Bone marrow as a priming site for naīve CD8+ T cells - Weizmann ...

Thesis for the degree
Doctor of Philosophy
Submitted to the Scientific Council of the
Weizmann Institute of Science
Rehovot, Israel
עבודת גמר ‏(תזה)‏ לתואר
דוקטור לפילוסופיה
מוגשת למועצה המדעית של
מכון ויצמן למדע
רחובות,‏ ישראל
במתכונת ‏"רגילה"‏
In a "Regular" Format
By
Anita Sapoznikov
מאת
אניטה ספוז'ניקוב
הבנת תפקידיהם של תאים דנדריטיים באיברים הלימפואידים בעכבר
Probing In-Vivo Dendritic Cell functions in Lymphoid Organs
Advisor:
Dr. Steffen Jung
Prof. Idit Shachar
מנחה:‏
דר'‏ סטפן יונג
פרופ'‏ עידית שחר
July 2009
תמוז,‏ תשס"ט
0

Acknowledgements
I am grateful to my supervisors, Dr. Steffen Jung and Prof. Idit Shachar for opening
the door to the wonderful world of immunology science and for sharing with me their
broad knowledge and experience.
I am especially grateful to Dr. Yael Pewzner-Jung, Vyacheslav Kalchenko; Dr. Guy
Shakhar and Idan Milo for the fruitful discussions, professional support and creative
collaboration on this study.
Finally, I would also like to thank my fellow members of Steffen Jung's laboratory for
sharing their expertise, technical assistance and friendship.
1

List of abbreviations
APCs
AFCs
APRIL
BAFF
BCMA
BM
bmDCs
BST 2
cDCs
CLPs
CMTMR
CTLs
DN
DTR
DTx
ECFP
ELISPOT
GFP
HEVs
IFN I
IPCs
i.v.
LCs
LNs
MACS
MDPs
MHC
MIF
MLR
OVA
PDCs
Antigen Presenting Cells
Antibody-Forming Cells
Proliferation-Inducing Ligand
B cell-Activating Factor
B Cell Maturation Antigen
Bone Marrow
Bone Marrow-resident Dendritic Cells
Bone marrow Stromal cell antigen-2
conventional Dendritic Cells
Common Lymphoid Precursors
ChloroMethyl benzoyl amino TetraMethylRhodamine
Cytotoxic T Lymphocytes
Double Negative
Diphtheria Toxin Receptor
Diphtheria Toxin
Enhanced Cyan Fluorescent Protein
Enzyme-Linked Immunospot assay
Green Fluorescent Protein
High Endothelial Venules
Interferon type I
Interferon-Producing Cells
Intravenously
Langerhans Cells
Lymph Node
Magnetic Cell Sorting
Macrophage/Dendritic cell Precursors
Major Histocompatiblity Complex
Migration-Inhibitory Factor
Mixed-Leukocyte Reaction
Ovalbumin
Plasmacytoid Dendritic Cells
2

Rag 2 Recombination-Activating gene 2
s.c. Subcutaneously
SiglecH Sialic acid binding Ig-like lectin H
S1P1 Sphingosine 1-Phosphate receptor-1
Spl MΦ Splenic Macrophages
TACI Transmembrane Activator
TCR T Cell Receptor
TLRs Toll-Like Receptors
TNF Tumor Necrosis Factor
TRITC Tetramethyl Rhodamine IsoThioCyanate
3

Table of content
Summary 6
1. Introduction 8
1.1 Dendritic cells (DCs) 8
1.2 Bone marrow (BM) 12
1.3 Intravital microscopy 15
2. Perivascular clusters of dendritic cells provide critical
survival signals to B cells in bone marrow niches 17
2.1 Introduction 17
2.2 Results 18
2.2.1 Phenotypic and functional characterization of bone marrow DCs 18
2.2.2 Organization of bmDCs into perivascular clusters 19
2.2.3 DC ablation causes depletion of recirculating B cells from BM 21
2.2.4 BmDCs provide a survival signal to recirculating mature B cells 27
2.2.5 Recirculating mature B cells require MIF-producing bmDCs for survival 29
2.3 Discussion 35
3. The bone marrow immune niche: Bone marrow as a
priming site for naïve CD8 + T cells 38
3.1 Introduction 38
3.2 Results 39
3.2.1 Identification of bmDC clusters that contain B cells in the BM of the
long bones 39
3.2.2 BmDCs originate without monocytic intermediate from
macrophage/DC precursors (MDPs) 41
3.2.3 In the steady-state T lymphocytes are more motile than B cells
in the bmDC niche 43
3.2.4 Naïve CD8 + T cells form multi-cell clusters in the bmDC niches
upon blood-borne antigen stimulation 45
3.2.5 Naïve CD8 + T cells are efficiently activated in BM niches in
absence of DCs 49
3.2.6 Naïve CD8 + T cells fail to form multi-cell clusters in mice
4

harboring MHC class-I-deficient stroma 53
3.3 Discussion 54
4. Organ-dependent in vivo priming of naïve CD4 + , but not
CD8 + T cells by plasmacytoid dendritic cells 59
4.1 Introduction 59
4.2 Results 60
4.2.1 PDCs are spared from ablation in DTx-treated CD11c-DTRtg mice 60
4.2.2 PDCs fail to prime naïve T cells in the spleen 63
4.2.3 PDCs can prime naïve CD4 + T cells in LNs, but fail to support
CD8 + T cell priming 65
4.2.4 LN PDCs efficiently acquire and process soluble antigen and
prime productive T cell responses 72
4.2.5 PDC-specific antigen targeting and PDC-mediated in vivo and
in vitro CD4 + T cell priming 74
4.3 Discussion 79
5. Final discussion 82
6. Material and Methods 86
6.1 Perivascular clusters of dendritic cells provide critical survival
signals to B cells in bone marrow niches 86
6.2 The bone marrow immune niche: Bone marrow as a priming
site for naïve CD8 + T cells 88
6.3 Organ-dependent in vivo priming of naïve CD4 + , but not
CD8 + T cells by plasmacytoid dendritic cells 90
7. References 94
8. List of publications 106
9. Statement about independent collaboration 107
5

Summary
Dendritic cells (DCs) play a central role in T-cell activation and the control of the
inherent autoreactivity of the T-cell compartment. Pleiotropic DC functions are likely
associated with discrete DC subsets. However, the latter remain largely defined by
phenotype and unique anatomic location, rather than function. The investigation of
DC involvement in complex phenomena that rely on multicellular interactions, such
as immuno-stimulation and tolerization calls for an assessment of DC functions
within physiological context. Given the highly dynamic DC compartment, in the
current study, we investigated in vivo DC functions by their conditional ablation in the
intact organism.
In my PhD thesis we phenotypically and functionally characterized bone marrowresident
DCs (bmDCs). We identified an architecturally-defined novel bone marrow
niche defined by DC clusters, which wrap distinct blood vessels in steady-state.
Suggesting a potential role in adaptive immune responses, the niches harbored both
mature B and T cells. Surprisingly, we found that bmDC ablation resulted in the
specific loss of B cells from the niches. The combined use of transgenic and knockout
mouse models, finally allowed us to define the molecular mechanism for the B
cell loss. Thus, bmDC provide a critical survival factor, the cytokine MIF, to
recirculating B cells, which ensures their maintenance in the bone marrow immune
niches. The identification of lymphoid follicle-like niches in the BM represents a
breakthrough in our understanding of this organ as a potential site of primary immune
responses against blood-borne pathogens. Furthermore, we identified the origin of
bmDCs by showing that they arose without monocytic intermediate from
macrophage/DC precursor (MDP). In addition we studied the motility of T and B
lymphocytes in the bmDC niches in steady-state. Application of state-of-the-art
intravital microscopy, allowed us to show that naïve CD8 + T cells formed multi-cell
clusters and differentiated into effector cells in the bmDC niches upon blood-borne
antigen stimulation, which fulfill the function of BM as a secondary lymphoid organ.
Unexpectedly, however, we observed that naïve CD8 + T cells were efficiently
activated and primed in BM niches in absence of DCs, challenging the critical APC
function of DCs observed for the spleen. Using the BM chimera approach, we
revealed that radio-resistant stromal cells were critical for antigen cross-presentation
6

and naïve CD8 + T cell activation in absence of DCs. Taken together, our results thus,
suggest the novel unique role of nonhematopoietic cells in the BM.
Finally, we unraveled the APC potential of plasmacytoid dendritic cell (PDCs), which
due to the lack of suitable experimental system - has remained controversial. In most
past experimental systems any putative in vivo T cell priming potential of PDCs could
have been masked by the presence of conventional DCs (cDCs). In contrast here, we
studied in vivo CD4 + and CD8 + T cell responses in mice that were conditionally
depleted of cDCs, but retained PDCs. Furthermore, we use a novel antibody-mediated
strategy to specifically target cDCs and PDCs. Using these approaches, we showed
that PDCs were unable to support CD4 + and CD8 + T cell responses in cDC-depleted
spleens. However, surprisingly, we found that in absence of cDCs, PDCs were able to
stimulate productive naive CD4 + T cell responses in lymph nodes (LNs).
Interestingly, and in contrast to the cDC-driven immune responses these PDCtriggered
responses were not associated with concomitant CTL responses. Our results,
thus, characterized PDCs as bona fide DCs that can initiate unique CD4 + helper T
cell-dominated primary immune responses.
7

1. Introduction
1.1 Dendritic cells (DCs)
Dendritic cells (DCs) are hematopoietic cells that belong to the family of
“professional” antigen-presenting cells (APCs), which also includes B cells and
macrophages. In fact, DCs were originally discovered based on their APC function,
when Steinman and Cohn in 1973 first identified DCs in mouse spleen as potent
stimulators of the primary immune response [1].
DCs belong to myeloid-lineage derived mononuclear phagocytes and are a
heterogeneous population of cells that can be divided into two major populations: (1)
nonlymphoid tissue migratory (mainly called tissue DCs) and lymphoid tissue–
resident DCs (also called “classic” or “conventional” DCs (cDCs)) and (2)
plasmacytoid DCs (PDCs) (also called natural interferon-producing cells).
Migratory and resident DCs have two main functions: the maintenance of selftolerance
and the induction of specific immune responses against invading pathogens
[1,2], whereas the main function of PDCs is to secrete large amounts of interferon-α
in response to viral infections and to prime T cells against viral antigens [3].
1.1.1 DCs in nonlymphoid and lymphoid tissues
Nonlymphoid tissue DCs can be further subdivided into cells present in sterile tissues,
such as the pancreas and the heart, DCs present in filtering sites, such as the liver and
the kidney, and DCs present at environmental interfaces as lung, gut, and skin.
Among interface DCs, are the epidermal Langerhans’ cells (LCs). LCs constitutively
express major histocompatibility complex (MHC) class II and high levels of the lectin
langerin, that is required and sufficient to form the LC-characteristic intracytoplasmic
Birbeck granules [4].
Lymphoid tissue-resident DCs are the most studied DC populations in mice. They
populate the spleen. In mice, splenic DCs that originate from blood-derived
circulating precursors (pre-cDCs) [5] constitutively express MHC class II and the
integrin CD11c. CD11c hi cDCs can be further subdivided into CD4 + CD8α - CD11b +
DCs that localize mostly in the marginal zone and CD8α + CD4 - CD11b - DCs localized
in the marginal and T-cell zone [6]. CD4 - CD8α - CD11b + DCs have also been
identified and are called double-negative (DN) DCs. CD8α + DCs are specialized in
MHC class I presentation, whereas CD4 + DC subset is specialized in MHC class II
8

presentation [7]. CD8α + DCs have also been shown to cross-present cell-associated
antigens, whereas CD4 + DCs are unable to do so [8,9].
Lymph node (LN) DCs are more heterogeneous as they include blood-derived
lymphoid tissue-resident CD8α + , CD4 + , and DN spleen-equivalent DCs, plus
additional migratory DCs entering via the afferent lymphatics that vary according to
the LN draining site [10]. Thus for instance, migratory epidermal LCs and dermal
DCs are present in skin-draining LNs, but are absent from mesenteric LNs, which
contain intestinal lamina propria derived cells.
1.1.2 Plasmacytoid DCs in nonlymphoid and lymphoid tissues
Similarly to DCs, PDCs constitutively express MHC class II molecules, but opposed
to cDC they are characterized by low CD11c expression [11]. Murine PDCs lack
CD11b and express CD45RA (B220) and Ly6C (Gr-1). Two PDC-restricted surface
markers have been reported. The monoclonal antibodies 128G [12] and mPDCA-1
[13] recognize BST-2 (bone marrow stromal cell antigen-2) [14] on PDCs. Injection
of these antibodies results in the depletion of PDCs [15,16]. BST-2 has been recently
described as a ‘‘tetherin’’ that holds newly formed virions on the surface of infected
cells to limit viral spread [17]. It also mediates endocytosis of virions, so it may
function as a receptor for presentation of antigens contained in viral particles.
Notably, the specificity of BST-2 as a PDC marker was recently challenged, because
BST-2 is inducible by IFN-γ treatment on other cells, including T cells, B cells and
plasma cells [14]. The second PDC-restricted surface marker is Siglec-H, a member
of the sialic acid binding Ig-like lectin (Siglec) family, which is recognized by the
440C antibody that blocks type I IFN production by PDCs, but does not induce
depletion [18].
PDCs circulate in blood and are found in steady-state BM, spleen, thymus, LN, and
the liver. They enter the LNs through the high endothelial venules (HEVs) and
accumulate in the paracortical T cell-rich areas [19]. PDCs do not efficiently migrate
to peripheral tissue in the steady state with the exception of the liver. The PDC
proliferation rate in lymphoid organs is very low, and less than 0.3% PDCs are in cell
cycle. On continuous BrdU labeling over 14 days in vivo, 90% of PDCs were found
positive [11]. Thus, the lifespan of differentiated PDCs in the spleen and LNs is short
and continuous replacement via blood is essential.
9

The most characteristic functional feature of PDCs is their unique propensity to
secrete large amounts of type I interferons (IFN I) in response to viral infections,
owing to their constitutive expression of the transcription factor IRF-7 [20]. Helixloop-helix
transcription factor (E protein) E2-2/Tcf4 is preferentially expressed in
murine and human PDCs and is required for their development of IFN I response
[21]. To respond to pathogens, PDCs do not need to be infected. They can detect the
unique structural features of viral nucleic acids, such as unmethylated CpG-rich DNA
motifs or double-stranded RNA, by employing Toll-like receptors (TLRs). When
TLRs engage these motifs, they initiate a signaling cascade that results in PDC
activation. In addition to secreting IFN I, activated PDCs undergo other important
phenotypic changes, notably the acquisition of a dendritic morphology and the
upregulation of MHC and T cell costimulatory molecules, which enable PDCs to
engage and activate naive T cells [11,22,23,24,25,26]. These are also the major
changes that activated cDCs go through when they detect pathogens, and these
changes epitomize the so-called maturation process [27]. By secreting IFN I, PDCs
can activate both the innate (e.g., natural killer cells) and the acquired (e.g., cDCs and
B cells) arms of the immune system.
There has been some controversy regarding whether PDCs are capable of priming.
The expression of MHC and T cell costimulatory molecules on activated PDCs is not
as high as on their cDC counterparts, and this is probably why PDCs tend to be less
efficient at T cell priming than cDCs. Nevertheless, PDCs can stimulate immunity
upon adoptive transfer [28,29], or sustain protective responses at sites of infection
[30], demonstrating their immunogenic potential. Several reports have indicated that
PDCs can also induce T cell tolerance, primarily through the induction of regulatory T
cells, a capacity they also share with cDCs [31,32,33,34,35]. This may enable PDCs
to promote regulatory T cell formation within the infection site to dampen the
immune response and prevent immunopathology [36,37,38].
1.1.3 Antigen presentation by DCs
The functional feature that defines DCs is their unrivaled capacity to capture, process
and present antigens, which is a prerequist for T cell priming. However, not all DCs
have equivalent antigen-presenting roles in vivo. Differences may derive from
intrinsic abilities of individual DC types to capture and process antigens, and to load
the resulting antigenic peptides onto their MHC molecules. All DC subtypes express
high levels of MHC class I and II molecules, and thus can potentially present peptide
10

antigens to CD8 + and CD4 + T cells, respectively. Antigens can be categorized
according to their source as endogenous (that is synthesized by the APC itself) or
exogenous (that is synthesized by other cells and taken up by the APC) [39]. Most
endogenous antigens are derived from proteosomal degradation of proteins in the
cytoplasm. Peptides are subsequently transported into the ER and loaded onto MHC
class I molecules [39] More recently, it has been shown that endogenous proteins can
also reach the MHC class II pathway, via autophagy [40]. Exogenous antigens are
internalized by pinocytosis, phagocytosis or receptor-mediated endocytosis [39].
Then, these antigens become accessible to the endosomal proteases, are processed
into peptides that can be loaded in specialized endosomal compartments on MHC
class II molecules. Presentation of exogenous antigens on MHC class I molecules, a
process known as cross-presentation, requires the presence of a unique phagosome-tocytosol
pathway. As most cells express MHC class I molecules, but only a few can
cross-present, this pathway must rely on specific machinery to handle endocytosed
antigens, but how this machinery works remains under debate [41].
Like direct presentation, cross presentation can have two out-comes: it can lead to the
triggering of protective CD8 + T cell responses (cross-priming) or to the neutralization
of self-reactive CD8 + T cells (cross-tolerance). Cross-priming is essential for the
defense against intracellular pathogens, incl. bacteria and viruses. Importantly, DCs
seem to be uniquely able to cross-prime naïve T cells in vivo and are absolutely
required for certain responses [42]. Cross priming is also believed to play a role in
transplant rejection and cancer immuno-surveillance, although the latter remains
under debate [43,44]
1.1.4 Differentiation of DCs from hematopoietic progenitor cells
The “early DC progenitors” present in the BM, have high proliferative capacity and
express CD117 (c-kit, the receptor for stem cell factor), but no mature lineage marker.
In clonal in vitro assays and on in vivo transfer, they generate offspring cells
severalfold the progenitor input numbers. These so-called “macrophage and DC
progenitors” (MDPs) [45] give rise to monocytes, preDCs, macrophages, and DCs, as
well as PDCs.
Monocytes develop in the BM from dividing myeloid precursors, and are released to
the peripheral circulation as non-dividing cells [46], before they enter tissues. Murine
BM and blood monocytes are best defined by their expression of the macrophagecolony-stimulating-factor
receptor (M-CSF receptor, CD115), CD11b (membrane-
11

activating complex 1) and the F4/80 antigen [47]. Distinct surface expression levels of
the chemokine receptor allow the identification of two discrete Ly6C high and Ly6C low
monocyte subsets [48,49]. The monocyte subsets are also functionally distinct: the
Ly6C low population was characterized by homing to non-inflamed tissues, whereas
Ly6C high
cells were shown to be actively recruited to sites of inflammation.
Adoptively transferred Ly6C high monocytes efficiently seeded the recipient spleen
with CD11c int progeny, however, failed under non-inflammatory conditions to give
rise to splenic conventional CD11c high DCs [50].
1.2 Bone marrow (BM)
The bone marrow occupies the cavities of the bones throughout the skeleton and
contains a dense network of medullary vascular sinuses. The densely packed extravascular
spaces between the sinuses are the sites where lymphoid and myeloid
lineages of hematopoietic precursors arise from common multi-potential progenitors.
BM vasculature is distinctive because it has similar characteristics to vasculature in
inflammed tissues with a greater expression of leukocyte adhesion molecules as
compared with normal vessels [51]. Endothelial cells direct trafficking of cells into
the BM via series of molecular interactions between specific vascular cell adhesion
molecules and chemokines as well as their cognate ligands and receptors on
circulating cells [51].
BM contains at least seven types of stromal cells (osteoblasts, osteoclasts, fat cells,
mast cells, fibroblasts, endothelial cells and smooth muscle cells) that undergo
complex interactions with hematopoietic cells [52]. Thus, BM is organized in distinct
"niches", which provide support for hematopoiesis, as well as the proper environment
for the maintenance of cells that homed to the BM from the periphery [53]. The
spatial organization of these cells and their interaction with the microenvironment
within the BM remain poorly understood.
Recent studies show that in addition to its role in hematopoesis, the BM is also an
important site for cytotoxic T cell activation and memory T cell generation [54]. In
addition, it was suggested that the BM might support for B cell responses to antigen
challenge [55]. Together these findings indicate that the BM might fulfill a dual
function as primary and secondary lymphoid organ.
12

1.2.1 B cell development
B cells are generated from T, B and NK cell-committed common lymphoid precursors
(CLPs) that derive from haematopoietic stem cells (HSCs) in the fetal liver and adult
BM. In B cell differentiation, these CLPs give initially rise to B cell precursors that
are negative for surface Ig but positive for the B cell lineage marker B220. According
to their differential expression of additional cell surface markers these precursors have
been divided into four subsets termed pre-pro-B cells, pro-B cells, pre-B cells and
immature B cells. Pre-pro B cells retain all Ig heavy and light chain genes in germline
configuration, whereas pro-B cells have rearranged heavy chain D-J (diversity and
junction) segments. Successful heavy-chain gene rearrangement leads to generation of
pre-B cells, which are characterized by surface expression of pre-B-cell receptor (pre-
BCR). At this stage light-chain rearrangement takes place, and if successful results in
surface expression of a BCR on the immature B cells [53,56]. Immature IgM + B cells
exit the BM and reach the spleen, where they mature into peripheral mature IgM +
IgD + B cells. Newly formed B cells give rise to either follicular or marginal zone B
cells. Follicular B cells comprise the bulk of the peripheral B cell pool, are the main
cellular constituent of the splenic and lymph node follicles, recirculate throughout the
blood and lymphatic systems and contribute to the primary and memory humoral
response by generating both antibody secreting plasma cells and germinal center B
cells. In contrast, marginal zone B cells constitute only 5% of all peripheral B cells,
are localized to the marginal sinus of the spleen, do not recirculate and contribute to
the early primary humoral response [57]. Plasma cells are terminally differentiated B
cells specialized in Ig secretion. They develop in response to activation of mature B
cells by antigen in peripheral lymphoid organs, and then return to colonize the BM
[58].
The identity of the BM stromal cells establishing the niches for B (and T)
lymphocytes remains uncertain. By using CXCL12 GFP knockin mice, it has been
shown that BM stromal cells expressing high levels of CXCL12 are different from
those producing IL-7. The two types of BM stromal cells were found to be associated
with B lymphocytes at different developmental stages, so that pre-pro-B cells and
plasma cells adjoined CXCL12-expressing stromal cells, whereas pro-B cells were in
contact with IL-7-producing stromal cells [59].
13

1.2.2 B cell maintenance
The steady- state B cell pool size is determined by the B cell production rate and
lifespan of mature B cells. The majority of the peripheral B cells are small resting
cells that are programmed to respond rapidly to antigenic challenge. They are actively
supported in this quiescent state by extrinsic survival factors that prevent death by
apoptosis. The ligands and receptors necessary for B cell growth and survival have
been identified as members of the tumor necrosis factor (TNF) superfamily [90]. The
primary ligand is B cell-activating factor (BAFF), which is synthesized by
radioresistant stromal cells [91], macrophages, DCs and neutrophils [92]. BAFF binds
three distinct receptors: transmembrane activator (TACI), B cell maturation antigen
(BCMA) and BAFF-R. A related ligand, a proliferation-inducing ligand (APRIL),
binds only TACI and BCMA and is critical for plasma cell survival [196]. Studies of
BAFF - / - mice showed that BAFF is not required for B cell development in the BM
[197], however, in these mice, B cell development is blocked at the immature stage
and no mature B cells are present in BM or periphery [197]. In addition, treatment
with soluble BAFF receptor (TACI-Ig) results in rapid loss of mature peripheral B
cells [198].
CD74 (invariant chain, Ii) is a nonpolymorphic type II integral membrane protein that
was originally thought to function mainly as an MHC class II chaperone [199].
However, CD74 was recently found to play an additional role as accessory signaling
molecule. A small proportion of CD74 is expressed on the surface of antigenpresenting
cells together with CD44 [200]. In macrophages, CD74 was recently
reported to demonstrate high-affinity binding to the proinflammatory cytokine,
macrophage migration-inhibitory factor (MIF). MIF binds to the extracellular domain
of CD74, and this interaction is required for MIF-mediated cell proliferation [95]. In
B cells, MIF initiates a signaling cascade that involves Syk and Akt, leading to NF- B
activation, proliferation, and survival in a CD74- and CD44-dependent manner [201].
CD74 stimulation results in activation of the p53 family member, TAp63, which in
turn transactivates the Bcl2 gene and augment B-cell survival [98].
Thus, MIF regulates the adaptive immune response by maintaining the mature B cell
population in the periphery.
14

1.2.3 T cells in the BM
Mature T cells circulating in the periphery enter primary lymphoid organs through the
blood route. In the thymus, single positive CD4 and CD8 T cells represent recently
generated naive T cells, which have completed their development and are ready to
egress [60]. In the BM, mature T cells represent about 3–8% of total nucleated cells.
The CD4:CD8 ratio in the BM is approximately 1:2 [61]. BM T cells arrive from the
blood route and, after homing to the BM, can move back to the blood and then
migrate to other lymphoid organs [61]. In addition, memory CD8 + T cells reside and
proliferate in the BM [62]. Intravital microscopy studies of mouse BM showed that
central memory CD8 T cell home preferentially to the BM. Their rolling in BM
microvessels occurs through L-, P- and E-selectins, whereas sticking is mostly
mediated by the interaction between the lymphocyte integrin α4β1 and the endothelial
adhesion molecule VCAM-1 [63]. Chemokines, such as CXCL12 mediate α4β1
integrin activation [63]. This is in agreement with the finding that high levels of
CXCL12, a master regulator of HSC recruitment into the BM, are present in normal
BM sinusoidal endothelium.
The anatomical location of the niches where T cells localize in the BM and the
cellular components of such niches are current topics of investigation. In vivo imaging
studies showed that adoptively transferred T cells migrated to specific BM
perivascular regions, which were localized parasagittally within the frontal and
parietal bones of the mouse skull and were defined by a specialized endothelium by
leukemic cells for BM seeding. T cells were found in these regions for at least 2
weeks after transfer [64].
1.3 Intravital microscopy
Two-photon microscopy is a relatively new imaging method that allows studying
dynamic cell behavior in vivo and in situ. Two-photon microscopy overcomes
previous limitations of deep tissue imaging by using femtosecond-pulsed infra-red
laser sources, which feature the following advantages: 1) deeper tissue penetration of
up to several hundred microns; 2) reduced phototoxicity and photobleaching,
permitting long-term imaging of living tissue; 3) simultaneous visualization of several
fluorophores using multichannel photodetectors; and 4) visualization of unlabeled
15

tissue components (i.e. collagen, laminin, and elastin) using second harmonic
generation [65,66].
Using intravital microscopy investigators are dissecting the cellular and molecular
underpinnings controlling immune cell motility and interactions in the tussues. Twophoton
microscopy enables to observe, quantify and probe the complex behaviors of
units such as T cells, B cells, granulocytes and DCs in their native anatomic context.
The laser allows rapid acquisition of stacks of 3D stacks, which are used to produce
3D time-lapse movies. From the movies, tracking of migration paths of individual
cells are measured. Then, the track coordinates are exported as numerical databases
and used to compute various parameters defining cell migration [65].
1.3.1 BM as a model for intravital imaging
The thickness of bone surrounding BM cavities in most anatomic locations renders
these tissues inaccessible for in vivo imaging. However, recently, a new method that
allows microscopic observation in BM of anesthetized mice has been developed [52].
It exploits the fact that the thin flat bones that form the skull's calvaria are sufficiently
transparent to allow imaging. This technique that maintains tissue integrity without
requiring surgical manipulation, except a small skin incision [52]. To enhance the
visibility of the BM microcirculation and allow measurements of its luminal
dimentions, an inert, high molecular weight plasma marker that remains strictly
confined to the intravascular compartment is injected [52]. The organization of the
vasculature in murine skull BM has parallels to that of long bones. Moreover, the
space between and around venules and sinusoids that is occupied by hematopoietic
tissue contains hematopoietic precursor cells at a similar frequency as the femoral
BM [67].
16

