Half-time report 2001 - Microbiology main - Göteborgs universitet

The National Research School in
Genomics and Bioinformatics
half-time report 2001 - 2005
Hosted by:
Göteborg University (GU)
Partners:
Chalmers University of Technology (Chalmers)
Halmstad University College (HH)
Lund University (LU)
Skövde University College (HIS)
GÖTEBORGS UNIVERSITET
CHALMERS

The National Research School in Genomics
and Bioinformatics is governmentally supported
and hosted by Göteborg University
with partners at Chalmers University of
Technology, Halmstad University College,
Lund University and Skövde University
College.
h a l f - t i m e r e p o r t
Vision
It is the overall aim of the research
school to play the role of a strong
force in south-western Sweden for
research and education in the field
of Genomics and Bioinformatics,
and in that process strengthen the
links between the collaborating
universities at all possible levels.
CONTENT
A word from the Programme Director
Overview in brief
4
5
Student Presentations
Louise Olofsson
Anders Sjögren
Göran Karlsson
Spring Liu
Angelika Lindlöf
Markus Bräutigam
Daniel Dalevi
Liwen You
Lina Gunnarsson
Henrik Nilsson
Comments from supervisors
A word from two course leaders
Summerschool leaders
Statistics
Projects supported
Student Publications
An International outlook
6
7
8
9
10
11
12
13
14
15
16
20
22
24
26
28
30

A word from the programme director
From the beginning my colleagues have kept asking me: “Hi Anders, how is it going
with the research school? Does it work out well with the pair-projects? Are the students
good?” And what could I answer except – I don’t know. Yet!
However, we are now passing half-time and the results of this research school activity
are becoming more clear, and so now I respond to my colleagues: “Yes, we are making
constant progress with now, in half-time:
• more than 60 publications in good international journals;
• we have arranged 14 courses with the aim of improving our communication skills and
understanding of other disciplines;
• in total 12 Open Days in genomics and bioinformatics have been organised by all
partners with about 800 participants (many not from the research school);
• we have built a strong network of PhD students in the region, where some of them
even have met during the joint activities and later published jointly;
• international links have been established that will be good for both students and
science in general in the region via internationally renowned scientists who have
played important roles in activities like the summer schools and the annual conference
in “Functional Genomics.”
I also tell my colleagues that the annual workshop, where we discuss and evaluate all the
research projects (by oral presentations or posters), displays fascinating scientific projects
where great progress is being made around a wide variety of questions: What determines
the cold-resistance in oat? What genes are linked to breast cancer? Can we find good
bio-markers in fish for toxicity? What determines that some gets allergic?
“Yes, I think we are doing well!”
We have also shown that integration of different research topics, disciplines and environments
does not necessarily have to depend on financing and creating new buildings
and physical centres. This is generally believed to be the key component when creating
modern multidisciplinary high quality research institutions. The research school design
constitutes an alternative more flexible solution to this via the formation of a “virtual
department” including a wide range of topics and several universities.
Most importantly, the research school builds a network of contacts for young scientists
in the region, PhD students who in a not too far future will be the leading scientists
in south-western Sweden (or elsewhere in the world). If in 10-years time this network
remains and the former PhD students now transformed into principle investigators and
experts continue to collaborate, integrate and ask each other for advice and now and
again publish jointly – then we have truly succeeded!
Anders Blomberg
Professor of Functional Genomics
Dept. of Cell and Molecular Biology, GU
Overview in brief
The Swedish Ministry of Education launched in 2000 what was one of
its strongest support for basic science in Sweden - 16 research schools
covering widely divergent topics. Key-words in this initiative were collaboration
– Sweden is small so we have to join forces, multidisciplinarity
– we have to think anew and cross borders, and the integration of
university colleges into strong research environments.
Göteborg University was selected as host for the Research Schools in
Genomics and Bioinformatics with partners from Chalmers University of
Technology, Halmstad University College, Lund University and Skövde
University College. The research school is headed by a board with
members from all partners. During spring 2001 the Faculty of Science
at Göteborg University approved the proposed programme plan.
A two-step process started where projects were initially selected and
then the Research School advertised for students. This procedure was
repeated twice and in total 150 projects applied from which 25 were
selected after a process where the projects were ranked based on three
criteria of equal weight: i) relevance to the field genomics and bioinformatics,
ii) quality of previous research and the proposed research plan,
and iii) the level and implementation of multidisciplinarity. The applications
were sent out to four external reviewers and based on their marks
the final decision was taken by the board of the Research School.
The announcement for students was successful and in total 170
students from 17 different countries applied. For each of the projects
several top candidates were selected for an interview. The end result of
this process was 25 students working on different high-quality projects
in genomics and bioinformatics with many projects having a pair-student
design; a theoretician and an experimentalist working together
within the same research project. More recently, the Research School
has been incorporating associated students who are supported from
other sources but where the student and supervisor have chosen to link
to the Research School activity. There are currently 47 PhD students
who are part of the Research School.
The Research School has a defined core curriculum that all students, independent
of their discipline, should complete. These mainly represent
courses and activities that are intended to widen their understanding of
other disciplines and enhance their communication skills over discipline
boarders. One of these compulsory activities are the Open Days in
Genomics and Bioinformatics, which is a one-daysymposium with a mix
of presentations from invited speakers and students and supervisors in
the school. These are held approximately every three months, with their
organisation circulating around the Research School partners. Another
compulsory activity is the summer school that has been arranged twice
with international leaders on the themes “Phylogenomics” (2003) and
“Systems Biology” (2004).
Do you want to know more?
Go to our web site
http://www.cmb.gu.se/research_school

Contributions
from some students
P a i r p r o j e c t
“Expression analysis by DNA microarray
– a tool in the identification of susceptibility for complex diseases”
Dept. of Internal Medicine, Göteborg University
supervisor – Lena Carlsson
PhD student - Louise Olofsson (GU)
We have designed a novel strategy for identification of susceptibility genes for complex diseases
based on transcriptional profiling. The novelty of our gene identification strategy is that we include
analysis of gene expression in samples from affected subjects and matched controls, before, during
and after treatment that ameliorates the disease. This enables exclusion of genes that differ in
expression between the groups as a consequence of the disease. Using this approach on subjects
with obesity-related metabolic disease we identified Zn-alpha2-glycoprotein (ZAG) as a potential
susceptibility gene for dyslipidemia i.e. abnormally high lipid (fat) levels in the blood. By serum
correlations, association and allelic imbalance studies we could link ZAG to dyslipidemia. These
results suggest that our strategy can be used to identify susceptibility genes for complex diseases
harbouring functional non-coding single nucleotide polymorphisms (SNPs).
In collaboration with Anders Sjögren and Mats Rudemo at the Dept. of Mathematical Statistics,
Chalmers University of Technology we have now expanded this study and included an increased
number of well characterized subjects. Using improved methods for DNA microarrays normalization,
background correction and quality control and new strategies for identification of susceptibility
genes, we will increase our chances to identify genes important for the development of the
disease. The collaboration with the people at Chalmers has also included a study aiming to identify
good reference genes for gene expression studies. The use of the bootstrap technique enabled us
to further develop the method described by Vandesompele et al for evaluating possible reference
genes.
The work together with my partner at Chalmers has improved our study planning, facilitated data
handling and led to new strategies for identification of susceptibility genes. Several parts of these
studies demand bioinformatics tools and better statistical method for improved data analysis. The
research school has increased my knowledge of these tools and methods and given me an extensive
network of colleagues.
ATGTCCGCTAAATCGTTTGAAGTCACAGATCCAGTCAATTCAAGTCTCAAAGGGTTTGCCATGTCCGCTAAATCGTTTGAAGTCACAGATCCAGTCAATTCAAGTCTCAAAGGGTTTGCC
PhD student - Anders Sjögren (Chalmers)
“Expression analysis by DNA microarray
– experimental design and statistical methods for finding susceptability genes of complex diseases”
Dept. of Mathematical Statistics, Chalmers University of Technology
supervisor – Mats Rudemo
The expression of genes partly controls the behaviour of the cells in the human body. By studying gene
expression under experimental conditions of interest, a detailed picture of the mechanisms involved can be
identified. This strategy can be used to identify the mechanisms of diseases, which can ideally help find the
perfect drugs.
I am involved in a cross-disciplinary project with Louise Olofsson, a PhD student in medicine, and her colleagues.
We try to identify mechanisms involved in obesity and diabetes. We examine gene expression for
tens of thousands of genes simultaneously, provided by the DNA microarray technique. The roles for me as a
statistician include experimental planning, quality control and identification of potentially relevant (=statistically
significant) genes from the data, which will later be examined by Louise and her colleagues to validate
relevant biological mechanisms. In the identification step, just a few genes are sought from tens of thousands
of genes measured in relatively few patients, containing substantial technical and biological variation. This is
indeed like searching for a needle in a haystack. To succeed in this task, one has to make the most out of the
data, exploiting as much structure hidden in the data as possible. This has called for novel statistical techniques,
which really have proven to be interesting challenges for the statistical community.
The statistical problem that I have focused on for the last two years is to improve quality control in microarray
experiments and to include this quantitatively in the analysis. We recently proposed a statistical model where
the different arrays may have different precision and where shared sources of variation may exist (modelled
as correlations). The benefit of the resulting method is that qualities are objectively estimated and incorporated
into the analysis, so that arrays of lesser quality automatically have a down-weighted impact on the
end result. Thus, the sharp decision of entirely excluding or including arrays with evidence of lesser quality is
avoided.
I find the cross-disciplinary collaboration rewarding, since it involves working with talented people with skills
and points of view complementing mine. It also brings new challenges into the picture, with the difficulties
of handling real data and the different objectives and languages of different disciplines. However, this only
makes research more interesting and rewarding. After all, how fun is an easily solved puzzle?

