitrogen 

fixers entered by bacterization become competitive with microorganisms from 

microbe congregation, for food and space, which provoke changes in microbe 

congregation. Entered diazotrophs in conditions of various presence of mineral 

nitrogen in different percenta 

n 

genesis 

tivity in soil (Cvijano et al. 2008). 

Entered nitrogen fixers in cond of v prese f mineral nitrogen act 

on b nts of l, and h y on qu and quantit yield 

, 2006). of yiel priori nds on erial g e and 

onditions of rainf temper re, and ied agr hnical ents, 

ecially fertilizing. 

e a nalysis of res ws tha e yield differe er year ng on 

a teorologi 

ns. If ield realized during fertili 

kgN.ha -1 (normal dose) is 100%, then in 2006, increment of yield in combination 

with 90 kgN.ha -1 was 0.9% (110 kg.ha -1 ), and with 60 kgN.ha -1 , the increment was 

2.65% (210 kg.ha - 1) (Tab.1). 

Amount of mineral nitrogen (N kg.ha 

Tab. 1. 

-1 Kinds of inoculates 

) 

60 90 120 150 

Average 

N60-N150 

Az 13.39 12.53 12.27 11.22 12.35 

Az+Av 12.25 11.68 11.77 10.51 11.55 

Az+humic acids 11.93 12.32 11.87 11.37 11.87 

A v+humic acids 12.02 12.19 12.38 11.93 12. 13 

Average 12.39 12.18 12.07 11.25 

Als erved that 07, w agro-m ions were 

favourable for plant pro on, t fluence nocula was signific 

-1 

bigger during fertilizing 90 i 

b. 2). ighest yield 

re rtilizing 120 ha -1 , wh as onl g.ha -1 o is obs in 20 hen eteorological condit less 

ducti he in of i tion antly 

with 120 kgN.ha (Ta The h was 

ali zed during fe with kgN. ich w y for 40 k bigger



than during fertilizing with 90 kgN.ha -1 . Fertilizing with amount of 150 kgN.ha -1 

and inoculation was reversely proportional influenced to height of realized yield. 

This can be defined by big amounts of mineral nitrogen acting inhibitionally on 

nitrogen fixers, while performing enzyme inhibition, responsable for nitrogen 

fixation. 

Tab. 2. 

Amount of mineral nitrogen (N kg.ha -1 Kinds of 

) Average 

inoculates 60 90 120 150 

N60-N150 

Az 8.31 7.93 7.88 7.78 7.98 

Az+Av 7.30 8.39 8.52 7.09 7.82 

Az+humic acid 8.47 8.48 8.99 8.01 8.48 

Av+humic acid 7.77 8.56 8.18 7.01 7.89 

Average 7.96 8.35 8.39 7.64 

There is to be determined, based on correlation análysis, that, in 2-years period of 

research, the inoculation significantly influenced on increment of maize yield using 

smaller doses of mineral nitrogen (Figure 1). Increasing doses of mineral nitrogen 

over 120 kg/ha, the height of yield was not adequate to entered amounts of mineral 

nitrogen. Nitrogen fixers had significant influence on height of maize yield. 

Average yields were realized using fertilizers 90 kgN.ha -1 (10,26 t.ha -1 ) and120 

kgN.ha -1 (10,23 t.ha -1 ), which was, in relation to realized yield using fertilizers 150 

kgN.ha -1 (9,37 t.ha -1 ) more for 860, i.e. 890 kg.ha -1 . Based on derived results, there 

is a conclusion that by inoculation of nitrogen fixers' compatible kinds, 

in 

combination 

with humic acids, can be decreased to 40 kgN.ha 

t.ha- 

-1 

1 

Fig. 1. Dependence of maize hybrid yield on appliance of nitrogen fixers, 

fertilizing and doses of mineral nitrogen in average for period 2006-2007 

Time variation curves of some nonsinusoidal values



cterization would provide income 

aize production is around 131 euro.ha -1 From economic aspect observed, the seed ba 

increase, i.e. better financial results per surface unit, because, according to 

calculations, resources saving in m 

. From 

aspect of sustainable agricultural production, specific amounts of mineral nitrogen 

would decrease or totally miss. 

Conclusion 

- 

According to got results, 

there can be concluded the following: 

Effectiveness of inoculates appliance with nitrogen fixers depended on amount 

of applied mineral nitrogen and inoculate kind. 

- Yield as a definite goal of production during inoculation was higher while 

fertilizing by smaller doses of mineral nitrogen. 

- The appliance of nitrogen fixers as biofertilizers could be an alternative and/or 

supplement to mineral fertilizing. 

- The appliance of bacterization would assure more economical production 

besides subsistence 

of stable yield and environment preservation in the system of 

sustainable 

agriculture. 

- Due to reseaching results, there can be concluded that free and associative 

microorganisms can be successfully used as biofertilizers, in the form of microbiological 

fertilizers. 

- The researches should be directed toward production technology of qualitative 

microbiological fertilizer, which should furthermore 

imply effective 

microorganisms, activating certain microbiological processes, to provide 

assimilative for plant and help its growth. In order to fulfill these criteria, the 

selection of microorganisms is done, and furthermore, the researches must be 

directed to microorganisms selection according to plant genotype. 

References 

1. Bashan, Y., Levanony, H. (1990): Current status of Azospirillum inoculation 

techmology: Azospirillum 

as a challenge for agriculture. Can. J, Microbiolog., 

36, 591-608. 

2. Bertlin, J. (1992): Sustainable agriculture and natural resources development. 

Annali. Fac. Agr. Univ.Perugia. Vol. XLVI:13-44. 

3. Burns, R. G. (1995): Enumeration, Survival, and Beneficial Activities 

of 

Microorganisms Introduced into Soil. 145-164. In: Huang, P. M., et al., (eds.)



Environmental impact of soil component interaction, Metal, Other Inorganics, 

and Microbial Activities, CRC 

Pres. Inc. London. 

4. Cvijanović Gorica, Nada Milošević, Ivica Djalovic, Milica Cvijović, 

Aleksandar Paunović (2008): Nitrogenization and N Fertilization Effects on 

Protein Contents in Wheat Grain VII Alps-Adria Scientific Workshop, Stará 

Lesná, Slovaki, 28 april - 1 may, 2008. Cereal Research Communications, vol. 

36 pp251-254. 

5. Cvijanović, G., Jovanović, Ž., Govedarica, M., Milošević, N., Cvijanović, D. 

(2005): Ecological and economic effects of the bacterisation application within 

system of sustainable agriculture, Savremena poljoprivreda Novi Sad Vol. 54, 

3-4, UDC: 63(497.1)(051)-“540.2“, YUISSN 0350-1205, 115-119. 

6. Cvijanović, G., Milošević, N., Cvijanović, D. (2006): Biological 

Nitrogen as 

development function of new fertilizing technology in crop production , 

Economics of Agriculture Year, 53 Special edition, UDC 631.147:631.847, 

YU ISSN 0352-3462,39-44. 

7. Cvijanović Drago, Gorica Cvijanović, Jonel Subić (2007): 02“Ecological, 

Economic and Marketing Aspects of the Application 

of Biofertilisers in the 

Production of Organic Food”, Međunarodna Monografija “Enviromental 

Tehnologies-New Development”, ARS Vienna, I-Tech Education and 

Publishing 

KG, Kirchengasse 43/3, A-1070 Vienna, Austria, EU; pp. 25-41. 

8. Cvijanović Gorica, Jonel Subić, Drago Cvijanović (2007): The significance of 

associative-nitrogen-fixators appliance in wheat production technology, 

Proceedings „Dezvoltarea Durabila a Apatiului Rural“, Conferentia 

Internationala Bucuresti, 15-16 iunie 2007 , ISBN 978-606-505-025-9, Editura 

Academia de Studii Economice, Bucuresti, Romania. Pp 96-101. 

9. Cvijanović Gorica, Nada Milošević, Marko Jeločnik (2008): Effect of Diferent 

Type of fertilizers on Soil Biological Reclamation, 

24trogen 

вный 

симбиоз и его роль в продуктивности с-х . растений- Сб:Тимирязеви 

биологическая наука. М, :МСХА, 1994, с.106-119. 

, s Vitalitz in the Process of 

Thematic Proceedings, International Scientific Meeting “State, Possibilities 

and Pespectives of Rural Development on are of Huge Open pit Minings, 

25 th , april, Belgrade-Vruici Spa, pp 387-395. 

10. Govedarica, M.(2001): Mogućnost primene biofertilizatora u proizvodnji 

neleguminoznih biljaka Zbornik naučnih radova PKB INI Agroekonomik, 3, 1, 

69-76. 

11. Govedarica, M., Milošević, N., Jarak, M., Jeličić, Z., Protić, R. (1997a): 

Diazotrophs and their Activity in Maize and Wheat, Biological Ni 

Fixation for 21 st Century, In: Elmerich et al (eds). Current Plant Science and 

Biotechnology in Agriculture, Vol. 31, 408 Academic Publish London. 

12. Jемцев B.Т. Селицкая О.Б., Кубарева О.Г., (1994): Ассоцијати



13. Kovačević Dušan , Oljača Snežana, (2005): Organska poljoprivredna 

proizvodnja, Monografija. D. Kovačević, „Organsko ratarstvo” str. 35-70. 

14. Kovačević, D. (2004d): Sistemi zemljoradnje u konceptu održive 

poljoprivrede. Međunarodna konferencija o odrđivoj poljoprivredi evropski 

integracioni procesi.Uvodni 

referat, Knjiga abstrakta 19-24 septembar, Novi 

Sad, 34. 

15. Milojić, B. (1991): Sistem biološke poljoprivredeu svetu i kod nas. 

Ekonomika poljoprivrede, Vol 38. No. (6-7-8) Beograd :263-275. 

16. Mrkovački, N., Mezei, S., Čačić, N., Kovačev, L. (2007): Efekat primene 

različitih tipova inokulacije šećerne repe, Zbornik radova Naučnog instituta za 

ratarstvo i povrtarstvo Novi Sad, ISSN 0354-7698, Sveska 43, 201-209. 

17. Németh T.: 2006. Nitrogen in the soil–plant system, nitrogen balances. Cereal 

Research Communications 34: 1. 61–65. 

18. Wani, S.P., Rupela, O.P., Lee, K.K. (1994): BNF Technology for Sustainable 

Agriculture in the Semi-Arid Tropics. 15th World Congress of Soil Science, 

Acapulco, 4a, 245-262.



FLOWERING AND FRUIT- PARTICULARITIES TO 

DENA LETTUCE VARIETY 

ELENA STEFANESCU*,ELENA-LILIANA 

MILOVICI*, 

MINERVA HEITZ**, F. GAPSA* 

It was studied Dena salad variety having as objective the flowering and 

fruit biology under the conditions of I.C.L.F. Vidra in period of 1987-1990. 

Taking into account anatomy-species morphology (M. Ravarut, 1973), 

these studies 

have intensified even from the freshman floral phase. As result, was 

observed to microscope the dynamic development of floral organs, pollination, of 

flowering and fructification. 

By putting delimitations, was possible establishment of flowering and fruit 

dynamics on plant and also the in-floweriness. 

The researches have been annually affected on a population between 7000- 

10000 individuals involved in 175 variations (down line). 

Have been studied 

5(five) plants from each variant. 

2. 

Abstract: In order to maintain the lettuce DENA variety at optimal 

parameters of productivity and quality owned at its registering and to improve 

methods of seed production, phenomena of flowering, pollination and fruiting 

have been studied under the specific conditions at I.C.L.F. Vidra. 

Keywords: lettuce, flowering, pollination, fruiting 

1. Material and method research 


As knew, the flowers are grouped in-floweriness called calatidius. In a 

calatidium pollination and also the flowering and physiological maturity takes 

place from outside to inside. 

* Research And Development Institute For Vegetable And Flower Growing 

Vidra 

** Research And Development Station For Vegetable Growing Iernut



es (fig.1). 

pollen from stamina jutting on the bilobda stigma. Takes place 

the seed 

has opened the flower (flowering). Opening of 

flowers takes place from 8:00-9:00 AM and lasts 3 hours. It may take 2 ho 

temperature over 30 0 C to 3 00 lucks) or may 

4-5 a high unclearness and te 25 0 On a plant, these phenomena occur from top of the plant to base and from 

outside to the inside in the form of concentric con 

Pollination takes place before opening the flower being about the 

cleistogamy. 

Since freshman of the state of the flower, the style was extend, the 

lettucedown gather 

of pollen germination and fecundation. 

After training polinic tube, 

urs in a 

5 

C. 

Flowering begins at 78-82 day om the rise of plants, which are now 

gathe 400 and ended after 30 days. 