2. Perivascular clusters of dendritic cells provide critical
survival signals to B cells in bone marrow niches
2.1 Introduction
The bone marrow (BM) is generally considered a primary lymphoid organ providing a
unique microenvironment with defined niches for stem cells, as well as for lymphoand
myelogenesis [53,68,69,70]. Early B cell development is confined to the BM
where it comprises a number of defined states (pre-pro-B, pro-B, pre-B) [71].
Immature B cells then leave the BM and mature in the spleen [72]. Notably, up to a
quarter of the mature B cell pool positive for immunoglobulin D (IgD) and IgM can
subsequently be found recirculating in steady state through the BM [55]. Moreover,
these BM-resident mature B cells can participate in situ in T-independent humoral
immune responses to blood-borne microbes [55]. Finally the BM constitutes a storage
site for terminally differentiated B cells, i.e. long-lived plasma cells [59,73]. T cell
development occurs in the thymus, but mature CD4 and CD8 T cells continuously
home to the BM as well [61]. In addition, it is well established that this organ
represents a principal reservoir for both CD4 + and CD8 + memory T cells, which
represent a chief obstacle to BM transplantation [74,75]. BM-resident naïve and
memory T cells can be both activated in situ, suggesting the presence of professional
antigen presenting cells (APC) in the BM [54,75,76]. Collectively these findings show
that in addition to its established function as the primary lymphoid organ in
hematopoiesis, the BM can also act as secondary lymphoid organ, providing a suitable
microenvironment for initiation and restimulation of adaptive immune responses.
Recent histological and imaging data emphasize the importance of functional
compartmentalization of lymphoid organs. The existence and localization of a
postulated BM immune niche [77], however, remains elusive.
Dendritic cells (DCs) are mononuclear phagocytes specialized in the stimulation and
tolerization of T lymphocytes [1,78]. Emphasizing their function in
immunosurveillance, most tissues are populated with DCs that translocate to draining
lymph nodes (LNs) after encountering antigen. In addition to those migratory DCs,
there are also lymphoid tissue-resident DCs, which are believed to collect and present
antigen in the tissue itself [78]. Not surprisingly, as an established hallmark of
adaptive immunity, DCs are found in greatest numbers and complexity at sites where
17

immune responses are initiated, such as the secondary lymphoid organs [79].
Here we report the phenotypic characterization of BM-resident Dendritic cells
(bmDCs). In situ imaging revealed that these rare cells were concentrated in the BM
in unique perivascular clusters enveloping blood vessels and seeded with mature B
and T lymphocytes. Highlighting a critical role of the bmDCs in the maintaining the
integrity of these putative BM immune niches, conditional bmDC ablation resulted in
a specific loss of recirculating mature B cells from the BM. This phenotype could be
reversed by transgenic overexpression of the antiapoptotic factor Bcl-2 in B cells.
Finally, the survival of recirculating B cells in the niches specifically required the
presence of bmDCs that produced macrophage migration-inhibitory factor (MIF).
2.2 Results
2.2.1 Phenotypic and functional characterization of bone marrow DCs
The BM of naïve mice contained a sizable population of DCs phenotypically defined
by the expression of major histocompatibility complex (MHC) class II and the β
integrin subunit CD11c (Fig. 1a); we obtained 1.1x10 6 ± 0.2x10 6 bmDCs from one
femur and tibia of each wild-type C57BL/6 mouse (± s.d.; n=10). Comparative flow
cytometry showed that bmDCs differed from the bulk of splenic conventional DCs
(cDCs) by prominent expression of CD103 (α E integrin) and F4/80, a surface marker
expressed on monocytes, macrophages and DC subsets (Fig. 1b). In addition, bmDCs
had lower expression of CD62L and higher expression of Ly6C/G (Gr-1), CD11b and
CD115 than did splenic cDCs. Furthermore, bmDCs had an activated phenotype, as
indicated by high expression of MHC class II (I-A b ), CD40, CD44 and the costimulatory
molecule CD86. DCs were originally identified by their ability to
stimulate naive in vitro T cell responses and this functional feature remains the best
criteria to distinguish them from the closely related macrophages [80]. To functionally
define bmDCs, we therefore tested their ability to prime naïve alloreactive T cells in a
mixed-leukocyte reaction (MLR). In contrast to BM-resident monocytes and
macrophages, defined as F4/80 + CD11c - MHC II - and F4/80 + CD11c- MHC II+ cells,
respectively, the F4/80 + CD11chigh MHC class II high bmDCs efficiently stimulated
allogeneic naive CD4 + T cells (Fig. 1C). Hence, these cells can be classified as true
DCs.
18

Figure 1. Characterization of the mouse bmDC compartment
(a) Identification of CD11c high DCs (outlined) in BM and spleen by flow cytometry.
(b) Flow cytometry of the expression of cell surface markers by bmDCs and splenic cDCs from
C57BL/6 wt mice (gated asCD11c high MHC class II + cells, as indicated in A). MFI, mean fluorescence
intensity.
(c) Mixed-leukocyte reaction with mononuclear phagocyte populations isolated from BM and spleen.
Stimulator cells were sorted according to the following markers: splenic cDCs (CD11c-GFP + , F4/80 - ,
MHC II + ); bmDCs (CD11c-GFP + , F4/80 + , MHC II + ); splenic macrophages (Spl MΦ) (CD11c-GFP - ,
F4/80 + , MHC II + ); bmMΦ (CD11c-GFP - , F4/80 + , MHC II + ); and BM monocytes (CD11c-GFP - , F4/80 + ,
MHC II - ). CD4 + T cell responses were measured by thymidine incorporation. Error bars represent SED.
2.2.2 Organization of bmDCs into perivascular clusters
The DC compartment of secondary lymphoid organs is highly organized. Although
adoptively transferred splenic cDCs have been visualized in the BM of recipient
mice [54], the localization and organization of endogenous bmDCs remains unknown.
To study the in vivo distribution of DCs in the BM, we used an in situ imaging
19

strategy with mice containing DCs expressing green fluorescent protein (GFP; called
Cx3cr1 gfp/+ mice) [81,82,83,84]. CD11chigh bmDCs of these Cx3cr1 gfp/+ mice were
brightly labeled with green fluorescence (Fig. 2a). Furthermore, histologically,
bmDCs could be distinguished from other cells expressing GFP-tagged CX3CR1 in
Cx3cr1 gfp/+ BM, such as rare lymphocytes and monocytes [50,81], by their
characteristic spindle-shaped morphology (Fig. 2). Surprisingly, two-photon
microscopy of skull BM [67] of Cx3cr1 gfp/+ mice showed that the DCs in the cranial
BM parenchyma were organized in unique perivascular clusters wrapped around
distinct blood vessels and occupying architecturally definable niches (Fig. 2b-d).
Notably, bmDCs were not in direct contact with the vessel walls and thus were
distinct from rare perivascular BM macrophages present tight association with the
endothelium (Fig. 2e). The bmDC clusters were reminiscent of the perisinusoidal
niches identified by adoptive B cell transfer [55]. To determine whether grafted B
lymphocytes indeed localized together with the bmDC clusters, we adoptively
transferred Hoechst-labeled splenic B cells into Cx3cr1 gfp/+ recipient mice. The
grafted mature B cells homed to the BM, and their distribution was restricted to the
extravascular areas covered by bmDCs (Fig. 2f). Finally, we determined whether the
niches defined by bmDCs also harbored T cells. Indeed, adoptively transferred T cells
homed to the perivascular bmDC clusters and localize there together with bmDCs and
B cells (Fig. 2g,h). We conclude that bmDCs define novel previously unidentified
specific anatomic locations or niches in the BM that harbor DCs and recirculating B
and T lymphocytes.
20

Figure 2. bmDCs are organized into unique perivascular clusters that define BM immune niches
harboring B and T cells
(a) Flow cytometry of wt and Cx3cr1 gfp/+ BM, indicating GFP expression by CD11c high MHC II +
bmDCs.
(b, c, d) Two-photon microscopy of cranial BM cavity of Cx3cr1 gfp/+ mice (bmDCs – green; blood
vessels- red).
(e) Two-photon microscopy of cranial BM cavity of Cx3cr1 gfp/+ mouse. Note perivascular MΦ (green),
that are tightly associated with the endothelium (upper blood vessel) and distinct from bmDC clusters
(green); blood vessels (red).
(f) Two-photon microscopy of the colocalization of adoptively transferred B cells (blue), host bmDCs
(green) and blood vessels (red) in BM cavities of Cx3cr1 gfp/+ mice at 5 h after transfer.
(g) Two-photon microscopy of the localization of adoptively transferred T cells (blue), host bmDCs
(green) and blood vessels (red) in BM cavities of Cx3cr1 gfp/+ mice 5 h after transfer of splenic CD4 +
and CD8 + T cells. (h) Two-photon microscopy of the localization of adoptively transferred T cells
(blue), B cell (red) and host bmDCs (green) in BM cavities of Cx3cr1 gfp/+ mice at 5 h after transfer.
Scale bars: 20 μm. Data are from one representative experiment of three.
2.2.3 DC ablation causes depletion of recirculating B cells from BM
To probe for bmDC functions, we next took advantage of the CD11c-diphtheria toxin
receptor (DTR)-transgenic (CD11c-DTRtg) mouse model, which allows the
conditional ablation of CD11c high DCs through the use of diphtheria toxin (DTx) [42].
BM chimeras generated by the reconstitution of lethally irradiated recipient mice with
21

CD11c-DTRtg BM tolerate repeated DTx injection without adverse side effects,
which allows prolonged DC ablation [85]. Intraperitoneal DTx injection into chimeras
of wild-type mice reconstituted with CD11c-DTRtg BM [CD11c-DTRtg > wt]
resulted in systemic depletion of DCs, including 90% of the bmDCs (Fig. 3a). The
ablation of BM-resident DCs was confirmed by two-photon imaging of cranial BM of
CD11c-DTRtg Cx3cr1 gfp/+ (double-transgenic) mice. Notably, the perivascular BM
immune niches of these mice harbor both GFP + bmDCs and monocytes [50], which
can be distinguished by their morphology. Only the characteristically spindle-shaped
bmDCs expressed CD11c and were thus depleted by the DTx treatment of CD11c-
DTRtg Cx3cr1 gfp/+ mice, whereas monocytes were resistant to DTx (Fig. 3b).
Figure 3. Conditional ablation of bmDCs
(a) Flow cytometry of BM from CD11c-DTRtg Cx3cr1 gfp/+ mice not treated or 24 hafter intraperitoneal
injection of DTx to deplete CD11c high DCs. Numbers adjacent to outlined areas indicate percent
CD11c + MHC class II + cells.
(b) Two-photon microscopy of cranial BM cavity of CD11c-DTRtg Cx3cr1 gfp/+ mice, untreated or
treated with DTx as described in A. Note distinct morphology of bmDCs and monocytes, which define
the BM niche in the absence of bmDCs. Green – monocytes and bmDCs; red – blood vessels. Scale
bars: 20 μm. Data are from one representative experiment of four.
We next studied the outcome of the bmDC depletion on the cellular composition of
the BM immune niches. Flow cytometry of the BM of untreated mice confirmed
the presence of a distinct population of recirculating B cells, defined as
B220 + IgM + IgD + cells [72] or CD93 - (AA4.1) CD23 + cells [86]. Unexpectedly,
bmDC-depleted mice exhibited a profound reduction of these mature B cells, which
22

decreased in abundance with time (Fig. 4a,b,d). B cell development was not
substantially affected by bmDC ablation, as indicated by the presence of pro-B cells,
pre-B cells and immature B cells (B220 + IgM- and IgM + IgD - CD93 + cells) (Fig. 4a,b).
Moreover, the effect was specific to the BM, since mature B cell numbers in spleen
and LNs were not affected (Fig. 4c). BM-resident mature B cells have been shown to
respond to antigenic challenge by in situ differentiation into antibody-secreting
plasmablasts [55]. The bmDC depletion would be expected to impair such humoral
BM immune responses and thus have functional consequences. It has been reported
that short-lived plasma cells express CD11c and are hence DTx-sensitive in CD11c-
DTRtg mice [87]. To test the outcome of bmDC ablation on short-lived plasma cell
generation in the BM, we generated mixed BM chimeras by reconstitution of lethally
irradiated wt recipients with a 95 : 5 mixture of CD11c-DTRtg recombinationactivating
gene 2-defecient (RAG - / - CD45.2 + ) BM and wild-type (CD45.1 + ) BM. All
B cells in the recipient mice were derived from the wild-type BM (CD45.1), whereas
the bulk of the DCs expressed the DTR-GFP transgene [87] (Fig. 5a). Chimeras were
inoculated daily with DTx to deplete DCs. To exclude an influx by plasma cells from
the spleen, the animals were splenectomized [55]. Mice were immunized with the T-
independent antigen NP-Ficoll, then 4 d later, BM cells were isolated and analyzed
with an IgM enzyme-linked immunospot assay (ELISPOT) [87]. Ablation of bmDCs
impaired the formation of NP-specific IgM-secreting short-lived plasma cell in the
BM of the asplenic mice (Fig. 5b). Cumulatively, these results indicate the critical
requirement of bmDCs in the recruitment or maintenance of mature recirculating B
cells inthe BM.
23

Figure 4. BmDCs are required for the maintenance of recirculating mature B cells in
the BM
(a) Flow cytometry of BM B cell compartment of untreated and bmDC-depleted [CD11c-
DTRtg > wt] BM chimeras. Pro, pre-B cells are plotted as B220 + IgM - IgD - , immature B cells are
B220 + IgM + IgD - and mature B cells are B220 + IgM + IgD + . Note reduction of mature B cells.
Bar diagram summarizes cell numbers obtained from flow cytometry for cells isolated from two fibiae
and femurs (3 mice/ group). Data are from one representative experiment of five.
(b) Flow cytometry of BM B cell compartment of untreated and bmDC-depleted [CD11c-DTRtg > wt]
BM chimeras. Pro, pre-B cells and immature B cells are plotted as B220 + CD93 (AA4.1) + CD23 - cells
and mature B cells are B220 + CD93 (AA4.1) - CD23 + cells. Note reduction of mature B cells.
(c) Summary of numbers of mature B cells in the BM, spleen and LNs of [CD11c-DTRtg > wt] BM
chimeras left untreated or administered DTx for 5 d. Error bars represent s. d.
of data obtained from analysis of three experiments with 9 mice / group.
(d) Flow cytometry of BM B cell compartment of untreated and DTx-treated [CD11c-DTRtg > wt] BM
chimeras showing disappearance kinetics of endogenous mature BM B cells. Of note, not all mature
BM B cells are dependent on bmDCs.
25

Figure 5. Ablation of bmDCs impaired the formation of IgM-secreting short-lived plasma cells
(a) Flow cytometry of spleens of untreated and DTx-injected [95%CD11c-DTRtg Rag - / - / 5%wt > wt]
BM chimeras for DCs and B cells. Note that most DCs are DTR-GFP + and ablated by the DTx
treatment, whereas all mature IgD + B cells are of wt origin (CD45.1) and unaffected by the treatment.
(b) Ablation of bmDCs impairs NP-specific IgM-secreting plasma cell formation in the BM of asplenic
mixed BM chimeras. Scheme illustrating the experimental protocol. Graph showing the result of
ELISPOT assay for NP-specific antibody-forming cells (AFCs) in the BM of the various mice.
26

2.2.4 BmDCs provide a survival signal to recirculating mature B cells
BmDCs could be a source of chemokines needed to attract mature B cells from the
blood circulation. Alternatively, bmDCs could provide critical B survival factors in
the perivascular BM niches. To address those options, we isolated B cells from wildtype
mice and mice overexpressing the antiapoptotic factor Bcl2 (Eμ-bcl-2-22 mice
[88]; called Bcl-2-transgenic), labeled the cells with cell-tracking dye CMTMR and
adoptively transferred them into recipient mice. When grafted into untreated [CD11c-
DTRtg > wt] BM chimeras, wild-type B cells were readily detected in association
with the bmDC clusters; however, we failed to locate significant numbers of these
cells in bmDC-depleted BM immune niches (Fig. 6a,b). In contrast, we detected
transferred Bcl-2tg B cells regardless of bmDC ablation (Fig. 6c,d). To confirm this
result and to allow quantification, we repeated the experiment using allotype-marked
B cell grafts and flow cytometry. As shown above (Fig. 4a,b), depletion of bmDCs
resulted in a significant loss of mature host B cells from the BM of [CD11c-DTRtg >
wt] BM chimeras (Fig. 6e). Furthermore, mice treated with DTx had half as many
transferred wild-type B cells as did untreated controls mice, but there was no
significant loss of cell survival in treated mice after transfer of Bcl-2-tg B cells (Fig.
6f). Importantly, the DTx-induced loss of the B cell graft was specific to the BM, and
did not occur in the spleens or LNs of the recipient mice (Fig. 6g). The finding that
the B cell reduction could be observed with adoptively transferred wild-type B cells
ruled out the possibility that it was due to a direct effect of the toxin on CD11c-DTRtg
B cells. These results allow two conclusions to be drawn. First, bmDCs are not
required for B cell homing to the BM, as Bcl-2tg B cells were presented in DCdepleted
BM. Second and more importantly, the finding that enforced overexpression
of Bcl-2 restored the BM-resident mature B cells indicates that bmDCs provide these
cells directly or indirectly with a critical survival signal.
27

Figure 6. BmDCs provide survival signals to mature B cells in the BM
(a-d) Multiphoton microscopy of cranial BM cavities of untreated and DTx-treated CD11c-DTRtg
Cx3cr1 gfp/+ mice that received a wt (A,B) or Bcl-2 transgenic (C,D) B cell graft 24 h before B cell
analysis; B cells (CMTMR, red) host bmDCs (green). Note absence of host bmDCs (green) from DTx-
28

treated mice and unique survival of Bcl-2 transgenic B cells (CMTMR, red). Scale bars: 20 μm. Data
are from one representative experiment of two.
(e,f,g) Flow cytometry of BM B cell compartment of untreated and DTx-treated [CD11c-DTRtg > wt]
BM chimeras 24 h after engraftment with splenic wt or Bcl-2tg B cells.
(e) Analysis of host cells (CD45.1 - ) and donor B cells (CD45.1 + ) in BM.
(f) Analysis of grafted cells in BM.
(g) Analysis of grafted cells in spleen and LNs. Bar diagram summarizes results obtained from one
representative experiment of two (3 mice/group).
2.2.5 Recirculating mature B cells require MIF-producing bmDCs for survival
Adoptively transferred T cells also home to the bmDC clusters and localized together
with B cells (Fig. 2g,h). However, the abundance of BM T cells remained unaffected
by the bmDC depletion (Fig. 7). It is thus unlikely that bmDCs act via T cells that
provide an indirect B cell survival signal, such as CD40L [89].
One of the best-characterized B cell survival factors is the B-cell activating factor
(BAFF) [90], a member of the TNF family, which is required by mature splenic
follicular and marginal zone B cell subpopulations. Although the splenic BAFF signal
is provided by nonhematopoietic cells, including stromal and follicular DCs [91],
BAFF production has also been reported in immune cells, including in vitro cultured
DCs [92,93]. To test whether bmDCs promote the mature BM B cell survival by
secreting BAFF, we generated mixed BM chimeras by injecting BM from BAFFdeficient
mice [94] and CD11c-DTRtg mice into wild-type mice. Injection of DTx
into the resultant these [BAFF - / - / CD11c-DTRtg > wt] chimeras resulted in the
specific ablation of BAFF + / + bmDCs expressing the GFP-DTR fusion protein [42],
but it spared GFP - BAFF - / - bmDCs (Fig. 8a,b). In this setting, a loss of recirculating
mature B cells would indicate that the critical survival factor provided by bmDC is
BAFF. However, mature BM B cells were retained in the DTx-treated mixed
chimeras that had lost CD11c-DTRtg BAFF + / + bmDCs and exclusively retained
BAFF-deficient bmDCs (Fig. 8c). Importantly, this experimental set up did not
address any potential contribution of BAFF-producing non-DCs to B cell survival, as
their wild type counterparts were not be ablated in the CD11c-DTRtg system. Rather
our results establish that mature BM B cell survival was independent of BAFFproducing
bmDCs.
29

Figure 7. T cell compartment in the BM remains unaffected by bmDC ablation
Flow cytometry of BM T cell compartment of untreated and DTx-treated [CD11c-DTRtg > wt] BM
chimeras. Note that the frequency of the CD4 + and CD8 + T cells remains unaffected by ablation of the
bmDCs.
30

Figure 8. Mature B cell survival in BM is independent of BAFF-producing bmDCs
(a) Approach used to determine molecular contribution of DCs in BM chimeras. Note that after DTx
treatment [CD11c-DTRtg / mutant > wt] mice are left with only mutant DCs.
(b) Flow cytometry of DTx-induced DC depletion in [BAFF - / - /CD11c-DTRtg > wt] chimeras, on day
6 after 5 daily intraperitoneal DTx injections. CD11c high DCs generated from CD11c-DTR BM and
BAFF - / - BM are GFP + and GFP - , respectively. Data are from one representative experiment of three.
(c) Flow cytometry of BM of [wt > wt], [BAFF - / - > wt] and [BAFF - / - /CD11c-DTRtg > wt] BM with
or witout 5 daily intraperitoneal injections of DTx before analysis on day 6.chimeras. Bar diagram
summarizes results obtained from one representative
experiment of two (3 mice/group).
The chemokine MIF has been found to activate an antiapoptotic PI3K-Akt signaling
pathway via triggering of a CD74-CD44 receptor complex [95,96]. Moreover, data
indicate involvement of MIF in controlling the survival of mature B cells [97,98].
Both CD74 and CD44 were expressed by BM-resident mature B cells (Fig. 9a). MIF
is widely expressed by myeloid cells, including DCs [99]. RT-PCR analysis showed
that whereas all the mononuclear phagocyte populations in the BM transcribed MIF,
its expression was greater in bmDCs (Fig. 9b). To investigate the possible
involvement of MIF in the maintenance of recirculating B cells, we analyzed the
31

spleens and BM of MIF - / - mice and age-matched wild-type controls [99]. The
frequency of splenic CD93 - CD23 + mature B cells was not affected by the MIF
deficiency (Fig. 9c). However, the BM of MIF - / - mice had significantly fewer mature
B cells than did the BM of wild-type control mice (Fig. 9c). Although these data
suggest that MIF might indeed play a role in the maintenance of the mature B cells in
the BM, cells other than bmDCs could provide the critical MIF signal. To directly test
whether MIF-expressing bmDCs are required for the maintenance of the mature B
cells, we generated mixed BM chimeras by injecting wild-type mice with BM from
MIF-deficient mice and CD11c-DTRtg mice. DTx treatment of these [MIF - / - / CD11c-
DTRtg > wt] chimeras resulted in the specific ablation of GFP + MIF + / + bmDCs,
sparing GFP - MIF - / - bmDCs (Fig. 9d). Importantly, and in contrast to the [BAFF - / - /
CD11c-DTRtg > wt] chimeras included as additional control, mice that retained after
DTx treatment only MIF-deficient bmDCs in their BM, showed a significant loss of
mature B cells from the BM, but not from the spleen (Fig. 9e). Notably, the mixedchimera
approach specifically targeted DCs, but did not impair other MIF-producing
cells in the BM, such as monocytes or macrophages (Fig. 9b). Depletion of bmDCs
equally affected wild-type (CD45.1 + ) and MIF - / - (CD45.1 - ) B cells equally in the
mixed chimeras (Fig. 9f), which indicated that the phenotype was not due to an
intrinsic defect of MIF - / - B cells. Collectively, these data establish that bmDCs
produce MIF, which is a critical steady-state survival factor for mature recirculating B
cells in the BM.
32

Figure 9. Mature B cell survival in BM requires MIF-producing bmDCs
(a) Flow cytometry of mature B cells in the BM for surface expression of components of the MIF
receptor complex CD44 and CD74. Histograms are gated according to dot plot. Open histograms
represent isotype control (CD74) or BM B cells of CD44 - / - (CD44).
(b) RT-PCR analysis of MIF expression by monocytes (Mono), macrophages, DCs and unfractionated
cells (UF) from BM. Cells are defined as described in Fig. 1c and sorted accordingly.
(c) Flow cytometry of B220 + CD93 - CD23 + mature B cells from the spleen and BM of MIF - / - mice and
age-matched wt controls. Bar diagram summarizes results obtained from representative experiment of
two (3 mice/group).
34

