Subcellular localization of tyrosine hydroxylase ... - Biology of the Cell

Biology of the Cell (1998) 90, 39-51 

o Elsevier, Paris 

39 

Original article 

Subcellular localization of tyrosine hydroxylase (TH) 

gene transcripts: New insights into the pattern 

of TH gene expression in the locus coeruleus 

under pharmacological stimulation 

Alain Trembleau * and Floyd E Bloom 

The Scripps Research Institute, Department of Neuropharmacology, SBR-I, 10666 North Torrey Pines Road, 

La Jolla, CA 92037, USA 

To document the subcellular compartmentalization of the tyrosine hydroxylase (TH) primary (heterogeneous 

nuclear, hnRNA) and processed mRNA transcripts in viva, we have studied the expression 

of the TH gene in the locus coeruleus of the rat brain in basal conditions and under pharmacological 

stimulation by reserpine. Using exon-specific probes and electron microscopic in situ 

hybridization in reserpine-treated animals, we have demonstrated that the TH mRNA is localized 

both in the perikaryal cytoplasm (in association with domains of the endoplasmic reticulum) and 

in the nucleus (in large and smaller aggregates). By comparing hybridization patterns with intronand 

exon-specific probes, we have shown that the two main foci of nuclear TH RNA labeling correspond 

to the primary (hnRNA) transcript, while accessory secondary tracks or dots represent 

mature transcript devoid of introns. Finally, our data indicate that the pattern of expression of the 

TH gene is heterogeneous within the locus coeruleus neuron population. Under basal conditions, 

many neurons exhibit no detectable intron signal, although all locus coeruleus neurons express the 

TH gene. Other neurons display high intron labeling, and obviously express the gene at a much 

higher level. Upon reserpine stimulation, the number of neurons displaying detectable intron signals, 

as well as the intensity of the intron signal per neuron progressively increases during the first 

24 h, suggesting that TH expressing neurons are progressively recruited for higher expression of 

this gene as the stimulation progresses. (0 Elsevier, Paris) 

tyrosine hydroxylase mRNA / in situ hybridization / intron / exon / electron microscopy 

INTRODUCTION 

During the last decade, the cellular compartmentalization 

of mRNAs with respect to subcellular structures 

has been addressed thanks to the development 

of high resolution in situ hybridization techniques 

combined with confocal fluorescence or electron 

microscopy. Among the questions examined using 

these approaches, a fundamental issue concerns the 

* Present address: hole Normale Suphieure, URA-CNRS 1414, 

46, rue d’Ulm, 75252 Paris cedex 05, France 

TH gene expression in the locus coeruleus 

processes of gene transcription and RNA processing 

in relation to nuclear territories which can be identified 

with specific markers. Recent works using high 

resolution in situ hybridization to examine RNA 

intron or exon sequences within nuclei of cultured 

cells have shed light on the nuclear compartmentalization 

of mRNA metabolism (Lawrence et al, 1989; 

Huang and Spector, 1991; Puvion-Dutilleul and 

Puvion, 1991; Wang et al, 1991; Dirks et al, 1993; Xing 

et al, 1993; Zhang et al, 1994). Briefly, from the study 

of expression of viral or abundant cellular mRNAs, 

the main conclusions were that specific gene transcripts 

are concentrated in foci or tracks within the 

Trembleau and Bloom

40 Biology of the Cell (1998) 90, 39-5 i 

nucleus (Lawrence ef al, 1989). These foci or tracks of 

transcripts are colocalized with the corresponding 

genes, thus providing strong evidence for the aggregation 

of primary nuclear transcripts (heterogeneous 

nuclear RNA, hnRNA) at the transcription sites 

(Xing et al, 1993). Furthermore, using intron- and 

exon-specific probes it was shown for the few 

mRNAs studied so far that the splicing occurs at the 

transcription site, within the RNA foci or tracks 

(Xing et al, 1993; Zhang ef aI, 1994). Whether the sites 

of splicing coincide with the intranuclear speckles 

(Spector et al, 1991; Spector, 1993), which are known 

to be enriched in splicing factors, remains however 

controversial (Xing et al, 1995; Singer and Green, 

1997; Misteli et al, 1997). Overall, the view we now 

have from these studies performed in vitro is that 

specific mRNAs can be visualized in the nucleus as 

foci or tracks located at the transcription sites, where 

they are spliced shortly after transcription, and 

before being exported out of the nucleus. 

All these data have been obtained on cultured 

cells, and only for a few genes, all of which are 

expressed at very high levels. However, little is 

known so far about these processes as they occur in 

~iaa, in complex heterocellular tissues such as the 

brain. Furthermore, it appears of interest to apply 

these in sifu hybridization strategies on nuclear 

hnRNAs to groups of cells expressing a given gene in 

viuo, because this approach might potentially allow 

the determination of the precise pattern of expression 

of such a gene within a cell population. It might also 

permit insight at the transcriptional level, into the 

dynamics of regulation of a given gene’s expression 

in physiological or experimental circumstances, for 

example, to determine whether a stimulus regulates 

the expression of a given gene in a same way and 

with the same kinetics for all cells of an apparently 

homogeneous population (ie a brain nucleus). 

The aim of the present work was to analyze the 

expression of the tyrosine hydroxylase gene in vim 

in a neurochemically homogeneous central nervous 

system nucleus, the noradrenergic locus coeruleus 

of the rat. In these neurons, tyrosine hydroxylase 

catalyzes the rate limiting step in the synthesis of 

catecholamines (Levitt et al, 1965). We have examined 

the subcellular compartmentalization of TH 

primary and mature transcripts using haptenlabeled 

multiple oligonucieotide probes (Trembleau 

and Bloom, 1995), by confocal and electron 

microscopy. These experiments were conducted 

under basal conditions or pharmacological stimulation 

by reserpine. Reserpine disrupts vesicular 

storage of catecholamines leading to tissue deple-, 

tion of dopamine, norepinephrine, adrenaline and 

5-hydroxytryptamine (Carlsson, 1965). Catecholamine 

depletion is followed by regionally specific 

increases in the level of tyrosine hydroxylase 

TH gene expression in the locus coerueus 

mRNA in various brain nuclei including the locus 

coeruleus, in which there is a 65%450% increase in 

TH mRNA following reserpine administration 

(Mallet et nl, 1983; Faucon Biguet et al, 1986; Berod 

et al, 1987; Austin et aI, 1990). 