14-16 days from the closing of flowers appears papusul-sign that 

begin maturity. Even in this moment, the seeds are fit to germinate. 

of the seeds harvest is when 2 / 3 of infloweriness present 

pus is is 

at 120-130 days from rise plants, which currently have accrued 

0 

from 

C. 

tical ind of cara tudies 

Nr. erties 

Statistic indexes 

. 

1 20 25 5 25 15 – 25 

seeds 

/c 

N 

17 9 3 18 14 – 20 

/p 

1990 

(M 

0,1 10 0,9 – 1,1 

0 C and strong brightness (over 100 

take hours under mperatures below 

s fr 

red in 1300-1 

After 

s physiologic 

The best 

pa um. Th 

registered 

2150 to 2200 

Table 1 

Statis ex cters s 

Prop 

crt x S 2 s S% k 

Number of 

flowers 

/calatidium 

Number of 

2 

alatidium 

umber of 

3 

fertile 

calatidiums 

lant 

1504 - 486 32 

1018 – 

4 

Quantity of 

seed /plant (g) 

The quantity of 

32 324 18 56 14 – 50 

5 thousand seeds 

MB) - g 

1 0,01 

The fruit is a black achena*.



Because the number of flowers / calatidium is 15-25 (table 1) the number 

of seeds 

on calatidium is no more than 25. There are also calatidiums without any 

seeds (graphic 1, 3). 

From the graphic representation of a fertile infloweriness (graphic 

1,2,3,4) result that both calatidiums from the 

top of the plant as well as those from 

the top of main ramifications give a little quantity of seeds. The largest quantity of 

seeds is obtained on the first 13-15 main ramification 

from base on 2 / 3 of their 

length from base to the top (graphic 1, 2,3,4). 

A plant of Dena salad has calatidiums from 1018 - 1990 which form seed. 

The quantity of selected seed on plant is 14 g-50 g. 

The selected seed has a germination of 98 to 100%, and M.M.B. = 0.9 to 

1.1 g. 

Graphic 1 Graphic 2 

The number of 

inflorweriness/main 

ramification 

120 

100 

80 

60 

40 

20 

0 

Infloweriness 

repartition 0n plant 

1 

3 5 7 9 11 13 15 17 

The number of main ramification 

nr.infl/ramif.princ. 

The number 

infloweriness/main 

ramification 

300 

250 

200 

150 

100 

50 

0 

ramificatia principala 

Graphic 3 

Infloweriness repartition/middle ramifications on plant 

Graphic: 

1, 2, 3 – Distribution of inflorescences on plant in the lettuce variety 

Dena 

Number infloweriness 

160 

140 

120 

100 

Infloweriness repartition on main ramifications 

1 3 5 7 9 11 13 15 17 19 21 23 

The number of main ramification 

80 

60 

40 

20 

0 

1 3 5 7 9 11 13 15 17 19 21 23 25 27 

Series1 

Series2 

Ramification middle



3. Conclusions. 

Flowering starts at 8:00-9:00 

AM and takes from 2 to 5 hours. 

This phenomenon was broken out to 78 - 82 days 

from the plants rise when 

were gathered 1300 C and lasts 25-32 days. 

ollination takes place before the opening of flowers. 

iologic maturity is broken out at 2 weeks from flowering when it 

appears papusum. 

gh biological value is 

w s papus, meaning at 120-103 days from plant’s rise, 

w 

0 C – 1400 0 

P 

Phys 

The best time of harvest for getting seeds with a hi 

hen 2/3 of in-flowriness present 

hen is gathered 2150 0 

C-2200 0 C. 

The quantity of selected seed/plant is 15-50 g. 

M.M.B. is 0.9-1.1g. 

References 

1. 

Bremer A.,H., 1962 – Handbuche der Pflanzen-Zuchtung 

2. 

Ravarut, M., 1973-Botanica 

3. 

Elena Stefanescu, - Studiul unor particularitati biologice la soiul de salata Dena 

( Researches of some biologycal particularities at Dena lettuce variety). In Annals 

Research 

And Development Institute For Vegetable And Flower Growing Vidra, 

XIV, 

380-385



FL OWERING AND FRUIT- SETTING BIOLOGY OF THE 

SPINACH CULTIVAR SMARALD 

ELENA STEFANESCU*,ELENA-LILIANA MILOVICI*, 

MINERVA HEITZ**, F. GAPSA* 

Abstract: To spinach, the quantity and quality of seed is directly connected with the 

phenotypic expression of the sex. This is given by the interaction of the chromosome 

genes X and Y and 

of selfsomal genes A and G with the environmental factors (the 

day, humidity, light 

intensity, fertilizers, etc.). 

To achieve a valuable seed is necessary a good knowledge of flowering and fruit 

biology of that variety. 

Since 1987 was studied the flowering and fruit biology of the spinach 

cultivar 

Smarald. 

Keywords: spinach, flowering biology, flower combination, pollination, 

fruit- 

setting biology 

1. Method and material research 

It has worked with the variety of spinach cultivar Smarald. 

The re were studied: 

- floral combinations and their characteristics types of plants; 

- phonotypical expression of sex and the flower dynamic; 

- pollination; 

- fructification; 

- 

- 

M.M.M. variability, consequence of the connection between floral 

combinations and the forming of seed (of the fructification). 

2. Obtained results 

Spinach is considered a dioic species. 

This 

species has 2n = 12 chromosomes (Fig. 1). 

* Research And Development Institute For Vegetable And Flower Growing 

Vidra 

** Research And Development Station For Vegetable Growing Iernut



Fig.1 Chromosome diagram for spinach 

From the studies was found that, in a population of this species, are mono 

plants, dioicious and with different floral combinations. 

Research conducted at the variety of spinach Emerald have pointed out the 

following floral combinations 

on plant (Table 1): 

- with female flowers; 

- with male flowers; 

- with hermaphrodite flowers; 

- with male and female flowers: 

a. predominantly female (feminine plants); 

b. predominantly male (masculine plants). 

- with female, male and hermaphrodite 

flowers: 

a. predominantly female; 

b. predominantly male; 

c. predominantly hermaphrodite. 

- with female and hermaphrodite 

flowers: 

a. predominantly female; 

b. predominantly hermaphrodite. 

- with male and hermaphrodite flowers: 

a. predominantly male; 

b. predominantly hermaphrodite,



which may restrict and categorized into four main types of plants (table1): 

Table 1 

Plant c lassification according to the phenotypic expression of the sex – spinach 

cultivar SMARALD 

Nr.crt. I II III IV 

1 ++++ 

- - - 

2 +++ + - - 

3 +++ - + - 

4 +++ - - + 

5 ++ + + - 

6 ++ + - + 

7 ++ - + + 

8 + + + + 

9 - ++++ - - 

10 - +++ + - 

11 - ++ + - + 

12 - ++ + + 

13 - - ++ ++ 

- 

14 - - ++ + 

+ 

15 - - - +++ + 

16 + + - ++ 

17 - + + ++ 

18 + - - +++ 

19 - + - +++ 

20 - _ + +++ 

- Type I: the male flowers have 1-4 floral shells and 4 stamens; 

- Type II: the female flowers that have 1-2-4 floral shells, a short style and 4-6 

long stigmas forming a single seed; 

- Type III: hermaphrodite flowers that have an indivisible wrapper floral (by 

SEPA), 4 stamens and a pistil with 2-6 stigmas; 

- Type 

IV: hermaphrodite flowers that have an indivisible wrapper floral which has 

inside a pistil and1-2 stamens outside of the sepals.



Studying floral combinations on offspring, it was found that in 1988, from the 

2000 families (individual descending line): 2 families had all male plants with 

flowers, 8 families had all 

female plants with flowers, 23 families had all plants 

with hermaphrodite flowers, and the rest of the families had different floral 

combinations on plants. 

Being in a total male descending line comes from, crossing female plants with 

certain male ones (XXAAGG) x (YYAAGG) (Janick-Stevenson, 1954). 

Stimulation of being in the background 

of woman gender takes place after crossing 

some 

pure female plants with hermaphrodite plants with a very heavily female 

tilted (XxaaGG) - Sneep, 1975. 

Representing in the background with male and hermaphrodite plants takes 

place 

after hermaphrodites crossing male plants (XXAAgg) x (Xyaagg) (Janick and 

Stevenson 1955). 

At polyploizes only in the presence of Y chromosome are male pure (Dressler). 

Was made the graphic representation of the expression of phenotypic sex, 

following studies on a large population 

of individuals (35,000 - 80,000), in a 

different 

environment (several years) conditions, on descending line and with a 

free-pollinated (see Figure 1.2). 

From the research carried out on the phenomenon of prosperity, to Emerald 

variety of spinach was found that: 

- Beginning time of flowery is advance to the male flowers with 7-10 days 

from the female flowers (sometimes 3-4 days). 

Bags of the four police stamina spank on the line after a well-established order 

as represented in Figure 2, to an interval of 1-3 days, in such way to release the 

pollen in totally from a flower in 4-9 days time. 

Fig.2. Flowering dynamic for a male flower 

Most male flowers are opening in the same time with female flowers. A small 

number (5%) of male flowers blossom behind the female.



Flowering time takes two weeks. In terms of days long, strong brightness 

(10,000 lucks) flowering times is 5-7 days, and in a short day, of wet weather with 

poor lighting (4.000-5.000 lucks) flowering period exceeds two weeks. 

Female 

flowers on this variety are receptive to pollen for a period of 13 - 15 days 

after the stigmata occurrence. 

Hermaphrodite flowers 

are usually photogene. 

Both 

beginning time and physiologic maturity take place from the base to top in a 

glomerulus’s and on a twig. 

From conducted research, was found that families with female plants or 

feminized have a longest maturity period of consumption (14-20 days) in contrast 

with the male or masculine 

families to which this phenophase is 3-7 days. 

Sometimes 

the growth of floral stem takes place before the normal development of 

the rosettes of 

leaves. 

The development of floral bud, flourishing and training seeds are represented 

in fig.3, 4. 

Fig.3 Development of an exclusively female flower from flower bud till seed 

formation 

Fig.4 Flowering and setting of the seed with open flower covering (hermaphrodite 

flowers)



The structure of these types of plant is recording in the table 2 and 1, 2, 3, 4 

graphics, which are presenting as a graphic on a down line 

Table 2 

Structure of plants (%) po pulations studied during 1987-1990, 

Smarald 

cultivar 

Type of plant 

Total Number of 

Year 

Mascule 

plants 

(%) 

Female 

plants 

(%) 

Hermaphrodite 

plants 

number 

of downline 

plant 

studied on 

population 

1987 46,8 49,5 3,7 76 7614 

1988 45,2 52 2,8 61 7328 

1989 49,88 49,92 0,1 97 9691 

1990 46,35 36,2 17,45 51 5100 

47,08 46,90 6 x x 

Graphic 2 - Population structure 

resulting from 

phonotypical floral 

plant expression (0n down line) in 

1988year 

% line 

Graphic 1 -Population structure 

resulting from phonotypical 

floral plant expression (0n 

down line) i n 1987year 

% line



Graphic 

3 

Population structure resulting from 

phonotypical floral plant expression 

(0n down line) in 1990 year 

% line 

Graphic 4 

The coefficient of 

variability of MMB has 

values greater than 20, 

which means 

a large 

variability. 

Obtained seed from 

female plants or feminine 

has the largest MMB 

(11.5-12.4 g) and the 

smaller MMB (4-5 g) has 

the seed obtained from 

plants hermaphroditecoated 

floral divided (type 

III). 

The percentage on plant of pollinates flowers ranges from 20% to 80%, 

due to both environmental conditions during polarization, and also of uncorrelated 

flowering. This uncorrelated situation usually occurs at the end of flowering. Over 

90% of the plant have the last flowers (both of the top of middle and the top of 

shoot) not 

fructify. 

In a small percentage of 2-5% were found plants with false seeds. 

3. 

Conclusions 

The study of the flower combination, phenotypic expression of the 

sex, flowering dynamics, 

pollination, fruit - setting and variability of the mass 

of 1000 grains showed that: 

- the male flowers start flowering 3 – 10 days before the female flowers;



- the maximum flowering of the male flowers coincides with the maximum 

flowering of the female flowers; 

- the male flowers continue to flower after the flowering of the female 

flowers ended; 

- the flowering and the fruit setting occur from bottom to top; 

- the phenotypic expression of the sex is given by the interaction of the 

chromosome genes X and Y and of the selfsomal genes A and G with the 

environmental factors; 

- the optimum ratio for the phenotypic expression of the sex is 60/40 (female 

flowers/male flowers), if we want to obtain high leaf yields and 

quantitatively and qualitatively valuable seeds. 

