Inhibition of lipid metabolic enzymes using Mangifera indica extracts

Inhibition of lipid metabolic enzymes using Mangifera indica extracts
Diego A. Moreno 1 , Christophe Ripoll 1 , Nebojsa Ilic 2 , Alexander Poulev 1 , Cristin Aubin 3 and Ilya Raskin 1*
1
Rutgers – The State University of New Jersey, Biotech Center, Cook College, 228 Foran Hall, 59 Dudley Road, New
Brunswick, New Jersey 08901-8520, U.S.A. *e-mail: raskin@aesop.rutgers.edu. 2 Phytomedics Inc., 65 Stults Road, Dayton, NJ
08810-1523, USA. 3 Children’s Hospital Boston, Division of Endocrinology, 300 Longwood Ave., Boston, MA 02115, U.S.A
Received 28 August 2004, accepted 27 November 2005.
Abstract
This study assesses the effects of mango tree (Mangifera indica L.) extracts (stem bark – MSB and leaves – ML) on lipases (pancreatic lipase,
lipoprotein lipase and hormone-sensitive lipase). The MSB and ML samples were extracted in 95% ethanol and the extracts assayed for the
inhibition of pancreatic lipase (PL) and lipoprotein lipase (LPL) as well as for the inhibition of lipolysis of 3T3-L1 adipocytes. We have also
examined the anti-obesity action of MSB and ML by testing whether the extracts prevented weight gain induced by feeding a high-fat diet to male
Wistar rats for 12 weeks. Both MSB and ML inhibited PL and LPL, suggesting that they may affect both fat absorption and the uptake of fatty
acids, if enough of the active components can be absorbed and entered into the circulation. The inhibition of stimulated lipolysis by MSB and ML
suggested that the cells took up the active components of the extracts. In addition, MSB and ML increased fecal fat excretion and reduced serum
glucose and insulin levels and down-regulated some obesity-related genes (LPL, hormone-sensitive lipase, fatty acid synthase, resistin) in liver and
epididymal fat. The precise molecular mechanisms by which MSB and ML inhibit lipases and lipolysis still requires further investigation.However,
the relative biochemical complexity of these extracts may produce a pleiotropic action on several lipid and carbohydrate metabolism targets
simultaneously, making MSB and ML multifunctional botanical therapeutics useful in weight control. MSB and ML or some of their components
may also provide effective biochemical tools for studying the complex relationships between energy balance, adiposity and endocrine function.
Key words: Botanicals, dietary supplements, natural products, obesity, plant extracts, lipase.
Introduction
In the United States and worldwide, the epidemic of overweight
and obesity is expanding 1, 2 . Western diets are high in fat and
promote obesity 3 , and the only available U.S.-F.D.A. approved
drug for the pharmacological inhibition of the digestion of dietary
triglycerides is Orlistat (Xenical ® ) 4 . Even though, people use
many nutritional supplements for weight loss, none of them have
been convincingly demonstrated to be safe and effective 5 . In
this situation, it becomes clear that we need more effective and
better tolerated anti-obesity treatments. Pancreatic lipase (PL),
lipoprotein lipase (LPL) and hormone-sensitive lipase (HSL) are
enzymes responsible for the digestion of triglycerides coming
from the diet 6 , the plasma lipoproteins 7 and the adipocytes 8, 9 ,
respectively. The existence of ethnopharmacological sources of
phytochemicals with anti-lipase activity has been investigated
and reported in different plant species including Cassia
mimosoides 10 , Salacia reticulata 11 , Salix matsudara 12 ,
Dioscorea nipponica 13 and Camelia sinensis 14 .