We report here that reserpine stimulation of TH 

gene expression dramatically increases the nuclear 

content of TH mRNAs mainly as the primary gene 

transcript, but also as an intronless processed transcript 

appearing-as track- or foci-like aggregates of 

nuclear TH mRNA. Finally, the analysis of the time 

course of stimulation of TH gene expression and 

the pattern of labeling strongly suggest that catecholaminergic 

neurons express the TH gene asynchronously, 

and that they are progressivel) 

recruited for high expression of this gene as the 

functional stimulation progresses. 

Probes 

Hapten-labeled oligonucleotides were used in this study 

to detect the tyrosine hydroxylase intronic or exonit 

sequences. Five non-overlapping oligonucleotides were 

used for the detection of exonic sequences of the 

TH mRNA (THl: S’GCTGCTGTGTCTGGGTCAAAC 

GCTCGGACCTCAGG3’; TH2: GCGCTGGATACGA 

GAGGCATAGTTCCTGAGCTTGTC3’; TH3: 5’CTC 

CAAGGAGCGCTGGATGGTGTGAGGGCTGTC3’; TH5: 

5’ACTGGGCACCTCGAAGCGCACAAAATACTC 

CAGS’; and TH6: 5’ACTGCGCACGTCGTCAGACACCC 

GACGCACAGA3’). These oligonucleotide sequences 

were designed from the published sequence of rat TH 

cDNA (Grima ef al, 1985), so as to display the lowest 

homology with other related mI?NAs, such as the tryptophan 

hydroxylase mRNA. The specificity of these oligonucleotides 

was assessed in a previous work (Trembleau 

and Bloom, 1995). 

Four non-overlapping oligonucleotides designed from 

intron 2 sequences of the rat TH gene (Sherman and 

Moody, 1995) were used to localize the TH nuclear heterogeneous 

mRNA (iTH1: 5’GGAGGTCACTAGCCA 

GAGCAACAATGCAATCAG3’; iTH2: 5’TATGCGTGT 

CAGAGCTGAGGCTAACTAGAGGAG3’; iTH3: 5’CCT 

TGTTGTCCTAAGCAGCCGTATTTAGCCCTG3’; iTH4: 

5’GCACAGGGTTCTGGCTTTAATGTCATTTGAGAT 

TT3’). 

Oligonucleotides were labeled by tailing the? entl 

using terminal transferase (Boehringer Mannheim, Germany) 

and either biotin-16-dUTP (Boehringer, Mannheim, 

Germany) or digoxigenin-ll-dUTP (Boehringer, 

Mannheim, Germany), as described in .detail elsewhere 

(Trembleau et ai, 1993,1994). 

Aduli male Sprague-Vawley rats weighing between 

200-220 g were used in this study. Animals were injected 

with 10 mg/kg reserpine or with vehicle (20% ascorbic 

Trembfeau and Bloom

Biology of the Cell (1998) 90, 39-51 41 

acid in saline; control animals). All injections (0.25 mL) 

were administered subcutaneously in the neck. Animals 

were killed 6, 24 or 48 h later as follows. They were 

deeply anesthetized with chloral hydrate (300 m&kg ip) 

and intracardially perfused with 50 mL saline, followed 

by 300 mL ice-cold fixative solution. The fixative solution 

was either 4% paraformaldehyde (PFA) plus 0.1% glutaraldehyde 

(GA) diluted in 0.1 M phosphate buffer 

(PB) (pH 7.4) for tissues processed for electron microscopy 

(vibratome sections), or 4% PFA alone diluted in 

PB for tissues processed for light microscopy (cryostat 

sections). The brains were quickly removed, post-fixed in 

4% PFA for 1 h and then immersed overnight at 4°C in 

sterile phosphate buffered saline (PBS) (pH 7.4) containing 

15% sucrose. 

For electron microscopic analyses, 50 pm vibratome 

sections were obtained from the brains fixed with 4% 

PFA and 0.1% GA. They were then permeabilized using 

the following procedure. The sections were first 

immersed for at least 2 h at 4’C in Eppendorf tubes containing 

a cryoprotective buffer (10% glycerol, 25% 

sucrose in PBS), then frozen in liquid nitrogen, and 

finally thawed at room temperature. They were subsequently 

rinsed in several baths of PBS before prehybridization. 

For the light microscopy experiments, the brains fixed 

with 4% PFA were frozen in vapors of liquid nitrogen. 

Coronal sections of 12 q were cut in a cryostat (Reichert-Jung, 

Germany) and collected in sterile culture dishes 

containing PBS. The free-floating sections were then 

rinsed gently in several exchanges of PBS before being 

prehybridized. 

Both the vibratome and cryostat sections were prehybridized 

for 1 h at 37°C in 4 X SSC buffer containing 1 X 

Denhardt (0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 

0.02% bovine serum albumin) and 10 pg/mL tRNA. 

Light microscopic detection of the TH mRNA 

with exonic or intronic sequences 

Cryostat sections were hybridized overnight at 37°C in 

the hybridization buffer (50% formamide, 600 mM NaCl, 

80 mM Tris-HCl, pH 7.5, 4 mM EDTA, 0.1% sodium 

pyrophosphate, 0.1% sodium dodecyl sulfate (SDS)) containing 

either exon-specific (n = 5) or intron-specific 

(n = 4) digoxigenin-labeled oligoprobes (2 nM each). Following 

the hybridization step, the sections were washed 

three times in 2 x SSC (30 min each) and in three baths of 

0.1 x SSC (30 mm each) at 37”C, and then immersed in 

buffer I (0.1 M Tris, pH 7.5,l M NaCl, 2 mM MgCl,) containing 

1% BSA for 30 mm. Then the sections were incubated 

overnight at 4°C in buffer I containing the alkalinephosphatase-labeled 

anti-digoxigenin Fab fragment 

(Boehringer, Mannheim, Germany, l/5000). The sections 

were subsequently washed in buffer I (3 x 10 min) and in 

buffer II (0.1 M Tris, pH 9.5, 0.1 M NaCl, 5 mM MgCl,) 

(5 min). Tissue-bound alkaline phosphatase activity was 

visualized by incubating the sections with NBT and BCIP 

(Gibco BRL, Gaithersburg, MD, USA) in buffer II. The 

enzymatic reaction was stopped by rinsing the sections in 

PBS. Finally, the sections were mounted in PBS-glycerol 

(l/ 1, v/v) on gelatin-coated slides. 


