dna marker - GeneCraft

TABLE OF CONTENTS3Summary of our thermostable polymerases 4BioTherm DNA polymerase 5First description of Taq polymerase 7BioThermMix 8NeoTherm DNA polymerase 10SupraTherm DNA polymerase 11CoverIt overlay for PCR 12PCR-Grade H 2 O 12Crystal violet buffer 13BioThermRed DNA polymerase 14BioThermT DNA polymerase 15BioThermBio DNA polymerase 17BioThermStar DNA polymerase 18BioThermStarMix DNA polymerase 20BioThermAB DNA polymerase 22Hot Start Taq monoclonal antibody 23Hot Start PCR compound 24KlenTherm DNA polymerase 25KlenThermN DNA polymerase 28KlenThermPlatinum DNA polymerase 29KlenThermase DNA polymerase 31KlenThermaseN DNA polymerase 32DNA cycle sequencing kit 32Tth inorganic pyrophosphatase 34Sequencing and pyrophosphatase 35AccuTherm DNA polymerase 36Comparison of somethermostable polymerases 37Synergy DNA polymerase 38SynergyN DNA polymerase 39SynergyT DNA polymerase 40SynergyPlus DNA polymerase 41TthPlus DNA polymerase 42Comparison of TthPlus andGeneScript RT 44GeneScript reverse transcriptase 48RT-PCR using GeneScriptreverse transcriptase 48RNase-Inhibitor 49Klenow fragment 50T4 polynucleotide kinase 51T4 DNA ligase 52Tth DNA ligase 53SP6 RNA polymerase 54T7 RNA polymerase 54Restriction enzymes 55Random prime labeling kit 58dNTP set 59DNA polymerization mix 20 & 10 60dNTPs 60dNTP custom service 61Biotin-4-dUTP 61Biotin-11-dUTP 61Uracil-DNA glycosylase 62λ DNA 62T-Vector System 63pBS-KS-EcoRV 66BstE II-λ-DNA marker 66Hpa II-pBS-DNA marker 67EcoRI-λ-DNA marker 68HindIII-λ-DNA marker 69EcoRI+HindIII-λ-DNA marker 70100 bp ladder 711 kb ladder 72MegaPure DNA purification kit 73Treponema pallidumrecombinant antigen-pA 74Monoclonal IgG to Thermusaquaticus DNA-polymerase 74IPTG (Isopropyl-ß-D-thiogalactoside) 75Acrylamid solutions 76Laemmli puffer 78TBE buffer 78TEMED 79Amoniumpersulfate 79Agarose LSL 8100 80Agarose S 18000 81Agarose S-IM 18500 82Bounded ethidium bromide agarose 83Magnetic particles 84MagicTubes for perfect PCR 85Laboratory consumables 88Index 89Order-form 90That´s new 91

BioTherm DNA POLYMERASEDESCRIPTIONBioTherm DNA polymerase is a thermostable DNA -polymerase purified from the Thermus aquaticus strainin accordance with the procedures developed by Kaledin(1,2,3) for the isolation of thermostable enzymesprocessing DNA polymerase activity from thermophilicbacteria. Amplification of DNA fragments (100 bp to10kb) can be achieved with this enzyme. The enzymehas both 5'-3' polymerase- and 5'-3' exonuclease activities.BioTherm can add a single template-directeddeoxyadenosin (A) residue to the 3’ end of duplex PCRproducts. This property allows easy and efficient ligationof PCR products in TA cloning vectors.BESCHREIBUNGBioTherm DNA-Polymerase ist eine hitzestabile DNA-Polymerase, welche nach dem Protokoll von Kaledin(1,2,3) zur Reinigung von hitzestabilen Enzymen mitPolymerase-Aktivität aus thermophilen Bakterien ausThermus aquaticus isoliert wurde. Diese Polymerase istin der Lage DNA-Fragmente mit einer Länge von 100bp bis 10 kb zu amplifizieren. BioTherm DNA-Polymerasebesitzt sowohl eine 5´-3´ Polymerase- als aucheine 5´-3´ Exonuklease-Aktivität. Das Enzym kanneinen einzelnen, Template-abhängigen Deoxyadenosin(A) –Rest an das 3´ -Ende doppelsträngiger PCR-Produkteanhängen. Diese Eigenschaft erlaubt die einfacheund effiziente Ligation von PCR-Produkten in TA-Klonierungs-Vektoren.5APPLICATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25ºC);50 mM KCl; 2 mM MgCl 2 ; 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20, 50% glycerol(v/v)STORAGE TEMPERATUREStore BioTherm DNA polymerase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.STORAGE TEMPERATURE160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl 2 , 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge.10X REACTION BUFFER1.5 ml 10x reaction buffer (contains 15 mM MgCl 2 )Cat. No. GC-002-0061.5 ml 10x reaction buffer without MgCl 2 plus50 mM MgCl 2 separatelyCat. No. GC-002-007ASSOCIATED ACTIVITIESEndonuclease- and exonuclease activities were notdetectable after 2 and 1 hours incubation, respectively,of 1 µg lambda DNA and 0.22 µg of EcoRIdigested lambda DNA, respectively, at 72ºC in thepresence of 15-20 units of BioTherm DNA polymerase.COMPANION PRODUCTSBioThermRed DNA polymerase, SupraThermDNA polymerase, dNTPs, T-VectorCATALOG NO.GC-002-0100 GC-002-0250 GC-002-0500 GC-002-1000 GC-002-5000100 u 250 u 500 u 1000 u 5000 u

AMPLIFICATION CONDITIONS10x reaction buffer 3 µldNTPs (200 µM each) 5 µlhuman genomic DNA (300-600 ng) 1 µlforward primer (25 pM) 2 µlreverse primer (25 pM) 2 µlBioTherm (0.2-1 units/µl) 1 µlH 2 O 16 µl58ºC 0.5 min72ºC 4 min93ºC 20 sec30 cyclestotal 30 µl6REFERENCES1 Kaledin, A.S., et al. (1980) Biokhimiya 45, 4942 Kaledin, A.S., et al. (1981) Biokhimiya 46, 15763 Kaledin, A.S., et al. (1982) Biokhimiya 47, 1785COMPARISON OF DIFFERENT TAQ DNA POLYMERASESMIXTURETemplate1 µl (IN4/TNOMF5-product)Buffer 4 µldNTPs 8 µl => 200 µMMgCl 22.4 µl (lanes 3-6) => 1.5 mMIN4 2 µlTNOMF5 2 µl (lanes 1,3,5,7)TNOMF6 2 µl (lanes 2,4,6,8)Polymerase 2 µlH 2 O added to 30 µlProgram1 94°C 2 min2 94°C 30 sec65°C 30 sec 30 cycles72°C 30 sec (75°C by Eurogentec HA DNA polymerase)3 72°C 7 min4 4°CPOLYMERASESLaneMarker 9 MarkerGEL1.5% Agarose-TAE-Gel, 85V10 µl of each mixture per lane1+2 Sigma, 1 u3+4 Promega, 1 u5+6 Eurogentec HA, 0.3 u7+8 BioTherm, 1 u1 2 3 4 5 6 7 8 9680 bp240 bp

THE FIRST DESCRIPTION OF TAQ POLYMERASEby the Russian scientist Kaledin7Kaledin, A.S, at al. (1980) Biokhimia 45, 494

8BioThermMixDESCRIPTIONBioThermMix is a 2.5x concentrated reagent mixfor PCR comprising BioTherm DNA polymerase(0.06 u/µl), 2.5x PCR-Buffer with 3.75 mM MgCl 2 ,500 µM of each dNTP and stabilizers. The 2.5x concentrationof the Mix provides high versatility for settting-upPCR reactions. Up to 60% of the final reactionvolume can be used for the addition of primer andtemplate DNA solutions, co-solvents or otheradditives, if necessary.BESCHREIBUNGBioThermMix ist ein 2.5x konzentrierter Reagenzien-Mixfür PCR-Reaktionen. Der Mix enthält Bio-Therm DNA-Polymerase (0.06 u/µl), 2.5x PCR-Puffer mit 3.75 mM MgCl 2 , 500 µM von jedem dNTPund stabilisierende Substanzen. Die 2.5x Konzentrationdes BioThermMix ermöglicht einen flexiblenEinsatz in den PCR-Reaktionen.Auf diese Weise kannbis zu 60 % des endgültigen Reaktion-Volumens fürdie Zugabe von Primern, Template-DNA, sowie anderenReaktionssubstanzen genutzt werden.APPLICATIONBioThermMix is suitable and tested for amplificationof genomic targets ranging from l00 bp to 4 kband of episomal targets (lambda phage; plasmids) upto 10 kb under various reaction conditions.high through-put PCRroutine diagnostic PCR requiring high reproducibilityDNA sequencing template preparationSTORAGE CONDITIONSBioThermMix can be stored at either -20°C in afreezer or at 2-8°C in a usual refrigerator. Shipment atambient temperature is possible without reduction ofPCR performance and activity. Storage at 2-8°C is convenientfor easy and time-saving assembling of thePCR assays. Storage of BioThermMix at -20°C isrecommended for long-term storage after the mix hasbeen used once under non-sterile conditions. Multiplefreezing and thawing do not affect the performance oractivity of the Mix.At 2-8°C the BioThermMix is at least stable for 12months, in frozen state for 2 years.NOTEDo not contaminate the BioThermMix with primersand template DNA used in individual reactions. Thawand mix all components thoroughly, spin down shortlyand chill on ice.It is very important to mix the BioThermMix beforeuse to avoid localized concentration!PROTOCOL1 Place the PCR tubes on ice.2 Prepare first a template/primer mix according to thevolumes given in the table below for different reactionvolumes. Mix the template/primer mix and chillon ice.3 Dispense now the corresponding volume of Bio-ThermMix (20 µl for a 50 µl reaction) followed bythe template/primer mix into each reaction tube.Close tubes and mix well. Spin down shortly, ifnecessary, and chill the tubes on ice.4 Start the program on the thermal cycler. Transfer thetubes directly from ice into the thermal cycler whenthe temperature of the block has reached 90°C.IMPORTANT NOTEThe stabilizers in the BioThermMix are potentialgrowth substrates for bacterial contaminations! If theMix has been opened and used under non-sterile conditions,the residual moiety should be used during thenext 2 weeks with intermediate storage at 2-8°C orshould be frozen at -20°C for longer storage!

BioThermMixPCR Sterile redi- Sense Antisense Template 2.5x PCRVolume stilled H 2 O Primer Primer DNA Mix100 µl up to 60 µl x µl y µl z µl 40 µl50 µl up to 30 µl x µl y µl z µl 20 µl25 µl up to 15 µl x µl y µl z µl 10 µl20 µl up to 12 µl x µl y µl z µl 8 µlFinal concentrations: 200 nM 200 nM 1-100 ng 1x9Other variable reaction conditions (temperatures,cycling times, concentrations of template, primers,magnesium and polymerase) have to be optimizedempirically for each template/primers combination.Most PCR applications work at the standard concentrationof 1,5 mM Mg 2+ provided with 1x diluted PCRMix. Optimal Mg 2+ concentration higher than 1,5 mMcan be adjusted using a separate magnesium solutionor by increasing stepwise (5 µl increments) the amountof BioThermMix added to the reaction assay. Thisapproach can also be used to improve the productyield in amplification of difficult targets on complextemplate DNA (see table below).Optimization by adding variable amounts of concentrated BioThermMix to a 50 µl-assay:Volume of Volume of Final Mg 2+ Final dNTP- Taq units Final2,5x PCR template/ Concen- Concen- per concen-Mix primer mix tration tration reaction trations20 µl 30 µl 1.5 mM 200 µM 1.25 u 1x25 µl 25 µl 2.0 mM 250 µM 1.6 u 1.25x30 µl 20 µl 2.25 mM 300 µM 1.9 u 1.5xCATALOG NO.GC-047-10001 ml

10NeoTherm DNA POLYMERASEDESCRIPTIONNeoTherm is a thermostable DNA polymerase purifiedfrom the Thermus aquaticus strain in accordancewith the procedures developed by Kaledin for the isolationfrom thermophilic bacteria of thermostableenzymes processing DNA polymerase activity.It is a highly processive 5'-3' DNA polymerase lacking3'-5'-exonuclease activity. The enzyme is highly purifiedand is free of nonspecific endo- or exonucleases.This polymerase has a template-dependent activitywhich adds a single deoxyadenosine (A) to the 3' endsof PCR products (3'-A-overhangs).This property allowseasy and efficient ligation of PCR products in TA cloningvectors.BESCHREIBUNGNeoTherm DNA-Polymerase ist eine hitzestabileDNA-Polymerase, welche nach dem Protokoll vonKaledin (1,2,3) zur Reinigung von hitzestabilen Enzymenmit Polymerase-Aktivität aus thermophilen Bakterienaus Thermus aquaticus isoliert wurde.Dies ist eine äußerst aktive 5´-3´ DNA-Polymeraseohne 3´-5´ Exonuklease-Aktivität. Das Enzym weisteinen sehr hohen Reinheitsgrad auf und enthält daherkeinerlei unspezifische Endo- oder Exonukleasen.Die Polymerase besitzt eine Template-abhängige Aktivität,welche einen einzelnen Deoxyadenosin (A) -Restan das 3´ -Ende von PCR-Produkten anhängt (3´-A-Überhänge).Diese Eigenschaft erlaubt die einfache und effizienteLigation von PCR-Produkten in TA-Klonierungs- Vektoren.APPLICATIONPCRDNA labellingCONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 min at 72°C.STORAGE BUFFER20 mM Tris-HCl pH 8.0, 100 mM KCl, 0.1 mM EDTA,5 mM DTT, 50% glycerol, 1% Triton X-100STORAGE TEMPERATURE-20°C10X REACTION BUFFER160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl 2 , 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge.QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickasesand exonucleasesThe enzyme is also tested to verify that less than 10copies of bacterial 16S ribosomal RNA gene sequencesare present in a standard 2.5 unit aliquot.CATALOG NO.GC-031-0100 GC-031-0250 GC-031-0500 GC-031-1000 GC-031-5000100 u 250 u 500 u 1000 u 5000 u

SupraTherm DNA POLYMERASEDESCRIPTIONSupraTherm DNA polymerase is a thermostableDNA polymerase purified from the Thermus aquaticusstrain by several rounds of liquid chromatography. Thepurity of SupraTherm DNA polymerase is more than90% of the total protein in the preparation. Amplificationof DNA fragments (100 bp to 5 kb) can be achievedwith it. The enzyme has both, 5'-3' polymeraseand5'-3'exonuclease activities. SupraTherm canadd a single template-directed deoxyadenosin (A) residueto the 3’ end of duplex PCR products. This propertyallows easy and efficient ligation of PCR productsin TA cloning vectors.11BESCHREIBUNGSupraTherm DNA-Polymerase ist eine hitzestabileDNA-Polymerase, die in mehreren Durchläufen mittelsFlüssigkeits-Chromatographie aus Thermus aquaticusisoliert wurde. Der Reinheitsgrad der SupraThermDNA-Polymerase beträgt mehr als 90 % bezogen aufden Gesamt-Proteingehalt. Das Enzym ist in der LageDNA-Fragmente mit einer Länge von 100 bp bis 5 kb zuamplifizieren. SupraTherm DNA-Polymerase besitztsowohl eine 5´-3´ Polymerase- als auch eine 5´-3´ Exonuklease-Aktivität.Das Enzym kann einen einzelnen,Template-abhängigen Deoxyadenosin (A) –Rest an das3´ -Ende doppelsträngiger PCR-Produkte anhängen.APPLICATIONThe enzyme may be used for PCR, thermosequencingand for other research and diagnostic applications.SupraTherm DNA polymerase is the best enzyme foreveryday routine applications. The enzyme has limitedapplication for PCR with low-abundance template(less then 100 DNA molecules of template). Please usefor PCR of low-abundance templates and for othermore sophisticated techniques BioTherm DNA polymerase.CONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25ºC),50 mM KCl, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore SupraTherm DNA polymerase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl 2 , 0.1% Tween 20The 10x reaction buffer(on request with or withoutMgCl 2 ) is delivered free of charge.1.5 ml 10x reaction buffer (contains 15 mM MgCl 2 )Cat. No. GC-002-0061.5 ml 10x reaction buffer without MgCl 2 plus 50mM MgCl 2 separatelyCat. No. GC-002-007QUALITY CONTROLSupraTherm DNA polymerase was tested for theabsence of unspecific endo- and exonucIeases activities.COMPANION PRODUCTSBioThermRed DNA polymerase, BioTherm DNApolymerase, dNTPs, T-VectorCATALOG NO.GC-022-0100 GC-022-0250 GC-022-0500 GC-022-1000 GC-022-5000100 u 250 u 500 u 1000 u 5000 u

CoverIT OVERLAY FOR PCR REACTIONS12DESCRIPTIONCoverIt can be used as a sample overlay in PCRreaction tubes. The use of CoverIt prevents evaporationand subsequent condensation of the reactionmixture in the reaction tube. Upon cooling to +4 o CCoverIt becomes solid allowing convenient recoveringof the reaction mix by sticking through it with apipet tip.STORAGE TEMPERATUREstore at room temperatureBESCHREIBUNGCoverIt kann als Proben-Überschichtung in PCRReaktions-Gefäßen verwendet werden. Die Verwendungvon CoverIt verhindert die Verdunstung und anschließendeKondensation des Reaktionsansatzes im Reaktionsgefäß.Nach Kühlung auf +4 °C wird CoverItfest, so dass man mit einer Pipettenspitze durchstechenkann, um den Reaktionsansatz heraus zu pipettieren.PROTOCOLFor 10-100 µl PCR mix use 60 µl (two drops) CoverIt .CATALOG NO.GC-0261.5 mlPCR-GRADE H 2 OCATALOG NO.GC-0581,5 ml

CRYSTAL VIOLET BUFFERDESCRIPTIONBy including crystal violet in the gel and loading buffferit is possible to visualize DNA bands as they separateduring agarose gel electrophoresis. This is particularlyuseful for isolating DNA fragments for cloningwork. The advantage of this method is that the DNA isnot exposed to the damaging effects of ultraviolet(UV) light, as occurs when ethidium bromide is usedfor staining. The improvement in cloning efficiencyobserved when crystal violet is used is threefold whencompared with ethidium bromide and a transilluminatorwith max. 320 nm and tenfold in comparison witha shorter wavelength (302 nm).APPLICATIONCloning of DNA fragments (PCR products and DNAmolecules digested by restriction enzymes)STORAGE TEMPERATURE+4° C to -20° CREFERENCESRand, K. N. (1996) Crystal violet can be used to visualizeDNA bands during gel electrophoresis and to improvecloning efficiency. Elsevier Trends Journals TechnicalTips Online, T40022.BESCHREIBUNGMit Hilfe des Crystal Violet in Gel und Puffer ist es möglichdie DNA-Banden sichtbar zu machen, während siesich in einer Agarose-Gel-Elektrophorese trennen. Diesist besonders nützlich bei DNA-Fragmenten, die für Klonierungenisoliert werden. Der Vorteil dieser Methodeist, dass die DNA nicht den schädigenden Einflüssenultravioletten (UV) Lichts ausgesetzt werden muss, wasnötig ist, wenn Ethidiumbromid für die Färbung verwendetwird. Der Erfolg einer Klonierung ist nach Verwendungvon Crystal Violet dreimal höher als bei Verwendungvon Ethidiumbromid oder einem Transilluminatormit max. 320 nm, sowie zehnmal höher bei einerkürzeren Wellenlänge (302 nm).PROTOCOLCrystal violet has a lower sensitivity than ethidiumbromide. Load as much as 1 to 3 µg DNA in a slot. Ifless than 100 ng of the required fragment is loadedonto the gel it may be necessary to make a controlwith ethidium bromide by running a second minigel atthe same time. Agarose should be prepared by adding100 µl Crystal violet gel buffer to 100 ml gel. Add 3-5µl Crystal Violet loading buffer to 30 µl digest or PCRaliquot and load that into the slot. For maximum sensitivitythe running buffer should only just cover thegel. After electrophoresis, place the gel on a light boxto visualize separated fragments. Crystal violet is runnningin opposite direction as DNA, so do not run thegel for a too long time.13CATALOG NO.GC-030500 µl loading buffer,10 ml gel buffer (100 rxns).

14BioThermRed DNA POLYMERASEDESCRIPTIONBioThermRed DNA polymerase is a mixture of Bio-Therm DNA polymerase and red pigment thatworks like BioTherm. After addition of BioTherm-Red a thin red layer on the bottom of the tubeappears. So you have a visible pipetting control. Furthermoreyou can see, if your reaction is alreadymixed, when the color of your reaction becomes uniform.BESCHREIBUNGBioThermRed ist eine neue, mit rotem Farbstoff verseheneVariante der BioTherm DNA Polymerase. Siefunktioniert genauso wie BioTherm DNA Polymerase.Nach Zugabe von BioThermRed erscheint einedünne rote Schicht am Boden des Reaktionsgefäßes.Dadurch haben Sie eine deutlich sichere Pipettierkontrolle.Weiterhin können Sie anhand der roten Farbeerkennen, ob ihr Ansatz gut durchmischt ist. GleichmäßigeFarbverteilung deutet auf eine vollkommeneDurchmischung der Probe hin.CONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25ºC),50 mM KCl, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20,0.2%indicator red dye, 50% glycerol (v/v)The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge.STORAGE TEMPERATUREStore BioThermRed DNA polymerase below 0ºC,preferably at -20ºC, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl 2 , 0.1% Tween 201.5 ml 10x reaction buffer (contains 15 mM MgCl 2 )Cat. No. GC-002-0061.5 ml 10x reaction buffer without MgCl 2 plus50 mM MgCl 2 separatelyCat. No. GC-002-007ASSOCIATED ACTIVITIESEndonuclease- and exonuclease activities were notdetectable after 2 and 1 hours incubation, respectively,of 1 µg lambda DNA and 0.22 µg of EcoRI digestedlambda DNA, respectively, at 72ºC in the presence of15-20 units of BioThermRed DNA polymerase.COMPANION PRODUCTSBioTherm DNA polymerase, SupraTherm DNApolymerase, dNTPsCATALOG NO.GC-021-0100 GC-021-0250 GC-021-0500 GC-021-1000 GC-021-5000100 u 250 u 500 u 1000 u 5000 u

BioThermT DNA POLYMERASEDESCRIPTIONBioThermT is a modified BioTherm DNA polymeraseto facilitate incorporation of Biotin-dUTP and Digoxigenin-dUTPin DNA.BESCHREIBUNGBioThermT ist eine modifizierte BioTherm DNA-Polymerase, die es ermöglicht Biotin-dUTP und Digoxigenin-dUTPin DNA einzubringen.15CONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 minutes at 72ºC under the assay conditions(25 mM TAPS (tris-(hydroxy-methyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25ºC),50 mM KCl, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20,0.2%indicator red dye, 50% glycerol (v/v)The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge.STORAGE TEMPERATUREStore BioThermT DNA polymerase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.8 (at25ºC), 15 mM MgCl 2 , 0.1% Tween 201.5 ml 10x reaction buffer (contains 15 mM MgCl 2 )Cat. No. GC-002-0061.5 ml 10x reaction buffer without MgCl 2 plus50 mM MgCl 2 separatelyCat. No. GC-002-007ASSOCIATED ACTIVITIESEndonuclease- and exonuclease activities were notdetectable after 2 and 1 hours incubation, respectively,of 1 µg lambda DNA and 0.22 µg of EcoRI digestedlambda DNA, respectively, at 72ºC in the presence of15-20 units of BioThermT DNA polymerase.COMPANION PRODUCTSBioTherm, BioThermBioA 700 bp DNA fragment of a single copy gene wasamplified without (lane 1) and with the addition ofbiotin-11-dUTP using different concentrations (lanes2-4, MW = molecular weight standard). PCR reactionswere run for 40 cycles, 10 sec at 92°C,15 sec at 65°C,and 2 min at 72°C in a volume of 25 µL, including 10x amplification buffer (Genecraft), 2 mM MgCl 2 ,5pmol of each forward and reverse primers, 1 ng ofDNA, 1 unit of BioTherm T Taq polymerase (Genecraft)and 0.1 mM of each dNTPs, whereas dTTP was proportionallysubstituted with increasing concentrationsof biotin-11-dUTP: 20% (lane 2), 50% (lane 3), and70% (lane 4). The incorporation of biotin-11-dUTPcorrelates with a size shifting of the amplified product.Note, the decrease of PCR efficiency at a proportion of70% biotin -11-dUTP (lane 4) compared to the lowerconcentrations.MW 1 2 3 4 MW