Mango (Mangifera indica L.), belonging to the family
Anacardiaceae, is widely distributed in many tropical and subtropical
regions; it is one of the most popular edible fruits in the
world 15 . Mango stem bark (MSB), containing a variety of
polyphenols, which included phenolic acids, phenolic esters,
flavan-3-ols and a xanthone (mangiferin), has been traditionally
used for the treatment of menorrhagia, scabies, diarrhea, allergies,
syphilis, diabetes, cutaneous infections and anemia, using an
aqueous extract obtained by decoction 16, 17 . The leaves of mango
(ML) are also used as an antidiabetic agent in Nigerian folk
medicine 18 . Mangiferin present in Mangifera extracts in addition
to different Salacia reticulata polyphenols resulted in enhanced
lipolysis and inhibited PL and LPL activities in female Zucker
rats 11 .
The development of botanical drugs, following the guidelines
of the U.S.-F.D.A. 19 , can be faster and cheaper than conventional
single-entity pharmaceuticals 20 . The present study was carried
out to test the hypothesis that the bioactive compounds in MSB
and ML extracts may have anti-obesity effects in rats through
inhibition of fat metabolizing enzymes (pancreatic lipase and
lipoprotein lipase) and reduced lipolysis (HSL). In an effort to
clarify the anti-obesity mechanisms of MSB and ML, we also
evaluated their effects on body weight, fecal lipids, blood and
liver chemistry as well as the expression of obesity-related genes
in liver and epididymal fat tissue of male Wistar rats under highfat
diet supplemented with MSB and ML.
Materials and Methods
Preparation and chemical analysis of the extracts: MSB,
obtained from Amazon Herbs (Paramaribo, Suriname) and ML,
obtained from Standard Fruit de Honduras S.A. (Zona Mazapan
La Ceiba Atlantida, Honduras), were extracted in 95% ethanol
(1:10 w:v) with mechanical agitation for 24 h. The organic solvent
was then evaporated and these crude extracts freeze-dried.

Pancreatic lipase [PL; E.C. 3.1.1.3]: Lipase-PS TM reagents were
obtained from Sigma Diagnostics (Procedure No. 805, Sigma-
Aldrich, St. Louis, MO). Human pancreatic lipase (Lipase-PS
standard, 230 U l -1 ) was obtained from Sigma Diagnostics (Sigma-
Aldrich, St. Louis, MO). Aliquots (30 µl) of lipase standard, blank
(water as reference) and MSB and ML samples were added to 400
µl of substrate solution, mixed gently and incubated for 5 min at
37°C. Activator reagent (300 µl) was added to the samples, mixed
by gentle inversion and incubated for an additional 3 min at 37°C.
The increase in absorbance at 550 nm, due to the formation of
quinone diimine dye, was measured to determine the activity in
the samples 4, 6 .
Lipoprotein lipase [LPL; E.C. 3.1.1.34]: LPL was measured
according to the method of Nilsson-Ehle and Schotz 22 . A pool of
LPL was made by incubating human adipose tissue fragments
with 10 U ml -1 heparin (500 mg 5 ml -1 ) for 45 min at 24°C. Aliquots
of this heparin eluate were preincubated with varying
concentrations of MSB and ML (Table 2) for 30 min at 4°C. After
addition of 3 H-triolein substrate, samples were incubated for 60
min at 37°C and the released 3 H-oleic acid was measured 23 .
Hormone-sensitive lipase [HSL, E.C. 3.1.1.]: Lipolytic activity
in cultured mouse 3T3-L1 adipocytes was used as a measure of
HSL activity 21, 24 . 3T3-L1 cells were cultured with DMEM (4500
mg glucose l -1 ) supplemented with 100 g l -1 fetal bovine serum, 2
mM glutamine, 100 units ml -1 penicillin, 100 µg ml -1 streptomycin,
110 µg ml -1 sodium pyruvate and 8 µg ml -1 biotin, in a 50 g kg -1 CO 2
atmosphere at 37°C. The differentiation of 3T3-L1 cells was
initiated by the addition of 10 µM dexamethasone, 0.5 mM
isobutyl-methylxanthine and 10 µg ml -1 insulin to the culture
medium of confluent cells for 3 days, followed by the cultivation
of cells without supplements for an additional 3 or more days. We
added MSB and ML extracts as indicated in Fig. 1; after 18 hours
of incubation, the stimulation of lipolysis was accomplished by
incubating differentiated adipocytes with 10 µM isoproterenol
-
and 20 g l 1 fatty acid-free bovine serum albumin for 1 h. Lipolysis
was determined by measuring glycerol release using a fluorometric
23, 24
enzymatic assay .