Electron microscopic visualization 

of the TH mRNA exonic sequences 

Following the prehybridization step, the vibratome sections 

were immersed overnight at 37°C in the hybridization buffer 

(50% formamide, 600 mM NaCl, 80 mM Tris-HCl, pH 7.5, 

4 mM EDTA, 0.1% sodium pyrophosphate) containing the 

5 TH exon-specific oligonucleotide probes labeled with bio 

tin (2 nM each). Following the hybridization step, the sections 

were washed three times in 2 x SSC (30 min each) and 

in three baths of 0.1 x SSC (30 min each) at 3T”C, and then 

immersed in PBS. The sections were then blocked in 0.5% 

BSA in PBS for 30 min at room temperature. Biotin was subsequently 

detected using a rabbit anti-biotin antibody (Enzo 

Biochem, l/1000, overnight at 4”C), and then a biotinylated 

anti-rabbit antibody (Amersham, l/200,2 h at room temperature) 

followed by a streptavidin-biotinylated peroxidase 

(l/400). Each of these incubations was performed in PBS 

containing 0.5% bovine serum albumin (PBS-BSA), and were 

followed by three rinses in PBS. Finally, the tissue-bound 

peroxidase activity was detected using 3,3’-diaminobenzidine 

(DAB), and the sections were processed for electron 

microscopy as previously described (Trembleau et aI, 1994). 

Simultaneous detection of intronic and exonic 

TH mRNA sequences using fluorescent 

reporters and confocal microscopy 

To detect simultaneously two RNA sequences using fluorescent 

reporters, we used a procedure described in 

detail elsewhere (Trembleau and Bloom, 1995). Briefly, 

the cryostat sections fixed with 4% PFA were hybridized 

as described above in a hybridization buffer containing 

the 5 TH mRNA exonic-specific probes labeled with biotin 

and the 4 TH mRNA intronic-specific probes labeled 

with digoxigenin (2 nM each). 

Following the hybridization step, the cryostat sections 

were washed in SSC buffer using the same protocol as 

described above for vibratome sections, and the cryostat 

sections were blocked in PBSBSA for 1 h at 4°C. A sheep 

anti-digoxigenin antibody (l/1000, Boehringer, Mannheim, 

Germany) and a rabbit anti-biotin antibody 

(l/1000, Enzo Biochem, New York, USA) diluted in PBS 

BSA were then incubated together with the floating sections 

overnight at 4°C. Following three rinses in PBS 

(10 min each), the sections were subsequently immersed 

in the PBS-BSA buffer containing a Cy3-conjugate donkey 

anti-sheep antibody (l/400, Jackson) and a FITC-conjugate 

donkey anti-rabbit antibody (l/200, Jackson) for 2 h 

at room temperature. Finally, the sections were mounted 

on gelatin-coated slides with an anti-fading reagent and 

observed with a Zeiss laser scanning confocal microscope. 

Appropriate short pass filter sets were used to separate 

optimally the emission signals from both fluorescent dyes. 

Simultaneous detection of intronic 

and exonic TH mRNA sequences using 

alkaline phosphatase and peroxidase 

as the reporters 

In the experiments in which the TH mRNA exonic and 

intronic sequences were co-localized using two enzy- 

Trembleau and Bloom

42 Biology of the Cell (1998) 90, 39-51 

matic reporters, cryostat sections were hybridized as for 

the dual fluorescent experiments. Following the washing 

steps, the sections were blocked as described above and 

incubated overnight at 4°C in buffer I with both the aIkaline 

phosphatase-labeled anti-digoxigenin Fab fragment 

(Boehringer, Mannheim, Germany, l/5000) and the rabbit 

anti-biotin antibody (Enzo Biochem, l/1090). Then 

the sections were incubated with a biotinylated anti-rabbit 

antibody (Amersham, l/200, 2 h at room temperature) 

followed by a streptavidin-biotinylated peroxidase 

(l/400)). Each of these incubations was performed in buffer 

I containing 0.5% bovine serum albumin, and were 

followed by three rinses in buffer I. The tissue-bound 

peroxidase activity was detected using DAB and the set-, 

tions were processed for the alkaline phosphatase detection 

using NJ3T-BCIP and mounted as described above. 

RESULTS 

Effect of twerp&e 

of cateehehminergic 

coedeus 

on.the cekdar 

OftheTH 

neurons of tie locus 

In initial experiments, we visualized the TH mRNA 

using a single exon-specific oligonucleotide probe 

(THl) labeled with digoxigenin, and detected with 

alkaline phosphatase and NBT-BCIP as the 

reporter. Sections through the locus coeruleus were 

obtained from control rats or animals treated with a 

single injection of reserpine for 2 days. The sections 

were hybridized in the same conditions within a 

same experiment, and the alkaline phosphatase 

detection was processed identicaIly for both groups 

of sections in order to compare the signals 

obtained. Figure 1 displays representative pictures 

from a control (fig 1Af and reserpine-treated animal 

(fig lB), and compares the cellular compartmentalization 

of TH mRNA in these two conditions. 

In control animals, the TH mRNA staining 

appears variable from cell to cell within the locus 

coeruleus neuron population, some intensely 

labeled, and others faintly labeled. This staining 

was consistently observed only in the perikaryal 

cytoplasm. In reserpine-treated animals, this perikaryal 

staining was significantly increased, leading 

to a strong labeling of the cytoplasm of nearly all 

the neurons of the locus coeruleus. Furthermore, 

significant staining was also sometimes observed in 

proximal dendrites of these caterholaminergic neurons. 

However, no significant staining was ever 

observed in thin neuronal processes (dendrites or 

axons) in either basal or reserpine-treated conditions. 

In contrast, while no detectable intranuclear 

hybridization aggregates were observed in control 

rats, following reserpine treatment generally one 

or two foci of highly intense staining were 


observed in many locus coeruleus neurons. However, 

not all of the locus coeruleus contained this 

nuclear staining, and some of them had no detectable 

nuclear staining. In all the sections examined,- 

no significant TH RNA staining was observed in 

either the cytoplasm or nucleus of cells located outside 

the locus coeruleus. 