Contributions
from some students
P a i r p r o j e c t
PhD student - Göran Karlsson (LU)
PhD student - Spring Liu (LU)
ATGTCCGCTAAATCGTTTGAAGTCACAGATCCAGTCAATTCAAGTCTCAAAGGGTTTGCC
“Genetic control of stem cell fate decisions using engineered mouse model systems”
Dept. of Molecular Medicine and Gene Therapy, Lund University
supervisor – Stefan Karlsson
The growth factor TGF-beta is a regulator of important biological processes like the immune response, wound healing,
vessel formation and cancer. Additionally, it has been demonstrated that TGF-beta is a potent inhibitor of hematopoietic
stem cells (HSC; stem cells of different blood cells) growth in tissue culture. HSCs are multipotent, meaning that they
have the unique capacity to differentiate into all the different blood cells and at the same time self-renew, keeping
the stem cell pool intact. These features make the HSCs key players in the up-come as well as in treatment of human
hematopoietic malignancies, such as leukemias. Microarrays have been used to identify gene expression profiles for
many biological systems. It would be of importance to look for characteristic pathway activities for such gene profiles.
In particular, for microarray data from experiments designed to investigate one specific pathway, it would be interesting
to analyze crosstalk with other pathways. Such studies would serve as a starting point to explore networks of cross-talking
signalling pathways. The in vitro potential of TGF-beta to regulate HSC growth made us conduct gene expression
profiling experiments to identify the gene targets of TGF-beta signalling. In a primary study, microarrays and functional
analysis were performed on fibroblasts deficient in the TGF-beta receptor or stimulated with the TGF-beta ligand. The
study identified 465 gene targets of TGF-beta signalling and was published in March 2005 in Physiological Genomics.
It was previously reported that mouse models deficient in the TGF-beta receptor had normal HSC function despite the
documented effects of TGF-beta on HSCs in culture. The reason for this discrepancy is unknown, but it is appealing to
suspect redundant, compensatory mechanisms in the downstream Smad signalling network or cross-talk with other
pathways that may be relevant in the more complex and enduring in vivo setting. In a present study, we try to circumvent
these predicaments by investigating the effects of complete disruption of the Smad signalling pathway through deletion
of Smad4, a common signalling molecule for all the TGF-beta family ligands. Data from these mice demonstrate severe
defects in HSC functions as measured by bone marrow transplantation experiments. We are currently investigating the
mechanisms for these defects by performing similar microarray studies on HSCs as conducted in the previous study on
fibroblasts.
Through the research school an exceptional collaboration between our group and Yingchun Liu and Markus Ringnér
at the Department of Theoretical Physics has been initiated. For me personally, this collaboration has, together with
the interdisciplinary activities in the research school, immensely improved my understanding of statistical analyses and
experimental planning. Furthermore, through the heterogeneous composition of students, the school activities provide
an excellent forum for new ideas and inspiration. It has also been educational for me to be involved in the organization
of such activities, both when it comes to summer schools and open days.
“Gene expression analysis of hematopoetic stem cells using mouse model systems”
Dept. of Theoretical Physics, Lund University
supervisor – Markus Rignér
To take full advantage of this novel microarray data, we are developing methods to identify significant pathways in
gene signatures by looking for the over-representation of targets for transcription factors in specific pathways. As a
first test, we used the gene targets of the TGF-beta pathway from our previous study, and designed our method as
follows. We retrieved regulatory sequences of these genes from the UCSC genome database. We identified known
regulatory sequence motifs that were over-represented in the up-stream sequences of these genes by using the Toucan
software. The motifs were then related to their binding transcription factors based on the TRANSFAC database.
In our analysis we explored all transcription factors associated with a pathway in the TRANSPATH database. Finally,
we investigated if the transcription factors we found to be associated with the TGF-beta gene targets were significantly
associated with specific pathways.
Identifying significant pathways is challenging, since the mechanisms of many pathways have not been fully characterized.
The information about the transcription factors in individual pathways in the TRANSPATH database is far
from complete. Furthermore, crosstalk between pathways is itself intricate, since a transcription factor can play its
role in more than one pathway, and one motif may bind multiple transcription factors. This scenario has shown up
when we related common motifs to transcription factors, which led to a large number of transcription factors that
bind the gene signatures in question. To extract pathway activities hidden in such noise, we used statistical methods
to identify statistically significant pathways in which the transcription factors are involved. Interestingly, for our TGFbeta
gene targets, we found that the TGF-beta and Toll-like receptor-4 (TLR4) signalling pathways had much lower p-
values than other pathways. This finding suggests that our method can identify relevant pathways in gene expression
signatures. We are currently trying to improve the statistics, and are looking forward to applying the methods to our
Smad4 knockout HSCs data, as well as other datasets.
The two students and their supervisors working on this project share a common grant from the Research School in
Genomics and Bioinformatics. Additionally, the collaboration, including regular meetings, experimental planning and
analyzes, has been greatly facilitated by the activities organized by the research school, which have focused on the
networking and dialog between disciplines.

AAATCGTTTGAAGTCACAGATCCAGTCAATTCAAGTCTCAAAGGGTTTGCCATGTCCGCTAAATC
Contributions
from some students
P a i r p r o j e c t
PhD student - Angelika Lindlöf (HIS)
PhD student - Markus Bräutigam (GU)
“Using expression analysis and reconstruction of regulatory
pathways to understand frost tolerance in oat”
Dept. of Computer Science, Skövde University College
supervisor – Björn Olsson
The Swedish Oat project started in 2001 and is a joint effort between Gothenburg University, University of
Skövde and the VL-foundation (Västsvenska lantmännen). I am a PhD student at Skövde University and my collaboration
partner is PhD student Marcus Bräutigam at Gothenburg University. My discipline is mainly bioinformatics
and I have a computer science background.
The aim of this project is to develop an increased knowledge on frost tolerance in oat, Avena sativa, and in the
long-term to develop a frost tolerant oat variety. As a first step, 9 792 expressed sequence tags (ESTs) were
sequenced from a cDNA library of a cold induced winter oat variety. Several cold and/or drought induced genes
were identified, as well as several new genes not matching any genes present in the public databases.
The next step is now to compare this data set with publicly available ESTs from different libraries, such as nonstressed,
cold and drought, both from oat and related species. The aim is to identify potential cold acclimation
specific genes, which can be used in microarray experiments. The challenge here is to implement a method for
systematic comparison of gene expression across these libraries, to develop a suitable method for identifying
cold acclimation genes, and to streamline the annotation and analysis of the extracted genes. Since the EST
data sets consist of several thousands of sequences it is not possible to analyse all these sequences manually,
hence, computational methods are required. The comparative analysis will include using both existing, well-established
programs as well as newly developed ones. In the EST analysis part where individual ESTs are grouped
and assembled according to similarity, existing programs will be used, but for the remaining steps there will be a
need to develop customized programs.
Working within a multidisciplinary environment is very rewarding, since it gives you insights into many different
research areas, especially to the area where your collaborator is working within. The research school has
also made it possible to meet PhD students from other disciplines, which has given me insight to the challenges
these students have to face within their areas. The Open Days provide a great opportunity to establish contacts
with colleagues working within the same or adjacent areas, and from whom you can get valuable input to your
research problem.
“Development of frost tolerant oat (Avena sativa) by genetical engineering”
Dept. of Cell and Molecular Biology, Göteborg University
supervisor – Olof Olsson
Oat is a very promising functional food plant with characters like antioxidants, betaglucans and high levels of favourable
fatty acids and proteins. However, before any further improvement of these characters will be economically
feasible, yield has to be increased. The single most important limitation to oat yield in Sweden is the climate.
A Swedish winter oat, which presently does not exist, would increase yield by about 30% due to longer vegetation
periods. I joined the project in 2002 since it was a multidisciplinary project with a mix of both basic- and
applied science. In addition, this project also has a clear business potential.
The project can be divided in to three major activities. First we started a small scale sequencing project where
we sequenced approximately 10 000 EST sequences from cold acclimated oat plants. Together with my research
school partner we were assigned with the mission to functionally classify these sequences to put them into a
biological context. We have been able to identify a unique set of 2,800 oat genes (UniGene set) with potential
roles during the cold adaptation process in oat. The UniGene set has now been used in the second major activity
of the oat project were we have manufactured oat microarrays. These biochips will be used in studies to reveal
the expression profiles during the cold adaptation process in oat. Since the oat genome is not sequenced we
are also performing array studies in rice and by using knowledge gained from these experiments, together with
promoter analysis in both rice and oat, we will build a model of the regulatory network during cold acclimation
in oat. Finally the key regulatory genes will be used to develop knew molecular markers that can be used for efficient
selection of cold tolerant oat varieties in traditional breeding.
I think that overall the research school is providing a good environment for multidisciplinary research. It’s very
good to have the opportunity to network with colleagues during summer schools and open days. However, I
would have liked to see another theme selection during the summer schools, i.e. a microarray theme would have
been appropriate. An initial intention in this research school was to create multidisciplinary pair projects. Pair
projects have a great potential but they are also demanding since they require clear project goals and strong supervision.
Finally, our research school has the potential to create the multidisciplinary research environment that is
needed for successful research within the field of bioinformatics and functional genomics. But to be able to harvest
the research school´s full potential I think the initial PhD program should be followed by a post doc program.
10 11