(d) Flow cytometry of splenic DCs in control [MIF - / - / CD11c-DTRtg > wt] BM chimeras, left
untreated or treated with 5 daily intraperitoneal DTx injections, before analysis on day 6. Note
conditional ablation of DTR/GFP + MIF + / + DCs.
(e) Flow cytometry of BM and spleen B cell compartment of [wt > wt], [CD11c-DTRtg > wt] and
[MIF - / - / CD11c-DTRtg > wt] BM chimeras. Bar diagram summarizes results obtained from two
representative experiments of two (3 mice/group). Note inclusion of data of [BAFF - / - /CD11c-DTRtg
> wt] chimeras in this experiment that did not show mature B cell loss in response to bmDC depletion.
(f) Flow cytometry of the distribution of MIF - / - B cell (CD45.1 - ) and MIF + / + B cells (CD45.1 + ) in the
BM B cell compartment. Bar diagram summarizes results obtained from two representative
experiments of two (4 mice/group). Note that CD11c-DTRtg and MIF - / - B cells are equally affected by
the DC depletion.
2.3 Discussion
Here we have reported the phenotypic and functional characterization of the dendritic
cell compartment in unmanipulated murine BM. We found bmDCs were organized
into unique perivascular clusters that wrapped distinct blood vessels. Moreover, the
bmDCs seemed to mark unique BM immune niches, as the clusters were seeded by
recirculating B and T cells. Conditional ablation of bmDCs resulted in the specific
loss of the mature B cells from the niches, as B cell maintenance required the
presence of bmDCs that expressed the survival factor MIF.
The mammalian BM is the major site of adult hematopoiesis. The advent of advanced
imaging studies has led to the identification of unique niches that provide a highly
specialized microenvironment for distinct developmental processes. These include
anatomically defined niches for hematopoietic stem cells [68,70], B cell development
[59] and thrombopoiesis [70]. A far less appreciated role of the BM is its involvement
in the generation of adaptive immune responses to blood-borne antigens. Naïve B and
T cells can be found in the BM, and have been shown to undergo in situ antigenspecific
activation [55,76]. Moreover, the BM is a major reservoir for memory T
cells, which undergo basal proliferation [61,75] and can be activated in this site [54].
The BM is also known to harbor DCs, however, these cells have not been
characterized in depth so far. Here we have defined CD11c high bmDCs functionally as
myeloid BM cells that most efficiently primed naïve alloreactive T cells in vitro.
Phenotypic characterization showed that bmDCs had an activated phenotype and
expressed unique markers that distinguished them from their splenic counterpart.
Most notably, multiphoton analysis of the cranial BM of mice containing GFP-labeled
bmDCs (Cx3cr1 gfp/+ mice) revealed that these cells were concentrated in unique
perivascular clusters that wrapped a distinct set of sinusoids and venules. Adoptive
transfer of labeled B and T lymphocytes led to the seeding of the DC clusters with
35

grafted cells, which suggested that the structures represent previously sought BM
immune niches [76]. Here we focused on unmanipulated naïve mice and it remains to
be shown, if T cell responses that have been assigned to the BM, are impaired in
bmDC-depleted mice. The notion that bmDCs are critical APC that initiate BM T cell
responses would be supported by the studies [76] and our in vitro MLR results. The
effect of the bmDC depletion on the generation of BM-resident plasma cells in
response to NP-Ficoll challenge suggests that B cells might be primed in the niches.
However, in vivo triggering of B cells by antigen-bearing DCs in the BM immune
niches, as reported for the LNs [100], remains to be shown. An intriguing question
raised by our finding is what restricts the size of the DC clusters and BM immune
niches. Published studies have reported the existence of specialized endothelial
microdomains in the BM vasculature that express the adhesion molecule E-selectin
and present the chemokine SDF-1 (CXCL12) [101]. These domains, like the DC
clusters, are found in parasagittal locations in the skull and were shown to abruptly
terminate. If these domains represent the entry ports to the BM immune niches, they
might provide longitudinal restrictions. The widths of the niches could be determined
by distinct stromal cell cuffs on selected blood vessels. The importance of stromal cell
subsets in the organization of lymphoid organs has been demonstrated in studies of
LNs [102].
Highlighting the functional importance of bmDCs, their conditional ablation resulted
in the specific loss of both endogenous and adoptively transferred mature B cells from
the BM immune niches. This failure to engraft bmDC-depleted BM could be
overcome by the overexpression of the antiapoptotic factor Bcl-2 in mature B cells,
which suggested that bmDCs provide a unique survival factor. Studies of mixed BM
chimeras subsequently allowed us to show that this factor was MIF. Although we
would like to mention that we did not covered in this study other factors than survival
that could also affect accumulation or migration of circulating B cells in the BM.
The cytokine MIF has pleiotropic functions and is important in acute and chronic
inflammatory diseases such as septic shock, rheumatoid arthritis, colitis and
atherosclerosis [103]. A critical breakthrough in the understanding of MIF's action
was provided by expression cloning of its cellular receptor complex CD74-CD44
[95]. Importantly, MIF engagement of the receptor complex has been shown to trigger
the antiapoptotic PI3K/-Akt signaling pathway in cultured fibroblasts, tumor cells and
primary B cells and thus promote their survival [96,97,98]. Here we provided a first in
36

vivo evidence for thas MIF activity, by demonstrating that mature B cell maintenance
required MIF-producing bmDCs.
It has been shown that splenic marginal zone B cells depend on DCs for survival and
differentiation into IgM-secreting plasmablasts [104]. However, in this case, the TNF
superfamily members BAFF and APRIL were identified as critical factors provided
by the DCs. Using a mixed-BM chimera approach, we have ruled out the possibility
that mature B cells in the BM require BAFF-producing DCs; however, it remains to
be determined whether APRIL is involved in the BM immune niche. Such a scenario
could indicate similarities between the splenic marginal zone and the BM immune
niches, both of which receive their antigenic input via the blood and not the
lymphatics and thus likely share the task to providing systemic immunity to bloodborne
pathogens. Notably, not all mature B cells were lost from the bmDC-depleted
BM. This could suggest that other cells can provide B cells with survival signals in
the BM immune niches. Alternatively, the niches could be inhabited by mature B cells
of two origins: recirculating B cells that matured in the spleen, and B cells that
matured in the BM, as proposed before [105]. Given their distinct history, the later
IgD + IgM + B cells might be independent of MIF and they might thus persist in the DCdepleted
BM immune niches. Such cells would be expected to accumulate in BM
niches of MIF - / - mice, which might explain the less severe B cell loss in these mice
relative to the loss in those with conditional ablation.
Finally, it is noteworthy that in many mutant mice with enhanced B cell signaling,
mature B cells fail to accumulate in the BM [106,107,108,109,110]. Although this has
been hypothesized to be due to impaired B cell homing [111], our finding that mature
B cells in the BM immune niches uniquely depended on a specific survival factor
raises the possibility that local B cell apoptosis might account for some of the
phenotypes.
Cumulatively, we have reported here the existence of a novel BM immune niches that
harbored DCs, mature B and T lymphocytes. Beyond their established role as APC,
DCs residing in this microenvironment needed to provide a critical cytokine, MIF to
maintain the survival of recirculating B cells in the niche. Our identification of the
lymphoid follicle- like BM structure should have a critical effect on future studies
investigating the role of this organ in the immune defense against blood borne
pathogens.
37

3. The bone marrow immune niche: Bone marrow as a
priming site for naïve CD8 + T cells
3.1 Introduction
The unique cellular composition and the architecture of the T cell area
microenvironment of secondary lymphoid organs are thought to be prerequisites for
primary T cell responses [112]. It is in these places where naive T cells encounter
antigen-ladden DCs [113]. The BM is a part of the lymphocyte recirculation network
and similar to spleen, is highly vascularized, but lacks a lymphatic drainage [114]. It
has been shown that the parenchyma of the mouse BM contains 3-8% CD3 + T
lymphocytes [76]. T lymphocyte homing to the BM requires VCAM-1 and ICAM-1
that are constitutively expressed in on the stroma [115]. Furthermore, BM is enriched
with antigen-specific memory T cells [61]. CD8 + memory T cells in the BM were
shown to undergo more vigorous homeostatic proliferation and respond faster to
antigen stimulation than those in other tissues [116,117]. The BM accumulates CD8 +
central memory T cells, which are more frequent among T cells in the BM than
elsewhere [63]. Antigen-specific CD8 cells persist in the BM for several months after
resolution of acute infection [118]. BM-resident T cells are a major obstacle to BM
transplantation, because contaminating T cells in the BM allografts can cause graft
versus host disease (GvHD). On the other hand, T cell depletion from allogenic BM
grafts compromises engraftment [119], because CD8 + T cells and DCs facilitate
engraftment [120]. On the basis of these observations, the hypothesis is that BM is not
only a site that harbors antigen-experienced memory T cells, but also a site for
initiation of naïve T cell responses - a function that is generally restricted to secondary
lymphoid organs. The existence of bmDC clusters that contain mature B and T
lymphocytes could indicate that the BM displays structural feature of a secondary
lymphoid organs that contain follicle-like structures. The BM represents a major part
of the lymphocyte recirculation network [115], with billions of lymphocytes
recirculating through it per day. Thus, understanding whether the identified niches
harbor similar function of secondary lymphoid organs, i.e. initiation of primary T cell
responses, can be of major clinical importance.
38

3.2 Results
3.2.1 Identification of bmDC clusters that contain B cells in the BM of the long
bones
We have shown that in the cranial BM parenchyma bmDCs are organized into unique
perivascular clusters that occupy structurally definable niches and contain B cells and
T cells. However, it remained unclear whether similar DC niches exist in the BM of
the long bones. Since these bones are not accessible to intravital two-photon
microscopy, we performed classical immunohistochemistry of femura fragments of
Cx3cr1 gfp/+ mice. As seen in Fig. 10A we identified DC clusters reminiscent of the
ones detected in the skull according to CD11c expression, CX3CR1-GFP
fluorescence and characteristic spindle-shape DC morphology (Fig. 10A). BmDC
clusters could mainly be visualized in the subendosteal region of BM cavities (Fig.
10B) that is known to be populated by most primitive stem cells [68]. Moreover,
staining for B cells revealed that these cells were located in close contacts with
bmDCs (Fig. 10C). Furthermore, all bmDC clusters were found densely populated by
B lymphocytes (Fig. 10D). In addition, preliminary results indicate that bmDC
depletion in CD11c-DTRtg Cx3cr1 gfp/+ double-transgenic mice leads to a reduction of
the B220 + B cells (Fig. 10E). These results suggest that the organization of bmDCs is
similar in the BM of skull and the long bones. These bmDCs reside in close proximity
to B cells and are needed for their survival in the niche.
39

A
B
C
D
E
DTx
Figure 10. bmDCs in the long bones are organized in clusters containing B cells
(A) Immunohistochemistry of femura fragment from Cx3cr1 gfp/+ mouse (bmDCs-green), stained with
DAPI (blue), anti-CD11c antibody (red) at x40 magnification.
(B) Fluorescence microscopy analysis of Cx3cr1 gfp/+ femura (bmDCs-green) at x10 magnification.
(C) Fluorescence and immunostaining microscopic analysis of Cx3cr1 gfp/+ femura section, stained with
anti-B220 (red), (bmDCs-green) at x40 magnification.
(D) Fluorescence and immunostaining microscopy analysis of Cx3cr1 gfp/+ femura section, stained with
anti-B220 (blue), (bmDCs-green) at x20 magnification.
(E) Fluorescence and immunostaining microscopy analysis of femura section from untreated CD11c-
DTR Cx3cr1 gfp/+ double-transgenic mouse and 1 d after i.p. injection of DTx. Sections are stained with
anti-B220 antibody (blue), (bmDCs-green) at x20 magnification.
40

3.2.2 BmDCs originate without monocytic intermediate from macrophage/DC
precursors (MDPs)
Macrophage/DC precursors (MDPs), defined as cKit + CD11b - Cx3cr1 gfp/+ Gr-1 - BM
cells [45], act as in vivo precursors of both BM and blood Gr-1 high and Gr-1 low
monocytes [50]. We previously showed that Gr-1 high monocytes differentiate under
resting conditions into mucosal DCs in the intestinal lamina propria [50] and in the
lungs [84]. However, monocytes do not give rise to classical splenic CD11c hi DCs
[50,121], which arise from MDPs via circulating non-monocytic precursors, the
preDCs [5,50]. To investigate the origin of bmDCs, we took advantage of CD11c-
DTR Cx3cr1 gfp/+ double-transgenic mice. In these mice, systemic injection of DTx
depleted endogenous bmDCs from the niches (Fig. 11A, middle panel), but spared
round-shaped monocytes. The ablation was however transient, since already four days
after DTx treatment, we found the niches reconstituted with bmDCs (Fig. 11A, right
panel). To identify the bmDC precursors, we adoptively transferred sorted MDPs
(cKit + CD11b - Gr-1 - Cx3cr1 gfp/+ ) or monocytes (cKit - CD11b + Gr-1 + Cx3cr1 gfp/+ or
cKit - CD11b + Gr-1 - Cx3cr1 gfp/+ high) from Cx3cr1 gfp/+ mice into CD11c-DTRtg mice,
that were depleted of their endogenous bmDCs. To prevent bmDC regeneration from
endogenous progenitors the mice were repeatedly injected with DTx, until they were
sacrificed for analysis (Fig. 11B). Notably, neither transferred Gr-1 high , nor Gr-1 low
monocytes gave rise to bmDCs (Fig. 11C, two left panels), whereas in the same
experiment, the Gr-1 high monocytes efficiently reconstituted intestinal lamina propria
DCs (Fig. 11C, third panel from the left). In stark contrast, the MDP transfer resulted
in the efficient reconstitution of bmDCs (Fig. 11C, right panel). Collectively, these
findings show that bmDCs, similarly to their splenic counterparts arise from MDPs
and not from monocytes as does a large fraction of DCs in non-lymphoid organs.
41

A
before DTx
24h after DTx
4d after DTx
B
Day 1 2 3 …………………...….. 14
DTx
DTx DTx analysis
Monocyte/
MDP
transfer into
DTR chimeras
C
Gr-1 low monocytes
Gr-1 high monocytes
Lamina Propria –
monocyte transfer
MDP transfer
Figure 11. bmDCs arise without monocytic intermediate from MDPs
(A) Two-photon microscopy of cranial BM cavities of CD11c-DTRtg Cx3cr1 gfp/+ mice left untreated or
24 h and 4 d after i.p. DTx injection. Note that 24 h after DTx treatment, monocytes (green, roundshape)
define the BM niche in absence of DCs (green, spindle-shape).
(B) Schedule used to determine the origin of bmDCs. CD11c-DTRtg chimeras were treated with DTx 1
d before transfer of sorted Cx3cr1 gfp/+ monocytes or MDP. Then, every second day, the mice were
injected with DTx and cranial BM cavities and lamina propria were analyzed on day 14.
(C) Cranial BM cavities and lamina propria of DTx treated CD11c-DTRtg chimeras 14 d after transfer
of Cx3cr1 gfp/+ monocytes or MDP.
42

3.2.3 In the steady-state T lymphocytes are more motile than B cells in the bmDC
niche
Although secondary T-cell responses in the BM are well established, the motility of
naïve T cells, their positioning in specific niches and primary immune responses to
blood-borne antigens in this organ have yet to be explored. After exiting the thymus
or the BM, naïve T cells and B cells search for an antigen by recirculation between
blood and secondary lymphoid organs. Using intravital imaging, it has been reported
that T cells in the LNs move at high velocities [122]. Their trajectories are chaotic and
random in absence of appropriate antigen [122]. To investigate naïve T and B cell
motility in the BM under the steady-state conditions, we transferred 5x10 7 CMTMRlabeled
T cells (with equal ratio of CD4 + and CD8 + T cells) and CFP + B cells (isolated
from β-actin-Enhanced Cyan Fluorescent Protein transgenic mice) into Cx3cr1 gfp/+
mice, and examined the motility of the cells 4 h later by intravital microscopy. We
observed that grafted T and B cells dispersed equally in the BM (Fig. 12A, Movie 1).
Time-lapse imaging and tracking of individual cells in three dimensions over 20-45
min showed that T cell trajectories are longer and more random than those of B cells
(Fig. 12A, Movie 1). Quantification revealed that T cells crawled with mean velocity
of 3.6 μm per minute and their displacement rate was 2 μm per minute, whereas B cell
mean velocity was 2 μm per minute and displacement rate was 1 μm per minute (Fig.
12B). Next, we analyzed the differences in motility of naïve CD8 + T cells only versus
mature B lymphocytes. The measurement of velocity and displacement rate showed
again that T cells are more motile than their B cell counterparts (with mean velocity
of 6.3 versus 4.05 μm per minute; and displacement rate of 3.6 versus 2.02 μm per
minute, respectively) (Fig. 12C, Movie 2). The observation of Movies 1, 2 revealed
that most of the B cells are in close contacts with DCs that are display frequent shape
changes and dendrite extensions. Taken together, our analysis showed that although in
these setting, no antigen is added to the system, B cells movement is confined;
whereas T cells display significant and random cell movement within the BM, similar
to their motility in the LNs.
43

A
T cell (yellow)
B cell (blue)
B
Velocity (µ/min)
27.5
25.0
22.5
20.0
17.5
15.0
12.5
10.0
7.5
5.0
2.5
0.0
T cells
P=0.0009
B cells
Displacement rate (µ/min)
20.0
17.5
15.0
12.5
10.0
7.5
5.0
2.5
0.0
T cells
P

Figure 12. T lymphocytes are more motile than B cells in the bmDC niche under steady-state
conditions
(A) Time lapse images of CMTMR-labeled wild type T cells (yellow) and CFP + B cells (blue)
transferred into Cx3cr1 gfp/+ mice (bmDCs – green), BM microvasculature was delineated by i.v.
injection of Quantum dots (red). Tracks of one T cell and one B cell (white circles) at different time
points. The last images on the right show the entire track (white line).
(B) Velocity and displacement rate of transferred T (total CD4 + and CD8 + ) and B cells. Data points
represent individual cells (n of T cells = 228, n of B cells = 178).
(C) Velocity and displacement rate of transferred CD8 + T cells and B cells. Data points represent
individual cells (n of T cells = 236, n of B cells = 168).
3.2.4 Naïve CD8 + T cells form multi-cell clusters in the bmDC niches upon bloodborne
antigen stimulation
In the LNs, T cells home to a specific area, termed T cell zone, to which DCs that
captured antigens in peripheral tissue migrate. A naïve T cell spends an average of 24
hours in a given LN, but its duration is extended to 3-4 days when the T cell is
exposed to its cognate antigen [122]. If a T cell encounters a DC presenting its
cognate peptide, the T cell arrests on the DC and a stable contact is established,
lasting for 36-48h to fully activate T cell [123]. Although we have a considerable
understanding of T cell motility, their interaction with DCs and activation in the LNs,
these processes in the BM remain poorly defined. Therefore, we decided to study
motility of naive CD8 + T cells within the BM in detail, focusing first on the initial
steps leading to T cell activation, by examining T cells motility upon antigen
administration. To test whether CD8 + T cells can sense antigen presented by cells in
the BM, we purified naïve OVA-specific TCR transgenic CD8 + T cells from the
spleens of OT-I mice (Fig. 13A) and labeled them with CMTMR dye. Cx3cr1 gfp/+
recipient mice were engrafted with 5x10 7 labeled CD8 + T cells. Four hours later, the
mouse was prepared for intravital imaging of the BM and quantum dots were injected
just before beginning of imaging to visualize blood vessels. After the start of the
recording, 0.5 mg SIINFEKL peptide and FITC-dextran, were i.v. coinjected to the
recipient. Coinjection of FITC-dextran into the blood stream facilitates the
observation of the peptide effect in real-time as it diffuses. Peptide administration
resulted in delineation of BM microvasculature in green color and immediate
immobilization of the majority of CD8 + OT-I cells (Movie 3). Analysis of one
representative movie using computerized 3D tracking software demonstrated that T
cells covered a longer distance before the administration of the peptide than following
its injection (Fig. 13B). Velocity analysis showed that most of the cells that were
motile at the beginning of the movie, moved at a significantly slower rate after OVA
45

peptide administration (Fig. 13C). We could observe that T cell immobilization was
general and not restricted to the specific areas where DCs reside. This is likely, since
the peptide does not have to be processes by APC, but is extracellulary loaded on all
MHC class I expressing cells [124]. Therefore, it is expected that OT-I T cells
immediately stop in vicinity of cells that bound the peptide.
A
OT-I cells
99%
CD8
CD62L
B
FSC
before immunization
CD44
after immunization
C
50
Instantaneous velocity (μm/min)
45
40
35
30
25
20
15
10
OVA peptide
+FITC-dextran
injection
5
0
0 8.5 17 25.5 34 42.5 51
Time (min)
46

Figure 13. Motility of naïve CD8 + T cells upon peptide immunization
(A) Flow cytometry of enriched naïve CD8 + T cells by immunomagnetic cell separation with anti-CD8
beads. Staining with anti-CD62L and anti-CD44 shows that 99% of the purified cells are naïve.
(B) Time lapse images of CMTMR-labeled wild type T cells (yellow) transferred into Cx3cr1 gfp/+ mice
(bmDCs – green), before (left panel) and after i.v. injection of 0.5 mg OVA peptide and FITC-dextran
(right panel). Note that BM microvasculature, before the immunization, was delineated by Quantum
dots (red) and upon immunization by FITC-dextran (green). Tracks of T cells are in purple. The last
images on the right show the entire track (white line).
(C) Instantaneous velocity of individual T cells before and after peptide immunization. Note the
increase in the velocity at the time point of peptide injection and then robust decrease.
Next, we decided to study naïve CD8 + T cell priming within the BM, focusing on the
first steps to T cell activation after intact antigen administration.
We purified naïve OVA-specific TCR transgenic CD8 + T cells from the spleens of
OT-I mice (CD45.1) and transferred them into CD45.2 WT recipients that 16h later
were immunized with 0.5 mg OVA protein. Two hours after immunization, spleen,
LNs and BM of the mice were assessed for the activation status of OT-I cells by
measuring CD69 expression. CD69 is an early membrane receptor, which is rapidly
and transiently expressed on lymphocytes during activation and is not detected on
resting lymphocytes [125]. Interestingly, analysis of naive OT-I donor mice had
revealed that the basal levels of CD69 expression on CD8 T cells in the BM, were
higher than in spleen or LNs (Fig. 14A). In addition, after antigen challenge, CD69
expression on the transferred OT-I cells in the BM was notably higher than in other
organs (Fig. 14A). These results are in agreement with the findings of Feuerer et al.
[76]. To visualize the change in T cell behavior after antigen challenge, we next
immunized Cx3cr1 gfp/+ mice i.v. with 0.5 mg of OVA protein and 24h later
transferred into these mice a mix of two populations of naïve CD8 + T cells and
polyclonal CD8 + T cells purified from CFP + mice and CMTMR-labeled OT-I T cells
(5x10 7 each). Four hours later, the skull BM of the recipient mice was analyzed by
intravital imaging. Three-dimensional reconstitutions generated by time-lapse images
revealed that solely OT-I cells clustered in areas enriched with DCs (Fig. 14B, Movie
4). This suggested that bmDCs efficiently captured the exogenous antigen and rapidly
processed and presented it to the specific T cells. Polyclonal T cells that served as
internal control, moved with higher velocities (11 μm per minute compared to 4 μm
per minute) and displacement rate (5 μm per minute compared to 1 μm per minute)
than OT-I T cells that responded to their cognate antigen and arrested (Fig. 14C). In
addition, the trajectories of the polyclonal T cell movement were random and spread,
whereas OT-I T cell behavior was more restricted and showed a notable antigen-
47

dependent suppression in motility (Fig. 14D). These results indicate that the BM is
accessible to blood-borne antigens, which can be processed and presented by BMresident
cells, resulting in early activation of T cells. Moreover, our findings establish
that T cells arrest in the BM niches during antigenic challenge and this arrest leads to
their activation.
A
CD45.1
B
CD8
CD8
CD69
MFI of CD69 expression
90
80
no treatment
70
OVA
60
50
40
30
20
10
0
BM SP LNs
48

C
Velocity (µ/min)
22.5
20.0
17.5
15.0
12.5
10.0
7.5
5.0
2.5
0.0
Polyclonal
T cells
P

ate of specific OT-I T cells was significantly lower than of polyclonal T cells upon
immunization with the antigen and regardless of DC depletion (Fig. 15B). Moreover,
when OT-I T cells were tested for CD69 expression by flow cytometry, BM-resident
OT-I cells in DC depleted hosts expressed comparable levels of CD69 to DC-bearing
recipients (Fig. 15C). Interestingly, analysis of splenic OT-I cells served as internal
control for efficient DC depletion, as in this organ, depletion of DCs significantly
impaired CD69 expression on T cells (Fig. 15C). To verify that naïve CD8 + T cells
were primed in the BM in absence of DCs, we transferred CFSE-labeled OT-I
CD45.1 T cells into control mice and mice that were treated with DTx throughout the
experiment. The mice were immunized with OVA and 3 d after immunization spleen
and BM were isolated and analyzed for the proliferation status of the grafted T cells.
The transferred T cells readily proliferated in all organs of DC-proficient mice in
response to immunization with OVA (Fig. 5D). As reported previously, the DTxinduced
DC depletion abrogated the expansion of CD8 + T cells in the spleen.
Surprisingly, however, we observed a proliferate response of the grafted T cells in the
DC-depleted BM (Fig. 5D). Furthermore, since proliferative T cell expansion can be
associated with the generation of cytokine-producing effector T cells, we investigated
polarization of CD8 + T cells in DC-depleted BM. To analyze T cell polarization of the
grafted OT-I cells, we performed an in vivo restimulation by rechallenging the OVAimmunized
mice with an i.v. injection of OVA peptide [126]. In presence of DCs,
CD8 + T cells in the spleen and in the BM differentiated into IFN-γ-producing cells
(Fig. 5E). Depletion of DCs, impaired IFN-γ secretion in the spleen, but absence of
DCs did not affect the differentiation of CD8 + T cells into effector cells in the BM
(Fig. 5E). Collectively, our data show that BM contains APCs other than bmDCs that
are capable of stimulating naïve CD8 + T cells. Although DCs are known to be the
most potent cross-presenting cells [42,127], it could be that in the unique BM
microenvironment, other cells, such as B cells, macrophages, neutrophils, stromal
cells or other MHC class I expressing cells would be able to perform the task.
50

