NPC Progress Meeting 2012 - Netherlands Proteomics Centre

netherlandscentrenpc highlights 15 | May 2012Featuring cutting edge research projectsand enabling technologies of theNetherlands Proteomics Centre

FrontpageBlighted by Kenning: Fruits from the tree of knowledge.2346820242629303132333536ContentsAboutPrefaceNews headlinesInterview: Huib OvaaHighLights8 Harald Albers; Discovery and optimisation of autotaxin inhibitors12 Bas van Breukelen and Maarten Altelaar; Database-independent proteomics16 Karin Wolters, Hjalmar Permentier and Rainer Bischoff; Targeted proteomics as a tool to study aging in yeastPopular Science Writing ContestNPC Progress Meeting: PhD Students DayNPC Progrees Meeting: Keynote SpeakersBlighted by Kenning: A work in progressBart Thomma: Sabbatical gives momentum to research on pathogenic fungiJan Hoeijmakers: Proteomics and molecular genetics are a perfect matchNPC Top PublicationsDutch Techcentre for Life Sciences (DTL)Proteomics@Work: 13.5 Me for large-scale proteomics research facilityChristine Mummery: Promising proteomics in stem cell biology15 | NPC Highlights 15 | May 2012>AboutThe Netherlands Proteomics Centre (NPC) is a strategic collaboration of research groups fromseven universities, four academic medical centres and several research institutes and biotech companies.With a scientific programme addressing key areas of proteomics in several projects, andspecialised ‘research hotels’, the NPC performs high-quality research and knowledge transfer in aninternational context. The NPC is part of the Netherlands Genomics Initiative.In NPC Highlights researchers present progress and results from NPC projects of the scientificprogramme and the research hotels. NPC Highlights is published by the Netherlands ProteomicsCentre.Netherlands Proteomics CentrePadualaan 8NL 3584 CH Utrechtt +31 30 253 4564e info@npc.genomics.nlw www.netherlandsproteomicscentre.nlEditorial BoardAlbert Heck, Scientific Director NPCWerner Most, Managing Director NPCBert Poolman, member Executive Board NPCHerman Overkleeft, member Executive Board NPCRob Liskamp, member Executive Board NPCGeert Kops, member Executive Board NPCMartje Ebberink, Communications NPCText interviewsAstrid van de Graaf, Lilian Vermeer,Bastienne Wentzel, Marga van ZundertCoordination and editingMarian van OpstalBèta Communicaties, The HagueLay-outFrans KoemanF.Koeman DTP-Services, ZoetermeerPhotographyThijs Rooimans, Henk VeenstraPrintingBestenzet BV, ZoetermeerTo subscribe to NPC Highlights pleasesend an e-mail with your full name, organisationand address to info@npc.genomics.nl© 2012 Copyright Netherlands Proteomics Centre

News HeadlinesNPC Progress Meeting 2012Hans Cleversnew President KNAWPoster prize winnersOn 7 February 2012, the Media Plaza in Utrecht was onceagain the venue for the NPC Progress Meeting. Over 200researchers from all over the Netherlands found inspiration inlectures, posters and theme sessions with their collaborationpartners. There were poster prizes for Anna Guerreiro (UU),Tomasso Di Marchi (EMC) and Elizabeth McClellan (EMC). Inaddition, for the first time this year, prizes were awarded forthe best popular scientific articles. You can read the winningarticles in this issue on pages 20 to 23. | NPC Highlights 15 | May 2012Geert Kops in Eco-GownNPC theme leader GeertKops (brand new professor ofMolecular Tumour Cell Biologyat Utrecht University) hasbecome the second professorin the Netherlands and thefirst in Utrecht to have a fullyrecyclable ‘Eco-Gown’ made.During his inaugural lecture onMay 11, he will officially wearit for the first time. The gownis an initiative of Rotterdamprofessor of Sustainability Gail Whiteman, who is studyinghow to introduce sustainability into the business community.Produced without impacting the earth, the gown is made outof Returnity, a recycled polyester. It’s also eco-friendly: youcould bury it in the garden as it were. Only the velvet of thelapels and the leather on the inside of the beret, for example,has been made using leather from the flea market. When youopen up the gown, you can see that the universal rights ofman, animal and the planet have been printed on the lining.Kops says that this gown is more of a statement than himreally wanting to save the world with it.Hans Clevers, director of theHubrecht Institute and NPC projectleader, will succeed RobbertDijkgraaf as President of the RoyalNetherlands Academy of Arts andSciences (KNAW) per 1 June 2012.Clevers (1957) has been scientificdirector of the Hubrecht Institute inUtrecht and professor of moleculargenetics at Utrecht University since2002. He won the Dutch SpinozaAward in 2001 and received an ERC advanced grant of 2.5 M€in 2008. In January, he was awarded the Léopold GriffuelPrize for his research into stem cells and the growth of coloncancer. In March the KNAW announced that he is one of the sixwinners of the 2012 Heineken Prize.Clevers will serve four years as the President of the Academy.To avoid any conflict of interest, he will resign as director ofthe Hubrecht Institute as of 1 June and be employed by theUMCU. The Hubrecht Institute is affiliated with the UMCU,allowing Hans Clevers to continue his research work.Golden KNCV Medal 2011The Golden KNCV Medal 2011has been awarded to Huib Ovaa(NKI-AVL). The NPC themeleader received the award on30 November 2011 during theKNCV-NWO meeting CHAINS. NPCresearchers Sjaak Neefjes (NKI-AVL), Albert Heck (UU) and HermenOverkleeft (LU) received the medalin respectively 1996, 2001, 2008.The KNCV medal is regarded as the most important Dutchprize for young researchers who have excelled in the area ofchemical research (see also pages 6-7).Recent NPC PhD-thesesThe NPC congratulates NPC researchers Wouter van der Linden,Harald Albers and Marco Hennrich on successfully defendingtheir theses.Wouter van der Linden, Leiden University, 22 December 2011Towards subunit-specific proteasome inhibitorsHarald Albers, Netherlands Cancer Institute, Leiden, 4 April 2012Development of ATX and DUSP inhibitors: Inhibiting phosphateester hydrolysis in biologyMarco Hennrich, Utrecht University, 11 April 2012Expanding the toolbox to decipher the (phospho)proteome

“The ultimate goal is to develop a moleculethat may lead to a medical application.”Careerconsists of the scientists who come up with interesting biologicalquestions. The third group generates reagents and tools thatallow tackling the questions posed by group 2 using the expertiseof group 1. I am part of the third group and my role is to providethis link. We really put chemical biology into practice.”In businessThe way he talks about his research creates the impressionthat his primary goal is to serve the work of other scientists.Is he really that modest and service-oriented? He laughs a bit.“Well, yes, but that’s true for many researchers. You want tocontribute to the field. My aim is to establish a broad toolboxof chemical reagents to study the ubiquitin-proteasomesystem.” When it comes to serving the broader field, Ovaaliterally means business.In 2010 he and postdoc Farid El Oualid co-founded UbiQ, whichcommercialises the ubiquitin-related agents developed byhis lab. “The quickest way to make your results known andhave them used is to put them in a catalogue. It’s a familiarsystem and works for everyone.” But there is more. “Wecould come across an interesting drug lead; I certainly don’trule that out.” So there is another objective besides servingthe scientific community? Again a smile, but now more tingedwith incredulity. “Of course there is! The ultimate goal is todevelop a molecule that may lead to a medical application.A new drug: that is what everyone in this field wants.” Hestrongly favours scientists taking an active role in valorisationof their findings. “When you discover something promising, itis your duty to take it further. You don’t just put it on somebody’sdesk and hope for the best.”New drug leadsIn Ovaa’s case, the new drugs he is after are likely to be smallmolecules that act as chemical inhibitors of ubiquitin-mediatedpathways. “We very specifically study how the proteinubiquitinationcascade is organised. Our key question is howubiquitination regulates proteasome activity. Studying this indetail, which means covering both the chemistry and the biochemistry,could very well result in the discovery of new leadsfor drug targets or molecules with therapeutic potential.”His NPC project ‘Tyrosine phosphatase inhibitors, baits andABPs’ supports this claim, as the team succeeded in identifyinga number of very promising tyrosine phosphatase inhibitors.More generally he feels that this project also demonstratesthe need for adequate chemical reagents and targetedquestions in order to really deploy the power of proteomics.“I do not believe in systems biology in the sense that generatingbig datasets will somehow reveal the answers straight froma computer. You need focus. In the end, we aim for a betterunderstanding of biological processes and that forces you tofocus on a well-defined question.”Huib Ovaa2010 Co-founder and C.S.O. of UbiQ2009 Tenured staff member Netherlands CancerInstitute2004 Group leader Netherlands Cancer Institute2003 Instructor in Pathology at Harvard MedicalSchool2001 Postdoc at Harvard Medical School2001 PhD degree (cum laude) at LeidenUniversityAwards2011 KNCV Gold Medal (Royal NetherlandsChemical Society)2011 ERC Starting Grant2010 Amsterdam Inventor Award2010 NPC Valorisation Voucher2009 NVBMB prize2005 NWO VIDI Fellowship2003 NWO VENI FellowshipRecent key publications• Geurink P.P., et al. (2012) A general chemicalligation approach towards isopeptide-linkedubiquitin and ubiquitin-like assay reagents.ChemBioChem 13:293-297• El Oualid F., et al. (2010) Chemical synthesis ofubiquitin, ubiquitin-based probes and diubiquitin.Angew.Chem. Int. Ed. 49:10149-10153• Albers H.M.H.G., et al. (2010) Boronic acidbasedinhibitor of autotaxin reveals rapidturnover of LPA in the circulation. PNAS (107)16:7257-7262Quality is the bottleneckThe future of proteomics is not necessarily about furthertechnological advancement of the equipment says Ovaa. “Thecurrent MS machines are so sensitive I really don’t see howfurther improvement on that part alone would contribute toscientific progress. The main bottleneck right now is the qualityof the samples. New chemical reagents and new methodsand tools for quantitative analysis are what we need for futurebreakthroughs.”And the future of the Netherlands Proteomics Centre? “Theconcept of the NPC is very valuable and I would really like tosee it continued. To me the added value of the NPC is in havingaccess to the right know-how and facilities and particularlyall the other researchers involved with NPC. It is great to bepart of a community of people who share your interests. In theend, it is all about interesting questions and interactions.”|