Contributions
from some students
PhD student - Daniel Dalevi (Chalmers)
ATGTCCGCTAAATCGTTTATGTCCGCTAAATCGTTTGAAGTCACAGATCCAGTCAATTCAAGTCTCAAAGGGTTTGCC CTTGCTAACCCCTCCATTACGCTGGTCCCTGAAGAAAAAATTCTCTTCAGAAAGACCGATATGTCCGCTAAATCGTTTGAAGTCACAGATCCAGTCAATTCAAGTCTCA
PhD student - Liwen You (HH)
“Sequencing and phylogenetic studies of plasmids in marine bacteria”
Dept. of Computer Science, Chalmers University of Technology
supervisor – Devdatt Dubhashi/Malte Hermansson
Evolution is at present a well supported theory. The more easily comprehendible examples come
from everyday life where medical researchers are in constant battle with finding cures against
rapidly evolving diseases, e.g. bacteria become resistant and viruses change constantly to ensure
their survival against the immune defence. These changes in phenotype can all be traced back to
mutations in the genetic material, the DNA, or genome. Although it is not a general law, it seems
as if there is a tendency that the smaller the genome, the more rapidly an organism can change.
Therefore, since bacterial DNA is small compared to higher forms of life, they constitute perfect
sets for evolutionary studies. These studies are important and it cannot be said better than to
quote Gary Olsen,
“Each organism is a product of its history, knowledge of evolutionary relationships is essential to
understand the nature of any organism”.
Along with my two supervisors Devdatt Dubhashi (computing science) and Malte Hermansson
(microbiology) we perform evolutionary studies on small auxiliary chromosomes, so called plasmids,
which live inside bacteria. These small chromosomes, each acting like a vagabond, cannot
survive without being hosted by a bacterium. They move frequently and bring with them various
traits. They can even work as carriers of genetic material to another organism. The movement of
genes coding for different features, for example, antibiotic resistance, is an important mechanistic
factor of evolution. One of our goals is to identify and localise which genes that originate from
other organisms. Currently we developed tools and algorithms that can visualise structures in
DNA. The aim is to classify DNA according to their origin based on the content of DNA.
To work in a project that is in the boarder line between many different distinct sciences demands
a lot from me and my supervisors. The Research School in Genomics and Bioinformatics has provided
a good network for interacting with other students and other supervisors to discuss various
issues regarding the project. This has been crucial for the success we have had so far.
“Understanding protein feature prediction: in search for the optimal bias”
School of Information Science, Computer and Electrical Engineering, Halmstad University
supervisor - Denni Rögnvaldsson
The project I am doing is aimed at developing new guidelines, representations and algorithms to
answer biological and medical questions from available experimental research data.
At present, the project focuses on issues concerning protease cleavage and substrate specificity. The
project is expected to have future implications for several important areas of biomedical research,
since proteases are involved in a wide variety of physiological and pathological processes, such as
programmed cell death and infectious diseases.
My current work is to use machine learning methods to predict HIV-1 protease cleavage specificity
and find good templates for inhibitor design. We know that HIV-1 protease inhibitors are small
molecules, which bind tightly to the active site of the protease, but are not cleaved, so they compete
with natural substrates of the protease and hinder its normal functions in the viral life cycle. A problem
with clinical use of protease inhibitors is that the virus is able to develop drug-resistant strains.
This is due to its high mutation rate but possibly also because current inhibitors do not exploit all
aspects of the protease cleavage specificity. Therefore, a better understanding of the cleavage specificity
is probably necessary for developing more efficient inhibitors.
The challenge is to find good representation for sequence biological data, and to find algorithms
and underlying rules from a biological perspective. We have found some interesting results for HIV-1
protease cleavage specificity and published them in Bioinformatics and Journal of Virology. We are
now trying to extend our knowledge and discover broad interaction between enzyme and native
proteins.
During the two and half years, the research school has provided good courses and interesting workshops.
I like the membrane protein and molecular biology courses, especially their wet-lab parts,
in which I learned lots and I was so surprised at those amazing molecular biology experiments.
Working in a multidisciplinary field and to be an expert in bioinformatics, I definitely feel that I need
to have a thorough grasp both in molecular biology/biochemistry and computer science including
advanced statistics.
12 13

GCTAACCCCTCCATTACGCTGGTCCCTGAAGAAAAAATTCTCTTCAGAAAGACCGATATGTCCGCTAAATCGTTTGAAGTC
Contributions
from some students
associated student
associated student
PhD student - Lina Gunnarsson (GU)
PhD student - Henrik Nilsson (GU)
“Pharmaceuticals in the environment – development of biological fingerprints”
Dept. of Physiology and Pharmacology, Göteborg University
supervisor – Joakim Larsson
A great number of pharmaceutically active compounds pass our sewage treatment plants and reach the
aquatic environment. There is a risk that these substances may affect the normal physiology of wildlife since
pharmaceuticals are both biologically extremely potent and also often very stable. Of the water-living organisms,
fish are particularly susceptible to residual drugs as their physiology resembles ours and substances can
become bioconcentrated over the gills.
Biomarkers or biological responses that can reveal if organisms are exposed to and/or affected by certain
pollutants are very useful in environmental research. With the exception of biomarkers for estrogens, there is
a complete lack of validated, specific biomarkers to asses exposure of wildlife to pharmaceuticals.
This project is aiming to develop biomarkers (fingerprints) in fish for exposure to slowly degradable and
widely used pharmaceuticals. We will search for fingerprints by microarray analysis of hepatic mRNA expression
pattern in rainbow trout (Oncorhynchus mykiss) exposed to selected pharmaceuticals or sewage
effluent. The microarray analyses are performed with a newly developed chip, containing 16 000 salmonid
cDNAs, from the Canadian consortium GRASP (Genomic Research in Atlantic Salomon). Microarray analysis
is a new method within the field of ecotoxicology and to work with a species whose genome is not well
sequenced is challenging but also exciting.
mRNA expression patterns from fish exposed to the synthetic estrogen ethynylestradiol have been analyzed.
As expected we found the established biomarkers of estrogenic exposure, such as the genes vitellogenin
and vitelline envelope protein, among the most induced genes. Currently microarray data from fish exposed
to sewage effluent is being analyzed.
My research is part of a multidisciplinary project whose team members have backgrounds in fish physiology,
medical physiology, and molecular biology, organic and analytical chemistry. Despite the various competences
present in our group I sometimes lack a statistics and bioinformatics discussion partner. The research
school has provided valuable help with these issues. The activities arranged, like open days, are good
environments to meet and exchange ideas and information with other PhD students working with microarrays.
Especially interesting for me as a biologist are the discussions with students with mathematical and
computer science backgrounds. I have also found the courses in statistics and PERL programming helpful in
my microarray analysis.
“UNITE - a database of mycorrhixal fungal DNA sequences”
PhD in Systematic Botany, Dept. of Systematic Botany, Göteborg University
supervisor – Nils Hallenberg/Karl-Henrik Larsson
Fungi comprise a large and poorly understood group of organisms – the absolute majority of the estimated
2 million fungal species are still unknown to us. To make matters worse, many fungi are so similar – or in
fact lack distinct traits amenable to measurement or quantification altogether – that species identification, at
times, is little short of impossible. Yet, considering the major importance of fungi in our ecosystems as well
as in for example the food industry and medicine, it is a task that must be carried out; we simply need to be
able to identify a fungus – and indeed any organism - to species level.
DNA sequencing of organisms has provided traditional biology with an information source of unprecedented
resolution and consistency. Essentially, all you would need to do to identify a species is to sequence some
particular piece of its genome and compare it to that of other, previously identified organisms. This approach
is very efficacious and is used routinely today, but it is not devoid of complications. Erroneously annotated
and unidentified sequences in public databases obscure such comparisons, as does the fact that less than
1% of all fungi have been sequenced and are available for comparison. In addition, tradition bids use of DNA
similarity for these comparisons, but similarity is a poor conveyor of relatedness.
My research addresses mycorrhizal fungi – fungi that grow together with plants in symbiotic relationships
– and, in particular, the problems often encountered when trying to identify these. In collaboration with
researchers from the statistical and computational disciplines, we have developed a web-interfaced database
for DNA sequences of mycorrhizal fungi, and a new set of computational and statistical tools to be used for
their analysis. I am happy to see that my more practically oriented research on mycorrhizal fungi has been
given a real vitamin injection by these tools.
Working in interdisciplinary teams like this has meant the world to me – not only do you grow as a person,
but somehow the project itself always comes out far better than it would have otherwise. The new biology
that is taking shape before us is so rich in colour and nuance that it will take concerted efforts by researchers
from all disciplines to even begin asking the right questions, not to mention coming up with satisfactory
answers. In fact, one would have to call into question the circumscription of biology itself should elements of
statistics, mathematics, physics, and computational science be left out. For these - and other - reasons I am
very happy to be part of the multidisciplinary Research School. It is rewarding indeed.
14 15