BioThermT DNA POLYMERASE16500pg 50pg 5pg20% bio-dUTP50% bio-dUTP70% bio-dUTPA 700 bp DNA fragment was internally labeled by PCRmediated incorporation of biotin-11-dUTP (biotin-11-dUTP/dTTP = 1/4, 1/1, and 2.3, respectively; see figure1). The PCR products were diluted to 500 pg, 50 pg,and 5 pg and dot blotted onto nylon membrane. TheDNA was cross linked to the membrane by UV radiationand visualized by colorimetric detection by meansof Streptavidin/alkaline phosphatase conjugate incubationin the presence of BCIP and XPhosphat for 3hours at 37°C. Signal intensity was strongest at 1/1concentration (50%) of biotin-11-dUTP.The efficiency of PCR mediated incorporation of biotin-11-dUTP into a DNA fragment of 900 bp was assesedquantitatively and by comparing different Taq polymerasesusing a ratio of biotin-11-dUTP/dTTP of 1/1(amplification conditions as described in figure 1).Lane 1 shows the unincorporated PCR product, lanes2-4 show the biotinylated products using 0.1, 1, and10 ng of starting DNA template and BioTherm T polymerase(Gencraft), lane 5 and 6 depicts biotinylatedproducts using regular BioTherm polymerase (Genecraft)and an enzyme from a competitor, respectively.Note, the template dependent increase of PCR productyield, and the high efficiency of both BioTherm polymerasescompared to a competitor’s polymerase.MW 1 2 3 4 5 6 MWCATALOG NO.GC-055-0100 GC-055-0250 GC-055-0500 GC-055-1000100 u 250 u 500 u 1000 u

BioThermBio DNA POLYMERASEDESCRIPTIONBioThermBio is a novel thermostable DNA polymerasethat dramatically improves incorporation of Biotin-and Digoxigenin-dUTPs as compared to Taq DNApolymerase.BESCHREIBUNGBioThermBio ist eine neue hitzestabile DNA-Polymerase,welche das Einbringen von Biotin- und Digoxigenin-dUTPsin DNA grundlegend verbessert.17Biotine-11-dUTP labelling of PCR DNA fragment (650bp) by thermophilic DNA polymerases.Lane 1 Amplification by Taq polymerase, dNTPs200mM each, no Biotine-11-dUTPLane 2 Amplification by Taq polymerase, dATP, dGTP,dCTP 200 mM each, dTTP 130 mM, Biotin-11-dUTP70 mM.Lane 3 Amplification by NEW polymerase BioTherm-Bio, dATP, dGTP, dCTP 200 mM each, dTTP 130 mM,Biotin-11-dUTP 70 mM. Analysis with streptavidin/-alcalic phosphatase conjugates shows that specificincorporation of Biotin-11-dUTP was 20 times higherwith NEW polymerase.900 dp800 dp700 dp600 dpM 1 2 3CATALOG NO.GC-057-0100 GC-057-0250 GC-057-0500 GC-057-1000100 u 250 u 500 u 1000 u

18BioThermStar DNA POLYMERASEDESCRIPTIONBioThermStar is a thermostable DNA polymerasepurified from the Thermus aquaticus strain in accordancewith the procedures developed by Kaledin forthe isolation of thermostable enzymes processing DNApolymerase activity from thermophilic bacteria. Bio-ThermStar is a modified form of the enzyme designedfor Hot-Start-PCR. It is a highly processive 5'-3'DNA polymerase lacking 3'-5'-exonuclease activity.The enzyme is highly purified and is free of nonspecificendo- or exonucleases.BESCHREIBUNGBioThermStar ist eine hitzestabile DNA-Polymerase,welche nach dem Protokoll von Kaledin (1,2,3) - zurReinigung von hitzestabilen Enzymen mit Polymerase-Aktivität aus thermophilen Bakterien - aus Thermusaquaticus isoliert wurde. Diese 5´-3´ DNA-Polymeraseist eine modifizierte Form des Enzyms und für Hot-Start-PCR-Reaktionen entwickelt worden. Sie besitztkeine 3´-5´ Exonuklease-Aktivität. Das Enzym weisteinen sehr hohen Reinheitsgrad auf und enthält daherkeinerlei unspezifische Endo- oder Exonukleasen.Comparison of BioThermStar (GeneCraft) with AmpliTaqGold (PE)BioThermStarunitspre-heating-timeUNIT DEFINITIONOne unit of activity is the amount of enzyme requiredto incorporate 10 nmoles of dNTP into acid-insolublematerial in 30 min at 72°C.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20,50% glycerol (v/v)BUFFER PHWe strongly recommmendto use bufferswith pH 8.3!AmpliTaqGoldACTIVATIONThis polymerase is inactive until incubated 7-10 min at 95°C! These activation conditions areextremely important! The activation completelyprevents nonspecific primer annealing and the formationof primer-dimers during setup.REACTION TEMPERATUREIt is also very important to pay great attention tothe actual temperature (95°C) inside the tube!APPLICATIONHot-Start-PCRPCR with high specificityCONCENTRATION5 units/µlSTORAGE TEMPERATURE-20°C10X REACTION BUFFER160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.3 (at25°C), 15 mM MgCl 2 , 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge.Please note the difference between BioTherm andBioThermStar buffers!QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickasesand exonucleases.COMPANION PRODUCTSBioThermAB, MagicTubes

BioThermStar DNA POLYMERASEBioThermStar IN A TAQMAN ASSAY200 nM dNTP´s500 nM Primer1.25 u BioTherm Star/0.25 µl3 mM MgCl2300 nM passive reference dye (Rox)100 nM TaqMan-probe19CATALOG NO.GC-045-0100 GC-045-0250 GC-045-0500 GC-045-1000 GC-045-5000100 u 250 u 500 u 1000 u 5000 u

20BioThermStarMixDESCRIPTIONBioThermStarMix is a 2.5x concentrated reagentmix for Hot Start PCR comprising BioThermStarDNA polymerase (0.06 u/µl), 2.5x PCR-Buffer with3.75 mM MgCl 2 , 500 µM of each dNTP and stabilizers.The 2.5x concentration of the Mix provides high versatilityfor setting-up Hot Start PCR reactions. Up to60% of the final reaction volume can be used for theaddition of primer and template DNA solutions, co-solventsor other additives, if necessary.BESCHREIBUNGBioThermStarMix ist ein 2.5x konzentrierter Reagenzien-Mixfür Hot Start PCR-Reaktionen. Der Mixenthält BioThermStar DNA-Polymerase (0.06 u/µl),2.5x PCR-Puffer mit 3.75 mM MgCl 2 , 500 µM vonjedem dNTP und stabilisierende Substanzen. Die 2.5xKonzentration des BioThermStarMixermöglichteinen flexiblen Einsatz in den Hot Start PCR-Reaktionen.Auf diese Weise kann bis zu 60 % des endgültigenReaktion-Volumens für die Zugabe von Primern,Template-DNA, sowie anderen Reaktionssubstanzengenutzt werden.APPLICATIONBioThermStarMix is suitable and tested for amplificationof genomic targets ranging from l00 bp to 4 kband of episomal targets (lambda phage; plasmids) upto 10 kb under various reaction conditions.high through-put Hot Start PCRroutine diagnostic Hot Start PCR requiring highreproducibilityDNA sequencing template preparationSTORAGE CONDITIONSBioThermStarMix can be stored at either -20°C in afreezer or at 2-8°C in a usual refrigerator. Shipment atambient temperature is possible without reduction ofHot Start PCR performance and activity. Storage at 2-8°C is convenient for easy and time-saving assemblingof the Hot Start PCR assays. Storage of BioThermStar-Mix at -20°C is recommended for long-termstorage after the mix has been used once under nonsterileconditions. Multiple freezing and thawing donot affect the performance or activity of the Mix.At 2-8°C the BioThermStarMix is at least stable for12 months, in frozen state for 2 years.NOTEDo not contaminate the BioThermStarMix with primersand template DNA used in individual reactions.Thaw and mix all components thoroughly, spin downshortly and chill on ice.It is very important to mix the BioThermStarMixbefore use to avoid localized concentration!PROTOCOL1 Place the Hot Start PCR tubes on ice.2 Prepare first a template/primer mix according to thevolumes given in the table below for different reactionvolumes. Mix the template/primer mix and chillon ice.3 Dispense now the corresponding volume ofBioThermStarMix (20 µl for a 50 µl reaction) folllowedby the template/primer mix into each reactiontube. Close tubes and mix well. Spin down shortly, ifnecessary, and chill the tubes on ice.4 Start the Hot Start program. Transfer the tubesdirectly from ice into the thermal cycler when thetemperature of the block has reached 95°C. Incubateca. 7 min. at 95°C before cycling.IMPORTANT NOTEThe stabilizers in the BioThermStarMix are potentialgrowth substrates for bacterial contaminations! Ifthe Mix has been opened and used under non-sterileconditions, the residual moiety should be used duringthe next 2 weeks with intermediate storage at 2-8°Cor should be frozen at -20°C for longer storage!

BioThermStarMixPCR Sterile redi- Sense Antisense Template 2.5x PCRVolume stilled H 2 O Primer Primer DNA Mix100 µl up to 60 µl x µl y µl z µl 40 µl50 µl up to 30 µl x µl y µl z µl 20 µl25 µl up to 15 µl x µl y µl z µl 10 µl20 µl up to 12 µl x µl y µl z µl 8 µlFinal concentrations: 200 nM 200 nM 1-100 ng 1x21Other variable reaction conditions (temperatures,cycling times, concentrations of template, primers,magnesium and polymerase) have to be optimizedempirically for each template/primers combination.Most PCR applications work at the standard concentrationof 1,5 mM Mg 2+ provided with 1x diluted PCRMix. Optimal Mg 2+ concentration higher than 1,5 mMcan be adjusted using a separate magnesium solutionor by increasing stepwise (5 µl increments) the amountof BioThermStarMix added to the reaction assay.This approach can also be used to improve the productyield in amplification of difficult targets on complextemplate DNA (see table below).Optimization by adding variable amounts of concentrated BioThermStarMix to a 50 µl-assay:Volume of Volume of Final Mg 2+ Final dNTP- Taq units Final2,5x PCR template/ Concen- Concen- per concen-Mix primer mix tration tration reaction trations20 µl 30 µl 1.5 mM 200 µM 1.25 u 1x25 µl 25 µl 2.0 mM 250 µM 1.6 u 1.25x30 µl 20 µl 2.25 mM 300 µM 1.9 u 1.5xCATALOG NO.GC-041-10001ml

22BioThermAB DNA POLYMERASEDESCRIPTIONBioThermAB polymerase offers all the benefits ofBioTherm DNA polymerase plus an antibody-based,built-in hot start. The BioThermAB polymerase mixcontains Hot Start Taq Monoclonal Antibody, whichblocks polymerase activity prior to the onset of thermalcycling.This prevents primer-dimers and other artifactsresulting from low-level synthesis from nonspecificallyprimed sites. The antibodies are quickly inactivatedby the increased temperature of thermal cycling.BioThermAB polymerase requires no prolongedheating or denaturing step as do other hot-startmethods, making BioThermAB polymerase moreconvenient and easy to use.BESCHREIBUNGBioThermAB weist neben allen Vorteilen einer Bio-Therm DNA-Polymerase die Möglichkeit auf, diesein Hot-Start-PCR-Reaktionen einzusetzen. Zusätzlichenthält dieser BioThermAB Polymerase-Mix Hot-Start-Taq monoklonale Antikörper, welche die Polymerase-Aktivitätvor dem Beginn der PCR-Zyklen blokkiert.Dies soll Primer-Dimere und andere Artefakteaufgrund unspezifischer low-level Synthesen verhindern.Die Antikörper werden dann durch die steigendeTemperatur der PCR-Zyklen rasch inaktiviert.BioThermAB Polymerase benötigt keine anhaltendenHeiz- oder Denaturierungsphasen wie in anderenHot-Start Protokollen, was diese Polymerase komfortablerund leichter zu Handhaben macht.APPLICATIONHot-Start-PCRPCR with high specificityCONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 min at 72°C.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATURE-20°C10X REACTION BUFFER160 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl pH 8.8 (at 25°C),15 mM MgCl 2 , 0.1% Tween 20The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge.QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickasesand exonucleasesCOMPANION PRODUCTSBioThermStar, MagicTubesCATALOG NO.GC-008-0100 GC-008-0250 GC-008-0500 GC-008-1000 GC-008-5000100 u 250 u 500 u 1000 u 5000 u

HOT START TAQ MONOCLONAL ANTIBODYCLONE8C123DESCRIPTIONThe Hot Start Taq Monoclonal Antibodies were derivedfrom a hybridoma (fusion of mouse myeloma cell andthe cells after mouse immunization with Taq DNAPolymerase). Hot Start Taq Monoclonal Antibody ismouse IgG 2b isotype.Hot Start Taq Monoclonal Antibody inhibits polymeraseactivity before the onset of thermal cycling, preventingnonspecific amplification and primer-dimer formation.When the temperature is raised, the antibody isquickly inactivated and PCR proceeds.Hot Start Taq Monoclonal Antibody is effective with avariety of commercially available Taq DNA polymerases(native or recombinant). The use of Hot Start TaqMonoclonal Antibody significantly improves the specificityof PCR amplification what is especially importantfor PCR-based diagnostics.BESCHREIBUNGDie Hot Start Taq Monoklonalen Antikörper erhält manaus einer murinen, hybriden Zelle(Fusion einer murinen Myelom-Zelle und murinen Zelllennach Immunisierung der Maus mit Taq DNA-Polymerase).Die Antikörper haben den Isotyp IgG 2b.Hot Start Taq Monoklonale Antikörper blockieren diePolymerase-Aktivität vor dem Beginn der PCR-Zyklen,was Primer-Dimere und andere Artefakte aufgrundunspezifischer Amplifikationen verhindert. Die Antikörperwerden dann durch die steigende Temperatur derPCR-Zyklen rasch inaktiviert.Die Hot Start Taq Monoklonalen Antikörper funktionierenmit einer Reihe von kommerziell erhältlichenTaq-DNA-Polymerasen (nativ oder rekombinant). DieVerwendung dieser Antikörper verbessert signifikantdie Spezifität der DNA-Amplifikation, was speziell inder Diagnostik mit PCR sehr wichtig ist.APPLICATIONHot Start PCRPCR diagnosticsCONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of Hot Start TaqMonoclonal Antibody required to block 50% of activityof 1 µg of Taq DNA Polymerase at 37°C.STORAGE BUFFER10 mM Tris-HCl (pH 7.0 at 22°C), 50 mM KCl,0.1 mM EDTA, 50% glycerolSTORAGE TEMPERATURE-20°CREACTION BUFFERThe Hot Start Taq Monoclonal Antibody reaction bufferis the same buffer used for the thermostable DNApolymerase.PURITYMore than 90% in SDS electrophoresis in 15% PAAG.ASSOCIATE ACTIVITIESNo conversion to the covalently closed circular DNA tothe nicked or linear form was observed after incubationof 1 µg of pUC19 with antibodies in final concentrationof 6 u/µl in 20 µl of reaction mixture containing25 mM Tris-HCl (pH 7.9), 100 mM NaCl, 10 mM MgCl 2after 16 hours at 37°C.PROTOCOLAdd 5 u (1µl) Hot Start Taq Monoclonal Antibody to100 u enzyme.CATALOG NO.GC-029-0100 GC-029-0250 GC-029-0500 GC-029-1000 GC-029-5000100 u 250 u 500 u 1000 u 5000 u

HOT START PCR COMPOUND24TYPEHSplusDESCRIPTIONHot Start (HS) PCR is commonly used to enhance thespecificity and sensitivity of PCR amplification. In manycases, HS-PCR has yielded single products in a greateryield than it has been possible with conventional PCR.Usually HS-PCR is inconvenient, time-consuming andincurs a risk of cross contamination. This inconveniencesare overcome by HSplus compound.HSplus is used to block Taq polymerase activity duringset-up of the PCR reaction at ambient temperatures(20-25°C). The inhibition of Taq polymerase is completelyreversed when the temperature is raised above48°C.HSplus is effective with a variety of commercially availableTaq DNA polymerases (native or recombinant).The use of HSplus significantly improves the specificityof PCR amplification what is especially important forPCR-based diagnostics.BESCHREIBUNGHot Start (HS) PCR wird üblicherweise verwendet, umdie Spezifität und Sensitivität der PCR-Amplifikationzu steigern. In vielen Fällen erhält man mit der HS-PCRdie einzelnen Produkte in einer größeren Ausbeute alses mit einer herkömmlichen PCR möglich ist.Normalerweise ist eine HS-PCR relativ unbequem,zeitintensiv und beinhaltet das Risiko von Kreuz-Kontaminationen.Diese Nachteile kann man bei Verwendungvon Hsplus Compound umgehen.HSplus wird verwendet, um die Taq-Polymerase-Aktivitätwährend des Ansetzens der Reaktion bei Umgebungstemperaturenvon 20-25°C zu blockieren. Wenndie Temperatur dann über 48°C steigt, stellt sich dievolle Aktivität der Polymerase wieder ein.HSplus funktionieren mit einer Reihe von kommerziellerhältlichen Taq-DNA-Polymerasen (nativ oder rekombinant).Die Verwendung von HSplus verbessert signifikantdie Spezifität der DNA-Amplifikation, wasspeziell in der Diagnostik mit PCR sehr wichtig ist.APPLICATIONHot Start PCRPCR diagnosticsCONCENTRATION1 unit/µlUNIT DEFINITIONOne unit of activity is the amount of HSplus requiredfor 2 units Taq polymerase per reaction.STORAGE BUFFER20mM Tris-HCl; pH 8,0; 0,1 mM EDTASTORAGE TEMPERATURE-20°CREACTION BUFFERThe HSplus reaction buffer is the same buffer used forthe thermostable DNA polymerase.QUALITY CONTROLActivity, PAGE purity, absence of any enzyme contamination.IMPOTRANT NOTEDo not use HSplus when the PCR annealing cycletemperature is below 48°C.PROTOCOLMix 1 unit of HSplus with 2 units of Taq polymerase inthe PCR reaction buffer in presence of all componentswith the exception of the DNA template investigated.Incubate 10 min at room temperature, then add DNAand start PCR. Add in the same manner HSplus in thepositive control reaction.The concentration of HSplus can be 2-10 timesdecreased in case of absence of its positive action.CATALOG NO.GC-034-0100 GC-034-0250 GC-034-0500 GC-034-1000 GC-034-5000100 u 250 u 500 u 1000 u 5000 u

KlenTherm DNA POLYMERASEDESCRIPTIONKlenTherm DNA polymerase is thermostable polymerasecorresponding to the KlenTaq polymerase describedby W. M. Barnes. It is a N-terminally truncatedTaq DNA polymerase. As expressed from a gene constructin E.coli, translation initiates at Met 236 , bypasssingthe 5'-3' exonuclease domain of the DNA polymerase-encodinggene. This deletion leaves a highlyactive and even more heat-stable DNA polymeraseactivity. Repeated exposure to 98ºC, in the recommendedreaction buffer, does not seem to diminish theenzyme activity. Significant activity remains even afterexposure to 99ºC. The full length enzyme does nottolerate these treatments.Therefore KlenTherm DNA polymerase is an excelllentalternative to modified T7 RNA polymerase inthermal sequencing methods. Even problematic DNAtemplates with secondary structures and GC-richregions can be sequenced at 70°C.You can use KlenTherm DNA polymerase also forLong-PCR up to 35 kb in combination with thermostable„proof-reading“ polymerases (e.g. Accu-Therm). GeneCraft offers several mixtures of Klen-Therm DNA polymerase called Synergy.In special applications KlenTherm DNA polymerasehas proven better specificity than regular Taq polymerase.This results in minimising of unspecific DNAamplification products.KlenTherm DNA polymerase is similar to, yet disitinctfrom, USB Taq and Cetus Stoffel fragment. Youwill need more KlenTherm than Taq protein if thenucleic acid incorporation is more than 500 bp. Klen-Therm DNA polymerase is shipped at higher (10u/µl) concentration, so that it can easily incorporate 2kb, if the same quantity is used as for full-length Taq.The use of KlenTherm is espacially recomended foramplifications of small fragments from genomic DNA.The 10x reaction buffer (on request with or withoutMgCl 2 ) is delivered free of charge. KlenTherm has avery low 3’-A-Overhang-adding activity.BESCHREIBUNGKlenTherm DNA polymerase ist eine thermostabilePolymerase, welche der von W. M. Barnes beschriebenenKlenTaq Polymerase entspricht. Bei der Expressiondes Genkonstrukts in E.coli beginnt die Translationerst bei Met 236 , wodurch die 5’-3’ Exonucleasedomäneam N-Terminus wegfällt. Diese Deletion führt zuerhöhter Genauigkeit und Aktivität. Ausserdem machtsie die Polymerase hitzestabiler.Wiederholtes Erhitzen auf 98°C im entsprechendenReaktionspuffer beeinträchtigt nicht die Aktivität!Selbst nach Erhitzung auf 99°C behält KlenTherm ihreAktivität! Solch eine Hitzebeständigkeit besitzt normaleTaq Polymerase nicht.Dadurch ist sie auch für die thermale DNA Sequenzierungeine hervorragende Alternative zu modifiziertenT7 DNA Polymerasen. Besonders problematische DNATemplates mit Sekundärstrukturen und hohen GC-Gehalten können mit KlenTherm DNA Polymerasebei 70°C optimal sequenziert werden.Weiterhin ist die KlenTherm DNA Polymerase inKombination mit einer thermostabilen „proofreading“-DNAPolymerase (AccuTherm) für dieAmplifikation von besonders langen DNA Fragmentenbis 35 kb geeignet. GeneCraft bietet solche Mischungenunter dem Namen Synergy an.In bestimmten Applikationen kann KlenTherm DNAPolymerase eine optimalere Spezifität als herkömmlicheTaq Polymerasen aufweisen, was zur Minimierungvon unspezifischen DNA-Amplifikationsprodukten beitragenkann. Gerade bei kurzen Fragmenten genomischerDNA ist KlenTherm DNA Polymerase sehr zuempfehlen.KlenTherm DNA polymerase ist vergleichbar mitTaq (USB) und Stoffel fragment (Cetus). Wir empfehlen,bei Fragmenten über 500 bp mehr Units vonKlenTherm DNA Polymerase einzusetzen als beigewöhnlicher Taq Polymerase. Aus diesem Grund liefernwir Ihnen KlenTherm DNA polymerase in einerKonzentration von 10 u/µl.KlenTherm DNA Polymerase wird mit einem 10xReaktionspuffer (auf Wunsch auch mit MgCl 2 als separaterLösung) ohne Aufpreis geliefert. KlenThermzeigt eine sehr niedrige Aktivität 3´-A-Überhängeanzuhängen.25

