Microsatellite loci for Palaearctic gudgeons - Molecular Ecology ...

Page 1 of 9
Molecular Ecology Resources
Microsatellite loci for Palaearctic gudgeons: markers for identifying intergeneric
hybrids between Romanogobio and Gobio
Jan Mendel,* Ivo Papoušek,* Eva Marešová,* Lukáš Vetešník,* Karel Halačka,* Michał
Nowak,† and Dagmar Čížková*
*Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, v.v.i, Květná
8, 60365 Brno, Czech Republic
†University of Agriculture in Kraków, Spiczakowa 6, 30-199 Kraków-Mydlniki, Poland
Keywords: Gobioninae, Romanogobio, endangered species, microsatellites
Corresponding author: Jan Mendel, Květná 8, 603 65 Brno, Fax: +420 543 211 346; Email:
jmendel@seznam.cz
Running title: Microsatellites for gudgeons
Abstract
Six polymorphic microsatellite loci were isolated from the Danube whitefin gudgeon
Romanogobio vladykovi. The number of alleles per locus varied from three to sixteen and the
expected heterozygosities ranged from 0.404 – 0.897. In order to increase the number of
microsatellite markers, five additional loci originally developed for Gobio gobio were
successfully cross-amplified. The number of alleles per locus varied from two to fourteen.
Their usefulness was confirmed by successful cross-amplification for 12 members of the
gudgeon subfamily Gobioninae. The applicability of these markers was confirmed for
1

Molecular Ecology Resources
Page 2 of 9
intergeneric identification, discriminating between intergeneric hybrids and for population
genetic investigations of endangered species from the genus Romanogobio.
The representatives of the genus Romanogobio belong to the family Cyprinidae. This genus
includes small freshwater fishes, collectively known as gudgeons, and contains many taxa that
are endemic to various areas of Europe and Asia, as well as numerous threatened species.
Our main motivation was based on a current study of gudgeons in the Eurasian context
(Mendel 2007; Mendel et al. 2008) because the common distribution, the identical or very
similar biological characteristics of these taxa, the considerable visual similarity, as well as
the very frequent occurrence of hybridization events often lead to taxonomic confusion.
Presently, a reliable morphological and molecular key is being intensively sought which
would eliminate erroneous species identifications both in the field and in museum collections.
Along with other factors, the non-existence of microsatellite markers is the reason for
insufficient knowledge of the status of populations of the disappearing and often threatened
species of gudgeons in Europe, which hampers the establishment of suitable conservation
measures. For example, according to the latest Red List of Lampreys and Fishes of the Czech
Republic, the COUNCIL DIRECTIVE 92/43/EEC of 1992, and Order 166/2005 Coll., six
Sites of Community Importance (SCIs) in the hydrographic system of the CR were announced
for two gudgeons from the “kesslerii group” and “albipinnatus group” which are critically
endangered or vulnerable. The Czech Republic proceeded to conduct their regular monitoring
nevertheless, still without any knowledge of their genetic diversity.
To develop microsatellite primers, we employed a modified enrichment protocol developed
by Estoup & Martin (1996). Genomic (g) DNA was extracted (Genomic DNA Mini kit, KRD)
from an ethanol-preserved fin of a single gudgeon collected in 2003 from the Dyje River
2