Harald AlbersDiscovery and optimisationof autotaxin inhibitors | NPC Highlights 15 | May 2012Autotaxin (ATX) is an enzyme which is able to hydrolyse thelipid lysophosphatidylcholine (LPC) into lysophosphatidicacid (LPA) and choline. The ATX-LPA signalling axis hasbeen implicated in inflammation, fibrosis and tumourprogression, rendering ATX an attractive drug target. Thisarticle describes the route to the development of highlyactive ATX inhibitors for which the researchers used a smallmolecule screen as well as structure-based design of ATXinhibitors.The secreted glycoprotein autotaxin (ATX) is a lipid phosphodiesteraseresponsible for the hydrolysis of lysophosphatidylcholine(LPC) into lysophosphatidic acid (LPA) and choline (seeFigure 1). Hydrolytic activity of ATX predominately originatesfrom a threonine residue and two zinc ions in the ATX activesite. LPA acts on specific G protein-coupled receptors andthereby stimulates the migration, proliferation and survival ofmany cell types. ATX is essential for vascular development andis found overexpressed in various human cancers. Forced overexpressionof ATX or individual LPA receptors promotes tumourprogression in mouse models, while LPA receptor deficiency inmice protects from colon carcinogenesis. In addition to its rolein cancer, ATX−LPA signalling has been implicated in lymphocytehoming and (chronic) inflammation, fibrotic diseases,thrombosis, and cholestatic pruritus. Given its role in humandiseases, the ATX−LPA axis is an interesting drug target.Screening of a chemical library To search for unique ATXinhibitors, we screened a collection of about 40,000 drug-likesmall molecules using an assay based on an artificial substrateof ATX named bis(4-nitrophenyl) phosphate (bis-pNPP)[1,2]. Inthis assay bis-pNPP is hydrolysed by ATX into the yellow chromophore4-nitrophenol. This assay gives a direct readout makingit suitable for screening large libraries of small molecules.For validation of the screening hits we used a different assaybased on the physiological ATX substrate LPC. In this assay,ATX-mediated release of choline from LPC is detected by atwo-step enzymatic colorimetric reaction.Among the validated molecules from this screening the thiazolidine-2,4-dioneswere well represented. Since the thiazolidine-2,4-dionecore is readily amenable to chemical diversification,the most potent thiazolidine-2,4-dione, inhibitor A (seeFigure 2) was selected for further optimisation. Inhibitor A

What this research is about:Search for new medicines based oninhibition of the enzyme autotaxinAutotaxin (ATX) is an important enzyme for the hydrolysisof the lipid lysophosphatidylcholine (LPC) into lysophosphatidicacid (LPA) and choline. The bioactive lipid LPA is ableto activate several cellular processes like growth, migrationand survival. ATX and LPA have been implicated in variousdiseases including cancer, inflammation and fibrosis. “Inorder to study the exact role of ATX and LPA in these diseaseswe have been looking for ATX inhibitors,” says HaraldAlbers, who just finished his PhD research on this topic atthe Netherlands Cancer Institute (NKI-ALV). “By blockingthe activity of ATX, one can study the effect of ATX on thedevelopment of disease. If one obtains a positive effect, theinhibitors can be used as a starting point for the developmentof future medicines.”Albers and colleagues started this research by screeninga large library of 40,000 drug-like small molecules. Albersmade many chemical modifications on the most promising inhibitorresulting from this screening to improve its potency.The introduction of a specific chemical group, a boronicacid, into the compound improved the affinity for ATX tremendously.In mice this boronic acid-based inhibitor inducesa remarkable and instantaneous decline in LPA levels in theblood, showing that this inhibitor can target ATX in vivo.“After some time our Structural Biology colleagues at the NKIwere able to obtain a crystal structure of ATX bound to ourinhibitor. This was an important step forward since it allowedus to study the binding of the inhibitor with ATX in more detail.It furthermore enabled us to develop novel inhibitors in arational manner.” In the meantime pharmaceutical companieshave become very interested in ATX inhibitors. Pfizer andMerck have set up their own ATX inhibitor programmes. Albersis now working on the latest ATX inhibitors and will continuehis research as a postdoc at the NKI-AVL.| NPC T1: Cancer ProteomicsATXHONCholineFigure 1 | LPA-mediated bioactivity. The enzyme autotaxin (ATX) is responsiblefor the hydrolysis of lysophosphatidylcholine (LPC) into lysophosphatidicacid (LPA) and choline. LPA activates specific G protein-coupled receptorsstimulating migration, proliferation and survival of cells.showed an IC 50 value of 2.5 μM in the LPC hydrolysis assayused for in vitro inhibitor validation.On OOHLPCExtracellularOOPOONMigrationnOOOHLPAGOProliferationOPOOSurvivalTargeting the active site We next sought to target thethreonine oxygen nucleophile in the ATX active site. Wereplaced the carboxylic acid in inhibitor A with a boronicacid. Our rationale was that the carboxylic acid moiety ofinhibitor A could function as a phosphate mimic and therebybind near or at the threonine oxygen nucleophile, in whichcase the threonine oxygen nucleophile in ATX could be targetedvia a boronic acid.Boronic acid has previously been shown to be instrumental inthe anticancer drug bortezomib, which targets the threonineoxygen nucleophile in the active site of the proteasome.Replacing the carboxylic acid in inhibitor A with a boronicacid yielded compound HA130 (see Figure 2) with a ∼100-fold