KlenTherm DNA POLYMERASE26APPLICATIONSFidelityThe relative mutation rate during polymerization istwofold lower for KlenTherm as compared to the fulllengthTaq DNA polymerase.Cycle sequencingThe absence of the 5'-3' exonuclease activity makesKlenTerm especially suitable for cycle sequencing. Itgives higher sequence intensity and very low backgrounds.Long PCRKlenTherm in combination with a Pfu DNA polymerase(AccuTherm) exhibiting a proof-reading activitycan amplify up to 35 kb DNA fragments.Mutation analysisKlenTherm has a reduced tendency to extend a mismatched3'-oligonucleotide end making it suitable formutation analysis with mutationspecific oligos (ARMSanalysis).CONCENTRATION10 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acidinsolubleform in 30 min at 72ºC under the assay conditions 25mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonicacid, sodium salt) pH 9.3 (at 25ºC), 50 mMKCl, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol) andactivated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7,0; 100 mM NaCl; 0,5mM EDTA; 1 mM DTT; 0,01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore KlenTherm DNA polymerase below 0°C, preferablyat -20°C, in a constant temperature freezer.10X REACTION BUFFER500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C), 1%Triton X100, 35 mM MgCl 21.5 ml 10x reaction bufferCat. No GC-001-006Please note the difference between KlenThermand BioTherm reaction buffers!COMPANION PRODUCTSKlenThermN DNA polymerase, KlenThermase ,KlenThermaseN, Synergy DNA polymerase, SynergyN DNA polymerase, SynergyT DNA polymerase,dNTPsAMPLIFICATION CONDITIONS10x reaction buffer 3 µl50 mM MgCl 2 2.1 µldNTP Mix10 (end concentration 200 µM) 0.6 µlhuman genomic DNA (300-600 ng) 1 µlforward primer (25 pM) 2 µlreverse primer (25 pM) 2 µlKlenTherm (10 units/µl) 0.5 µlH 2 O 18.8 µl58ºC 0.5 min72ºC 4 min93ºC 20 sec30 cyclestotal 30 µlFragment is about 1,5 kbCATALOG NO.GC-001-0100 GC-001-0250 GC-001-0500 GC-001-1000 GC-001-5000100 u 250 u 500 u 1000 u 5000 u

KlenTherm DNA POLYMERASEREFERENCES1 Barnes W.M. 1992. The fidelity of Taq polymerasecatalyzing PCR is improved by an N-terminal deletion.Gene 112: 29-35„PCR conditions efficient enough to allow theamplification of a 5-kb fragment result in less thanhalf as many mutations, when KlenTaq is the DNApolymerase, compared to AmpliTaq.“2 Barnes W.M. 1994. PCR amplification of up to 35-kbDNA with high fidelity and high yield from bacteriophagetemplates. Proc. Natl. Acad. Sci. USA 91:2216-2220„A target length limitation to PCR amplification ofDNA has been idientified and addressed. Concomitantly,the base-pair fidelity, the ability to use PCRproducts as primers and the maximum yield of targetfragment were increased. These improvementswere achieved by the combination of a high level ofan exonuclease-free, N-terminal deletion mutant ofTaq DNA polymerase, Klentaq1, with a very low levelof a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). Atleast 35 kb can be amplified to high yields from 1 ngof DNA template.Amplification of DNA spans by the polymerase chainreaction (PCR) has become an important and widespreadtool of genetic analysis since the introductionof thermostabile Taq (Thermus aquaticus) DNA polymerasefor its catalysis. Two limitations to themethod are the fidelity of the final product and thesize of the product span, that can be amplified. Thefidelity problem has been partially addressed by thereplacement of Taq DNA polymerase by Pfu (Pyrococcusfuriosus) DNA polymerase, which exhibits anintegral 3'-(editing)-exonuclease, that apparentlyreduces the mutations per base per cycle from about10-4 to about 10-5. It was found, that this enzymeis unable to amplify certain DNA sequences in thesize range of 1.5-2 kb, that Klentaq1 (N-terminaldeletion mutant of Taq DNA polymerase analogousto the Klenow fragment of Escherichia coli DNApolymerase I) or AmpliTaq (fullength Taq DNA polymerase)can amplify handily, and Pfu is no more able(i.e., is not able) to amplify DNA product spans inexcess of 5-7 kb than is any form of Taq DNA polymerase.For full-length Taq DNA Polymerase and itsN-terminally truncated variants Klentaq1, Klentaq5and Stoffel fragment, PCR amplification rapidlybecomes inefficient or nonexistent as the length ofthe target span exceeds 5-6 kb. This is true even if30 min (10 times longer than seemingly necessary)is used during the extension step of each cycle. Althoughthere are several reports of inefficient butdetectable amplification at 9- to 10-kb target lengthand one at 15 kb, most general applications are limitedto 5 kb. Apparently something has been blokkingextension to longer lengths.“3 Newton C.R. et al. 1989. Analysis of any point mutationin DNA. The amplification refractory mutationsystem (ARMS). Nucl. Acids. Res. 17:2503-2516.„The basis of the invention is that unexpectedly, oligonucleotideswith a mismatched 3'-residue will notfunction as primers in the PCR under appropriateconditions.“27PURITY OF THE KlenTherm FRAGMENT ANDFULL-LENGTH BioThermKlenTherm3.75U7.5U15U30Umarker3.75U7.5U15U30UBioThermIndicated dilutions of the KlenTherm and BioTherm preparation have been analyzed via 10% SDS-PAGErunning gel and stained with Coomassie Brilliant Blue.

28KlenThermNDNA POLYMERASEDESCRIPTIONSubstitution of Asn for the conserved Ser 543 in thethumb subdomain of the Taq DNA polymerase largefragment (KlenTherm DNA polymerase) preventspausing during DNA synthesis and allows the enzymeto overcome template regions with a complex secondarystructure. The mutant enzyme, KlenThermN DNApolymerase (patent pending), provides specific PCRamplification and sequencing of difficult templates,e.g. those with a high GC content or complex secondarystructure. Furthermore this substitution increasesseveral times the efficiency of synthesis of long (over2 kb) DNA molecules. The difference in the DNA synthesisefficiencies by the mutant and native enzymesincreases with the increase in the DNA fragmentlength.BESCHREIBUNGDer Austausch von Asn gegen die konservierte Ser 543 inder „Daumen“-Untereinheit des großen Fragmentes(KlenTherm DNA Polymerase) der Taq-DNA-Polymeraseverhindert ein Pausieren während der DNA-Syntheseund erlaubt es dem Enzym Template-Regionenmit einer komplexen Sekundärstruktur zu bewältigen.Das modifizierte Enzym, KlenThermN DNA Polymerase,zeigt eine spezifische DNA-Amplifikation undsequenziert auch schwierige Templates, besonders solchemit einem hohen GC-Gehalt oder komplexenSekundärstrukturen. Außerdem erhöht der Austauschvon Asn gegen Ser 543 die Syntheseeffizienz langerDNA-Moleküle (über 2 kb). Je länger das DNA-Fragment,desto stärker zeigt sich der Unterschied in derEffizienz der Synthese zwischen dem modifizierten unddem nativen Enzym.CONCENTRATION10 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 min at 73ºC under the assay conditions 25mM TAPS (tris-(hydroxy-methyl)-methyl-amino-propanesulfonicacid, sodium salt) pH 9.3 (at 25ºC), 50 mMKCl, 3.5 mM MgCl 2 , 1 mM ß-mercaptoethanol) andactivated salmon sperm DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore KlenThermN DNA polymerase, preferably at-20°C, in a constant temperature freezer.10X REACTION BUFFER500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C), 1% TritonX100Please note the difference between KlenTherm andBioTherm reaction buffers!Extra solution: 50 mM MgCl2, add MgCl 2 to a finalconcentration of 3.5 mM1.5 ml 10x reaction bufferCat. No GC-001-006COMPANION PRODUCTSKlenTherm DNA polymerase, Synergy DNA polymerase,SynergyN DNA polymerase, dNTPsREFERENCESIgnatov, K.B., Miroshnikov, A.I., Kramarov, V.M. (1998)FEBS Lett. 425, 249-250. Substitution of Asn forSer543 in the large fragment of Taq DNA polymeraseincreases the efficiency of synthesis of long DNA molecules.CATALOG NO.GC-023-0100 GC-023-0250 GC-023-0500 GC-023-1000 GC-023-5000100 u 250 u 500 u 1000 u 5000 u

KlenThermPlatinum DNA POLYMERASEDESCRIPTIONKlenThermPlatinum DNA polymerase is a modifiedform of KlenTherm DNA polymerase, that offersexcellent specificity. It is designed for PCR with difficulttemplates such as GC-rich fragments and microsatelllites.KlenThermPlatinum is particularly well suitedto primer extension of Single Nucleotide Polymorphism(SNP) markers.KlenThermPlatinum maintains excellent specificityand minimal background even in conditions designedfor high yield (high Mg 2+ /primer concentrations). Infact, even on genomic templates, the enzyme can beused with MgCl 2+ concentrations as high as 10 mM.KlenThermPlatinum has an extrem low signal/noiseratio. In addition, it has an extremely high recognitionof base mis-matches which results in a very low rate ofmis-match extension.KlenThermPlatinum is capable of extending throughdifficult regions, e.g. regions, which include invertedtandem repeats and those with high amounts of secondarystructure.KlenThermPlatinum works in a totally unique way,involving improved nucleotide selection at the activesite, and a much lower rate of mis-match extension,meaning that only perfectly aligned primers will beextended. As a result, the enzyme can give even higherspecificity than hot-start (manual or automatic)techniques without the need for inconvenient preincubationsteps.KlenThermPlatinum has a very weak terminal transferaseactivity, and products can be assumed to beblunt-ended. However, this is sequence dependent,and some sequences may be tailed with a singlenucleotide.BESCHREIBUNGKlenThermPlatinum DNA Polymerase ist eine modifizierteForm der KlenTherm DNA Polymerase, welcheeine exzellente Spezifität zeigt. Diese DNA-Polymeraseist für PCR-Reaktionen mit einem komplizierten Template,wie z.B. GC-reiche Fragmente und Microsatelliten-DNA,entwickelt worden. KlenThermPlatinum istbesonders gut für die Primer-Verlängerung von Single-Nucleotide-Polymorphism (SNP) Markern geeignet.KlenThermPlatinum ermöglicht eine exzellente Speifitätund einen minimalen Hintergrund, sogar bei Reaktionsbedingungenfür eine möglichst große Ausbeute(hohe Mg 2+ /Primer Konzentrationen). Tatsächlich kanndas Enzym, sogar bei genomischen Templates, beiMgCl 2+ -Konzentrationen von 10 mM verwendet werden.KlenThermPlatinum zeigt ein extrem niedriges Signal/Hintergrund-Verhältnis.Zudem besitzt das Enzymeine extrem hohe Erkennungsrate für „mis-Matches“,woraus eine sehr niedrige Rate für „mis-match“-Verlängerungenresultiert.KlenThermPlatinum ist auch für komplizierte Regionengeeignet, wie z.B. seitenverkehrte Tandem-Wiederholungenoder Regionen mit einem hohen Anteil anSekundärstrukturen.KlenThermPlatinum arbeitet auf eine einzigartigeWeise, einschließlich einer verbesserten Nukleotid-Auswahlim aktiven Zentrum, und zeigt eine deutlich niedrigereRate von „mis-match“-Verlängerungen, d.h.nur perfekt gebundene Primer werden auch verlängert.Daraus resultiert eine sogar noch höhere Spezifität alsbei einer Hot-Start-PCR (manuell oder automatisch)abzüglich des Bedarfes für lästige Vor-Inkubationen.KlenThermPlatinum zeigt eine sehr schwache terminaleTransferase-Aktivität, sodass die Produkte vermutlich„blunt-ended“ sind. Dies ist jedoch von derSequenz abhängig, und einige können auch mit einemeinzelnen Nukleotid enden.29

KlenThermPlatinum DNA POLYMERASE30APPLICATIONSPCR requiring high specificityPCR with GC-rich regions or repeats (e.g. microsatellites)CONCENTRATION10 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme, thatincorporates 10 nmoles of dNTP into acid-insolubleform in 30 min at 73°C under the assay conditions (25mM TAPS pH 9.3 at 25°C, 50 mM KCl, 2 mM MgCl 2 ,1 mM ß-mercaptoethanol) and activated calf thymusDNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATURE-20°C10X REACTION BUFFER500 mM KCl, 100 mM Tris-HCl (pH 9 at 25°C), 1% TritonX100Please note the difference between KlenTherm andBioTherm reaction buffers!1.5 ml 10x reaction bufferCat. No GC-001-006QUALITY CONTROLActivity, non-specific endonucleases/nickases and exonucleases.CATALOG NO.GC-046-0100 GC-046-0250 GC-046-0500 GC-046-1000 GC-046-5000100 u 250 u 500 u 1000 u 5000 u

KlenThermase DNA POLYMERASEDESCRIPTIONKlenThermase DNA polymerase is an optimised versionof KlenTherm DNA polymerase designed forcycle sequencing with dideoxynucleotides.This enzymeis recommended both for manual DNA sequencingwith 35 S label and for automated fluorescent DNAsequencing. Mutations have been introduced into theKlenTherm DNA polymerase that confer on thisenzyme enhanced properties for cycle sequencing ofdouble-stranded PCR products. KlenThermase issimilar to, yet distinct from, USB ThermoSequenase.We recommend to use KlenThermase with our thermostableTth inorganic pyrophosphatase (1 unit of Tthinorganic pyrophosphatase added to 10 units of Klen-Thermase) for further improvement of uniformity ofband intensities.APPLICATIONSFidelityThe relative mutation rate during polymerisation istwofold lower for KlenThermaseas compared to thefull-length Taq DNA polymerase.Cycle sequencingThe absence of the 5'-3' exonuclease activity makesKlenThermase especially suitable for cycle sequencing.It gives higher sequence intensity and very lowbackgrounds. The mutational optimization improvesthe uniformity of band intensities. Combination ofKlenThermase with Tth inorganic pyrophospatasegenerates uniform bands that improve sequencingaccuracy and give long read lengths.CONCENTRATION25 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25°C),CATALOG NO.BESCHREIBUNGKlenThermase DNA Polymerase ist eine optimierteVersion der KlenTherm DNA Polymerase und ist fürdie zyklische Sequenzierung mit Dideoxynukleotidenentwickelt worden. Dieses Enzym ist sowohl fürmanuelle DNA-Sequenzierungen mit 35 S als auch fürautomatisierte, fluoreszenzmarkierte DNA-Sequenzierungenzu empfehlen. In die KlenTherm DNA-Polymerasesind Mutationen eingeführt worden, welchedem Enzym eine verstärkte Wirksamkeit für die zyklischeSequenzierung von doppelsträngigen PCR-Produktenverleihen. KlenThermase ist ähnlich der USBThermoSequenase, aber dennoch deutlich anders. Wirempfehlen KlenThermase mit unserer hitzestabilenTth inorganic Pyrophosphatase zu verwenden ( 1 Unitder Tth inorganic Pyrophosphatase zu 10 Unit Klen-Thermase geben), um eine noch gleichmäßigereBandenintensität zu gewährleisten.50 mM KCI, 2 mM MgCl 2 , 1 mM ß-mercaptoethanoland activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCI,0.5 mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore KlenThermase DNA polymerase below 0°C,preferably at -20°C, in a constant temperature freezer.10X REACTION BUFFER260 mM Tris-HCl (pH 9.5), 65 mM MgCl 2COMPANION PRODUCTSKlenThermaseN, KlenTherm DNA polymerase,KlenThermNTDNA polymerase, Tth pyrophosphataseREFERENCESTabor, S. and Richardson, C.C. I995. A single residuein DNA polymerase of the Escherichia coli DNApolymerase 1 family is critical for distinguishing betweendeoxy- and dideoxyribonucleotides. Proc. Natl.Acad. Scf. USA 92: 6339-634331GC-018-0100 GC-018-0250 GC-018-0500 GC-018-1000 GC-018-5000100 u 250 u 500 u 1000 u 5000 u

KlenThermaseN DNA POLYMERASEDESCRIPTIONKlenThermaseN DNA polymerase is an optimizedversion of KlenThermase for long-range DNAsequencing. This polymerase comprises mutations andbenefits of both KlenThermase and KlenThermNin one enzyme.BESCHREIBUNGKlenThermaseN DNA Polymerase ist für lange DNA-Sequenzierungen entwickelt worden und eine optimierteVersion der KlenThermase. Diese Polymerasebeinhaltet alle Mutationen und Vorteile von KlenThermaseund KlenThermN in einem Enzym.32CONCENTRATION25 units/µlCATALOG NO.GC-002-0100 GC-002-0250 GC-002-0500 GC-002-1000 GC-002-5000100 u 250 u 500 u 1000 u 5000 uDNA CYCLE SEQUENCING KITDESCRIPTIONThe kit contains all necessary components except labeleddNTPs for 100 dideoxy chain terminator-sequencingreactions on double stranded DNA template.Application of KlenThermase for effective DNAelongation provides the possibility to work with theminute amount of template DNA. The suggestedsequencing technique combines amplification DNAwith chain-terminator sequencing reaction. Thesequencing reaction should be performed in thermocyclingdevice routinely used for PCR. The kit does notcontain radioactive dNTPs. Any type of 32,33 P or 35 S-dNTP (2000-8000 Ci/mmol) may be used for radioactivelabeling.CONTENTSKlenThermase5x annealing buffer (260 mM Tris-HCl, pH 9.5)Labeling Nucleotide Mixture (for use with radiolabeleddATP) 1.5 µM dGTP,1.5 µM dCTP, 1.5 µM dTTP (Note: To use labeleddCTP this mixture should contain 1.5 µM each ofdATP, dGTP, dTTP)Termination Nucleotide Mix (one for each dideoxynucleotide).Each mixture contains 15 µM dATP, 15µM dGTP, 15 µM dCTP,15 µM dTTP. In addition the„A” mixture contains 0.2 µM ddATP; the „G“ mix0.4 µM ddGTP; the „C“ mix 0.2 µM ddCTP andthe „T“ mix 0.4 µM ddTTPBESCHREIBUNGDieses Kit enthält, ausgenommen markierter dNTPs, allenotwendigen Komponenten für 100 Sequenzier-Reaktionenmit einem doppelsträngigen DNA-Template. DieAnwendung der KlenThermase für effektive DNA-Verlängerung gibt die Möglichkeit mit der absolut exaktenMenge an Template-DNA zu arbeiten. Die vorgeschlageneSequenzier-Technik kombiniert die Amplifikationder DNA mit einer Kettenabschluss-Sequenzier-Reaktion. Die Reaktion sollte in einem handelsüblichenThermocycler für PCR durchgeführt werden. Das Kit enthältkeine radioaktiv-markierten dNTPs. Alle Arten von32P, 33 P oder 35 S-dNTPs (2000-8000 Ci/mmol) können fürradioaktive Markierungen verwendet werden.NOTEFor better reading sequence close to primer (30-100nt), use higher dideoxy nucleotides concentrations: the„A“- 1 µM ddATP, the „G“- 2 µM ddGTP, the „C“- 1µM ddCTP and the „T“- 1 µM ddTTP.Stop solution 95% formamide; 20 mM EDTA;0.05% bromphenol blue; 0.05% xylene cyanol FFprotocolCOMPANION PRODUCTKlenThermase, KlenThermaseN, Tth pyrophosphatase,Acrylamid 4K -Fertiglösungen für denaturierendeDNACATALOG NO.GC-024-0100100 reactions

SEQUENCING REACTION PROTOCOLANNEALING TEMPLATE AND PRIMERThe template (3-5 µg of a plasmid), mixed with the primer(10 pmol), is denatured in 0.2 M NaOH, 0.2 mMEDTA (30 min at 37°C). Mixture is neutralized byadding 0.1 volumes of 3 M sodium acetate (pH 4.5-5.5) and the DNA is precipitated with 2-4 volumes ofethanol (-70°C, 15 min). After washing the pelletedDNA with 70% ethanol, it is redissolved in 12 µl ofditilled water and 2 µl of 5x Annealing buffer.LABELING REACTIONTo the annealed template-primer (14 µl) add the folllowing:Labeling Nucleotide Mix2µl[α- 35 S], [α- 33 P] or [α- 32 P] 5µCi(typically 0.5µl)KlenThermase1 µl (25 units)Mix thoroughly and incubate for 5 min at 45°C.TERMINATION REFERENCES1 Label 4 tubes „G“, „A“, „T“ and „C“. Fill each with4 µl of the appropriate dideoxy termination mixture.Keep on ice until ready for use.2 When the labeling reaction is complete, transfer 4 µlof it to the tube labeled „G“. Similarly transfer 4 µlof the labeling reaction to each of the other threetubes („A“, „T“ and „C“). Place the tubes in a70°C bath.3 After 5-10 min incubation at 70°C, cool to roomtemperature and add 4 µl of Stop Solution to eachtermination reaction, mix and store on ice.4 To load the gel, heat the samples to 70°C for 5 min(or more) and load 2-3 µl in each lane.33

Tth INORGANIC PYROPHOSPHATASE (thermostable)34DESCRIPTIONNative, thermostable Tth inorganic pyrophosphatase(pyrophosphate phosphohydrolase: E.C. 3.6.1.1.) ispurified from Thermus thermophilus and is a hydrolase.Tth inorganic pyrophosphatase catalyses the conversionof inorganic pyrophosphate to orthophosphatein reactions, where pyrophosphate is accumulated,like DNA synthesis and amplification.Tth inorganicpyrophosphatase provides enhanced polymerisationby removing inhibitive pyrophosphates in reactions.BESCHREIBUNGTth anorganische Pyrophosphatase (pyrophosphatephosphohydrolase: E.C. 3.6.1.1.) ist aus Thermus thermophilusisoliert worden und eine native, hitzestabileHydrolase. Das Enzym katalysiert die Umwandlung vonanorganischem Pyrophosphat in Orthophosphat. Diesempfiehlt sich in Reaktionen, in denen sich Pyrophosphatansammelt, wie z.B. DNA-Synthesen und –Amplifikationen.Durch Zusatz Tth anorganischer Pyrophosphataseerhält man aufgrund der Entfernung des inhibierendenPyrophosphates aus den Reaktionen eineverstärkte Polymerisation.APPLICATIONSEnhanced DNA amplificationThe addition of Tth inorganic pyrophosphatase greatlyenhances amplification reactions and provides superiorresults. The PCR is inhibited by the presence ofpyrophosphate even at very low concentrations.Thisinhibition may be prevented by introducing Tth pyrophosphatase,capable of removing contaminatingpyrophosphate, to the reaction mixture. The additionof 1 unit Tth inorganic pyrophosphatase to 10 units ofthermostable DNA polymerase (BioTherm,SubTherm or KlenTherm) may double the level ofPCR amplification.Long fragmentsTth inorganic pyrophosphatase enables longer DNAfragments to be processed successfully.DNA SequencingTth inorganic pyrophosphatase is recommended forhigh-temperature cycle sequencing with thermostableDNA polymerases (BioThermor KlenTherm).In vitro mutagenesisTth inorganic pyrophosphatase provides increasedfidelity.CONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme which isrequired to convert 1 µmole of pyrophosphate into2 µmoles of orthophosphate in one minute at 75ºCunder the following conditions: 1 mM K 4 P 2 O 7 ,2 mMMgCl 2 , 50 mM Tris-HCl pH 9.0 (at 75ºC).STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore at -20°C in a constant temperature freezer.QUALITY CONTROL TESTATP-ase and P-Klen are not detectable.COMPANION PRODUCTSKlenThermase, KlenThermaseNCATALOG NO.GC-006-0100 GC-006-0250 GC-006-0500 GC-006-1000 GC-006-5000100 u 250 u 500 u 1000 u 5000 u

SEQUENCING AND PYROPHOSPHATASESEQUENCE-SPECIFIC PYROPHOSPHOROLYSISCAN RESULT IN SEQUENCING ARTIFACTS. PYRO-PHOSPHATASE CAN PREVENT THIS.35In dideoxy-sequencing DNA synthesis is initiated at aunique priming site and terminated by the incorporationof dideoxynucleoside monophosphates. Tabor andRichardson noted that, under certain conditions, theintensities of some of the bands on resulting sequencinggels can be weak. This phenomenon is particularlyapparent when the reactions are run for 30 minutesor longer and when dITP is used in place of dGTP.These weak bands are the result of pyrophosphoroly-sis. This is the reversal of the polymerisation reactioncatalysed by the DNA polymerase wherein DNA andpyrophosphate (PPi) react to form a deoxynucleosidetriphosphate,leaving the DNA chain one base shorter.Pyrophosphorolysis can be prevented using inorganicpyrophosphatase to hydrolyse the pyrophosphate. Thepyrophosphorolysis of terminated chains during DNAsequencing can be summarized as follows:Pyrophosphatase2PiPPiddNTP5’ddN5’dNterminated chainextendible chainAll known DNA polymerases catalyse the templatedependentincorporation of a deoxynucleotide ontothe 3' hydroxyl terminus of a primer, with the releaseof inorganic pyrophosphate. Catalysis requires the presenceof a bivalent cation, either Mg 2+ or Mn 2+ . Underthe conditions normally used for DNA synthesis (i.e.high dNTP concentrations and low pyrophosphateconcentration), the forward reaction (polymerization)is greatly favoured over the reverse reaction (pyrophosphorolysis).Many DNA polymerases also catalysethe hydrolysis of nucleotides from the 3' terminus ofDNA through a seperate exonuclease activity. Thisreaction is unlike pyrophosphorolysis because the substrateis H 2 O and the product is a nucleoside monophosphate.REFERENCES1 Tabor S. and Richardson C. 1987. DNA sequenceanalysis with a modified bacteriophage T7 DNApolymerase. Proc. Natl. Acad. Sci. USA 84:4767-47712 Tabor S. and Richardson C. 1990. DNA sequenceanalysis with a modified bacteriophage T7 DNApolymerase. Effect of pyrophosphorolysis and metalions. J. Biol. Chem.265:8322-8328