Comments
from supervisors
Olle Nerman Karin Klinga-Levan Josef Bigun Carsten Peterson Lena Carlson
Supervisors have responded to the following questions:
1) Besides getting funding for one PhD student (which of course is good) what do you see as the main benefit
from this kind of joint, multidisciplinary research school activity when it comes to your research project as well as
the education/training of the PhD student?
2) Do you see any risk with this type of joint multidisciplinary activity?
3) Any suggestions for future developments of the research school concept?
Olle Nerman (Chalmers) (supervisor for fully-financed student Erik Kristiansson)
1. A statistician can choose to work theoretically inside generic standard models or applied, designing, modelling
and analysing specific real world experiments as well as deductive within adopted designs and models in connection
to those experiments . Genomics and molecular biology open fascinating opportunities for the latter, and
currently vitalise many academic disciplines, including statistics. The multi-disciplinary projects, especially those
with student pairs, in this graduate school is instrumental in making dreams come true and in linking disciplines
together. I am very impressed by the speed by which most of our students mature into open-minded, applied
scientists. The varied background of the students give an open, fruitful atmosphere in the school. The open days,
courses and workshops so far have been quite excellent.
2. The main risk is that the supervisor teams develop “relational trouble” and give diverse directions to the students.
In a small scale this is a part of the training and the risk of more serious clashes is quite much smaller in the
pair design provided complementary student skills.
3. The associated student concept has worked very well. A new round of associated students should be recruited
as soon as possible. Close collaboration with the northern, Stockholm University-lead twin school, and the Karolinska
Institute-organised Research School in Medical Bioinformatics, in organising special topics courses would result
in better economy, flexibility and quality for students in their final years . For long term survival, which I think the
school deserves, it is tricky to only use the association-idea, because of inherit lack of mechanisms generating new
pairs.
Karin Klinga-Levan (HIS) (supervisor for fully-financed student Sandra Karlsson)
1. That the PhD students meet other students and learn about other types of projects. The student-student “meetings”
can lead to future cooperation. The possibility to hear about other projects can give new ideas in their own
projects.
Josef Bigun (HH) (supervisor for fully-financed student Martin Persson)
1. The collaboration motivated us to learn more about the questions of our colleagues in proteomics. Efficient
multidimensional image analysis techniques can provide new approaches to help answering questions effectively.
Perhaps most rewarding is that we, together with our colleagues, discover new questions in the course of the collaboration.
2. Important questions and results are not given sufficient attention because the breadth of knowledge might not
develop as fast as the depth in fast changing research.
3. Residential workshops (~1 month): PhD students follow courses, lectures in the morning and work towards a
deliverable implemented on common servers in the afternoons.
Carsten Peterson (LU) (supervisor for fully-financed student Carl Troein)
1. PhD students get confronted with a diversity of subjects and other students/supervisors that would not have
been the case otherwise. Many of the courses would not have been given at a single department.
2. As always with interdisciplinary programs you may have students enrolling because they think it is a cheap way
of getting a PhD exam.
3. PhD subject proposals should be more truly interdisciplinary than has been the case for our school.
Lena Carlson (GU) (supervisor for fully-financed student Louise Olofsson)
1. The research school has provided an extremely valuable contact with researchers from another field and this has
been very important for the training of the PhD student funded by the research school. However, I believe that the
main benefit is that the activities that started within the research school have been extended to include my entire
research group resulting in collaborative projects. Thus, I believe that the research school stimulates multidisciplinary
research in a way that goes beyond the training of the PhD student.
2. No.
2. I think that the research school concept is very good because it supports cooperation between the universities
in Sweden. Especially for the small ones, it is important to make them visible as competent participants in the
academic world.. It is good with the ”open days”, but one each term would be enough.
16 17

Comments
from supervisors
Graham Kemp Cecilia Emanuelsson Lars Förlin
Graham Kemp (Chalmers) (supervisor for associated student Merja Karjalainen)
1. The range of activities offered by the Research School has helped to build an open collaborative spirit within
the School. Everyone involved with the School has gained intellectual stimulation through exposure to a broad
range of scientific questions. The School’s open days and workshops present opportunities to meet with
scientists from disparate fields and to be informed of new developments. Through participation in the School’s
events, students gain an awareness and appreciation of research activities in different disciplines. Students
also gain experience in presenting their own research to colleagues with different backgrounds at the School’s
open days and workshops, which provide students and supervisors with regular forums to review progress and
obtain feedback on different facets of the projects.
2. No.
3. I believe that future developments within the Research School should focus even more strongly on those
multidisciplinary research activities that are not addressed or well served by traditional single-discipline research
schools.
Cecilia Emanuelsson (LU) (supervisor for associated student Rickard Alm)
1. PhD students become exposed to other projects, similar in conceptual and methodological aspects to his/her
own PhD project, which increases the intellectual “critical mass” which is an instant quality gain. In a longer
perspective, the contacts made among students is likely to give a further scientific quality increase. Access to a
good set of PhD courses is also important.
Lars Förlin (GU) (supervisor for associated student Eva Albertsson)
1. The main benefit is to regularly meet other scientists and exchange experiences and ideas both within your
own field but more important also get inspired (in mutual ways) to reach beyond that and gain new scientific
insight valuable for the project.
2. Important is to optimise the balance between the research school mulitidisciplinary activities and the interdisciplinary
activities. Both take time and effort. Still, it seems to me as if such multidisciplinary research schools
are among the best ways to educate young scientists. It will be naturally for them to create contacts points also
outside their own field of science in their future work.
3. From my point of view being a supervisor I would like to take more of my time to participate in the research
school activities, i.e. give it more priority. When it comes to practice it is a matter of time and thus money. I
do not favour that funding should be taken to subsidise us supervisors but more force and/or encouragement
should make us more active in the research school.
Also, a thought about the PhD-students future career. In the Science -faculty (Göteborg University) suggestion
about the PhD-student plans that should be written at the start of the studies and each year revised should
include a future career plan. Is this handled in the current research school? One suggestion would be that a
research school has a few post-doc positions, available at the end of research school period? For example 1-2
such positions for each ten PhD positions?
2. I can see mostly advantages, few disadvantages.
3. In addition to some joint activities (workshops, open days) students could perhaps make exchanges between
laboratories - working in another laboratory is often tremendously awarding. Students could select a.
one lab among their fellow PhDs in the Research school to work in for a couple of weeks, and b. one visit to
any laboratory in the world.
18 19

A word from two
course leaders
Lars Hederstedt (LU)
Course: Membrane proteins – a practical course for theoreticians
Research education of high quality for graduate students requires access to advanced courses. Programs with graduate
student courses must include topics from many different traditional disciplines and research directions and need
to be long term in order for the same course to be given repeatedly (this makes each course accessible for many
students and they can together with their supervisors better plan the research education). National graduate research
schools, such as the Research School in Genomics and Bioinformatics, offer an excellent environment for multi-disciplinary
course programs. This is because the programs include students with different backgrounds from many
disciplines and engage research groups with a wide variety of scientific skills and interests.
Main benefits of multi-disciplinary course programs
• Better trained and satisfied students.
• New methods are more rapidly disseminated among research groups.
• More enthusiastic researchers (both course leaders/teachers and graduate students).
• An investment in the research potential of universites.
• Increased contacts and exchanges across university, faculty and discipline borders (concerns both scientists and students).
“Membrane proteins” is one example of a course that timely addresses a topic that is very important in the fields of
life science. This course has attracted and trained graduate students from widely different disciplines. The one week
long course, financed by the Research School in Genomics and Bioinformatics, was first given in February 2003 and
was repeated in February 2005. The course focuses on the biochemistry, bioinformatics, biophysics and physiological
functions of membrane proteins. It is aimed for students with little previous wet laboratory experience. It is a full time
intensive course with theory and extensive experimental work. The course is held at the Department of Cell & Organism
Biology, Lund University, by teachers that are experts in membrane proteins. Some of the teachers are recruited
from other universities in (Göteborg and Stockholm) and outside Sweden (Imperial College, London; Groningen, The
Netherlands).
Denni Rögnvaldsson (HH)
Course: PERL for biologists
The course is an introductory course to programming, using the Perl programming/scripting language.
The course is aimed towards people with no background at all in programming and hence introduces
the very basic concepts of programming, like explaining what a “program” is, what variables are, how
data is input and output, loops, if-then statements etc.
There are two challenges for this course: a conceptual one and a timing one. The conceptual one is
how to help people that do not know (or have no memory of) how to formalise a problem in the “algorithmic”
way to understand how this is done and how a program is constructed. The timing one regards
how this is done in 2 weeks (one week with attendance in Halmstad and one week with a home
assignment). We had great help from a bioinformatics course developed in Lund (for the Bioinformatics
Master program there) when designing the course for people with no algorithmic background, the
course builds very much on the first parts of the Lund course. The time issue was “solved” by providing
a challenging examination task for the second week, dealing with biological database type data,
which the students were given roughly a month to finish. The examination tasks were designed to
make the students apply all the parts of the course to a practical problem, so that we were certain that
the basic concepts had been absorbed.
My impression is that the course worked out well (judging from the feedback from the students) both
times it has been given, but better the second time (we teachers learn as well).
There are definitely too few academic courses of this type, courses that provide a quick introduction
into a subject with the main purpose of making the participants productive with the tool in question.
In total 19 graduate students have so far taken the “Membrane proteins” course. There is a wide distribution in disciplines
(medicine, statistics, biology, biotechnology, physics, ecology, computer science, biophysics etc) and affiliations
[Göteborg (Chalmers and the University), Halmstad, Lund, Malmö (University Hospital) and Skövde] of the students.
According to evaluations graduate students very much appreciate the course and recommend it to others.
20 21