The best representation of phenotypic sex to obtain higher production per unit 

of leaf surface with a length of nearly two weeks shifting consumer and a valuable 

seeds in terms of quality and quantity is 60% female plants (40% male plants). 

Maximum blooming flowers blooming male coincide with a maximum of female 

flowers. 

Female flowers are receptive to pollen from appearance of stigmata for a 

period of two weeks, providing a good pollination and binding of seeds to this kind 

of spinach. MMB variability is large (20). 

From the strictly female plants or feminine result seeds with MMB (11.5-12.5 

g), while the plants hermaphrodite type III result seeds with small MMB (4 - 6 g). 

The range of variability of MMB is 4.5-12.5 g. 

References 

1. H.Kappert, W.RUDORF, 1962, Spinat, Handbuch der pflanzenzuchtung 

vol.VI, 1962, p.227-253 

2. I.Iordan, Efectul heterozis la spanac,Anale ICDLF Vidra, 1968 

3. Elena Stefanescu, Biologia infloritului si fructificarii la soiul de spanac 

Smarald (Flowering and fruit- setting biology of the spinach cultivar 

Smarald), Annals- Research And Development Institute For Vegetable 

And Flower Growing Vidra, vol.XIV, 385-398



MAGNETOSPIRILLUM GRYPHISWALDENSE AS A 

SOURCE OF MAGNETITE NANOPARTICLES: 

BIOLOGICAL AND BIONANOTECHNOLOGICAL 

SIGNIFICANCE 

C. MOISESCU 

VIRGO AN 

18 , M. IGNAT 19 , M. CONSTANTIN 20 , M. 

LICI 3 , M. CÎRNU 1 1,21 

, I. ARDELE 

Abstract: In this contribution we present our work on the magnetotactic 

bacterium Magnetospirillum gryphiswaldense regarding the optimization of the 

growth conditions in batch cultures, the study of the oxygen consumption of the 

wild-type and of a non-magnetotactic mutant strain, fatty acids profile in intact 

cells and isolated magnetosomes, isolation of magnetosomes, nanomaterial with 

high bionanotechnological potential and the magneto-aerotacitc behavior of 

intact cells. 

Keywords: Magnetospirillum, bionanotechnology, nanoparticles, 

respiration, fatty acids. 

Introduction 

Magnetotactic bacteria (MTB) are prokaryotes of the Domain Bacteria whose 

specific functional characteristic is magnetotaxis, the ability to orient and migrate 

along Earth’s geomagnetic field lines [4]. Magnetotaxis is determined both by the 

presence of magnetosomes and the ability to perform active movements. Dead cells 

containing magnetosomes also align along the geomagnetic field lines whereas 

alive and swimming MTB with no magnetosomes, do not align. In Earth’s 

geomagnetic field (around 0.05mT), cells are neither attracted nor pulled towards 

either geomagnetic pole [3]. 

Magnetosomes are intracellular bodies which consist of magnetic iron mineral 

particles, either magnetite (Fe3O4) or greigite (Fe3S4) enclosed within a lipid bilayer 

containing different types of proteins, some of them being involved in the 

18 

Dept. of Microbiology, Institute of Biology of the Romanian Academy, Bucharest, Romania, email: 

ioan.ardelean@ibiol.ro 

19 

National Institute of Research for Electrical Engineering ICPE-CA, Bucharest, Romania, e-mail: 

mignat@icpe-ca.ro 

20 

Institute IFIN-HH, IRASM Center, Magurele, Romania, e-mail: virgolicimarian@yahoo.com 

21 

“Ovidius” University , Faculty of Natural Sciences, Constanta, Romania



transformation of soluble iron in magnetic nanoparticles. Magnetotactic bacteria 

(MTB) are a model system for studying the synthesis by living organisms of 

ferrimagnetic iron oxide and sulfide nanocrystals with very specific structural, 

chemical, and magnetic properties [2, 8]. 

In Magnetospirillum gryphiswaldense as well as in other MTB, magnetosomes 

are only produced at low atmospheric oxygen tensions, these microorganisms 

showing a microaerophilic behavior in which magnetosomes play an important 

role. It was proposed that in natural environments magnetotaxis enables the cells to 

locate and maintain an optimal position in water columns or in sediments, with 

respect to their main metabolically needs: molecular oxygen and other nutrients 

[6], all in all allowing them to keep their headings as they swim in the face of the 

disorienting Brownian buffering by the medium. There are also other several 

proposals concerning the biological signification of magnetosomes which would be 

involved in iron homeostasis and detoxification [12], cell’s response to gravity 

[18], redox and pH control [8, 12]. 

Furthermore, in the last years the evaluation of the potential of magnetosomes 

in various biomedical and nanotechnological applications has received special 

attention ([16, 11]. The unique structural and functional characteristics of biogenic 

magnetic nanoparticles, makes them very useful in various nano-biotechnological 

applications, therefore a better understanding of their biomineralization and its 

correlation with oxygen metabolism is stringently necessary, specially in M. 

gryphiswaldense for which there are no scientific papers concerning the respiratory 

activity. 

The aim of this paper is to improve the flask cultivation method, to quantify the 

intensity of cyanide-sensitive aerobic respiration in wild type M. gryphiswaldense 

strain grown under microaerobic conditions either in iron depleted culture media or 

in iron-rich culture media, to emphasize the modification of the fatty acids profiles 

between the wild-type M. gryphiswaldense strain and isolated magnetosomes, to 

develop a new magnetosome isolation method, and the study of the aerotactic 

behavior of wild type M. gryphiswaldense strain in the presence of magnetic field. 


Organism and culture conditions. The wild-type strain of the magnetotactic 

bacterium Magnetospirillum gryphiswaldense was used in this study. M. 

gryphiswaldense cells were cultured in a flask standard growth medium [9] in ironrich 

(100 µM) and iron-limited (0.7 µM Fe) conditions. To generate microaerobic 

conditions, the culture flasks were sparged with nitrogen and sealed before 

autoclaving with butyl rubber stoppers. Cell growth [13] and transmission electron 

microscopy were done as previously described [14].



02 consumption rates were monitored with an oxygen meter (Rank Brothers, 

LTD) and titrated with different concentrations of KCN. 

Fatty acids profiling was done according to Sasser [15]. Over 96% of extracted 

FAME from magnetotactic bacteria and magnetosomes were identified (named), 

the rest being excluded from the percentual report. Standard deviation for 

percentual report was found to be less than 0.5%. Therefore significant differences 

were considered to be over 1.5% for tested samples. 

Magnetosomes isolation. For intact magnetosomes (magnetite crystals 

surrounded by the magnetosome membrane) isolation, intact cells of M. 

gryphiswaldense were treated with 50 mM phosphate buffer, pH 7.0, followed by 

lysozyme treatment resulting in spheroplasts isolation. The intact magnetosomes 

were extracted by an osmotic shock of the spheroplasts and magnetically separated 

from the cellular debris. Denuded magnetosomes (magnetite crystals without the 

surrounding phospholipidic membrane) extraction was performed by treating the 

M. gryphiswaldense cells with 1M NaOH solution at 95°C, for 10 minutes. The 

magnetosomes were magnetically separated from the cell debris and washed at 

least 10 times in distilled water. 

Magneto-aerotactic behavioral assays were performed in capillaries tubes with 

a 0.5 mm cross section, sealed at both ends and placed near a permanent magnetic 

bar. For behavioral assays, magnetically responsive cells were concentrated by 

centrifugation (10 min at 9500 r.p.m) and placed at one end of the capillary tube, 

together with a small bubble of air. The bar magnet was placed at a certain distance 

from the starting point and the cells were left to migrate towards the bar magnet 

and far away from the air bubble (the repellent). The duration of the behavioral 

response was recorded with a timer and the speed of the bacteria was measured by 

a photographic procedure. 


Flask cultivation of M. gryphiswaldense has been improved by appropriately 

flushing the growing medium with nitrogen gas (Lindegas, 99% purity ) to avoid 

anaerobiosis in the flask, as indicated by total bleach of the molecular oxygen (and 

redox potential) indicator- resazurine. This was achieved usually by 3 minutes of 

flushing the flask with non-sterile nitrogen gas, followed by thermal sterilization in 

normal conditions. The 10% v/v inoculation of these sterile flasks with a stationary 

phase culture of M. gryphiswaldense enabled us to reproducibly obtain late log 

exponentially grown cells in several days. The cells grown in medium with 100 

µM iron contain normal chain of magnetosomes, as shown in the Fig. 1.



Fig. 1. TEM image of a typical magnetite 

chain in wild- type Magnetospirillum 

gryphiswaldense. 

Fig. 2. Schematic representation of the two possible terminal oxidases in M. 

gryphiswaldense in (a) the presence and (b) the absence of iron. TO–terminal 

oxidase; CO?–possibly cytochrome c oxidase. 

Respiration. Typical results in M. gryphiswaldense show an O2 consumption 

rate of 35 nmoles O2/min/O.D for iron-rich (100 µM) cultures and 23 nmoles 

O2/min/O.D for iron-limited (0.7 µM) cultures, suggesting that high O2 

consumption rate could be correlated with the presence of magnetosomes. 

Furthermore, in iron-rich (100 µM) culture media, 20 µM KCN inhibits oxygen 

consumption by 30% and 1,4 mM KCN by 90%, suggesting that cytochrome c



oxidase and another terminal oxidase should be involved in respiratory oxygen 

consumption. 

In the M. gryphiswaldense cultures grown in iron-limited (0.7 µM) culture 

media, 20 µM KCN inhibits oxygen consumption by 45% and 1,4 mM KCN by 

90%, suggesting that this so far unknown terminal oxidase is used preferentially in 

iron-limited conditions compared with iron-rich conditions. Up to our best 

knowledge this is for the first time differences in sensitivity against KCN are 

shown in M. gryphiswaldense (Fig. 2). Figure 2 shows the contribution of the two 

putative terminal oxidase (TO1- unknown terminal oxidase; TO2- probably 

cytochrome c oxidase) to oxygen consumption by intact cells of M. 

gryphiswaldense grown in iron-limited (0.7 µM) and iron –rich (100 µM) culture 

media. 

These results deserve further investigations to better understand the relationship 

between iron concentration, magnetosome synthesis and molecular oxygen 

consumption by intact cells. When it comes to the identity of the two terminal 

oxidases in M. gryphiswaldense it could be possible that one is a cytochrome c 

oxidase whereas the second one could be a nitrite reductase (Prof. Dirk Schüler, 

personal communication). These results obtained in M. gryphiswaldense are 

important also for the fact that in Magnetospirillum magnetotacticum, the first 

MTB isolated and grown in pure culture the researches on respiration and 

respiratory electron carriers shown a soluble cytochrome c-550 and a membrane 

(cytoplasmic) bound novel ccb- type cytochrome c oxidase that seems to function 

as the terminal oxidase in microaerobic respiratory chain [17] and a cythochrome 

cd1-type nitrate reductase [7]. 

It seems that oxygen metabolism in MTB is a rather complicate story which can 

offer new and interesting aspects of bacterial diversity with respect to metabolic 

plasticity. 

Fatty acids profiles. As it can be seen in Table 1 there are no significant differences 

between FAME percentual report for whole cells and cells without external 

membrane, but there are several significant differences between whole cells and 

magnetosome membranes. Coeluted 3-hydroxytetradecanoic acid and 15-methyl 

hexadecenoic acid, coeluted 9-cis hexadecenoic acid and 10-cis hexadecenoic acid 

are found in higher concentration in whole cells than in the magnetosome 

membranes, last two concentration being almost double. Other three FAME are 

found in higher concentration in magnetosome membranes than in whole cell: 13methyl 

pentadecanoic acid, octadecanoic acid and 10-(2-heptylcyclopropyl) 

decanoic acid, also first seems to be found in significant concentration only in 

magnetosome membranes. Further correlations between fatty acid composition and 

corresponding bio-chemical functions will be investigated.



Magnetosomes isolation. During this study we developed a new method for 

magnetosomes extraction. The main advantage of this method is that it allows the 

isolation of intact magnetosomes, surrounded by the phospholipidic membrane that 

can be used further for different biotechnological applications (Fig. 3). 

The brown colour of the isolated magnetosomes is a possible indication of the 

presence of the surrounding phospholidipidic membrane which fades the black 

color of pure magnetite crystals (magnetosomes without the surrounding 

phospholipidic membrane) (Fig. 4). 

The isolated magnetosomes could be used for the development of micro- and 

nanoactuators, as already proposed by Ignat and Ardelean [10], Ignat et al. [11]. 