36AccuTherm DNA POLYMERASEDESCRIPTIONAccuTherm is a thermostable enzyme possessing5'-3' DNA polymerase and 3'-5' proof reading exonucleaseactivities. It is isolated from the hyperthermophilicmarine archae Pyrococcus furiosis (Pfu). Accu-Therm provides extremely high fidelity. Whereas theenzyme is not able to amplify long fragments as efficientlyas BioTherm or KlenTherm because of itsvery high exonuclease activity, a mixture of eitherKlenTherm or BioTherm with AccuTherm providesmore robust synthesis of longer amplificationproducts (Barnes, 1994. Proc. Natl. Acad. Sci. USA91:2216-2220).BESCHREIBUNGAccuTherm ist ein hitzestabiles Enzym, das eine 5´-3´-DNA-Polymerase- und eine 3´-5´-proof-reading-Exonuklease-Aktivitätbesitzt. Diese Polymerase ist ausdem hyperthermophilen, marinen ArchaebakteriumPyrococcus furiosis (Pfu) isoliert worden. AccuThermzeigt eine extrem hohe Genauigkeit. Man muß jedochsagen, dass AccuTherm aufgrund seiner sehr hohenExonuklease-Aktivität lange DNA-Fragmente nicht soeffizient amplifiziert wie BioTherm oder Klen-Therm. Die Mischung von entweder BioThermoder KlenTherm mit AccuTherm zeigt jedoch wiedereine sehr stabile Synthese auch längerer DNA-Fragmente (Barnes, 1994; Proc.Natl.Acad.Sci. USA91:2216-2220).CONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)methyl-amino-propanesulphonicacid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCI,0.5 mM EDTA; 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore AccuTherm polymerase below 0°C, preferablyat -20°C, in a constant temperature freezer.5X REACTION BUFFER350 Tris-HCl pH 8,8; 83 mM (NH) 4 SO 4 , 100 mM KCl22 mM MgCl 2 0,75% Triton X100COMPANION PRODUCTSSynergy DNA polymerase, SynergyN DNA polymeraseCATALOG NO.GC-004-0100 GC-004-0250 GC-004-0500 GC-004-1000 GC-004-5000100 u 250 u 500 u 1000 u 5000 u

Comparison of some thermostable DNA polymerasesACCURACY OF THERMOSTABLE DNA POLYMERASES37400003500030000Accuracy (Nucleotides)2500020000150001000050000BioThermNeoThermSupraThermSynergySynergyNSynergyTAccuThermPROCESSIVITY OF THERMOSTABLE DNA POLYMERASES ON GENOMIC- AND λ-DNASynergyPlusSynergyNSynergyBioThermNeoThermSupraThermAccuTherm0 5 10 15 20 25 30 35genomic DNAλ DNAProcessivity (kb)

38Synergy DNA POLYMERASEDESCRIPTIONSynergy is a mix of thermostable components possesssing5'-3' DNA polymerase activivity (KlenTherm)and 3'-5' proof-reading activity (AccuTherm). Thesecomponents are optimized to achieve amplification of35 kb or 10 kb products from lambda templates orgenomic DNA, respectively. A mixture of KlenThermwith AccuTherm provides more robust synthesis oflonger amplification products (Barnes, 1994. Proc.Natl. Acad. Sci. USA 91:2216-2220).DESCRIPTIONSynergy ist ein Mix hitzestabiler Komponenten, welchereine 5´-3´-DNA-Polymerase-Aktivität (KlenTherm)und eine 3´-5´-proof-reading-Aktivität (AccuTherm)beinhaltet. Diese Komponenten sind für die Synthesevon 35 kb oder 10 kb großen Produkten anhand vonLambda-Templates bzw. genomischer DNA optimiertworden. Diese Mischung zeigt eine besonders stabileSynthese längerer Amplifikations-Produkte (Barnes,1994; Proc.Natl.Acad.Sci. USA 91:2216-2220).CONCENTRATION10 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7,0; 100 mM NaCI; 0,5mM EDTA; 1 mM DTT; 0,01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore Synergy DNA polymerase below 0°C, preferablyat -20°C, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH) 4 SO 4 , 670 mM Tris-HCl pH 9,1;8 % Glycerol, 2 % DMSO, 35 mM MgCl 2Please note the difference between Synergy andBioTherm reaction buffers.COMPANION PRODUCTSSynergyN DNA polymerase, AccuTherm DNApolymerase.TYPICAL REACTION CONDITIONS10x Synergy reaction buffer 3 µl10 mM dNTP mix 2 µlDNA template 2 µlprimer mix 1 µlSynergy DNA polymerase 0.5 µlH 2 O21,5µl58°C 30 sec72°C 15 min93°C 30 sec30 cyclesTotal 30 µlCATALOG NO.GC-005-0100 GC-005-0250 GC-005-0500 GC-005-1000 GC-005-5000100 u 250 u 500 u 1.000 u 5.000 u

SynergyN DNA POLYMERASEDESCRIPTIONSynergyN is a mix of thermostable polymerasespossessing 5'-3' DNA polymerase activity that is optimizedto amplify longer GC-rich fragments (Klen-ThermN) and 3'-5' proof-reading activity (Accu-Therm). These components are optimized to achieveamplification of 15 kb products from genomic DNA.A mixture of KlenThermN with AccuTherm providesmore robust synthesis of longer GC-rich amplificationproducts.BESCHREIBUNGSynergyN ist eine Mischung hitzestabiler DNA-Polymerasen,welche zum einen eine 5´-3´-DNA-Polymerase-Aktivitätbeinhaltet (KlenThermN), die optimiertwurde, um lange, GC-reiche Fragmente zu amplifizieren.Zum anderen zeigt SynergyN eine 3´-5´-proofreading-Aktivität(AccuTherm). Diese Komponentensind optimal um 15 kb große Fragmente anhand genomischerDNA zu erhalten. Eine Mischung von Klen-ThermN mit AccuTherm zeigt außerdem eine stabilereSynthese längerer, GC-reicher Fragmente.39CONCENTRATION10 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)-methyl-aminopropanesulfonicacid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCI, 0.5mM EDTA; 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore SynergyN DNA polymerase below 0°C, preferablyat -20°C, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH) 4 SO 4 , 670 mM Tris-HCl pH 9,1;8 % Glycerol, 2 % DMSO, 35 mM MgCl 2Please note the difference between SynergyN andBioTherm reaction buffers.COMPANION PRODUCTSSynergy DNA polymerase, dNTPsCATALOG NO.GC-028-0100 GC-028-0250 GC-028-0500 GC-028-1000 GC-028-5000100 u 250 u 500 u 1000 u 5000 u

40SynergyT DNA POLYMERASEDESCRIPTIONSynergy mixture with addition of TthPlus DNA polymeraseespecially suited for low specificity PCR withdegenerated primers.APPLICATIONSLow specificity PCR for degenerated primersCONCENTRATION10 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)methyl-aminopropanesulphonicacid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)BESCHREIBUNGDieses Produkt entspricht Synergy mit dem Zusatzeiner TthPlus DNA-Polymerase, welche sich besondersfür PCR-Reaktionen mit niedriger Spezifität und fehlerhaftenPrimern eignet.STORAGE TEMPERATUREStore SynergyT DNA polymerase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH) 4 SO 4 , 670 mM Tris-HCl pH 9,1;8 % Glycerol, 2 % DMSO, 35 mM MgCl 2Please note the difference between SynergyT andBioTherm reaction buffers.QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases.REFERENCEBarnes W.M. 1994. PCR amplification of up to 35-kbDNA with high fidelity and high yield from bacteriophagetemplates. Proc. Natl. Acad. Sci. USA 91: 2216-2220COMPARISON OFSynergy ANDSynergyT UNDERElektrophorese in 1,5% agarose gel of PCR products obtained by detection of LTR in human locus 7p22.3 and higherprimates. The presence of LTR in this locus was detected by a PCR product of 1831 bp using either Synergy orSynergyT. As templates were used DNA from human(1), chimpanzee(2), gorilla(3), orang-utan(4) and gibbon(5).SPECIAL REACTIONCONDITIONS Synergy SynergyT1831 bpM 1 2 3 4 5 M 1 2 3 4 5CATALOG NO.GC-049-0100 GC-049-0250 GC-049-0500 GC-049-1000 GC-049-5000100 u 250 u 500 u 1000 u 5000 u

SynergyPlus DNA POLYMERASEDESCRIPTIONTaq-based mixture with addition of pyrophosphatasefor the amplification of long fragments. SynergyPlusDNA polymerase can amplify up to 20 kb from genomicDNA.BESCHREIBUNGDies ist eine Mischung von Taq-Polymerasen mit demZusatz einer Pyrophosphatase zur Amplifikation langerFragmente. SynergyPlus DNA-Polymerase amplifiziertbis zu 20 kb lange Fragmente anhand genomischerDNA.41APPLICATIONSVery Long and accurate PCRCONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the assay conditions(25 mM TAPS (tris-(hydroxymethyl)methyl-aminopropanesulphonicacid, sodium salt) pH 9.3 (at 25°C),50 mM KCI, 2 mM MgCl 2 , 1 mM ß-mercaptoethanol)and activated calf thymus DNA as substrate.10 mM K-phosphate buffer pH 7.0, 100 mM NaCl, 0.5mM EDTA, 1 mM DTT, 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore SynergyPlus DNA polymerase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.10X REACTION BUFFER160 mM (NH) 4 SO 4 , 670 mM Tris-HCl pH 9,1;8 % Glycerol, 2 % DMSO, 35 mM MgCl 2Please note the difference between SynergyPlusand BioTherm reaction buffers.QUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickases and exonucleases.REFERENCEBarnes W.M. 1994. PCR amplification of up to 35-kbDNA with high fidelity and high yield from bacteriophagetemplates. Proc. Natl. Acad. Sci. USA 91: 2216-2220CATALOG NO.GC-048-0100 GC-048-0250 GC-048-0500 GC-048-1000 GC-048-5000100 u 250 u 500 u 1000 u 5000 u

42TthPlus DNA POLYMERASEDESCRIPTIONTthPlus DNA polymerase is isolated from the Thermusthermophilus strain.TthPlus DNA polymerase isa single 92 kDa polypeptide showing a 5'-3' exonucleaseactivity but lacking 3'-5' exonuclease activity. Itcatalyzes the polymerization of nucleotides into double-strandedDNA in the presence of MgCl 2 . Its efficiancyhas been shown more particularly on large DNAfragments up to 12 kb (using lambda phage DNA as atemplate). TthPlus DNA polymerase is also capableof catalyzing the polymerization of DNA using a RNAtemplate in the presence of MnCl 2 . The ability ofTthPlus DNA polymerase to reverse transcribe atelevated temperatures (70°C) minimizes the problemsencountered with strong secondary structures in RNAsince they are unstable at higher reaction temperatures.Higher temperatures also result in increased specificyof primer hybridization and extension. In coupledRT/PCR assays, TthPlus is about 50-100 times moreefficient than Taq DNA polymerase.TthPlus DNA polymerase is delivered with 10x RTbuffer,5x amplification-buffer and separate MnCl 2(25 mM) and MgCl 2 (50 mM) solutions. The 5x amplification-buffercontains EGTA, which binds/neutalizesMn 2+ from the RT-reaction. Therefore after RT it is notnecessary to change the buffers. For subsequentamplification we recommend to use BioTherm orKlenTherm DNA polymerase.FEATURESthermostableDNA polymerase activity in the presence of MgCl 2reverse transcriptase activity in the presence ofMnCl 2reverse transcription at elevated temperature minimisingsecondary structure problemsCONCENTRATION5 units/µlSTORAGE BUFFER10 mM K-phosphate buffer pH 7.0 (25°C), 100 mMNaCl, 0.5 mM EDTA, 1 mM DTT, 50% glycerol (v/v),0,1 mg/ml BSABESCHREIBUNGTthPlus DNA-Polymerase ist aus dem Stamm Thermusthermophilus isoliert worden. TthPlus ist ein einzelnes92 kDa großes Polypeptid mit einer 5´-3´-Exonuklease-Aktivität,jedoch ohne eine 3´-5´-Exonuklease-Aktivität. Das Enzym katalysiert die Polymerisation vonNukleotiden in doppelsträngige DNA in Anwesenheitvon MgCl 2 . Die Effizienz dieser Polymerase zeigt sich insbesonderebei langen DNA-Fragmenten bis zu 12 kb(unter Verwendung einer Lambda-Phagen-DNA als Template).TthPlus DNA-Polymerase ist ebenso dazu geeignet diePolymerisation von DNA mit Hilfe eines RNA-Templatesin Anwesenheit von MnCl 2 zu katalysieren. Die Fähigkeitder TthPlus auch bei höheren Temperaturen (70°C)ihre Reverse Transkriptase-Aktivität zu behalten, minimiertdie Probleme mit ausgeprägten Sekundärstrukturenin RNA-Molekülen, da diese bei diesen hohen Temperaturennicht stabil sind. Höhere Temperaturen erhöhenaußerdem noch die Spezifität der Primerbindungund -verlängerung. In gekoppelten RT-PCR-Reaktionenist die TthPlusT zudem ungefähr 50-100 mal effizienterals eine Taq-Polymerase.TthPlus DNA-Polymerase wird mit 10x RT-Puffer, 5xAmplifikations-Puffer und separatem MnCl 2 (25 mM)und MgCl 2 (50 mM) geliefert. Der 5x Amplifikations-Puffer enthält EGTA, welches Mn 2+ aus der RT-Reaktionbindet und damit neutralisiert. Daher ist es nach der RT-Reaktion nicht nötig den Puffer zu wechseln. Für nachfolgendeAmplifikationen empfehlen wir BioThermoder KlenTherm DNA-Polymerase.UNIT DEFINITIONOne unit is defined as the amount of enzyme thatincorporates 10 nmoles of dNTPs into acid-insolubleform in 30 minutes at 72°C under the following reactionconditions: 25 mM TAPS buffer (Tris-(hydroxymethyl)-methyl-amino-propanesulfonicacid, sodium salt)pH 9.3 (25°C), 50 mM KCl, 2 mM MgCl 2 , 1 mMß-mercaptoethanol, 200 µM dNTPs and 10 µg of calfthymus DNA in a final reaction volume of 50 µl.STORAGE TEMPERATUREStore TthPlus TM DNA polymerase, preferably at -20°C,in a constant temperature freezer.

TthPlus DNA POLYMERASE10x RT BUFFERThe optimal experimental conditions depend on the670 mM Tris-HCl pH 8.8 (25°C), 166 mM (NH 4 ) 2 SO 4 , system used and they should be individually determined.The Mg 2+ or Mn 2+ concentrations and the enzyme0.1% Tween 20amount are the limiting factors for an accurate result.VARIOUS CONDITIONS FOR RT-PCRTraditionally 5 units of enzyme and a MnCl 2 concentrationof 1 mM are used for the reverse transcriptionTwo different buffer systems can be used for RT-PCRwith TthPlus DNA polymerase. The first system for Tth in a final 50 µl reaction volume. For the amplificationDNA polymerase consists of 4 buffers: 1. reverse transcription(RT) buffer, 2. PCR (amplification buffer), 3. reaction volume of 50 µl.MgCl 2 concentration of 1.5 mM are used for a finalMnCl 2 , (supplement for RT buffer) 4. MgCl 2 (supplementfor PCR buffer). The reaction has to be carried 10X ONE-TUBE BUFFERout in two steps: RT and PCR in two different vials. The 500 mM bicine-KOH pH 8,3; 1 M KOAc pH 7,5second buffer system is a so-called one-tube buffer 30% glycerol (v/v);(10x) for one-step RT-PCR. Both reactions (RT andPCR) are carried out in the same buffer and the same EXTRA SOLUTIONvial. The one tube buffer does not contain Mn(OAc). 50 mM Mn(OAc) 2Mn(OAc) is provided extra and have to be added tothe one-tube buffer before the experiment. The protocolto use our TthPlus DNA polymerase is described in GeneScript reverse transcriptase, BioTherm DNACOMPANION PRODUCTSone-tube buffer below (buffer and polymerase concentrationsand cycle conditiones). It was worked outpolymerase, KlenTherm DNA Polymerase, dNTPsfor real-time RT-PCR by our customer Roboscreen REFERENCESGmbH.1 Ruttiman C. Cotara S.M., Zaldivar J. and Vicuna R.(1985) DNA polymerase from the extremlythermophylic bacterium Thermus thermophilus HB-5x AMPLIFICATION BUFFER8. Eur. J. Biochemistry, 149, 41-46335 mM Tris-HCl pH 8.8 (25°C), 83 mM (NH 4 ) 2 SO 4 ,3.75 mM EGTA, 25% glycerol (v/v), 0.1% Tween 20 2 Myers T.W. and Gelfand D.H. (1991)Reverse transcriptionand DNA amplification by a ThermusEXTRA SOLUTIONSthermo-philus DNA polymerase. Biochemistry, 30,25 mM MnCl 27661-766650 mM MgCl 243CATALOG NO.GC-003-0100 GC-003-0250 GC-003-0500 GC-003-1000 GC-003-5000100 u 250 u 500 u 1000 u 5000 u

Comparison of sensitivity of RT-PCR withTthPlus DNA polymerase and MMLV-RT44MW 1 2 3 4 5 6 7 8 9 WBAA) MMLV-RT 100 u/µl,Taq-pol. 5 u/µlBB) TthPlus 5 u/µlMW - molecular weight markers (530 bp)1 - RNA 1 µg 6 - RNA 10 -5 µg2 - RNA 10 -1 µg 7 - RNA 10 -6 µg3 - RNA 10 -2 µg 8 - RNA 10 -7 µg4 - RNA 10 -3 µg 9 - RNA 10 -8 µg5 - RNA 10 -4 µg WB - water blankComparison of RT-PCR with TthPlus DNA polymeraseand MMLV-RT in 16S-rRNA systemMW 1 2 3 4 5 6 7 WB1100 bpMW - molecular weight marker (λ PstI)1 - MMLV RT (100 u), RNA 1 µg 5 - TthPlus (5 u), RNA 10 -2 µg2 - MMLV RT + HS 21-9, RNA 1 µg 6 - TthPlus (5 u), RNA 10 -3 µg3 - TthPlus (5 u), RNA 1 µg 7 - TthPlus (5 u), RNA 10 -4 µg4 - TthPlus (5 u), RNA 10 -1 µg WB - water blank

Quantification of HCV Control RNA using twodifferent Tth DNA PolymerasesEXPERIMENTAL PROTOCOLMaterialHCV Control cRNA (10,000,000;1,000,000; 100,000; 10,000; 1,000;100; 50; and 10 molecules per 8-well Control strip [8 tubes/strip or0.1 ml tubes, respectively]), Lot 008rTth DNA Polymerase, 2.5 U/µl (AppliedBiosystems; supplier ABI)plus:5x EZ-buffer (Roboscreen)Mn-acetate-solution, 25 mM (Roboscreen)TthPlus DNA Polymerase, 5 U/µl(supplier Genecraft)plus:10x One-Tube RT-PCR-buffer(supplier Genecraft)Mn-acetate-solution, 50 mM(supplier Genecraft)InstrumentsABI PRISM 7000 Sequence DetectionSystem (Applied Biosystems)Rotor-Gene 2000 (Corbett Research)RESULTSSaturation curvesEnzymerTth DNA Polymerase(Applied Biosystems,supplier ABI); instrument:7000SDSREACTION CONDITIONS (BOTH INSTRUMENTS)Reaction component10x/5x bufferMn-acetate solutionNucleotide mixForward and reverse primerTaqMan ® probe (FAM/TAMRA)Tth DNA PolymeraseCYCLER PROGRAMFinal concentration (25 µl-Assay)1x3.5 mM0.3 mM dATP, dCTP and dGTP,0.6 mM dUTP7.5 pmol each3.4 pmol1.5 URotor-Gene RT Hold Cycle HoldTemperature (°C) 59 95 95 59 25Time (min:s)Cycles 60 10:00 00:15 01:00 ∞457000 SDS RT Hold Cycle Holdshut off “9600 emulation” (window “instrument”)Temperature (°C) 59 95 95 59 25Time (min:s)Cycles 60 10:00 00:30 01:30 ∞4045

Quantification of HCV Control RNA using twodifferent Tth DNA PolymerasesEnzymeTthPlus DNA Polymerase(supplier Genecraft);instrument: 7000SDS46EnzymerTth DNA Polymerase(Applied Biosystems,supplier ABI); instrument:Rotor-GeneEnzymeTthPlus DNA Polymerase(supplier Genecraft);instrument: Rotor-Gene

Quantification of HCV Control RNA using twodifferent Tth DNA PolymerasesREFERENCE CURVES47Molecules reference RNA per assayInstrument 7000SDS RG, 0,1 mlEnzyme supplier ABI supplier GC supplier ABI supplier GC16.10.2002 17.10.2002 16.10.2002 17.10.2002Tube No. Molecules 161002_HCV_1 171002_HCV_1 161002_HCV_2RG 171002_HCV_2RGper tube1 10.000.000 17,55 15,04 16,83 14,762 1.000.000 21,08 18,85 20,43 17,773 100.000 24,16 22,48 23,94 21,944 10.000 27,56 25,35 27,27 25,495 1.000 29,77 28,97 30,61 29,296 100 34,34 32,59 33,72 32,527 50 34,4 33,05 34,52 33,078 10 38,31 35,89 37,21 36,15SUMMARYThe use of the TthPlus DNA Polymerase (supplierGenecraft) improved the sensitivity of the HCV RNAquantification significantly.