In the substantia nigra, another group of catecho 

laminergic neurons, no such nuclear aggregation oi 

the TH mRNA was observed in control animals or 

following reserpine injection. 

This observation lead us to pose several questions. 

First, what is the nature of this nuclear TH 

mRNA? Is it newly synthesized primary transcript 

(hnRNA) or a processed transcript stored in the 

nucleus? Do the nuclear domains labeled by the TH 

probe correspond to a specific nuclear subcompartment? 

Finally, are these nuclear aggregates of TH 

mRNA the artificial result of the reserpine injection 

or do such nuclear aggregates also exist normally; 

but in too low a concentration of mRNA to be 

detectable by irt situ hybridization? 

In order to address some of these issues, we then 

extended our preliminary observations using more 

sensitive approaches combined with electron 

microscopic localizations of the in situ hybridization 

aggregates. 

Using a more sensitive approach (ie with a multioligoprobe, 

being a mixture of five exon-specific 

TH oligoprobes; see Trembleau and Bloom, 1995>, 

we have detected the TH mRNA through the locus. 

coeruleus of reserpine-treated rats killed 2 days following 

injections. After the peroxidase-DAB detection 

of the probe, the vibratome sections were studied 

(fig 2;4, B), embedded in epoxy resin (see 

Mate&Es und methods), and semithin and ultrathin 

sections were obtained. 

Using this sensitive technique, we observed that 

the nuclear compartmentalization of the TH mRNA 

was more complex than was revealed by our first 

experiment using only one oligonucleotide as the. 

probe. Indeed, it appeared that besides the two 

heavily labeled foci of TH nuclear RNA, additional 

weakly stained dots or track-like hf7bridization 

derived structures were present. These additional 

TH mRNA aggregates were visible in the vibratome 

sections (fig 2A, B), as well as in the semithin 

(fig 2C, D) and ultrathin sections (fig 2E, F). The 

nucleol.us was never labeled, nor was any Label 

(foci, dots or tracks) ever observed in the close 

vicinity of the nuclear envelope. 

ln the cytoplasm, the TH mRNA staining was 

apparently associated with domains of the endo- 

‘Trembleau and Bloom

Fig 1. Cellular localization of TH mRNA within the locus coeruleus. Rats killed 48 h following a single injection of reserpine 

(6) or the vehicle solution (A). The TH mRNA was visualized using the THl oligonucleotide alone and alkaline phosphatase- 

NBT/BCIP as the reporter. Cryostat sections from both groups of animals (sham- and reserpinetreated) were processed 

together, and the alkaline phosphatase reaction was performed for the same duration, so that a rigorous comparison can 

be made. In control animals (Al, the labeling is restricted to the cytoplasm of the noradrenergic perikarya. This cytoplasmic 

labeling is high in some cells and weaker in others. In the reserpine-treated animals (B), the labeling is greatly increased, all 

cells bearing now a high level of staining in their cytoplasm. In addition, many cells display one or two foci of nuclear labeling 

(arrows). Bar, 10 pm. 

TH gene expression in the locus coeruleus Trembleau and Bloom

Fig 2. Subcell&r localization of TH mRNA within locus coeruleus neurons of reserpine-treated rats. The-TH mRNA was 

detected using a cocktait of five non-overlapping oligonucleotides (THI, TH2, TH3, TH5, Ti-6) and peroxidase-DAB as the 

reporter. A, 8. A same field of the vibratome sectian was photographed at two different focal planes. Those two ceils display 

in their nucleus one or two intensely labeled primary foci /large curved arrows), as well as additional weakly labeled 

smaller accessory dots or tracks (small arrows). C, D. Semi-thin sections through the locus coeruleus, in which large foci 

(large curved arrows) and accessory dots (small arrows) of labeling can be obsewed in the nuclear matrix. No significant 

staining is observed in the nucleoli. E-G. Uttrastructirat localization of the TH-mRNA in the nucleus (E, FI and cy&piasm 

(G) of noradrenergic neurons. Within the nucleus, primary foci of labeling are observed in the nuclear matrix, sometime in 

the vicinity of the nucleoli (r-4. Accessory dots or tracks of label are also observed throughout the nuclear matrix. No-label 

is found in the nucleoli. Within the cytopl&m, the labeling is associated with domains of the endoplasmic reticulum complex 

(RER) (G). Bar, 5 pm (A-D) or 1 pm (E-G).


plasmic reticulum of the Nissl bodies (fig 2). 

Although ribosomes were not well-preserved due 

to the method used here, this reticulum had the 

classical appearance of rough reticulum endoplasmic 

(RER) as found in these locus coeruleus neurons 

when using conventional electron microscopy. 

These experiments confirmed the presence of 

two large intranuclear foci of abundant TH mRNA 

in catecholaminergic neurons of the locus coeruleus 

in reserpine-treated animals. They furthermore 

demonstrate the presence of additional intranuclear 

aggregates of nuclear TH mRNA which are less 

intensely labeled. 

To determine the nature of the TH RNA within 

these aggregates (hnRNA or processed mRNA), we 

further extended our studies by using both intronand 

exon-specific probes. 

Colocalization of intronic and exonic 

sequences of the TH RNA: evidence 

for one or two major foci of TH primary 

transcript plus accessory tracks 

or aggregates of mature mRNA 

In order to determine whether the signal obtained 

with the TH exon-specific probe represented primary 

transcript or processed mRNA, we undertook 

the colocalization of intron and exon sequences of 

the TH transcript, using either fluorescent (fig 3) or 

enzymatic reporters (fig 4A, B). These experiments 

were performed on reserpine-treated animals, 

examined 48 h after injection. 

In these double-staining experiments, the pattern 

of labeling obtained with the TH exon-specific 

probe was identical to that already described from 

the single-labeling experiments. The cytoplasm of 

most neurons of the locus coeruleus was labeled. In 

the nucleus of these neurons, we generally 

observed two foci (or one only in some cells) of 

intense label (fig 3A, D, G, J), plus, in some cells, 

track-like structures or accessory weaker dots 

(figs 3G, 4A, B). 