Fatty acid 

Standard name Short name 

Table 1. Qualitative fatty acids analysis 

Whole 

cell 

Cells 

without 

external 

membrane 

Magnetosomes 

with 

membrane 

tetradecanoic acid 

coeluted 3-hydroxytetradecanoic acid and 15- 

14:0 4% 4% 3% 

methyl hexadecenoic acid 14:0 3OH/16:1 iso I 5% 5% 3% 

13-methyl pentadecanoic acid 15:0 anteiso 0% 0% 3% 

14-methyl pentadecanoic acid 15:0 iso 0% 0% 1% 

hexadecanoic acid 16:0 14% 14% 15% 

3-hydroxyhexadecanoic acid 16:0 3OH 1% 1% 1% 

15-methyl hexadecanoic acid 

coeluted 9-cis hexadecenoic acid and 10-cis 

16:0 iso 0% 0% 1% 

hexadecenoic acid 16:1 w7c/16:1 w6c 19% 19% 10% 

heptadecanoic acid 17:0 0% 0% 1% 

15-methyl heptadecanoic acid 17:0 anteiso 0% 0% 1% 

octadecanoic acid 18:0 3% 3% 5% 

3-hydroxyoctadecanoic acid 18:0 3OH 1% 1% 1% 

2-hydroxyoctadecenoic acid 18:1 2OH 1% 1% 0% 

11-cis octadecenoic acid 18:1 w7c 48% 48% 48% 

9-cis octadecenoic acid 18:1 w9c 0% 0% 1% 

17-methyl nonadecanoic acid 19:0 anteiso 0% 0% 1% 

10-(2-heptylcyclopropyl)decanoic acid 19:0 cyclo w8c 2% 2% 4% 

eicosanoic acid 20:0 0% 0% 1%



Fig. 3. Magnetic collection of intact magnetosomes surrounded by phospholipidic 

membrane extracted from M. gryphiswaldense. (a) Homogenous suspension of 

magnetosomes surrounded by phospholipidic membrane. (b) Attachment of the bar 

magnet and (c) magnetic accumulation of the membrane enclosed magnetosomes 

as a result of magnetic attraction compared with. 

Fig. 4. (a) Magnetosome particles without the surrounding phospholipidic 

membrane isolated from M. gryphiswaldense. The intense black colour of the 

deposit (arrow) indicates the absence of the phospholipidic membrane. (b) TEM 

image of the isolated magnetite crystals. Bar represents 50 nm. 

Magneto-aerotactic behavior. Aerotaxis, the migratory response towards or away 

from oxygen, is a universal property of motile bacteria that enables the bacteria to 

move to a concentration of dissolved oxygen that is optimal for their preferred 

metabolism. Aerotaxis and magnetotaxis work in conjunction in magnetotactic 

bacteria, behavior being referred to as magneto-aerotaxis. As microaerophiles, M. 

gryphiswaldense cells are very sensitive to the oxygen concentration and that is 

why magnetotactic cells of M. gryphiswaldense use magnetotaxis to increases the 

efficiency of aerotaxis in an oxygen concentration gradient by reducing a threedimensional 

search to a single dimension [3]. The influence of oxygen on the



direction of movement (aerotaxis) by the magnetotactic cells of M. 

gryphiswaldense was investigated by placing a small drop of bacterial suspension 

in a sealed capillary tube together with an air bubble. The air bubble acts as a 

repellent for the magnetotactic M. gryphiswaldense cells which will swim away 

from the air bubble and towards the smaller oxygen concentration. As it was 

expected, the magnetotactic M. gryphiswaldense cells showed a negative horizontal 

swimming response to 21% oxygen, the cells accumulating at the opposite end of 

the capillary tube, next to the bar magnet and faraway from the starting point, 

swimming a total distance of 3.5 cm in 110 min with a speed of 18.6 µm/s. These 

results correlate with the literature data [5]. 

Conclusions 

In conclusion, better understanding at molecular and cellular levels of the 

interactions between energy metabolism and magnetosome synthesis, as well as 

understanding of the biological significance of magnetosomes and magnetotaxis 

will further enhance the bionanotechnological application of MTB and isolated 

magnetosomes [1]. 

References 

1. Ardelean, I., Moisescu, C., Popoviciu, D.R.: Magnetotactic bacteria and 

their potential for terraformation. In: From Fossils to Astrobiology, Ed. 

Springer, vol. 12 - Series: Cellular Origin, Life in Extreme Habitats and 

Astrobiology, 2008. 

2. Balkwill, D. L., Maratea, D., Blakemore, R. P.: Ultrastructure of a 

magnetotactic spirillum. J. Bacteriol., vol. 141, 1980, p. 1399-1408. 

3. Bazylinski, D. A., Frankel, R. B.: Magnetosome formation in prokaryotes. 

Nature Reviews, vol. 2, 2004, p. 217-230. 

4. Blakemore, R. P.: Magnetotactic bacteria. Science, vol. 190, 1975, p. 377- 

379. 

5. Flies, C. B., Jonkers, H. M., De Beer, D., Bosselmann, K., Böttcher, M. E., 

Schüler, D.: Diversity and vertical distribution of magnetotactic bacteria 

along chemical gradients in freshwater microcosms. FEMS Microbiology 

Ecology, vol. 52, 2005, p. 185–195. 

6. Frankel, R. B., Bazylinski, D. A., Johnson, M. S., Taylor, B. L.: Magnetoaerotaxis 

in marine coccoid bacteria. Biophys. J., vol. 73, 1997, p. 994- 

1000.



7. Fukumori, Y., Oynagi, H., Yoshimatsu, K., Noguchi, Y., Fujiwara, T. 

Enzymatic iron oxidation and reduction in magnetite synthesizing 

Magnetospirillum magnetotacticum. J. Phys., vol. IV 7, 1997, p. 659-666. 

8. Gorby, Y. A., Beveridge, T. J., Blakemore, R. P.: Characterization of the 

bacterial magnetosome membrane. J. Bacteriol., vol. 170, 1988, p. 834- 

841. 

9. Heyen, U., Schüler, D.: Growth and magnetosome formation by 

microaerophilic Magnetospirillum strains in an oxygen-controlled 

fermentor. Appl. Microbiol. Biotechnol., vol. 61, 2003, p. 536–544 

10. Ignat, M., Ardelean, I.: Distinct nano-biological structure: magnetotactic 

bacteria. Models and applications in the electromechanical nanoactuation. 

Romanian Journal of Physics, vol.49, 2004, p. 835-848 

11. Ignat, M., Zarnescu, G., Soldan, S., Ardelean, I., Moisescu, C.: Magnetomechanic 

model of the magnetotactic bacteria. Applications in the 

microacuator field. Journal of Optoelectronics and advanced materials, vol. 9, 

2007, p. 4:1169-1171. 

12. Mann, S., Sparks, N. H. C., Board, R. G.: Magnetotactic bacteria: 

microbiology, biomineralization, palaeomagnetism and biotechnology. 

Adv. Microbiol. Physiol., vol. 31, 1990, p. 125-181. 

13. Moisescu, C., Bonneville, S., Tobler, D., Ardelean, I., Benning, L. G.: 

Controlled biomineralization of magnetite (Fe3O4) by Magnetospirillum 

gryphiswaldense. Mineralogical Magazine, vol. 72(1), 2008, p. 333–336 

14. Moisescu, C., Lazaroaie, M., Ignat, M., Ardelean, I.: Magnetosomes from 

magnetotactic bacterium Magnetospirillum gryphiswaldense: synthesis, 

isolation and possible applications in bio-nanotechnologies. Annals of 

West University of Timisoara, Series Chemistry, vol. 16, 2007, p. 217-226. 

15. Sasser, M.: Bacterial Identification by Gas Chromatographic Analysis of 

Fatty Acids Methyl Esters (GC-FAME). MIDI, Inc. Technical Note #101, 

1990. 

16. Schűler, D., Frankel, R. B.: Bacterial magnetosomes: microbiology, 

biomineralization and biotechnological applications. Appl. Microbiol. 

Biotechnol. vol. 52, 1999, p. 464–473. 

17. Tamegai, H., Yamanaka, T., Fukumori, Y.: Purification and properties of 

a 'cytochrom a 01'-like hemoprotein from a magnetotactic bacterium, 

Aquaspirillum magnetotacticum. Biochim. Biophys. Acta., vol. 1158, 

1993, p. 137-243. 

18. Urban, J. E.: Adverse effects of microgravity on the magnetotactic 

bacterium Magnetospirillum magnetotacticum. Acta Astronautica, vol. 10, 

2000, p. 775-780.



MORPHO-ANATOMIC CHANGES OF SOME 

HORTICULTURAL PLANTS WHEN ARE ATTACKED 

BY APHIDS 

VASILICA LUCHIAN 1 , MINODORA TUDOSE 2 , ELENA 

SĂVULESCU 1 

Abstract 

In order to track down and identify the leaf aphids that attack the horticultural 

plants samples were taken and observations were made in the tree plantation of 

U.S.A.M.V.-Bucharest and in the green areas in the campus. The pests have been 

identified in the Genetics, Plant Improvement and Protection Department, 

Entomology Subject, and the study of the morphological and anatomical mutations 

that followed the attack of several pests was realized in the Botanics and Plant 

Physiology Department, Botanics Subject. A part of the material was directly 

scanned or photographed with a digital camera. We mention that there are few data 

in the speciality literature regarding the morphological and anatomical 

modifications caused by the presented pests. 

Key words: spongy tissue, mesophyll, aphids, epidermis 

Introduction 

Knowing the pests of the horticultural plants and the mutations produced 

by these are very important in order to limit the damage they cause. In all the 

developed countries it exists the preoccupation to create a microclimate favourable 

to human health, to embellish the exterior spaces, the streets and the constructed 

areas, to diminish the atmospheric pollution, to create an environment good for 

relaxation. That’s why the parks, squares, green areas, plantations of the traffic 

areas, personal and public gardens represent an accomplishment of the modern 

development of the urban areas. The cultures of wooden species (with nutritional 

and ornamental value) constitute the base skeleton of the green areas. 

1 Department of Botanics and Plant Physiology, USAMV Bucharest, Romania 

2 Department of Plant Protection, USAMV Bucharest, Romania



In the case of ornamental wooden species it must be taken into 

consideration the fact that creation of a green area implies many years of wait and 

attendance of the cultures, substantial expenses and the distruction of these plants 

because of improper treatment can be very fast. In this paper we will present 

several exemples of horticultural plants attaked by leaf louse and the mutations that 

follow the attack. 


The observations were made in the tree plantation of U.S.A.M.V. 

Bucharest, in the period 2007 – 2008. 

For the monitoring of the pests observations were made in the tree 

plantation and in the green areas surrounding the university. 

Samples of attacked plants were taken and the pests were identified. 

Tracking down and identification of the pests were made in the Genetics, Plant 

Improvement and Protection Department, Entomology Subject. The collected 

material was photographed directly on the field or in the laboratory using a Sony 

digital camera. 

Transverse sections were made in the leaves of the studied plants, in the 

Botanics and Plant Physiology Department, Botanics Subject. The sections were 

clarified with chloral-hydrate for 24 hours [6,8]. The microscopical concoctions 

were fixed in jellified glycerine and the observations and photos were made at the 

optical microscope type MC-7, having attached the Sony digital camera. 

Observations of the anatomical structures in healthy and plagued tissues in order to 

identify the mutations caused by the mentioned pests. 

3. Results and discusSions 

Plants like: Malus domestica Borkh., Persica vulgaris Miller, Prunus 

cerasifera var. cerasifera Ehrh., Catalpa bignonioides Walter were investigated. 

In the apple tree orchard the species Aphis pomi De Geer was tracked down – the 

apple tree green aphids that attacks the twigs and the leaves forming 

pseudoceccidia on the leaves (fig. 1). The seriously attacked trees have small twigs, 

with twisted tips, the formed fruits are small and there are no fruit branches formed 

for next year. In figure 2 it can be observed that the median vein of the leaf has 

dimples (compared to the vein of the healthy leaves that have a semicircular 

outline). In figure 3 the normal structure of the leaf can be observed and in figure 4 

it can be observed that the mesophyll of the attacked leaf of Aphis pomi has both 

the palisade tissue and the spongy tissue with necrosis. Also the inferior epidermis 

has necrosis.



Fig. 2 – Median vein of the apple tree leaf 

attacked by aphid the apple tree green 

(original) 

Fig. 4 – Transverse section of apple tree leaf 

attacked by the apple tree green aphid 

(original) 

Fig. 1 – Pseudocecidia caused by Aphis 

pomi at apple tree on leaves (original). 