GeneScript REVERSE TRANSCRIPTASE48SOURCEE.coli strain that carries a plasmid with the cloned andmodified M-MuLVRT gene with deleted RNAseHcoding part.DESCRIPTIONMoloney Murine Leukemia Virus (M-MuLV) reversetranscriptase is a RNA-dependent DNA polymerase.This enzyme can synthesize a complementary DNAstrand initiating from a primer using either singlestrandedRNA or DNA template. The enzyme lacksRNaseH activity.BESCHREIBUNGMoloney Murine Leukemia Virus (M-MuLV) ReverseTranskriptase ist eine RNA-abhängige DNA-Polymerase.Das Enzym synthetisiert einen komplementärenDNA-Strang ausgehend von einem Primer, der entwedereinzelsträngige RNA oder DNA als Templatebenutzt. Das Enzym besitzt keine RNaseH-Aktivität.CONCENTRATION100 units/µlUNIT DEFINITIONOne unit is the amount of enzyme required to incorporate1 nmol of dTTP into an acid insoluble form in10 minutes at 37ºC using poly(rA)-oligo(dt) 10-20 astemplate primer.STORAGE BUFFER50 mM Tris-HCl pH 8.3, 1 mM EDTA, 0.1 mM DTT, 0.1mM NaCI, 0.1% Triton X-100, 50% glycerol5X REACTION BUFFER250 mM Tris-HCI pH 8.3, 15 mM MgCl 2, 400 mM KClAdd to buffer: dNTPs (end concentration 2 mM),MnCl 2 (end concentration 2-4 mM) and DTT (end concentration10 mM). Incubate at 37ºC.EXTRA SOLUTIONS25 mM MnCl 2 100 mM DTTUNIT ASSAY CONDITIONS20 mM Tris-HCI pH 8.0, 2 mM MnCl 2 , 100 mM KCl, 1mM DTT, 0.6 mM poly rA, 0.1 mM poly(dT)10-20;0.5 mM dTTP( 3 H) - 0.5-5 units of enzymeQUALITY ASSURANCEGeneScript reverse transcriptase is tested for itsability to synthesize full length cDNA from 4kb RNA.RT-PCR using GeneScript reverse transcriptasePROTOCOLSet up a 20 µl reaction mixture as follows:total RNA 2-5 µg; RT-buffer; primer; 1 mM each dNTP;optional: 1 U/µl RNasinincubate at 70°C for 2 min, chill to 23°C to annealprimer to RNAadd 200 units GeneScript and incubate 10 minat 23°C followed by 30 min at 42°Coptional: incubate with RNaseHheat the reaction at 95°C for 5 min and chill on iceStore the RT-reaction by -20°C and use 2 µl for subsequentPCR.The addition of 2 mM MnCl 2 in the 1x RT buffer isoptional.CATALOG NO.GC-016-0500 GC-016-1000 GC-016-5000 GC-016-10000 GC-016-50000500 u 1000 u 5000 u 10000 u 50000 u

RNase-InhibitorDESCRIPTIONNative RNase-Inhibitor from human placenta exerts itsinhibitory effect by binding non-covalently to RNasesin a 1:1 ratio with an association constant of 1014. Itis a protein with molecular weight of 51 kDa and inhibitscommon eukaryotic RNases including RNase A,RNase B, RNase C.It does not inhibit RNase H, S1 Nuclease, SP6, T7 or T3RNA polymerase, AMV or M-MLV Reverse Transcriptase,Taq DNA polymerase and RNase T1.The enzyme is active over a broad pH range between5 and 8, with a maximum activity at pH 7-8.BESCHREIBUNGDieser native RNase-Inhibitor aus der menschlichenPlazenta übt seinen hemmenden Effekt aus, indem erin einem 1:1 Verhältnis und einer Asoziations-Konstantevon 1014 eine nicht-kovalente Bindung zuRNasen ausbildet. Das Protein besitzt ein Molekulargewichtvon 51 kDa und inhibiert alle herkömmlicheneukaryotischen RNasen einschließlich RNaseA, RNaseB,RNaseC.Allerdings hemmt es folgende Enzyme nicht: RNaseH,S1 Nuklease, SP6, T7 oder T3 RNA- Polymerase, AMVoder M-MLV Reverse Transkriptase, Taq-DNA-Polymeraseund RNase T1.Dieser RNase-Inhibitor behält seine Aktivität übereinen weiten pH-Bereich, der zwischen 5 und 8 liegt,mit einer maximalen Aktivität bei pH 7-8.49APPLICATIONAny application where eukaryotic RNase contaminationis a potential problemRNA transcriptionIn vitro RNA translationcDNA synthesisDNA and RNA sequencingRT-PCRCONCENTRATION10 units/µlUNIT DEFINITIONOne unit inhibits 5 ng of RNase A by 50% using cytidine2',3'-cyclic monophosphate (cCMP) as a substrat.STORAGE BUFFER20 mM Hepes-KOH, 50 mM KCl, 8 mM DTT, 50% glycerolSTORAGE TEMPERATURE-20°CQUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickasesand exonucleases.REFERENCEBlackburn, P. (1979) J. Biol. Chem. 254:12484CATALOG NO.GC-042-0100 GC-042-0250 GC-042-0500 GC-042-1000 GC-042-5000100 u 250 u 500 u 1000 u 5000 u

50KLENOW FRAGMENTDESCRIPTIONKlenow fragment is a DNA-dependent polymerasewith 3'-5' exonuclease activity. It lacks 5'-3' exonucleaseactivity of the native enzyme and is suited for random-primedlabelling of DNA with randomoligonucleotides and for filling-in of 5' protrudingends to blunt-ends.BESCHREIBUNGKlenow Fragment ist eine DNA-abhängige Polymerasemit einer 3´-5´-Exonuklease-Aktivität.Dem nativen Enzym fehlt eine 5´-3´-Exonuklease-Aktivitätund ist für Amplifikationen mit willkürlichgewähltem Primer und Oligonukleotiden, sowie fürdas Auffüllen von hervorstehenden 5´-Enden zu„Blunt-Ends“ geeignet.CONCENTRATION5 units/µlUNIT DEFINITIONOne unit is the amount of enzyme that incorporates10 nmoles of deoxynucleotides into acid-insolubleform in 30 minutes at 37ºC.STORAGE BUFFER20 mM Tris-HCl pH 7.5, 100 mM NaCl, 0.1 mM EDTA,2 mM DTT, 0.1 mg/ml BSA; 50% glycerol (v/v)STORAGE TEMPERATUREStore Klenow Enzyme below 0ºC, preferably at -20ºC,in a constant temperature freezer.10X REACTION BUFFER100 mM Tris-HCl pH 7.5, 100 mM MgCl 2 , 10 mM DTE(= buffer L for restriction endonucleases!)COMPANION PRODUCTST4 DNA Ligase, dNTPCATALOG NO.GC-009-0100 GC-009-0250 GC-009-0500 GC-009-1000 GC-009-5000100u 250 u 500 u 1000 u 5000 u

T4 POLYNUCLEOTIDE KINASEDESCRIPTIONIsolated from a recombinant E. coli strain this enzymecatalyzes the transfer of the terminal phosphate groupof ATP to 5'-OH ends of DNA. T4 polynucleotide kinaseis suited for labelling of 5'-OH ends of DNA withγ 32 P-ATP.BESCHREIBUNGDieses aus einem rekombinanten E. coli-Stamm isolierteEnzym katalysiert den Transfer der terminalenPhosphat-Gruppe von ATP an das 5´-OH-Ende derDNA. Die T4 Polynukleotid-Kinase ist ebenfalls dazugeeignet an das 5´-OH-Ende der DNA γ 32 P-ATP anzuhängen51CONCENTRATION10 units/µlUNIT DEFINITIONOne unit is the amount of enzyme that incorporates 1nmol of acid-insoluble 32 P in 30 minutes at 37ºC.STORAGE BUFFER10 mM K-phosphate buffer pH 7.0; 100 mM NaCl; 0.5mM EDTA; 1 mM DTT; 0.01% Tween 20;50% glycerol (v/v)STORAGE TEMPERATUREStore T4 polynucleotide kinase below 0ºC, preferablyat -20ºC, in a constant temperature freezer.5X REACTION BUFFER350 mM Tris-HCl pH 7,6; 50 mM MgCl 2 ; 25 mM DTTCATALOG NO.GC-010-0100 GC-010-0250 GC-010-0500 GC-010-1000 GC-010-5000100 u 250 u 500 u 1000 u 5000 u

52T4 DNA LIGASEDESCRIPTIONT4 DNA ligase is isolated from a recombinant E. colistrain and is suitable for ligation of sticky- and bluntended DNA fragments.BESCHREIBUNGT4 DNA-Ligase ist aus einem rekombinanten E. coliStamm isoliert worden und für die Ligation von DNA-Fragmenten mit sowohl sticky- als auch blunt-endsgeeignet.CONCENTRATION10 Weiss units/µlUNIT DEFINITIONOne unit (Weiss unit) is the amount of enzyme thatcatalyses the conversation of one nanomol 32 P-ATP in20 minutes at 37ºC. 1 ligation unit = 0,015 Weissunit.STORAGE BUFFER20 mM Tris-HCI buffer pH 7.5; 100 mM NaCI; 0.1 mMEDTA; 2 mM DTT; 0.1 mg/ml BSA; 50% glycerol (v/v)STORAGE TEMPERATUREStore T4 DNA ligase below 0ºC, preferably at -20ºC, ina constant temperature freezer.10X REACTION BUFFER660 mM Tris-HCI pH 7.5; 50 mM MgCI2; 10 mM DTE;10 mM ATPREACTION CONDITIONoptimal ligation occurs at 15ºCefficiency of T4 DNA ligase1 2 3 4 5 6lane 1: λ DNA BstEII markerlane 2: 2 Weiss units of ligaselane 3: 0.2 Weiss units of ligaselane 4: 0.02 Weiss units of ligaselane 5: no ligase addedlane 6: λ DNA BstEII marker0.8 µg of pBS digested with Hind III were incubatedovernight at +15ºC with indicated amounts of ligase.CATALOG NO.GC-011-0100 GC-011-0250 GC-011-0500 GC-011-1000 GC-011-5000100 u 250 u 500 u 1000 u 5000 u

Tth DNA LIGASEDESCRIPTIONThermus thermophilus DNA ligase (recombinant formof the enzyme; cloned from strain HB27) catalyses theformation of a phosphodiester bond between the 5`phosphateand 3`-hydroxil groups of adjacentnucleotides which are hybridized to a complementarytarget DNA.The ligation will occur only if the oligonucleotides areperfectly paired to the complementary target DNA andhave no gaps between them. There fore, a single-basesubstitution can be detected.BESCHREIBUNGThermus thermophilus DNA Ligase (rekombinanteForm des Enzyms; kloniert aus dem Stamm HB27)katalysiert die Bildung von Phosphodiester-Bindungenzwischen dem 5´-Phosphat-Ende und der 3´-Hydroxil-Gruppe benachbarter Nukleotide, welche mit einemkomplementären Strang der Ziel-DNA hybridisieren.Die Ligation kann jedoch nur erfolgreich sein, wenndie Oligonukleotide vollkommen an den komplementärenDNA-Strang gebunden sind und keine Lückenzwischen den Nukleotiden bestehen. Auf diese Weisekann der Austausch einzelner Basen ermittelt werden.53APPLICATIONLCRDNA ligationCONCENTRATION5 units/µlUNIT DEFINITIONOne unit is defined as the amount of the enzymerequired to give 50% (cohesive end unit) ligation ofthe 12-base pair cohesive ends of 1 µg of BstE II-digestedλ−DNA in 15 minutes at 45°C in a total reactionvolume of 50 µl. One cohesive end ligation unit equals0,015 Weiss units.STORAGE BUFFER10 mM Tris-HCl pH 7.5; 50 mM KCl; 0.1 mM EDTA; 1mM DTT; 0.2% Triton X-100; 50% glycerolSTORAGE TEMPERATURE-20°C10X REACTION BUFFER200 mM Tris-HCl pH 7.6; 250 mM KCl; 100 mMMgCl 2 , 100 mM DTT; 10 mM NAD, 1% Triton X-100Optimal ligation occurs at 45°C.QUALITY CONTROLActivity, SDS-PAGE purity, absence of RNases, ssDNases,endonucleases and phosphatases.CATALOG NO.GC-040-0100 GC-040-0250 GC-040-0500 GC-040-1000 GC-040-5000100 u 250 u 500 u 1000 u 5000 u

SP6 RNA POLYMERASE54DESCRIPTIONIsolated from a recombinant E. coli strain this DNAdependentRNA polymerase is strictly specific for itspromoter. It is used to transcribe RNA from DNA templates,cloned into vectors containing SP6 promoter.CONCENTRATION60 units/µlUNIT DEFINITIONOne unit is the amount of enzyme that incorporates1 nmol of labelled nucleoside triphosphates into acidprecipitableRNA in 60 minutes at 37ºC.STORAGE BUFFER20 mM Tris-HCl pH 7.5; 100 mM NaCl; 0,1 mM EDTA;2 mM DTT; 0,1 mg/ml BSA; 50% glycerol (v/v)BESCHREIBUNGDiese DNA-abhängige RNA-Polymerase ist aus einemrekombinanten E. coli Stamm isoliert worden undabsolut spezifisch für den eigenen Promoter. DasEnzym wird verwendet, um RNA von DNA-Templateszu transkribieren, welche in Vektoren kloniert wurden,die den SP6-Promoter enthalten.STORAGE TEMPERATUREStore SP6 RNA polymerase below 0ºC, preferably at-20ºC, in a constant temperature freezer.5X REACTION BUFFER200 mM Tris-HCl pH 7.9; 30 mM MgCl 2 ; 50 mM DTTCATALOG NO.GC-012-1000 GC-012-3000 GC-012-5000 GC-012-10000 GC-012-200001000 u 3000 u 5000 u 10000 u 20000 uT7 RNA POLYMERASEDESCRIPTIONIsolated from a recombinant E. coli strain this DNAdependentRNA polymerase is strictly specific for itspromoter. It is used to transcribe RNA from DNA templates,cloned into vectors containing T7 promoter.BESCHREIBUNGDiese DNA-abhängige RNA-Polymerase ist aus einemrekombinanten E. coli Stamm isoliert worden undabsolut spezifisch für den eigenen Promoter. DasEnzym wird verwendet, um RNA von DNA-Templateszu transkribieren, welche in Vektoren kloniert wurden,die den T7-Promoter enthalten.CONCENTRATION60 units/µlUNIT DEFINITIONOne unit is the amount of enzyme that incorporates1 nmol of labelled nucleoside triphosphates into acidprecipitableRNA in 60 minutes at 37ºC.STORAGE TEMPERATUREStore T7 RNA polymerase below 0ºC, preferably at-20ºC, in a constant temperature freezer.5X REACTION BUFFER200 mM Tris-HCl pH 7.9; 30 mM MgCl 2 ; 50 mM DTTSTORAGE BUFFER20 mM Tris-HCl pH 7.5; 100 mM NaCl; 0,1 mM EDTA;2 mM DTT; 0,1 mg/ml BSA; 50% glycerol (v/v)CATALOG NO.GC-020-1000 GC-020-3000 GC-020-5000 GC-020-10000 GC-020-200001000 u 3000 u 5000 u 10000 u 20000 u

RESTRICTION ENDONUCLEASESDESCRIPTIONGeneCraft offers most restriction enzymes from pBSpolylinker. Reaction buffers are supplied together withenzymes free of charge.BESCHREIBUNGGeneCraft bietet die meisten Restriktionsenzyme despBS polylinker an. Die jeweiligen Reaktions-Pufferwerden zu den Enzymen kostenlos mitgeliefert.55UNIT DEFINITION & CONCENTRATIONOne unit of the enzyme is the amount required tohydrolyze 1 µg of DNA in 1 hour in a total reactionvolume of 50 µl. Most restriction enzymes are normalllydelivered at the concentration of 20 units/µl.STORAGE BUFFER20 mM Tris-HCI pH 7.5; 100 mM NaCI; 0.1 mM EDTA;2 mM DTT; 0.1 mg/ml BSA; 50% glycerol (v/v)STORAGE TEMPERATUREStore restriction enzymes below 0°C, preferably at-20°C, in a constant temperature freezer.A B L M HTris-Acetat 330 mM – – – –Tris-HCl – 100 mM 100 mM 100 mM 100 mMpH at 37°C 7.9 8.0 7.5 7.5 7.5Mg-(Acetat) 2 100 mM – – – –MgCl 2 – 50 mM 100 mM 100 mM 100 mMK-Acetat 660 mM – – – –NaCl – 1 M – 500 mM 1 MDithioerythriol (DTE) – – 10 mM 10 mM 10 mMDithiothreitol (DTT) 5 mM 10 mM – – –ß-Mercaptoethanol – 10 mM – – –

GeneCraft Schnittmuster activity [%] in buffer optimal heat in-Cat. No. restriction 5’ —-> 3’ reaction activableenzyme 3’ —-> 5’ A B L M H temp. 20’ at56GC-RE-017 Acs I R/AATTY 0 - 25 100 25 - 50 50 - 75 50 - 75 50°CYTTAA/RGC-RE-001 Alu I AC/GT 100 50 - 75 25 - 50 25 - 50 0 - 10 37°C 65°CAC/GTGC-RE-018 Apa I GGGCC/C 100 10 - 25 50 - 75 50 - 75 0 - 10 30°C 65°CC/CCGGGGC-RE-043 AspLE I GCG/C 25 - 50 50 - 75 0 - 25 75 - 100 100 37°C 65°CC/GCGGC-RE-044 AsuNH I G/CTAGC 75 - 100 0 - 10 100 50 - 75 0 - 10 37°C 65°CGCTAG/CGC-RE-002 Bam H I G/GATCC 100 100 75 - 100 100 25 - 50 37°C 80°CCCTAG/GGC-RE-003 Bgl I GCCNNNN/NGGC 25 - 50 50 - 75 10 - 25 25 - 50 100 37°C 65°CCGGN/NNNNCCGGC-RE-057 Bgl II A/GATCT 100 100 25 - 50 100 100 37°C 80°C - NOTCTAG/AGC-RE-056 Bsc4 I CCNNNNN/NNGG 100 55°CGGNN/NNNNNCCGC-RE-039 Bse21 I CC/TNAGG 100 37°CGGANT/CCGC-RE-019 Bsp19 I C/CATGG 0 - 10 100 0 - 10 25 - 50 100 37°C 65°CGGTAC/CGC-RE-048 BstH2 I RGCGC/Y 100 0 - 10 0 - 10 0 - 10 0 - 10 37°C 80°C - NOY/CGCGRGC-RE-049 BstHP I GTT/AAC 100 25 - 50 0 - 10 50 - 75 0 - 10 37°C 65°CCAA/TTGGC-RE-020 BsuR I GG/CC CC/GG 50 - 75 50 - 75 75 - 100 100 25 - 50 37°CCC/GGGC-RE-052 Btr I CAC/GTC 75 - 100 75 - 100 75 - 100 75 - 100 100 60°C 80°CGTG/CAGGC-RE-036 CciN I GC/GGCCGC 100 75 - 100 25 - 50 50 - 75 75 - 100 37°C 65°CCGCCGG/CGGC-RE-004 Cla I AT/CGAT 100 100 75 - 100 100 100 37°C 65°CTAGC/TAGC-RE-026 Dra I TTT/AAA 100 75 - 100 100 100 50 - 75 37°C 65°CAAA/TTTGC-RE-005 EcoR I G/AATTC 100 100 25 - 50 50 - 75 100 37°C 65°CCTTAA/GGC-RE-028 EcoR V GAT/ATC 25 - 50 100 0 - 10 25 - 50 50 - 75 37°C 80°CCTA/TAGGC-RE-047 Erh I C/CWWGG 0 - 10 100 0 - 10 25 - 50 25 - 50 37°C 65°CGGWWC/CGC-RE-058 FauND I CA/TATG 100 37°CGTAT/ACGC-RE-027 Fok I GGATG (9/13) 100 50 - 75 75 - 100 100 25 - 50 37°C 65°CCCTACGC-RE-006 Hae III GG/CC 50 - 75 50 - 75 75 - 100 100 25 - 50 37°C 80°CCC/GGGC-RE-007 Hind III A/AGCTT 50 - 75 100 25 - 50 100 50 -75 37°C 65°CTTCGA/AGC-RE-038 Hinf I G/ANTC 100 100 50 - 75 75 - 100 100 37°C 80°CCTNA/GGC-RE-041 Hpa II C/CGG 50 - 75 25 - 50 100 50 - 75 10 - 25 37°C 80°C - NOGGC/CGC-RE-008 Kpn I GGTAC/C 75 - 100 10 - 25 100 25 - 50 0 - 10 37°C 80°C - NOC/CATGGGC-RE-021 Ksp22 I T/GATCA 25 - 50 50 - 75 50 - 75 100 50 - 75 37°C 65°CACTAG/T

GeneCraft Schnittmuster activity [%] in buffer optimal heat in-Cat. No restriction 5’ —-> 3’ reaction activableenzyme 3’ —-> 5’ A B L M H temp. 20’ atGC-RE-051 Kzo9 I /GATC 50 - 75 50 - 75 50 - 75 100 50 - 75 37°C 65°CCTAG/GC-RE-022 Mlu I A/CGCGT 10 - 25 25 - 50 0 - 10 10 - 25 100 37°C 65°CTGCGC/AGC-RE-046 MroX I GAANN/NNTTC 25 - 50 100 50 - 75 50 - 75 50 - 75 37°C 65°CCTTNN/NNAAGGC-RE-009 Msp I C/CGG 100 100 100 100 50 - 75 37°C 65°CGGC/CGC-RE-029 Nco I C/CATGG 50 - 75 50 - 75 50 - 75 50 - 50 100 37°C 65°CGGTAC/CGC-RE-010 Not I GC/GGCCGC 10 - 25 50 - 75 0 - 10 25 - 50 100 37°C 65°CCGCCGG/CGGC-RE-011 Nru I TCG/CGA 10 - 25 100 0 - 10 10 - 25 75 - 100 37°C 65°CAGC/GCTGC-RE-053 Pci I A/CATGT 50 - 75 75 - 100 50 - 75 75 - 100 100 50°C 80°CTGTAC/AGC-RE-054 Psi I TTA/TAA 75 - 100 25 - 50 100 25 - 50 10 - 25 37°C 65°CAAT/ATTGC-RE-023 Psp124B I GAGCT/C 75 - 100 0 - 10 75 - 100 100 75 - 100 37°C 65°CC/TCGAGGC-RE-030 PspE I G/GTNACC 50 - 75 50 - 75 100 50 - 75 25 - 50 37°C 65°CCCANTG/GGC-RE-012 Pst I CTGCA/G 25 - 50 25 - 50 10 - 25 25 - 50 100 37°C 80°CG/ACGTCGC-RE-035 Pvu II CAG/CTG 25 - 50 25 - 50 25 - 50 100 25 - 50 37°C 80°C - NOGTC/GACGC-RE-031 Rsa I GT/AC 100 50 - 75 100 50 - 75 0 - 10 37°C 65°CCA/TGGC-RE-013 Sal I G/TCGAC 0 - 10 25 - 50 0 - 10 10 - 25 100 37°C 65°CCAGCT/GGC-RE-032 Sbf I CCTGCA/GG 100 0 - 10 75 - 100 50 - 75 0 - 10 37°C 80°C - NOGG/ACGTCCGC-RE-050 SfaN I GCATCN 5 /NNNN 0 - 10 75 - 100 45931 25 - 50 100 37°C 65°CCGTAGNNNNN 5 /GC-RE-024 Sfi l GGCCN 4 /NGGCC 25 - 50 25 - 50 75 - 100 100 25 - 50 50°C 80°C - NOCCGGN/N 4 CCGGGC-RE-045 Sfr303 I CCGC/GG 75 - 100 0 - 10 100 50 - 75 0 - 10 37°C 65°CGG/CGCCGC-RE-025 Sma I CCC/GGG 100 0 - 10 1 - 10 2 - 10 3 - 10 25°CGGG/CCCGC-RE-033 Sph I GCATG/C 50 - 75 75 - 100 25 - 50 100 75 - 100 37°C 65°CC/GTACGGC-RE-037 Ssp l AAT/ATT 75 - 100 75 - 100 10 - 25 75 - 100 100 37°C 65°CTTA/TAAGC-RE-014 Taq I T/CGA 50 - 75 100 25 - 50 50 - 75 50 - 75 65°C 80°CAGC/AGC-RE-042 Tru9 I T/TAA 100 25 - 50 100 100 25 - 50 65°C 80°C - NOAAT/TGC-RE-015 Xba l T/CTAGA 100 75 - 100 75 - 100 75 - 100 100 37°C 65°CAGATC/TGC-RE-016 Xho l C/TCGAG 25 - 50 75 - 100 10 - 25 25 - 50 100 37°C 65°CGAGCT/CGC-RE-034 Xma I C/CCGGG 100 0 - 10 75 - 100 50 - 75 0 37°C 65°CGGGCC/CGC-RE-055 Zsp2 I ATGCA/T 100 37°CT/ACGTA57