The TH intron-specific probe intensely labeled 

one or two nuclear foci within the nucleus of neurons 

of the locus coeruleus (figs 3B, E, H, K, 4A, B) 

in the double-staining experiments. A diffuse and 

much weaker staining was occasionally observed in 

the cytoplasm of these catecholaminergic neurons. 

No TH intron staining was ever observed in any 

pontine neurons located outside the locus coeruleus. 

From these double labeling experiments, we concluded 

that the main intensely labeled intranuclear 

foci of TH RNA detected with the TH exon-specific 

probe also contained intronic sequences. These two 

aggregates of nuclear TH RNA therefore probably 

contained the TH primary transcript. In contrast, 

the accessory TH RNA labeled using the TH exonspecific 

probe were never labeled by the intron-specific 

probe (figs 3H, 4A, B). Therefore, these accessory 

intranuclear tracks or dots probably represent 

mature TH mRNA, as is the RNA in the perikaryal 

cytoplasm. 

Dynamics of TH gene expression 

during reserpine stimulation. 

In order to examine the dynamics of the TH gene 

stimulation following a single injection of reserpine, 

we killed rats at different periods of time after 

injection, and used the highly sensitive TH intronspecific 

multiple oligonucleotide probe as a marker 

of TH gene expression. In these experiments, sections 

through the locus coeruleus were taken from 

control rats or rats treated by a single injection of 

reserpine and killed at different times post-injection 

(6,24 or 48 h). 

In basal conditions, only a subset of locus coeruleus 

neurons contained detectable nuclear aggregates 

of TH primary transcript, and this TH intron 

RNA staining could be observed only after a prolonged 

(overnight) alkaline phosphatase reaction 

time (fig 4C, D). 

In some experiments, we ran the alkaline phosphatase 

reporter reaction for a shorter time (only 

3 h), a duration at which no significant staining 

could be observed in control animals. With this 

shorter reaction time we were able to evaluate and 

roughly compare the intron staining for the three 

times post-reserpine injection examined (6,24 or 48 h; 

see fig 4E-H ). While no significant staining is 

observed in control animals (not shown), some neurons 

appear weakly labeled at 6 h (fig 4E, F show 

two of such neurons). Twenty-four hours after the 

reserpine injection (fig 4G), more neurons appeared 

labeled, and the level of labeling within the nuclear 

foci was increased over that observed at 6 h postinjection. 

No further differences were observed in 

terms of density of labeled neurons, or level of staining 

within the intranuclear foci between 24 (fig 4G) 

and 48 h (fig 4H) post-reserpine. At every time point 

examined (6,24 or 48 h), neurons were still observed 

which exhibited either no label or weaker label. This 

observation strongly suggests that even at 24 or 48 h 

post-reserpine injection, time points at which the TH 

gene expression is maximally stimulated in the over- 

all locus coeruleus, not all noradrenergic neurons 

express this gene at the maximum rate. 

DISCUSSION 

In this work, we have analyzed the subcellular 

compartmentalization of the tyrosine hydroxylase 

primary and processed transcripts within a neuro- 


1 Fig 3. Colocalization of exonic 

, and intronic sequences of the 

;; TH mRNA within four reprssentative 

individual neurons observed 

in the locus coeruleus of a~ 

reserpine-treated rat (&C,~lI-F, 

:- G-t, J-L). Confocal imQjes~ 

j obtained using appropriate YiEer- 

: sets allow the visuafiiatiqn of 

the exonic sequences (green flue’ 

orescent marker 44TC: A, D, 6, 

,i J) and the intronic sequences 

: (red fluorescent marker Cy3: 

] @, E, H, Kl; merged imag?s a?e 

j represented in C,- F, I and L. 

:, Using the exon-specific probe, 

!; the labeling is observed in the 

i’ cytoplasm and in one or two foci 

i tocaliaed in the nucleus. In all 

j:: those neurons, the intronic stainb 

ing, generatly restricted to one 

or two nuclear foci, colocalizes 

with the intenseiy stained 

: nuclear dom~alns of exonic labelfI 

ing (small arrows). Besides 

! these nuclear foci doubly 

Ii- labeted by exon and intron 

probes, additionat track-like 

. structures labeled by the exon 

probes can only be observed in 

some neurons (open arrow in G 

8: and II. Occasional eeurons display 

two intensely doubly- 

;. ~labetcsd nuclear dots btit no significant 

cytoplasmic staining -tJ, 

KI L). Bar, 5 m. 



Fig 4. A, B. Colocalization of intronic and exonic sequences of the TH mRNA using enzymatic detection systems (rat 

treated by a single injection of reserpine 48 h prior to fixation). These two pictures taken at different focal planes show that 

the nucleus of a representative cell contains two primary foci (large curved arrows) doubly stained by both the intronic 

probe and the exonic probe, plus additional secondary dots or tracks labeled by the exonic probe only (small arrows). Bar, 

10 pm. C-H. Localization of TH mRNA intronic sequences in the locus coeruleus from control or reserpine-treated rats 

using the highly sensitive intron-specific multiple oligonucleotide probe. C, D. In cryostat sections from control rats in which 

the alkaline phosphatase reaction was revealed overnight, although the majority of noradrenergic neurons contain no 

detectable signal, some neurons displaying one or two foci of intronic signal are observed. E-H. Detection of intronic 

mRNA sequence in sections of locus coeruleus from rats treated with reserpine for 6 h (E, F), 24 h (G1, or 48 h fH).The 

alkaline phosphatase reaction was run for only 3 h in this experiment, a duration of reporter development which produces 

no significant staining in control rats (not shown). Six hours after the reserpine injection, some neurons display a weak 

staining in their nucleus. This nuclear staining appears stronger after 24 or 48 h. No significant difference is observed 

between 24 and 48 h. Arrowhead, labeled neurons; arrows, non-labeled neurons. Bar, 10 pm. 


48 Biology of the Ceil (1998) 90, 39-5 i 

chemically homogeneous group of neurons, using 

non-radioactive in situ hybridization. Following 

treatment with reserpine, a drug previously known 

to enhance TH gene expression, we have observed 

aggregates of TH mRNA in the nucleus of some 

cells of the locus coeruleus. Finally, we have 

attempted to determine at the cellular level the pattern 

of TH gene stimulation, using a non-radioactive 

intron-specific probe. 