Fig. 3 – Healthy apple tree leaf – transverse 

section (original)



At the peach tree the species Myzus persicae Sulz. – peach tree green louse 

(fig.5) was tracked down, that causes the leaves to twist, turn yellow and dry, the 

productions to decrease and the plants to become sick [2,3,4]. In figure 6 we can 

observe a transverse section in the unnattacked peach tree leaf compared to figures 

7 and 8 where we can notice the mutations that followed the attack of Myzus 

persicae. Both the inferior epidermis and the leaf mesophyll are affected and in the 

area of the median vein the tissues are separated from each other 

Fig. 5 – Colony of Myzus persicae at the peach 

tree (original). 

Fig. 6 – Transverse section in the 

unnattacked peach tree leaf (original) 

At the mirobolam tree the species Hyalopterus pruni Geoffr.- plum tree 

ashen lice was tracked down, that recorded high densities (fig. 9). Also in the case 

of this plant necrosis in the area of the mesophyll and of the median vein can be 

observed in the attacked leaves (fig.10). 

Fig. 7 – Epidermis and surrounding tissues with 

necrosis at the peach tree attacked by the peach tree 

green aphid (original) 

Fig. 8 – Necrosis and separation of tissues 

from the median vein at the peach tree 

attacked by the peach tree green aphid 

(original)



Fig. 9 – Colonies of Hyalopterus pruni at 

the mirobolam tree (original). 

Fig. 10 - Transverse section in the mirobolam 

tree leaf attacked at the median vein level by the 

At the plants plantele of Catalpa bignonioides Walter a species of the Aphis 

genus was tracked down, that colonized the leaves, but also the flowers 

(inflorescence), reducing the ornamental value of the plants. On the attacked 

organs, on the sugary excretions of the pest (honey dew) saprophyte fungus 

installed (smoke-grey). When tha attack takes place on the young inflorescence the 

flower punks die [1,8]. 

Fig. 11 – Colonies of Aphis on the leaves of 

catalpa (original) 

Fig. 12 – Decrease of the ornamental value of 

the attacked catalpa flowers (original)



In figure 13 we can observe a transverse section in a healthy catalpa leaf, 

the chloroplasts being visible in the lacunose tissue, and in figure 14 we can 

observe a transverse section in a leaf attacked by affida, the mesophyll and the 

inferior epidermis having severe necrosis. 

Fig. 13 – Transverse section in a healthy 

catalpa leaf (original) 

Fig. 14 – Mesophyll and inferior 

epidermis with necrosis at catalpa 

attacked by aphids (original) 

4. CONCLUSIONS 

1. In the spring of 2007-2008 there were attacks on the studied plants, hereby 

observations were made regarding the species or the gender of the present pests. 

The climatic conditions specific to the years 2007 and 2008 were favourable for the 

development in high densities of the leaf aphids in horticultural plants. 

2. It is known that the epidermis is a defense tissue of the leaf, formed by 

cells without spaces between them, covered by a cuticule, that protects the living 

tissues of the leaf against various environment factors. From the conducted studies, 

it was ascertained that the leaf louse cause the distruction of the cuticule and the 

necrosis of the epidermis, therefore this tissue fails to do its job, not allowing the 

adjustement of perspiration and the gas exchange between the living tissues and 

and the environment. The assimilation tissues of the leaf (palisade and spongy 

tissues), because of the the mutations produced unde the influence of the leaf 

aphids, stop the synthesis of organic substances through photosynthesis because the 

chloroplasts are destroyed. 

3. The aphids attak at catalpa plants led to the dry up of the flower punks, 

fact that caused an unaesthetic aspect of this ornamental plant. Due to the 

morphological and anatomical mutations caused by the aphids attack, the leaves 

did not reach the normal size, turned yeelow and fell before maturity. 

4. The social and economical impact of the pests are: the unaesthetic aspect 

of the ashen plants, the decrease of the plants ornamental value, dry up of the 

plants following repeated attacks, decrease of production and small fruits in the



case of fruit trees, changes in the microclimate due to the reduction of 

photosynthesis, respiration and perspiration. The unaesthetic impact of the yellow 

and ashen catalpa trees in streets, parks and gardens during summer months should 

increase the public interest to these pests, regarding that in the last years numerous 

catalpa plants dried up because repeated aphids attacks. 

References 

1. Ionescu M.A., Lăcătuşu Matilda, 1971 – Entomology. Didactic and Pedagogical 

Printing House Bucharest. 

2. Miles P.W.,1990 – Aphid Saliva. Biological Review 74:41-85. 

3. Peter W. Miles, 1999 – Aphid Saliva. Department of Molecular and Applied 

Ecology, University of Adelaide, Australia. 

4. Pickett J.A., wadhams L.J., and Woodcock C.M., Hardie J., 1992. The Chemical 

Ecology of Aphids. AFRC United Kingdom. 

5. Paşol P. şi colab., 1991 – Horticultural Entomology, Vol. I and II, Agronomia 

Cluj – Napoca Printing House. 

6. Şerbănescu - Jitariu Gabriela, Marin Andrei, Natalia Rădulescu – Mitroiu, Elena 

Petria, 1983 – Vegetable Biology Practicum. Ceres Printing House, Bucharest. 

7. Tudose Minodora, 2000 – Entomology Practical Studies, AMC, USAMV, 

Bucharest. 

8. Tudose Minodora, P. Ploaie, Mihaela Georgescu, Vasilica Palanciuc, 2003 – 

Anatomical and Morphological Mutations Caused by Microplasma that Induce 

virescence in the Plants of Catharanthus Roseus C.Don. Scientifical Studies, 

Series A, XLVII, Agronomie USAMV Bucharest, pg. 323 – 327.



MORPHO – ANATOMIC CHANGES OF SOME 

HORTICULTURAL PLANTS INDUCED BY MITES 

LUCHIAN VASILICA 1 , TUDOSE MINODORA 2 , SĂVULESCU 

ELENA 1 

Abstract 

The change of the climatic conditions from the last years has favourized the 

multiplication and the development of several pests associated to parks and 

ornamental gardens, among which the mites. Knowing the mites that damage the 

horticultural plants allows the intervention through different methods in order to 

limit the damage caused by them. In this study we intended to track the mites 

present on the following plants: Pyrus communis L., Juglans regia L., Tilia spp., 

C. sativus L., and evaluate the attack method at the level of genus and species. We 

also observed the morphological and anatomical mutations caused by eriophyid 

mites in the mentioned attacked plants. 

Key words: mesophyll, mites, epidermis 


The horticultural plants, through their variety (vegetables, fruit trees, 

ornamental plants) have an important role in man’s life, ensuring us the necessary 

nourishment, but also, in the same time, some of them create a favourable 

environment for daily activities. Also the horticultural plants contribute to the 

improvement of the man’s life quality by realizing a pleasant environment for 

outdoors relaxation, embelish the cities, the places we live and work in. In all the 

developed countries with a high urbanization level, preservation and creation of 

green areas represent an important means n and his living environment. In the last 

years, in almost every area of the coutry, the spring-summer drought from the 

months may-august affects the horticultural plants directly but also indirectly by 

favourizing the development of pests. 

2. MATERIALS AND WORK METHODS 

The observations were made in the experimental fields from USAMV 

Bucharest, in the Genetics, Improvement and Plant Protection Department and in 

the Botanics and Plants Physiology Department, in the period 2006-2008. 

In order to monitor the mites associated to the horticultural plants 

observations were made periodically in the experimental sectors (green houses for 

vegetables, tree plantation, ornamental plants from green areas). Samples were



taken from attacked plants (types of damage) and the respective mites in order to 

be determined in the laboratory. The determinations were made inside the 

Genetics, Improvement and Plant Protection Department, Entomology Subject. 

Transverse sections were made in the harvested material in order to observe the 

morphological and anatomical changes caused by the mites attack in Botanics 

laboratory. The collected material was photographed directly on the field or in the 

lab using a Sony digital camera. Part of the material was directly scanned. The 

sections were clarified with chloral-hydrate for 24 hours [2,6]. The microscopical 

concoctions were fixed in jellified glycerine and the observations and photos were 

made at the optical microscope type MC-7, having attached the Exakta Varex 

camera or the Sony digital camera. Observations of the anatomical structures in 

healthy and plagued tissues in order to identify the mutations caused by eriophyid 

mites. 

3. RESULTS AND DISCUSSIONS 

In the didactic tree plantation of USAMV Bucharest in the spring of 2006 

we found just one mites species at the pear tree and that is the galicol mite of the 

pear tree leaves - Eriophyes pyri. The attack showed on the leaves through the 

appearance of a brown felt on the inferior side of the leaves and the blistering of 

the tissues on the superior side, the leaves twisted and the folicular limb was 

diminished (Figure 1) [1,3,4]. In the transverse section in a healthy folicular it can 

be observed: the inferior epidermis, the superior epidermis and the mesophyll. The 

mesophyll is bifacial with palisade tissue rich in chloroplasts under the superior 

epidermis and spongy tissue under the inferior epidermis. The leading fascicles are 

of collateral type. After the attack of Eriophyes pyri all the mentioned structures 

are affected and in the case of a strong attack the tissues get necrosis (Fig. 2). It can 

be observed that the mesophyll gets disorganized especially towards the inferior 

epidermis forming big gaps so that the two epidermis stay connected due to several 

cell rows. 

Fig. 1 – Eriophyes pyri attack (brown felt, 

leaves twisting and reducing of the 

folicular limb) (original). 

Fig.2– Advanced attack of Eriophyes pyri 

in the pear tree folicular limb (original).



The species from the Tilia genus are attacked by tetranichyid mites that 

settle on the inferior side of the leaves where they form a thin web (Figure 3). The 

leaves and the flowers dry up and fall beginning with June. The mentioned species 

is the tile tree yellow spider (Eotetranychus tiliarum), considered at the moment as 

the most important pest of the tile tree plants. The increase of the populations 

especially during hot and dry summers determine mass defoliation of the plants [3]. 

Together with the tetranichyid mites, at tile tree we find also the mites from the 

Eriophyes spp. genus, that produce on the inferior side of the leaves felty 

formations (hypertrophy of the hairs) and on the superior side the tissues swell 

forming galls (Figure 4). The attacked leaves get deformed comparative with health 

leaf [8]. 

From the anatomical point of view it can be observed that the superior 

epidermis gets wrinkled forming numerous folds, the mesophyll gets necrosis and 

in some places gest disorganized beginning from the median vein area (Figure 6), 

the hairs from the inferior epidermis get hypertrophied (the leaf has a felty aspect), 

in an advanced attack. 

Fig. 3 – Tetranichyid mites attack 

(original). 

Fig. 4 – Eriophyid mites attack 

at Tile tree (original). 

At the walnut tree the eriophyid mite of the walnut tree was found - Aceria 

erineus (Nalepa). The attack manifests through the presence of felty formations of 

various sizes (Figure7). In the transverse section in a healthy folicular limb it can 

be observed: the superior epidermis, the inferior epidermis and the mesophyll. In 

both epidermis but especially in the inferior one there are protective and secretive 

hairs. The protective hairs are long, unicelullar, with a visible thick wall. The 

secretive hairs are pluricelullar, spread between the protective hairs. The mesophyll 

is differentiated in palisade tissue with two layers and spongy tissue. After the 

mites attack these structures suffer mutations, the tector hairs get hypertrphied and 

elongated, the tissues from the mesophyll get necrosis, the tissues from the median 

vein get disorganized (Figure 8), the leaves dry up, the fruits stop growing at 

normal sizes.



Fig. 5 – Transverse section in the folicular 

limb at the American tile tree attacked by 

eriophyid mites. (original). 

Fig. 7 – Walnut tree eriophyid mite 

attack - Aceria erineus. 

Fig. 6 – Transverse section in the folicular 

limb of the tile tree plants attacked by 

eriophyid mites at vein level (original). 

Fig. 8– Transverse section in the leaf 

of Juglans regia attacked by 

eriophyid mites in the median vein 

area (original). 

In the green house cucumber culture we found the species Tetranychus 

urticae. The attack can be recognized from the presence of the mites on the inferior 

side of the leaves whre a thin web is formed. The tissues turn yellow and the leaves 

dry up. The attack took place in hearths and was localized in less airy areas. The 

attacked plants that were not treated aginst this mite dry up and the production 

decreases or is even completely compromised. 

CONCLUSIONS 

1. The following mites species were found: the galicol mite of pear tree 

leaves - Eriophyes pyri; the eriophyid mite of the walnut tree - Aceria erineus



(Nalepa); the eriophyid mites at tile tree (Eriophyes tetratichus, E. tiliae rudis, E. 

tiliae exilis), the yellow spider of the tile tree – Eotetranychus tiliarium; 

tetranichyid mites (Tetranychus urticae) at cucumbers. 