58RANDOM PRIME LABELING KITDESCRIPTIONThe random prime labeling kit can be used for rapidrandom-primed labeling of DNA with [ 32 P], [ 32 S] or [ 3 H]dCTP to a specific activity.The kit is based on themethod described by Feinberg and Vogelstein (1, 2), inwhich a mixture of random hexamers is used to primeDNA synthesis from any DNA template. In particularthis kit may be used to label DNA fragments directlyafter isolation from agarose gels using the MegaPure TMDNA purification kit.BESCHREIBUNGDer Random Prime Labeling Kit kann für die schnellewillkürliche Bindung der DNA mit [ 32 P], [ 32 S] oder [ 3 H]dCTP bis zu einer bestimmten Aktivität verwendetwerden. Der Kit basiert auf der Methode beschriebenvon Feinberg und Vogelstein (1, 2), in der eineMischung zufälliger Hexamere verwendet wird, umDNA von jedem beliebigen Template zu synthetisieren.Dieser Kit kann insbesondere direkt für DNA-Fragmenteverwendet werden, die gerade frisch mit Hilfe desMegaPure DNA Purification Kit aus einem Agarose-Gel isoliert wurden.APPLICATIONSGeneration of high specific activity DNA hybridizationprobes from 10 ng to 3 µg of DNA in a standardreaction. Supercoiled or linearized DNA may be usedfor labeling DNA of different lengths. Probes can beproduced from fragments purified from a variety ofsources.STANDARD REACTIONThaw all reagents on ice, keep the Klenow fragment at-20ºC until required. Double-stranded template DNAmust be denatured by heating in a microcentrifugetube at 95ºC for 2 minutes and rapidly chilled on ice.Assemble the reaction in a microcentrifuge tube, onice, in the following order:Add water to achieve a final volume of 50 µl.10x Primer mix 5 µl10x dNTP mix 5 µldenatured DNA template 25 ng[ 32 P]dCTP, 50 µCi 5 µlKlenow fragment 1 µlIncubate the reaction at room temperature for 60minutes, remove unincorporated dCTP using a SephadexG-50 spin column.STORAGE TEMPERATUREStore at -20ºC in a constant temperature freezer.MIXES10x primer mix: 100 mM Tris-HCl pH 7.5; 100 mMMgCl 2 ; 4.5 µM hexamers10x dNTP mix: 5 mM each dATP, dGTP, dTTP, 10 mMDTECOMPANION PRODUCTSKlenow fragment, MegaPure DNA purification kitREFERENCES1 Feinberg A.P. and Vogelstein B. (1983) Anal. Biochem.132, 62 Feinberg A.P. and Vogelstein B. (1984) Anal. Biochem.137, 266CATALOG NO.GC-025PACK SIZE20 labeling reactions: 25 µl Klenow fragment (125 u), 100 µl primer mix, 100 µl dNTP mix

dNTP SETDESCRIPTIONReady-to-use dNTP solutions are available as tetrasodiumsalts for use in DNA polymerization reactionsand all DNA labelling and sequencing processes.BESCHREIBUNGDas dNTP Set besteht aus dNTP-Lösungen, die direktverwendet werden können und als Tetrasodium-Salzeerhältlich sind, um in DNA-Polymerisations-Reaktionen,allen DNA-Labellings und Sequenzierungen ihrenEinsatz zu finden.CATALOG NO.59GC-013-001dGTP, dATP, dTTP, dCTPGC-013-005dGTP, dATP, dUTP, dCTPPACK SIZE100 mM each solution, 4 x 25 µmol each, 250 µl each vialdGTP Na 4 *3H 2 OMW 649.2Deoxyguanosine 5'-triphosphatetetrasodiumsaltPurity: UV - 98%, columnchromatography (polysil) -98.8%Integral spectral ratio:250/260 - 1.127;270/260 - 0.793;280/260 - 0.635;290/260 - 0.278PCR reaction is successfulfor the template up to 10kb length.dATP Na 4 *3H 2 OMW 634.2Deoxyadenosine 5'-triphosphate, tetrasodiumsaltPurity: UV - 95%,column chromatography(polysil) - 96.3%Integral spectral ratio:250/260 - 0.865;270/260 - 0.696;280/260 - 0.144PCR reaction is successfulfor the template upto 10 kb length.dTTP Na 4 *3H 2 OMW 624.2Deoxythymidine 5’-triphosphate,tetrasodium saltPurity: UV - 96%, columnchromatograohy (polysil) -99.5%Integral spectral ratio:250/260 - 0.693;270/260 - 1.082;280/260 - 0.755;290/260 - 0.292PCR reaction is successfulfor the template up to 10kb length.dCTP Na 4 *3H 2 OMW 591,2Deoxycytidine 3'-triphosphate,tetrasodiumsaltPurity: UV - 99%,column chromatography(polysil) - 98.5%Integral spectral ratio:250/260 - 0.861;270/260 - 1.179;280/260 - 0.972;290/260 - 0.352PCR reaction is successfulfor the template upto 10 kb length.

60DNA POLYMERIZATION MIX 20/10DESCRIPTIONContains all four dNTPs in a pre-mixed solution, readyfor immediate use. For procedures requiring unlabeledmixtures of all four dNTPs such as PCR or cDNA synthesis.PURITY97-99% by UV and polysil column chromotography.PCR reaction is successful for the template up to 10 kblength indicating high purity and absence of deleteriousterminatorsBECHREIBUNGDieser Mix enthält alle vier dNTPs in einer vorgemischtenLösung, welche zur sorfortigen Verwendunggedacht ist. Er ist für alle Verfahren geeignet, für dieman unmarkierte Mischungen aller vier dNTPs benötigt,wie z.B. PCR oder cDNA-Synthese.CATALOG NO.GC-013-002GC-013-00420 mM each dNTP, each 10 µmol, 500 µl 10 mM each dNTP, each 5 µmol, 500 µldNTPsSupplied in a convenient solution at pH 7,0PURITY95% purity by HPLC.QUALITY CONTROLQuality controlled by HPLC for maximum purity andminimal di- and monophosphate content. All batchestested in standard labelling reactions.STORAGE CONDITIONSdNTPs are stable at -20ºC in a constant-temperaturefreezer. Avoid multiple freeze/thawing. For long termusage it is recommended to aliquote the nucleotides.CATALOG NO.GC-013-006 GC-013-007 GC-013-008 GC-013-009 GC-013-010dGTP dATP dTTP dCTP dUTPPACK SIZE100 mM solution, 25 µmol, 250 µl

dNTP CUSTOM SERVICEBIOTIN-4-dUTPDESCRIPTIONAny of the nucleotide products described can be preparedto your custom specifications; i.e. concentration,volume, various dNTP combinations for labelling, etc.BENEFITSFast efficient service (normally next day)Meeting your precise custom requiremnts for allnucleotide combinationsCost-effective serviceSTORAGE CONDITIONSdNTPs are stable at -20ºC in a constant-temperaturefreezer. Avoid multiple freeze/thawing. For long termusage it is recommended to aliquote the nucleotides.BECHREIBUNGAlle unsere beschriebenen Nukleotid-Produkte könnenauch nach Ihren ganz persönlichen Wünschengemischt werden; wie z.B. die Konzentration, Volumen,verschiedene dNTP Kombinationen etc.QUALITY CONTROLQuality controlled by HPLC for maximum purity andminimal di- and monophosphate content. All batchestested in standard labelling reactions.61CONCENTRATION1 mMCATALOG NO.GC-013-003-0050 GC-013-003-100050 µl (50 nmol) 1 ml (1 µmol)BIOTIN-11-dUTPCONCENTRATION1 mMCATALOG NO.GC-013-011-0050 GC-013-003-100050 µl (50 nmol) 1 ml (1 µmol)

62URACIL-DNA GLYCOSYLASEDESCRIPTIONE. coli uracil-DNA glycosylase (UDG) is the recombinantform of the enzyme, which catalyzes the releaseof free uracil from uracil-containing DNA (U-DNA) andcreates an alkali-sensitive apyrimidinic site in the DNA.UDG efficiently hydrolyzes uracil from single-strandedor double-stranded U-DNA, but not from oligomers (6or fewer bases).BESCHREIBUNGE. coli Uracil-DNA-Glycosylase (UDG) ist die rekombinanteForm des Enzyms, das die Freisetzung vonfreiem Uracil aus Uracil-haltiger DNA (U-DNA) katalysiertund für hohe pH-Werte empfindliche, PyrimidinfreieOrte in der DNA erzeugt. UDG hydrolysiert effizientUracil aus einzel- oder doppelsträngiger U-DNA,jedoch nicht aus Oligomeren (6 Basen oder weniger).APPLICATIONSPCRRT-PCRsite-directed mutagenesisas a probe for protein-DNA interaction studies producinghighly labeled oligonucleotide probesCONCENTRATION5 units/µlUNIT DEFINITIONOne unit of enzyme activity is the amount that catalyzesthe degradation of 1 µg single-stranded uracilcontainingDNA at 37°C in 60 minutes.STORAGE BUFFER20 mM Tris-HCl pH 8.0; 100 mM NaCl; 0.1 mM EDTA;1 mM DTT; 0.1 mg/ml BSA; 50% glycerolSTORAGE TEMPERATUREstore at -20°C10X REACTION BUFFER500 mM Tricine pH 8.5, 10 mM MgCl 2 or buffer forPCR or RT-PCR protocolQUALITY CONTROLActivity, SDS-PAGE purity, absence of endonucleases/nickasesand exonucleases.CATALOG NO.GC-038-0100 GC-038-0250 GC-038-0500 GC-038-1000 GC-038-5000100 u 250 u 500 u 1000 u 5000 uλ-DNASOURCEWild-type λ-phageCOMPANION PRODUCTSBstE II-λ-DNA markerSTORAGE TEMPERATUREstore at -20°CCATALOG NO.GC-015-005-0500500 µg

T-VECTOR SYSTEMDESCRIPTIONCloning of PCR products using plasmid T-vectors is aneasy and well established method (1-4). This methodtakes advantage of the terminal transferase activity ofTaq polymerase (5). This enzyme adds a single deoxyadenosinebase to the 3´end of their reaction products.These PCR products can be ligated directly into a vectorcontaining compatible single T-nucleotide overhangs.The BS-SK-T-vector was produced by a very efficientprocedure using terminal deoxynucleotidyl transferaseand ddTTP (4). The T-vector is prepared from2961-bp vector pBluescript II SK(+) by cutting withEcoR I, filling recessed 3’ termini and adding a 3´ terminalthymidine to both ends. These single 3´-T overhangsat the insertion site greatly improve the efficiencyof ligation of a PCR product into the plasmidsby preventing recircularization of the vector and providinga compatible overhang for PCR products generatedby certain thermostable polymerases. These polymerasesoften add a single deoxyadenosine, in a template-independentfashion, to the 3´-ends of theamplified fragments.The T-vector contain T7 and T3 RNA polymerase promotersflanking a multiple cloning region within theα-peptide coding region of the enzyme β-galactosidase.Insertional inactivation of the α-peptide allowsrecombinant clones to be directly identified by colorscreening on indicator plates. To increase the efficiencyof the vector the tailed product was religated andthe linear form was purified from an agarose gel. Thisvector cannot be used for cloning of PCR productsgenerated with some DNA polymerases like Pfu DNApolymerase that does not exhibit any terminal transferaseactivity (for cloning of such PCR products use ourpBS-EcoRV vector, page 66). However a simple incubationof such PCR products with Taq polymerase willadd 3´ nucleotide overhang, enabling the cloning ofthese products into T-vector.BESCHREIBUNGDas Klonieren von PCR-Produkten mit Hilfe eines Plasmid-T-Vectorsist eine einfache und etablierte Methode(1-4). Diese Methode nutzt den Vorteil der terminalenTransferaseaktivität einer Taq-Polymerase (5).Dieses Enzym hängt eine einzelne Deoxyadenosin-Base an das 3´-Ende ihrer Reaktionsprodukte. DiesePCR-Produkte können direkt in einen Vector eingebrachtwerden, welcher einzelne kompatible T-Nukleotid-Überhängeenthält. Der BS-SK-T-Vector ist mit Hilfeeiner sehr effizienten Methode mittels terminaler Deoxynucleotidyl-Transferaseund ddTTP hergestellt worden.Der T-Vector ist aus dem 2961-bp Vector pBluescriptII SK(+) angefertigt worden, indem dieser mitEcoRI geschnitten, die vertieften 3´-Enden aufgefülltund ein 3´-terminaler Thymidin-Rest an beide Endenangehängt wurde. Diese einzelnen 3´-T-Überhänge ander Einfügestelle verbessern die Effizienz der Ligationeines PCR-Produktes in das Plasmid drastisch, indemdie Recirculation des Vectors verhindert wird und dieÜberhänge eine kompatible Ansatzstelle für PCR-Produktedarstellen, welche mit Hilfe von herkömmlichenhitzestabilen Polymerasen erzeugt wurden. Diese Polymerasenhängen oft in einer Template-unabhängigenArt und Weise einen einzelnen Deoxyadenosin-Rest andas 3´-Ende der amplifizierten Fragmente. Der T-Vectorenthält Promotoren für die T7 und T3 RNA-Polymerasen,welche eine Multiple-Cloning-Site flankieren.Zusätzlich enthält der T-Vector die kodierende Regionfür das α-Peptid des Enzyms β-Galactosidase. Durchdie Inaktivierung dieses α-Peptids erhält man rekombinanteKlone, die direkt anhand eines Farb-Screeningsauf speziellen Indikator-Platten identifiziert werdenkönnen. Um die Effizienz des Vectors zu steigern,ist das End-Produkt religiert und die lineare Form auseinem Agarose-Gel gereinigt worden. Dieser Vectorkann nicht für die Klonierung von PCR-Produkten verwendetwerden, die mit bestimmten DNA-Polymerasenwie z.B. der Pfu-DNA-Polymerase erzeugt wurden,da diese keine terminale Transferase-Aktivität aufweisen.Jedoch kann man mit einer einfachen Inkubationdieser PCR-Produkte mit einer Taq-Polymerase einen3´-Nukleotid-Überhang anhängen, was die Klonierungdieser PCR-Produkte in den T-Vector ermöglicht.63

T-VECTOR SYSTEM64PROTOCOLLigations Using the T-Vector1. Briefly centrifuge the T-Vector and Insert DNA tubesto collect contents at the bottom of the tube.2. Set up ligation reactions as described below.Standard ReactionBackground Control5X Ligation Buffer 2µl 2µlT-Vector (50ng) 1µl 1µlPCR product Xµl* –T4 DNA Ligase(2 Weiss units/µl) 1µl 1µlATP (5 mM) 2µl 2µldeionized water to a final volume of 10µl a final volume of 10µl*Molar ratio of PCR product:vector may require optimizationas described below3. Mix the reactions by pipetting. Incubate the reactions1 hour at room temperature.Alternatively, if the maximum number of transformantsis required, incubate the reactions overnight at 4°C.NOTES1. Use GeneCraft’s T4 DNA Ligase in performing T-Vector ligations. Other commercial preparations ofT4 DNA ligase may contain exonuclease activitiesthat may remove the terminal deoxythymidinesfrom the vector.2. 5X Ligation Buffer (without ATP) contains: 250 mMTris-HCl (pH 7.8); 50 mM MgCl 2 ; 50 mM dithiothreitol.3. It is important to vortex the 5X Ligation Buffer beforeeach use.4. Longer incubation times will increase the number oftransformants. Generally, incubation overnight at4°C will produce the maximum number of transformants.5 Use 0.5ml tubes known to have low DNA-bindingcapacityOPTIMIZING INSERT: VECTOR MOLAR RATIOSThe T-Vector have been optimized using a 1:1 molarratio of the Control Insert DNA to the Vector. However,ratios of 8:1 to 1:8 have been successfully used. Ifinitial experiments with your PCR product are suboptimal,ratio optimization may be necessary. Ratios from3:1 to 1:3 provide good initial parameters. The concentrationof PCR product should be estimated bycomparison to DNA mass standards on a gel. The T-Vector is approximately 3kb and is supplied at50ng/µl.T-VECTOR MULTIPLE CLONING SITE REGION(sequence shown 828 - 600)M13 Reverse primer BssH II T3 promoter –>5’ CAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAAC3’ GTCCTTTGTCGATACTGGTACTAATGCGGTTCGCGCGTTAATTGGGAGTGATTTCCCTTG| Met ß-galactosidase –>820BstX I Eag ISac I Sac II Not I Xba I Spe I BamH I Sma I Pst IAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGTTTTCGACCTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTCCla I Hinc II Dra IIEcoR V Hind III Sal I Xho I Apa I Kpn IGAATTT-3’ AATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCTTAA 3’-TTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGGBssH IICAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTAC 3’GTTAAGCGGGATATCACTCAGCATAATGCGCGCGAGTGACCGGCAGCAAAATG 5’

T-VECTOR SYSTEMCONCENTRATION50 ng/µlREFERENCES1. Trower, M.K. and Elgar G.S. PCR cloning using T-vectors. Methods in Molecular Biology, Vol. 31: Protocolsfor Gene Analysis, 1994 Humana Press Inc.,Totowa, NJ2. Mead, D.A. etal. (1991) A universal method for thedirect cloning of PCR amplified nucleic acid. Biotechniques9: 657- 6633. Marchuk, D.A. et al. (1991) Construction of T-vectors,a rapid and general system for direct cloning ofunmodified PCR products. Nucleic Acids Res. 19:1154STORAGE TEMPERATURE-20°C4. Holton, T.A. and Graham, M.W. (1991) A simple andefficient method for direct cloning of PCR productsusing ddT-tailed vectors. Nucleic Acids Res. 19:11565. Clark, J.M. (1988) Novel non-templated nucleotidereactions catalyzed by procaryotic and eucaryoticDNA polymerases. Nucleic Acids Res. 18:L 9677-968665T7Kpn IXho ISal IHind IIIEco R VpBluescript II SK (+)3.0 kbTTPst IBamH IXba INot ISac IT3CATALOG NO.GC-050-0011 µg (ca. 20 reactions)

pBS-KS-EcoRV66DESCRIPTIONThe pBS-KS-EcoRV vector was produced by digestionof pBS-KS plasmid with EcoRV and the linear form waspurified from an agarose gel. This vector is a ready-touseproduct, designed for cloning of PCR productscontaining blunt ends and amplified with a class ofSynergy DNA polymerases containing Pfu-DNA polymerase.For protocol see T-Vector System (page 64).CONCENTRATION50 ng/µlBESCHREIBUNG:Der pBS-KS-EcoRV Vector entsteht durch den Verdaueines pBS-KS Plasmids mit EcoRV, und die lineare Formist aus einem Agarosegel gereinigt worden. Der Vectorkann sofort verwendet werden. Er ist für die Klonierungvon PCR-Produkten mit blunt ends hergestellt und miteiner Klasse von Synergy DNA-Polymerasen, welche einePfu-DNA-Polymerase enthalten, erweitert worden. DasProtokoll finden Sie auf der Seite des T-Vectors (S. 64).STORAGE TEMPERATURE-20°CCATALOG NO.GC-050-0021 µg (ca. 20 reactions)DNA MOLECULAR WEIGHT MARKERBSTE II-λ-DNA MARKERDESCRIPTIONBstE II-λ-DNA Marker consists of 15 fragments rangingin size from 117 to 14140 bp. Their asymmetricdistribution makes determination of molecular weighteasier.Two fragments containing the cos sites hybridize toeach other resulting in additional band of 14140 bp atthe top. This can be avoided by heating the marker to80ºC for 15 minutes and cooling it on ice.BESCHREIBUNGBstE II-λ-DNA Marker besteht aus 15 Fragmentenmit einer Größe von 117 bis 14140 bp.Die ungleichmäßige Verteilung der Banden macht dieBestimmung des Molekulargewichtes einfacher.Zwei Fragmente tragen eine cos-site, so daß diese zueinem Fragment von 14140 bp hybridisieren. Dieskann durch Erhitzen des Markers für 15 min. auf 80 °Cund anschließendem auf Eis halten verhindert werden.STORAGE TEMPERATUREStore at +4°C to -20°C.CATALOG NO.GC-015-002PACK SIZE100 µg in 1 ml (100 rxns) loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose inwater), the marker is ready to use. Load 10 µl in one lane.

DNA MOLECULAR WEIGHT MARKERHpa II-pBS-DNA MARKERDESCRIPTIONHpa II-pBS-DNA Marker consists of 13 fragmentsranging in size from 26 to 712 bp. Their asymmetricdistribution makes determination of molecular weighteasier.BESCHREIBUNGHpa II-pBS-DNA Marker besteht aus 13 Fragmentenmit einer Größe von 26 bis 712 bp. Die ungleichmäßigeVerteilung der Banden macht die Bestimmungdes Molekulargewichtes einfacher.STORAGE TEMPERATUREStore at +4°C to -20°C.67CATALOG NO.GC-015-001PACK SIZE50 µg in 500 µl (100 rxns) loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose inwater), the marker is ready to use. Load 5-10 µl in one lane.BSTE II-λ-DNA MARKERHpa II-pBS-DNA MARKERBOTH MARKERS LOA-DED SIMULTANEOUS-LY IN ONE LANE ANDRUN ABOUT 1 HOURON 1% AGAROSEGEL.

68EcoRI-λ-DNA MARKERDESCRIPTIONEcoRI-λ-DNA marker consists of 6 fragments rangingin size from 3530 to 21226 bp.Their asymmetric distribution makes determination ofmolecular weight easier.Two fragments (3530 bp and 21226 bp) containingthe cos sites of bacteriophage lambda may hybridiseto each other resulting in an additional band at 24756bp. This can be avoided by heating the marker to 80°Cfor 15 minutes and cooling it on ice.BESCHREIBUNGEcoRI-λ-DNA Marker besteht aus 6 Fragmenten mieiner Größe von 3530 bis 21226 bp.Die ungleichmäßige Verteilung der Banden macht dieBestimmung des Molekulargewichtes einfacher.Zwei Fragmente (3530 bp und 21226 bp) enthaltendie cos-sites des Bakteriophagen Lambda und könnensich deshalb zu einer Bande von 24756 bp addieren.Dies kann durch Erhitzen des Markers für 15 min. auf80 °C und anschließendem auf Eis halten verhindertwerden.STORAGE TEMPERATUREStore at +4 °C to -20 °C21226*The marker is ready to use.Load 10 µl in one lane.To demonstrate the mobility of the DNA fragments,1µg of marker was loaded onto a 0.7% agarose gel.74215804564248783530*CATALOG NO.GC-015-006100 µg in 1 ml (100 rxns) loading buffer(0.25 % bromphenol blue, 0.25 % xylene cyanol FF, 40 % sucrose in water).

HindIII-λ-DNA MARKERDESCRIPTIONHindIII-λ-DNA marker consists of 7 fragments rangingin size from 564 to 23130 bp.Their asymmetric distribution makes determination ofmolecular weight easier.Two fragments (4361 bp and 23130 bp) containingthe cos sites of bacteriophage lambda may hybridiseto each other resulting in an additional band at 24756bp. This can be avoided by heating the marker to 80 °Cfor 15 minutes and cooling it on ice.BESCHREIBUNGHindIII-λ-DNA Marker besteht aus 7 Fragmenten mieiner Größe von 564 bis 23130 bp. Die ungleichmäßigeVerteilung der Banden macht die Bestimmung desMolekulargewichtes einfacher.Zwei Fragmente (4361 bp und 23130 bp) enthaltendie cos-sites des Bakteriophagen Lambda und könnensich deshalb zu einer Bande von 24756 bp addieren.Dies kann durch Erhitzen des Markers für 15 min. auf80 °C und anschließendem auf Eis halten verhindertwerden.69STORAGE TEMPERATUREStore at +4 °C to -20 °CThe marker is ready to use.Load 10 µl in one lane.To demonstrate the mobility of the DNA fragments,1µg of marker was loaded onto a 1 % agarose gel.23130*941665574361*23222027564CATALOG NO.GC-015-008100 µg in 1 ml (100 rxns) loading buffer (0.25 % bromphenol blue, 0.25 % xylene cyanol FF,40 % sucrose in water).

70EcoRI+HindIII-λ-DNA MARKERDESCRIPTIONEcoRI+HindIII-λ-DNA marker consists of 13 fragmentsranging in size from 564 to 21226 bp.Their asymmetric distribution makes determination ofmolecular weight easier.Two fragments (3530 bp and 21226 bp) containingthe cos sites of bacteriophage lambda may hybridiseto each other resulting in an additional band at 24756bp. This can be avoided by heating the marker to80 °C for 15 minutes and cooling it on ice.STORAGE TEMPERATUREStore at +4 °C to -20 °CThe marker is ready to use.Load 10 µl in one lane.To demonstrate the mobility of the DNA fragments,1µg of marker was loaded onto a 1 % agarose gel.BeschreibungEcoRI+HindIII-λ-DNA Marker besteht aus 13 Fragmentenmit einer Größe von 564 bis 21226 bp. Dieungleichmäßige Verteilung der Banden macht dieBestimmung des Molekulargewichtes einfacher.Zwei Fragmente (3530 bp und 21226 bp) enthaltendie cos-sites des Bakteriophagen Lambda und könnensich deshalb zu einer Bande von 24756 bp addieren.Dies kann durch Erhitzen des Markers für 15 min. auf80 °C und anschließendem auf Eis halten verhindertwerden.21226*5148497342683530*2027190415841375947831564CATALOG NO.GC-015-007100 µg in 1 ml (100 rxns) loading buffer (0.25 % bromphenol blue, 0.25 % xylene cyanol FF, 40 % sucrose in water).