Page 3 of 9
Molecular Ecology Resources
(Czech Republic). Total gDNA was digested with an RsaI restriction enzyme (Promega).
Following the restriction digest, MluI oligo adaptors (RSA21 and phosphorylated RSA25) that
serve as priming sites for the PCR were ligated onto the ends of gDNA fragments. Two
biotinylated probes [dinucleotide (TG) 10 and tetranucleotide (ATCT) 5 ] were hybridized to the
ligated DNA
and selected using streptavidin magnetic particles (Promega). PCRs were
performed on the microsatellite-enriched eluate using one of the oligo adaptors (RsaI) as a
primer. The amplification products were purified (QIAquick PCR Purification Kit, QIAGEN)
and ligated into a plasmid vector (pGEM-T Easy Vector system II, Promega), transformed
into JM109 competent cells (Promega), and plated onto Luria-Bertani (LB) agar medium.
Recombinant plasmids were identified by blue-white screening. Positive-transformed cells
were grown on LB agar, transferred onto Hybond-N + membranes (Amersham), screened
using dioxigenin-end-labelled (TC) 10 and (ATCT) 5 probes (DIG Oligonucleotide Tailing Kit,
Roche) and visualised using a DIG Nucleic Acid Detection Kit (Roche). We obtained 185
positive clones from the two libraries and each clone was sequenced by Macrogen (South
Korea). The sequences from 89 clones were of high quality and contained repeat regions. The
primers were developed from flanking sequences using Oligo (Rychlik 2007). Successful
amplifications with polymorphisms were detected with five unlabelled primer pairs based on
PCR tests with 10 - 15 reference specimens. PCR conditions were optimized to produce clear
bands on agarose gels and five loci-forward primers were labelled with a fluorescent dye
(Applied Biosystems; Table 1).
PCRs were performed on Mastercycler pro (Eppendorf) in a total volume of 10 µL using PPP
Master Mix (Top-Bio) following the manufacturer’s protocol, 1 pmol of each primer and ~30
ng of genomic DNA. The PCR consisted of an initial denaturation cycle of 95°C for 3 min; 35
cycles at 95°C for 1 min; 50-60°C for 50 s (Table 1), elongation at 72°C for 60 s; and final
3

Molecular Ecology Resources
Page 4 of 9
extension at 72°C for 10 min. The amplified products were diluted, of which 1 µL was added
to 12 µL of formamide and 500 LIZ Size Standard (Life Technologies) and electrophoresed
by ABI PRISM 310 Genetic Analyzer (Applied Biosystems) using GENESCAN version 3.7.
The conditions and characteristics of the loci are given in Table 1. We calculated the number
of alleles per locus, observed and expected heterozygosities, the deviation from Hardy-
Weinberg equilibrium and linkage disequilibrium expectations, and the frequency of null
alleles using GENALEX 6 (Peakall & Smouse 2006), MICRO-CHECKER 2.2.3 (Van
Oosterhout et al. 2004) and online version of GENEPOP 1.2 (Raymond & Rousset 1995).
Our study developed six unique polymorphic dinucleotide microsatellite loci isolated from R.
vladykovi (Rvla; Table 1). At the same time, using cross-species amplification we confirmed
the applicability of these markers for 7 other species of the genus Romanogobio and 3 species
of the genus Gobio. Two additional species of the genus Gobio (G. carpathicus and G.
volgensis) were included in the analysis in order that the applicability of some loci for the
easy identification of intergeneric hybrids and for the identification of both the genera might
be reliably evaluated (Table 2).
We evaluated the amplification patterns in 12 members of the gudgeon subfamily
Gobioninae, including R. vladykovi (Dyje River, Czech Republic), R. belingi (Sluch River,
Ukraine), R. albipinnatus (Moksha River, Russia), R. parvus (Kuban River, Russia), R.
pentatrichus (Kuban River, Russia), R. uranoscopus (Ulička River, Slovakia), R. kesslerii
(San River, Poland), R. banaticus (Bečva River, Czech Republic), G. gobio (Elbe River,
Czech Republic), G. obtusirostris (Váh River, Slovakia), Gobio sp. 1 (Topľa River, Slovakia),
G. carpathicus (Laborec River, Slovakia), G. volgensis (Bol’shaya Lašva River, Russia).
Prior to this, all species had been both morphologically and molecularly identified (Mendel
2007; Mendel et al. 2008).
4