These observations provide insight into the subcellular 

compartmentalization of the extra-nuclear 

TH mRNA within the catecholaminergic neurons of 

the locus coeruleus, and on the nuclear compartmentalization 

of primary and mature TH transcripts. 

In addition, our observations provide new 

information on the spatial and temporal pattern of 

TH gene expression within the locus coeruleus neuron 

population during reserpine stimulation. 

Recent studies have shown that some neuronal 

mRNAs can be transported beyond the perikarya, 

in dendrites where they are probably locally translated 

(Bruckenstein et ~2, 1990; Kleinman ef al, 1990; 

Steward, 1995; Racca et aI, 1997) and even in axons, 

where their functions remain to be established (Jirikowski 

et al, 1990; Mohr and Richter, 1992; Trembleau 

et al, 1994; Vassar et al, 1994; Wensley et al, 

1995; Olink-Coux and Hollenbeck, 1996). We were 

interested in refining the subcellular structural 

localization of the TH mRNAs because we previously 

reported that TH mRNA can be chemically 

detected in terminal axonal fields of locus coeruleus 

and substantia nigra catecholaminergic neurons 

with a highly sensitive reverse transcription coupled 

to polymerase chain reaction (Melia et al, 

1994). Those data provided evidence supporting 

the possibility of axonal compartmentalization of 

TH mRNA. In the present work, despite the use of 

a sensitive in situ hybridization strategy (mqlti-oligonucleotide 

probes; see Trembleau and Bloom, 

1995), as well as radioactive riboprobes (data not 

shown), we were still unable to detect the TH 

mRNA in neuronal processes such as axons, thin 

dendrites or axonal fields of the catecholaminergic 

nuclei (ie cerebellum or striatum). Only proximal 

domains of dendrites contained significant 

amounts of TH mRNA. These observations suggested 

that if some TH mRNA is transported in 

axons, the amount of this transcript in this compartment 

is extremely low, below the limit of sensitivity 

of the technique used here. 

Within the perikarya and proximal dendrites, the 

TH mRNA was abundant in cytoplasmic territories 

enriched in rough endoplasmic reticulum (RER). In 


fact, it seems from our observations that the 

TH mRNA is associated with domains of the RER, 

suggesting that this mRNA might be translated 

within or close to the RER complex. Such a localization 

is quite surprising because tyrosine hydroxy-. 

lase does probably not enter the secretory pathway, 

and therefore it is thought to be synthesized by free 

polysomes. In.terestingly enough, a hydrophobic 

domain present at the NH,-terminus of the tyrosine 

hydroxylase protein is reminiscent of a signal 

sequence (Grima et al, 1985). This hydrophobic 

sequence might participate in the co-translational 

localization of the TH mRNA in the RER complex. 

Alternatively, the TH mRNA might also be targeted 

to domains of the RER through other unknown 

mechanisms. Indeed, we have recently provided 

evidence for a similar association with domains nf 

the RER for the mRNA encoding the Gas membrane 

associated protein, a palmitylated protein 

devoid of signal peptide (Trembleau and Bloom, 

7996). 

coet3tlm1s fmgmns 

We report here the presence of two kinds of nuclear 

aggregates of tyrosine hydroxylase mRNA within 

locus coeruleus neurons under reserpine stimulation 

of TH gene expression. The first kind of aggregate 

corresponds to one or two foci 6f staining containing 

both exon- and intron-specific labeling. 

These two main foci most probably represent 

newly synthesized heterogeneous nuclear TH RI+$A 

(primary transcript) located at the transcription 

sites. Indeed, similar foci of primary transcripts 

were previously reported in cultured cells, and 

were co-localized with the corresponding genomic 

DNA (Huang and Spector, 1.991; Xing et a7, 1993; 

Zhang et al, 1994). 

The second kind of nuclear aggregates of TH 

mRNA found in locus coeruleus neurons were less 

intensely labeled tracks or dots characterized by 

exon-specific staining exclusively. These aggregates 

most probably correspond to processed TM 

mRNA, devoid of introns. This nuclear mature TH 

mRNA might correspond to molecules in transit 

between the transcription site to the nuclear envelope. 

However, although it is clear from our observations 

that these accessory tracks or dots are often 

physically connected to the one or two main intranuclear 

foci, we never saw any connections 

between these tracks or dots and the nuclear envelope. 

Therefore, it appears unlikely that these 

tracks would simply represent intranuclear pathways 

between the foci of gene transcription and 

the nuclear envelope. 

Jrembleau and Bbom


Other studies have previously reported the 

presence of tracks of mature mRNAs for some 

mRNA species (Huang and Spector, 1991; Xing et 

al, 1993; Zhang ef ~2, 1994). Although in one case, 

tracks of c-fos mRNA were found continuous 

from the foci to the nuclear envelope (Huang and 

Spector, 1991), no other observations support any 

physical link between the tracks and the nuclear 

envelope (Xing et al, 1993; Zhang et al, 1994). So 

far, whether tracks of processed mRNA extend 

from the splicing site to the nuclear envelope, or 

whether mature mRNAs move from the nuclear 

foci and tracks by conventional diffusion remains 

controversial (for review see Zachar et al, 1993; 

Xing and Lawrence, 1993; Kramer et al, 1994). 

Some authors have recently predicted that mature 

mRNA in transit should not be detectable by in 

situ hybridization (due to the limited sensitivity 

of the technique), because the steady-state levels 

of mature mRNA in transit from gene to the 

nuclear envelope should be substantially lower 

than those of nascent primary transcripts (Kramer 

et al, 1994). We therefore can not exclude whether 

the tracks and dots of mature TH mRNA 

observed in the catecholaminergic neuron nuclei 

might be either intranuclear storage sites of 

mRNA, or rather due to the abnormal overproduction 

of TH mRNA resulting from the sustained 

enhancement of transcription induced by 

the reserpine treatment. Two observations might 

favor this latter hypothesis: 1) although foci of 

intron staining were observed in control rats, no 

such tracks or dots were observed in those nontreated 

rats; 2) even 2 days following the reserpine 

injection, only a subset of neurons display 

such tracks or dots of mature TH mRNA. However, 

we cannot exclude the presence of tracks or 

dots containing low concentration of TH mature 

mRNA in control rats, which could not be 

observed simply due to the low sensitivity of in. 

situ hybridization. 