100 bp DNA LADDERDESCRIPTIONThe 100 bp DNA ladder is suitable for sizing lineardouble-stranded DNA fragments from 100 to 1000 bp.The 10 bands of the ladder contain fragments with thefollowing sizes:100, 200, 300, 400, 500, 600, 700, 800, 900 and1000 bpBESCHREIBUNGDie 100 bp DNA Ladder ist für die Größenbestimmunglinearer, doppelsträngiger DNA-Fragmente von 100 bis1000 bp geeignet. Der Einsatz dieser Ladder ergibt 10Banden folgender Größe:100, 200, 300, 400, 500, 600, 700, 800, 900 und1000 bp71CONCENTRATION1 µg/10 µlTO DEMONSTRATETHE MOBILITY OF THEDNA FRAGMENTS,1 µg OF MARKERWERE LOADED ONTOA 1% AGAROSE GEL.The recommended amount of size marker to load onan agarose gel is 0.5-1 µg per lane (5-10 µl).CATALOG NO.GC-015-00450 µg in 500 µl (100 rxns) loading buffer (0.25% bromphenoblue, 0.25% xylene cyanol FF, 40% sucrose in water).

721 kb DNA LADDERDESCRIPTIONThe 1 kb DNA ladder is suitable for sizing linear double-strandedDNA fragments from 0.25 to 10 kb. The13 bands of the ladder contain fragments with thefollowing sizes:250, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000,5000, 6000, 8000 and 10000 bpFor easy reference on agarose gels, the 1000 and3000 bp bands are three times brighter than the otherbands in the ladder.CONCENTRATION1 µg/10 µlBESCHREIBUNGDie 1 kb DNA Ladder ist für die Größenbestimmunglinearer, doppelsträngiger DNA-Fragmente von 0.25bis 10 kb geeignet. Der Einsatz dieser Ladder ergibt 13Banden folgender Größe:250, 500, 750, 1000, 1500, 2000, 2500, 3000, 4000,5000, 6000, 8000 und 10000 bpFür die bessere Vergleichbarkeit auf dem Gel sind die1000 bp und die 3000 bp Bande dreimal stärker alsdie anderen.TO DEMONSTRATETHE MOBILITY OF THEDNA FRAGMENTS,1 µg OF MARKERWERE LOADED ONTOA 1% AGAROSE GEL.The recommended amount of size marker to load onan agarose gel is 0.5-1 µg per lane (5-10 µl).CATALOG NO.GC-015-003100 µg in 1 ml (200 rxns) in loading buffer (0.25% bromphenol blue, 0.25% xylene cyanol FF, 40% sucrose in water).

MegaPure DNA PURIFICATION KITDESCRIPTIONThe kit is based on the defined size silica matrix usedfor purification of DNA from agarose gels.COMPONENTS OF THE STANDARD KIT15 ml MELT solution1 ml BIND solution3 ml 40x WASH solution(for 120 ml WASH solution mix with 60 mlethanol and 57 ml H 2 O)COMPONENTS OF THE SAMPLE KIT1 ml MELT solution20 µl BIND solution100 µl WASH solution, 40x concentrateSOLUTIONSMELT solution:BIND solution:WASH solution:6 M NaIDNA-binding silica matrix50 mM NaCI 10 mM Tris-HCIpH 7.5; 2,5 mM EDTA;50% v/v ethanolSTORAGE TEMPERATUREStore the components of the DNA purification kit at+4ºC in the dark.PROTOCOL1 Add water to MELT powder to obtain 15 ml solution.2 Mix 60 ml ethanol and 57 ml water with 3 ml of40x WASH concentrate. For sample kit, mix 2 mlethanol and 1,9 ml wate with 100 µl of 40x WASHconcentrateBESCHREIBUNGDieser Kit basiert auf der definierten Größe der Silica-Matrix, die für die Reinigung von DNA in Agarose-Gelen verwendet wird.3 Excise the DNA fragment from agarose gel and addone volume of MELT (300-500 µl)4 Melt the gel slice at 65 °C for 5 min. Cool down5 Add 5-15 µl of BIND (will bind up to 4 µg DNA) andincubate 5 min. at room temperature6 Centrifuge 1 min. at 7000 rpm, remove the supernatant7 Add 500 µl of WASH solution to the pellet and vortex.Centrifuge 1 min. at 7000 rpm. Repeat washing.8 Dry pellet at room temperature. Speedvac and airdryingare admissible.9 Elute DNA by resuspending the pellet in 50-100 µlwater and incubate 5 min. at 55 °C. Centrifuge 5min. at maximum speed.10Transfer the supernatant in another tube. If necesssary,repeat centrifugation step to clean you samplefrom the remaining BIND. Keep this DNA probe at+4 °C or –20 °C. If necessary, concentrate or dryDNA in Speedvac.The DNA purified by this protocol can be used fordigestion with restriction enzymes, for ligation, transformationand labeling with Klenow enzyme. This kitcan also be used for purification of PCR products. DNAfragments from 20 bp up to 10 kb length can be succcessfullypurified with this kit.73CATALOG NO.GC-017-020050-100 preps

TREPONEMA PALLIDUM RECOMBINANT ANTIGEN - tmpA74DESCRIPTIONtmpA protein is the main surface protein of Treponemapallidum.The protein is modified by means of genetic engineering,all major epitops are intact, hydrophobic anchoris removed. rec-tmpA was shown to bind effectivelywith Ig from T. pallidum infected patients. The proteinis purified from water-soluble fraction of rec-E.coliproteins.SOURCEThe protein is purified from E. coli strain harboring theplasmid with the tmpA gene.CONCENTRATION2.6 mg/mlBESCHREIBUNGtmpA ist das wohl bedeutenste Protein der Zelloberflächevon Treponema pallidumDieses Protein ist mit Hilfe der Gentechnik modifiziertworden, alle wichtigen Epitope sind intakt und hydrophobeAnker-Sequenzen wurden entfernt. Man konntezeigen, daß rec-tmpA effektiv an den entsprechendenAntikörper, aus mit T. pallidum infizierten Patienten,bindet.Das Protein ist aus einer wasserlöslichen Fraktionrekombinanter E. coli-Proteine gereinigt worden.STORAGE BUFFER10 mM Tris-HCl pH 7.5; 150 mM NaCl; 0.08% sodiumazideSTORAGE TEMPERATURE+4°C. Do not freeze!!!PURITYMore than 90% by SDS-PAGE. Purified by affinitychromatography.CATALOG NO.GC-AG-0010,52 mgMONOCLONAL IgG TO THERMUS AQUATICUS DNA POLYMERASESOURCEClone: 109, mouse astitic fluidISOLATIONAmmonium sulphate precipitation, followed by ionexchangechromatography on DEAE-cellulosePROTEIN CONCENTRATION1 mg/mlPRESENTATIONSolution in 100 mM NaCl; 10 mM Na-phosphate;pH 8.0, 50% GlycerolSTORAGE TEMPERATURE2 years at -20°CFor research and manufacturing use only.CATALOG NO.GC-AG-036-1100 µg

IPTG (ISOPROPYL-ß-D-THIOGALACTOSIDE)DESCRIPTIONChemical analogue of galactose that cannot be cleavedby ß-galactosidase.BESCHREIBUNGDies ist das chemische Analogon von Galactose, welchesnicht mit Hilfe der ß-Galactosidase gespaltet werdenkann75APPLICATIONSVery effective inducer of the lac operon for the ß-galactosidase by binding and inactivating the lacrepressor. It is recommended to use 0,1-1 mM IPTG inLB-media. So a stock solution of 100 mM or 500 mM,which should be stored at -20°C after sterilization, isuseful.CHARACTERISTICSWhite crystalline powder. Soluble in water and methanol.FormulaC 9 H 18 O 5 SMolecular weight M r = 238,3Melting point 110-114°Cα20°/D; 1%, H 2 O -30° ± 2°Moisture content NMT 1,0%Residue on ignition NMT 0,5%Purity (by TLC) NLT 98,0%STORAGE TEMPERATURE-20°C, protected from light.CATALOG NO.GC-SS-00110 g (or as requested)

ACRYLAMID76Acrylamid, TBE, TEMED und APS sind nur für den Verkauf in Deutschland bestimmt. Acrylamides, TBE, TEMED and APS are sold only in Germany.wässrige Lösungen HS-Nr.: 38220000 Lagerung: RT R: 45-46-E24/25-E48/24/25 LGK: 6.1 B S: 53-45 / WGK: 3Entsorgung: 9 giftig, krebserzeugend, erbgutverändernd RID/ADR: 6.1/12 c UN 2074 Giftkl. (CH): 2Acrylamid 4K-Fertiglösungen für nicht denaturierende DNA-PAGEBESCHREIBUNGDie hier aufgelisteten Acrylamid-Fertiglösungen sindaus der hochreinen „4K-ultrapure“ Qualität und30%igen Stammlösungen hergestellt. Sie bestehenaus Acrylamid/Bisacrylamid im Verhältnis 29:1 mit denjeweils angegebenen Konzentrationen an freiemMonomer und 1X TBE (pH 8,3).LAGERUNGRaumtemperaturFür die Polymerisation des Gels müssen pro 100 mlGellösung 1 ml APS (GC-A2941) (aus einer 10%igenStocklösung) und 50 µl TEMED (GC-A1148) zugegebenwerden. Als Elektrophoresepuffer wird TBE-Puffer(GC-A3945) verwendet.EIGENSCHAFTEN250 ml, 500 ml, 1 LKat. Nr. % Acrylamid (4K) Trennbereich (bp)GC-A0721 3,5 ca. 1000-2000GC-A0722 5 ca. 80-500GC-A0723 6 ca. 70-450GC-A0724 8 ca. 60-400GC-A0725 12 ca. 40-200GC-A0726 15 ca. 25-150GC-A0727 20 ca. 6-100Acrylamid 4K-Fertiglösungen für denaturierende DNA-PAGEHINWEISDa Sauerstoff die Polymerisationvon Acrylamidhemmt, sollten Acrylamidlösungenvor derZugabe von TEMED entgastwerden. Die empfohleneund relativgroße Menge an APSmacht dies in der Regeljedoch überflüssig. Fallsder Harnstoff bei niedrigenTemperaturen ausfällt,kann er durchErwärmen der Lösung im37°C-Wasserbad wiedergelöst werden.BESCHREIBUNGDie hier aufgelisteten Acrylamid-Fertiglösungen sindaus der hochreinen „4K-ultrapure“ Qualität und40%igen Stammlösungen hergestellt und für dieDNA-Sequenzierung geeignet. Sie bestehen aus Acrylamid/Bisacrylamidim Verhältnis 19:1 mit den jeweilsangegebenen Konzentrationen an freiem Monomerund 50% Harnstoff und 1X TBE (pH 8,3).LAGERUNGRaumtemperaturKat. Nr. % Acrylamid (4K) WanderungsverhältnisBromphenolblau/Xylencyanol (b)GC-A0733 4GC-A0734 5 35/130GC-A0735 6 26/106GC-A0736 8 19/76GC-A0738 10 12/55Für die Polymerisation des Gels müssen pro 100 mlGellösung 1 ml APS (GC-A2941) (aus einer 10%igenStocklösung) und 50 µl TEMED (GC-A1148) zugegebenwerden. Als Elektrophoresepuffer wird TBE-Puffer(GC-A3945) verwendet.EIGENSCHAFTEN250 ml, 500 ml, 1 L

ACRYLAMIDAcrylamid 4K-Fertiglösungen für SDS-PAGEBESCHREIBUNGDie hier aufgelisteten Acrylamid-Fertiglösungen basierenauf der Arbeit von Laemmli (1) und sind aus derhochreinen „4K-ultrapure“ Qualität sowie 30%igenStammlösungen hergestellt. Sie bestehen aus Acrylamid/Bisacrylamidim Verhältnis 29:1 mit den jeweilsangegebenen Konzentrationen an freiem Monomerund 0.1% SDS sowie 380 mM Tris (pH 8.8).LAGERUNGRaumtemperaturSAMMELGELZu jeder Packung 250 ml (bzw. 500 ml und 1 Liter)Trenngellösung wird 100 ml (bzw. 125 ml und 250 ml)Sammelgellösung mitgeliefert. Die Konzentration derSammelgellösung (125 mM Tris, pH 6.8) beträgt unabhängigvon der gewählten Trenngellösung 4%.Für die Polymerisation des Gels müssen pro 100 mlGellösung 1 ml APS (GC-A2941) (aus einer 10%igenStocklösung) und 50 µl TEMED (GC-A1148) zugegebenwerden. Als Elektrophoresepuffer wird derLaemmli (SDS-Tris-Glycin)-Puffer (GC-A1415) verwendet.EIGENSCHAFTEN250 ml, 500 ml, 1 L77Kat. Nr. % Acrylamid (4K) Trennbereich (bp)GC-A0709 5 ca. 60-210GC-A0710 7,5 ca. 35-95GC-A0711 10 ca. 15-70GC-A0712 12,5 ca. 14-57GC-A0713 15 ca. 12-45LITERATURLaemmli, U.K. (1970) Nature 227, 680-685HINWEISDie Länge des Sammelgels sollte ungefähr 1,5fachlänger sein als die Tiefe des Kammes, da bei einemkürzeren Sammelgel die Gefahr besteht, dass beimHerausziehen des Kammes das Sammelgel zerstörtwird. Da Sauerstoff die Polymerisation von Acrylamidhemmt, sollten Acrylamidlösungen vor der Zugabe vonTEMED entgast werden. Die empfohlene und relativgroße Menge an APS macht dies in der Regel jedochüberflüssig.

REAGENZIEN FÜR DIE ELEKTROPHORESE78Laemmli (SDS-Tris-Glycin)-Puffer (10x)HS-Nr.: 38220000Laemmli-Puffer, SDS-Tris-Glycin-Puffer, 10fach konzentriertfür die ElektrophoreseBESCHREIBUNGLaemmli hat mit der SDS-Polyacrylamidgelelektrophoreseein SDS-Tris-Glycin-Puffersystem (pH 8,3) eingeführt.Der Puffer wird als 10fach Konzentrat geliefert.SPEZIFIKATIONTris 30.29 g/L (0.25 M)Glycin 144.13 g/L (1.92 M)pH (H 2 O)8.3 ± 0.1 (25°C)SDS 10 g/L (1%)CATALOG NO.GC-A1415-0250 GC-A1415-0500 GC-A1415-1000250 ml 500 ml 1 LTBE (Tris-Borat-EDTA)-Puffer (10x) für die MolekularbiologieHS-Nr.: 38220000Lagerung: RTBESCHREIBUNGTBE-Puffer wird als Elektrophoresepuffer für Polyacrylamidgeleund für Agarose-Gele verwendet. TBE hateine höhere Pufferkapazität als TAE, allerdings wandertdoppelsträngige, lineare DNA bei gleicher Auflösung10% schneller durch TAE als durch TBE. ‚Supercoiled’DNA wird jedoch besser in TAE als in TBE aufgetrennt.Normalerweise verwendet man den Puffer inSPEZIFIKATIONTris 107.81 g/L (0.89 M)EDTA-Na 2 * 2 H 2 O 7.44 g/L (0.20 M)Borsäure 55.03 g/L (0.89 M)den Arbeitskonzentrationen 1x für Polyacryamidgeleund 0,5x für Agarose-Gele. Für ‚band shifts’ (gel mobilityshift assay) wird ebenfalls 0.5x TBE eingesetzt. TBEwird meist als 10x Konzentrat bei Raumtemperaturgelagert. Bei langer Lagerung bildet sich ein Präzipitat- der Puffer sollte dann theoretisch nicht mehr verwendetwerden.DNasen/RNasen nicht nachweisbarpH (20°C, H 2 O) 8.3 ± 0.2CATALOG NO.GC-002-0100 GC-002-0250 GC-002-0500 GC-002-1000 GC-002-5000100 u 250 u 500 u 1000 u 5000 u

REAGENZIEN FÜR DIE ELEKTROPHORESETEMED, N,N,N’,N’-TetrametrylendiaminTEMED, N,N,N’,N’-Tetramethylendiamin TMEDA C 6 H 16 N 2 Lagerung: +4°C R: 11-20/22-34 S: 16-26-36/37/39-45Siedepunkt 121°C M = 116.21 g/mol LGK: 3 A n 20°/D 1.417 CAS-Nr.: 110-18-9HS-Nr.: 29212900 RID/ADR: 3/3 b EINECS : 2037446 UN 2372 Giftkl. (CH): 4Entsorgung: 5 leichtentzündlich, gesundheitsschädlich, ätzendBESCHREIBUNGTBE-Puffer wird als Elektrophoresepuffer für Polyacrylamidgeleund für Agarose-Gele verwendet. TBE hateine höhere Pufferkapazität als TAE, allerdings wandertdoppelsträngige, lineare DNA bei gleicher Auflösung10% schneller durch TAE als durch TBE. ‚Supercoiled’DNA wird jedoch besser in TAE als in TBE aufgetrennt.Normalerweise verwendet man den Puffer inSPEZIFIKATIONGehalt (GC) min. 99%Wasser max. 0.3%den Arbeitskonzentrationen 1x für Polyacryamidgeleund 0,5x für Agarose-Gele. Für ‚band shifts’ (gel mobilityshift assay) wird ebenfalls 0.5x TBE eingesetzt. TBEwird meist als 10x Konzentrat bei Raumtemperaturgelagert. Bei langer Lagerung bildet sich ein Präzipitat- der Puffer sollte dann theoretisch nicht mehr verwendetwerden.ACHTUNGTEMED ist gesundheitsschädlich. Dämpfe sollten nichteingeatmet werden!79CATALOG NO.GC-A1148-0100 GC-A1148-0250 GC-A1148-0500100 ml 250 ml 500 mlAMMONIUMPERSULFAT FÜR DIE MOLEKULARBIOLOGIEAmmoniumperoxodisulfat, APS H 8 N 2 O 8 S 2 Lagerung: RT M = 228.20g/mol LGK: 5.1 HS-Nr.: 28334000R: 8-22-42/43 S:17-22-24-37-43.8 / WGK: 1 Löslichkeit (20°C) 582 g/L (H 2 O) CAS-Nr.: 7727-54-0 Schmelzpunkt: 120°C (Zers.)RID/ADR: 5.1/18 c Giftkl. (CH): 4 EINECS: 2317865 UN 1444 Entsorgung: 22 gesundheitsschädlich, sensibilisierendBESCHREIBUNGAmmoniumpersulfat (APS) dient als Initiator der Polymerisationvon Acrylamid. Da APS in wässriger Lösungnicht sehr stabil ist, sollte die Lösung frisch angesetztwerden. Aus Erfahrung kann sie aber bei +4°Cmehrere Wochen gelagert werden.SPEZIFIKATIONDNasen/RNasen nicht nachweisbar Chlorat max. 0.001%Gehalt (titr.) min. 98% Chlorid max. 0.001%pH (5%, H 2 O) 1.0 - 2.0 (20°C) Fe max. 0.001%Freie Säure max. 0.1% Mn max. 0.00005%Glührückstand max. 0.05% Pb max. 0.005%CATALOG NO.GC-A2941-0100 GC-A2941-0250 GC-A2941-0500100 g 250 g 500 g

80GeneCraft AGAROSE LSL 8100DESCRIPTIONFor preparative and analytical separation ofnucleic acids.GeneCraft Agarose LSL 8100 is ideally suited for electrophoresisof nucleic acids. It is a high purity agaroseextracted from the Gelidium species of seaweed and ischaracterised by a low sulphate content.GeneCraft Agarose LSL 8100 is recommended for preparativeas well as analytical nucleic acid electrophoresis.It provides very firm gels at low concentrations.GeneCraft Agarose LSL 8100 is quality assured specificallyto meet the stringent requirement of nucleicacid applications.GeneCraft Agarose LSL 8100 is manufactured andquality-controlled under very stringent conditions andin accordance with ISO 9000 certified quality systemto ensure conformance with the demanding requirementsof nucleic acid applications.BESCHREIBUNGFür die präparative und analytische Trennungvon Nukleinsäuren.GeneCraft Agarose LSL 8100 ist für Elektrophoresenmit Nukleinsäuren ideal geeignet. Diese hochgereinigteAgarose wird aus der Rotalgengattung Gelidiumgewonnen und zeichnet sich durch einen geringen Sulfat-Gehaltaus.GeneCraft Agarose LSL 8100 ist sowohl für die präparativeals auch für die analytische Elektrophorese mitNukleinsäuren geeignet. Mit dieser Agarose erhältman auch bei niedrigen Konzentrationen trotzdem stabileGele.GeneCraft Agarose LSL 8100 steht für eine garantierte,ganz besondere Qualität, die alle Anforderungen imBereich der Einsatzmöglichkeiten von Nukleinsäurenerfüllt.GeneCraft Agarose LSL 8100 ist unter äußerst strengenBedingungen nach ISO 9000 hergestellt und kontrolliertworden, um die Anforderungen im Einsatzbereichvon Nukleinsäuren voll erfüllen zu können.SPECIFICATIONGelling temperature 34 - 37°C(dynamic measurement in 1.5% solution)Gel strength (1.5% gel) ≥ 2300 g/cm 2Electroendosmosis (-m r ) 0.08 - 0.14Sulphate ≤ 0.05%Loss on drying ≤ 10%Residue on ignition ≤ 1.0%DNase and RNase activity and DNA bindingNoneCOMPANION PRODUCTSGeneCraft Agarose S 18000,GeneCraft Agarose S-IM 18500CATALOG NO.GC-BMA-8100500g

GeneCraft AGAROSE S 18000DESCRIPTIONFor preparative and analytical separation ofnucleic acids < 1000 bp.BESCHREIBUNGFür die präparative und analytische Trennungvon Nukleinsäuren < 1000 bp.81GeneCraft Agarose S 18000 offers very fine and consistentresolution of nucleic acid fragments below1000 bp. The agarose is capable of separating DNA orRNA fragments, which only differ with few a basepairs.The fine physical properties of GeneCraft Agarose S18000 provide the opportunity consistently to decidethe perfection and size of amplified fragments, in vitrotranslation, transcriptional mapping and small restrictiondigestion fragments.In addition, GeneCraft Agarose S 18000 offers highgel strength, which provides easy-to-handle, flexiblegels for electrophoresis of small DNA and RNA fragments.For separation of nucleic acids > 1000 bp we recommmendto use GeneCraft Agarose LSL 8100, whichoffers superior resolution of high molecular weightfragments.GeneCraft Agarose S 18000 is manufactured and quality-controlledunder very stringent conditions and inaccordance with ISO 9000 certified quality system toensure conformance with the demanding requirementsof nucleic acid applications.SPECIFICATIONGelling temperature31 -39°C(dynamic measurement in 4% solution)Melting temperature (4% solution) ≤ 92°CGel strength (4% geI) ≥ 1200 g/cm 2Electroendosmosis (-m r ) 0.06-0.14Sulphate ≤ 0.15%Loss on drying ≤ 10%Residue on ignition ≤ 1.0%DNase and RNase activity and DNA bindingNoneCOMPANION PRODUCTSGeneCraft Agarose LSL 8100, GeneCraft Agarose S-IM 18500CATALOG NO.GC-BMA-18000100gGeneCraft Agarose S 18000 weist eine ausgezeichneteund gleichbleibende Auflösung von Nukleinsäure-Fragmentenunter 1000 bp auf. Die Agarose ist für die Trennnungvon DNA und RNA geeignet, die sich nur durch einpaar Basenpaare voneinander unterscheiden.Die ausgezeichneten physikalischen Eigenschaften derGeneCraft Agarose S 18000 ermöglicht immer wiederdie Bestimmung von Erfolg und Größe amplifizierterFragmente, in-vito Translationen, Transkriptions-Kartierungenund kleiner Fragmente nach Restriktions-Verdaung.Darüber hinaus bietet GeneCraft Agarose S 18000 einehohe Gel-Festigkeit, was einfach zu handhabende, flexibleGele für die Elektrophorese von kleinen DNA- undRNA-Fragmenten gewährleistet.Für die Trennung von Nukleinsäuren > 1000 bp empfehlenwir GeneCraft Agarose LSL 8100, welche eineäußerst hohe Auflösung von Nukleinsäure-Fragmentenmit hohem Molekulargewicht bietet.GeneCraft Agarose LSL 8100 ist unter äußerst strengenBedingungen nach ISO 9000 hergestellt und kontrolliertworden, um die Anforderungen im Einsatzbereich vonNukleinsäuren voll erfüllen zu können.