2. The climatic conditionsspecific to the year 2006 favourized the growing at 

high densities of the tetranichyid mites at Tilia spp. and at the green house 

cucumbers. 

3. Using transverse sections in the leaves of several plants ( tile tree, pear 

tree and walnut tree) attacked by mites, morphological and anatomical mutations 

were emphasized through suggestive images: spots of various forms and aspects, 

the wrinkling of the superios epidermis, disorganisation and necrosis of the 

mesophyll, the hypertrophy of the hairs from the inferior side of the leaves. 

4. The social and economical impact of these pests consists of: the 

unaesthetic aspect of the plants because of the grey colour; the decrease of the 

plants ornamental value; the drying of the plants at repeated attacks; the decrease 

of the medicinal features of some plants (tile tree flowers); the change of the 

microclimate due to the decrease of the plants photosynthesis, respiration and 

perspiration. 

5. The unaesthetic impact of the yellow and grey tile trees on the streets, in 

the parks and gardens during the summer months should increase significantly the 

public interest for these pests. 

Bibliography 

1. Boguleanu Gh. and coworkers, 1980 – Agricultural Entomology. Didactic 

and Pedagogic Printing House Bucharest. 

2. Georgescu Mihaela Ioana, Palanciuc Vasilica, Săvulescu Elena, Pădure 

Ioana,2001 – Practical botany studies, AMC, U.S.A.M.V., Bucharest. 

3. Iacob N. and coworkers, 1978 – Agricultural Zoology Treatise, Academy 

Printing House; 

4. Ionescu M.A., Lăcătuşu Matilda, 1971 – Entomology. Didactic and 

Pedagogic Printing House Bucharest. 

5. Manolache C. And coworkers, 1969 – Agricultural Entomology. 

Agricultural and Forest Printing House Bucharest. 

6. Naum A., Schmidt Elisabeta, Dobrin Ionela, 1997 – Guide for Entomology 

Practical Studies. Polygraphic Printing House USAMV Bucharest. 

7. Şerbănescu - Jitariu Gabriela, Marin Andrei, Natalia Rădulescu – Mitroiu, 

Elena Petria, 1983 – Vegetable Biology Practicum. Ceres Printing House 

Bucharest. 

8. Toma C., Rodica Rugina, 1998 – Medicinal Herbs Anatomy – Atlas. 

Romanian Academy Printing House Bucharest.



OBTAINING OF METALLIC NANOPARTICLES USING 

B. SUBTILIS 

O. POPA 22 , M. DRUGULESCU 23 , Narcisa BĂBEANU 1 , V. S. 

MĂNOIU 24 , Nela ZAMBILĂ 25 , 

Abstract: An important area of research is the synthesis of nanoparticles with 

different chemical composition, size and morphology. It is necessary to develop 

methods of nanoparticles synthesis without the use of toxic chemical processes. 

Development of an ecological, low cost, good results process, for synthesis of 

metallic nanoparticles is an important step in the field of nanotechnology 

application. 

As a result, researchers in the field of synthesis and "assembling" nanoparticles 

have sought to draw on the biological systems. 

Through transmission electronic microscopy (TEM) and scanning electron 

microscopy (SEM) we could see that the synthesis processes of nanoparticles and 

colloidal metallic particles by biosynthesis using microorganisms in the medium 

culture with high concentration of metallic ions is different. 

Introduction 

Keywords: silver nanoparticles, nanobiotehcnology, Bacillus 

subtilis, TEM microscopy. 

Nanomaterials have pushed the manipulation limit of matter at atomic and 

molecular level. They have different physical, chemical, electronic, magnetoelectric 

properties from those of classical materials used in science and technology, 

just because of their extreme size. 

The potentialities of this nanobiotechnological design based on bacterial 

biosynthesis of nanoparticles for several technical applications are important, 

including their high potential as antibacterial material. 

22 Applied Biochemistry and Biotechnology Centre – BIOTEHNOL, Bucharest, Romania 

23 R&D Department of SC COMPRESERV SRL, Bucharest, Romania 

24 National Institute of Research and Development for Biological Sciences, Bucharest, Romania 

25 R&D Department of SC ECOAGRICOLA SRL, Bucharest, Romania



Fig. 1. Bacillus subtilis with Ag deposits. Note the 

shift from a coil form to the nanoparticles 

deposits. 

Bacterial cells are in the form of rods, having 

large dimensions; polysaccharides from the cell 

surface forms a capsule; sporulation is an 

identification criteria, the percentage of this being 

determined by the amount of nutrients and oxygen 

in the environment. 

Micro-organisms which are brought into contact with high concentrations of Ag 

ions solutions adapt their physiological mechanisms to resist them. 

Biosynthesis of intracellular metal is developed by bacterial species that have 

metabolic property to fix or to precipitate these metals. This biosynthesis is 

because of interactions between electropositive charging and the electronegative 

charging of the external surface of bacterial cells. 

The same phenomenon appears if the metal ions are stored extracellular. These 

bioaccumulation processes are conducted under the influence of physical and 

chemical factors acting at the micro media of the microbial cells. 

These mechanisms of reducing of metallic ions could be: 

fixing of metallic ions on the cell walls through irreversible chemical 

bounds; 

formation of an accumulation center for new metal quantities; 

precipitation of accumulated metals. 

In the situation of lack of nutrients, such as putting in contact the bacterial 

biomass with solutions containing metallic ions without input nutrient, the viability 

of cells is maintained by endogenous metabolism which determines: 

the supply on low level of energy used in metabolic activities, for 

surviving; 

re-synthesizing of some basic cellular components using the N and C 

from cell inner media. 

Bacillus subtilis has a slow endogenous metabolism that allows them to survive 

in an environment that is characterized by fluctuations in the concentration of 

nutrients. Endogenous metabolism is a form of adaptation to environmental 

conditions. 

Adapting the bacterial cell to the deficiency of nutrients in the environment is 

made by increasing the concentration of enzymes that are involved in the take-in of



nutrients, synthesis of new protein with affinity for other substances from the 

environment. 

Conditions of cultivation media and characteristics: 

the cultivation media is simple and contain glucose as carbon source; 

the optimum of multiplication temperature is 37°C; 

the turbidity is low; 

in solid cultivation media the microbial colonies are patchy, R type, large 

with white-grey color; 

in semisolid cultivation media the colonies are developed in the zone with 

higher oxygen amount. 

Experimental conditions 

Study of metabolic particularities and multiplication of bacteria Bacillus subtilis 

has been made on the simple broth with pH 7.4 with glucose content 10 grams per 

1,000 ml of medium. 

The study was conducted in 500 ml Erlenmeyer flask (200 mL of culture 

medium; in total 5 bottles, total volume of 1,000 ml). 

The inoculums’ was prepared in 20 ml of culture medium without glucose 

addition, being cultivated for 16 hours at temperature of 37°C 

The biological control of inoculums’: 

UFC/ml was determined by decimals dilution method and growing on 

solid medium in Petri plates: the bacterial titre 10 8 UFC / ml; 

there has established the purity of bacterial and fungal sterility by 

microscopic examination and inoculation for 1-7 days in agar peptone 

medium culture and liquid medium Sabouraud type: inoculate used was 

pure bacterial and fungal sterile. Inoculation bottles of 200 ml were inside 

the laminar flow of sterile air. 

The bacterial biomass was processed to remove traces of culture medium; also 

was taken in silver nitrate solution: 

a. AgNO3 1 M; 

b. AgNO3 0,01 M; 

c. AgNO3 0,001 M. 

The silver nitrate solution was added to 1 g of wet biomass in 6 ml volume. 

Samples with silver nitrate were incubated at 28°C for 72 hours with agitation. 

Measurement methods 

Through transmission electronic microscopy (TEM) we could see that the 

synthesis processes of nanoparticles and colloidal metallic particles by biosynthesis



using microorganisms in the medium culture with high concentration of silver ions 

is different from those with other metallic ions. 

From the dimensional viewpoint the range of the particle size are between 5 and 

50 nm. 

The used characterization techniques are: 

1. energy-dispersive X-ray spectroscopy (EDX), 

2. scanning electron microscopy (SEM), 

3. transmission electronic microscopy (TEM). 

The analysis and determinations using diffraction of X radiation, transmission 

electron microscopy, the scanning electronic microscopy, can put in evidence the 

following: 

1. nanoparticles and colloidal silver particles deposits; 

2. if the identified deposits are separated particles; 

3. if the identified particles generally present a protein envelope from 

microorganisms; 

4. if the identified microorganisms present large colloidal and nanoparticles 

silver deposits on the surface and in the immediate neighborhood; 

TEM microscopy analysis was done on sediment obtained by centrifugation, 

which was dripping directly on the grids covered with film of formvar. Grids were 

washed with distilled water through drip and dry on paper filter. 

For SEM microscopy, the obtained sediment was dripping on microscope plate 

and left to dry under the cluster. The plate was fixed in microscopic samples 

support with tape with special carbon. 

Samples analysis 

The obtained samples were investigated by transmission electron microscopy 

TEM, SEM and EDX analysis in order to put in evidence biosynthesis of silver 

nanoparticles, dimensionality and morphology of obtained nanoparticles and 

chemical composition. 

The samples were analyzed at TEM microscope after 20 hours and 72 hours 

incubation time. 

Analyses of images obtained suggest that bacterial cells after 20 hours fixes 

silver ions depending on the stage of growth. Young cells deposited extracellular 

nanoparticles of silver and retain the stick shape.



Fig. 3. SEM image microscopy. 

Note deposits of silver 

nanoparticles in the form of 

bright dots, the outlines of 

microorganisms that have not 

started the process of 

biosynthesis of metal particles 

(in the form of photography 

dark ovoid) 

Fig. 2. A micro phase of disintegration and a 

colony of microorganisms with multiple 

nanoparticles deposits. (TEM microscopy) 

The mature cells fix strongly Ag ions with a 

helical arrangement throughout its length. 

Bacterial cell enter into a rapid process of 

involution, the stick form of cell being more 

unrecognizable as the microbial cell is more 

mature. 

After 40 hours, analyzed samples proved that the extracellular agglomerations of 

silver ions in the form of a spiral surrounding the microbial cell is continuing; the 

cells being increasingly degraded; aggregation arrangement of nanoparticles 

replace the destroyed bacterial cells. 

SEM microscopy images and EDX analysis highlights biosynthesized silver 

nanoparticles.



Results and conclusions 

Fig. 4. EDX spectrum analysis 

in a microorganism on a 

silver-based metallic particle. 

The silicon and other elements 

peaks correspond to the 

composition of glass. 

Ag nanoparticles are agglomerated as a helical coating outside the 

bacterial cells of Bacillus subtilis; 

these agglomerations are stable; 

deposits of nanoparticles presents a relatively uniform dimensional 

distribution limits between 4 and 50 nm; 

by EDX analysis was determined 8.09% mass percent concentration of 

silver (by subtracting the background) in the environment and 4.32% 

mass percent concentration for a particle inside of a micro-organism, 

respectively 1.84 and 1.01 atomic percent; 

the pH value was 7.3; 

the temperature was 32°C; at this temperature the formed deposits are Ag 

nanostructure; 

young bacterial cells are more resistant to the action of silver ions in 

comparison with the mature cells that become senescent from the 20-hour 

takeover of biomass in the solution of silver nitrate; 

1:6 ratio of wet biomass : silver nitrate solution ensure that the action of 

bacteria on the silver ions will generate nanoparticles; 

the order of bacterial titre is 109 UFC/ml; that ensures, after 

centrifugation, the amount of bacterial cells to metabolize the Ag ions; 

the 0,01M and 0,001M concentration ensures formation of Ag 

nanoparticles; 

the laboratory method for biosorbtion and nanostructuration of Ag 

involve these steps: 

1. obtaining of bacterial biomass by cultivating of ATCC 6633 

Bacillus subtilis strain, for 48 hours at 37°C; 

2. biomass centrifugation for 30 min at 6000 rpm;



References 

3. mixing the bacterial biomass with silver nitrate solution (0,01 M, 

0,001 M) – 1:6 ratio of wet biomass : silver nitrate solution; 

4. separation of formed nanostructures by incubation at 32°C and 

agitation at 200 rpm; 

5. The analysis of obtained samples using TEM, SEM and EDX. 

1. Williams D., Sheryl Ehrman and Tracey Pulliam Holoman: Evaluation 

of the microbial growth response to inorganic nanoparticles, Journal of 

Nanobiotechnology 4:3 2006; 