In vivo study: This study was approved by the Animal Care and
Facilities Committee in the Office of Research and Sponsored
Programs at Rutgers University. 7-9-week-old healthy male Wistar
rats (Charles River Laboratories Inc., MA, USA) were kept, one
per collection cage, in a temperature-controlled room at 22°C with
a 12h/12h light/darkness cycle with lights on at 7:00 AM. There
was an average of 10-15 air changes per room per h. Rats were
allowed free access to water and food and adapted to the facility
for 1 week before treatment.
The rats were divided into three groups. The control group was
fed a high-fat AIN-76A purified rodent diet (45% kcal fat, Dyets
Inc. Bethlehem, PA). The other two groups were fed a modified
diet to match the energy supply of the diets and including 10 g
-
kg 1 of either MSB or ML extracts for 12 weeks. Body weight was
measured between 9:00-11:00 AM every Thursday morning. Daily
(24 h) food intake was measured on a per-animal basis once per
__________________________________________________________________________________
Abbreviations: BWG: body weight gain; FAS: Fatty acid synthase; FFA: Free fatty acids; HSL: Hormonesensitive
lipase; ISO: Isoproterenol; LPL: Lipoprotein lipase; PL: Pancreatic lipase; MSB: Mango stem
bark; ML: Mango leaves
week. Feces were collected once per 2 weeks. Feces from each rat
were pooled and dried to constant weight. Fecal lipids were
extracted by the method of Folch et al. 25 .
After 12 weeks of treatment, we kept rats fasting overnight
and euthanized by decapitation for necrospy. Liver and fat
deposits (right-half epididymal fat depots) were excised, weighed
and immediately frozen in liquid nitrogen and stored at –80°C for
future analyses. Blood was collected for biochemical analyses
on a Hitachi 747 chemistry analyzer (Ani Lytics Inc., Gaithersburg,
MD): glucose (Hexokinase, Roche Molecular Biochemicals,
Germany) and insulin (Radioinmunoassay specific for rat, Linco
Research Inc., Missouri); total cholesterol (Cholesterol/HP assay
kit Roche Molecular biochemicals, Indianapolis) and triglycerides
(Glycerol Phosphate Peroxidase, Roche reagents). These
experiments were carried out at the Cook Animal Facility (Cook
College, Rutgers University), an A.A.A.L.A.C. Intl.-accredited
facility. Animals were cared for in accordance with national
guidelines of Public Health for the Care and Use of Laboratory
Animals.
Obesity-related gene expression analyses: Total RNA from liver
and epididymal fat tissues was extracted following the TRI-
Reagent® protocol (Sigma, St Louis, MO) and pooled from the 6
rats per treatment before RT-PCR analysis. RNA was treated with
RNase-free RQ1 DNase (Promega, Madison, WI) and then
submitted to a reverse transcription with superscript II H-
(Invitrogen, Carslad, CA) according to the manufacturer’s
instructions.
Obesity-related gene expression levels were quantified using
a Stratagene Mx 3000P TM Real-Time PCR System (Stratagene, La
Jolla, CA). Primers for each gene were designed using Primer
Express® ver. 2.0 (Applied Biosystems, Foster City, CA) as
presented in Table 1.
Real-time PCR analyses were carried out in a Brilliant® SYBR®
Green PCR master mix kit (Stratagene) according to kit instructions.