A
DTx
B
Velocity (µ/min)
13
12
11
10
9
8
7
6
5
4
3
2
1
0
P

D
no immunization
CD45.1
CD8
OVA DTx OVA
SP
counts
CFSE
BM
E
SP
non treated OVA DTx OVA
CD45.1
CD8
1% 21%
5%
CD8
BM
IFN gamma
CD45.1
CD8
CD8
1% 5%
6%
IFN gamma
Figure 15. Naïve CD8 + T cells are efficiently activated in BM niches in absence of DCs.
(A) Two-photon imaging of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T cells (blue)
transferred into CD11c-DTR Cx3cr1 gfp/+ mice that were untreated or injected with DTx twice, 24 h and
3 h prior to the transfer. Then, 6 h after the first DTx injection, recipient mice were immunized with
0.5mg OVA. Note that after DTx treatment, monocytes (green, round-shape) define the BM niche in
absence of DCs (green, spindle-shape).
(B) Velocity and displacement rate of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T
cells (blue) transferred into CD11c-DTR Cx3cr1 gfp/+ mice that were treated as described in (A). Data
points represent individual cells (n of polyclonal T cells = 37, n of OT-I cells = 45).
(C) Flow cytometry of CD69 expression of transferred OT-I CD45.1 naïve T cells into CD11c-DTRtg
chimeras that were left untreated or were injected with DTx and then, and 2 h before the analysis were
immunized with 0.5mg OVA. The bar graph represents mean fluorescent intensity (MFI) of CD69
expression in the spleen and BM.
(D) Flow cytometry of transferred CFSE-labeled CD45.1 OT-I cells into untreated or DTx-injected
CD11c-DTRtg chimeras, 3 d after i.v. immunization with 0.5 mg OVA. Histograms represent cells
gated according to scatter, CD45.1 and CD8 expression, as indicated in the dot plots.
52

(E) CD45.1 OT-I cells were transferred into CD11c-DTRtg chimeras. One day later, mice were treated
with DTx and 8 hours later i.v. immunized with OVA and CpG. Three days after immunization, INF-γ
production in the spleen and BM was assessed after in vivo restimulation with OVA peptide, 2 h before
sacrificing the mice. Data represent INF-γ profiles after gating on CD45.1 and CD8 lymphocytes.
3.2.6 Naïve CD8 + T cells fail to form multi-cell clusters in mice harboring MHC
class-I-deficient stroma
Few studies demonstrated the capacity of nonhematopoietic cells, i.e. stromal cells to
present antigens and stimulate CD8 + T cells. For instance, after ingestion, oral
antigens distribute systemically and provoke T cell stimulation outside the
gastrointestinal tract. Within the liver, scavenger liver sinusoidal endothelial cells
cross-present oral antigens on H-2K b to CD8 + T cells [128]. In other study, osteoclasts
that resorb the bone throughout the life of an animal, in presence of OVA induce
proliferation of CD8 + T cells [129]. Given the notion that BM is populated by high
variety of stromal cells and that bmDCs are not crucial for generation of T cell
clusters after immunization, we decided to test the possibility that stromal cells are
capable to do so. To this end, we generated BM chimeras by the reconstitution of
lethally irradiated H-2K b -deficient recipient mice [130] with Cx3cr1 gfp/+ BM
[Cx3cr1 gfp/+ > H-2K b- / - ]. These mice contain cells of hematopoietic origin (e.g.,
macrophages, DCs, and B cells) that are capable of presenting antigenic peptides on
MHC class I molecules, whereas the radiation-resistant cells, such as stromal cells,
lack the capacity to express MHC class I molecules. The chimeras were transferred
with equal amounts of purified polyclonal CFP + and CMTMR-labeled OT-I CD8 + T
cells, and immunized with OVA protein. Analysis of the behavior of transferred T
cells, unexpectedly, revealed that MHC class I deprivation on stromal cells was
sufficient to impair formation of OT-I T cell clusters [Fig. 16, Movie 7]. Although
these are only preliminary results, and analysis of both DC-depleted [CD11c-DTRtg
Cx3cr1 gfp/+ > H-2K b - / - ] chimeras and reciprocal [H-2K b - / - > CD11c-DTRtg
Cx3cr1 gfp/+ ] chimeras will be required, our results suggest that stromal cells in the
BM are essential for CD8 + T cell priming in the BM.
53

Figure 16. MHC class I deprivation on stromal cells impairs formation of OT-I cells after
immunization with antigen
Two-photon imaging of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T cells (blue)
transferred into [Cx3cr1 gfp/+ > H-2K b - / - ] chimeras that were 24 h prior to transfer immunized with
0.5mg OVA. T cells were analyzed 4 h after transfer. BM microvasculature was delineated by
Quantum dots (red).
3.3 Discussion
After birth, the BM is the principal site of hematopoiesis in mammals and thus, it is
mainly considered to serve as a primary lymphoid organ. However, its potential to
serve as a secondary immune organ has hardly been explored.
The BM microenvironment consists of many types of cells, which provide unique
cues for the development of blood cells and for the survival and maintenance of HSCs
and mature cells, such as mature B cells, plasma cells and memory T cells. It is
believed that to fulfill these different tasks the BM includes functionally distinct
areas, termed niches, for different processes that take place in this organ. In the
previous study, we phenotypically and functionally characterized a unique population
of BM-resident DC CD11c high MHCII high DCs (bmDCs). Intravital multiphoton
imaging revealed that these bmDCs were concentrated in unique perivascular clusters
enveloping selected blood vessels and seeded with mature B and T lymphocytes, as
well as monocytes. Moreover, we showed that bmDCs are critical for the maintenance
of recirculating B cells in the BM through the production of MIF. These findings
suggested that the clusters seeded with DCs and lymphocytes function as niches.
Here, we investigated the dynamic behavior of mature lymphocytes in the BM and
specifically in the areas enriched with DCs and tested the hypothesis that BM is
capable of antigen presentation and initiation of primary T-cell responses – a function
thought to be restricted to secondary lymphoid organs. First, we elucidated the origin
of bmDCs. Interestingly, our results established that like splenic cDCs, bmDCs seem
54

to originate in the steady state exclusively from MDPs, rather than from recirculating
monocytes. However, these results do not exclude the possibility that monocytes may
carry antigen into the BM to support T-cell responses, as shown earlier for adoptively
transferred DCs [54]. We next focused on naïve T and B lymphocyte motility in
bmDC niches. We discovered that B cell migration is restricted, whereas T cells
move more freely and faster than B cells in the BM. Our findings regarding B
lymphocytes are consistent with published observation that B cells are organized in
defined niches near blood vessels and do not migrate from one B cell niche to another
[55]. However, this is the first report examining the motility of naïve T cells in the
BM. We have found that T cells move approximately twice as fast as B cells in the
BM, similarly to their motolity in the LNs [122]. These results suggest that
differences in cell motility are intrinsic to the type of lymphocyte and do not depend
on the specific microenvironment in the organ. The similarities in lymphocyte
behavior in BM and LNs also argue for possible shared functional features in both
organs.
A microenvironment for efficient induction of a primary immune response requires an
architecture facilitating homing of naïve T cells to areas of antigen presentation,
thereby allowing efficient scanning of peptide-MHC complexes on DCs by T cells.
These conditions seem to be met in the parenchyma of mouse BM, which contains
both T lymphocytes and DCs. Indeed, Feuerer et al. showed that CD8 + T cells bearing
a specific TCR can be activated and proliferate in the BM by administration of its
cognate antigen into the circulation [76]. In addition, central memory T cells can be
activated in the BM by blood-borne DCs [54]. In another study, mature recirculating
B cells in the BM were demonstrated to be activated by Salmonella typhimurium to
generate short-lived plasma cells [55]. These results show that B cells can be activated
in the BM in response to blood-borne microbes. We, therefore, decided to further
investigate these findings and focused on primary T-cell responses to blood-borne
antigens. We aimed at examining whether naïve T cells can respond to blood-borne
antigens presented by DCs in the BM. To address this question, we transferred OT-I
cells to mice expressing green fluorescent DCs in the BM. After T cell homing to the
BM, we imaged the mice in areas rich in DCs and T cells (BM immune niches).
During the imaging session, TCR-specific peptide was administered and an almost
immediate arrest of T cells was observed. This T cell arrest was not restricted only to
the immediate vicinity of DCs, since most BM cells expresses cognate MHC-
55

molecules, therefore the injected peptide can bind to any cell in the BM and
consequently T cells stop immediately on a cell that bound the peptide in their
vicinity. To circumvent this obstacle, we took advantage of the ability of DCs to
cross-present extracellular antigens to CD8 + T cells. Intravital imaging of the BM
after injecting a specific protein revealed clusters of specific T cells in areas enriched
with DCs, whereas polyclonal T cells continued to migrate in chaotic and random
fashion. We have confirmed that the change in T cell dynamics (arrest) was indeed
accompanied by cell activation as CD69 was upregulated in the BM, even to greater
extent than in the spleen, during antigenic challenge. During steady-state, naïve
lymphocytes continually enter and exit lymphoid organs in a recirculation process that
is essential for immune surveillance. In contrast, during immune responses, the egress
process can be shut down transiently. When this occurs locally, it increases
lymphocyte numbers in the responding lymphoid organ [131]. Lymphocyte egress
requires sphingosine 1-phosphate receptor-1 (S1P1), whereas, CD69 negatively
regulates S1P1 and promotes lymphocyte retention in lymphoid organs [132].
Interestingly, the basal levels of CD69 in the BM were significantly higher than in
other organs, suggesting that BM CD8 + T cells are in an activated state, and they are
retained in the BM in order sample antigens and to respond in situ in case of antigen
stimulation.
To further establish if bmDCs are critical antigen-presenting cells that initiate BM T-
cell responses, we analyzed the responses of naïve CD8 + T cells to antigen challenge
in mice that were depleted of DCs. Surprisingly, ablation of bmDCs did not impair the
capacity of antigen-specific T cells to cluster. In support of previous reports [42,133],
we found that the capacity to prime CD8 + T cells in the spleen is uniquely restricted to
cDCs. Thus, in DC-depleted spleens, T cells neither upregulated CD69 expression and
proliferated, nor secreted IFN-γ. However, unexpectedly, in the BM of the same mice,
T cells showed prompt CD69 upregulation, in vivo proliferation after antigen
challenge and IFN-γ production.
Lymphoid organs have a highly organized and complex architecture composed of
distinct cellular compartments, at heart of which is a nonhematopoietic cell backbone
[134]. In the LNs, nonhematopoietic microanatomy actively organizes the cellular
encounters by providing preformed migration tracks that create dynamic, but highly
ordered movement patterns [135]. Although it is established that the main function of
56

the stroma is to orchestrate cell migration within lymphoid organs, recently it has
been shown that stromal cells can cross-present tumor-associated antigens to CD8 +
cytotoxic T lymphocytes that mediate tumor rejection [136]. Studies of the BM
chimera approach, allowed us to address the question which cells activate and prime
naïve CD8 + T cells in DC-ablated BM niches. Chimeras, in which H-2K b -deficient
recipients were reconstituted with Cx3cr1 gfp/+ BM, the MHC class I-deprived stroma
was incapable of sustaining primary CD8 + T-cell response. These data suggest a
novel unique role of nonhematopoietic cells in the BM, although a more detailed
study is required to elucidate the nature of these cells.
Collectively, our data suggest that BM is unique among lymphoid organs in
performing primary and secondary immune functions. It contains a microenvironment
that interacts with naïve, circulating antigen-specific T cells in absence of antigenpresenting
DCs and leads to induction of primary CD8 + T-cell responses.
57

Movies are added on disk
Movie 1
Two-photon imaging of CMTMR-labeled wild type CD4 + and CD8 + T cells (yellow) and CFP + B cells
(blue) transferred into Cx3cr1 gfp/+ mice (bmDCs – green), blood vessels are stained with Quantum
dots (red).
Movie 2
Two-photon imaging of CMTMR-labeled wild type CD8 + T cells (yellow) and CFP + B cells (blue)
transferred into Cx3cr1 gfp/+ mice (bmDCs – green), blood vessels are stained with Quantum dots (red).
Movie 3
Two-photon imaging of CMTMR-labeled wild type T cells (yellow) transferred into Cx3cr1 gfp/+ mice
(bmDCs – green), before and after i.v. injection of 0.5 mg OVA peptide and FITC-dextran. Note that
BM microvasculature, before the immunization, was delineated by Quantum dots (red) and upon
immunization by FITC-dextran it became green.
Movie 4
Two-photon imaging of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T cells (blue)
transferred into Cx3cr1 gfp/+ mice (bmDCs - green) that was 24 h prior to transfer immunized with
0.5mg OVA. T cells were analyzed 4 h after transfer. BM microvasculature was delineated by
Quantum dots (red).
Movie 5
Two-photon imaging of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T cells (blue)
transferred into CD11c-DTRtg Cx3cr1 gfp/+ double transgenic mice that were untreated or injected with
DTx twice, 24 h and 3 h prior to the transfer. Then, 6 h after the first DTx injection, recipient mice
were immunized with 0.5mg OVA. Note that after DTx treatment, monocytes (green, round-shape)
define the BM niche in absence of DCs (green, spindle-shape).
Movie 6
Two-photon imaging of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T cells (blue)
transferred into CD11c-DTRtg Cx3cr1 gfp/+ double transgenic mice that were untreated or injected with
DTx twice, 24 h and 3 h prior to the transfer. Then, 6 h after the first DTx injection, recipient mice
were immunized with 0.5mg OVA. Note that after DTx treatment, monocytes (green, round-shape)
define the BM niche in absence of DCs (green, spindle-shape).
Movie 7
Two-photon imaging of CMTMR-labeled OT-I T cells (yellow) and CFP + polyclonal T cells (blue)
transferred into [CD11c-DTRtg Cx3cr1 gfp/+ > H-2K b - / - ] chimeras that were 24 h prior to transfer
immunized with 0.5mg OVA. T cells were analyzed 4 h after transfer. BM microvasculature was
delineated by Quantum dots (red).
58

4. Organ-dependent in vivo priming of naïve CD4 + , but not
CD8 + T cells by plasmacytoid dendritic cells
4.1 Introduction
T lymphocytes respond to antigenic peptides presented on major MHC molecules.
Cytotoxic CD8 + T cells recognize peptides in the context of MHC class I, whereas
CD4 + helper T cells recognize peptides in complex with MHC class II. Naïve T cell
activation is restricted to secondary lymphoid organs, such as the spleen and LNs, and
thought to rely on specialized APCs comprising B cells, macrophages and DCs. The
APC composition of lymphoid organs likely encodes a potential to initiate distinct T
cell responses. However, the differential contribution of APC to in vivo immune
responses remains poorly understood.
Natural IFN-producing cells (IPCs) are a unique subset of hematopoetic cells that play
a critical role in the innate and adaptive immune defense against infections [3].
Viruses (or unmethylated CpG DNA) engage Toll-like-receptors (TLR) 7 and TLR 9
on IPC [25] and trigger secretion of massive amounts of type I interferons (IFN-α, -β,
-ω and -λ) [137]. This specialization of IPCs in cytokine production is reflected in
their distinct "plasmacytoid" morphology resembling Ig-secreting plasma cells [138].
IPC-derived cytokines are critical for the initiation of early anti-viral NK cell
responses [139,140]. In addition, IPC-derived type I IFNs boost the ability of cDCs to
mature and stimulate T cells, thus promoting antiviral CTL responses [141,142].
Furthermore, IPCs provide a critical costimulatory signal for the CpG-induced
activation of cDCs [143,144]. Independent of their cytokine- and CD40L-mediated
accessory function to control NK and cDC activities, IPCs have also been proposed to
play a direct role as APC in the onset of T cell stimulation. Constitutive presence of
IPCs in lymphoid organs, their expression of MHC molecules and acquisition of DC
morphology upon culture has led to the concept that IPCs represent a distinct DC
subset, as so-called plasmacytoid DCs (PDCs). However, the original discovery of
DCs defined them by the capacity to prime naïve T cells [80] and this activity has
remained their hallmark since. Moreover, recent in vivo DC depletion experiments
indicate that CD11c high cDCs are required to initiate cytotoxic CD8 + T cell responses
against intracellular pathogens [42,145]. The potential of IPC/PDCs to prime naïve T
cells remains however controversial. Freshly isolated PDCs are generally poor T cell
stimulators. Thus, human blood-derived PDCs do not stimulate naïve CD4 + T cells in
59

a MLR, unless cultured in the presence of IL-3 or virus (HSV) [146]. Moreover,
murine splenic PDCs fail to induce naïve T cell proliferation to endogenous antigens
even after virus exposure [147]. In contrast, murine peptide-pulsed PDCs derived
from Flt-3-driven BM cultures or spleens can promote the in vitro expansion of CD4 +
T cells and T H polarization [148]. Adoptive transfer experiments with splenic and BM
culture-derived, CpG-matured PDCs showed that PDCs can elicit responses of naïve
CD8 + T cells to endogenous, but not exogenous antigens [149]. These conflicting
results are likely due to the different source of the PDCs used in the reports.
Moreover, none of the studies addressed the in vivo potential of un-manipulated PDCs
to prime naïve T cells.
Recently, IPC/PDCs have been shown to play a critical role in the control of airway
inflammation [36,150] and allo-transplant rejection 151,152]. Although these findings
mark PDCs as potential candidates for future adoptive cell therapies, such approaches
will require better understanding of the in vivo characteristics of this unique cell type.
Here we analyze CD4 + and CD8 + T cell responses to antigen challenge in mice that
were conditionally depleted of CD11c high cDCs, but retain IPC/PDCs. We show that
depletion of cDCs impairs splenic T cell responses, indicating that PDCs are
incapable of T cell priming in this organ. In contrast, the combined use of cDC
ablation and a novel PDC-specific antigen targeting strategy revealed that in LNs,
PDCs can efficiently trigger productive naïve CD4 + T cell responses. Interestingly,
and in contrast cDC-driven responses, the PDC-triggered CD4 + T cell stimulations
lack a concomitant CD8 + T cell expansion. Our in vivo results, thus, characterize
PDCs as bona fide DCs that can initiate unique CD4 + Th cell-dominated primary
immune responses.
4.2 Results
4.2.1 PDCs are spared from ablation in DTx-treated CD11c-DTR transgenic
mice
To investigate differential in vivo functions of APC in lymphoid organs we recently
developed a DTR-based system that allows the conditional ablation of CD11c high
cDCs (12). DTR expression in CD11c-DTR transgenic mice is driven by a DNA
fragment flanking the Itgax gene [153], which encodes the α X subunit of the CD11c
integrin. Murine CD11c expression is found in all cDCs, but has also been reported
60

for certain macrophages [154,155,156], activated T cells [157], NK cells [158] and
plasmablasts [87].
Murine PDCs are defined as being CD11c low B220 + Ly6C + and can furthermore be
identified by the PDC-specific antibodies 120G8 [12], 440c [159] and mPDCA-1
[160]. To test the DTx-sensitivity of CD11c-DTRtg CD11c low PDCs, we injected
CD11c-DTRtg C57BL/6 mice with DTx. Flow cytometry of the spleens one day after
DTx treatment revealed that PDCs were spared from DTx-induced ablation, whereas
cDCs were depleted (Fig. 17A). The DTx resistance of PDCs is explained by fact that
the Itgax promoter fragment does not carry all transcription control elements required
for CD11c expression in all the cells where it is active. Thus, this DNA fragment is
inactive in PDCs that transcribe their endogenous Itgax allele. DTx resistance was
also confirmed for LN PDCs (Fig. 17C,D; Fig. 19A).
To investigate whether the toxin treatment results in a functional impairment of PDCs
we tested type I interferon responses. As seen in Fig. 17E, DTx treatment neither
affected the IFN-α response to in vivo CpG treatment nor compromised the ability of
PDCs to produce IFN-α in response to an in vitro influenza virus challenge. Of note,
we consistently observed in spleens, but not LNs of CD11c-DTRtg C57BL/6 mice a
small fraction of mPDCA-1 + CD11c low cells that were DTR-GFP + and DTx
sensitive(Fig. 17B,D) Collectivelly, these results indicate that PDCs of CD11c-DTR
transgenic mice are resistant to DTx treatment. CD11c-DTRtg mice, thus, provide a
unique model to study the role of PDCs in the priming of immune responses in the
absence of conventional CD11c high DCs.
61

Figure 17. PDCs are spared from ablation in DTx-treated CD11c-DTRtg mice
(A) Flow cytometry of the spleens of untreated controls and CD11c-DTRtg mice 1 d after i.v. injection
of DTx (4 ng/body weight). cDCs are gated as CD11c high mPDCA-1 neg cells; PDCs are defined as being
CD11c int mPDCA-1 + . Bar diagram represents analysis of splenic cDCs and PDCs of untreated mice
and mice 24 h after treatment (i.p. DTx ; 10 μg OVA i.v.). (each group n=5). Dot blots show cells
gated according to scatter.
(B) DTR-GFP expression profiles of splenic cDCs and PDCs isolated from CD11c-DTRtg mice
untreated or treated with DTx. Cells are defined and gated as in A. Graphs are representative of five
repeats. Percentage refers to DTx-sensitive GFP + mPDCA-1 + CD11c low cells (filled area).
(C) Flow cytometry of popliteal LNs of control mice CD11c-DTRtg mice 1 d after s.c. injection of 20
ng DTx into the hind footpads. Bar diagram represents analysis of splenic cDCs and PDCs of untreated
mice and mice 24 h upon indicated treatment (i.p. DTx ; 10 μg OVA i.v.). (each group n=5). Dot blots
show cells gated according to scatter.
(D) DTR-GFP expression profiles of LN PDCs isolated from untreated or treated CD11c-DTRtg mice.
Note absence of GFP + mPDCA-1 + CD11c low subpopulation observed in spleen (B).
(E) IFN-α production by splenic PDC and non-PDC cell fractions isolated from noninjected or DTxinjected
CD11c-DTRtg mice and incubated in vitro for 20 h in the presence or absence of 400 HAU/
ml influenza virus and blood sera analysis of DTx-treated and untreated CD11c-DTRtg mice, 6 h after
PBS or 100 μg CpG i.v. injection. Error bars depicts the s.d.
(F) Immunohistochemistry of popliteal LN from wt mouse, untreated CD11c-DTRtg mouse and
CD11c-DTRtg mouse, 1 d after footpad injection of 20 ng DTx. Sections are stained with anti-GFP
antibody (brown). Scale bar refers to 100 μm.
(G) Flow cytometry of CD8 - and CD8 + cDC subsets in popliteal LNs, 1 d after footpad injection of 20
ng DTx. Dot plots were gated according to the scatter and exclude B220 + cells.
4.2.2 PDCs fail to prime naïve T cells in the spleen
We first investigated the potential of splenic PDCs to stimulate naïve T cells in the
absence of CD11c high cDCs. We isolated TCR transgenic Ovalbumin (OVA)-specific
CD8 + and CD4 + T cells from OT-I and OT-II mice, respectively [161,162]. Donor
mice carried an allotypic marker (CD45.1) that allowed for detection of the
transferred cells in the recipient mice. Prior to transfer, the T cells were labeled with
63

the intracellular dye CFSE, which allows the monitoring of in vivo proliferation [163].
T cells were cotransferred into wt and CD11c-DTRtg C57BL/6 mice. The grafted
mice were treated with DTx and eight hours later immunized by intravenous (i.v)
injection of soluble OVA (10μg) or OVA-loaded splenocytes [8]. Four days after
immunization, the mice were sacrificed, spleens were isolated and analyzed for the
proliferation status of the T cell grafts (Fig. 18). All challenges resulted in vigorous
expansion of both CD4 + and CD8 + T cell grafts in the wt recipient mice. As
previously reported [42], depletion of CD11c high cDCs impaired the response of CD8 +
T cells to cell-associated antigen. Presentation of antigen in the context of MHC class
I to CD8 + T cells requires a unique phagosome-to-cytosol pathway resulting in crosspresentation,
which is an activity proposed to be uniquely associated with cDCs or
cDC subsets [8,42,127]. In support of this notion, we found that cDCs were also
needed for CD8 + T cell priming after challenge with exogenous soluble antigen (Fig.
18). Moreover, depletion of splenic cDCs also abrogated OVA-specific CD4 + T cell
responses to cell-associated and soluble antigen, thus extending the study by Tian et
al. [133]. Importantly, as opposed to a recent report [164], we evaluated the T cell
priming potential of PDCs in the absence of cDCs. Taken together, splenic PDCs are
unable to prime naïve CD4 + and CD8 + T cells in absence of CD11c high cDCs.
64

Figure 18. cDC ablation impairs splenic CD4 + and CD8 + T cell priming
Flow cytometry of cotransferred CFSE-labeled CD45.1 + OT-I and OT-II T cell grafts (10 6 cells each)
in DTx-treated nontransgenic and CD11c-DTRtg mice (CD45.2), 4 d after i.v. immunization with
OVA-loaded splenocytes or soluble OVA. Histograms represent cells gated according to scatter,
CD45.1 and CD8 or CD4 surface expression, as indicated in the dot plots. Data show results of one
representative experiment out of three.
4.2.3 PDCs can prime naïve CD4 + T cells in LNs, but fail to support CD8 + T cell
priming
T cell responses are initiated in specialized secondary lymphoid organs, such as the
spleen and LNs, which differ considerably in their micro-architecture reflecting their
specialization for the handling of blood- and tissue-borne antigens, respectively. We
next investigated whether CD11c high DCs would also be required in the LNs. Local,
subcutaneous (s.c.) DTx injection results in the rapid depletion of LN-resident cells
expressing the DTR-GFP fusion protein, including both CD8α + and CD8α - CD11c high
cDCs and sinusoidal macrophages [154], but not PDCs (Fig. 17C,F,G; Fig 19A).
Repetitive s.c. DTx injection results in persistent cDC ablation (Fig. 19A; Fig. 20A).
To investigate the impact of the LN cDC depletion on T cell responses in this organ,
we engrafted wt and CD11c-DTRtg C57BL/6 recipient mice with a mixture of OVAspecific
CD4 + (OT-II) and CD8 + T cells (OT-I). The mice were subjected to the DTx
65

treatment (which was continued throughout the experiment to maintain cDC depletion
(Fig. 19A)) and eight hours later immunized by s.c. injection of 10μg OVA. Three
days after immunization, we isolated the antigen-draining popliteal LNs and analyzed
them for the proliferation status of grafted T cells. The adoptively cotransferred
CD45.1 + CD4 + and CD8 + T cells readily proliferated in the LNs of DTx-treated wt
mice in response to immunization with soluble OVA (Fig. 19B). Importantly, the
DTx-induced cDC depletion abrogated the expansion of CD8 + T cells indicating that,
as in the spleen, priming of naïve CD8 + T cells required the presence of cDCs.
Surprisingly, however, we observed a proliferative response of the grafted CD4 + T
cells in the cDC-depleted LNs (Fig. 19B). Importantly, this was unlikely to be caused
due to residual cDCs, since the DTx treatment impaired in the same LNs the CD8 + T
cell response, which is generally more sensitive to antigen challenge [165]. The
persistence of the CD4 + T cell priming in absence of cDCs was also observed in
CD11c-DTRtg BALB/c mice, in combination with an OVA-specific TCR transgenic
naïve CD4 + T cell graft isolated from DO11.10 mice [166] (Fig. 21). Moreover, to
confirm our observation in a non-TCR transgenic system and with an antigen other
than OVA, we challenged untreated and cDC-depleted DTRtg mice with KLH/ CpG
and analyzed the resulting response of endogenous CD4 + T cells. On day 7 after s.c.
antigen challenge, we purified CD4 + T cells from popliteal LNs and subjected them to
an in vitro restimulation protocol with KLH-pulsed APC. Again, CD4 + T cells were
efficiently primed irrespective of the presence of cDCs (Fig. 20).
66