Summerschool
leaders
Jack Heinemann
Dept. of Gene Ecology, University of Canterbury, Christchurch, New Zeeland
Course leader summerschool 2003 – “Phylogenomics”
I had the honour of leading the Phylogenomics course, and the challenge of introducing the first summer course
in 2003. Since I was working on the planning from New Zealand, and the course was in Sweden, the challenges
were large. There were many teething problems in the months before the course, but by the time the course
launched, the hard work and strong support from the staff on the ground in Göteborg erased most of the logistic
problems. Having also participated in the second summer school 2004, I saw that the infrastructure we tested in
2003 was largely retained and further improved.
The concept of the School is well reflected in the interdisciplinary topics of the courses. The courses use students
with a mix of specialist backgrounds needing to work cooperatively toward a common goal that cannot be
achieved by any single specialist. The students within the School have the advantage of being favourably predisposed
to interdisciplinary work (or they would not have applied to the School) and are encouraged through their
own research to work across the traditional boundaries biologists, mathematicians, statisticians and computer
scientists like to impose around themselves.
Interdisciplinary research is difficult, even for those who embrace it. While I can be convinced of the value, that
alone does not absolve me of enduring the same pain of the learning curve that might keep others from attempting
to be interdisciplinary. I believe this is also true for the students. Although younger and less constrained by a
lifetime of thinking within a particular discipline, they still already have been indoctrinated into the techniques of
thinking that characterise their undergraduate degrees. This is a lot to undo, and of course it is not the goal of the
School to discard the lessons of its component disciplines; I believe that it is the goal to build upon their synergies.
So did the summer school courses work?
My feeling is that the courses did work. Their full value may not be realised immediately. In fact, I think most
of the value will not even be consciously recognised at all. I realised the second year just how much better the
students were at working with one another. Everyone was now familiar with the structure of the course and their
surroundings, both physical and social. Feeling more confident at communicating across discipline boundaries,
even if it is because you have come to enjoy the company of people in different fields and believe that you can
trust them to not embarrass you too much, is an achievement that may not be fully appreciated until these students
attempt to make new interdisciplinary collaborations.
Olaf Wolkehauer
Professor in Computer science and Bioinformatics
Dept. of Computer Science, University of Rostock, Germany
Course leader Summerschool 2004 – “Systems biology”
The life sciences benefit from collaborations with theoreticians, data analysts and modellers but it is not easy to
realize successful interdisciplinary collaborations: the different subject languages, working practices and different
‘cultures’ naturally cause problems. However, the main challenge has really more to do with the things we are
trying to understand – biological systems are incredibly complex and challenge the confidence developed in the
engineering and physical sciences. The truth is that we cannot simply understand a biological system as a physical
system: the complexity, beauty and functionality of a simple bacterial cell ridicules any technological achievement
humankind has ever been proud of. Interdisciplinary research in genomics and bioinformatics is not simply about
the application of previously developed or established tools and techniques to biological data; both camps are
equally challenged.
It is naïve to expect a biologist to become a statistician, a computer scientist to become a molecular biologist and
yet we require an appreciation and knowledge from the opposite discipline. I believe the only way interdisciplinary
research in the life sciences can succeed is when everyone involved is equally fascinated by the biological questions
under consideration. To create an environment in which interdisciplinary research can succeed, you need
to offer courses that condense and explain the essence of the disciplines involved, developing an appreciation of
the other knowledge domain. Secondly, you need people who “get on”, and to provide an environment in which
people can meet and communicate across disciplines. Good collaborations cannot be forced; they are outliers in a
statistic of failed attempts.
Your research school, with its summer schools and open days, is an excellent example for an environment in
which one can effectively gain an appreciation of new material and interact with others. The Systems Biology
summer school which I organised for you was a first for me. I have learned from this experience and while I now
try to make my material more accessible to the biologists, I also accept now that one cannot expect all students
to succeed with interdisciplinary research. Modern life sciences, bioinformatics and systems biology require exceptionally
good students.
Your research school is an incubator for well trained interdisciplinary scientists and I hope to collaborate with
some of them in the future. Thank you for the opportunity to get involved in your research school – I wish you all
the success this risky and challenging endeavour deserves.
I took much from my experience. I learned so much just in preparing for the Phylogenomics course, and I now use
some of that material in my teaching in New Zealand. On a personal level, I feel strongly bonded to the School
and the many staff and students who were so receptive to me.
22 23

Statistics
Students // Courses // Seminars//Workshops//Conferences
NUMBER OF STUDENTS
Total number of PhD students in December 2005 are 25 fully financed and 22 associated students. Female students 49%.
There is roughly an equal mix of students with a theoretical and experimental background.
fully financed
associated
male female total male female total
GU 5 1 6 8 11
CHALMERS 5 2 7 2
hh 2 0 0 0
HIS 0 2 2 0 1 1
LU 4 4 8 5 3 8
-------------------------- ---------------------------
total 5 10 25 9 13 22
EXAMINATION TOPICS
Examination topics, fully financed students (25)
cell and molecular biology, computer science, internal medicin, chemical reaction engineering, mathimatical statistics,
mathematics, medical biochemistry, microbial exology, microbiology, molecular biology, molecular biotechnology, molecular
medicine, protein technology, signals and systems, theoretical physics
Examination topic, associated students (22)
cell and molecular biology, clinical chemistry, computer science, ecology, genetics, internal medicine, mathematical statistics,
medical biochemistry, microbial ecology, pediatrics, plant biochemistry, systematic botany, zoology
COURSES 2001 – 2005
“Public Bioinformatics Tools and Databases” - compulsory course
2002, Björn Olsson/Graham Kemp, HIS/Chalmers
“Etik och forskningsetik” - compulsory course
2002, Stellan Wellin, GU
“Membrane Proteins” - optional course
2003, Lars Hederstedt, LU
“Statistics for genomic science” - compulsory course
2003, Olle Nerman, Chalmers
“Summer School - PHYLOGENOMICS” - compulsory course
2003, Jack Heinemann, New Zeeland
“Basics in molecular biology for bioinformaticians” - compulsory course
2003, Anders Blomberg, GU
“Public Bioinformatics Tools and Databases” - compulsory course
2003, Björn Olsson/Graham Kemp, HIS/Chalmers
“Ethics and research ethics” - compulsory course
2003, Stellan Wellin, GU
“PERL for biologists” - compulsory course
2003, Thorstein Rögnvaldsson, HH
“PERL for bioinformaticians” - optional course
2004, Thorstein Rögnvaldsson, HH
“Summer School - “SYSTEMS BIOLOGY” - compulsory course
2004, Olaf Wolkenhauer, Germany
“Statistics for genomics” - compulsory course
2005, Olle Nerman, Chalmers
“Membrane Proteins - lab-course for theoreticians” - optional
course
2005, Lars Hederstedt, LU
“PERL for biologists” (PERL I) - compulsory course
2005, Thorstein Rögnvaldsson, HH
COMPULSORY COURSES ARRANGED
BY THE RESEARCH SCHOOL
The core curriculum for the students is defined by these compulsory courses:
Public Bioinformatics Tools and Databases (2p)
Ethics and research ethics (2p)
Basic Statistics for Genome science (3p)
Basics in Molecular Biology (5p)
Basic Programming - a PERL course for beginners (2p)
Popularising Science (1p)
Participation in Open Days in Genomics and Bioinformatics (max points 2p)
Participation in Summer schools (max 3 p)
TOTAL BASIC COURSE POINTS 20
(Students have different backgrounds. It is expected that students already have
knowledge that corresponds to courses representing roughly 5 points)
OPEN DAYS IN GENOMICS AND
BIOINFORMATICS 2002 - 2005
The research school arranges seminars/mini-symposiums. To stress that these
events are open to everyone interested, and not only to students and supervisors
directly linked to the research school, they are called “Open Days in “Genomics
and Bioinformatics”. Organisation circulates among the partners. In total about
800 participants for the 12 Open Days arranged in the period 2001 – 2005.
GÖTEBORG (Univ.) 2002 May 22 Host: Anders Blomberg
SKÖVDE 2002 September 25 Host: Björn Olsson
LUND 2002 December 5 Host: Anders Tunlid
GÖTEBORG (CTH) 2003 February 5 Host: Olle Nerman
HALMSTAD 2003 April 7 Host: Josef Bigun
GÖTEBORG (Univ.) 2003 November 12 Hosts: Per Sunnerhagen/Markus Tamas
SKÖVDe 2004 February 26 Host: Karin Klinga-Levan
HALMSTAD 2004 October 6 Host: Thorsteinn Rögnvaldsson
LUND 2004 November 25 Hosts: Ola Hössjer/Azra Kurbasic
GÖTEBORG (CTH) 2005 February 8 Host: Graham Kemp/
merja Karjalainen/Daniel Dalevi
LUND 2005 May 4 Hosts: Stefan Karlsson/Göran Karlsson
GÖTEBORG (Univ.) 2005 November 24 Host: Lars Förlin/Joakim Larsson/
eva Albertsson/Lina Gunnarsson
SUPPORT/ORGANISATION OF CONFERENCES:
“FUNCTIONAL GENOMICS - the flowering future” 2001; Göteborg
“FUNCTIONAL GENOMICS - visualising the complexity” 2002; Göteborg
“FUNCTIONAL GENOMICS - genome communication” 2003; Göteborg
“FUNCTIONAL GENOMICS - from birth to death” 2004; Göteborg
“FUNCTIONAL GENOMICS - quantitative biology” 2005, Göteborg
BIOINFORMATICS (national workshop) 2004, Lund
BIOINFORMATICS (national workshop) 2005, Göteborg
WORKSHOPS
Workshops where all projects are being presented and discussed have been arranged
annually - 2001, 2002, 2003, 2004, 2005 (2005 jointly organised at the
island Marstrand toghether with the the other national Research School in Genomics
and Bioinformatics, hosted by Stockholm University).
THE BOARD FOR THE RESEARCH SCHOOL
The board has representatives from all partners. From 2002 also
2 student representatives have been part of the board (elected
for one year). All in all there have been 21 board meetings from
2001 – 2005.
The current board May, 2005 –
Anders Blomberg - Program Director, GU
Jöran Bergh - Board Chairman, GU
Tommy Nilsson, GU
Olle Nerman, Chalmers
Thorstein Rognvaldsson, HH
Carsten Petersson, LU
Cecilia Emanuelsson, LU
Björn Olsson, HIS
Michael Thorsen, student member, GU
Sandra Karlsson, student member, GU
The board between 2001 - April, 2005
Anders Blomberg - Program Director, Board Chairman, GU
Anna-Stina Sandelius/Margareta Wallin/Jöran Bergh, GU
Håkan Billig, GU
Olle Nerman, Chalmers
Thorstein Rognvaldsson, HH
Carsten Petersson, LU
Cecilia Emanuelsson, LU
Björn Olsson, HIS
Student members between 2002 – April, 2005 (one year each)
Peter Samsson
Tobias Gebäck
Liwen You
Merja Karjalainen
Yingchun Liu
Mikael Johansson
CONTACT DETAILS
Anders Blomberg - Program Director, GU
Department of Cell and Molecular Biology
Lundberg Laboratory
Göteborg University
P.O Box 462
413 19 Göteborg
phone: +46 31 773 2589
e-mail: anders.blomberg@gmm.gu.se
24 25