Samples were amplified using the following program: 2 minutes
incubation at 50°C; initial denaturation and polymerase activation
at 95ºC for 10 min; 40 PCR cycles consisting of 15 s at 95°C and 60
s at 60°C each. The RNA expression was analyzed by ‘∆∆Ct’
methods 26 , using the β-actin gene as a normalizer. Amplification
of specific transcripts was further confirmed by obtaining melting
curve profiles. All samples were assayed in duplicate and 5
independent analyses were performed.
Statistical analysis: All data were subjected to analysis of
variance (ANOVA). The data (means ± SEM) shown are mean
values and the significance of the differences was compared using
the Duncan’s Multiple Range Test at Least Significant Difference
(P

Table 1. Primers sequence for RT-PCR (5’-3’) of selected obesity-related genes.
Gene (accession number) Forward Reverse
Medium Chain Acyl-CoA
GCTAGTAAAGCCTTCACCGGATT TTAGTTCCTTTTTTCCGATGTGTATTC
(NM_016986)
Acyl-CoA oxidase (NM_01734) TGGCCAACTATGGTGGACATC TACCAATCTGGCTGCACGAA
Fatty Acid Synthase (NM_017332) GGCATCATTGGGCACTCCTT GCTGCAAGCACAGCCTCTCT
Lipoprotein Lipase (NM_012598) CTGAAAGTGAGAACATTCCCTTCA CCGTGTAAATCAAGAAGGAGTAGGTT
Hormone sensitive lipase
CCAAGTGTGTGAGCGCCTATT CACGCCCAATGCCTTCTG
(NM_012859)
UCP-2 (NM_019354) TCCGGACACAATAGTATCTTTAAG GCCTGATCCCCTTGATTTCC
Adiponectin (NM_144740) CCCAGGGTCCAGATTCAACTC GGTGTAATGGTGGGCTTGCT
Resistin (NM_144741) ACTGCCAGTGCGGAAGCATAG ATCAACCGTCCTCAGGAACCA
Actin (NM_031144) GGGAAATCGTGCGTGACATT GCGGCAGTGGCCATCTC
Table 2. Inhibitory effects of Mangifera indica extracts on the activity of human
pancreatic lipase (PL) and lipoprotein lipase (LPL).
Extract (mg ml -1 ) PL (U l -1 )
Inhibitory
effect (%)
LPL (U ml -1 )
(µmol glycerol released
h -1 ml -1 )
0 230.00.2 a † 0.628 0.016 a †
MSB 0.01 204.52.1 b 11 0.620 0.015 a
0.1 193.32.8 c 16 0.560 0.021 b 11
1 115.52.4 d 50 0.158 0.015 c 75
ML 0.01 169.52.1 b 26 0.618 0.020 a
0.1 159.32.1 c 31 0.508 0.017 b 19
1 129.81.3 d 44 0.478 0.011 c 24
Inhibitory
effect (%)
Inhibitory effect shown as the lowering of relative activity (%) compared to control (0 mg ml -1 = 100% activity).†Values followed
by different lowercase letters are significantly different (ANOVA) from the control at p

200
a
b
b
a
35
***
a
Control HFD MSB +HFD ML +HFD
a
µM Released Glycerol (well) -1
150
100
50
d
c
b
c
Fecal Lipids (mg g -1 feces d.w.) d -1 rat -1
30
25
20
15
10
5
b
**
a
b
b
a
a
a
a
a
a
0
Figure 1. Inhibitory effect of Mangifera indica extracts on HSL activity
in cultured murine 3T3-L1 adipocytes. Each column represents the
mean ±SEM (n= 4). Means followed by the same letter are not significantly
different at p

Table 4. Effect of treatment with Mangifera indica extracts
extracts on gene expression in the liver and
epididymal fat tissues of male Wistar rats.