Figure 19. Ablation of cDCs impairs CD8 + T cell priming, but not CD4 + T cell priming in the LNs
(A) Flow cytometry of the popliteal LNs of CD11c-DTRtg mice during the course of priming
experiment. Mice were injected twice with DTx into the hind footpads, on day 1 and 3. The line graph
represents the analysis of LN cDCs and PDCs as indicated in the FACS blots (each group n=3). The
bottom schedule refers to T cell priming experiments performed in B.
(B) Flow cytometry of cotransferred CFSE-labeled CD45.1 + OT-I and OT-II cells (bottom row: OT-II
transfer only) into DTx-treated nontransgenic and CD11c-DTRtg mice (CD45.2 + ), 4 d after s.c.
immunization with soluble OVA. Histograms represent cells gated according to scatter, CD45.1 and
67

CD8 or CD4 expression, as indicated in the dot plots. Data show results of two representative
experiments out of ten repeats. Graph summarizes percentages of dividing CFSE-labeled CD45.1 + OT-
II cells in mice (n=14) that were treated with DTx and immunized, compared with proliferation in
immunized wt control mice (n=8) (set as 100%). Each dot represents an independent mouse.
Figure 20. Priming of endogenous, nontransgenic CD4 + T cells in the LNs of cDC-depleted mice
(FVB/N background)
(A) Dynamics of CD11c high cDC and CD4 + T cell (B) numbers throughout course of experiment
involving KLH/CpG immunization (d1) and daily s.c. injections of DTx (10ng/ footpad). Both FVB/N
and CD11c-DTRtg FVB/N mice were treated with DTx.
(C) In vitro restimulation assay of MACS-enriched CD4 + T cells with KLH-pulsed, irradiated FVB/N
splenocytes. T cell proliferation was assessed by addition of 1 μCi of [H 3 ] thymidine, 72 h after coculture
of T cells and splenocytes and measured 8 h later. Note that increase in proliferation observed
in absence of cDCs is likely due to absence of recruitment of bystander T cells to the LNs [189].
68

Figure 21. CD4 + T lymphocyte priming in the LNs of cDC-depleted BALB/c mice
(A) Flow cytometry of adoptively transferred CFSE-labeled OVA specific CD4 + T cells (DO11.10).
Cells were transferred into nontransgenic and CD11c-DTRtg BALB/c mice, that were subsequently
treated with DTx and immunized by s.c. injection with soluble OVA (10mg/ footpad). Histograms
represent CFSE profiles of cells gated according to expression of the TCR clonotype (KJ126) and CD4.
Data show one representative experiment out of three.
(B) Priming of CD4 + T cells (DO11.10) by OVA-pulsed PDC in vitro. T cells (1 x 10 5 ) were cocultured
with OVA-pulsed cDCs or PDCs (2 x 10 4 ) isolated from LNs of naïve BALB/c mice. The
positive PDC fraction, which was obtained by high-speed sorting according to CD11c and mPDCA-1
expression contained no contaminating CD11c high cDCs. Proliferation was assessed by addition of 1
μCi of [H 3 ] thymidine, after 72 h and measured 8 h later.
Our data show that LNs contain APC other than CD11c high DCs or macrophages. that
are capable of stimulating naïve CD4 + T cells. Although PDCs are potential
candidates, other MHC class II + cells could be responsible for the CD4 + T cell
priming. By far, the largest MHC class II + population in the LNs are B lymphocytes,
which, even when naïve, have been shown to efficiently ingest and process
noncognate protein antigens [167]. However, the ability of B cells to activate naïve
CD4 + T cells remains under debate [168,169,170]. Moreover, pMHC encounter on B
cells is believed to result in non-productive T cell priming or tolerization [171]. To
investigate the role of B cells in our system, we crossed the CD11c-DTR transgene
onto a B cell-deficient genetic background (C57BL/10-Igh-6tm1Cgn (μMT) [172].
CD11c-DTRtg μMT and μMT C57BL/6 mice were engrafted with OVA-specific
CD4 + T cells (OT-II) and subjected to the DTx treatment and OVA immunization. B
cell deficiency resulted in a reduced recovery of grafted CD4 + T cells in DTx-treated
69

CD11c-DTRtg μMT and μMT C57BL/6 mice. However, the frequency of OT-II cells
that lost the CFSE-label and thus proliferated in response to the OVA challenge was
unaffected by the absence of B cells (Fig. 22A,B). CD4 + T cell priming in the LNs,
thus, persisted in the combined in absence of B cells and CD11c high cDCs. Another
potential APC candidate are epidermal Langerhans cells (LCs), which are CD11c neg ,
but up-regulate CD11c expression upon migration to the skin draining LNs [4]. LCs
would, hence, be expected to become DTx-sensitive by the time they reach the LNs.
To nevertheless exclude the possibility that the CD4 + T cell response we observed
was due to residual LCs, we crossed the CD11c-DTRtg mice to mice that harbor the
DTR gene under the LC-specific Langerin promoter [173]. DTx-treatment of CD11c-
DTRtg LanDTRtg mice results in ablation of cDCs and LCs (data not shown).
However, the response of the adoptively transferred OT-II CD4 + T cells to the OVA
challenge persisted (Fig. 22C). Collectively, these data suggest that cells other than
cDCs, macrophages, B cells or LCs are responsible for the priming of CD4 + T cells
and point at a role of PDCs in antigen presentation.
70

Figure 22. LN CD4 + T cell priming in combined absence of cDCs and B cells, as well as cDCs and
Langerhans cells
(A) Flow cytometry of cDC depletion in popliteal LNs of CD11c-DTRtg μMT mice before and 1 d
after footpad injection of 20 ng DTx.
(B) CD4 + T cell priming in popliteal LNs persists in combined absence of B cells and CD11c high cDCs.
Flow cytometry of transferred CFSE-labeled CD45.1 OT-II cells in DTx treated wt, μMT, CD11c-
DTRtg and CD11c-DTRtg μMT mice (CD45.2), 4 d after s.c. footpad immunization with 10 μg soluble
OVA. Histograms represent CFSE profiles of cells gated according to CD45.1 and CD4 expression.
Data show one representative experiment out of three.
(C) CD4 + T cell priming persists in combined absence of Langerhans cells and CD11c high cDCs. Flow
cytometry of transferred CFSE-labeled CD45.1 OT-II cells after transfer in DTx treated CD11c-DTRtg
and CD11c-DTRtg Lan-DTRtg mice (CD45.2), 4 d after s.c. footpad immunization with 10 μg soluble
OVA. Histograms represent CFSE profiles of cells gated according to CD45.1 and CD4 expression.
71

4.2.4 LN PDCs efficiently acquire and process soluble antigen and prime
productive T cell responses
Antigen presentation and CD4 + T cell priming by LN-resident PDCs would require
their antigen uptake. Importantly, soluble antigens of low molecular weight (

Proliferative T cell expansion can be associated with the generation of cytokineproducing
effector T cells, but also abortive T cell responses [176,177,178]. We
therefore investigated the quality of the primed LN CD4 + T cells by studying (Th) cell
polarization and long-term T cell survival. To analyze Th polarization of the grafted
OVA-specific CD4 + T cells, we performed an in vivo restimulation assay by
rechallenging the OVA-immunized mice with an i.v. injection of OVA peptide [126].
Both in presence and absence of CD11c high cDCs, CD4 + T cells differentiated
efficiently into IFN-γ-producing effector T cells (Fig. 24A). Abortive T cell
stimulation is characterized by a collapse of the antigen-specific T cell population
after its initial expansion [176,177]. To test the persistence of CD4 + T cells that were
primed in absence of cDCs we used mixed CD11c-DTRtg BM chimeras, which allow
for repetitive DTx treatment and hence extended cDC depletion [85]. In both
untreated and cDC-depleted mice, the OT-II CD4 + T cell graft clonally expanded and
persisted well beyond the initial antigen challenge (Fig. 24B). Furthermore, in
presence and absence of cDCs the grafted naïve CD4 + T cells differentiated into T
cells of CD45RB low memory phenotype [179].Taken together, PDCs seem capable of
stimulating naïve CD4 + T cells, resulting in a persistent response including IFN-γproducing
effector T cells of memory phenotype. Importantly, and in contrast to the
immune reaction triggered by cDCs, this response is not accompanied by a
concomitant CD8 + T cell response.
73

Figure 24. CD4 + T cells that are primed in absence of cDCs differentiate into T effector cells with
memory phenotype and persist for extended periods of time
(A) CFSE-labeled CD45.1 + OT-II cells were transferred into nontransgenic and CD11c-DTRtg mice
(CD45.2 + ). 1 d later, mice were treated s.c. with DTx and 8 h later, they were immunized in hind
footpads with OVA and CpG. 3 d after immunization, INF-γ production in the popliteal LNs was
assessed after in vivo restimulation with OVA peptide, 2 h before removal of popliteal LNs. Data
represent INF-γ profiles after gating on CD4 + CD45.1 + lymphocytes. Results are representative of two
independent experiments.
(B) CFSE-labeled CD45.1 + OT-II cells were transferred into mixed [wt>wt] or [CD11c-DTRtg>wt]
BM chimeras (CD45.2 + ). The mice were injected s.c. with DTx 1 d after the transfer and were
immunized 8 h later with OVA into hind footpads. Sequential s.c. DTx injections were performed
every second day until day 21. Blood was collected on days 4, 11 and 21 and evaluated for presence of
OT-II cells (CD4 + CD45.1 + ), and expression of the memory T cell marker CD45RB. Bar graph depicts
mean fluorescence intensity (MFI) values of blood staining for CD45RB on day 4, 11 and 21. Results
are representative of two independent experiments.
4.2.5 PDC-specific antigen targeting and PDC-mediated in vivo and in vitro CD4 +
T cell priming
The above results suggest that LN PDCs efficiently ingest exogenous antigen and are
able to initiate productive CD4 + T cell responses. To obtain independent evidence that
PDCs can act as APC, we decided to adopt a strategy involving specific, antibodymediated
antigen targeting to APC [176] and conjugate the PDC-specific mPDCA-1
antibody to OVA. To avoid complement-dependent lysis [160], we used a nondepleting
F(ab') 2 fragment. Functional integrity of the construct was tested by
Western blotting. As depicted in Fig. 25A, the conjugates were readily detected both
74

via the kappa light chain and the OVA-fraction, whereas free OVA or unconjugated
mPDCA-1-F(ab’) 2 fragments were only detected with the anti-rat IgG or the anti-
OVA antibody, respectively. The OVA-conjugated antibody fragment specifically
targeted PDCs in splenic or LN single cell suspensions in vitro (data not shown). To
demonstrate in vivo specificity, we took advantage of a FITC-conjugate of the
mPDCA-1-F(ab’) 2 -OVA construct. Intravenous or s.c. injection of FITC-mPDCA-1-
F(ab’) 2 -OVA resulted in specific labeling of CD11c low PDCs in spleens and LNs and
spared CD11c high cDCs (Fig. 25B).
Figure 25. Characterization of selective APC targeting via the anti-mPDCA-1-F(ab’) 2 -OVA construct
(A) Western blot analysis of the OVA-conjugated antibody construct. Free OVA, unconjugated or OVAconjugated
anti-mPDCA-1 antibody constructs were resolved by SDS-PAGE (4-12% gradient Tris-glycine
gel) and after immunoblotting detected with anti-rat and anti-OVA antibody, respectively. Lanes 1 and 5
contain free OVA, lane 2 and 6 contain the unconjugated anti-mPDCA-1 F(ab’) 2 antibody fragment, and
lanes 3, 4 and 7, 8 contain two fractions of the anti-mPDCA-1-F(ab’) 2 -OVA conjugate.
(B) Specific in vivo targeting of PDCs with FITC-labeled anti-mPDCA-1-F(ab’) 2 -OVA. Conjugates
were injected i.v. or s.c. and after 3 h spleens and popliteal and inguinal LNs were isolated.
Counterstaining with CD11c was performed on single cell preparations from untreated (left dot plots)
or in vivo targeted cells (middle and right dot plots). Note that the staining in the FL-1 channel is based
on the in vivo injected FITC-coupled mPDCA-1-F(ab’) 2 -OVA construct.
To direct the OVA antigen to both PDCs and cDCs we used the mPDCA-1-F(ab’) 2 -
OVA conjugate (mPDCA-1-OVA) and an OVA conjugate that targets a subset of
CD11c high cDCs via the CD205 receptor (DEC205-OVA) [176,180]. We first
investigated the response of OVA-specific CD8 + T cells (OT-I) to the conjugate
challenge. As seen in Fig. 26A, s.c. immunization of untreated CD11c-DTRtg mice
with the mPDCA-1-OVA and DEC205-OVA conjugates resulted in comparable
responses of the naïve CD8 + T cells in the draining popliteal LNs. Importantly,
depletion of cDCs abrogated both the DEC205-OVA and the mPDCA-1-OVA-
75

induced CD8 + T cell expansion. Thus, The cDC-driven CD8 + T cell response to the
mPDCA-1-OVA conjugate was likely due to antibody-independent antigen uptake by
cDCs or secondary cross-presentation of cellular PDC debris by cDCs. Conventional
DC ablation thus revealed that, in contrast to a recent study [164], even when directly
targeted with exogenous antigen, PDCs seem unable to trigger CD8 + T cell responses.
Instead, our results support the notion of the general inability of PDCs to channel
exogenous antigen into the MHC class I presentation pathway and cross-present
[149].
Next we analyzed the response of OVA-specific LN CD4 + T cells (OT-II) to
conjugate challenge. Like the immunization with OVA, challenge of untreated
CD11c-DTRtg mice with the antibody-conjugates resulted in vigorous expansion of
the CD4 + T cell grafts. In contrast to the CD8 + T cell responses and confirming our
previous results (Fig. 19), the CD4 + T cell responses to the OVA and mPDCA-1-
F(ab’) 2 -OVA challenge resisted the DTx treatment in CD11c-DTRtg mice (Fig. 26B).
Importantly, however, the CD4 + T cell response to the DEC205-OVA challenge was
impaired by depletion of CD11c high cDCs. These results provide further evidence that
the CD4 + T cell response we observe in the absence of CD11c high cDCs is driven by
PDCs. Notably, the antibodies to DEC205 and mPDCA-1 target distinct surface
receptors [14,181], which likely differ in their potential to promote endocytosis. This
precludes any quantitative conclusion on the priming potential of cDCs vs. PDCs.
76

Figure 26. In vivo antigen targeting of PDCs leads to priming of LN CD4 + T cells, but not CD8 + T
cells in absence of cDCs
(A) Flow cytometry of transferred CFSE-labeled CD45.1 + OT-I cells into s.c. DTx treated CD11c-
DTRtg mice (CD45.2), 4 d after footpad immunization with 8 μg mPDCA-1-OVA (OVA content ~
7.5%) or 7 ng DEC205-OVA (OVA content ~10%). Histograms represent CFSE profiles of cells gated
according to CD45.1 and CD8 expression, as indicated in the dot plot. Data show a representative
result out of three experiments.
(B) Flow cytometry of transferred CFSE-labeled CD45.1 + OT-II cells into DTx treated CD11c-DTRtg,
4 d after footpad immunization with F(ab) 2 , OVA, control F(ab) 2 -OVA, mPDCA-1- F(ab) 2 -OVA or
DEC20-OVA. Histograms represent CFSE profiles of cells gated according to CD45.1 and CD4
expression, as indicated in the dot plot. Data show one representative experiment out of three.
To obtain final proof for the CD4 + T cell priming potential of PDCs we decided to
employ an antibody-mediated depletion protocol to test T cell responses in the
combined absence of both cDCs and PDCs. However, in our hands, even repetitive
injection of mPDCA-1 and anti-Gr1 antibodies [36,160] resulted in incomplete LN
PDC depletion (data not shown). Therefore, we resorted to an in vivo loading / in vitro
read-out system. Wt BALB/c mice were immunized with OVA or mPDCA-1-OVA.
One day later, PDCs, cDCs and B cells were isolated from LNs and spleens, sorted to
purity and tested in vitro for their ability to prime naïve OVA-specific CD4 + T cells
(DO11.10). As seen in Fig. 27, cDCs isolated from LNs or spleens of OVAimmunized
mice readily stimulated T cell proliferation, whereas cDCs and B cells
isolated from mPDCA-1-OVA immunized mice failed to do so. This confirms the
specificity of the in vivo antigen targeting strategy (Fig. 25B). Importantly, PDCs
77

isolated from LNs of mice immunized with both OVA and mPDCA-1-OVA were able
to stimulate the naïve CD4 + T cells. Substantiating our in vivo data on the inability of
splenic PDCs to prime CD4 + T cells, also in the in vitro assay PDCs isolated from
spleens of immunized mice failed to stimulate the T cells. Collectively, our results
show that LN PDCs can initiate unique CD4 + T helper cell-dominated primary
immune responses.
Figure 27. In vivo antigen targeting of PDCs leads to LN PDC-mediated in vitro CD4 + T cell
proliferation
CD11c high cDCs, PDCs and B cells were sorted from spleens and LNs of BALB/c mice that were i.v. or
s.c. immunized with OVA or mPDCA-1-F(ab’) 2 -OVA, and cultured with OVA-specific CD4 + T cells
(DO11.10) for 72 h, after which thymidine incorporation was measured. Results are plotted as the
mean of cpm from triplicate cultures with cells isolated from immunized mice minus the mean cpm of
cultures of the respective cell populations isolated from unimmunized mice. The positive fraction of
PDCs contained less than 0.01% contaminating CD11c high cDCs. Note CD4 + T cell priming by LN
PDCs isolated from OVA and PDCA-OVA immunized mice. (Each group n=4). Error bars represent
s.d. Controls include responder T cells only and DO11.10 T cells with B cells isolated from PDCA-
OVA immunized mice.
78

4.3 Discussion
Here we analyzed the responses of naïve CD4 + and CD8 + T cells to antigen challenge
in mice that were depleted of conventional CD11c high DCs, but retain PDCs. In
support of previous reports [42,133], we found that the capacity to prime naïve CD4 +
and CD8 + T cells in the spleen is uniquely restricted to cDCs. Ablation of cDCs,
however, revealed the surprising potential of PDCs to support CD4 + T cell responses
in the LNs. Importantly, PDCs differed from cDCs in that they could not induce CD8 +
T cell priming.
Naïve T cells are stimulated in lymphoid organs by specialized, professional APC that
induce clonal T cell expansion and differentiation. Efficient eradication of invading
microbes requires distinct immune responses, involving both cellular and humoral
defense mechanisms. Pathogen identification is believed to result from engagement of
pathogen sensors (such as TLRs), which are differentially expressed on APC and may
allow distinct APC subsets to trigger specific responses. Division of labor between
APC remains however poorly understood. This holds in particular for IPC/ PDCs,
which are critical for NK cells and cDC function, but whose in vivo capacity for
antigen presentation and T cell priming remains unclear. We reasoned that any
potential APC functions of PDCs might be masked by the presence of cDCs and thus
decided to test naïve T cell responses in mice that were conditionally depleted of
cDCs.
Surprisingly, PDCs could prime CD4 + T cells in the LNs, but not in cDC-depleted
spleens. It remains unclear whether this discrepancy results from the distinct organ
architecture or reflects an inherent difference between splenic and LN PDCs. In
support of the former, PDCs are in naïve mice located in the red pulp and T cell area,
but rarely in the marginal zone, which is the site of blood-borne antigen entry to the
spleen [182]. Moreover, when challenged splenic PDCs form clusters and, compared
with cDCs, show a delayed translocation to the T cell zone [182]. This migration
might be critical for the spleen, while it may not be required in the LNs. Recruitment
of PDCs to the LNs occurs via high endothelial venules (HEVs), and thus the cells
enter directly into the T cell area [183]. Even before antigen-carrying DCs arrive from
the periphery, resident LN APCs are known to take up soluble antigens [171], which
enter the deeper LNs through an intricate network of conduits [174]. Accessibility of
antigen to LN PDCs is also highlighted by the observation that these cells readily
79

ingested injected DQ-OVA (Fig 23), although, interestingly, we failed to label splenic
PDCs by intravenous DQ-OVA injection (data not shown). Alternatively, the unique
ability of LN PDCs to prime CD4 + T cells might indicate that these cells differ from
their splenic counterpart. Indeed, even when we targeted antigen directly to both LN
and spleen PDCs and overrode the need for translocation (by an in vitro read-out, Fig.
27), splenic PDCs failed to prime CD4 + T cells (Fig. 27). Interestingly, LN PDCs are
characterized by a distinct expression pattern of activation markers, such as Sca-1,
and are poor producers of IFN-α compared to Sca-1 + BM PDCs (J.A.A. Fischer and
A. Dzionek, unpublished observation). However, a more detailed comparative study
will be required to investigate qualitative differences between splenic and LN PDCs.
Importantly, the antigen challenge results in a rapid PDC influx to the LNs and in our
experimental set-up we do not discriminate between LN-resident and recruited PDCs.
Although we would like to stress that we do not want to compare the efficiency of
cDCs and PDCs in T cell priming potential, we establish that PDCs can prime naïve
CD4 + T cells. Absence of cDCs is arguably an artificial situation unlikely to occur
under physiological circumstances. However, we predict that pathogens that
specifically target or activate PDCs will elicit exclusive CD4 + T cell responses
supporting humoral, but not cytotoxic immunity. PDC-specific targeting could be
mediated by endocytic receptors, such as the Siglec-H [18,164], which are expressed
on murine PDCs, but not cDCs. So far, murine PDC-specific pathogen sensors have
not been reported, although PDCs are characterized by higher expression of TLR7
and TLR9 [184], which are also expressed by human PDCs, but absent from human
interstitial DCs [25,185]. The unique priming of CD4 + , but not CD8 + T cell responses
by PDCs could result from exclusive presentation of exogenous antigens on MHC II,
but not MHC I molecules. As suggested earlier [149], PDCs might lack the
phagosome-to-cytosol pathway required for cross-presentation. Importantly, this
would spare the priming PDCs from a unique negative-feedback mechanism, through
which CTLs kill APC and thereby terminate the priming process [186,187]. The
inability to cross-present would render PDCs resistant to the CTLs elicited by cDCs.
In the course of an ongoing response to a given antigen, the APC balance might
therefore be shifted from cDCs to PDCs and, as a result, priming of CD4 + T cells and
potentially humoral responses might be favored. As CD4 + T cells also critically
contribute to the development of CD8 + T cell memory [188], the APC function of
PDCs might have a general impact on the shape of immune responses.
80

We show that in LNs, PDCs efficiently trigger productive naïve CD4 + T cell
responses. Interestingly, and in contrast to cDC-triggered responses, PDC-triggered
CD4 + T cell responses are not associated with concomitant CD8 + T cell expansion.
Instead, PDCs initiate unique CD4 + Th cell-dominated primary immune responses.
81

5. Final Discussion
Dendritic cells (DCs) are part of the mononuclear phagocyte system and form a
complex body-wide network comprised of multiple subsets, currently largely defined
according to anatomic location and phenotype. The functionally definition of these
DC subsets and detection of potential task division within the DC compartment,
arguably requires the study of DCs in the in vivo context. In my PhD thesis I hence
took advantage of two recently established transgenic mouse systems that allow (1)
the visualization of DCs in physiological context and (2) the ablation of DCs from the
otherwise intact organism. Using these novel approaches I focused on the role of DCs
in the bone marrow and investigated the function of a unique population of DCs, the
plasmacytoid dendritic cells.
Characterization of BM-resident DCs: Flow cytometry analysis revealed the
existence of a defined population of CD11c hi , MHC-II + DC in the BM of
unchlallenged mice. BmDCs differ from splenic DCs in that they increased levels of
F4/80, Gr-1, CD103 and CD115, but also relatively high amounts of major MHC
class I and II, CD86, CD44 and CD40, suggesting that they have been activated.
Two-photon imaging of cranial BM in vivo revealed characteristic spindle-shaped
DCs in distinct perivascular clusters surrounding the distinct vascular sinuses.
However, notably, the two-photon imaging shows that bmDCs are generally not in
direct contact with the vessel walls. In this respect, it is interesting that Nagasawa and
colleagues have reported that most vascular sinuses are lined by a population of
reticular cells with abundant expression of the chemokine CXCL12, and is essential
for BM mature B cells. However, it remains to be shown whether these so-called
CAR cells exists in the BM immune niches [190].
Conditional ablation of CD11c high DCs resulted in a selectively loss of BM B cells.
The ablation of DCs did not substantially affect the numbers of developing pro-B
cells, pre-B cells or immature B cells in the BM, or the numbers of B cells in spleen
or LNs, demonstrating a specific role for DCs in the maintenance of recirculating
mature BM B cells. Two-photon imaging revealed that DCs in the niches organized in
situ together with adoptively transferred B and T cells, suggesting that direct
interactions between the DCs and B cells are required for maintaining mature B cells
in the BM. To understand how bmDCs maintain mature B cells in the BM we
adoptively transferred B cells overexpressing a Bcl-2 transgene into the CD11c-
82