Projects supported
by the Research School
The following projects are supported by the research school (25 fully supported students and
22 partially supported - i.e. associated students). The multidisciplinary design of the research
school is clearly apparent in the large number of disciplines/examination topics represented.
Starting year in the research school is indicated.
FULLY FINANCED STUDENTS
(ordered alphabetically after examination topic)
“Type 2 diabetes and lipotoxicity: Elucidation of mechanisms of lipid induced type 2 diabetes
through mRNA, protein and metabolite mapping of tissues from mouse models of hormonesensitive
lipase”
PhD in Cell and Molecular Biology, Dept. of Cell and Molecular Biology, Lund University
PhD student - CELINE FERNANDEZ (start 2002)
supervisor - CECILIA HOLM
“A metabolome and metabolic modeling approach to functional genomics”
PhD in Chemical Reaction Engineering, Dept. of Chemical reaction Engineering, Chalmers
Universty of Technology
PhD student - MIKAEL JOHANSSON (start 2002)
supervisor — CARL JOHAN FRANZÉN
“Understanding expression analysis and reconstruction of regulator pathways to understand
frost tolerance in oat”
PhD in Computer Science, Dept. of Computer Science, Skövde University
PhD student - ANGELICA LINDELÖF (start 2002)
supervisor — BJÖRN OLSSON
“Sequencing and phylogenetic studies of plasmids in marine bacteria”
PhD in Computer Science, Dept. of Computer Science, Chalmers University of Technology
PhD student - DANIEL DALEVI (start 2003)
supervisor - DEVDATT DUBASHI/MALTE HERMANSSON
“Databases with image content query and retrieval for Proteomics”
PhD in Computer Science or Electrical Engineering, School of Information Science, Computer
and Electrical Engineering, Halmstad University
PhD student - MARTIN PERSSON (start 2002)
supervisor — JOSEF BIGUN
“Understanding protein feature prediction: in search for the optimal bias”
PhD in Computer Science or Electrical Engineering, School of Information Science, Computer
and Electrical Engineering, Halmstad University
PhD student - LIWEN YOU (start 2002)
supervisor — THORSTEINN RÖGNVALDSSON
“Expression analysis of genes involved in the development of adenocarcinomas in a rat model
of human endometrial cancer”
PhD in Genetics, Dept. of Natural Science, University of Skövde
PhD student - SANDRA KARLSSON (start 2003)
supervisor - KARIN KLINGA-LEVAN
“Expression analysis by DNA microarray – a tool in the identification of susceptibility for
complex diseases”
PhD in Internal Medicine, Dept. of Internal Medicine, Göteborg University
PhD student - LOUISE OLOFSSON (start 2002)
supervisor - LENA CARLSSON
“One- and two-locus linkage analysis applied to breast cancer data”
PhD in Mathematical Statistics, Dept. of Mathematical statistics, Lund University
PhD student - AZRA KURBASIC (start 2002)
supervisor — OLA HÖSSJER
“Expression analysis by DNA microarray – experimental design and statistical methods for
finding susceptability genes of complex diseases”
PhD in Mathematical Statistics, Dept. of Mathematical Statistics, Chalmers University of
Technology
PhD student - ANDERS SJÖGREN (start 2002)
supervisor - MATS RUDEMO
“Statistical planning, analysis and bioinformatics tools in micro-array screenings, focusing on
heavy metal stressed yeast cultures”
PhD in Mathematical Statistics, Dept. of Mathematical Statistics, Chalmers University of
Technology
PhD student - ERIK KRISTIANSSON (start 2003)
supervisor - OLLE NERMAN
“Spatial dynamic modelling of an intracellular signalling pathway”
PhD in Mathematics, Dept. of Mathematics, Chalmers University of Technology
PhD student - TOBIAS GEBÄCK (start 2002)
supervisor — ALEXEI HEINTZ
“Large scale metabolic modelling”
PhD in Mathematics, Dept. of Mathematics, Chalmers University of Technology
PhD student - MILENA ANGUELOVA (start 2002)
supervisor — BERNT WENNBERG
“Hunting for novel RNA regulatory elements in genomes”
PhD in Medical Biochemistry, Dept. of Medical Biochemistry, Göteborg University
PhD student - PAUL PICCINELLI (start 2002)
supervisor — TORE SAMUELSSON
“Transcript profiling during ectomycorrhiza development”
PhD in Microbial Ecology, Dept. of Microbial Ecology, Lund University
PhD student - PETER SAMSSON (start March 2002)
supervisor — ANDERS TUNLID
“Proteome and functional analysis of Bacillus subtilis membrane proteins”
PhD in Microbiology, Dept. of Microbiology, Lund University
PhD student - MIRJA MÖLLER (start 2002)
supervisor — LARS HEDERSTEDT
“Identification and functional characterization of non-coding RNA genes in S. cerevisiae”
PhD in Microbiology, Dept. of Cell and Molecular Biology, Göteborg University
PhD student - JONATHAN ESGUERRA (start 2003)
supervisor - ANDERS BLOMBERG
“Heavy metals and the cell: identification of cellular targets and defence mechanisms”
PhD in Microbiology, Dept. of Cell and Molecular Biology, Göteborg University
PhD student - MICHAEL THORSEN (start 2002)
supervisors - MARKUS TAMAS/STEFAN HOHMANN
“Analysis of the dynamics of the spatial organization of signaling pathways in the living cell”
PhD in Molecular Biology, Dept. of Cell and Molecular Biology, Göteborg University
PhD student - CLAES MOLIN (start 2002)
supervisor - PER SUNNERHAGEN
“Development of frost tolerant oat (Avena sativa) by genetical engineering”
PhD in Molecular Biology, Dept. of Cell and Molecular Biology, Göteborg University
PhD student - MARCUS BRÄUTIGAM (start 2002)
supervisor — OLOF OLLSON
“Structural genomics of membrane proteins: protein production”
PhD in Molecular Biotechnology, Dept. of Chemistrey, Chalmers University of Technology
PhD student - MARIA NYBLOM (start 2003)
supervisor - RICHARD NEUTZE
“Genetic control of stem cell fate decisions using engineered mouse model systems”
PhD in Molecular Medicine, Dept. of Molecular Medicine and Gene Therapy, Lund university
PhD student - GÖRAN KARLSSON (start 2002)
supervisor - STEFAN KARLSSON
“The development of methods for the global analysis of membrane proteins”
PhD in Protein Technology, Dept. of Electrical Measurements, Lund University
PhD student - MARIA JANSSON (start 2002)
supervisor — PETER JAMES
“Gene Expression Analysis of Breast Cancer Tumors - from Microarray Data to the Clinic”
PhD in Theoretical Physics, Dept. of Theoretical Physics, Lund University
PhD student - CARL TROEIN (start 2002)
supervisor — CARSTEN PETERSON
“Gene expression analysis of hematopoetic stem cells using mouse model systems”
PhD in Theoretical Physics, Dept. of Theoretical Physics, Lund University
PhD student - YINGCHUN LIU (start 2002)
supervisor — MARKUS RIGNÉR
ASSOCIATED STUDENTS
(ordered after start year)
“Proteome fingerprinting of strawberry phenotypes for identification of allergens”
PhD in Biochemistry, Dept. of Medical Biochemistry, Lund University
PhD student - RIKARD ALM (start 2003)
supervisor - CECILIA EMANUELSSON
“Identification of candidate genes involved in the development of Theumatoid arthritis using
microarray and bioinformatics”
PhD in Cell and Molcecular Biology, Dept. of Cell and Molecular Biology, Lund University
PhD student - LINA OLSSON (start 2003)
supervisor - RIKARD HOLMDAHL
“Identification of genes affecting susceptability to collagen induced arthritis using microarray
and database mining”
PhD in Cell and Molcecular Biology, Dept. of Cell and Molecular Biology, Lund University
PhD student - EMMA AHLQVIST (start 2003)
supervisor - RIKARD HOLMDAHL
“Regulation of the Epstein-Barr virus Bam HI C promoter by the OriP-EBNA 1 protein complex”
PhD in Clinical Chemistry, Dept. of Clinical chemistry and Transfusion medicine, Göteborg
Universisty
PhD student - CECILIA BORESTRÖM (start 2003)
supervisor - LARS RYMO
“Database development to support comparative genome studies”
PhD in Computer Science, Dept. of Computer Science, Chalmers University of Technology
PhD student - MERJA KARJALAINEN (start 2003)
supervisor - GRAHAM KEMP
“Functional structure of insect odorant binding proteins”
PhD in Ecology, Dept. of Ecology, Lund University
PhD student - SEVERINE JANSEN (start 2003)
supervisor - JEAN-FRANCOIS PICIMBON
“Human adipose tussue mass distribution - identification of novel regulatory pathways”
PhD in Internal Medicine, Dept. of Internal Medicine, Göteborg University
PhD student - JENNY PALMIMNG (start 2003)
supervisor - MALIN LÖNN
“Evolutionary genomics in fungi”
PhD in Microbial Ecology, Dept. of Microbial Ecology, Lund University
PhD student - BALAJI RAJASHEKAR (start 2003)
supervisor - ANDERS TUNLID
“The virtual yeast cell”
PhD in Microbiology, Dept. of Cell and Molecular Biology, Göteborg University
PhD student - LUCIANO FERNANDEZ-RICAUD (start 2003)
supervisor - ANDERS BLOMBERG
“DNA microarray to study gene expression patterns in allergie disease”
PhD in Pediatrics, Dept. of Pediatrics, Göteborg University
PhD student - MAJA OLSSON (start 2003)
supervisor - MIKAEL BENSON
“Proteomics and crystallography of integral membrane proteins”
PhD in Plant Biochemistry, Dept. of Plant Biochemistry, Lund University
PhD student ERIK ALEXANDERSSON (start 2004)
supervisor - PER KJELLBOM
“Web-based DNA taxonomy and its application to fungi”
PhD in Systematic Botany, Dept. of Systematic Botany, Göteborg University
PhD student - HENRIK NILSSON (start 2004)
supervisor - NILS HALLENBERG/KARL-HENRIK LARSSON
“Pharmaceuticals in the environment – development of biological fingerprints”
PhD in Pharmacology, Dept. of physiology and pharmacology, Göteborg University
PhD student - LINA GUNNARSSON (start 2004)
supervisor - JOAKIM LARSSON
“Integrating bioinformatics and physiology to describe genetic effects in complex polygenic
diseases”
PhD in Endocrinology, Dept. of Endocrinolgy, Lund University
PhD student - HEMANG PARIKH (start 2004)
supervisor - LEIF GROOP
“Analysis of epigenomics in relation to cancer development”
PhD in Clinical Genetics, Dept. of Clinical Genetics, Göteborg University
PhD student - HELEN CARÉN (start 2004)
supervisor - TOMMY MARTINSSON
“Identification and characterization of proteins associated with the EBV-encoded nuclear
antigen 5 (ENBA5)”
PhD in Internal Medicine, Dept. of Clinical Chemistry and Transfusion Medicine, Göteborg
University
PhD student - ALMA STRÖMBERG (start 2005)
supervisor - LARS RYMO
“Phylogenetic studies of plasmids in marine bacteria”
PhD in Computer Science, Dept. of Computer Science, Chalmers
PhD Student - TORBJÖRN KARFUNKEL (start 2005)
supervisor - DEVDATT DUBHASHI
“Gastrointestinal stromal tumors”
PhD in Biochemistry, Dept. of Pathology, Göteborg University
PhD Student - GABRIELLA ARNE (start 2005)
supervisor - LARS-GUNNAR KINDBLOM
“Understanding the differentiation of human embryonic stem cells”
PhD in Computer Science, Dept. of Computer Science, Skövde University
PhD Student - JANE SYNNERGREN (start 2005)
supervisor - BJÖRN OLSSON/PATRIC NILSSON
“A genomics approach to the identification of key transcriptional regulators for extracellular
matrix production and maintenance in vascular smooth muscle cells”
PhD in Medical Biochemistry, Dept. of Medical Biochemistry, Göteborg University
PhD Student- ERIK LARSSON (start 2005)
supervisor - PER LINDAHL
“Design of pentose-fermenting Saccharomyces cerevisiae strains”
PhD in Applied Microbiology, Dept. of Applied Microbiology, Lund University
PhD Student - OSKAR BENGTSSON (start 2005)
supervisor - MARIE-FRANCOISE GORWA-GRAUSLAND/BÄRBEL HAHN-HÄGERDAL
“Proteomics in fish and interactive effects of chemical mixtures”
PhD in Zoophysiology, Dept. of Zoology, Göteborg University
PhD Student - EVA ALBERTSSON (start 2005)
supervisor - LARS FÖRLIN
26 27