2. Kowshik M., Ashtaputre S., Kharrazi S., Vogel W., Urban J., Kulkami 

S.K., Paknikar K.M.: Extracellular Synthesis of silver nanoparticles by a 

silver-tolerant yeast strain MKY3. Nanotechnology, 14:95 –100, 2003; 

3. Elechiguerra J.L., Burt J., Morones J.R., Alejandra Camacho-Bragado: 

Interaction of silver nanoparticles with HIV-I, Journal of 

Nanobiotechnology, 2005; 

4. Nelson Durán, Priscyla D Marcato, Oswaldo L Alves, Gabriel IH De 

Souza, Elisa Esposito: Mechanistic aspects of biosynthesis of silver 

nanoparticles by several Fusarium oxysporum strains. Journal of 

Nanobiotechnology, 2005; 

5. Beveridge T.J.and Doyle R.J: Metal ions and Bacteria,Wiley, New 

York,1989; 

6. Bender A.R. Hvon Briesen, J Creuter ,I. B. Duncan and H.Rubsamen- 

Waigmann: Antimicrobial Agents Chemotherapy, 40 (1996) 1467; 

7. Sastry Murali, Ahmad Absar, Khan Islam M, Kumar Rajiv: Biosynthesis 

of metal nanoparticles using fungi and actinomycete, Current Science , 

85, 2 2003; 

8. Elechiguerra J.L., Burt J., Morones J.R., Alejandra Camacho-Bragado: 

Interaction of silver nanoparticles whth HIV-I, Journal of 

Nanobiotechnology, 3: 6 2005; 

9. Williams D., Sheryl Ehrman and Tracey Pulliam Holoman: Evaluation 

of the microbial growth response to inorganic nanoparticles, Journal of 

Nanobiotechnology 4:3 2006;



REPRESENTATION OF ROMANIAN COMPANIES 

IN EUROPEAN E-COMMERCE 

G.MARGARIT ∗ , R.TOMA ∗ 

Abstract: E Commerce is one of the most important facets of the Internet to have emerged 

in the recent times. Ecommerce or electronic commerce involves carrying out business over 

the Internet with the assistance of computers, which are linked to each other forming a 

network. To be specific ecommerce would be buying and selling of goods and services and 

transfer of funds through digital communications. 

Electronic commerce has the potential to bring significant benefits to producers 

and consumers. E-commerce grew more slowly in Europe for a variety of reasons. In 

general, Europeans proved more skeptical regarding the potential of e-commerce ventures, 

which meant funding was more difficult for up-starts to obtain. The European e-commerce 

market is forecast to reach $255.7 million this year - a growth of 28% - after which market 

growth is expected to gradually decelerate, reaching 16% growth in the fifth year of the 

forecast (2011). 

The main objectives of this article are to present situation of representation of 

Romanian companies in European e-Commerce. 

Conceived as a presentation and communication interface between Romanian and 

European companies, as well as international business environment, subscribing on 

european area sites is an instrument for the Romanian companies integration into the 

European and worldwide economic system. 

Keywords: e-Commerce; Romanian companies; cross-border transactions, consumers 

1. INTRODUCTION 

Electronic commerce has the potential to bring significant benefits to 

producers and consumers. It can provide greater choice, promote competition 

among suppliers, and allow businesses to develop new relationships with their 

customers for mutual advantage. It also has the potential to play a large part in the 

development of the cross-border shopping dimension of the internal market. While 

e-commerce is growing, competition between suppliers move them to double their 

efforts making own offer more spectacular but obstacles to consumer confidence 

remain. 

∗ USAMV Bucharest



E-commerce grew more slowly in Europe for a variety of reasons. In 

general, Europeans proved more skeptical regarding the potential of e-commerce 

ventures, which meant funding was more difficult for up-starts to obtain. Ecommerce 

players also faced many more regulatory hurdles than in the U.S. as 

online commerce laws varied widely across the different countries within Europe, a 

fact that not only dissuaded some traditional European firms from engaging in ecommerce, 

but also slowed the European expansion of some worldwide ecommerce 

giants. In addition, interactive information services, also enjoyed more 

prominence in Europe, which undermined the novelty of the Internet for many 

Europeans. Perhaps one of the largest obstacles to Internet use in Europe was the 

cost of local phone access, which was billed by most major telecommunications 

firms there on a per-minute basis. Since local telephone lines provided the most 

common form of access to the Internet, users were forced to pay not only monthly 

fees to their Internet services provider (ISP), but also per-minute fees for the call as 

well. 

However, Internet access across the continent did begin to increase in 

1999, due in large part to the free Internet access offered by firms such as United 

Kingdom-based Freeserve, launched by European electronic retailing giant Dixons 

Group in September of 1998. 

Consumer trust depends to a large extent on the perception of a particular 

company/site as being trustworthy, and on a secure telecommunications 

connection. This is confirmed by the fact that major operators, who benefit from 

what is known as “brand recognition” in the marketplace benefit from the growth 

of the market. This does not always appear to be the case for other enterprises. 

In particular SMEs have confirmed that they need enhanced consumer 

confidence in the responses given to an open consultation on legal barriers in ebusiness. 

A key medium for consumer purchasing is electronic commerce, since it 

has an unrivalled potential for cross-border transactions, and thus providing 

consumers with the opportunity to benefit fully from open competition across the 

internal market. 

2. THE EUROPEAN MARKET AND ITS IMPORTANCE 

The European e-commerce market is forecast to reach $255.7 million this 

year - a growth of 28% - after which market growth is expected to gradually 

decelerate, reaching 16% growth in the fifth year of the forecast (2011). 

The European market is far from uniform, according to “European B2C E- 

Commerce: Spotlight on the UK, Germany and France.” The three countries in the 

title together now account for 72% of Europe’s online sales:



• The UK is by far the largest of the three major markets, with projected 

2007 sales of 42 billion pounds ($84 billion) and is on track to grow 39% 

this year. 

• Germany, however, has the most online buyers, with 27.2 million, but 

produces less than half the online sales volume of the UK. 

• France, in turn, produces less than half Germany’s e-commerce sales 

volume and has 14.5 million online buyers. 

• On average, German and French buyers are spending considerably less 

online per person than their UK counterparts. 

Fig1. Geographic position of Europe - benefits to be in the center of the world 

In Romania, electronic commerce has also continued to grow. For 

instance, the total number of transactions made by holders Romanian Visa cards 

in Romania and abroad increased by 123%, reaching 141,000. The value of 

online transactions is $ 17.5 million, with 103% more than at the end of 

September 2006, compared to the same period of 2005. Most Visa cards were 

used for travel, the value of online transactions recorded by airlines and travel 

agencies representing 36% of the total volume of e-commerce. 

In 2006, a study conduct by Gemius with support assured by Mercury 

company, reflect that e-buyers represent only 29% of the total online population. 

Home shopping was in the incipient evolving phase. The majority of Internet users



makes their payments in cash at delivery, instead of using bank transfers. This is 

the consequence of the opinion that making bank transfers is risky (44%). 

In addition, in Romania, online shops are more popular than auctions, therefore the 

domestic market edged up to 26% for online shops, whilst auctions maintain at a 

very modest level of 5% represented mostly by foreign auctions. e-mag is the 

leader of on-line shops in Romania, it’s unaided brand awareness reaching 25% of 

the choices of online shops buyers. Ranked behind are: Flamingo (8%), dc-shop 

(5%), Diverta and librarie.net (4% all). The undisputed leader of auctions in 

Romania is www.ocazii.ro accounting for 35% of total choices in the top of 

unaided brand awareness of auctions. 

e-Commerce Sales in Europe between 2006-2008, in forecast to 2011, according 

to eMarketer in 2007, presents the following data: 

Table 1 

e-Commerce Sales in Europe 

Year Bilions ($) % increase versus prior 

year 

2006 132,9 - 

2007 196,9 37,2 

2008 255,7 28,0 

2009 307,1 25,6 

2010 357,4 20,0 

2011 406,8 15,6 

3. WAYS TO BE SEEN THROUGH E-COMMERCE 

The Romanian EuroPartners database includes 32131 Companies 

registered. 

There are specialized sites who bring companies in customers attention. 

For example, www.alibaba.com is a world occasion to meet together suppliers and 

customers. One of the profesional business sites, very accesively for Romanian 

companies, with main objective to bring together producers, suppliers and 

customers from Europe is www.profittool.eu. Conceived as a presentation and 

communication interface between Romanian companies and local, as well as 

international business environment, www.profittool.eu is an instrument for the 

Romanian companies integration into the European and worldwide economic 

system. All company profiles contain detailed information necessary to a potential 

partner when making decisions concerning the cooperation with a Romanian or 

foreign company.



According to profittool database, the repartition of Romanian companies in 

e-Commerce is described in tabel 2. 

Table 2 

Romanian Companies registered on profittool.eu Romania - 2008 

Domains % 

Agriculture, food, beverages and tobacco. Forestry 5,17 

Wood, wooden products and furniture 7,50 

Mining and quarrying. Oil, gas, coal and nuclear fuel. 

2,50 

Electricity, heating, water, recycling and environment 

Textile, clothing, leather and footwear 5,78 

Paper and cardboard. Printing and publishing. Office machinery and 4,22 

equipment 

Chemicals, pharmaceuticals and cosmetics.Rubber and plastics. 

7,37 

Non-metallic mineral products. Glass and ceramics 

Electrical, electronic, nuclear, optical and medical equipment. 

5,20 

Measuring apparatus and equipment 

Metallurgy, metalworking and metal products 13,73 

Machinery. Other industrial products 6,65 

Building industry 18,90 

Transportation. Transport means and services. Spare parts and accessories 9,97 

Telecommunications. Computers and software 2,89 

Import-export, wholesalers and distributors. Departmental and chain 

stores 

2,46 

Tourism, hotels, leisure and entertainment 1,30 

Business services (commercial, financial and insurance, research and 

engineering, advertising, real estate, education and training) 

6,36 

Total 100,00 

Here it is the graphic illustration about each domain and its percentage 

from total Romanian companies being in profittool.eu database at this time (Figure 

2).



Figure 2 

4. E-COMMERCE, THE OPPORTUNITY FOR ROMANIAN 

COMPANIES 

Basic benefits for Romanian companies in e-commerce are: 

increase sales - this is the first thing that people consider when dealing w 

e-commerce 

decreasing costs 

increase profits 

understanding that profits is not the same as sales 

expands the size of the market from regional to national or national to 

international 

contract the market 

reach a narrow market 

target market segmentation allows you to focus on a more select group of 

customers 

therefore have a competitive advantages in satisfying them 

Great benefits from e-commerce: 

Expanded Geographical Reach 

Expanded Customer Base



Increase Visibility through Search Engine Marketing 

Provide Customers valuable information about your business 

Build Customer Loyalty 

Reduction of Marketing and Advertising Costs 

Collection of Customer Data 

Ecommerce allows companies to carry out businesses without the barriers 

of time or distance. One can log on to the Internet at any point of time, be it day 

or 

night and 

purchase or sell anything one desires at a single click of the mouse. 

The direct cost-of-sale for an order taken from a web site is lower than 

through traditional means (retail, paper based), as there is no human interaction 

during the on-line electronic purchase order process. Also, electronic selling 

virtually eliminates 

processing errors, as well as being faster and more convenient 

for the visitor. 

E-commerce is ideal for niche products. Customers for such products are 

usually few. But in the vast market 

place like is the Internet, even niche products 

could generate 

viable volumes. 

Another important benefit of Ecommerce 

for Romanian companies is that 

it is the cheapest means of doing business. 

The day-to-day pressures of the marketplace have played their part in 

reducing the opportunities for companies to invest in improving their competitive 

position. If the selling price cannot be increased and the manufactured cost cannot 

be decreased then the difference can be in the way the business is carried out. 

Ecommerce 

has provided the solution by decimating the costs, which are incurred. 

The strategic benefit of making a business „e-commerce enabled”, is that it 

helps reduce 

the delivery time, labour cost and the cost incurred in the following 

areas: 

1. Document preparation 

2. Error detection and 

correction 

3. Reconciliation 

4. Mail preparation 

5. Telephone calling 

6. Data entry 

7. Overtime 

8. Supervision expenses 

Operational benefits of e-commerce include reducing both the time and 

personnel required to complete business processes, and reducing strain on other 

resources. It’s because of all these advantages that one can harness the power of 

ecommerce and convert a business to ebusiness by using powerful 

turnkey e- 

commerce solutions made available by ebusiness solution providers.



In the same time, a Romanian companies who wants to do e-commerce is 

provider and also buyer. 