Pattern of TH gene expression in the locus 

coeruleus neurons. The asynchronized 

bursting gene expression hypothesis 

Because reserpine depletes vesicular stores of catecholamines, 

it is thought that the induction of tyrosine 

hydroxylase in cell bodies may result from 

direct and/or indirect feedback signals indicating 

the need for more biosynthetic enzyme to replenish 

depleted neurotransmitter levels. It was known 

before that a single reserpine injection increased 

the concentration of TH mRNA in the locus coeruleus 

(Mallet et al, 1983; Faucon Biguet et a2, 1986; 

Berod ef aZ, 1987; Austin et al, 1990). However, it 

was not clear whether this increase was due to an 


increased transcription or a regulation of the stability 

of the TH mRNA, as previously shown for this 

mRNA in another brain nucleus under experimental 

lesions (Sherman and Moody, 1995). In situ 

hybridization using intron-specific probes has 

recently been introduced to monitor the rate of 

transcription of genes in tissue sections. This 

approach has been validated in a study in which 

the results of run-on experiments and in situ 

hybridization using intron probes were compared 

(Herman et al, 1991). Our experiments show that 

the TH intron-specific intranuclear signal is 

increased in many neurons following reserpine 

treatment and that an increased number of neurons 

display such an intron signal under these conditions. 

These observations clearly demonstrate 

that the previously reported increase of TH mRNA 

in the locus coeruleus induced by reserpine is in 

fact an increased transcription rather than stabilization 

of the TH transcript. Indeed, in the case of a 

stabilization of the mRNA, no increase of the 

hnRNA would be observed. 

However, a surprising observation obtained in 

the present work is that a great heterogeneity is 

found within the locus coeruleus neuronal population 

with respect to the rate of TH gene transcription 

at any given time. In control animals, while 

many neurons displayed no detectable TH 

l-u-RNA, other neurons contained quite high levels 

of TH hnRNA. Although it is clear that reserpinetreated 

animals have more neurons expressing the 

TH gene at a higher rate than control animals, we 

observed that in either basal or reserpine-treated 

conditions, neurons devoid of detectable intron 

staining still exist. Therefore, our results strongly 

suggest that there is no synchronous transcription 

activity of the TH gene among the catecholaminergic 

neuron population of the locus coeruleus. In 

other words, in basal condition, at any given time, 

some neurons seem to transcribe the TH gene at a 

quite high level while other neurons transcribe the 

gene at a low level below our detection threshold. 

Following the reserpine injection, more neurons 

seem to be progressively recruited from 6 h to 24 h 

for transcription of the TH gene at a higher level, 

but no significant difference was observed between 

24 h and 48 h post-injection. In reserpine-treated 

animals, we even found occasional neurons displaying 

intranuclear primary TH mRNA, which 

were devoid of detectable TH mRNA in their cytoplasm 

(fig 3J-L), exactly as if these neurons were 

just beginning to transcribe the TH gene. Such 

observations suggest that some ‘resting catecholaminergic 

neurons’ characterized by a very low 

level of TH expression in basal conditions might 

exist in the locus coeruleus, and that these neurons 

could be recruited for expression of the TH gene 

Trembleau and Bloom


under certain functional challenges, such as reserpine 

treatment. Interestingly, rare neurons having 

the ability to uptake sH-5-HT were reported in the 

locus coeruleus, leading the authors to propose the 

existence of occasional serotoninergic neurons in 

this brain nucleus (Dupuy and Calas, 1982). It 

would be interesting to determine whether the 

described-above ‘resting catecholaminergic 

neurons’ correspond to these putative serotoninergic 

neurons. 

Overall, our data suggest that within individual 

locus coeruleus neurons, the TH gene might be 

expressed in a ‘bursting’ manner, with periods of 

high transcriptional activity followed by periods of 

lower transcriptional activity. This hypothesized 

bursting gene transcriptional activity is apparently 

not synchronized within the population of the locus 

coeruleus neurons. The stimuli responsible for such 

regulations might be related to the neurona. activity 

of the individual neurons (ie electrical activity, 

neurotransmitter release, etc), and remain to be 

established. 

REFEMHCES 

Austin MC, Cottingham SL, Paul SM and Crawley JN (199Oj 

Tyrosine hydroxylase and galanin mRNA levels in locus 

coeruleus neurons are increased following reserpine 

administration. Synapse 6,352-357 

Berod A, Faucon Biguet N, Dumas S, Bloch B and Mallet J 

(1987) Modulation of tyrosine hydroxylase gene-expression 

in the central nervous system visualized by im sifu hybridization. 

Pm Nat1 Acad Sci USA 84‘1699-1703 

Bruckenstein DA, Lein PJ, Higgins D and Fremeau Jr RT (1990) 

Distinct spatial localization of specific mRNAs in cultured 

sympathic neurons. Neuron 5,809-819 

Carlsson A (1965) Drugs which block the storage of S-hydroxytryptamine 

and related amines. In: Handbuch Exp Pharm 

Vol19 (Erspamer V, ed) Springer, Berlin, 529592 

Dirks RW, van de Rijke FM, Fujishita S, van der Ploeg M and 

Raap AK (1993) Methodologies for specific intron and exon 

RNA localization in cultured cells by haptenized and fluorochromized 

probes. J CeIt Sci 104,1187-1197 

Dupuy JJ and Calas A (1982) Distribution of 5-HT accumulating 

neurons in the rat brain. A radioautographic study after 

different modes of 3H-5-HT administration. J Hirnforsch 23, 

39-47 

Faucon-Biguet N, Buda M, Lamouroux A, Samolyk 0 and 

Mallet J (1986) Time course of the changes in TH mRNA in 

rat brain and adrenal medulla after a single injection of 

reserpine. Eur Ma1 Biol Org J 5286-291 

Grima 8, Lamouroux A, Blanot F, Faucon-Biguet N and Mallet 

J (1985) Complete coding sequence of rat tyrosine hydroxylase 

mRNA. Proc Nat1 Acad Sci USA 82,617-621 

Herman JP, Schafer MK-H, Watson SJ and Sherman TG (1991) 

In situ hybridization analysis of arginine vasopressin gene 

transcription using intron-specific probe. Mel Endocrinof 5, 

1447-1456 

Huang S and Spector DL (1991) Nascent pre-mRNA transcripts 

are associated with nuclear regions eririched in 

splicing factors. Genes Dev 5,2288-2302 

Jirikowski GF, Sanna PP and Bloom FE (1990) mRNA coding 

for oxytocin is present in axons of the hypothalamoneurohypophyseal 

tract. Proc Nat1 Acad Sci USA 87. 