!Publications
from students
PUBLICATIONS FROM STUDENTS IN
THE RESEARCH SCHOOL
(students in the research school are
indicated in bold)
2005
D. Ahren, M. Tholander, C. Fekete, B. Rajashekar, E. Friman, T. Johansson and A. Tunlid (2005)
Comparison of gene expression in trap cells and vegetative hyphae of the nematophagous
fungus Monacrosporium haptotylum
Microbiology 151, 789-803.
E. Alexandersson, L. Fraysse, S. Sjovall-Larsen, S. Gustavsson, M. Fellert, M. Karlsson, U.
Johanson and P. Kjellbom (2005)
Whole gene family expression and drought stress regulation of aquaporins
Plant Mol Biol 59, 469-84.
J. Almqvist, J. Zou, Y. Linderson, C. Borestrom, E. Altiok, H. Zetterberg, L. Rymo, S. Pettersson
and I. Ernberg (2005)
Functional interaction of Oct transcription factors with the family of repeats in Epstein-Barr
virus oriP
J Gen Virol 86, 1261-7.
M. Brautigam, A. Lindlof, S. Zakhrabekova, G. Gharti-Chhetri, B. Olsson and O. Olsson
(2005)
Generation and analysis of 9792 EST sequences from cold acclimated oat, Avena sativa
BMC Plant Biol 5, 18.
T. Breslin, M. Krogh, C. Peterson and C. Troein (2005)
Signal transduction pathway profiling of individual tumor samples
BMC Bioinformatics 6, 163.
H. Caren, K. Ejeskar, S. Fransson, L. Hesson, F. Latif, R. M. Sjoberg, C. Krona and T. Martinsson
(2005)
A cluster of genes located in 1p36 are down-regulated in neuroblastomas with poor prognosis,
but not due to CpG island methylation
Mol Cancer 4, 10.
D. Dalevi and D. Dubhashi (2005) The Peres-Shields Order Estimator for Fixed and Variable
Length Markov Models with Applications to DNA Sequence Similarity
Lecture Notes in Bioinformatics (LNBI/LNCS).
K. Ejeskar, C. Krona, H. Caren, F. Zaibak, L. Li, T. Martinsson and P. A. Ioannou (2005)
Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death
BMC Cancer 5, 161.
M. G. Fagerlind, P. Nilsson, M. Harlen, S. Karlsson, S. A. Rice and S. Kjelleberg (2005)
Modeling the effect of acylated homoserine lactone antagonists in Pseudomonas aeruginosa
Biosystems 80, 201-13.
L. Fernandez-Ricaud, J. Warringer, E. Ericson, I. Pylvanainen, G. J. Kemp, O. Nerman and A.
Blomberg (2005)
PROPHECY--a database for high-resolution phenomics
Nucleic Acids Res 33, D369-73.
B. G. Gabrielsson, L. E. Olofsson, A. Sjogren, M. Jernas, A. Elander, M. Lonn, M. Rudemo
and L. M. Carlsson (2005)
Evaluation of reference genes for studies of gene expression in human adipose tissue
Obes Res 13, 649-52.
P. Garden, R. Alm and J. Hakkinen (2005)
PROTEIOS: an open source proteomics initiative
Bioinformatics 21, 2085-7.
C. Hagman, M. Ramstrom, M. Jansson, P. James, P. Hakansson and J. Bergquist (2005)
Reproducibility of tryptic digestion investigated by quantitative fourier transform ion cyclotron
resonance mass spectrometry
J Proteome Res 4, 394-9.
D. S. Hibbett, R. H. Nilsson, M. Snyder, M. Fonseca, J. Costanzo and M. Shonfeld (2005)
Automated phylogenetic taxonomy: an example in the homobasidiomycetes (mushroomforming
fungi)
Syst Biol 54, 660-8.
J. Holmkvist, P. Almgren, H. Parikh, M. Zucchelli, J. Kere, L. Groop and C. M. Lindgren (2005)
Haplotype construction of the FRDA gene and evaluation of its role in type II diabetes
Eur J Hum Genet 13, 849-55.
M. Johannesson, L. M. Olsson, A. K. Lindqvist, S. Moller, D. Koczan, L. Wester-Rosenlof, H. J.
Thiesen, S. Ibrahim and R. Holmdahl (2005)
Gene expression profiling of arthritis using a QTL chip reveals a complex gene regulation of
the Cia5 region in mice
Genes Immun 6, 575-83.
G. Jonsson, P. O. Bendahl, T. Sandberg, A. Kurbasic, J. Staaf, L. Sunde, D. G. Cruger, C.
Ingvar, H. Olsson and A. Borg (2005)
Mapping of a novel ocular and cutaneous malignant melanoma susceptibility locus to chromosome
9q21.32
J Natl Cancer Inst 97, 1377-82.
G. Karlsson, Y. Liu, J. Larsson, M. J. Goumans, J. S. Lee, S. S. Thorgeirsson, M. Ringner and
S. Karlsson (2005)
Gene expression profiling demonstrates that TGF-beta1 signals exclusively through receptor
complexes involving Alk5 and identifies targets of TGF-beta signaling
Physiol Genomics 21, 396-403.
U. Koljalg, K. H. Larsson, K. Abarenkov, R. H. Nilsson, I. J. Alexander, U. Eberhardt, S. Erland,
K. Hoiland, R. Kjoller, E. Larsson, T. Pennanen, R. Sen, A. F. Taylor, L. Tedersoo, T. Vralstad and
B. M. Ursing (2005)
UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal
fungi
New Phytol 166, 1063-8.
E. Kristiansson, A. Sjögren, M. Rudemo and O. Nerman (2005)
Weighted Analysis of Paired Microarray Experiments
Statistical Applications in Genetics and Molecular Biology 4, 30.
A. Lindlof and Z. Lubovac (2005)
Simulations of simple artificial genetic networks reveal features in the use of Relevance
Networks
In Silico Biol 5, 239-49.
S. Nelander, E. Larsson, E. Kristiansson, R. Mansson, O. Nerman, M. Sigvardsson, P.
Mostad and P. Lindahl (2005)
Predictive screening for regulators of conserved functional gene modules (gene batteries) in
mammals
BMC Genomics 6, 68.
R. H. Nilsson, E. Kristiansson, M. Ryberg and K. H. Larsson (2005)
Approaching the taxonomic affiliation of unidentified sequences in public databases--an
example from the mycorrhizal fungi
BMC Bioinformatics 6, 178.
M. Persson and J. Bigun (2005)
Detection of Spots in 2-D Electrophoresis Gels by Symmetry Features
Lecture Notes in Computer ScienceJ
P. Piccinelli, M. A. Rosenblad and T. Samuelsson (2005)
Identification and analysis of ribonuclease P and MRP RNA in a broad range of eukaryotes
Nucleic Acids Res 33, 4485-95.
M. Ridderstrale, H. Parikh and L. Groop (2005)
Calpain 10 and type 2 diabetes: are we getting closer to an explanation?
Curr Opin Clin Nutr Metab Care 8, 361-6.
B. Samuelsson and C. Troein (2005)
Random maps and attractors in random Boolean networks
Phys Rev E Stat Nonlin Soft Matter Phys 72, 046112.
K. Sjoholm, J. Palming, L. E. Olofsson, A. Gummesson, P. A. Svensson, T. C. Lystig, E. Jennische,
J. Brandberg, J. S. Torgerson, B. Carlsson and L. M. Carlsson (2005)
A microarray search for genes predominantly expressed in human omental adipocytes: adipose
tissue as a major production site of serum amyloid A
J Clin Endocrinol Metab 90, 2233-9.
L. You, D. Garwicz and T. Rognvaldsson (2005)
Comprehensive bioinformatic analysis of the specificity of human immunodeficiency virus type
1 protease
J Virol 79, 12477-86.
2004
D. Ahren, M. Faedo, B. Rajashekar and A. Tunlid (2004)
Low genetic diversity among isolates of the nematode-trapping fungus Duddingtonia flagrans:
evidence for recent worldwide dispersion from a single common ancestor
Mycol Res 108, 1205-14.
D. Ahren, C. Troein, T. Johansson and A. Tunlid (2004)
phorest: a web-based tool for comparative analyses of expressed sequence tag data
Molecular Ecology Notes 4, 311-314.
E. Alexandersson, G. Saalbach, C. Larsson and P. Kjellbom (2004)
Arabidopsis plasma membrane proteomics identifies components of transport, signal transduction
and membrane trafficking
Plant Cell Physiol 45, 1543-56.
M. Benson, L. Carlsson, M. Adner, M. Jernas, M. Rudemo, A. Sjogren, P. A. Svensson, R.
Uddman and L. O. Cardell (2004)
Gene profiling reveals increased expression of uteroglobin and other anti-inflammatory genes
in glucocorticoid-treated nasal polyps
J Allergy Clin Immunol 113, 1137-43.
M. Benson, M. Olsson, M. Rudemo, G. Wennergren and L. O. Cardell (2004)
Pros and cons of microarray technology in allergy research