82GeneCraft AGAROSE S-IM 18500DESCRIPTIONFor high resolution and analytical separationof nucleic acids < 1000 bp.GeneCraft agarose S-IM 18500 is an intermediatemelting temperature agarose which offers uniqueresolution capabilities. It is ideally suited for electrophoreticseparation and analysis of nucleic acid fragmentsbelow 1000 bp.GeneCraft agarose S-IM 18500 forms a clear andhighly resolving gel which can separate DNA fragmentsdown to a 2% difference between 200 bp and800 bp. In addition, it is easy to prepare and cast.The high resolution capabilities of GeneCraft agaroseS-IM 18500 make a perfect choice for separation ofamplified products as well as STRs and tri- and tetranucleotiderepeats.For separation of nucleic acids > 1000 bp, we recommendGeneCraft agarose LSL 8100 which offerssuperior resolution of high molecular weight DNAfragments.GeneCraft agarose S-IM 18500 is manufactured andquality-controlled under very stringent conditions andin accordance with ISO 9000 certified quality systemto ensure conformance with the demanding requirementsof nucleic acid applications.BESCHREIBUNGFür die präparative und analytische Trennungvon Nukleinsäuren < 1000 bp.GeneCraft Agarose S-IM 18500 ist eine bei mittlerenTemperaturen schmelzende Agarose, die einzigartigeAuflösungseigenschaften besitzt. Diese Agarose ist fürElektrophoresen mit Nukleinsäure-Fragmenten unter1000 bp ideal geeignet.GeneCraft Agarose S-IM 18500 bildet ein klares undhochauflösendes Gel, welches DNA-Fragmente einerGröße zwischen 200 und 800 bp mit bis zu 2%-igemUnterschied trennt.Die hochauflösenden Eigenschaften der GeneCraftAgarose S-IM 18500 bietet eine perfekte Auswahl beider Trennung von amplifizierten Produkten, sowieSTRs und Tri- bzw. Tetranukleotid-Wiederholungen.Für die Trennung von Nukleinsäuren > 1000 bp empfehlenwir GeneCraft Agarose LSL 8100, welche eineäußerst hohe Auflösung von Nukleinsäure-Fragmentenmit hohem Molekulargewicht bietet.GeneCraft Agarose S-IM 18500 ist unter äußerststrengen Bedingungen nach ISO 9000 hergestellt undkontrolliert worden, um die Anforderungen im Einsatzbereichvon Nukleinsäuren voll erfüllen zu können.SPECIFICATIONGelling temperature ≤ 36°C(dynamic measurement in 3% solution)Melting temperature (3% solution) ≤ 75°CGel strength (3% geI) ≥ 400g/cm 2Electroendosmosis (-m r ) 0.02-0.05Sulphate ≤ 0.25%Loss on drying ≤ 10%Residue on ignition ≤ 1.0%DNase and RNase activity and DNA bindingNoneCOMPANION PRODUCTSGeneCraft Agarose LSL 8100, GeneCraft Agarose S 18000CATALOG NO.GC-BMA-18500100g

BOUNDED ETHIDIUM BROMIDE AGAROSEDESCRIPTIONTo avoid usage of hazardous Ethidium bromide andimprove the gel resolution, we introduce the novelEthidium bromide (EtBr) bounded Agarose.BESCHREIBUNGUm die gesundheitsgefährdende Handhabung mitEthidium Bromid zu verhindern, empfehlen wir dieneue mit Ethidium Bromid gebundene Agarose. Außerdemverbessert dieses Produkt die Auflösung des Gels.83A B A B A Chemical bounded EtBr-agarose gelsB Non bounded (standard) agarose gels with EtBrDNA fragments- 1 kb and 100bp ladders1% - agarose 1,5% - agaroseCOMPANION PRODUCTSAgarose LSL 8100, Agarose S 18000, Agarose S-IM18500CATALOG NO.GC-EtBrAgarose100 g

STREPTAVIDIN-COATED PARTICLESCat. No. GC-SER-0011 ml 1%MAGNETIC STREPTAVIDIN-COATED PARTICLES84DESCRIPTIONSera-Mag MG-SA microparticles have a highly uniquesurface. These particles combine the fast magneticresponse time of a 1 µM particle with the high biotinbinding capacities and fast reaction kinetics of a 0.3µM particle. Three levels of biotin binding capacity(low, medium and high) are available. Sera-Mag MG-SA microparticles are colloidally stable in the absenceof a magnetic field. When a magnetic force is applied,the particles are separated from suspension rapidlyand completely.Covalently-bound StreptavidinSuper-ParamagneticCat. No. GC-SER-0021 ml 1%BESCHREIBUNGSera-Mag MG-SA Mikropartikel besitzen eine absoluteinzigartige Oberfläche. Diese Partikel vereinen dieschnellen magnetischen Reaktionszeiten eines 1 µMPartikels mit dem hohen Biotin-Bindungsvermögensund der schnellen Reaktions-Kinetik eines 0.3 µM Partikel.Drei verschiedene Stärken des Biotin-Bindungsvermögens(niedrig, mittel und hoch) sind erhältlich.Sera-Mag MG-SA Mikropartikel sind außerhalb vonmagnetischen Feldern weiterhin stabil. Wird ein magnetischesFeld angelegt, so können die Partikel schnellund restlos aus der Suspension entfernt werden.Uniform 1 Micron DiameterCARBOXYLATE-MODIFIED PARTICLESCat. No. GC-SER-00315 ml 10%MAGNETIC CARBOXYLATE-MODIFIED PARTICLESDESCRIPTIONSera-Mag MG-CM microparticles have a highly uniquesurface. These particles combine the fast magneticresponse time of a 1 µM particle with the high biotinbinding capacities and fast reaction kinetics of a 0.3µM particle. Sera-Mag MG-CM microparticles are collloidallystable in the absence of a magnetic field.When a magnetic force is applied, the particles areseparated from suspension rapidly and completely.Covalent coupling to carboxyl groups on the surface iseasily accomplished using the Seradyn standard couplingtechnology.Patent GrantedUniform 1 Micron DiameterSuper-ParamagneticBESCHREIBUNGSera-Mag MG-CM Mikropartikel besitzen eine absoluteinzigartige Oberfläche. Diese Partikel vereinen dieschnellen magnetischen Reaktionszeiten eines 1 µMPartikels mit dem hohen Biotin-Bindungsvermögensund der schnellen Reaktions-Kinetik eines 0.3 µM Partikel.Sera-Mag MG-CM Mikropartikel sind außerhalb vonmagnetischen Feldern weiterhin stabil. Wird ein magnetischesFeld angelegt, so können die Partikel schnell undrestlos aus der Suspension entfernt werden. KovalenteBindungen an die Carboxyl-Gruppen auf der Oberflächewerden unter Verwendung der Standard-Techniken vonSeradyn perfekt ausgebildet.For detailed technical information visit the Seradynweb page at www.seradyn.comCat. No. GC-SER-00415 ml 10%

MagicTubes FOR PERFECT PCRDESCRIPTIONIn MagicTubes (pending patent) we realize a newapproach to the increase of PCR specificity and reactionproduct yield.The advantages of the MagicTubes can be especialllyrevealed at the PCR amplification of „difficult“ templates(GC-rich DNA sequences, templates with complexstructure etc.), when performing the multiplexPCR and at the amplification of small quantities of theinitial DNA.MagicTubes are very easy to use, crystals of magnesiumsalt are fixed on inner walls by a special polymer.This polymer provides conditions for strong „hot start“of PCR by means of magnesium ion diffusion regulation.The performing of the „hot start“ in MagicTubesinstead of wax-barrier, manual, or antibodymediated„hot starts“ to prevent nonspecific amplificationand primer-dimer formation, provides enhancingthe specifity and sensitivity of PCR. Since no extrareagents (as antibody) are added during setup, there isno risk of contamination of eucariotic DNA traces fromantibody solution or due to re-opening reaction tubesafter heating as in manual „hot start“.BESCHREIBUNGMit den MagicTubes (zum Patent angemeldet) sindwir bei den Bemühungen Spezifität und Ausbeute vonPCR-Reaktionen zu erhöhen einen großen Schrittweitergekommen.Die herausragenden Vorteile der MagicTubes zeigensich besonders bei der Amplifikation „schwieriger“Templates (GC-reiche DNA-Sequenzen, Templates mitkomplexer Struktur etc.), bei der Durchführung vonMultiplex-PCR und der Amplifikation mit einer sehrgeringen Menge Template-DNA.MagicTubes sind in der Handhabung sehr einfach,Kristalle eines Magnesiumsalzes sind mit Hilfe einesspeziellen Polymers an der inneren Wand der Tubesfixiert. Dieses Polymer schafft aufgrund der Regulationmit diffundierenden Magnesium-Ionen stabile Bedingungenfür eine „hot start“ PCR. Die Durchführungeiner „hot start“ in den MagicTubes, statt der Verwendungvon Wachs, einer manuellen oder Antikörper-vermittelten„hot start“, um unspezifische Amplifikationenund die Bildung von Primer-Dimeren zu verhindern,verstärkt die Spezifität und Sensitivität derPCR. Da keine zusätzlichen Reagenzien (wie z.B. Antikörper)zugegeben werden besteht kein Risiko derKontamination mit Spuren eukaryotischer DNA aus derAntikörper-Lösung bzw. aufgrund des nochmaligenÖffnens der Tubes nach dem Heizschritt wie es inmanuellen „hot start“ nötig ist.85APPLICATIONSObtain the „hot start“ effect using ordinary (i.e.unmodified by antibodies or chemically) DNApolymerasesReduce nonspecific amplification product causedby low-temperature primingIncrease the reaction specifityIncrease the yield of the target PCR productPROTOCOL1. Prepare the full reaction mixture with MagicBuffferand Taq-polymerase.(If you use another enzyme, you should adjust thereaction buffer to your enzyme by AdjustingBufferapplication.)2. Add the full reaction mixture into the MagicTube3. Incubate for 5 min. at 92-95 °C4. Start cycling the PCR reaction:92-95°C – 30 sec.50-60°C – 30-45 sec.70-75°C – ≥ 30 sec.NOTESIn order to achieve the best results, the PCR with Taqpolymeraseshould be performed with the 10x reactionMagic-buffer provided with MagicTubes. This reaction-bufferwas specially developed for the performingof the PCR with Taq-polymerase in MagicTubes.MagicTubes can be used with various polymerasesand not only with Taq, as the reaction buffer can beeasily adjusted to the properties of the enzymes usedin the PCR.

MagicTubes FOR PERFECT PCRIn order to optimize your reaction mixture to the usedenzyme, the 10x Adjusting-buffer should be used withthe Magic-buffer (as shown in the table) for the reactionmixture preparation.86Polymerases Mg 2+ concentration Volume of 10x Volume of 10xrequired for ordinary PCR MagicBuffer (mkL) AdjustingBuffer (mkL)Taq, Tth, BioTherm 1.5 – 2.0 mM 10 0Pfu, Pwo, Vent, 2.0 – 3.0 mM 4 6DeepVentKlenTaq, KlenTherm, 3.0 – 4.0 mM 2 8KlenThermN, SynergyAccuTherm 4.0 – 5.0 mM 0 10180 bpOptimization of the reaction mixture to used polymeraseby 10x AdjustingBuffer application.(Final volume of PCR mixture – 100 mkL)It is possible to prepare and store the PCR mixture atroom temperature.ATTENTION!1. The 10x reaction MagicBuffer provided is optimizedfor the application with Taq-polymerases2. The reaction „hot start“ is achieved by the 5-minutespreheating at the temperature of 92-95 °Cduring the first PCR cycle3. When the 10x MagicBuffer is used, Mg 2 + shouldnot be added to the reaction mixture4. The recommended volume of the reaction mixtureis 20-80 µl1 2 3 4 5INCREASED SPECIFITY OF PCRIN MAGICTUBESA 180 bp DNA-fragment wasamplified from 50 ng of humangenomic DNA for 30 cycles. „Hotstart“ was performed manually (theenzyme was brought in into the 94°C preheated reaction mixture)(lanes 1, 2) or with the use ofMagicTubes (lanes 3, 4). The PCRwas performed in the volume of 25µl containing 0.5 activity units(lanes 1, 3) or 2.0 activity units(lanes 2, 4) of Taq polymeraseaccordingly. Lane 5: molecularweight markerOPTIMIZATION EXPERIMENTSWe found that optimization of the amplifications iscritical to get amplification products with the Magic-Tubes. In two optimization experiments we were ableto get amplification when we increased the amount ofTaq DNA Polymerase in each reaction and/or when weoptimized the magnesium level using both the 10xMagic Buffer and 10x Adjusting Buffer. The methodsand results for these two experiments are givenbelow.In these experiments the magnesium concentrationwas titrated using the 10x Magic buffer and 10xAdjusting buffer. The four different levels of magnesiumwere generated as recommended in the Magic-Tubes literature: 1.5-2.0mM, 2.0-3.0mM, 3.0-4.0mM,and 4.0-5.0mM. Three levels of Taq DNA Polymerasewere used in the 50ml reactions: 1.25U, 2.5U and 4U.As a positive control, amplifications in Promega’sThermophilic DNA Polymerase buffer with 1.5mMmagnesium in Gene Amp tubes were included.Amplification of a 1.5kb fragment from plasmidDNA that requires hot start amplification.Final concentration of the components:1x buffer200 µM each dNTP (dATP, dCTP, dGTP, dTTP)0.2 µM upstream primer0.2 µM downstream primer20 pg/µl plasmid templatein 50 µl reactionsThe reactions were assembled at room temperatureand tubes were put into a room temperature thermalcycler.THERMAL CYCLING CONDITIONS1 cycle (5 min. at 95 °C)30 cycles (30 sec. at 93 °C, 45 sec. at 60 °C, 1 min. at72 °C)1 cycle (5 min. at 72 °C)

MAGICTUBES FOR PERFECT PCRM 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 MFigure 1Hot Start amplification using a template/primer pairthat requires hot start amplificationMagicTubes were used in lanes 1-16 and Gene Amptubes were used in lanes 17-20. Magnesium titrationswere done: lanes 1-4 Magic buffer only to give 1.5-2.0mM magnesium, lanes 5-8 Magic and Adjustingbuffers to give 2.0-3.0mM magnesium, lanes 9-12Magic and Adjusting buffers to give 3.0-4.0mM magnesium,lanes 13-16 Adjusting buffer only to give 4.0-5.0mM magnesium, lanes 17-20 Promega ThermophilicDNAP buffer with 1.5mM magnesium. Three levelsof Taq DNA Polymerase were used: lanes 1, 5, 9, 13,17 had 1.25U Taq DNA Polymerase/50ml reaction,lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 had 2.5U TaqDNA Polymerase/50ml reaction, lanes 3, 7, 11, 15,19had 4U Taq DNA Polymerase/50ml reaction. No templatecontrol reactions: lanes 4, 8, 12, 16, 20. Lane Mis pGEM DNA Markers.Amplification of a 1.3kb beta-globin fragmentfrom human genomic DNA that does not requirehot start amplificationFinal concentration of the components:1x buffer200 µM each dNTP (dATP, dCTP, dGTP, dTTP)1 µM upstream primer1 µM downstream primer100 ng human genomic DNA template in 50 µl reactionsThe reactions were assembled at room temperatureand tubes were put into a room temperature thermalcycler.THERMAL CYCLING CONDITIONS1 cycle (5 min. at 95 °C)35 cycles (30 sec. at 95 °C, 30 sec. at 60 °C, 1 min. at72 °C)1 cycle (5 min. at 72 °C)Figure 2Amplification using a template/primer pair that doesnot require hot start amplification. MagicTubes wereused in lanes 1-16 and Gene Amp tubes were used inlanes 17-20. Magnesium titrations were done: lanes1-4 Magic buffer only to give 1.5-2.0mM magnesium,M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Mlanes 5-8 Magic and Adjusting buffers to give2.0-3.0mM magnesium, lanes 9-12 Magic and Adjustingbuffers to give 3.0-4.0mM magnesium, lanes 13-16 Adjusting buffer only to give 4.0-5.0mM magnesium,lanes 17-20 Promega Thermophilic DNAP bufferwith 1.5mM magnesium. Three levels of Taq DNAPolymerase were used: lanes 1, 5, 9, 13, 17 had 1.25UTaq DNA Polymerase/50ml reaction, lanes 2, 4, 6, 8,10, 12, 14, 16, 18, 20 had 2.5U Taq DNA Polymerase/50mlreaction, lanes 3, 7, 11, 15, 19 had 4U TaqDNA Polymerase/50ml reaction. No template controlreactions: lanes 4, 8, 12, 16, 20. Lane M is pGEMDNA Markers.87CATALOG NO.GC-059-02GC-059-05100 pcs./bulk+buffer, 0,2 ml tube-volume 100 pcs./bulk+buffer, 0,5 ml tube-volume

88LABORATORY CONSUMABLESGeneCraft distributes products of the companiesAlpha Laboratories Ltd. (UK) and Brand GmbH (Germany).If you are interested in closer informations ofthese companies, please contact us and we will bepleased to send you catalogs of our partners.GeneCraft vertreibt Produkte der Firmen Alpha LaboratoriesLtd. (UK) und Brand GmbH (Deutschland).Wenn Sie an weiteren Informationen über diese Firmeninteressiert sind, dann setzen Sie sich bitte mituns in Verbindung. Wir werden Ihnen dann gerneKataloge unserer Partnerfirmen zusenden.

ALPHABETICAL PRODUCT INDEX89ProductPageProductPageABCDGHIKAccuTherm DNA polymerase 36Acrylamide solutions 76Agarose LSL 8100 80Agarose S 18000 81Agarose S-IM 18500 82Amoniumpersulfate 79BioTherm DNA polymerase 5BioThermAB DNA polymerase 22BioThermBio DNA polymerase 17BioThermMix 8BioThermRed DNA polymerase 14BioThermStar DNA polymerase 18BioThermStarMix DNA polymerase 20BioThermT DNA polymerase 15Biotin-4-dUTP 61Biotin-11-dUTP 61Bounded ethidium bromide agarose 83BstE II-l-DNA marker 66CoverIt 12Crystal violet buffer 13DNA cycle sequencing kit 32DNA marker 66-70DNA polymerization mix 20 & 10 60DNA purification kit 73dNTP custom service 61dNTPs 60dNTP set 59GeneScript reverse transcriptase 48Hot Start PCR compound 24Hot Start Taq monoclonal antibody 23Hpa II-pBS-DNA marker 67IPTG 75Klenow Fragment 50KlenTherm DNA polymerase 25KlenThermase DNA polymerase 31KlenThermaseN DNA polymerase 32KlenThermN DNA polymerase 28KlenThermPlatinum DNA polymerase 29LMNPRSTULadder, 100 bp 71Ladder, 1 kb 72Laemmli-buffer 78λ DNA 62MagicTubes for perfect PCR 85Marker 66-70MegaPure DNA purification kit 73Monoclonal IgG to Thermusaquaticus DNA polymerase 74NeoTherm DNA polymerase 10Nucleotides 59-61Particles 84pBS-KS-EcoRV 66PCR-Grade H 2 O 12Pyrophosphatase, Tth 34Random Prime labeling kit 58Restriction endonucleases 55Reverse transcriptase 48RNA polymerase, SP6 54RNase Inhibitor 49SDS-Tris-Glycin buffer 78SP6 RNA polymerase 54SupraTherm DNA polymerase 11Synergy DNA polymerase 38SynergyN DNA polymerase 39SynergyPlus DNA polymerase 41SynergyT DNA polymerase 40T7 RNA polymerase 54T-Vector System 63TBE buffer 78TEMED 79Treponema pallidum recombinantantigen - tmpA 74Tth inorganic pyrophosphatase 34TthPlus DNA polymerase 42T4 polynucleotide kinase 51T4 DNA ligase 52Tth DNA ligase 53Uracil-DNA glycosylase 62

FAX-BESTELLUNGNAMEDATUMKUNDEN NR.90UNTERNEHMEN/ UNIVERSITÄTADRESSETEL./ FAX / E-MAILBESTELLUNGPOS. BESTELL NR. PAKETGRÖSSE PREISGESAMTPREISAlle Preise gelten zuzüglich der 16% Mehrwertsteuer.Für Bearbeitung, Verpackung, Versand und denumweltfreundlichen Rückholservice werden innerhalbDeutschlands Euro 15,- berechnet. Die Lieferungerfolgt gegen offene Rechnung. Rechnungen sindinnerhalb von 30 Tagen nach Rechnungsdatum zurZahlung fällig. Preise gemäß der jeweils aktuellenPreisliste (siehe Anlage).Bitte faxen Sie uns Ihre Bestellung zu oder schicken sieper E-mail oder Post an:GENECRAFT GmbHAdresseRaiffeisenstr. 12, 59348 LüdinghausenTel. +49 2591 794990Bestell-Fax +49 2591 8927989E-mailmail@genecraft.dewww.genecraft.de

THAT´S NEWAb sofort erhalten Sie bei uns bis auf weiteres auf alleBrand Produkte 5% Rabatt.Möchten Sie unsere Produkte einmal austesten? KeinProblem! Wir schicken Ihnen gerne von unseren Enzymen,dNTPs, Markern und Kits kostenlose Proben zu.Selbstverständlich berechnen wir dabei keine VersandundVerpackungsgebühr.Bei Ihrer ersten Bestellung erhalten Sie von uns einenEinführungsrabatt von 20% - ganz gleich, was oderwieviel Sie bestellen.Beim Kauf von insgesamt 5000 u thermostabiler DNAPolymerasen erhalten Sie von uns auf Wunsch kostenloseinen DNA Polymerization Mix 10.Wir liefern Ihnen alle unsere Produkte in unterschiedlichenPackungsgrößen nach Ihrem Wunsch - selbstverständlichohne Preisaufschlag. Bei GeneCraft gibtes keine Mindestbestellmengen! Jede Bestellung iststets willkommen.Selbstverständlich richten wir Ihnen auch gerne einKonto ein. Sollten Sie daran interessiert sein, so setzenSie sich doch einfach mit uns in Verbindung.Wir sind ständig darum bemüht, unser Warenangebotzu erweitern. Alle Produkte, die nach Druck unseresKataloges hinzugekommen sind, haben wir in derPreisliste mit NEW gekennzeichnet. Beschreibungen zudiesen Waren finden Sie als Beilagen in unserem Katalog.Produkte, die Sie vor 14:30 Uhr (Mo-Do) bestellen,werden noch am selben Tag durch UPS abgeholt undsind am nächsten Tag in Ihrem Labor. Für den Versandverwenden wir Kühlakkus, die zuverlässig dienotwendige Kühlung unserer Produkte während desTransports gewährleisten. Die wertvollen Kühl-Verpackungenwerden regelmässig wieder abgeholt und anuns retourniert. Das schont auch die Umwelt! Bittestellen Sie aus diesem Grunde die Boxen mit Kühlakkkusfür die Rückführung durch den Fahrer bereit.Wir bitten Sie um Verständnis, dass wir die realenKosten für Verpackung und Versand nicht in unsererPreisliste verstecken, sondern die tatsächlichen Kostenvon € 15,- berechnen.Alle Preise gelten zuzüglich der 16% Mehrwertsteuer.Für die Bearbeitung, Verpackung, den UPS-Versandkostenanteilund den umweltfreundlichen Rückholservicewerden € 15,- berechnet. Die Lieferung erfolgt gegenoffene Rechnung. Rechnungen sind innerhalb von 30Tagen nach Rechnungsdatum zur Zahlung fällig.91

GENECRAFT GmbHAdresse Raiffeisenstr. 12, 59348 LüdinghausenTel. +49 2591 794990Bestell-Fax +49 2591 8927989E-mail mail@genecraft.dewww.genecraft.deE N Z Y M E S F O R M O L E C U L A R B I O L O G Y