Page 5 of 9
Molecular Ecology Resources
The microsatellite loci in R. vladykovi revealed both moderate (Rvla22114-I, Rvla22114-II,
Rvla22211) and high genetic variation (Rvla21030, Rvla21177, Rvla21144). Genotypes of fin
samples from the natural population (Dyje River) showed polymorphisms with three to
sixteen alleles per locus among 21 - 23 individuals. Most loci were at Hardy-Weinberg
equilibrium, except for Rvla22211, which showed a significant excess of homozygotes,
possibly caused by the presence of null alleles. Most loci were unlinked, except for
Rvla22114 (based on MICRO-CHECKER results, see Table 1).
In order to supplement the design of microsatellite panel for the genus Romanogobio, we
proved the usefulness of additional five loci (Gob3, Gob12, Gob15, Gob22, Gob28) from the
microsatellite library of G. gobio (Knapen et al. 2006). The microsatellite loci in R. vladykovi
revealed both low (Gob15) and high genetic variation (Gob3, Gob12, Gob22, Gob28), with
two to fourteen alleles per locus among 20 - 27 individuals. Most loci were at Hardy-
Weinberg equilibrium, except for Gob3, similarly as in Knapen et al. (2006), possibly caused
by the presence of null alleles (Table 1).
Table 2 provides cross-species amplification results for 10 - 12 species from both the genera.
From the 11 primer pairs cross-amplified in this study, 6 presented here and 5 from Knapen et
al. 2006, seven resulted in an amplified PCR product for all the tested species and three for
the eight, nine resp. eleven species.
The detected allele length and chosen combination of fluorescent labelling enables the
employment of the entire developed panel of 11 microsatellite loci in a multiplex PCR
analysis.
Two loci, Rvla22114_II (A) and Rvla22211 (B), proved to be more suitable for generic
identification and for easier detection of intergeneric hybridization events. Locus A exhibited
the generic alleles within 196 - 202 bp for Romanogobio and within 308 - 338 bp for Gobio.
5

Molecular Ecology Resources
Page 6 of 9
For Romanogobio, locus B exhibited the generic alleles within 152 and 154 bp, always in the
homozygotic form, while the second allele did not amplify. For the representatives of the
genus Gobio and the intergeneric hybrids, the alleles 146 or 148 bp were always attached,
forming a heterozygotic pattern. This was true for all tested species except R. pentatrichus.
Furthermore, loci Gob15, Gob22 and Gob28 also appear to be potentially interesting for
hybrid identification and taxonomical purposes. Further analyses of a greater number of
specimens from the individual species will be required for the evaluation of the applicability
of the developed loci.
In conclusion, our study suggests that these loci may be helpful for intergeneric identification,
for the discrimination of intergeneric hybrids and for population genetic investigations of
disappearing and endangered species of the genus Romanogobio.
Acknowledgements
This study was carried out within the framework of research project 206/09/P608 supported
by the Grant Agency of the Czech Republic. We are thankful to E. D. Vasileva, J. Koščo for
their help with obtaining the samples.
References
Estoup A, Martin O (1996) Marqueurs microsatellites: isolement a`l’aide de sondes non
radioactives, caracte´risation et mise au point. Personal communication, protocols available in
the web at http://www.agroparistech.fr/svs/genere/microsat/microsat.htm.
Knapen D, Taylor MI, Blust R, Verheyen E (2006) Isolation and charakterization of
polymorphic
microsatellite loci in the gudgeon, Gobio gobio (Cyprinidae). Molecular
Ecology Notes, 6, 387-389.
6