Gene HFD Control MSB +HFD
ML +HFD
Mango leaf
Liver
MCAD 100 90.5 10.0 86.3 14.0
-Amylase 100 95.5 8.1 86.1 8.0
ACO 100 74.3 11.4 108.0 11.4
FAS 100 109.5 11.3 88.9 8.3
Epididymal fat
LPL 100 a† 77.5 3.6 b 69.4 3.7 b
HSL 100 a 87.3 4.7 b 73.0 1.2 c
UCP-2 100 107.1 3.6 101.2 5.1
FAS 100 a 64.8 3.5 b 38.7 8.6 c
Adiponectin 100 101.0 5.0 111.6 8.1
Resistin 100 a 90.3 4.7 a 67.5 7.7 b
Results represents means ± SEM (n = 6).†Values followed by different lowercase letters are
significantly different (ANOVA) from the control at p

Chemistry 37:361-368.
7
Goldberg, I.J. and Merkel, M. 2002. Lipoprotein lipase: physiology,
biochemistry, and molecular biology. Front Biosciences 6: D388-4051.
8
Holm, C., Osterlund, T., Laurell, H. and Contreras, J. 2000. Molecular
mechanisms regulating hormone-sensitive lipase and lipolysis. Annual
Review Nutrition 20:365-93.
9
Slee, D.H., Bhat, A.S., Nguyen, T.N., Kish, M., Lundeen, K., Newman,
M.J. and McConnell, S.J. 2003. Pyrrolopyrazinedione-based inhibitors
of human hormone-sensitive lipase. Journal Medicinal Chemistry 46:
1120-1122.
10
Yamamoto, M., Shimura, S., Itoh, Y., Ohsaka, T., Egawa, M. and Inoue,
S. 2000. Anti-obesity effects of lipase inhibitor CT-II, an extract from
edible herbs, Nomame Herba, on rats fed a high-fat diet. International
Journal Obesity 24:758-764.
11
Yoshikawa, M., Shimoda, H., Nishida, N., Takada, M. and Matsuda,
H. 2002. Salacia reticulata and its polyphenolic constituents with
lipase inhibitory and lipolytic activities have mild antiobesity effects
in rats. Journal of Nutrition 132:1819-1824.
12
Han, L.-K., Sumiyoshi, M., Zhang, J., Liu, M.-X., Zhang, X.-F., Zheng,
Y.-N., Okuda, H. and Kimura, Y. 2003. Anti-obesity action of Salix
matsudana leaves (Part 1). Anti-obesity action by polyphenols of
Salix matsudana in high fat-diet treated rodent animals. Phytotherapy
Research 17:1188-1194.
13
Kwon, C.-S., Sohn, H.-Y., Kim, S.-H., Kim, J.-H., Son, K.-H., Lee, J.-
S., Lim, J.-K. and Kim, J.-S. 2003. Anti-obesity effect of Dioscorea
nipponica Makino with lipase-inhibitory activity in rodents.
Bioscience, Biotechnology and Biochemistry 67:1451-1456.
14
Wu, L.-Y., Juan, C.-C., Ho, L.-T., Hsu, Y.-P. and Hwang, L.-S. 2004.
Effect of green tea supplementation on insulin sensitivity in Sprague-
Dawley Rats. Journal Agricultural Food Chemistry 52:643-648.
15
Ross, I.A. 2003. Mangifera indica L. In Medicinal Plants of the World,
Volume 1. Chemical Constituents, Traditional and Modern Uses. 2 nd
Edition. Humana Press, Totowa NJ, pp. 315-328.
16
Nunez-Selles, A.J., Velez-Castro, H.T., Agüero-Agüero, J., Gonzalez-
Gonzalez, J., Naddeo, F., De Simone, F. and Rastrelli, L. 2002. Isolation
and quantitative analysis of phenolic antioxidants, free sugars, and
polyols from mango (Mangifera indica L.) stem bark aqueous decoction
used in Cuba as nutritional supplement. Journal Agricultural Food
Chemistry 50:762-766.
17
Garcia, D., Escalante, M., Delgado, R., Ubeira, F.M. and Leiro, J. 2003.
Anthelminthic and antiallergic activities of Mangifera indica L. stem
bark components vimang and mangiferin. Phytotherapy Research 17:
1203-1208.