~ 40,000small moleculesOOHHOOHBFigure 2 | Search for potent ATX inhibitors.About 40,000 small molecules have been screened.Among the validated molecules the thiazolidine-2,4-diones were well represented. The mostscreenOOSNOOoptimisation(100x increased inhibition)ONSOOpotent thiazolidine-2,4-dione, inhibitor A wasselected for further optimisation. Replacing thecarboxylic acid in inhibitor A with a boronic acidyielded a highly potent ATX inhibitor (HA130).Finhibitor AIC = 2500 nMFHA130IC = 28 nMincreased potency (IC 50 = 28 nM) compared to inhibitor A(IC 50 =2.5 μM).To investigate how ATX inhibition affects circulating plasmaLPA levels in vivo, we tested HA130 in mice. We used HPLCtandem mass spectrometry to monitor the plasma levels of LPAand HA130. Injection of HA130 into mice resulted in a rapidfall in circulating LPA levels (see Figure 3)[1]. HA130 togetherwith PF-8380, an inhibitor recently reported by Pfizer, are theonly two inhibitors to date that have been demonstrated tolower LPA levels in vivo. After validation of HA130 in mice,the position of the boronic acid in HA130 was optimised frommeta to para resulting in inhibitor HA155 with a further 5-foldincrease in potency (IC 50 = 5.7 nM).10 | NPC Highlights 15 | Harald AlbersCrystal structure In 2011 the crystal structure of ATX wasresolved independently by two groups (the Perrakis group atNKI [3] and the Nureki group at the University of Tokyo[4]).These structures confirmed that a threonine residue and twozinc ions are necessary for activity of ATX. Furthermore, thesestructures showed that ATX specifically binds its lipid substratesin a hydrophobic pocket extending from the active siteof ATX. This pocket accommodates the alkyl chain of the lipidsLPA plasma levels (µM)Vehicle HA1301.51.00.50.00 5 10 15 20Time (min)Figure 3 | In vivo validation. Injection of HA130 in mice resulted in a rapidfall of plasma lysophosphatidic acid (LPA) levels.as observed in various crystal structures of ATX. The crystalstructure of ATX in complex with HA155 obtained by thePerrakis group (see Figure 4A) confirmed our hypothesis thatHA155 targets the threonine oxygen nucleophile in the ATX activesite via the boronic acid moiety (see Figure 4B).In addition, one of the boronic acid hydroxyl moieties is tetheredby the two zinc ions in the ATX active site. Thus the boronicacid targets not only the threonine oxygen nucleophile,but also the two zinc ions that are essential for catalytic activityof ATX. Another interesting feature is the binding of thehydrophobic 4-fluorobenzyl moiety of HA155 to the hydrophobicpocket in ATX, to which the alkyl chain of the lipid usuallybinds (see Figure 4C).Now with the HA155-ATX structure in hand we were able torationally design novel boronic-based inhibitors. The mostpotent inhibitor resulting from these modifications turned outto be compound E-28 (see Figure 4D).Molecular docking In order to explain the binding of inhibitorE-28 to ATX, we decided to calculate likely binding poses [5].For this purpose, we used the Glide (grid-based ligand dockingwith energetics) docking software. With this software it is possibleto dock molecules into the active site of a protein and toevaluate the calculated binding poses of these molecules usinga scoring function. The best docking pose for E-28 suggeststhat the 4-fluorobenzyl moiety binds to a different area in thehydrophobic pocket compared to the binding of this moietyin HA155 with ATX (compare Figure 4C with 4D). This findingmay be used to design new inhibitors that fully exploit thehydrophobic pocket in ATX, opening further options for inhibitordesign[6].Promising prospects In conclusion, we discovered thiazolidine-2,4-dionesas potent non-lipid ATX inhibitors. Replacingthe carboxylic acid in the most potent thiazolidine-2,4-dionescreening hit with a boronic acid increased the inhibitorypotency tremendously. The resulting compound HA130 dramaticallylowered LPA levels in mice demonstrating that ATXis a valid target for manipulating LPA levels in vivo. Exploringstructure-activity relations building on HA155, a positionalboronic acid isomer of HA130 with higher affinity for ATX,resulted in a number of potent inhibitors. Using the crystalstructure of ATX liganded with optimised inhibitor, HA155, wewere able to rationally design novel inhibitors with high affinityfor ATX.

ABHA155Figure 4 | ATX structure and inhibitor binding.(A) Surface representation of ATX with inhibitorHA155 (magenta). (B) Binding of HA155 to thethreonine oxygen nucleophile and two zinc ions.(C) Two-dimensional representation displaying howThreonineHA155 binds to the ATX active site. (D) Schematicrepresentation of how inhibitor E-28 binds differentlyto ATX compared to HA155 based on theZinc(II)results of molecular docking experiments.CDFOHA155 ATXZincE-28N SOHOOB OFOHThreonineONNOOOHB OOHHydrophobic pocketActive siteFinally, molecular docking efforts proved useful to explainunexpected high potency of E-28 and suggested that thehydrophobic pocket near the ATX active site may be exploitedmore in future for the design of new inhibitors. Further developmentof boronic acid-based inhibitors of ATX holds promisefor therapeutic use in ATX/LPA-dependent pathologies.Harald Albers completed his PhDstudy at the Netherlands CancerInstitute in Huib Ovaa’s group(Division Cell Biology II).Thesis: Development of ATX andDUSP inhibitors,Leiden, 4 April 2012.References1 Albers, H.M.H.G. et al. (2010) Boronic acid-based inhibitorof autotaxin reveals rapid turnover of LPA in the circulation.PNAS 107, 7257-7262.2 Albers, H.M.H.G. et al. (2010) Discovery and optimizationof boronic acid-based inhibitors of autotaxin. J Med Chem53, 4958-4967.3 Hausmann, J. et al. (2011) Structural basis for substratediscrimination and integrin binding by autotaxin. NatStruct Mol Biol 18, 198-204.4 Nishimasu, H. et al. (2011) Crystal structure of autotaxinand insight into GPCR activation by lipid mediators. NatStruct Mol Biol 18(2), 205-12.5 Albers, H.M.H.G. et al. (2011) Structure-based design ofnovel boronic acid-based inhibitors of autotaxin. J MedChem 54, 4619-4626.6 Albers, H.M.H.G. and Ovaa, H. (2012) Chemical evolutionof autotaxin inhibitors, Chem Rev Epub ahead of printsummaryResearch teamNKI-AVL Amsterdam: Harald Albers and Huib Ovaa (Division ofCell Biology II), Wouter Moolenaar (Division of Cell Biology I),Anastassis Perrakis (Division of Biochemistry).ContactDr. Harald AlbersThe Netherlands Cancer Institute (NKI-AVL)Division of Cell Biology IIPlesmanlaan 1211066 CX AmsterdamT +31 20 512 1979h.albers@nki.nl| 11Autotaxin (ATX) is a secreted phosphodiesterase that hydrolysesthe lipid lysophosphatidylcholine (LPC) to producelysophosphatidic acid (LPA). The ATX-LPA signalling axis hasbeen implicated in inflammation, fibrosis, and tumour progression,rendering ATX an attractive drug target. By screening achemical library, we have identified thiazolidine-2,4-dionesas inhibitors of ATX that selectively inhibit ATX-mediated LPAproduction both in vitro and in vivo. Inhibitor potency wasincreased approximately 100 fold after the incorporation ofa boronic acid moiety (inhibitor HA130), designed to targetthe threonine oxygen nucleophile in the ATX active site. Wedesigned new inhibitors based on the crystal structure of ATXin complex with HA155, a positional boronic acid isomer ofHA130, which resulted in a highly active analogue of HA155.To understand the binding of this novel inhibitor with nanomolarpotency, we performed molecular docking experiments.Intriguingly, molecular docking suggested a remarkable bindingpose for this inhibitor, which differs from the original bindingpose of HA155 for ATX, opening further options for new inhibitordesigns. The use of crystal structures of ATX-inhibitor complexeswill aid medicinal chemistry efforts to further develop the ATXinhibitors into therapeutic agents.

Bas van Breukelen and Maarten AltelaarDatabase-independentproteomics12 | NPC Highlights 15 | May 2012While database searching is still a fast and reliable method forprotein identification, it is not applicable for un-sequencedspecies, mutations or modifications. De novo sequencing is analternative, but depending on the complexity of the spectra,accuracy is not very high. A new de novo method using acombination of fragmentation methods has improved thisaccuracy considerably. Using this method, a set of previouslyunknown peptide sequences from the ostrich has beenaccurately identified.In the field of mass spectrometry the method of choice forprotein identification is by database searching. In this techniquea recorded peptide fragmentation spectrum is comparedto a database of computer generated fragmentation spectraof peptides from in silico digested proteins. The best match isthe peptide sequence of the theoretical spectrum that showsthe largest overlap with the recorded spectrum. While thisapproach is very robust and also allows for an estimation ofa false discovery rate, it is limited by only allowing the identificationof those sequences present in a given database [1].Consequently, wrong protein annotation and mutations cannotbe found. Non-sequenced genomes are also outside the scopeof this method. Concurrently, genome sequencing has becomefaster and cheaper than proteomics experiments and more andmore (re-annotated) genomes have become available.Still, current genome databases do not tell the whole story,as they lack information on posttranslational modifications,mutations, or hypervariable proteins such as antibodies [2].Moreover, even the most well annotated genomic databases,such as that of human, E. coli and yeast still contain missedopen reading frames (genes) and wrongly annotated splice isoforms.Therefore it is of great interest to explore other methodsfor protein identification in order to be able to identifythose sequences not present in these databases, or even tobe able to find proteins in not yet (fully) sequenced species.This would require as alternative a so-called ‘database-free’method.Different approaches Direct interpretation of a fragmentationspectrum, called de novo sequencing, is such a method.This technique, however, has its limitations. It is very sensitiveto noise in a fragmentation spectrum. In addition, it dependsheavily on the complexity and completeness of the observedfragment ion series. In our lab we have devised a new methodto facilitate de novo sequencing by combining protein digestionusing Lys-N as protease with Electron Transfer Dissociation(ETD) for peptide fragmentation [3,4]. Lys-N digestion aids inthe simplification of the fragmentation spectra as it createsa basic moiety on the N-terminus that attracts the positivecharge to this side. When SCX (strong cation exchange) enrichmentof the Lys-N peptides containing only a single N-terminal