Clin Exp Allergy 34, 1001-6.
E. Parmasto, R. H. Nilsson and K.-H. Larsson (2004)
Cortbase version 2. Extensive updates of a nomenclatural database for corticioid fungi
(Hymenomycetes)
Phyloinformatics 1.
L. S. Erlendsson, M. Moller and L. Hederstedt (2004)
Bacillus subtilis StoA Is a thiol-disulfide oxidoreductase important for spore cortex synthesis
J Bacteriol 186, 6230-8.
B. G. Gabrielsson, A. C. Karlsson, M. Lonn, L. E. Olofsson, J. M. Johansson, J. S. Torgerson,
L. Sjostrom, B. Carlsson, S. Eden and L. M. Carlsson (2004)
Molecular characterization of a local sulfonylurea system in human adipose tissue
Mol Cell Biochem 258, 65-71.
A. L. Karlsson, R. Alm, B. Ekstrand, S. Fjelkner-Modig, A. Schiott, U. Bengtsson, L. Bjork, K.
Hjerno, P. Roepstorff and C. S. Emanuelsson (2004)
Bet v 1 homologues in strawberry identified as IgE-binding proteins and presumptive allergens
Allergy 59, 1277-84.
S. Kauffman, C. Peterson, B. Samuelsson and C. Troein (2004)
Genetic networks with canalyzing Boolean rules are always stable
Proc Natl Acad Sci U S A 101, 17102-7.
M. Krantz, B. Nordlander, H. Valadi, M. Johansson, L. Gustafsson and S. Hohmann (2004)
Anaerobicity prepares Saccharomyces cerevisiae cells for faster adaptation to osmotic shock
Eukaryot Cell 3, 1381-90.
C. Krona, K. Ejeskar, H. Caren, F. Abel, R. M. Sjoberg and T. Martinsson (2004)
A novel 1p36.2 located gene, APITD1, with tumour-suppressive properties and a putative
p53-binding domain, shows low expression in neuroblastoma tumours
Br J Cancer 91, 1119-30.
A. Kurbasic and O. Hossjer (2004)
On computation of p-values in parametric linkage analysis
Hum Hered 57, 207-19.
A. Le Quere, A. Schutzendubel, B. Rajashekar, B. Canback, J. Hedh, S. Erland, T. Johansson
and A. Tunlid (2004)
Divergence in gene expression related to variation in host specificity of an ectomycorrhizal
fungus
Mol Ecol 13, 3809-19.
Y. Liu and M. Ringner (2004)
Multiclass discovery in array data
BMC Bioinformatics 5, 70.
R. H. Nilsson, K. H. Larsson and B. M. Ursing (2004)
galaxie--CGI scripts for sequence identification through automated phylogenetic analysis
Bioinformatics 20, 1447-52.
R. H. Nilsson, B. Rajashekar, K. H. Larsson and B. M. Ursing (2004)
galaxieEST: addressing EST identity through automated phylogenetic analysis
BMC Bioinformatics 5, 87.
H. Parikh and L. Groop (2004)
Candidate genes for type 2 diabetes
Rev Endocr Metab Disord 5, 151-76.
E. Parmasto, R. H. Nilsson and K.-H. Larsson (2004)
Cortbase version 2. Extensive updates of a nomenclatural database for corticioid fungi
(Hymenomycetes)
Phyloinformatics 1.
T. Rognvaldsson and L. You (2004)
Why neural networks should not be used for HIV-1 protease cleavage site prediction
Bioinformatics 20, 1702-9.
R. Wysocki, P. K. Fortier, E. Maciaszczyk, M. Thorsen, A. Leduc, A. Odhagen, G. Owsianik, S.
Ulaszewski, D. Ramotar and M. J. Tamas (2004)
Transcriptional activation of metalloid tolerance genes in Saccharomyces cerevisiae requires
the AP-1-like proteins Yap1p and Yap8p
Mol Biol Cell 15, 2049-60.
H. Zetterberg, C. Borestrom, T. Nilsson and L. Rymo (2004)
Multiple EBNA1-binding sites within oriPI are required for EBNA1-dependent transactivation
of the Epstein-Barr virus C promoter
Int J Oncol 25, 693-6.
2003
C. Borestrom, H. Zetterberg, K. Liff and L. Rymo (2003)
Functional interaction of nuclear factor y and sp1 is required for activation of the epstein-barr
virus C promoter
J Virol 77, 821-9.
B. G. Gabrielsson, J. M. Johansson, M. Lonn, M. Jernas, T. Olbers, M. Peltonen, I. Larsson, L.
Lonn, L. Sjostrom, B. Carlsson and L. M. Carlsson (2003)
High expression of complement components in omental adipose tissue in obese men
Obes Res 11, 699-708.
M. S. Johnson, J. M. Johansson, P. A. Svensson, M. A. Aberg, P. S. Eriksson, L. M. Carlsson
and B. Carlsson (2003)
Interaction of scavenger receptor class B type I with peroxisomal targeting receptor Pex5p
Biochem Biophys Res Commun 312, 1325-34.
S. Kauffman, C. Peterson, B. Samuelsson and C. Troein (2003)
Random Boolean network models and the yeast transcriptional network
Proc Natl Acad Sci U S A 100, 14796-9.
A. Lindlof (2003)
Gene identification through large-scale EST sequence processing
Appl Bioinformatics 2, 123-9.
A. Lindlof and B. Olsson (2003)
Genetic network inference: the effects of preprocessing
Biosystems 72, 229-39.
R. H. Nilsson and N. Hallenberg (2003)
Phylogeny of the Hypochnicium punctulatum complex as inferred from ITS sequence data
Mycologia 95, 54.
R. H. Nilsson, N. Hallenberg, B. Norden, N. Maekawa and S. H. Wu (2003)
Phylogeography of Hyphoderma setigerum (Basidiomycota) in the Northern Hemisphere
Mycol Res 107, 645-52.
M. Persson and J. Bigun (2003)
Protein Spot Detection by Symmetry Derivatives of Gaussians
Lecture Notes in Computer Science
B. Samuelsson and C. Troein (2003)
Superpolynomial growth in the number of attractors in Kauffman networks
Phys Rev Lett 90, 098701.
J. Warringer, E. Ericson, L. Fernandez, O. Nerman and A. Blomberg (2003)
High-resolution yeast phenomics resolves different physiological features in the saline
response
Proc Natl Acad Sci U S A 100, 15724-9.
2002
B. G. Gabrielsson, J. M. Johansson, E. Jennische, M. Jernas, Y. Itoh, M. Peltonen, T. Olbers,
L. Lonn, H. Lonroth, L. Sjostrom, B. Carlsson, L. M. Carlsson and M. Lonn (2002)
Depot-specific expression of fibroblast growth factors in human adipose tissue
Obes Res 10, 608-16.
A. Irbäck and C. Troein (2002)
Enumerating Designing Sequences in the HP Model
Journal of Biological Physics 28, 1.
L. H. Saal, C. Troein, J. Vallon-Christersson, S. Gruvberger, A. Borg and C. Peterson (2002)
BioArray Software Environment (BASE): a platform for comprehensive management and
analysis of microarray data
Genome Biol 3, SOFTWARE0003.
28 29

An international
outlook
from one of the evaluators
Marc Vidal
Professor and director of The Centre for Cancer Systems Biology
Harvard Medical School, USA
Evaluator of the first round of project applications 2001
It is with the greatest delight that I write this letter to comment about
the quality of training at the “Research School”, originally started and
now directed by Dr. Anders Blomberg. Over the last few years I have
been in relatively close contact with the School, having been in Goteborg
a few times for scientific visits, having participated in the original
selection process of the students as one of the outside evaluators, and
having recently attended an annual workshop with the students on the
island of Marstrand.
It is easy to summarize my impressions of the program so far. It is by far
the best effort I have seen in the field of interdisciplinary teaching. On
the international scene, this effort is acclaimed as one of the first of its
kind. It is fair to say that this and other efforts have sparked a renewed
interest in multidisciplinary teaching on the international scene. For example,
Harvard Medical School has decided to launch a systems biology
curriculum for graduate students, an effort headed by Dr. Pam Silver,
and Dr. David Botstein at Princeton University is preparing a totally new
curriculum for undergraduate studies, also based on multidisciplinary.
One can safely say that in such a context, Dr Blomberg and his colleagues
were truly visionary.
30 31

Design: clayone.com
http://www.cmb.gu.se/research_school
32