7400-7404 

Kleinman OR, Banker G and Steward 0 (1990) Differential sub- 


cellular localrzation of particular mRNAs m hippocampai 

neurons in culture. Neuron 5,821-830 

Kramer J, Zachar Z and Bingham PM (1994) Nuclear pee 

mRNA metabolism: channels and tracks. TlCB 4,35-37 

Lawrence JB, Singer RH and Marselle LM (1989) Highly locaiized 

tracks of specific transcripts within interphase nuclei 

visualized by in situ hybridization. Cell 57,493-502 

Levitt M, Spector S, Sjoerdsma A and Udenfriend S (1965) Elucidation 

of the rate limiting step in norepinephrine biosynthesis 

in the perfused guinea-pig heart. f Pharmacul Ex/? ‘??trpr 

148,1-7 

Mallet J, Faucon Biguet N, Buda M, Lamouroux A and Saxno 

lyk D (1983) Detection and regulation of tyrosine hydroxylase 

mRNA levels in rat adrenal medulla and brain tissues. 

Cold Spring Harbor Symp Quanf Bio/48,305-308 

Melia KR, Trembleau A, Oddi R, Sanna PP and Bloom FE 

(1994) Detection and regulation of tyrosine hydroxylase 

mRNA in catecholaminergic terminal fields: possible axonal 

compartmentalization. Exp Neural 130,394-406 

Misteli T, Caceres JF and Spector DL, (1997) The dynamics of rj 

pre-mRNA splicing factor in living cells. Nature 387 

52,3-527 

Mohr E and Richter D (1992) Drversrty of mRNAs m the ~XO 

nal compartment of peptidergic neurons in the rat. Eur [ 

Neurosci 4,870-876 

Olink-Coux M and Hollenbeck PJ (1996) Localization and 

active transport of mRNA in axons of sympathetic neuronsin 

culture. ] tieurosci 16,1348-1356 

Puvion-Dutilleul F and Puvion E (1992) Sites of transcrrphon 

of adenovirus type 5 genomes in relation to early viral 

DNA replication in infected HeLa cells. A high resolution 

in sitrt hybridization and autoradiographical study. Biel C& 

71,135-144 

Racca C, Gardiol A and Triller A (1997) Dendritic and postsyn 

aptic localizations of glycine receptor a subunit mRNAs 

J Ncurosci 17,1691-1700 

Sherman TG and Moody CA (1995) Alterations in ryrosint 

hydroxylase expression following partial lesions of the 

nigrostriatal bundle. Mol Brain Res 29,285-296 

Singer RH and Green MR (199’7) Compartmentalization of eukaryotic 

gene expression: causes and effects. Cell 91,291-294 

Spector DL, Fu X-D and Maniatis T (1991) Associations 

between distinct pre-mRNA splicing components and the 

cell nucleus. EMBO ] 10,3467-3481 

Spector DL (1993) Nuclear organization of pre-mRNA procrssing. 

Curr Opin Cell Biol-5,442-448 

Steward 0 (1995) Targeting of mRNAs to subsynaptic microdomains 

in dendrites. Curr Opin Neurobiol 5,55--61 

‘Trembleau A, Roche 13 and Calas A (1993) Combination ot 

non-radioactive and radioactive ill situ hybridization withimmunohistochemistry: 

a new method allowing the 

simultaneous detection nf two mRNAs and one antigen in 

the same brain tissue section. J Hisfochrm Cyfochem 41, 

489-498 

Trembleau A, MoraIes M and Bloom FE (1994) Aggregation tii 

vasopressin mRNA in a subset of axonal swellings of the 

median eminence and posterior pituitary: light and electron 

microscopic evidence. J Neurosci 14,39-53 

Trembleau A and Bloom FE (1995) Enhanced sensitivity for 

light and electron microscopic rn situ hybridization with 

multiple simultaneous non-radioactive oligodeoxynucleotide 

probes. J Hisfochem Cyfochem 43,829-841 

Trembleau A and Bloom FE (1996) Spatial segregation of Gus 

mRNA and wasopressin mRNA to distinct domains of the 

rough endoplasmic reticulum within secretory neurons ol 

the rat hypothalamus. Mel Cell Neurosci 7,17-28 

Vassar R, Chat? SK, Sitcheran R, Nunez JM, Vosshali LB and 

Axe1 A (1994) Topographic organization of sensory projec 

tions to the &factory bulb. CeiZ 79, 881-891 

Wang J, Cao LG, Wang Yl. and Pederson T (1991) Locaiizahon 

of pre-messenger RNA at discrete nuclear sites. Proc Nati 

Acad Sci USA f38,73?1-7395 

Wensley CH, Stone DM, Baker H, Kauer JS, Margotis FL and 

Chikaraishi DM (1995) Olfactorv marker protein mRNA is 

rrembleau and Bloom


found in axons of olfactory receptor neurons. J AJeurosci 15, 

4827-4837 

Xing Y and Lawrence JB (1993) Nuclear RNA tracks: structural 

basis for transcription and splicing? Trends Cell Biol 3, 

346353 

Xing Y, Johnson CV, Dobner PR and Lawrence JB (1993) 

Higher level organization of individual gene transcription 

and RNA splicing. Science 259,1326-1330 

Xing Y, Johnson CV, Moen PT, McNeil JA and Lawrence JB 

(1995) Nonrandom gene organization: structural arrange- 

ments of specific pre-mRNA transcription and splicing 

with SC-35 domains. J Cell BioZ131,1635-1647 

Zachar Z, Kramer J, Mims IP and Bingham PM (1993) Evidence 

for channeled diffusion of pm-mRNAs during nuclear RNA 

transport in metazoans. J Cell BioZl21,729-742 

Zhang G, Taneja KL, Singer RH and Green MR (1994) Localization 

of pre-mRNA splicing in mammalian nuclei. Nature 

372,809-812 

Received 6 January 1998; accepted 5 February 1998 


Trembleau and Bloom

Subcellular localization of tyrosine hydroxylase ... - Biology of the Cell

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?