C:\What this research is about:De novo sequencingDatabases contain information about the genome sequencesof many organisms. Using the information from thesedatabases to identify proteins is usually a fast and reliablemethod. But although a large and growing amount of data isavailable in these databases, they are not complete. Not allorganisms are represented, for example the ostrich whichBas van Breukelen and colleagues from the BiomolecularMass Spectrometry and Proteomics Group in Utrecht haveanalysed. Furthermore, the data may contain mistakes,and mutations are not always included. “Therefore developinga database-free method is useful for protein identification,”explains Bas van Breukelen, NPC theme leader‘Bioinformatics in Proteomics’.Such a method, called de novo sequencing, has been in existencefor some time. But it has been shown to be accuratein only about 10% of the cases. Processes such as the loss ofa neutral molecule or the possibility of not only N-terminusfragmentation but also C-terminus fragmentation all createvery complex spectra. “I am convinced that one can reducethis complexity by carefully designing an experiment,” saysVan Breukelen.The researchers bought an ostrich steak at the butcher andprepared it using a novel enzyme called Lys-N. They then applieda combination of two different methods for fragmentationof the peptides (ETD and CID) and analysed these usingNPC E4: Bioinformatics in Proteomicsmass spectrometry. The result was less complex data whichcould be fed into a computer algorithm for de novo sequencing.A set of 2,744 new peptide sequences were identified.Since there is no database available for the ostrich proteome,Van Breukelen and colleagues had to devise anotherway to prove the accuracy of the results. They compared theset of peptides against the evolutionary Tree of Life, fromwhich the step on the evolutionary ladder of the organismcan be determined. The set of peptides was shown to belongto a bird, proving the accuracy of the analytical method.“We have doubled the accuracy of the de novo sequencing,”claims Van Breukelen. A patent has been filed on this method.“We are now investigating whether commercial partnersare interested.” In the meantime, higher resolution massspectrometers and a better visual interface will improve theapplicability of this database-free sequencing method.| 1327,067 CID spectraSCX fractions27,071 ETD spectraDe novo peptide sequence libraryNoise filtering, 11,183 spectraDe novo interpretation, 33,694,987 solutionsRemove redundancy, 5,765,043 unique solutions27,067 CID spectra 27,071 ETD spectra220,722 CID matches 217,017 ETD matches2,744 de novo peptides (0.7% FDR)Scoring through established algorithmFilter against predicted de novo scan numberAccept only ETD/CID matches with the samesequence and the same precursor, 8,890 matchesChoose top ranked ETD/CID solutionsFigure 1 | Schematic overview of the de novo pipeline. The entire processresulted in 8,890 de novo peptide solutions that represent an agreementbetween Mascot and the de novo algorithm as well as an agreement betweenETD and CID. Collapsing the data further led to 2,744 unique non-redundantpeptide sequences.lysine is followed by ETD fragmentation, spectra with singlec-ion series and hence easily interpretable sequence laddersare produced.This approach was shown to work very well in a proof ofconcept [4]. However, it also revealed that a large proportionof the fragmentation spectra still had gaps in their sequenceladders. These gaps in turn pose a challenge, as thousandsof possible amino acid combinations can complete a givengap, thereby creating an ambiguity. To tackle this issue, eachpeptide was sequenced by both ETD and CID (Collision InducedDissociation). The de novo algorithm subsequently generateda library of all possible peptide solutions to any sequence gapstogether with decoy (scrambled) sequences and fed these intothe database search software, Mascot [5].Complementary fragmentation techniques The processof the de novo pipeline is depicted in Figure 1. After Lys-Nprotein digestion and SCX enrichment of peptides containinga single N-terminal lysine, a nanoliter flow liquid chromatographyseparation and a mass spectrometric analysis areperformed. Each peptide is sequenced using the fragmentationtechniques ETD and CID. The resulting spectra are subsequentlyread into the de novo algorithm, which performs noise fil-

Figure 2 | Phylogenetic analysis of the peptide dataset generated by the de novo approach.(A) Ensemble Compara-based alignment of concatenated denovo identified peptides (peptides are separated by X) withthe sequence of four selected species at different evolutionarydistance, i.e., chicken, zebra finch, lizard and human. Becausethe de novo approach cannot distinguish between isoleucine andleucine, I is changed to L. All ostrich derived de novo peptidesthat map uniquely to a protein in one or more of these speciesare selected, and of these peptides the subset that mapped toa protein with exactly one orthologous sequence in the otherspecies was used for the alignment. (B) Maximum likelihoodtree of the concatenated multiple sequence alignments ofthe selected peptides with their orthologs. There was highbootstrap support for the distinct avian branch (67%), as wellas for the distinct differentiation within the avian branch(85%). (C) Negative control. Maximum likelihood tree of theconcatenated multiple sequence alignments of the selectedpeptides with their orthologs after randomising the order ofthe residues in the peptides of our species of interest. Therewas high bootstrap support (85%) for incorrectly placing ostrichwith lizard. (D) ETD MS/MS spectra of two different forms of theostrich phosphopeptide KGILAADESTGSIA clearly revealed the sitelocalisation capabilities of this approach with a clear distinctionbetween the isobaric phosphopeptides KGILAADESTGpSIAand KGILAADEpSTGSIA. (E) ETD MS/MS spectra of two lysineacetylated peptides from the protein ostrich l-lactatedehydrogenase A chain, the human homologue of which is knownto be heavily decorated with lysine acetylations.(F) Sequence alignment of these peptides from ostrich withseveral other species showing the acetylated lysines (in red),the high conservation of the lysine found to be acetylated in ourstudy and a novel point mutation (in green).on an as yet to be fully sequenced genome. At the same time14 | NPC Highlights 15 | Bas van Breukelen a human cell line (HEK293) was also examined in a similartering and de novo interpretation. From approximately 27,000ETD spectra, this process resulted in more than 5.5 millionpossible sequence solutions for 11,183 spectra. The algorithmoutput consists of a library of all possible peptide solutionsalongside the coordinates of the parent spectrum. To retrievethe best match between the ETD fragment spectrum and itsreported de novo sequences, the de novo sequence library,alongside a decoy library of equivalent size, is uploaded intothe identification engine Mascot, which then performs its ownmatching process on the ETD data.To further diminish false positive identifications, the pairedCID data are also matched by Mascot against the de novo solutions.The resulting matches are then filtered such that onlyresults for an ETD spectrum obtained by Mascot originatingfrom a de novo solution for the same spectrum are acceptable.The paired CID scan must also match the same solutions.If multiple solutions match both the ETD and CID scans, thetwo scores for the same solution are combined and the highestrankingresult is taken forward. In this way we can exploit thecomplementarity of the two fragmentation techniques. Theentire process resulted in 8,890 de novo peptide solutionsthat represent an agreement between Mascot and the de novoalgorithm as well as an agreement between ETD and CID.Collapsing the data further led to 2,744 unique non-redundantpeptide sequences.Phylogenetic analysis We have applied our novel de novomethod to an ostrich meat sample to show its applicabilitysetup and was used to investigate the de novo performance incomparison with a conventional database searching approach.From the ostrich sample we were able to identify 2,744peptides. However, since no protein database was available,it was impossible to determine the exact level of accuracy.To address this concern and to obtain confirmation of theaccuracy of our results, we performed a phylogenetic analysisbased on 900 peptides that were identified with full backbonesequence coverage. This analysis showed the correct placementof ostrich in the tree of life as provided by the NationalCentre for Biotechnology Information (NCBI), thereby confirmingthat the obtained peptide sequences were very likely to becorrect (see Figure 2).Based on the human cell line sample, we were able to determinethat our de novo approach showed results similar toExperimental[M+2H] 2+KPGAVGLDLGTTY[M+2H] 2+KAAALGLDVATTY[M+2H] peptide 2+ KPCLAGLTEDENQc10c11 c12c9c11c8c6c8c11 c12c7c10c7c3 c4 c5 c6c8 c10c5c6c3 c4c3 c4SyntheticpeptideFigure 3 | Comparative assessment of three ETD fragment spectra originating from the humanHEK293 sample and their synthetic de novo constructed peptide sequences. Synthetic peptidesof the de novo predicted peptide sequences, unknown by IPI, were constructed and analysed byETD. The resulting fragment spectra are largely indistinguishable from the HEK293 experimentalpeptide spectra.