DTRtg mice prior to DC ablation. The transferred Bcl-2 transgenic B cells were not
affected by DC ablation, demonstrating that bmDCs are not required for mature B
cells to home to BM, but more likely provide survival signals to B cells after they
arrive. Given the strong preference of mature splenic B cells for BAFF, BAFF was a
likely candidate for mediating survival of mature BM B cells. We tested this by
generating mixed BM chimeras using BAFF-deficient and CD11c-DTRtg BM, in
which treatment with DTx selectively ablated BAFF-expressing DCs, so the mice
contained only BAFF-deficient DCs. Surprisingly, BAFF expression by bmDCs was
not required to retain recirculating BM B cells. T cells were also seen in perivascular
niches with bmDCs and B cells; however, the DC ablation did not affect their
numbers, suggesting that bmDCs do not act via T cells to keep mature B cells in the
BM. Another survival factor, MIF, turned out to be the B cell rescuer. MIF is a
chemokine that activates phosphatidylinositol-3-OH kinase-Akt signaling pathways
and induces anti-apoptotic signals via binding CD44–CD74 receptor complexes
expressed by B cells. The BM of MIF-deficient mice contained fewer recirculating
mature B cells, and DC ablation in mixed BM chimeras generated with MIF-deficient
and CD11c-DTRtg BM produced similar deficiencies in mature BM B-cell numbers
as seen in CD11c-DTRtg mice. Importantly, although MIF expression was detected
by bmDCs, monocytes and macrophages, MIF expression by the latter cells was not
sufficient to rescue B-cell survival to BM following DC ablation, directly implicating
bmDCs as the critical source of MIF. In addition, given that MIF is a noncognate
ligand of CXCR4 [191], the interaction between MIF and CXCL12-CXCR4 signaling
may be crucial for maintaining mature B cells.
These experiments, thus, revealed a novel, previously unappreciated role of DC in
lymphocyte homeostasis that is independent of their APC function. Moreover, this
study provides a new basis for understanding the spatio-temporal regulation of the
development and function of lympho-hematopoietic cells in three-dimensional
microenvironments in the BM.
Although DCs in the BM are capable of maintaining the homeostasis of mature B
cells, a task that in the spleen is carried out by nonhematopoietic cells, we
unexpectedly found that the origin of DCs in both lymphoid organs is similar. BmDCs
originated in the steady state exclusively from MDPs, rather than from recirculating
monocytes. This similarity raised the question, whether bmDCs can act as APCs and
initiate primary T-cell responses – a function thought to be restricted to secondary
83

lymphoid organs. Our focus on primary BM T-cell responses to blood-borne antigen
revealed clusters of specific T cells in areas enriched with DCs, in contrast to
unresponsiveness of polyclonal T cells in the same niches. Antigen-specific T-cell
arrest was accompanied by prompt early cell activation, measured by CD69. To
further establish if bmDCs are critical APCs that initiate BM T-cell responses, we
analyzed the responses of naïve CD8 + T cells to antigen challenge in mice that were
depleted of DCs. Surprisingly, ablation of bmDCs did not impair the capacity of
antigen-specific T cells to cluster. In addition, in the BM of these mice, T cells
showed CD69 upregulation, in vivo proliferation after antigen challenge and IFN-γ
production. To identify the enigmatic cell type that prime BM CD8 + T cells in
absence of DCs, we took advantage of chimeras, in which H-2K b -deficient recipients
were reconstituted with Cx3cr1 gfp/+ BM. Surprisingly, preliminary results indicate that
MHC class I-proficient hematopoetic cells that are in the presence of MHC class I-
deprived stroma incapable of sustaining primary CD8 + T-cell response. These data
suggest a novel unique role of nonhematopoietic cells in the BM.
In contrast to LN responses that function in preventing local spread of a disease, BM
could control a systemic disease, similarly to the spleen. Further investigation is
required to determine to which antigenic challenges and pathogens the BM responds.
Indeed, previous research has shown that pathogens can enter the BM; for example,
Staphylococcus aureus can enter the BM and cause osteomyelitis [192], and
intracellular pathogens like Listeria monocytogens induce cytotoxic T cell responses
in the BM [193]. It remains unclear what distinguishes the immune responses initiated
in the BM from those in the spleen. One hypothesis is that the BM assumes an
important role against systemic infections only when the spleen is not functional.
Another alternative is that the BM functions alongside the spleen to stave off systemic
infections. A third option is that the BM and spleen specialize in defense against
different pathogens, which are more accessible to one organ or the other.
Characterization of Plasmacytoid dendritic cells functions: Plasmacytoid dendritic
cells (PDCs) play a pivotal role in anti-viral immune defense. Type I IFN secretion by
PDC orchestrates both innate and adaptive immune responses highlighting them as
critical cytokine-secreting accessory cells. We studied the involvement of PDCs in T
cell stimulation and their capacity to act as APCs in naïve T cell priming. In most
84

experimental systems any putative in vivo T cell priming potential of PDCs could be
masked by the presence of cDCs. To this end we took advantage of mice that were
conditionally depleted of cDCs, but retain PDCs. When mice were challenged with
s.c. antigen injection, PDCs in draining LNs efficiently ingested and processed
antigen. Moreover, we found that in cDC-depleted LNs, PDCs readily stimulated
antigen-specific TCR-transgenic CD4 + T cells. CD4 + T cells in the LNs proliferated
and produced IFN-γ after antigen injection, even when the cDC ablation was
combined with the removal of B cells or LCs. Importantly, PDCs were, however,
unable to concomitantly activate TCR-transgenic CD8 + T cells, a fact that served as a
functional confirmation and internal control for the absence of cDCs from the nodes.
The priming potential of PDCs was subsequently confirmed by an antigen-targeting
strategy employing an mPDCA1-OVA conjugate. PDCs, but not cDCs sorted from
LNs of the conjugate-immunized mice, were able to promote the proliferative
expansion in an in vitro T-cell proliferation assay. The above results established that
LN PDCs are bona fide DCs that can prime naive CD4 + T-cell responses. The
inability of PDCs to stimulate CD8 + T-cell responses by PDCs could result from
exclusive presentation of exogenous antigens on MHC class II not MHC class I that
is, a lack the phagosome-to-cytosol pathway required for cross-presentation. This
would be supported by the notion that even CpG-matured PDCs can only elicit
responses of naive CD8 + T cells to endogenous, but not exogenous antigens.
However, the cross-presentation potential of PDCs remains under debate.
Interestingly, we found PDCs to be incapable to promote CD4 + T-cell priming in the
spleens of DTx-treated CD11c-DTRtg mice. Thus, cDC ablation abrogated the
priming of both TCR transgenic CD4 + and CD8 + T cells. It remains unclear, whether
these results from the distinct tissue architecture of LNs and the spleen. Alternatively,
it could indicate the existence of functionally distinct PDC subsets in different organs.
In addition, the molecular basis of the apparent T cell lineage-specific and organspecific
T cell-stimulatory capacity of PDCs remains to be identified.
Taken together, we believe our finding is an important addition to our understanding
of the enigmatic cell type – PDC. Furthermore, given the emerging role of PDCs in
the control of inflammation, it might be of critical importance for the clinic and
vaccination, in particular the targeting of vaccine antigens to specific DC subsets,
allo-graft rejection and auto-immunity.
85

6. Materials and Methods
6.1 Perivascular clusters of dendritic cells provide critical survival
signals to B cells in bone marrow niches
Mice. The following mice were used: 8 - to 12-week-old C57BL/6 (CD45.2,
CD45.1), BALB/c, CD11c-DTR transgenic (B6.FVB-Tg Itgax-DTR/GFP 57Lan/J)
mice carrying a transgene encoding a human DTR-GFP fusion protein under the
control of the murine CD11c promoter [42]; Cx3cr1 gfp/+ mice (B6.129P-
Cx3cr1tm1Litt/J) harboring a targeted replacement of the Cx3cr1 gene by an
enhanced GFP reporter gene [81]; RAG2 - / - mice (B6.129S6-Rag2tm1Fwa) [194],
BAFF - / - mice [94], which (kindly provided by Biogen Idec., Inc., Cambridge, MA),
MIF - / - mice [195] and Bcl-2 transgenic mice carrying a human Bcl-2 transgene driven
by the Eμ immunoglobulin heavy chain enhancer [88]. Cx3cr1 gfp/+ mice were crossed
with CD11c-DTR transgenic mice, generating CD11c-DTRtg Cx3cr1 gfp/+ mice. Bcl-2
transgenic mice were crossed with mice bearing the CD45.1 allotype (B6.SJL-Ptprca
Pep3b/BoyJ). Mixed [wt > wt], [CD11c-DTRtg > wt], [95% CD11c-DTRtg RAG1 - / - /
5% wt > wt], [BAFF - / - > wt], [50% BAFF - / - / 50% CD11c-DTRtg > wt] and [50%
MIF - / - / 50% CD11c-DTRtg / > wt] BM chimeras were generated as reported. For DC
ablation, mice were inoculated intraperitoneally every day for 5 d with 16 ng DTx/g
body weight. DC depletion was analyzed 24 h later. All animals were maintained in
specific pathogen-free (SPF) conditions and handled according to protocols approved
by the Weizmann Institute Animal Care Committee as per international guidelines.
Flow cytometry analysis. Staining reagents used in this study included the PEcoupled
antibodies anti-B220, CD11b, CD62L, CD103, F4/80 (Serotec), CD4, CD8,
CD86, CD80, CD44, CD40, Gr1 (Ly6C/G), CD115, H-2K b , I-A/I-E, IgD, CD93
(AA4.1, early B lineage antigen), IgM; the biotinylated antibodies anti-B220 and
anti- CD45.1; the APC-coupled antibodies anti-CD11c and anti-SA; and the FITCcoupled
antibodies anti-IgD and anti-CD23. Unless indicated otherwise, the reagents
were obtained from eBioscience. The cells were analyzed on a FACSCalibur
cytometer using CellQuest software (Becton-Dickinson).
Mixed-Leukocyte Reaction. Stimulator monocytes, MΦ and DCs were isolated from
spleens and BM of CD11c-DTRtg mice by high speed sorting using the FACSAria
(Becton-Dickinson) and were irradiated with 2500 rads. Responder T cells were
enriched from spleens of BALB/c mice by positive selection with anti-CD4
86

microbeads (Miltenyi Biotec). Stimulator DCs in indicated numbers were cultured
with 1x10 5 responder CD4 + T cells (BALB/c). After 72 h, cultures were pulsed after
with 1μCi of [H 3 ] thymidine, and incorporation was measured 16 h later.
Two-photon microscopy. Syngeneic splenic B cells were purified by depletion with
immunomagnetic anti-CD43 beads (Miltenyi Biotec), and were labeled with Hoechst
33342 (Molecular Probes), then 3-5x10 7 cells were injected intravenously into
CD11c-DTRtg Cx3cr1 gfp/+ mice. CD4 + and CD8 + T cell grafts were isolated from
spleens of naïve wt donor mice by magnetic-activated cell sorting (MACS), then were
labeled with Hoechst 33342 and injected alone or in combination with B cells labeled
with CMTMR (5-(and-6)-(((4-chloromethyl)benzoyl)amino)-tetramethylrhodamine;
Molecular Probes) (1:1 mixture) into recipients, followed by analysis 5 – 24 h after
engraftment. Immediately before imaging, tetramethylrhodamine isothiocyanatedextran
TRITC-dextran (150 kDa; Sigma) was injected into the mice for visualization
of BM vasculature. Mice were anesthetized and a small incision made in the scalp to
expose the underlying dorsal skull surface [52]. Two-photon imaging was performed
on skull BM with a Zeiss LSM 510META-NLO two-photon fluorescence microscope
equipped with a x20 or x40 objective. A MaiTai HP Ti:S one-box tunable laser
(Spectra Physics, USA) was used for two-photon excitation. Image acquisition was
performed using LSM 510 acquisition software. For two-photon excitation of Hoechst
and CMTMR, the laser was tuned to 800 nm, and the emission filter sets were 435-
485 and 535-590 nm, respectively. For excitation of GFP, the laser was tuned to 920
nm and the emission filter set was 500-550 nm.
ELISPOT assay. Mice were intraperitoneally immunized with 120 μg of NP-Ficoll
(Biosearchtech, CA). Four days later, BM was isolated and plated on 96-well plates
coated with 5 μg/ml NP 30 -BSA (Biosearchtech, CA). To detect NP-specific IgMsecreting
AFCs, biotinylated anti-IgM (Biotec) was applied, followed by
EXTRAvidin-AP (Sigma).
RT-PCR assay. Standard methods were used to prepare total cellular RNA and firststrand
cDNA from sorted monocytes, macrophages and DCs isolated from the BM of
wt C57BL/6 mice. The following primer pairs were used (5’ – 3’; forward / reverse):
MIF, GAACACCAATGTTCCCCGCGC / GCGAAGGTGGAACCGTTCCAG
(327bp product); HPRT1: GGGGGCTATAAGTTCTTTGC /
TCCAACACTTCGAGAGGTCC (320bp product). BM RNA of MIF - / - mice 42 served
as negative control.
87

Statistical analysis. All statistics were generated using a Students’s t-test. All error
bars in diagrams and numbers following a ± sign are standard deviations (s.d.).
6.2 The bone marrow immune niche: Bone marrow as a priming site
for naïve CD8+ T cells
Mice. The following mice were used: 8 - to 12-week-old C57BL/6 (CD45.2,
CD45.1), CD11c-DTR transgenic (B6.FVB-Tg Itgax-DTR/GFP 57Lan/J) mice
carrying a transgene encoding a human DTR-GFP fusion protein under the control of
the murine CD11c promoter; Cx3cr1 gfp/+ mice (B6.129P-Cx3cr1tm1Litt/J) harboring a
targeted replacement of the Cx3cr1 gene by an enhanced GFP reporter gene; OT-I
(C57BL/6) TCR transgenic mice harboring OVA-specific CD8 + T cells [166]; OT-II
(C57BL/6) TCR transgenic mice harboring OVA-specific CD4 + T cells [162]; β-
actin-Enahnced Cyan Fluorescent Protein (β-actin-ECFP) (stock #004218 Jackson
laboratories); Cx3cr1 gfp/+ mice which were crossed with CD11c-DTRtg mice creating
CD11c-DTRtg Cx3cr1 gfp/+ mice. The following chimeras were created: C57BL6
reconstituted with CD11c-DTRtg Cx3cr1 gfp/+ BM [CD11c-DTRtg Cx3cr1 gfp/+ > wt];
or with CD11c-DTRtg BM [CD11c-DTRtg > wt]; H-2K b -deficient mice [130]
reconstituted with Cx3cr1 gfp/+ BM [Cx3cr1 gfp/+ > H-2K b- / - ].
Fluorescent reagents. Fluorescent reagents used in this study included: non-targeted
quantum dots (2 µM Qtracker® 655, Molecular Probes), CellTracker Orange
CMTMR (Molecular Probes), Fluorescin isothicyanate (FITC)-dextran average
molelcular weight 500,000 (Sigma).
Live two-photon microscopy of the BM. The imaging system is the Ultima
Multiphoton Microscope from Prairie Technologies®. It incorporates a pulsed Mai
Tai Ti-sapphire laser (Newport Corp.) that produces an intense 3 Watt beam,
allowing deep imaging with minimal light scattering. Highly sensitive Gallium-
Arsenide photo-multiplier tubes and optimized optical elements minimize pulse
dispersion and maximize light collection. The system is equipped with a setup for
intravital imaging (warming elements, respiration and anesthesia).
For intravital imaging, mice are anesthetized with 100 mg ketamine, 15 mg xylazine
and 2.5 mg acepromazine per gram and are kept anesthetized with hourly injections of
half the dose. The hair on the skullcap is removed using lotion containing urea
88

(ORNAT 19) and trimmer, the scalp is incised at the midline, the frontoparietal bone
is exposed and an imaging chamber is glued to the skull using cyanoacrylate-based
glue. During imaging, mice are supplied with oxygen and their core temperature is
maintained around 37°C with a warming plate. Mineralized bone is identified based
on the second harmonic signal. To visualize blood vessels, mice are i.v. injected with
a contrasting agent – non-targeted quantum dots. To create time-lapse sequences, we
typically scan a 50-200 μm-thick volume of tissue at 5 μm Z-steps and 20-second
intervals. The excitation wavelength used is between 870-910 nm. Cell movements
were analyzed using Volocity® software (Improvision Ltd.) to determine cell
coordinates, tracking over time and speed.
Adoptive cell transfers. Syngeneic splenic B cells were purified from β-actin-ECFP
by depletion with immunomagnetic anti-CD43 beads (Miltenyi Biotec CD4 + and
CD8 + T cell grafts were isolated by MACS from spleens and LNs of OT-II and OT-I
donor mice, respectively, then were labeled with 5 μM CMTMR. Polyclonal CD8 + T
cells were isolated from spleens and LNs of naïve wild-type donor mice and labeled
with 5 μM CMTMR. Then, 5-7x10 7 B cells and T cells (1:1 mixture) were i.v.
injected into recipients, followed by analysis 4 h after engraftment.
Immunizations. For peptide immunization, approximately 15 min after beginning the
imaging, 50 μg of SIINFEKL peptide and 0.5 mg of dextran-FITC were i.v. injected.
For analysis of response to intact protein, Cx3cr1 gfp/+ recipient mice were injected
with 0.1-1 mg OVA protein (Sigma). Then, 24 h after the immunization, purified β-
actin ECFP polyclonal CD8 + cells and CMTMR-labeled OT-I CD8 + T cells were
transferred and 2 h later mice were prepared for intravital imaging. For analysis of
CD69 expression, mice were adoptively transferred with 1x10 7 OT-I CD8 + T cells, 16
h later mice were challenged with 0.5 mg OVA and 2 h later were sacrificed for flow
cytometry analysis.
Analysis of T cell proliferation. OT-I CD8 + T cells were isolated from spleens and
LNs of respective mice, enriched by MACS cell sorting with anti-CD8 antibodies
according to the manufacturer's protocol (Miltenyi Biotec) and labeled with CFSE
(Molecular Probes, C-1157) (57). CFSE-labeled T cells (1x10 7 / mouse) were injected
into the tail veins of the recipient mice.
Intracellular cytokine staining. Mice were i.v. immunized with 0.1 mg OVA in 35
μg CpG nucleotide 1668 (TIB MOLBIOL). Two days later, mice were in vivo
89

estimulated by i.v. injection of 100 μg OVA peptide (residues 323-329) 2 h before
the removal of the spleen and BM. The tissue was minced and incubated in 1 mg/ ml
of collagenase D (Roche Biochemicals) for 20 min at 37 °C in medium supplemented
with 10 μg/ml brefeldin A (Calbiochem). Cells were fixed in 2% formaldehyde,
permeabilized with 0.3% saponin, and stained for anti-CD45.1, anti-CD8 and anti-
IFN-γ antibodies.
Flow Cytometry. Staining reagents used in this study included: biotinylated anti-
CD45.1; APC-coupled anti CD8 and IFN-γ; FITC-coupled anti-CD8, CD69 and
CD44, PE-coupled streptavidin (eBioscience). Cells were analyzed on a FACSCalibur
with CellQuest software (Becton Dickinson).
Analysis of cell motility. Cell movement was analyzed with Volocity® software
(Elmer Perkin©). To calculate cell speed, the coordinates of each cell were
determined and tracked over time and motility parameters were calculated. To
eliminate motion artifacts, displacements smaller than 2µm were filtered out of the
cell tracks.
Statistics. Student’s t-test was used for comparison of two groups.
6.3 Organ-dependent in vivo priming of naïve CD4 + , but not CD8 + T
cells by plasmacytoid dendritic cells
Mice. CD11c-DTR transgenic (B6.FVB-Tg Itgax-DTR/GFP 57Lan/J) mice; OT-I
(C57BL/6) TCR transgenic mice harboring OVA-specific CD8 + T cells; DO11.10
(BALB/c) and OT-II (C57BL/6) TCR transgenic mice harboring OVA-specific CD4 +
T cells; B cell deficient mice (C57BL/10-IgH-6tm1Cgn (μMt) [172] and LanDTRtg
mice carrying the DTR-GFP gene under the Langerin promoter [173]. CD11c-DTRtg
LanDTRtg and CD11c-DTRtg μMT mice were obtained by intercrossing of the
respective lines. Mixed [CD11c-DTRtg > wt] BM chimeras were generated. For
systemic cDC depletion mice were injected i.p. with 4 ng /g body weight DTx (Sigma
D-2918). For local cDC depletion in popliteal LNs, animals were injected with 20 ng
DTx s.c. into hind footpads. All mice were used at the age of 6 to 12 wks, maintained
under specific pathogen-free conditions and handled according to protocols approved
by the Weizmann Institute Animal Care Committee as per international guidelines.
Isolation of CD11c high DCs and Plasmacytoid DCs. Peripheral LNs or spleens were
digested with 1 mg/ ml of collagenase D (Roche Biochemicals) for 45 min at 37° C.
90

Tissues were mechanically disrupted in PBS, and for spleens, RBC lysis was
performed by incubation with 1 ml ACK buffer (0.15 M NH 4 Cl, 0.1 M KHCO 3 , 1
mM EDTA and PBS) for 1 min at RT. PDCs were enriched by MACS cell sorting
according to the manufacturer's protocol (Miltenyi Biotec).
In vitro Proliferation assay. BALB/c mice were immunized i.v. (20 μg OVA or 10
μg mPDCA-1-OVA) and s.c. to hind footpads (10 μg OVA or mPDCA-1-OVA.
Twenty four hours later spleens, popliteal and inguinal LNs were harvested and cDCs
and PDCs were purified by high-speed cell sorting according to CD11c and mPDCA-
1 expression using a FACSAria (Beckton-Dickinson). Positive fraction of PDCs
contained less than 0.01% contaminating CD11c high cDCs. DCs (10 4 ) or PDCs (2-
3*10 4 ) were cultured with 10 5 DO11.10 CD4 + T cells. Cultures were pulsed after 72 h
with 1μCi of [H 3 ] thymidine, and incorporation was measured 16 h later.
INF-α secretion assay. MACS-enriched splenic PDCs were cultured at 2 x 10 6 cells/
ml in complete RPMI-1640 for 20 h with 400 HAU/ml influenza virus A/Texas/1/77
(kindly provided by R. Arnon, The Weizmann Institute, Rehovot). Supernatants were
assayed using an INF-α ELISA kit (Performance Biomedical Laboratories).
Conjugation of OVA to anti-mPDCA-1 F(ab’) 2 fragments and specificity test. AntimPDCA-1
monoclonal antibody (rat IgG2b, κ; Miltenyi Biotec GmbH) was digested with
Pepsin A (Sigma-Aldrich). After size fractionation (Superdex-200 16/60 gel filtration
column; GE Healthcare), F(ab’) 2 fragments were conjugated to OVA (Sigma-Aldrich)
activated with succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC,
Pierce Chemicals Co.) according to the manufacturer’s protocol. F(ab’) 2 -OVA conjugates
were size fractionated and sterile filtrated (Millex GV filter unit 0.22 μm; Millipore) for in
vivo application. Construct integrity was evaluated by Western blot analysis with HRPconjugated
polyclonal rabbit anti-rat Ig (H+L; Jackson ImmunoResearch Laboratories)
and HRP-coupled rabbit anti-OVA antibody (Research Diagnostics Inc.) respectively.
OVA content was determined by ELISA to be around 75 ng OVA / μg mPDCA-1 F(ab’) 2 -
OVA conjugate. To demonstrate in vivo specificity, we injected 10-25 μg FITCconjugated
anti-mPDCA-1-F(ab’) 2 -OVA i.v. or into the hind footpads. Three hours later,
spleens or pooled popliteal and inguinal LNs were analyzed for PDC-specific targeting.
Immunohistochemistry. Paraffin sections (4μm) of popliteal LNs were
deparaffinized and treated with 2 ml HCl, H 2 O 2 in 50% methanol and 50% PBS for 15
min at RT. For antigen exposure, sections were microwaved in 10 mM sodium citrate
91

pH 6.0. After blocking with 20% heat-inactivated normal goat serum and 0.1% Triton
X-100 in PBS, sections were incubated overnight at RT with polyclonal biotinylated
goat anti-GFP antibody (ab6658, Abcam). Staining was revealed with an avidin-biotin
peroxidase complex (Vectastain Elite ABC kit, Vector Laboratories). Finally, the
sections were stained with haematoxylin-Mayer (Finkelman).
Analysis of T cell proliferation. TCR transgenic T cells were isolated from spleens
and LNs of respective mice, enriched by MACS cell sorting with anti-CD8 or anti-
CD4 antibodies according to the manufacturer's protocol (Miltenyi Biotec) and
labeled with CFSE (Molecular Probes, C-1157) (57). CFSE-labeled T cells (1 - 2 x
10 6 / mouse) were injected into the tail veins of the recipient mice.
Immunization. Mice were immunized with cell-associated antigen by i.v. injection of
3 x 10 7 Ova-loaded β2m -/- splenocytes [8]. Soluble Ova was injected i.v. (10μg/
mouse) or s.c. to hind footpads (10μg/ footpad). Keyhole Limpet Hemocyanin (KLH)
(Sigma) was injected s.c. to hind footpads (10μg/ footpad). The anti-DEC205-OVA
conjugate (kindly provided by K. Mahnke, University
Hospital Heidelberg, Heidelberg,Germany) was used at a dose of 7ng/ footpad.
F(ab’) 2 and anti-mPDCA-1-F(ab’) 2 -OVA were injected at a dose of 8 μg/ footpad. For
measurement of Ag uptake mice were immunized with DQ-OVA (Invitrogen) by
hind footpad injection of 10μg/ footpad.
Intracellular cytokine staining. Mice were immunized with 25 μg OVA in 5 nmol/
footpad CpG nucleotide 1668 (TIB MOLBIOL). Two days later, mice were in vivo
restimulated by i.v. injection of 100 μg OVA peptide (residues 323-329) 2 h before
the removal of popliteal LNs. The tissue was minced and incubated in 1 mg/ ml of
collagenase D (Roche Biochemicals) for 20 min at 37 °C in medium supplemented
with 10 μg/ml brefeldin A (Calbiochem). Cells were fixed in 2% formaldehyde,
permeabilized with 0.3% saponin, and stained for anti-CD45.1, anti-CD4 and anti-
IFN-γ antibodies.
Flow cytometry analysis. The staining reagents used in this study included the PEcoupled
anti-CD4, CD19, CD45.1, CD11c, CD45RB, CD8 and KJ126 (DO11.10
clonotype); biotinylated anti-CD45.1 and mPDCA-1; APC-coupled CD11c, CD4,
IFN-γ, and CD8; the FITC- coupled anti-CD4; PE-Cy5.5-coupled anti-B220 (Caltag
laboratories) and PerCP- coupled anti-CD4 and CD8 antibodies. Unless indicated
otherwise, the reagents were obtained from Pharmingen or eBioscience. The anti-
92

Siglec-H antibody (440c) was provided by M.Colonna (Washington University
School of Medicine, St. Louis, MO). Cells were analyzed on FACSCalibur cytometer
using CellQuest software (Becton-Dickinson).
93