Page 7 of 9
Molecular Ecology Resources
Mendel J (2007) The using of mtDNA for characteristics of population structures of species
from the genera Gobio and Romanogobio. Thesis, Brno, 203pp. (in Czech with English
summary)
Mendel J, Lusk S, Vasil'eva ED, Vasil'ev VP, Lusková V, Ekmekci FG, Erk'kan F, Ruchin A,
Koščo J, Vetešník L, Halačka K, Šanda R, Pashkov AN, Reshetnikov SI (2008) Molecular
phylogeny of the genus Gobio Cuvier, 1816 (Teleostei: Cyprinidae) and its contribution to
taxonomy. Molecular Phylogenetics and Evolution, 47, 1061-1075.
Peakall R, Smouse PE (2006) Genalex 6: genetic analysis in Excel. Population genetic
software for teaching and research. Molecular Ecology Notes, 6, 288-295.
Raymond M, Rousset F (1995) Genepop (version 1.2): population genetics software for exact
tests and ecumenicism. Journal of Heredity, 86, 248-249.
Rychlik W (2007) Oligo 7 primer analysis software. In: Yuryev A(ed). Methods in molecular
biology vol. 402: PCR primer design. Humana Press Inc., Totowa, pp 35–59.
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) Micro-checker: software
for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology
Notes, 4, 535-538.
Data accessibility
Data sequences: Genbank accessions: DQ207799, DQ207801, DQ207802, DQ207804,
DQ207805, JQ993103 - JQ993107.
7

Molecular Ecology Resources
Page 8 of 9
Table 1 Characteristics of six microsatellite loci isolated from Romanogobio vladykovi and five loci prepared from cross-species
amplification
Locus Repeat motif Primer sequence Size (bp) N N a H O/H E P-value Dye Null freq. T a (°C)
Rvla21144 (AC) 2(ACTC) 3(AC) 8 CGG TTG ATG AGT TCG CTG TAG 269-287 21 8 0.571/0.760 NS VIC 0.107 60
GTC ACA TGA TCC TCG TTT GG
Rvla21177 (TG) 11 CTG ACT ACA CAT GGT TAA CGC 210-258 21 14 0.900/0.897 NS 6-FAM 0.024 54
CGG CTG CTT TAA TGT CCA C
Rvla22114-I (TG) 10 CGG CTT CCC ATA GTA AAC 142-146 23 3 0.364/0.404 NS VIC 0.031 53
GTT AGG CCT GGA GTC AAT G
Rvla22114-II (AC) 13GC(AC) 22 CGG CTT CCC ATA GTA AAC 196-200 21 3 0.762/0.618 NS VIC 0 53
GTT AGG CCT GGA GTC AAT G
Rvla22211 (CA) 14 GCA AAC CGT ATT TTC TAT CCC 152-156 23 3 0/0.541* ‡ NED 0.350 52
GTG AAA TAT GAG GAC GTT CCC
Rvla21030 (CA) 11AA(CT) 18 CTT CTG ATT TAA TGT TAG GGT 82-120 23 16 0.773/0.888 NS 6-FAM 0.083 50
TCC CAA TGA CGT GAT AGA G
Gob3 † (GA) 18 ACT CTG CCC ACA GTC ACT CG 182-212 25 11 0.320/0.847 ‡ NED 0.285 58
TGA AAT GTT TTC CTC AAA AAC G
Gob12 † (CA) 7AA(CA) 19 AAG GAA ATG CAG AAT CAC AAA ATT AC 165-197 20 9 0.650/0.860 NS 6-FAM 0.113 62
GAA CTT GCA AAA TAG CAG GGT G
Gob15 † (CA) 10 TGT CCA CGT TCT GGT CAC AG 135-137 22 2 0.318/0.499 NS 6-FAM 0.121 57
CTT TAA ATG TTA TTT GGT CTT TGC AG
Gob22 † (CA) 9N 18(CA) 10 GAT TGC CAT GGT TAC CGA AT 200-246 27 14 0.704/0.838 NS PET 0.073 58
TCT CCA CCT CGA AAT CAT CC
Gob28 † (GT) 9(GA) 4(GT) 3 CGC ACA AAC AGC TCA GAC TC 216-234 26 10 0.769/0.848 NS VIC 0.042 60
CGGTATGTACAAGCCAGATGAA
N, number of analyzed specimens; Na, number of alleles; H O /H E , average observed/expected heterozygosities; P value for Hardy-Weinberg
Equilibrium; Dye, 5' fluorescent label; Null freq., frequency of null alleles; Ta, annealing temperature; *all individuals were homozygotes;
‡indicates significant departure from HWE (P < 0.05); †indicates homologous cross-species amplified loci
8