a database search even though a lower number of peptideswere identified (1,097 from de novo and 2,900 from databasesearching), of which 25% had an identical match. Strikingly,we also identified a significant number of de novo predictedpeptides that had a poor or even no match after databasesearching in the human protein sequence database. Alignmentsearches of the de novo predicted peptides did not result inhits on similar proteins. To rule out the possibility that thesepeptides are artefacts of the algorithm, a set of artificialpeptides based on the de novo sequence were obtained,fragmented by ETD and recorded. The resulting ETD fragmentationspectra were largely indistinguishable from the HEK293experimental peptide spectra. This suggests that the predictedpeptide sequences are real but not present in current highquality databases (see Figure 3).Broad applicability The results show the quality of thede novo sequencing approach. It is clear that by relying onthe sequence databases alone one may miss peptides andproteins that would be found with our ‘database-independent’approach. The technique is obviously useful in the case oforganisms that are extinct or for which researchers havenot yet compiled protein databases. More broadly, suchapproaches could prove handy as proteomics moves towardtaking into account more phenomena like post-translationalmodifications, mutations, and highly variable protein regions.Two areas in which a direct great benefit is expected are theanalysis of post-translational modifications and the analysis ofantibodies, which have highly variable regions that actuallydetermine their affinity for antigen. Some of the peptideswe identified that were not in the current databases wereactually caused by single mutations in the database or in thesequence compared to the database.Technological advances Advances in mass spectrometrytechnology are expected to lead to improvements in thistechnique. As mass spectrometers become faster and moresensitive, the method could prove more and more useful. Theresults of this study were published recently in PNAS [6]. Thedata in this study were generated using a Thermo ScientificOrbitrap XL; however, newer machines like the Orbitrap Velosor the Orbitrap Elite could both speed up the method andimprove the accuracy of its identifications.In proteomics experiments, protein identification currentlyrelies very heavily on genome databases. Although the numberof databases is increasing many of them are still not well annotated.In future one just might want to rely on the proteomicsdata alone.References1 Sadygov, R. G., Cociorva, D.,Yates, J. R. (2004) Large-scaledatabase searching using tandem mass spectra: looking upthe answer in the back of the book. Nat Methods, 1 (3),195-202.2 Castellana, N. E. et al. (2010) Template proteogenomics:sequencing whole proteins using an imperfect database.Mol Cell Proteomics 9 (6), 1260-1270.3 Taouatas, N. et al. (2008), Straightforward ladder sequencingof peptides using a Lys-N metalloendopeptidase. NatMethods 5 (5), 405-407.4 van Breukelen, B. et al. (2010) LysNDeNovo: an algorithmenabling de novo sequencing of Lys-N generated peptidesfragmented by electron transfer dissociation. Proteomics10 (6), 1196-1201.5 Kim, S. et al. (2010) The generating function of CID, ETD,and CID/ETD pairs of tandem mass spectra: applications todatabase search. Mol Cell Proteomics 9 (12), 2840-2852.6 Altelaar, A. F. et al. (2012) Database independent proteomicsanalysis of the ostrich and human proteome. Proc NatlAcad Sci U S A 109 (2), 407-412.Research teamBas van Breukelen, Maarten Altelaar, Shabaz Mohammed and AlbertHeck from the Biomolecular Mass Spectrometry and ProteomicsGroup, Utrecht University.ContactDr. Bas van BreukelenKruytbuildingPadualaan 85384 CH UtrechtT +31 30 253 9761b.vanbreukelen@uu.nl| 15summaryIn proteomics identification of proteins and peptides thathave not yet been annotated is a challenge. Peptides, theproteolytically digested protein products, are fragmented andrecorded in a mass spectrometer. These are then comparedto theoretical in silico generated mass spectra derived fromprotein databases. Protein identification in MS relies heavilyon these protein databases, which are derived from thegenomic annotation of sequenced organisms. The databasesearch technique is robust; however, it presents a caveatwhen the organism under investigation does not yet havea sequenced or well-annotated genome. To put it simply,anything not present in a sequence database will not beobserved, or will be missed, by the database search approach.To tackle this limitation direct interpretation of afragmentation spectrum can be employed in a so-calledde novo sequencing method. This technique, albeit verypowerful, is hampered by the complexity of a fragmentationspectrum where multiple fragment ion series overlap andwhere gaps in a sequence ladder cause ambiguity in thepredicted peptide sequences. By employing the proteaseLys-N along with Electron Transfer Dissociation (ETD) and crossvalidation with conventional database search strategies, wewere able to address the above-mentioned concerns. We haveemployed our novel strategy on an ostrich sample and wereable to identify over 2,500 unique de novo peptide sequences.Based on these peptide sequences, we were moreover able tocorrectly place the ostrich in the evolutionary tree.

Karin Wolters, Hjalmar Permentier and Rainer BischoffTargeted proteomics as atool to study aging in yeast16 | NPC Highlights 15 | May 2012Targeted proteomics is a good alternative to discoverybasedproteomics since it can improve the level ofdetection and quantification by measuring just the proteinsof interest. The method described here was developed inorder to study alterations in proteins involved in specificmetabolic pathways in ageing yeast covering a wide range ofconcentrations. The results will be used to develop assaysfor other organisms, such as mice or humans.Ageing can be described as a process where deleteriouschanges in cells result in the loss of the organism’s functionalcapacity over time. In the budding yeast Saccharomycescerevisiae, these progressive ageing effects are not passed onto the daughter cells due to asymmetric cell division, whereinthe mother cell ages while the daughters have full replicativepotential. Each individual mother cell can generate around20-40 daughter cells before it dies. Accumulation of proteinsin mother cells due to the asymmetric cell division has beendescribed for proteins that are affected by oxidative stressand dysfunctional mitochondria [1]. Analysis of a large rangeof proteins will not only yield information about the accumulatedproteins in the mother cells but will also offer insightsinto cellular or enzymatic pathways that may be affected.The study of the proteome of organisms has mainly beendone using discovery-based proteomics by mass spectrometry,usually with shotgun proteomics techniques. In this approachthe proteome of interest is digested with a specific proteaselike trypsin and the resulting peptide mixture is fractionatedin one or multiple (LC) steps prior to MS/MS analysis for identificationand quantification purposes. In this way thousands ofproteins have been identified in prokaryotes and eukaryotes.However, proteomes are never detected completely. This ispartly due to the bias of the discovery-based proteomics tofocus on the highest signals, which are preferentially selectedfor fragmentation and subsequent identification and quantitation.Targeted proteomics is a good alternative approach toimprove the dynamic range of detection and quantification byspecifically selecting only the proteins of interest [2,3].Targeted workflow Targeted proteomics uses selected reactionmonitoring (SRM) assays on a triple quadrupole massspectrometer to specifically measure the proteins of interest.All measurement time is focused on these proteins alone,thereby avoiding the bias for the highest signals. The SRMmethod is used extensively as the standard approach for smallmolecule quantification, but has only recently been implementedfor protein mixtures. The general workflow is depicted

What this research is about:The cellular biology of ageingAgeing is a phenomenon of every living being, from singlecells to complex higher organisms. Certain biological mechanismsrelated to ageing have been preserved throughoutevolution and are quite common to all organisms. “We wouldlike to understand how ageing affects fundamental metabolicpathways at the protein level. Since metabolic pathways inyeast, mice and humans are rather similar, we can start tostudy this in yeast. Yeast is a single cell organism that can begrown easily and under controlled conditions. It is also wellstudied from a molecular biology point of view, so the resultscan be more easily interpreted from a systems biology pointof view,” according to professor Rainer Bischoff, NPC themeleader ‘New Separation and Enrichment Tools in Proteomics’.In this article the authors describe their new approach tomeasuring the proteins of certain metabolic pathways selectively.“We developed the methodology to study all individualproteins of these pathways together and to see whethertheir amounts change under different conditions of ageingor stress. Therefore we measure protein levels in differentyeast samples that aged in various ways,” explains HjalmarPermentier, head of the Mass Spectrometry Centre. “The bigchallenge is to quantify these proteins as accurately as possiblein complex mixtures.”Yeast cells age when they produce offspring (replicative ageing)according to Karin Wolters, a postdoctoral researcher atthe Systems Biology Centre in Groningen. When a yeast cellbuds, the produced daughter cell shows no ageing effects,while these effects accumulate in the mother cell. “To studyageing in yeast we look specifically at the mother cells. Inthe near future we are going to study aged mice with differentfeeding patterns and physical activity to mimic some ofthe life style effects that affect ageing and health in higherorganisms,” says Karin Wolters. “Our questions are veryfundamental, but by understanding the effects of ageing oncellular biology we hope to gain a better understanding onhow to age healthily.”| 17NPC E1: NPC New T2: Separation Proteome and Biology Enrichment of Plants Tools in ProteomicsFigure 1 | Selected Reaction Monitoring. Targeted proteomics uses selected reaction monitoring (SRM) assays on a triple quadrupole mass spectrometer to specifically measurethe proteins of interest. Protein mixtures are digested in the same way as in the discovery-based proteomics workflowsin Figure 1. Protein mixtures are digested in the same way asin the discovery-based proteomics workflows. One-dimensionalLC separation of the peptide mixtures is usually sufficient evenin complex samples, due to the focused detection of the targetproteins. Long gradients can be used to reduce ionisationsuppression due to co-eluting peptides in complex proteomes.Prefractionation is still advisable for analysis of classes of lowabundance proteins such as membrane proteins. High specificityand sensitivity is reached in the two selection steps thatare performed in the mass spectrometer.The peptide of interest is selected in the first stage of the MS,fragmented in the second stage and specific fragments areselected in the third stage (see Figure 1). The double selectionsteps decrease the effects of sample complexity and ofbackground interference in the measurements. An increasein speed due to advances in both MS hardware and softwarenow allows the (scheduled) measurement of hundreds ofmultiplexed SRM assays in a single LC run. This has been anextremely important development for targeted proteomicsin complex samples, since peptides are usually monitored by

