NPC Progress Meeting 2012 - Netherlands Proteomics Centre

More documents

Recommendations

Info

Hans SchölerKeynote lecture at NPC ProgressMeeting 2012 (Utrecht, 7February) entitled ‘Induction ofpluripotency.’Proteomics essential for investigating pluripotency“The discovery of a gene, Oct4, involved in maintainingpluripotency has played an important role in my scientificcareer,” says Professor Hans Schöler, director of theDepartment of Cell and Development Biology from the MaxPlanck Institute for Molecular Biomedicine in Münster. Hespoke at the NPC Progress Meeting on the germline cells hehas been studying for more than 20 years. With a long list ofpublications, Schöler has made an impressive contributionto this field.28 | NPC Highlights 15Hans Schöler is particularly interested in pluripotency,the ability of cells to transform into more than200 types of body cells. Until 2006 scientists didnot think that differentiated cells such as skin, hair and bloodcells could be transformed into one another. All the differentcells in the body were thought to be generated by pluripotentstem cells alone, which are transiently found in the earlyembryo. More than 20 years ago, Schöler and his researchteam discovered a transcription factor called Oct4 that plays acrucial role in pluripotency.The Oct4 gene is normally expressed only in embryonicstem cells (ESCs) and the precursors of egg and sperm cells.However, Schöler’s team recently found that Oct4 is transducedinto differentiated cells, such as neural stem cells,which can be reprogrammed into pluripotent stem cells.“These so-called induced pluripotent stem cells, or iPSCs, areespecially useful in basic research for uncovering which factorscontribute to the different stages of cell development,”says Schöler. “However, they are not suitable for transplantationas they can form teratomas, a special kind of tumour.”In 2003, Schöler’s team made another important discovery byshowing that oocytes were generated in in vitro cultures ofESCs in the presence of Oct4. Oocytes were previously thoughtto be generated from oocyte precursors alone. “The publicationof these results even made it to an article in the New YorkTimes,” Schöler remarks proudly.Advanced techniquesDifferent newly developed proteomics techniques have beeninstrumental in the diverse discoveries made by the Schölergroup. For example, quantitative mass spectrometry usingSILAC labelling (stable isotope labelling by amino acids in cellculture) has allowed the researchers to identify and quantifymore than 5,000 distinct proteins present in mouse ESCs, oneof the largest quantified proteomes to date. For this workSchöler collaborated with the Matthias Mann research groupat the Max Planck Institute for Biochemistry in Martinsriedand found that proteins involved in cell proliferation wereabundant.Furthermore, Schöler’s group developed a combined functionaland quantitative proteomics (SILAC) screen for identifyingproteins and complexes that contribute to reprogramming.“In this study we showed that a specific chromatin-remodellingcomplex plays a role in the generation of iPSCs throughsomatic cell reprogramming.” Using in-house mass spectrometry,Schöler’s team zoomed-in on Oct4 to uncover the precisearea involved in reprogramming. Oct4 contains two somewhatconserved regions tethered by a linker of 17 amino acids.They found that a single point mutation in the linker abolishesreprogramming.Neural stem cellsSchöler is very excited about his latest discovery, described inthe 6 April issue (2012) of Cell Stem Cell. “We have shown forthe first time that fibroblasts can be directly turned into neuralstem cells using the right factors. Colleagues had alreadydemonstrated that fibroblasts could be turned into neurons,but the neural stem cell stage had not been reached. Theseneural stem cells proliferate rapidly in vitro and do not formtumours after transplantation, unlike iPSCs. Now we can actuallystart to think about transplantation. However, much workis needed before we can really translate this to the clinic, forexample, to renew waning muscle in older people. I hope thatI will be able to witness this before I retire.”“We found that proteinsinvolved in cell proliferationwere abundant.”
NPC Progress Meeting 2012Blighted by KenningA work in progressThe Netherlands Proteomics Centre is collaborating withthe UK artist Charlotte Jarvis on a new bio-art projectcalled Blighted by Kenning. The completed project will beexhibited at The Big Shed in Suffolk in August and after thisin the Netherlands. The bio-art project is funded by theNPC and the Netherlands Genomics Initiative (NGI).The project proposes to bio-engineer a bacteria which hasthe Universal Declaration of Human Rights encoded into itsDNA sequence. Apples which have been grown at The Hague,seat of the International Courts of Justice, will then be‘contaminated’ with the bacteria. The NPC will send these‘fruits from the tree of knowledge’ to genomics laboratoriesaround the world and ask participating scientists to sequencethe declaration and send back a translation.International networkIn addition a limited number of labs will be asked to producethe actual protein encoding the text and will be asked toEach letter of the alphabet will be represented by oneDNA codon (a tri-nucleotide unit consisting of a specificcombination of Adenine (A), Thymine (T), Guanine(G) and Cytosine (C)). Helpfully, most codons alreadycorrespond to one of 20 amino acids, each of which isdesignated by a single letter of the alphabet. Becausenot all letters are represented by amino acids, but someCharlotte Jarvis presented Blighted by Kenning atthe NPC Progress Meeting on 7 February 2012.analyse it and ship the protein back to the Netherlands ifthey are successful. The proteins will then be analysed bymass spectrometers in Utrecht to confirm their identity as theUniversal Declaration of Human Rights. The hypothetical 3Dstructure of the protein will also be predicted and visualised.The NPC hopes Blighted by Kenning will create a networkof international institutions all participating in the project,and as such making a statement about the importance ofgenomics research. The project aims to create a scenario inwhich science, technology and genetics literally and palpablypropagate humanitys most highly valued achievements.Symbolic gestureFinally, the artist also hopes to find scientists at participatinginstitutions who would like to eat the fruit. We hope that thisact could constitute a symbolic gesture rejecting the hysteriaassociated with genetics research in much of the popular pressand also more generally making a statement that says ‘I wantto partake of the tree of knowledge — because it is learning,science and technology — including genomics — that will makeour lives better’.Encoding the Universal Declaration of Human Rightsamino acids are encoded by multiple codons, we willneed to slightly adapt the ‘meaning’ of some codons. Forexample, ‘Article One’ could be written into the genomeas ‘GCTCGTACTATTTGTTTAGAAAGAATAAATGAA’.In thissequence, the codon AGA is used to designate a spaceand the codon ATA is used for the letter ‘O’, which has noassociated amino acid.| 29
Page 1 and 2: netherlandscentrenpc highlights 15
Page 4: News HeadlinesNPC Progress Meeting
Page 8 and 9: Harald AlbersDiscovery and optimisa
Page 10 and 11: ~ 40,000small moleculesOOHHOOHBFigu
Page 12 and 13: Bas van Breukelen and Maarten Altel
Page 14 and 15: Figure 2 | Phylogenetic analysis of
Page 16 and 17: Karin Wolters, Hjalmar Permentier a
Page 18 and 19: Figure 2 | Targeted proteomics. (A)
Page 20 and 21: Popular Science Writing ContestNPC
Page 22 and 23: Fishing out DNAAs said above, trans
Page 24 and 25: PhD Students DayOn 6 February, a ve
Page 26 and 27: Alexander MakarovKeynote lecture at
Page 30 and 31: Plant proteomicsSabbatical gives mo
Page 32 and 33: Top publications with NPC contribut
Page 34 and 35: Dutch Techcentre for Life SciencesE
Page 36: upcoming events20-24 May 20129-12 J

NPC Progress Meeting 2012 - Netherlands Proteomics Centre

Create successful ePaper yourself

Delete template?

Save as template?