Page 9 of 9
Molecular Ecology Resources
Table 2 Characteristics of eleven microsatellite loci for the fish subfamily Gobioninae
R. belingi R. albipinnatus R. parvus R. uranoscopus R. banaticus R. kesslerii R. pentatrichus
Locus N/N a Size (bp) N/N a Size (bp) N/N a Size (bp) N/N a Size (bp) N/N a Size (bp) N/N a Size (bp) N/N a Size (bp)
Rvla21144 3/3 277-287 4/6 269-289 2/3 271-287 4/3 279-291 3/7 273-289 5/4 273-319 1/1 271
Rvla21177 3/4 228-256 4/5 210-234 2/4 218-308 4/5 210-250 3/7 212-262 5/7 214-240 1/2 216-224
Rvla22114_I 2/1 144 4/3 142-146 2/1 144 4/1 144 3/1 144 5/1 146 1/1 146
Rvla22114_II 3/2 196-200 4/2 196-202 2/1 196 4/1 200 3/3 196-200 4/2 198-202 1/- -
Rvla22211 3/1 154 4/1 154 1/1 154 4/1 154 3/2 152-154 5/1 154 1/2 146-154
Rvla21030 2/4 84-96 4/4 74-92 2/3 74-102 3/5 118-136 1/2 86-94 3/3 88-94 1/1 84
Gob3 4/2 171-193 2/1 172 2/- - 2/3 205-221 2/2 163-165 2/- - 2/4 212-238
Gob12 4/4 173-183 2/2 151-154 2/2 151-154 2/2 151-162 2/2 149-163 2/2 138-150 2/2 150-157
Gob15 4/2 137-139 2/2 138-140 2/3 138-142 2/1 138 2/2 138-150 2/3 171-183 2/2 140-146
Gob22 4/3 210-232 2/3 267-293 2/4 226-286 2/4 224-254 2/2 200-202 2/2 181-183 2/1 178
Gob28 4/4 222-228 2/2 222-234 2/3 214-230 2/2 212-224 2/3 208-240 2/2 236-244 2/2 226-228
N, number of analyzed specimens; N a , number of alleles; NA, locus did not analyze; -, locus did not amplify; *, Knapen et al., 2006.
Table 2 Continued
G. gobio G. obtusirostris Gobio sp. 1 G. carpathicus G. volgensis
Locus N/N a Size (bp) N/N a Size (bp) N/N a Size (bp) N/N a Size (bp) N/N a Size (bp)
Rvla21144 7/8 275-291 2/4 267-283 1/2 269-287 NA NA NA NA
Rvla21177 7/6 214-234 2/3 212-230 1/2 220-254 NA NA NA NA
Rvla22114_I 5/2 144-146 1/1 144 1/- - NA NA NA NA
Rvla22114_II 7/5 308-338 4/5 312-324 1/1 338 3/1 338 2/2 314-324
Rvla22211 8/4 146-154 2/2 146-154 1/2 146-154 2/2 146-154 2/4 146-154
Rvla21030 4/3 96-112 2/- - 1/1 106 NA NA NA NA
Gob3 82/12 163-208* 2/2 181-187 2/2 168-204 NA NA NA NA
Gob12 82/13 188-214* 2/3 178-186 2/2 115-151 NA NA NA NA
Gob15 82/5 139-154* 2/3 144-161 2/3 142-153 NA NA NA NA
Gob22 82/7 179-203* 2/3 185-191 2/3 183-195 NA NA NA NA
Gob28 82/6 190-202* 2/3 209-215 2/2 212-216 NA NA NA NA
9