Figure 2 | Targeted proteomics. (A) Definition of time windows in scheduledSRM. Each peptide elutes at a specific retention time and therefore eachpeptide is only measured across a narrow time window. (B) Relative quantificationof the targeted peptides. An example of how the relative concentrationof a peptide that decreases over time can be quantified using the ratioto a reference mixture added at equal concentrations to all samplesmultiple fragments to further increase specificity, and multiplepeptides per protein are followed to increase the confidenceon the protein level.Assay development Clear advantages of targeted proteomicsare a decreased need to reduce sample complexity and theincreased dynamic range over which proteins can be detectedand quantified. However, the development of assays requiressubstantial effort compared to the discovery-based proteomicsapproaches. For the development of assays three steps needto be performed, namely protein target selection, selection ofsuitable peptides and selection of the peptide fragments that18 | NPC Highlights 15 | Rainer Bischoffwill be monitored. Selection of the protein targets is crucial,because no information will be gathered outside the selectedtargets (in contrast to discovery-based proteomics).Multiple peptides (3-5) are preferably used for each targetprotein. These peptides are selected taking into account thatthe peptides have to be unique for the protein target (proteotypic)and that they are suitable for (reversed phase) LC separationand MS detection (MS signal response, size, charge). Foreach peptide, the best peptide fragments (3-5) are then selectedfor identification and quantification. The best peptideand peptide fragment combinations within the workflow canbe determined using synthetic peptides, but information canalso be obtained from (public) MS/MS data repositories. Publiclibraries like the NIST library (http://peptide.nist.gov) andPeptideAtlas (www.peptideatlas.org) contain MS/MS spectrafor several organisms.Separation of complex peptide mixtures on the LC columnincreases the number of peptides that can effectively bemeasured in a single run. Each peptide elutes at a specificretention time (based on its physico-chemical properties, thetype of column and type of gradient) and therefore each peptideis only measured across a narrow time window (see Figure2A). In modern triple quadrupole mass spectrometers, dutycycles are sufficiently fast to monitor 150 peptide fragmentsconcurrently.Relative quantification Stable isotope labelled syntheticpeptides (heavy peptides) have to be spiked (added to thesample) for quantification of the peptide concentrations incomplex samples. The heavy peptides will have the sameretention times and ionisation properties as the target (light)peptides and can therefore be used to correct for variationswithin the method and for matrix effects. However, synthesisof individual peptides will become costly for large numbers oftargets.Alternatively, relative quantification can be used. Relativequantification is well suited for studying replicative ageing,since we want to compare the mother cells after various numbersof replication cycles. Figure 2B shows an example of howthe relative concentration of a peptide that decreases overtime can be quantified using the ratio to a reference mixtureadded at equal concentrations to all samples. As referenceyeast cells were grown with a 15 N nitrogen source and thesecultures are used for spiking. Careful consideration is requiredto create an appropriate reference sample which contains allproteins of interest in 15 N-labelled form. In our case we haveharvested yeast cultures at different growth phases (exponentialphase, cells after diauxic shift and cells that are in thestationary phase) to create a global internal standard.Cellular processes Targeted proteomics is especially suitableto comprehensively study alterations in all proteins involved inspecific pathways which can show a large range of concentrations[4]. In a collaborative project within the Systems BiologyCentre for Metabolism and Ageing (SBC-EMA) in Groningen,we will combine the obtained protein levels with measurementsof metabolite levels as well as the determination of theage-associated phenotype at the single cell level. Currently,assays have been developed for about 350 proteins, whichcan be detected with 3-5 peptides each. The proteins werechosen to cover all biological processes as described by theirGene Ontology function and included proteins that have beendescribed in the literature as being affected during ageing.The application of targeted proteomics to the study of cellularprocesses is illustrated in Figure 3. Here, 54 proteins thatare involved in glycolysis and gluconeogenesis were targetedin yeast cultures grown to mid-exponential phase, after thediauxic shift, and at the stationary phase. Proteins werequantified relative to a digested reference standard createdby combining cultures grown with a 15 N nitrogen source andharvested at these three phases. The concentration of severalproteins shows a clear dependence on the growth phase.

Even more interesting is the different behaviour of variousisoenzymes, as is observed, for example, for the phosphoglucomutasesPGM1 (YKL127W) and PGM2 (YMR105C) in the upperpart of Figure 3.From yeast to mice The methods described above werespecifically developed for yeast proteins. However, similar approachescan be adopted to create assays for other organisms,as long as sequence information (and preferably MS/MS information)is present or can be obtained experimentally. We arecurrently developing assays to measure the effect of ageing inthe mouse proteome.References1 Partridge, L. (2011) Some highlights of research on ageingwith invertebrates 2010. Ageing Cell 10 (1), 5-9.2 Domon, B. and Aebersold, R. (2010) Options and considerationswhen selecting a quantitative proteomics strategy.Nature Biotechnology 28 (7), 710-721.3 Lange, V. et al. (2008) Selected reaction monitoring forquantitative proteomics: a tutorial. Molecular SystemsBiology 4 (222), 1-14.4 Picotti, P. et al. (2009) Full dynamic range proteome analysisof S. cerevisiae by targeted proteomics. Cell 138 (4),795-806.| 19Figure 3 | Metabolic pathways in yeast measured with targeted proteomics. Relative proteinconcentrations in yeast cultures at various growth phases for proteins involved in the glycolysis andgluconeogenesis pathway (according to the KEGG database (www.kegg.jp)). The three coloured blocksindicate the ratios of the ( 14 N) mid-exponential growth phase (14M), the diauxic shift (14D) and thestationary phase (14S) versus the ( 15 N) standard culture. Ratio colours range from dark red (2) indicatingthat the protein is abundant.Research teamUniversity of Groningen: Karin Wolters, postdoc at theSystems Biology Centre; Hjalmar Permentier, head of the MassSpectrometry Centre; and Rainer Bischoff, chair Analysis ofBiological Macromolecules.ContactProf. Dr. Rainer BischoffGroningen Research Institute of PharmacyAnalytical BiochemistryAntonius Deusinglaan 19713 AV Groningen, the NetherlandsT +31 50 363 3338r.p.h.bischoff@rug.nlsummaryTargeted proteomics has great potential for studying thechange of protein levels in biological processes more robustlythan discovery-based proteomics. The presented example ofprotein abundances in the yeast glycolysis pathway in variousgrowth phases illustrates the wealth of information that canbe obtained. These data will be combined with metabolomicsdata and single cell analyses to create a more comprehensiveimage of replicative ageing in yeast in a systems biologyapproach. Our study of the changes in protein levels duringreplicative ageing in the mother cells is part of a concertedeffort to study the molecular mechanisms of replicativeageing at both the single cell and the population level at theSystems Biology Centre for Metabolism and Ageing (SBC-EMA,one of three national systems biology centres funded bythe Netherlands Organisation for Scientific Research). Dataon protein and metabolite levels are obtained by MS-basedtargeted proteomics and metabolomics. This approach will beextended to study the effect of environmental conditions suchas dietary changes and other stress conditions.