18
Aderibigbe, A.O., Emudianughe, T.S. and Lawal, B.A.S. 1999.
Antihyperglycaemic effect of Mangifera indica in Rat. Phytotherapy
Research 13:504-507.
19
U.S. -F.D.A. 2004. Guidance for Industry Botanical Drug Products.
Center for Drug Evaluation and Research, US Food and Drug
Administration. URL: http://www.fda.gov/cder/guidance/4592fnl.htm
(Access 25 May, 2005).
20
Ribnicky, D., Poulev, A., O’Neal, J., Wnorowski, G., Malek, D.E.,
Jäger, R. and Raskin, I. 2004. Toxicological evaluation of the ethanolic
extract of Artemisia dracunculus L. for use as a dietary supplement
and in functional foods. Food Chemistry Toxicology 42:585-598.
21
Moreno, D.A., Ilic, N., Poulev, A., Brasaemle, D.L., Fried, S.K. and
Raskin, I. 2003. Inhibitory effects of grape seed extract on lipases.
Nutrition 19:876-879.
22
Nilsson-Ehle, P. and Schotz, M.C. 1976. A stable, radioactive substrate
emulsion for assay of lipoprotein lipase. Journal Lipid Research 17:
546-541.
23
Brasaemle, D.L., Barber, T., Wolins, N.E., Serrero, G., Blanchette-
Mackie, E.J. and Londos, C. 1997. Adipose differentiation-related
protein is an ubiquitously expressed lipid storage droplet-associated
protein. Journal Lipid Resesearch 38:2249-2263.
24
Laurell, S. and Tibbling, G. 1966. An enzymatic fluorometric
micromethod for the determination of glycerol. Clinical Chimica Acta
13:317-322.
25
Folch, J., Lees, M. and Sloane-Stanley, G.M. 1957. Simple method for
isolation and purification of total lipids from animal tissues. Journal
Biological Chemistry 226:497-509.
26
Winer, J., Jung, C.K.S., Shackel, I. and Williams, P.M. 1999.
Development and validation of real-time quantitative reverse
transcriptase-polymerase chain reaction for monitoring gene expression
in cardia myocytes in vitro. Analytical Biochemistry 270:41-49.
27
Harkness, J.E. and Wagner, J.E. 1995. The Biology and Medicine of
Rabbits and Rodents. 4 th Edition. Lea & Febiger Editors, Philadelphia,
PA, 372 pp.
28
Akiyama, T., Tachibana, I., Shirohara, H., Watanabe, N. and Otsuki,
M. 1996. High-fat hypercaloric diet induces obesity, glucose intolerance
and hyperlipidemia in normal adult male Wistar rat. Diabetes Research
Clinical Practice 31:27-35.
29
Muruganandan, S., Srinivasan, K., Gupta, S., Gupta, P.K. and Lal, J.
2005. Effect of mangiferin on hyperglycemia and atherogenicity in
streptozotocin diabetic rats. Journal Ethnopharmacology 97:497-501.
30
Choo, J.J. 2003. Green tea reduces body fat accretion caused by highfat
diet in rats through β-adrenoceptor activation of thermogenesis in
brown adipose tissue. Journal Nutritional Biochemistry 11: 671-676.
31
Ouchi, N., Kihara, S., Funahashi, T., Matsuzawa, Y. and Walsh, K.
2003. Obesity, adiponectin and vascular inflammatory disease. Current
Opinion Lipidology 14:561-566.
32
Sul, H.S., Latasa, M.J., Moon, Y. and Kim, K.H. 2000. Regulation of
the fatty acid synthase promoter by insulin. Journal of Nutrition 130:
315S-320S.
33
Vendrell, J., Broch, M., Vilarrasa, N., Molina, A., Gomez, J.M.,
Gutierrez, C., Simon, I., Soler, J. and Richart, C. 2004. Resistin,
adiponectin, ghrelin, leptin, and proinflammatory cytokines:
relationships in obesity. Obesity Research 12:962-971.