7. References
1. Banchereau, J. & Steinman, R.M. Dendritic cells and the control of immunity.
Nature 392, 245-52 (1998).
2. Steinman RM, Hawiger D, Nussenzweig MC. Tolerogenic dendritic cells. Annu
Rev Immunol. 21, 685-711 (2003).
3. Liu, Y.J. IPC: professional type 1 interferon-producing cells and plasmacytoid
dendritic cell precursors. Annu Rev Immunol 23, 275-306 (2005).
4. Ruedl, C., P. Koebel, M. Bachmann, M. Hess, and K. Karjalainen. Anatomical
origin of dendritic cells determines their life span in peripheral lymph nodes. J
Immunol. 165, 4910-4916 (2000).
5. Liu, K., Victora, GD., Schwickert, TA., Guermonprez, P., Meredith, MM., Yao,
K., Chu, FF., Randolph, GJ., Rudensky, AY., Nussenzweig, M. In vivo analysis of
dendritic cell development and homeostasis. Science 324, 392-397 (2009).
6. Shortman K, Liu YJ. Mouse and human dendritic cell subtypes. Nat Rev Immunol.
2002, 151-161 (2002).
7. Dudziak D, Kamphorst AO, Heidkamp GF, Buchholz VR, Trumpfheller C,
Yamazaki S, Cheong C, Liu K, Lee HW, Park CG, Steinman RM, Nussenzweig MC.
Differential antigen processing by dendritic cell subsets in vivo. Science 315, 107-11
(2007).
8. den Haan JM, Lehar SM, Bevan MJ. CD8(+) but not CD8(-) dendritic cells crossprime
cytotoxic T cells in vivo. J Exp Med. 192, 1685-1696 (2000).
9. Lin ML, Zhan Y, Proietto AI, Prato S, Wu L, Heath WR, Villadangos JA, Lew AM.
Selective suicide of cross-presenting CD8+ dendritic cells by cytochrome c injection
shows functional heterogeneity within this subset. Proc Natl Acad Sci. U S A 105,
3029-34 (2008).
10. Randolph GJ, Ochando J, Partida-Sanchez S. Migration of dendritic cell subsets
and their precursors. Annu Rev Immunol. 26, 293-316 (2008).
11. O’Keeffe M, Hochrein H, Vremec D, et al. Mouse plasmacytoid cells: long-lived
cells, heterogeneous in surface phenotype and function, that differentiate into CD8(+)
dendritic cells only after microbial stimulus. J Exp Med. 196, 1307-1319 (2002).
12. Asselin-Paturel C, Brizard G, Pin JJ, Briere F, Trinchieri G. Mouse strain
differences in plasmacytoid dendritic cell frequency and function revealed by a novel
monoclonal antibody. J Immunol. 171, 6466–6477 (2003).
13. Krug A, Luker GD, Barchet W, Leib DA, Akira S, Colonna M. Herpes simplex
virus type 1 activates murine natural interferon-producing cells through Toll-like
receptor 9. Blood 103, 1433–1437 (2004).
14. Blasius AL, Giurisato E, Cella M, Schreiber RD, Shaw AS, Colonna M. Bone
marrow stromal cell antigen 2 is a specific marker of type I IFN-producing cells in the
naïve mouse, but a promiscuous cell surface antigen following IFN stimulation. J
Immunol. 177, 3260–3265 (2006).
15. Krug A, French AR, Barchet W, Fischer JA, Dzionek A, Pingel JT et al. TLR9-
dependent recognition of MCMV by IPC and DC generates coordinated cytokine
responses that activate antiviral NK cell function. Immunity 21, 107–119 (2004).
16. Barchet W, Krug A, Cella M, Newby C, Fischer JA, Dzionek A et al. Dendritic
cells respond to influenza virus through TLR7- and PKR-independent pathways. Eur
J Immunol. 35, 236–242 (2005).
17. Neil, S.J., Zang, T., and Bieniasz, P.D. Tetherin inhibits retrovirus release and is
antagonized by HIV-1 Vpu. Nature 451, 425–430 (2008).
94

18. Blasius AL, Colonna M. Sampling and signaling in plasmacytoid dendritic cells:
the potential roles of Siglec-H. Trends Immunol. 27, 255–260 (2006).
19. Colonna M, Trinchieri G, Liu YJ. Plasmacytoid dendritic cells in immunity. Nat
Immunol. 5, 1219-1226 (2004).
20. Fitzgerald-Bocarsly, P., Dai, J., and Singh, S. Plasmacytoid dendritic
cells and type I IFN: 50 years of convergent history. Cytokine Growth Factor
Rev. 19, 3–19 (2008).
21. Cisse B. et al. Transcription factor E2-2 is an essential and specific regulator of
plasmacytoid dendritic cell development. Cell 135, 37-48 (2008).
22. Asselin-Paturel, C., Boonstra, A., Dalod, M., Durand, I., Yessaad, N., Dezutter-
Dambuyant, C., Vicari, A., O’Garra, A., Biron, C., Briere, F., and Trinchieri, G.
Mouse type I IFN-producing cells are immature APCs with plasmacytoid
morphology. Nat Immunol. 2, 1144–1150 (2001).
23. Bjorck, P. Isolation and characterization of plasmacytoid dendritic cells
from Flt3 ligand and granulocyte-macrophage colony-stimulating factortreated
mice. Blood 98, 3520–3526 (2001).
24. Grouard, G., Rissoan, M.C., Filgueira, L., Durand, I., Banchereau, J., and Liu,
Y.J. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin
(IL)-3 and CD40-ligand. J Exp Med. 185, 1101–1111 (1997).
25. Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R.A.,
Bazan, F., and Liu, Y.J. Subsets of human dendritic cell precursors express
different toll-like receptors and respond to different microbial antigens. J Exp Med.
194, 863–870 (2001).
26. Nakano, H., Yanagita, M., and Gunn, M.D. CD11c(+)B220(+)Gr-1(+) cells in
mouse lymph nodes and spleen display characteristics of plasmacytoid dendritic cells.
J Exp Med. 194, 1171–1178 (2001).
27. Reis e Sousa, C. Dendritic cells in a mature age. Nat Rev Immunol. 6, 476–483
(2006).
28. Salio, M., Palmowski, M.J., Atzberger, A., Hermans, I.F., and Cerundolo, V.
CpG-matured murine plasmacytoid dendritic cells are capable of in vivo priming of
functional CD8 T cell responses to endogenous but not exogenous antigens. J Exp
Med. 199, 567–579 (2004).
29. Schlecht, G., Garcia, S., Escriou, N., Freitas, A.A., Leclerc, C., and Dadaglio,
G. Murine plasmacytoid dendritic cells induce effector/memory CD8+ T-cell
responses in vivo after viral stimulation. Blood 104, 1808–1815 (2004).
30. McGill, J., Van Rooijen, N., and Legge, K.L. Protective influenzaspecific
CD8 T cell responses require interactions with dendritic cells in the lungs. J Exp Med.
205, 1635–1646 (2008).
31. Gilliet, M., and Liu, Y.J. Generation of human CD8 T regulatory cells by CD40
ligand-activated plasmacytoid dendritic cells. J Exp Med. 195, 695–704 (2002).
32. Ito, T., Yang, M., Wang, Y.H., Lande, R., Gregorio, J., Perng, O.A., Qin, X.F.,
Liu, Y.J., and Gilliet, M. Plasmacytoid dendritic cells prime IL-10-producing
T regulatory cells by inducible costimulator ligand. J Exp Med 204, 105–115 (2007).
33. Martin, P., Del Hoyo, G.M., Anjuere, F., Arias, C.F., Vargas, H.H., Fernandez,
L.A., Parrillas, V., and Ardavin, C. Characterization of a new subpopulation
of mouse CD8alpha+ B220+ dendritic cells endowed with type 1 interferon
production capacity and tolerogenic potential. Blood 100, 383–390 (2002).
34. Ochando, J.C., Homma, C., Yang, Y., Hidalgo, A., Garin, A., Tacke, F., Angeli,
V., Li, Y., Boros, P., Ding, Y., et al. Alloantigen-presenting plasmacytoid
95

dendritic cells mediate tolerance to vascularized grafts. Nat Immunol. 7, 652–662
(2006).
35. Sharma, M.D., Baban, B., Chandler, P., Hou, D.Y., Singh, N., Yagita, H.,
Azuma, M., Blazar, B.R., Mellor, A.L., and Munn, D.H. Plasmacytoid dendritic cells
from mouse tumor-draining lymph nodes directly activate mature Tregs via
indoleamine 2,3-dioxygenase. J Clin Invest. 117, 2570–2582 (2007).
36. De Heer, H.J., Hammad, H., Soullie, T., Hijdra, D., Vos, N., Willart, M.A.,
Hoogsteden, H.C., and Lambrecht, B.N. Essential role of lung plasmacytoid dendritic
cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med. 200,
89–98 (2004).
37. Smit, J.J., Rudd, B.D., and Lukacs, N.W. Plasmacytoid dendritic cells inhibit
pulmonary immunopathology and promote clearance of respiratory syncytial virus. J
Exp Med. 203, 1153–1159 (2006).
38. Wang, H., Peters, N., and Schwarze, J. Plasmacytoid dendritic cells limit viral
replication, pulmonary inflammation, and airway hyperresponsiveness in respiratory
syncytial virus infection. J Immunol. 177, 6263–6270 (2006).
39. Wilson NS, Villadangos JA. Regulation of antigen presentation and crosspresentation
in the dendritic cell network: facts, hypothesis, and immunological
implications. Adv Immunol. 86, 241-305 (2005).
40. Strawbridge AB, Blum JS. Autophagy in MHC class II antigen processing. Curr
Opin Immunol. 19, 87-92. (2007).
41. Rock KL, Shen L. Cross-presentation: underlying mechanisms and role in
immune surveillance. Immunol Rev. 207, 166-83 (2005).
42. Jung, S. et al. In vivo depletion of CD11c(+) dendritic cells abrogates priming of
CD8(+) T cells by exogenous cell-associated antigens. Immunity 17, 211-20 (2002).
43. Melief CJ. Regulation of cytotoxic T lymphocyte responses by dendritic cells:
peaceful coexistence of cross-priming and direct priming? Eur J Immunol. 33, 2645-
54 (2003).
44. Zinkernagel RM. On cross-priming of MHC class I-specific CTL: rule or
exception? Eur J Immunol. 32, 2385-92 (2002).
45. Fogg DK, Sibon C, Miled C, et al. A clonogenic bone marrow progenitor specific
for macrophages and dendritic cells. Science 311, 83-87 (2006).
46. van Furth R, Raeburn JA, van Zwet TL. Characteristics of human mononuclear
phagocytes. Blood 54, 485–500 (1979).
47. Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nat Rev
Immunol. 5, 953–964 (2005).
48. Palframan RT, Jung S, Cheng G, Weninger W, Luo Y, Dorf M et al. Inflammatory
chemokine transport and presentation in HEV: a remote control mechanism for
monocyte recruitment to lymph nodes in inflamed tissues. J Exp Med. 194, 1361–
1373 (2001).
49. Geissmann F, Jung S, Littman DR. Blood monocytes consist of two principal
subsets with distinct migratory properties. Immunity 19, 71–82 (2003).
50. Varol C, Landsman L, Fogg DK, Greenshtein L, Gildor B, Margalit R et al.
Monocytes give rise to mucosal, but not splenic, conventional dendritic cells. J Exp
Med. 204, 171–180 (2007).
51. Colmone A, Sipkins DA. Beyond angiogenesis: the role of endothelium in the
bone marrow vascular niche. Transl Res. 151, 1-9 (2008).
52. Mazo IB., von Andrian UH. Adhesion and homing of blood-borne cells in bone marrow
microvessels. J Leukoc Biol. 66, 25-32 (1999).
96

53. Nagasawa, T. et al. Microenvironmental niches in the bone marrow required for
B-cell development. Nat Rev Immunol 6, 107–116 (2006).
54. Cavanagh, L. et al. Activation of bone marrow-resident memory T cells by
circulating, antigen-bearing dendritic cells. Nat Immunol. 6, 1029-1037 (2005).
55. Cariappa, A. et al. Perisinusoidal B cells in the bone marrow participate in T-
independent responses to blood-borne microbes. Immunity 23, 397-407 (2005).
56. Cancro, M. et al. Peripheral B-cell maturation: the intersection of selection and
homeostasis. Immunol Rev. 197, 89-101 (2004).
57. Srivastava, B. et al. Models for peripheral B cell development and homeostasis.
Sem. Immunol. 17, 175-182 (2005).
58. Manz, R. et al. Lifetime of plasma cells in the bone marrow. Nature 388, 133-134
(1997).
59. Tokoyoda K, Egawa T, Sugiyama T, Choi BI, Nagasawa T. Cellular niches
controlling B lymphocyte behavior within bone marrow during development.
Immunity 20, 707-18 (2004).
60. Pabst R, Binns RM, Westermann J. What is the function of peripheral
lymphocytes migrating to the thymus and of B lymphocytes proliferating in the
thymus? Thymus 13, 149–156 (1989).
61. Di Rosa F, Pabst R. The bone marrow: a nest for migratory memory T cells.
Trends Immunol. 26, 360–366 (2005).
62. Becker, TC., Coley, SM., Wherry, EJ., Ahmed, R. Bone marrow is a preferred site
for homeostatic proliferation of memory CD8 T cells. J Immunol. 174, 1269-1273
(2005).
63. Mazo IB, Honczarenko M, Leung H, Cavanagh LL, Bonasio R, Weninger W et al.
Bone marrow is a major reservoir and site of recruitment for central memory CD8+ T
cells. Immunity 22, 259–270 (2005).
64. Sipkins DA, Wei X, Wu JW, Runnels JM, Cote D, Means TK et al. In vivo
imaging of specialized bone marrow endothelial microdomains for tumour
engraftment. Nature 435, 969–973 (2005).
65. Sumen C, Mempel TR, Mazo IB, von Andrian UH. Intravital microscopy:
visualizing immunity in context. Immunity 21, 315-329 (2004).
66. Bousso P. T-cell activation by dendritic cells in the lymph node: lessons from the
movies. Nat Rev Immunol. 8, 1-10 (2008).
67. Mazo I., Gutierrez-Ramos JC., Frenette PS., Hynes RO., Wagner DD., von
Andrian UH. Hematopoietic progenitor cell rolling in bone marrow microvessels:
parallel contributions by endothelial selectins and VCAM-1. J Exp Med. 188, 465-473
(1998).
68. Calvi, L.M. et al. Osteoblastic cells regulate the haematopoietic stem cell niche.
Nature 425, 841-6 (2003).
69. Zhang, J. et al. Identification of the haematopoietic stem cell niche and control of
the niche size. Nature 425, 836-41 (2003).
70. Avecilla, S.T. et al. Chemokine-mediated interaction of hematopoietic progenitors
with the bone marrow vascular niche is required for thrombopoiesis. Nat Med. 10,
64-71 (2004).
71. Hardy, R.R., Carmack, C.E., Shinton, S.A., Kemp, J.D. & Hayakawa, K.
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse
bone marrow. J Exp Med. 173, 1213-25 (1991).
72. Loder, F. et al. B cell development in the spleen takes place in discrete steps and
is determined by the quality of B cell receptor-derived signals. J Exp Med. 190, 75-89
(1999).
97

73. Moser, K., Tokoyoda, K., Radbruch, A., MacLennan, I. & Manz, R.A. Stromal
niches, plasma cell differentiation and survival. Curr Opin Immunol. 18, 265-70
(2006).
74. Masopust, D., Vezys, V., Marzo, A.L. & Lefrancois, L. Preferential localization of
effector memory cells in nonlymphoid tissue. Science 291, 2413-7 (2001).
75. Mazo, I.B. et al. Bone marrow is a major reservoir and site of recruitment for
central memory CD8+ T cells. Immunity 22, 259-70 (2005).
76. Feuerer, M. et al. Bone marrow as a priming site for T-cell responses to blood
borne antigen. Nat Med. 9, 1151-7 (2003).
77. Feuerer, M. et al. Bone marrow microenvironment facilitating dendritic cell: CD4
T cell interactions and maintenance of CD4 memory. Int J Oncol. 25, 867-76 (2004).
78. Shortman, K. & Naik, S.H. Steady-state and inflammatory dendritic-cell
development. Nat Rev Immunol. 7, 19-30 (2007).
79. Shortman, K. & Liu, Y.J. Mouse and human dendritic cell subtypes. Nat Rev
Immunol. 2, 151-61 (2002).
80. Steinman, R.M. & Witmer, M.D. Lymphoid dendritic cells are potent stimulators
of the primary mixed leukocyte reaction in mice. Proc Natl Acad Sci. U S A 75, 5132-
6 (1978).
81. Jung, S. et al. Analysis of fractalkine receptor CX(3)CR1 function by targeted
deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol. 20,
4106-14 (2000).
82. Niess, J.H. et al. CX3CR1-mediated dendritic cell access to the intestinal lumen
and bacterial clearance. Science 307, 254-8 (2005).
83. Soos, T.J. et al. CX3CR1+ interstitial dendritic cells form a contiguous network
throughout the entire kidney. Kidney Int. 70, 591-6 (2006).
84. Landsman, L., Varol, C. & Jung, S. Distinct differentiation potential of blood
monocyte subsets in the lung. J Immunol. 178, 2000-7 (2007).
85. Zaft, T., Sapoznikov, A., Krauthgamer, R., Littman, D.R. & Jung, S. CD11chigh
dendritic cell ablation impairs lymphopenia-driven proliferation of naive and memory
CD8+ T cells. J Immunol. 175, 6428-35 (2005).
86. Allman, D. et al. Resolution of three nonproliferative immature splenic B cell
subsets reveals multiple selection points during peripheral B cell maturation. J
Immunol. 167, 6834-40 (2001).
87. Hebel, K. et al. Plasma cell differentiation in T-independent type 2 immune
responses is independent of CD11c(high) dendritic cells. Eur J Immunol. 36, 2912-9
(2006).
88. Strasser, A. et al. Enforced BCL2 expression in B-lymphoid cells prolongs
antibody responses and elicits autoimmune disease. Proc Natl Acad Sci. U S A 88,
8661-5 (1991).
89. Lesley, R., Kelly, L.M., Xu, Y. & Cyster, J.G. Naive CD4 T cells constitutively
express CD40L and augment autoreactive B cell survival. Proc Natl Acad Sci. U S A
103, 10717-22 (2006).
90. Mackay, F. & Browning, J.L. BAFF: a fundamental survival factor for B cells.
Nat Rev Immunol. 2, 465-75 (2002).
91. Gorelik, L. et al. Normal B cell homeostasis requires B cell activation factor
production by radiation-resistant cells. J Exp Med. 198, 937-45 (2003).
92. Nardelli, B. et al. Synthesis and release of B-lymphocyte stimulator from myeloid
cells. Blood 97, 198-204 (2001).
93. Litinskiy, M.B. et al. DCs induce CD40-independent immunoglobulin class
switching through BLyS and APRIL. Nat Immunol. 3, 822-9 (2002).
98

94. Schiemann, B. et al. An essential role for BAFF in the normal development of B
cells through a BCMA-independent pathway. Science 293, 2111-4 (2001).
95. Leng, L. et al. MIF signal transduction initiated by binding to CD74. J Exp Med.
197, 1467-76 (2003).
96. Lue, H. et al. Macrophage migration inhibitory factor (MIF) promotes cell
survival by activation of the Akt pathway and role for CSN5/JAB1 in the control of
autocrine MIF activity. Oncogene 26, 5046-5059 (2007).
97. Starlets, D. et al. Cell-surface CD74 initiates a signaling cascade leading to cell
proliferation and survival. Blood 107, 4807-16 (2006).
98. Lantner, F. et al. CD74 induces TAp63 expression leading to B cell survival.
Blood 110, 4303-4311 (2007).
99. Calandra, T., Bernhagen, J., Mitchell, R.A. & Bucala, R. The macrophage is an
important and previously unrecognized source of macrophage migration inhibitory
factor. J Exp Med. 179, 1895-902 (1994).
100. Qi, H., Egen, J.G., Huang, A.Y. & Germain, R.N. Extrafollicular activation of
lymph node B cells by antigen-bearing dendritic cells. Science 312, 1672-6 (2006).
101. Sipkins, D.A. et al. In vivo imaging of specialized bone marrow endothelial
microdomains for tumour engraftment. Nature 435, 969-73 (2005).
102. Bajenoff, M. et al. Stromal cell networks regulate lymphocyte entry, migration,
and territoriality in lymph nodes. Immunity 25, 989-1001 (2006).
103. Morand, E.F., Leech, M. & Bernhagen, J. MIF: a new cytokine link between
rheumatoid arthritis and atherosclerosis. Nat Rev Drug Discov. 5, 399-410 (2006).
104. Balazs, M., Martin, F., Zhou, T. & Kearney, J. Blood dendritic cells interact with
splenic marginal zone B cells to initiate T-independent immune responses.
Immunity 17, 341-52 (2002).
105. Cariappa, A., Chase, C., Liu, H., Russell, P. & Pillai, S. Naive recirculating B
cells mature simultaneously in the spleen and bone marrow. Blood 109, 2339-45
(2007).
106. Nishizumi, H. et al. Impaired proliferation of peripheral B cells and indication of
autoimmune disease in lyn-deficient mice. Immunity 3, 549-60 (1995).
107. Otipoby, K.L. et al. CD22 regulates thymus-independent responses and the
lifespan of B cells. Nature 384, 634-7 (1996).
108. O'Keefe, T.L., Williams, G.T., Davies, S.L. & Neuberger, M.S. Hyperresponsive
B cells in CD22-deficient mice. Science 274, 798-801 (1996).
109. Pan, C., Baumgarth, N. & Parnes, J.R. CD72-deficient mice reveal nonredundant
roles of CD72 in B cell development and activation. Immunity 11, 495-506 (1999).
110. Cariappa, A. et al. The follicular versus marginal zone B lymphocyte cell fate
decision is regulated by Aiolos, Btk, and CD21. Immunity 14, 603-15 (2001).
111. Floyd, H., Nitschke, L. & Crocker, P.R. A novel subset of murine B cells that
expresses unmasked forms of CD22 is enriched in the bone marrow: implications
for B-cell homing to the bone marrow. Immunology 101, 342-7 (2000).
112. Fu, Y.-X. & Chaplin, D.D. Development and maturation of secondary lymphoid
tissues. Annu Rev Immunol. 17, 399-458 (1999).
113. Lanzavecchia, A. & Sallusto, F. The instructive role of dendritic cells on T cell
responses: lineages, plasticity and kinetics. Curr Opin Immunol. 13, 291–296 (2001).
114. Osmond, D.G. Production and selection of B lymphocytes in bone marrow:
lymphostromal interactions and apoptosis in normal, mutant and transgenic mice. Adv
Exp Med Biol. 355, 15–20 (1994).
115. Koni, P.A. et al. Conditional vascular cell adhesion molecule 1 deletion in mice:
impaired lymphocyte migration to bone marrow. J Exp Med. 193, 741–753 (2001).
99

116. Di Rosa, F. & Santoni, A. Bone marrow CD8 T cells are in a different activation
state than those in lymphoid periphery. Eur J Immunol. 32, 1873-1880 (2002).
117. Becker, T.C., et al. Bone marrow is a preferred site for homeostatic proliferation
of memory CD8 T cells. J Immunol. 174, 1269-1273 (2005).
118. Masopust D, Vezys V, Marzo AL, Lefrançois L Preferential localization of
effector memory cells in nonlymphoid tissue. Science 291, 2413-7 (2001).
119. Martinez, C., et al. Immune reconstitution following allogeneic peripheral blood
progenitor cell transplantation: comparison of recipients of positive CD34+ selected
grafts with recipients of unmanipulated grafts. Exp Hematol. 27, 561-568 (1999).
120. Adams, G.B., et al. Heterologous cells cooperate to augment stem cell migration,
homing, and engraftment. Blood 101, 45-51 (2003).
121. Naik, S. H., et al. Intrasplenic steady-state dendritic cell precursors that are
distinct from monocytes. Nat Immunol. 7, 663-671 (2006).
122. Miller, M.J., et al. Two-photon imaging of lymphocyte motility and antigen
response in intact lymph node. Science 296, 1869-1873 (2002).
123. Mempel, T.R., et al. T-cell priming by dendritic cells in lymph nodes occurs in
three distinct phases. Nature 427, 154-159 (2004).
124. Celluzzi CM, Mayordomo JI, Storkus WJ, Lotze MT, Falo LD, Jr. Peptidepulsed
dendritic cells induce antigen-specific CTL-mediated protective tumor
immunity. J Exp Med. 183, 283-287 (1996).
125. Sancho, D., et al. CD69 is a an immunoregulatory molecule induced following
activation. Trends Immunol. 26, 136-140 (2005).
126. Reinhardt, R.L., A. Khoruts, R. Merica, T. Zell, and M.K. Jenkins. Visualizing
the generation of memory CD4 T cells in the whole body. Nature 410, 101-105
(2001).
127. Kurts, C., M. Cannarile, I. Klebba, and T. Brocker. Dendritic cells are sufficient
to cross-present self-antigens to CD8 T cells in vivo. J Immunol. 166, 1439-1442
(2001).
128. Limmer, A., Ohl, J., Wingender, G., and Knolle, PA. et al. Cross-presentation of
oral antigens by liver sinusoidal endothelial cells leads to CD8 T cell tolerance. Eur J
Immunol. 35, 2970-2981 (2005).
129. Kiesel, JR., Buchwald, ZS., Aurora, R. Cross-presentation by osteoclasts induces
FoxP3 in CD8+ T cells. J Immunol. 182, 5477-5487 (2009).
130. P ´erarnau, B., Saron, M.-F., Reina San Martin, B., Bervas, N., Ong, H., Soloski,
M., Smith, A. G., Ure, J. M., Gairin, J.-E. and Lemonnier, F. A., Single H-2K b , H-2D b
and double H-2K b D b knock-out mice: peripheral CD8+ T cell repertoire and antilymphocytic
choriomeningitis virus cytolytic responses. Eur J Immunol. 29, 1243–
1252 (1999).
131. Hall, JG., & Morris, B. The immediate effect of antigens on the cell output of a
lymph node. Br J Exp Pathol. 46, 450-454 (1965).
132. Shiow, LR., Rosen, DB., Brdickova, N., Xu, Y., An, J., Lanier, LL., Cyster, JC.,
Matloubian, M. CD69 acts downstream of interferon-α/β to inhibit S1P 1 and
lymphocyte egress from lymphoid organs. Nature 440, 540-544 (2006).
133. Tian, T., J. Woodworth, M. Skold, and S.M. Behar. In vivo depletion of CD11c+
cells delays the CD4+ T cell response to Mycobacterium tuberculosis and exacerbates
the outcome of infection. J Immunol. 175, 3268-3272 (2005).
134. Gretz, JE., Kaldjian, EP., Anderson, AO., Shaw, S. Sophisticated strategies for
information encounter in the lymph node: the reticular network as a conduit of soluble
information and a highway for cell traffic. J Immunol. 157, 495-499 (1996).
100