Popular Science Writing ContestNPC challenged PhD students to write a popularscientific article about their research. Eight PhDstudents participated in the contest. During the2012 NPC Progress Meeting the three winners wereawarded the Popular Science Award. The winnerseach received a cheque of 1000 euros and honorarypublication of his or her article in this issue of NPCHighLights.Christian Frese, Alba Cristobal and Suzanne de Bruijnpresent their winning essays.Unravelling the ABCs of messengers in the brainMany people in poorer parts of the world are starving becausethey don’t have enough food. In the western world, itis the other way around. Nowadays more and more peoplesuffer from extreme overweight, which doctors call obesity.To present, it is not exactly clear what causes this disease.Christian FreseThe key to obesity is hidden in the brain. Our brain regulatesmany important features, for example how we feel pain, howwe learn and what things we remember. And it also regulateshow much food we eat. When a healthy person has lunch, his20 | NPC Highlights 15 | May 2012brain will tell him: ‘Stop eating; you’re full. You have hadenough!’ After a couple of hours the stomach is empty andthe brain again signals hunger. When this happens, thoughtsof something sweet or salty most immediately come to mind.In obesity something is wrong with this regulation: you alwaysfeel a bit hungry no matter how much you eat. This disordermakes you eat more than you need, resulting in more andmore weight gain over time.send many different neuropeptides, each one of which has adifferent meaning: some make you feel hungry; others makeyou feel full.You can compare the regulation of food uptake to the trafficlights at an intersection: the traffic lights control which carsare allowed to drive through. Normally, the red and greensignals switch in sequence and simultaneously the roads havedifferent colours, meaning the cars on one road have to stopwhile the other cars can go. The same happens in the brain.The cells send either neuropeptides that increase the feelingof hunger and stimulate the uptake of food or they releaseneuropeptides that have the opposite effect. In obesity theneurons are somehow confused. They don’t send the right signalsat the right time and they don’t understand one anotherin the normal way.Figure 2 | In scrabble you can use thesame letters to put together differentwords. The same happens with peptides.We can only see the order of the aminoacids when we fragment them.Traffic lightsBut how does the brain decide whether we feel hungry or not?The cells in our brain are called neurons; they use neuropeptidesto interact with other cells. Neuropeptides are smallmessengers that help the cells talk to each other as well ascommunicate with other parts of our body. The neurons canFigure 1 | Neuropeptide research is like playing scrabble.Playing scrabbleBut how can we study these tiny molecules we can’t evensee with the naked eye? Neuropeptide research is like playingscrabble (see Figure 1). Peptides are built from so-calledamino acids, just as words are made up of letters. The alphabethas 26 letters we use to spell all our words. Peptides areput together from 20 different amino acids and can have up to100 amino acids in a row.The neuropeptides are of all different sizes, so we measuretheir weight in order to identify them. Each amino acid has adifferent weight. The total weight of each peptide depends onwhich and how many amino acids are put together. When twopeptides have the same weight things can get a bit trickier,just as when you have the letters for DOG and GOD whenplaying scrabble (see Figure 2). Both words have the samethree letters and the sum of the numbers is the same, but theorder of the letters is different and the words have different

meanings. Two peptides have the same weight when they aremade from exactly the same amino acids, even if the aminoacids are in a different order. We have to cut the peptides intosmaller pieces to identify them; we say we have to ‘fragment’them to help us to see how the amino acids are sorted. For example,we fragment a word and just see some smaller pieces,say ES, T and NO. From the letters in these fragments we canspell the words NOTES or STONE. Let’s have a closer look atthe fragments: we see that E and S are joined together. Thismeans that STONE is not the word we are looking for: NOTESis the only word possible here because the letters E and S arenext to one another in that order!Not in the dictionaryThe neuropeptides are very special peptides. They are likewords that you cannot find in a dictionary; like words thathave a letter from a foreign language. And this is what makesit so difficult to identify them. You have to play around withthe fragments to find the right order of the amino acids.In our research we try to find the right spelling for neuropeptidesthat might play a role in obesity. Once we know whichneuropeptides are in the brain, we try to find out which onesare different in the case of obesity. To do so we look at neuropeptideswe extract from rats. Some rats eat normal food whilea second group gets only fat and sugar. After two weeks the ratsfrom the second group weigh a bit more than the rats that haveeaten normal food, and they are hungrier as well. These ratsare a good model for studying obesity. We hope to find someneuropeptides that we can only see in the fat rats but not inthe rats that get normal food. Perhaps we will also find thatsome neuropeptides in obesity are ‘spelled’ differently.Unravelling the mysteryThe first step in our research is always studying the ABCs ofthe neuropeptides. If we understand how the messengers inour brain are put together, hopefully we can unravel the mysteryof the language of the cells in the brain.Christian Frese (Germany) received his MScdegree from Ruhr University in Bochum in2009. He then moved to Utrecht Universityand joined Albert Heck’s Biomolecular MassSpectrometry and Proteomics Group as aPhD student. He works on the developmentof new peptide fragmentation tools tostudy for example neuropeptides, smallmessengers in the brain, and their role inobesity.Research into flowers: Comparing apples and oranges?Almost everyone associates flowers with certain emotions.For example, on Valentine’s Day they can’t get in enoughred roses, and we associate them with love. And as soonas the first snowdrops and crocuses are out, we feel thatspring has come. All these flowers differ in terms of colour,shape and size, and yet they are all designed in the sameway, with petals, sepals, stamen and a pistil.Suzanne de BruijnHow is it possible that the blueprint for all flowers is the sameand yet the flowers all look so different? In my research I amgoing to investigate that question. The master regulators thatspecify where a petal comes or where a pistil is conservedare the same in each species. However, these regulators turnother genes on or off; which genes those are differ in eachplant. This entire blueprint of regulators and targets is calleda network, and the details of the network are different ineach species. You can compare this to two companies thatboth have the same management yet each produce somethingcompletely different.Changing networksI want to know what changes in a network to form a flower sothat it looks different. To be exact, how does the network thatis controlled by conserved factors change? Does the functionof genes change, and does the plant look different as a result?Or do the genes remain the same but carry out their task ata different time or place? Again, you can compare this to acompany. The manager stays the same but he can still arriveat a different result, for example by giving employees differenttasks or by employing new staff. By looking at how thesekinds of networks in plants are designed, and how they havechanged in different plant species, I want to find out moreabout the evolution of flowers.The networks in plants (but of course also in animals) areformed by genes and their products, proteins. Each gene is alink in the network and each protein has a specific function. Tochange the appearance of a flower, something in this networkhas to change. However, we don’t know yet what has tochange. You might only have to turn a single gene on or off tochange the network, but equally, you might have to alter theactivity of 100 genes to have a flower look different. It couldalso be that you can’t turn a gene on or off at all but that youmake a bit more or a bit less of the protein. If we understandhow the networks in flowers change, we will better understandhow other networks in organisms work.Locks and keysWe don’t know how many changes are needed in a networkto change a flower. What we do know is how the network canchange. Given a different function, a protein can bring aboutchanges in the network. Another option is that the protein isFigure 1 | The blueprint for all flowers is the same and yet the flowers all lookso different.| 21

Fishing out DNAAs said above, transcription factors and promoters can becompared to keys and locks. There are a couple of transcriptionfactors that are specific to flowers. These have remainedthe same in the various plant species. However, the promoters(the locks) are different in each species. As a result, there arecertain genes in a species that cannot be turned on or off withthe key, while the key will fit the lock in another species. I amstudying how these locks have changed. I do this by extractingFigure 2 | Flowers are allDNA with the transcription factors attached from plants anddesigned in the same way,with petals, sepals, stamen cutting the DNA into pieces. I then fish out the transcriptionand a pistil. The various plant factors, the keys, from that DNA mixture. Bits of DNA stay attachedto these keys, and these are the locks. What I actuallyorgans are clearly shown in theArabidopsis (photo).do is fish out bits of DNA and then decide to which genesthese bits belong. I do this not in a single plant species but inno longer made, or that it is made earlier or later on, or in a various species. By comparing the genes I fish out, I can seedifferent quantity. Now how can you turn genes on or off? A which locks have remained the same in the various plants, andgene is made up of two parts. There is a part that is translated which locks have changed. That way, I know which links in theinto protein and a part that regulates where and when the network have changed.gene is translated. This part is called the promoter. The promoteris therefore like an on/off switch for the gene. Proteins Useful?that ensure that the gene is translated bind onto the gene’s Research into flowers. What’s the point exactly? This studypromoter (the switch). These regulators are called transcriptionfactors.this knowledge to make rice more nutritious, for instance, orteaches us how the networks in plants can change. We can useYou can compare transcription factors and promoters to keys to make potatoes immune to a particular fungus. But we can,and locks. A transcription factor is a skeleton key that fits a of course, also use this knowledge to enlarge the number ofnumber of locks. A promoter can be compared to a lock. A flower varieties!transcription factor can only turn a gene on or off if it recognisesthe gene; if the key fits the lock, as it were. Because therebecame aware of flower researchSuzanne de Bruijn (The Netherlands)are several keys and even more locks, you get an entire network.Highlights If one of the 15 locks | May is changed, 2012 the key no longer fits. Thisdoing her Master’s degree andfor the first time when she was22 | NPC shechanges the network and hence the outcome of the network:was immediately enthusiastic. Shewent on to write her own researchthe shape of the flower. You can compare this to the hierarchyplan and won a grant to do doctoralin a company; all employees have a specific job but it is theresearch. In October 2011 sheboss who tells them when and how to do their job exactly. Afterstarted as a PhD student in Gercoa reorganisation, a manager may suddenly manage differentAngenent’s Molecular Biology grouppeople, or employees may be given different tasks.at Wageningen University.The secret ingredients of scienceWhat does a computer represent to you? For students it hasbecome an indispensable tool for writing reports, preparingpresentations, searching for information via the Internetand so on. In the same way, scientists need tools for theirresearch. Like computers, which are smaller and fasterthan ever before, these tools are being further developedto achieve better results.Proteins are responsible for many of the changes our organismgoes through. The question is: how can we study theseproteins to better understand our body? In order to access theAlba CristobalMy research aims to develop improvements in the tools for studyingproteins. Since this type of work is not usually highly visible,let me take you on a trip to my field of research. Here you willdiscover the difficulties we encounter and you will learn thesecret ingredients leading to the best solutions (see Figure 1).Figure 1 | Scientists need to discover the secret ingredients for solving the problemsthey encounter.