From the buyer’s perspective also e-commerce offers a lot of tangible 

advantages: 

1. Reduction in buyer’s sorting out time. 

2. Better buyer descisions 

3. Less time is spent in resolving invoice and order discrepancies. 

4. Increased opportunities for buying alternative products. 

Reference 

1. Eurostat Statistical books – Europe in figures, year 2008 

2. Eurostat Statistical books – Eurostatistics Data for short-term economic 

analysis, Issue number 8/2008 

3. Gemius - E-commerce in the countries of Central and Eastern Europe: 

Romania, Warsaw, Poland March 2007, 

4. Gambini, G. - International trade of the European Union in 2007, 

Statistics in Focus, 2008 

5. http://www.ecommerceprogram.com/ecommerce/benefits-ofecommerce.asp 

6. http://www.sescommerce.com/benefits-of-ecommerce.asp 

7. www.eMarketer.com 

8. www.profittool.eu 

9. *** European Commision Staff Working Document - Consumer 

Confidence in E- Commerce: lessons learned from the e-confidence 

initiative, 2007



THE BEHAVIOR OF A VARIETIES OF VITIS 

VINIFERA L. WHEN ARE ATTACKED BY MITES 

VASILICA LUCHIAN 1 , MINODORA TUDOSE 2 

Abstract 

In order to track down and identify the mites that attack the plants of Vitis 

vinifera L. samples were taken and observations were made in the vine plantation 

of USAMV-Bucharest. There were taken samples from 25 vine varieties. In 

vegetation, the morphological and anatomical mutations caused by the attack of 

several species of mites were followed up, these annalysis being realized inside the 

Botanics and Plant Physiology Department, Botanics Subject. Leaves annalysis 

were made, from the morphological and anatomical point of view, so that we can 

observe what happens to the folicular limb attacked by mites. 

Key words: mesophylle, mites, epidermis 

1. INTRODUCTION 

From the group of eriophyid mites, the Colomerus vitis species is the most 

known in most of the countries that cultivate vine, both through the frequency of its 

dispersion and mostly through the damages it causes. The ecological plasticity of 

the mite, its strong affinity towards the main ecological factors, determine in some 

years large multiplication with favourable consequences over the efficiency and 

quality of the attacked crops. Eriophyid mites represent a group less studied on 

international level, compared to other groups and especially to tetranichyid mites. 

Also there are less data in the speciality literature regarding the morphological and 

anatomical changes that happen in the folicular limb of the vine attacked by mites. 

2. MATERIAL AND METHOD 

The observations were made in the vine plantation inside USAMV 

Bucharest, in the period 2005 – 2007. To monitor the mites observations were 

made periodically in the vine plantation. Samples of attacked plants (types of 

damage) and the respective pests were taken in order to be detrmined in the 

laboratory. Tracking and identifying the mites was made inside the Genetics and 

Plants Improvement and Protection Department, Entomology subject. 

Microscopical concoctions were made in order to determine the mites species. The



collected material was photographed, directly on the field or in the laboratory using 

the camera or a digital camera. A part of the material was directly scanned. 

Transverse sections were made in the vine leaves attacked by mites, inside 

the Botanics and Plant Physiology, Botanics Subject. The sections were clarified 

with chloral-hydrate for 24 hours and washed with water [3,5,6]. The 

microscopical concoctions were fixed in jellified glycerine and the observations 

and photos were made at the optical microscope type MC-7, having attached the 

Exakta Varex camera or a digital camera. Observations of the anatomical structures 

in healthy and plagued tissues in order to identify the mutations caused by mites. 

3. RESULTS AND DISCUSSIONS 

Table 1 

Tracking the mites at the varieties studied in the spring of 2005 

Variant Found Species Hibernating Stage Variety 

1 Colomerus vitis female ARCAŞ 

2 Colomerus vitis female AZUR 

3 Tetranychus urticae female ŞARBA 

4 Colomerus vitis female PANDUR 

5 Tetranychus urticae female RIESLING 

6 Colomerus vitis female MUSCAT DE 

HAMBURG 

7 Tetranychus urticae female AFUZ-ALI 

8 Colomerus vitis 

Tetranychus urticae 

female FETEASCĂ REGALĂ 

9 Tetranychus urticae female GRASĂ DE 

COTNARI 

10 Tetranychus urticae female PINOT GRIS 

11 Colomerus vitis female GREACA 

12 Colomerus vitis female NOVAC 

13 Colomerus vitis female PURPURIU 

14 Colomerus vitis female TRIUMF 

15 Tetranychus urticae female ALIGOTE 

16 Colomerus vitis female MERLOT 

17 Absent - PINOT NOIR 

18 Absent - CHARDONAY 

19 Absent - MUSCAT OTTONEL 

20 Absent - BRUMĂRIU 

21 Absent - MAMAIA



In order to track down the mites species in the spring of 2005, before the 

beginning of the vine vegetation (temperature < 10 0 C), branches from 21 varieties 

of vine were harvested and forced in the laboratory. After the swelling of the buds 

these were opened under the binocular and the presence or the absence of the 

hibernating stages and their density were noted. As a result of te researches 

regarding the tracking of the mites on the vine branches forced in the laboratory 

two mites species were found Colomerus vitis Pagst. and Tetranychus urticae 

Koch. The hibernating stages are represented by adult females under the scales of 

the buds for both species. The varieties were the hibernating stages were found are 

presented in table 1. The average values of the number of galls/leaf for the studied 

varieties in the spring of 2005 are presented in figure 1. It can be observed an 

average number of galls/leaf high at the varieties Azur, Arcaş, Fetească albă, 

Mamaia, Fetească regală, Donaris and Muscat Ottonel, with an average number of 

over 20 galls/leaf. This thing is connected to the presence of the preence of the 

hibernating stages previously found. The presence of the galls is shown in original 

images, sorted by varieties, the attack produced by this species being 

characteristical. 

A high number of galls/leaf can be observed, attack that is being directly 

connected to the characteristics of the variety (leaves pilosity). 

35 

30 

25 

20 

15 

10 

5 

0 

14,42 

32,85 

29,42 

10,14 

23,85 

5,28 

22 

13,57 

8,28 

14,8514,2814,28 

l 

22,28 

11,85 

Average number galls/leaf 

6,57 

21,85 

19,71 

15,57 

12,1412,42 

11, 28 

Fig. 1 - Behavior of several vine varieties to the attack of the galicol vine mite - 

Colomerus vitis, in the spring of 2005. 

From the annalysis of figure 2 results a high frequency of galls on leaves 

at the varieties: Azur, Donaris, Mamaia, Arcaş and Petit Sauvignon with values 

between 55,55 % and 37,50 %. Figure 2 presents graphically the galls frequency at 

the studied varieties. This thing is correlated with the average number of galls on



leaves recorded in the previous years. The adults and larva of Tetranichus urticae 

Koch colonize the inferior part of the leaves. The leaves show specific shiny grey 

or reddish spots, slightly curved. [1,2]. After strong attacks the leaves dry up and 

fall and the plants don’t make fruits in a normal way. The leaves attacked by 

Colomerus vitis Pagst show on the inferior side spots of various sizes with felty 

aspect (Figure 3). The felty formations are caused by the hypertrophy of the 

plurycellular hairs from the inferior epidermis. On the superior part of the leaf, 

connected with these spots, specific swellings appear. If the attack takes place in 

the inflorescence before it blooms numerous flowers suffer an abortion [4,7]. In the 

transverse section it can be observed that the folicular limb suffered morphological 

and anatomical changes. The superior epidermis got wrinkled and the hairs from 

the inferior epidermis suffered a hypertrophy. The mesophyll suffers a 

desorganization, the cells of the palisade and spongy tissue get necrosis. (Figure 4). 

Due to these morphological and anatomical mutations the physiological processes 

don’t take their normal course anymore. In a transverse section in the leaf with a 

advanced mites attack it can be observed that the spongy tissue begins to get 

desorganized and the inferior epidermis gets wrinkled. 

60 

50 

40 

30 

20 

10 

0 

Ă 

B 

L 

A 

Ă 

S 

C 

A 

E 

T 

E 

F 

30 

R 

U 

Z 

A 

55,55 

Ş 

A 

C 

R 

A 

40 

Ă 

N 

A 

D 

O 

C 

18,18 

Ă 

L 

A 

G 

E 

R 

Ă 

C 

S 

A 

E 

T 

F 

E 

33,33 

C 

A 

V 

O 

N 

20 

IU 

R 

U 

P 

R 

U 

P 

9,09 

IS 

R 

A 

N 

O 

D 

44,44 

F 

M 

IU 

R 

T 

10 

A 

C 

A 

E 

R 

G 

20 

R 

U 

D 

N 

P 

A 

11,11 

N 

O 

N 

I 

G 

V 

U 

A 

S 

IT 

T 

PE 

37,5 

L 

E 

N 

O 

T 

O 

T 

A 

C 

S 

U 

M 

25 

U 

R 

G 

E 

N 

IŞ 

M 

IŞ 

K 

11,110 

N 

O 

N 

I 

G 

V 

U 

SA 

T 

E 

N 

R 

E 

B 

A 

C 

N 

I 

A 

L 

A 

I 

T 

G 

IN 

L 

S 

IE 

R 

Fig. 2 – Frenquency of galls/leaf in the spring 2006 

28,57 

25 22,22 

12,514,28 

E 

R 

O 

D 

S 

A 

L 

E 

S 

A 

H 

C 

C 

U 

ID 

A 

H 

I 

N 

A 

Ş 

Ă 

G 

Ă 

R 

D 

E 

D 

Ă 

R 

G 

A 

E 

N 

IU 

R 

Ă 

M 

U 

R 

B 

IA 

A 

M 

A 

M 

44,44



Fig. 3 – Attack produced by 

Colomerus vitis on leaves, AZUR 

(original). 

4. CONCLUSIONS 

Fig. 4 – Transverse section in the leaf of 

Vitis vinifera attacked by Colomerus vitis 

(original). 

1. The following mites species were found on Vitis vinifera L.: Colomerus 

vitis Pagst., Tetranychus urticae Koch. 

2. In the spring of 2005 the galicol vine mite showed a strong attack, 

presented in this study through the average number of galls/leaves and the 

frequency of galls/leaves. 

3. The studies made on laboratory forced branches allow the tracking of the 

hibernating stages of the mites, establishing their density and chosing the control 

methods at the right moment. 

4. Following the observations concerning the behaviour of several vine 

varieties to the attack of the galicol vine mite – Colomerus vitis, the following 

varieties proved to be sensitive: Azur, Arcaş, Fetească albă, Mamaia, Fetească 

regală, Donaris and Muscat Ottonel, with an average number of galls on leaves of 

over 20. Also a high frequency of the galls on leaves was noticed at the varieties: 

Azur, Donaris, Mamaia, Arcaş and Petit Sauvignon with values between 55,55 % 

and 37,50 %. 

5. The leaves with typical symptoms of attack show differences of the attack 

according to the variety.



6. The high sensitivity of these varieties to the attack of the galicol vine mite 

– Colomerus vitis is correlated to the degree of leaves pilosity, fact mentioned in 

the entomological literature. 

7. Following the transverse sections made in the leaves of different plants 

varieties (vine, linden tree, pear tree and nut tree) attacked by eriophyid mites, 

anatomical and morphological changes were shown through suggestive images: 

wrinkling of the superior epidermis, dezorganization and necrosis of the mesophyll, 

hypertrophy of the hairs from the inferior side of the leaves, chaotical 

multiplication of the mesophyll cells. 

REFERENCES 

1. Arion G., 1958 – Agricultural Entomology, Agro-Silvică de Stat Bucharest 

Printing House. 

2. Boguleanu Gh., 1994 – Pests of the Agricultural and Forestry Cultures from 

Romania. Vol II, Technical and Agricultural Printing House. 

3. Georgescu Mihaela Ioana, Palanciuc Vasilica, Săvulescu Elena, Pădure 

Ioana,2001 – Practical botany studies, AMC, U.S.A.M.V., Bucharest. 

4. Manson D. C. M., 1984 - Eriophyoidea except Eriophyinae (Arachnida: Acari). 

Fauna of New Zeeland 4, 144 pages. ISBN 0-477-06745-X. Published 12 Nov 

1984. 

5. Săvulescu Elena, 2007 – Systematical Botanics, Printech Printing House, 

Bucharest. 

6. Şerbănescu - Jitariu Gabriela, Marin Andrei, Natalia Rădulescu – Mitroiu, Elena 

Petria, 1983 – Vegetable Biology Practicum. Ceres Printing House, Bucharest. 

7. Tudose Minodora ,2000 – Practical Entomology Studies, AMC, USAMV, 

Bucharest.

BIOTECHNOLOGY - Facultatea de Biotehnologii

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?