135. Bajenoff, M., Egen, JG., Koo, LY., Laugier, JP., Brau, F., Glaichenhaus, N.,
Germain, RN. Stromal cell networks regulate lymphocyte entry, migration, and
territoriality in lymph nodes. Immunity 25, 989-1001 (2006).
136. Spiotto, M., Rowley, DA., Schreiber, H. Bystander elimination of antigen loss
variants in established tumors. Nat Med. 10, 294-298 (2004).
137. Kawai, T., S. Sato, K.J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, M.
Matsuda, J. Inoue, S. Uematsu, O. Takeuchi, and S. Akira. Interferon-alpha induction
through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and
TRAF6. Nat Immunol. 5, 1061-1068 (2004).
138. Lennert, K., and W. Remmele. [Karyometric research on lymph node cells in
man. I. Germinoblasts, lymphoblasts & lymphocytes.]. Acta Haematol. 19, 99-113
(1958).
139. Trinchieri, G., and D. Santoli. Anti-viral activity induced by culturing
lymphocytes with tumor-derived or virus-transformed cells. Enhancement of human
natural killer cell activity by interferon and antagonistic inhibition of susceptibility of
target cells to lysis. J Exp Med. 147, 1314-1333 (1978).
140. Bandyopadhyay, S., B. Perussia, G. Trinchieri, D.S. Miller, and S.E. Starr.
Requirement for HLA-DR+ accessory cells in natural killing of cytomegalovirusinfected
fibroblasts. J Exp Med. 164, 180-195 (1986).
141. Yoneyama, H., K. Matsuno, E. Toda, T. Nishiwaki, N. Matsuo, A. Nakano, S.
Narumi, B. Lu, C. Gerard, S. Ishikawa, and K. Matsushima. Plasmacytoid DCs help
lymph node DCs to induce anti-HSV CTLs. J Exp Med. 202, 425-435 (2005).
142. Le Bon, A., N. Etchart, C. Rossmann, M. Ashton, S. Hou, D. Gewert, P. Borrow,
and D.F. Tough. Cross-priming of CD8+ T cells stimulated by virus-induced type I
interferon. Nat Immunol. 4, 1009-1015 (2003).
143. Shen, H., and A. Iwasaki. A crucial role for plasmacytoid dendritic cells in
antiviral protection by CpG ODN-based vaginal microbicide. J Clin Invest. 116,
2237-2243 (2006).
144. Kuwajima, S., T. Sato, K. Ishida, H. Tada, H. Tezuka, and T. Ohteki. Interleukin
15-dependent crosstalk between conventional and plasmacytoid dendritic cells is
essential for CpG-induced immune activation. Nat Immunol. 7, 740-746 (2006).
145. Probst, H.C., and M. van den Broek. Priming of CTLs by lymphocytic
choriomeningitis virus depends on dendritic cells. J Immunol. 174, 3920-3924 (2005).
146. Kadowaki, N., and Y.J. Liu. Natural type I interferon-producing cells as a link
between innate and adaptive immunity. Hum Immunol. 63, 1126-1132 (2002).
147. Krug, A., R. Veeraswamy, A. Pekosz, O. Kanagawa, E.R. Unanue, M. Colonna,
and M. Cella. Interferon-producing cells fail to induce proliferation of naive T cells
but can promote expansion and T helper 1 differentiation of antigen-experienced
unpolarized T cells. J Exp Med. 197, 899-906 (2003).
148. Boonstra, A., C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y.J. Liu,
and A. O'Garra. Flexibility of mouse classical and plasmacytoid-derived dendritic
cells in directing T helper type 1 and 2 cell development: dependency on antigen dose
and differential toll-like receptor ligation. J Exp Med. 197, 101-109 (2003).
149. Salio, M., M.J. Palmowski, A. Atzberger, I.F. Hermans, and V. Cerundolo. CpGmatured
murine plasmacytoid dendritic cells are capable of in vivo priming of
functional CD8 T cell responses to endogenous but not exogenous antigens. J Exp
Med. 199, 567-579 (2004).
150. Smit, J.J., B.D. Rudd, and N.W. Lukacs. Plasmacytoid dendritic cells inhibit
pulmonary immunopathology and promote clearance of respiratory syncytial virus. J
Exp Med. 203, 1153-1159 (2006).
101

151. Abe, M., B.L. Colvin, and A.W. Thomson. Plasmacytoid dendritic cells: in vivo
regulators of alloimmune reactivity? Transplant Proc. 37, 4119-4121 (2005).
152. Ochando, J.C., C. Homma, Y. Yang, A. Hidalgo, A. Garin, F. Tacke, V. Angeli,
Y. Li, P. Boros, Y. Ding, R. Jessberger, G. Trinchieri, S.A. Lira, G.J. Randolph, and
J.S. Bromberg. Alloantigen-presenting plasmacytoid dendritic cells mediate tolerance
to vascularized grafts. Nat Immunol. 7, 652-662 (2006).
153. Brocker, T., M. Riedinger, and K. Karjalainen. Targeted expression of major
histocompatibility complex (MHC) class II molecules demonstrates that dendritic
cells can induce negative but not positive selection of thymocytes in vivo. J Exp Med.
185, 541-550 (1997).
154. Probst, H.C., K. Tschannen, B. Odermatt, R. Schwendener, R.M. Zinkernagel,
and M. Van Den Broek. Histological analysis of CD11c-DTR/GFP mice after in vivo
depletion of dendritic cells. Clin Exp Immunol. 141, 398-404 (2005).
155. van Rijt, L.S., S. Jung, A. Kleinjan, N. Vos, M. Willart, C. Duez, H.C.
Hoogsteden, and B.N. Lambrecht. In vivo depletion of lung CD11c+ dendritic cells
during allergen challenge abrogates the characteristic features of asthma. J Exp Med.
201, 981-991 (2005).
156. Vallon-Eberhard, A., L. Landsman, N. Yogev, B. Verrier, and S. Jung.
Transepithelial pathogen uptake into the small intestinal lamina propria. J Immunol.
176, 2465-2469 (2006).
157. Huleatt, J.W., and L. Lefrancois. Antigen-driven induction of CD11c on
intestinal intraepithelial lymphocytes and CD8+ T cells in vivo. J Immunol. 154,
5684-5693 (1995).
158. Laouar, Y., F.S. Sutterwala, L. Gorelik, and R.A. Flavell. Transforming growth
factor-beta controls T helper type 1 cell development through regulation of natural
killer cell interferon-gamma. Nat Immunol. 6, 600-607 (2005).
159. Blasius, A., W. Vermi, A. Krug, F. Facchetti, M. Cella, and M. Colonna. A cellsurface
molecule selectively expressed on murine natural interferon-producing cells
that blocks secretion of interferon-alpha. Blood 103, 4201-4206 (2004).
161. Krug, A., A.R. French, W. Barchet, J.A. Fischer, A. Dzionek, J.T. Pingel, M.M.
Orihuela, S. Akira, W.M. Yokoyama, and M. Colonna. TLR9-dependent recognition
of MCMV by IPC and DC generates coordinated cytokine responses that activate
antiviral NK cell function. Immunity 21:107-119 (2004).
161. Clarke, S.R., M. Barnden, C. Kurts, F.R. Carbone, J.F. Miller, and W.R. Heath.
Characterization of the ovalbumin-specific TCR transgenic line OT-I: MHC elements
for positive and negative selection. Immunol Cell Biol. 78, 110-117 (2000).
162. Robertson, J.M., P.E. Jensen, and B.D. Evavold. DO11.10 and OT-II T cells
recognize a C-terminal ovalbumin 323-339 epitope. J Immunol. 164, 4706-4712
(2000).
163. Parish, C.R. Fluorescent dyes for lymphocyte migration and proliferation studies.
Immunol Cell Biol. 77, 499-508 (1999).
164. Zhang, J., A. Raper, N. Sugita, R. Hingorani, M. Salio, M.J. Palmowski, V.
Cerundolo, and P.R. Crocker. Characterization of Siglec-H as a novel endocytic
receptor expressed on murine plasmacytoid dendritic cell precursors. Blood 107,
3600-3608 (2006).
165. Foulds, K.E., L.A. Zenewicz, D.J. Shedlock, J. Jiang, A.E. Troy, and H. Shen.
Cutting edge: CD4 and CD8 T cells are intrinsically different in their proliferative
responses. J Immunol. 168,1528-1532 (2002).
102

166. Hogquist, K.A., S.C. Jameson, W.R. Heath, J.L. Howard, M.J. Bevan, and F.R.
Carbone. T cell receptor antagonist peptides induce positive selection. Cell 76, 17-27
(1994).
167. Zhong, G., C. Reis e Sousa, and R.N. Germain. Antigen-unspecific B cells and
lymphoid dendritic cells both show extensive surface expression of processed antigenmajor
histocompatibility complex class II complexes after soluble protein exposure in
vivo or in vitro. J Exp Med. 186, 673-682 (1997).
168. Williams, G.S., A. Oxenius, H. Hengartner, C. Benoist, and D. Mathis. CD4+ T
cell responses in mice lacking MHC class II molecules specifically on B cells. Eur J
Immunol. 28, 3763-3772 (1998).
169. Reis e Sousa, C., and R.N. Germain. Analysis of adjuvant function by direct
visualization of antigen presentation in vivo: endotoxin promotes accumulation of
antigen-bearing dendritic cells in the T cell areas of lymphoid tissue. J Immunol. 162,
6552-6561 (1999).
170. Attanavanich, K., and J.F. Kearney. 2004. Marginal zone, but not follicular B
cells, are potent activators of naive CD4 T cells. J Immunol. 172, 803-811 (2004).
171. Itano, A.A., S.J. McSorley, R.L. Reinhardt, B.D. Ehst, E. Ingulli, A.Y.
Rudensky, and M.K. Jenkins. Distinct dendritic cell populations sequentially present
antigen to CD4 T cells and stimulate different aspects of cell-mediated immunity.
Immunity 19, 47-57 (2003).
172. Kitamura, D., and K. Rajewsky. Targeted disruption of mu chain membrane
exon causes loss of heavy-chain allelic exclusion. Nature 356, 154-156 (1992).
173. Bennett, C.L., E. van Rijn, S. Jung, K. Inaba, R.M. Steinman, M.L. Kapsenberg,
and B.E. Clausen. Inducible ablation of mouse Langerhans cells diminishes but fails
to abrogate contact hypersensitivity. J Cell Biol. 169, 569-576(2005).
174. Sixt, M., N. Kanazawa, M. Selg, T. Samson, G. Roos, D.P. Reinhardt, R. Pabst,
M.B. Lutz, and L. Sorokin. The conduit system transports soluble antigens from the
afferent lymph to resident dendritic cells in the T cell area of the lymph node.
Immunity 22, 19-29 (2005).
175. Benitez-Ribas, D., G.J. Adema, G. Winkels, I.S. Klasen, C.J. Punt, C.G. Figdor,
and I.J. de Vries. Plasmacytoid dendritic cells of melanoma patients present
exogenous proteins to CD4+ T cells after Fc gamma RII-mediated uptake. J Exp Med.
203, 1629-1635 (2006).
176. Hawiger, D., K. Inaba, Y. Dorsett, M. Guo, K. Mahnke, M. Rivera, J.V. Ravetch,
R.M. Steinman, and M.C. Nussenzweig. Dendritic cells induce peripheral T cell
unresponsiveness under steady state conditions in vivo. J Exp Med. 194, 769-779
(2001).
177. Itano, A.A., and M.K. Jenkins. Antigen presentation to naive CD4 T cells in the
lymph node. Nat Immunol 4, 733-739 (2003).
178. Sporri, R., and C. Reis e Sousa. Inflammatory mediators are insufficient for full
dendritic cell activation and promote expansion of CD4+ T cell populations lacking
helper function. Nat Immunol. 6, 163-170 (2005).
179. Yang, C.P., S.M. Sparshott, D. Duffy, P. Garside, and E.B. Bell. 2006. The
phenotype and survival of antigen-stimulated transgenic CD4 T cells in vivo: the
influence of persisting antigen. Int Immunol. 18, 515-523 (2006).
180. Mahnke, K., Y. Qian, J. Knop, and A.H. Enk. Induction of CD4+/CD25+
regulatory T cells by targeting of antigens to immature dendritic cells. Blood 101,
4862-4869 (2003).
181. Swiggard, W.J., A. Mirza, M.C. Nussenzweig, and R.M. Steinman. DEC-205, a
205-kDa protein abundant on mouse dendritic cells and thymic epithelium that is
103

detected by the monoclonal antibody NLDC-145: purification, characterization, and
N-terminal amino acid sequence. Cell Immunol. 165, 302-311 (1995).
182. Asselin-Paturel, C., G. Brizard, K. Chemin, A. Boonstra, A. O'Garra, A. Vicari,
and G. Trinchieri. Type I interferon dependence of plasmacytoid dendritic cell
activation and migration. J Exp Med. 201, 1157-1167 (2005).
183. Yoneyama, H., K. Matsuno, Y. Zhang, T. Nishiwaki, M. Kitabatake, S. Ueha, S.
Narumi, S. Morikawa, T. Ezaki, B. Lu, C. Gerard, S. Ishikawa, and K. Matsushima.
Evidence for recruitment of plasmacytoid dendritic cell precursors to inflamed lymph
nodes through high endothelial venules. Int Immunol. 16, 915-928 (2004).
184. Iwasaki, A., and R. Medzhitov. Toll-like receptor control of the adaptive immune
responses. Nat Immunol. 5, 987-995 (2004).
185. Jarrossay, D., G. Napolitani, M. Colonna, F. Sallusto, and A. Lanzavecchia.
Specialization and complementarity in microbial molecule recognition by human
myeloid and plasmacytoid dendritic cells. Eur J Immunol. 31, 3388-3393 (2001).
186. Hermans, I.F., D.S. Ritchie, J. Yang, J.M. Roberts, and F. Ronchese. CD8+ T
cell-dependent elimination of dendritic cells in vivo limits the induction of antitumor
immunity. J Immunol. 164, 3095-3101 (2000).
187. Wong, P., and E.G. Pamer. Feedback regulation of pathogen-specific T cell
priming. Immunity 18, 499-511 (2003).
188. Janssen, E.M., E.E. Lemmens, T. Wolfe, U. Christen, M.G. von Herrath, and
S.P. Schoenberger. CD4+ T cells are required for secondary expansion and memory
in CD8+ T lymphocytes. Nature 421, 852-856 (2003).
189. Webster, B., E.H. Ekland, L.M. Agle, S. Chyou, R. Ruggieri, and T.T. Lu.
Regulation of lymph node vascular growth by dendritic cells. J Exp Med. 203, 1903-
1913 (2006).
190. Nagasawa, T. New niches for B cells. Nat Immunol. 9, 345-346 (2008).
191. Bernhagen J, Krohn R, Lue H, Gregory JL, Zernecke A, Koenen RR, Dewor M,
Georgiev I, Schober A, Leng L, Kooistra T, Fingerle-Rowson G, Ghezzi P, Kleemann
R, McColl SR, Bucala R, Hickey MJ, Weber C. MIF is a noncognate ligand of CXC
chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med. 13,
587-96 (2007).
192. Matsushita K, Hamabe M, Matsuoka M, et al. Experimental hematogenous
osteomyelitis by Staphylococcus aureus. Clin Orthop Relat Res. 334, 291-297 (1997).
193. Lenz LL, Butz EA, Bevan MJ. Requirements for bone marrow-derived antigenpresenting
cells in priming cytotoxic T cell responses to intracellular pathogens. J Exp
Med. 192, 1135-1142 (2000).
194. Shinkai, Y. et al. Restoration of T cell development in RAG-2-deficient mice by
functional TCR transgenes. Science 259, 822-5 (1993).
195. Fingerle-Rowson, G. et al. The p53-dependent effects of macrophage migration
inhibitory factor revealed by gene targeting. Proc Natl Acad Sci. U S A 100, 9354-9
(2003).
196. Mackay, F., Schneider, P., Rennert, P. And Browning, J. BAFF and APRIL: a
tutorial on B cell survival. Annu Rev Immunol. 21, 231-264 (2003).
197. Schiemann, B et al. An essential role of BAFF in the normal development of B
cells through a BCMA-independent pathway. Science 293, 2111-2114 (2001).
198. Gross, J. et al. TACI-Ig neutrolizes molecules critical for B cell development and
autoimmune disease: impaired B cell maturation in mice lacking BLys. Immunity 15,
289-302 (2001).
199. Stumptner-Cuvelette P and Benaroch P. Multiple roles of the invariant chain in
MHC class II function. Biochim Biophys Acta. 1542, 1–13 (2002).
104

200. Naujokas MF, Morin M, Anderson MS, Peterson M, Miller J. The chondroitin
sulfate form of invariant chain can enhance stimulation of T cell responses through
interaction with CD44. Cell 74, 257–268 (1993).
201. Gore Y, Starlets D, Maharshak N, Becker-Herman S, Kaneyuki U, Leng L,
Bucala R, Shachar I. Macrophage migration inhibitory factor induces B cell survival
by activation of a CD74-CD44 receptor complex. J Biol Chem. 283, 2784-92 (2008).
105

8. List of publications
8.1 Articles published in refereed journals (included in my thesis).
1. Sapoznikov A., Fischer, J.A.A., Zaft T., Krauthgamer R., Dzionek A. and S. Jung.
Organ-dependent In Vivo Priming of Naïve CD4 + , but not CD8 + T cells by
Plasmacytoid Dendritic cells. (2007) J Exp Med. 204(8):1923-33.
2. Sapoznikov A. *, Pewzner-Jung Y. *, Kalchenko V., Krauthgamer R., Shachar I.,
Jung S. Perivascular clusters of dendritic cells provide critical survival signals to B
cells in bone marrow niches. (2008) Nat Immunol. 9(4):388-95.
* equal contribution.
8.2 Articles in refereed journals (not included in my thesis).
1. Zaft, T.*, Sapoznikov, A.*, Krauthgamer, R., Littman, D.R. and S. Jung. CD11c high
dendritic cell ablation impairs Lymphopenia - driven proliferation of naïve and
memory CD8 + T cells. (2005) J Immunol. 175(10): 6428-35.
* equal contribution.
2. Vingert B, Adotevi O, Patin D, Jung S, Shrikant P, Freyburger L, Eppolito C,
Sapoznikov A, Amessou M, Quintin-Colonna F, Fridman WH, Johannes L, Tartour
E. The Shiga toxin B-subunit targets antigen in vivo to dendritic cells and elicits antitumor
immunity. (2006) Eur J Immunol. 36(5):1124-35.
3. Birnberg T., Bar-On L., Sapoznikov A., Caton M., Cervantes-Barragán L., Makia
D., Krauthgamer R., Brenner O., Ludewig B., Brockschnieder D., Riethmacher D.,
Reizis B., Jung S. Lack of conventional dendritic cells is compatible with normal
development and T cell homeostasis, but causes myeloid proliferative syndrome.
(2008) Immunity 29(6):986-97.
4. Hartmann TN., Grabovsky V., Wang W., Desch P., Rubenzer G., Wollner S.,
Binsky I., Vallon-Eberhard A., Sapoznikov A., Burger M, Shachar I, Haran M,
Honczarenko M, Greil R, Alon R. Circulating B-cell chronic lymphocytic leukemia
cells display impaired migration to lymph nodes and bone marrow. (2009) Cancer
Res. 69(7):3121-30.
8.3 Reviews
1. Sapoznikov A., Jung S. Probing in vivo dendritic cell functions by conditional cell
ablation. Review (2008) Immunol Cell Biol. 86(5):409-15.
106

8. Statement about independent collaboration
The manuscript entitled "Perivascular clusters of dendritic cells provide critical
survival signals to B cells in bone marrow niches" summarizes a study initiated by
Dr. Yael Pewzner-Jung, who first observed the reduction of the B cells upon DC
ablation. I substantiated the preliminary results and subsequently performed all the
experiments that led to the characterization of the underlying molecular mechanism.
The two-photon imaging was performed with the help of Dr. Vyacheslav Kalchenko.
The project entitled "The bone marrow immune niche: Bone marrow as a priming
site for naïve CD8 + T cells" is carried out in full collaboration with the laboratory of
Dr. Guy Shakhar, (Department of Immunology, WIS), specifically with the PhD
student Idan Milo. We contributed equally to the design of the experiments and
discussions. I performed and analyzed the experiments done by flow cytometry; the
purification of the cells, the adoptive transfers, the chimera preparation and
preparations of the cells and the mice for in vivo imaging. Idan performed the
intravital imaging and analyzed the results of the movies.
107

סיכום
T, ותאי
תאים דנדריטיים משחקים תפקיד מרכזי בשפעולם של תאי T ומבקרים את התגובה האוטוריאקטיבית.‏
תת-האוכלוסיות השונות של התאים הדנדריטים הינן בעלות תפקידים שונים.‏ למרות שהפנוטיפ והמיקום
האנטומי של תת-האוכלוסיות ידוע,‏ תפקידיהם אינם מובנים עד תום.‏ חקר מעורבותם של תאים דנדריטיים
במערכת יחסי גומלין עם תאים שונים,‏ כמו שפעול של מערכת החיסון או השתקתה,‏ דורש לימוד
תפקודיהם בתוך מערכת פיסיולוגית.‏ בנוסף,‏ אוכלוסיית התאים הדנדריטיים הינה דינאמית ביותר.‏
מסיבות אלו בעבודה זו נחקר תפקודם של התאים הללו באמצעות החסרתם המותנית בגוף החיי.‏
בחלק הראשון של העבודה,‏ התבצע אפיון פנוטיפי ותפקודי של תאים דנדריטיים המאכלסים את מח
העצם.‏ התגלו גומחות מיוחדות,‏ שתוחמו בצורה מבנית על-ידי מקבצים של תאים דנדריטיים,‏ אשר
ממוקמים בקרבה לדפנות כלי דם מסוימים במצב שיווי-משקל.‏ גומחות אלה מאוכלסות בתאי B בוגרים
דבר אשר מצביע על תפקידם במערכת חיסון הנרכשת.‏ להפתעתנו,‏ החסרה של תאים
דנדריטיים במח העצם גרמה לירידה ספציפית בתאי B בוגרים בגומחות.‏ באמצעות שימוש במודלים של
עכברים טרנסגניים ועכברים בהם בוצעה החסרה של גן מסוים,‏ גילינו את המנגנון המולקולארי,‏ אשר
גרם לירידה בתאי B. נמצא כי,‏ תאים דנדריטיים במח העצם מספקים לתאי B פקטור הישרדותי.‏ פקטור
B
,MIF
זה הינו הציטוקין אשר הכרחי לחיוניותם של תאי במח העצם.‏ זיהוי גומחות אלה,‏ המדמות
פוליקלים לימפואידים במח העצם מהווה פריצת דרך בהבנה,‏ כי מח עצם יכול לשמש מקום לתגובות
חיסוניות ראשוניות כנגד פתוגנים,‏ שמקורם בדם.‏
בחלק השני של העבודה,‏ גילינו את המקור של תאים דנדריטיים במח העצם,‏ אשר נוצרים מאב קדמון של
מאקרופאגים ותאים דנדריטיים,‏ הנקרא
תנועתיותם של לימפוציטים מסוג
,MDP
T
ללא שלב ביניים בו מתמיין למונוציטים.‏ בנוסף,‏ נחקרה
ו-‏B בגומחות,‏ המאוכלסות בתאים דנדריטיים במצב של שיווי-‏
משקל.‏ שימוש בשיטה חדשנית של דימות דו-פוטוני,‏ אפשרה להראות כי בגומחות המאוכלסות בתאים
דנדריטיים,‏
תאי T
נאיביים מסוג + CD8 יוצרים מקבצים רב-תאיים ומתמיינים לתאים אפקטוריים,‏ לאחר
מתן אנטיגן שמקורו בדם.‏ פעולה זאת מצביעה על תפקודו של מח העצם כעל איבר לימפואידי שניוני.‏
באופן בלתי צפוי,‏ נגלה כי תאי
CD8 + T
נאיבים שופעלו באופן יעיל גם לאחר החסרה של תאים
דנדריטיים במח העצם,‏ דבר אשר מטיל בספק את היותם של האחרונים הכרחיים כתאים מציגי אנטיגן
באיבר זה.‏ שימוש בכימרות,‏ אפשר להבין כי תאים,‏ אשר עמידים בפני קרינה,‏ הנקראים גם תאי סטרומה
היו חיוניים להצגה של אנטיגן ושפעול תאי CD8 + T בהעדר תאים דנדריטיים.‏ תוצאות אלו,‏ מדגישות את
התפקיד החדש של תאים שאינם המטופואטיים במח העצם.‏
לבסוף,‏ נחקרה יכולתם של תאים דנדריטיים מסוג פלסמציטואידיים
תאי
(PDCs)
T
להציג אנטיגנים.‏ תפקידם
זה אינו מובן עד תום,‏ עקב מחסור במערכת ניסויית מתאימה.‏ במערכות הקיימות,‏ תפקידם לשפעל את
תפקודם של תאי
ממוסך על-ידי נוכחותם של תאים דנדריטיים קונבנציונאליים
.(cDCs)
,PDCs
cDCs באופן מותנה,‏ אך לא נפגעו תאי
נחקרו תגובותיהם של תאי T מסוג
CD8 + - ו CD4 +
.PDCs
על מנת לעמוד על
בעכברים,‏ בהם הוחסרו
יתר על כך,‏ נעשה שימוש באסטרטגיה חדשה,‏ של הובלת
108

PDCs
cDCs או
אנטיגן באמצעות נוגדן ספציפי לתאי .PDCs שימוש בשיטות אלה,‏ אפשר להראות כי
אינם מסוגלים לתמוך בתגובות תאי T מכל סוג בטחולים של עכברים,‏ בהם הוחסרו עם זאת,‏
להפתעתנו,‏ נמצא כי בהעדר
.cDCs
,cDCs תאי
הלימפה.‏ באופן מעניין,‏ ובניגוד לתגובות המתווכות על-ידי
PDCs גרמו לשפעול יעיל של תאי
T מסוג + CD4 בבלוטות
,cDCs
PDCs נכשלו בשפעול תאי
T מסוג
.CD8 +
לאור תוצאותינו במחקר זה,‏ ניתן להגדיר את תאי
מסוגלים לאתחל תגובה ראשונית של תאי T עוזרים מסוג
,PDCs
.CD4 +
כתאים דנדריטיים טיפוסיים,‏ אשר
109