proteins involved, we have to chop these complex compoundsinto pieces. The fractions obtained are called peptides; theseare simpler and easier to investigate. Nowadays, mass spectrometryis the tool used most often for protein and peptideanalysis, but it is not possible to analyse real samples consistingof complex mixtures directly. A previous separation step isnecessary and that is where my research begins.The heart of the techniqueThe technique used for separating the peptides is liquid chromatography(LC). The most important part of this instrumentis the column, which is also called ‘the heart of the technique’.You could ask, what is this column? How does it separatethe peptides? The column is a very narrow tube filled withreally small particles. The peptides go through the columnmoved by a liquid stream and interact with these particles.Some peptides are attracted by the column particles morestrongly than others resulting in slower transport. Seperationof the peptides has been based on these different speeds.The column particles involved are extremely small spheres.To give you an idea: a grain of salt used in the kitchen has adiameter of 1mm. The particles inside the column are approximately300 times smaller with a diameter of 3.0 µm!High pressureOf what importance is my research if everything to this pointis known? The idea is that by using smaller particles, forexample 1.8 µm instead of 3.0 µm, the final separation will beimproved. The development of a new LC system applying suchsmaller particles is what we target. But how much differencecould there be between 3.0 µm and 1.8 µm? What would constitutesomething new? To answer these questions you need toknow that the column diameter measures 50 µm, comparableto the thickness of a hair. The problem with these small sizesis that enormous pressure is necessaryto transport the peptidesthrough the column. If with the3.0 µm particles the pressuremeasures about 300 bar, withthe 1.8 µm particles a pressureof approximately 1000 bar isnecessary. Keep in mind that thepressure on the wheels of a carFigure 2 | Pressure of a wheel is about 2 bar;is only 2 bar! (see Figure 2)pressure that the UHPLC can handle amountsA pressure of 1000 bar is really1200 bar.high; developing an instrumentthat can handle such pressureis not easy. A few researchers have tried to modify existinginstruments to withstand extremely high pressures. However,we opted to launch a new instrument, called UHPLC (Ultra-HighPressure Liquid Chromatography). Apart from handling higherpressure (up to 1200 bar), UHPLC is not very different fromusual HPLC (High Pressure Liquid Chromatography), which canreach maximum 400 bar.The real workNow that we know what we want to do, let´s get down towork. The first thing we need to do is prepare a column.Several companies sell them, but they are quite expensive.Luckily in our group there is a person highly experienced inthis task, so we decideto make the columnsourselves. Filling a reallynarrow column with suchsmall particles is not easy(see Figure 3): a greatdeal of experience, technique(to make the particlesgo inside the column)and time are required.Imagine looking through amicroscope at how a tube,as narrow as a hair, isfilled with particles 1000times smaller than a grain Figure 3 | Zoom in on the particlesof salt! These particles inside the column (left). Keep in mindthat the diameter of the column isstop, get blocked, then bysimilar to the thickness of a hair.utilising some tricks, weget them to move again.In fact, a whole day is needed to pack a column of 40 cm inlength with 1.8 µm particles. Using 3.0 µm particles it is mucheasier: we can make up to four of those per day. To quote aSpanish proverb: ‘Patience is the mother of science.’ You canimagine out how much patience is needed.As working with the small 1.8 µm particles is new, we need tostudy many parameters to get the best results. The speed ofthe liquid that transports the peptides through the column isone such parameter. When we use the 3.0 µm particles, speedmakes a difference. However, in our case using the 1.8 µmparticles, we find that applying different speeds, varying from50 to 200 nL/min, leads to similar results. As you can see, thespeed is quite slow, on the order of nanoliters. To fill a 1.5 lbottle of water at such slow speed we would need more than28 years! Many studies have demonstrated that this low speedis the best one for this type of analysis.The moment of truthAfter studying some more parameters and optimising themethods, the moment of truth has arrived. Do we identifymore peptides and proteins with this new UHPLC system thanwe did before using the HPLC system? Yes, we identify 30%more! So, after quite some time, effort and patience, wefinally get what we wanted. These are the secret ingredientsas indicated by the question in Figure 1. When you buy a newcomputer, it can take a bit of time for you to get used to itand benefit from all the advances. The same is true for proteinanalysis tools. Just by making a bit of effort at the beginning,a higher number of proteins can be identified, thereby speedingup the research.In this essay Alba Cristobal (Spain)describes her project during the Erasmusexchange one year ago. After receiving herChemistry MSc in Spain, she came back andjoined Albert Heck’s Biomolecular MassSpectrometry and Proteomics Group (UU)as a PhD student in October 2011. She isnow finishing this small particle project andwill begin new ones on one dimensionalproteomics.| 23

PhD Students DayOn 6 February, a very cold Monday morning, about fortyPhD students and NPC staff gather for the first NPC PhDstudents meeting. They enjoy a warm coffee at the stylishWinkel van Sinkel building right in the centre of Utrecht,the inside of which seems to have been selected to matchNPC’s in-house colours.The organisers’ intention for this meeting is to facilitate aninformal gathering of PhD students who could benefit primarilyfrom the opportunity to get to know their fellow proteomicsresearchers and be inspired to start collaborations.NPC researcher Serena Di Palma (UU) helped organise the meetingand provides the PhD student’s point of view. In addition to poison these frogs secrete through their skin.how he analyses and sequences the mRNA isolated from thethe lectures which were planned, she suggested a workshop for The afternoon starts with a crash course in Bioinformaticsthe PhD students to learn about various career opportunities for proteomics analysis. Salvatore Cappadona (Utrechtfrom senior experts who have already chosen a career path. A University) teaches a step by step beginners guide to quantitativeanalysis. Twan America (Plant Research Internationalworkshop on how to write scientific texts also seemed a goodidea to her. “Nowadays we have to write many proposals for in Wageningen) focuses on the practical aspects of proteinfunding. It is essential that we know how to do so.”quantitation using label free LC-MS. Finally, Peter HorvatovichDuring the morning lectures the NPC hotel managers presentedan overview of their work. Most speakers took the line for label free LC-MS. He compares several data processing(University of Groningen) focuses on the data processing pipe-opportunity to show the expertise and techniques available workflows and addresses the question of which is the best.in their group and illustrate these with examples. Maarten After this demanding theoretical session the workshops onAltelaar (NPC Analytical Hotel, Utrecht) for instance presentedan impressive array of proteomics techniques avail-by all PhD students. So well that no one attends the ‘Meet thescientific writing and career perspectives are well attendedable at his Biomolecular Mass Spectrometry & Proteomics expert’ setup where students have the opportunity to talk toGroup at Utrecht University. In a totally different vein Martijn researchers in an informal setting. Nonetheless, co-organiser24 | NPC Pinkse Highlights (NPC Analytical 15 | Hotel, May 2012 Delft) from the Delft Analytical Serena is satisfied: “I think the day was a success and weBiotechnology department talked about poisonous frogs and should certainly repeat it next year.”“A good venue for meeting others”Jeroen de Keijzer works on a rather stubborn organism: thetuberculosis bacteria. Not much is known about the proteomeJeroen de Keijzer, PhD student at LUMCNPC Project T5 ‘Proteomics and autoimmune diseases’of these bacteria. “Some tuberculosis strains are very resistantto treatment, others are less resistant. We would ideallylike to find differences in their proteome. Another question iswhether we can find changes when a medicine is administeredto these bacteria using proteomics techniques.” Jeroen hasoptimised the proteomics workflow during his first months as aPhD student and is now ready to start investigating.The new initiative of the PhD students meeting has beenvery useful for him. “Many subjects were familiar to meas a biomolecular scientist, but to hear someone explainthe techniques in their particular experimental settingwas illuminating. I was not aware of the large number ofproteomics research groups in the Netherlands either.” Heespecially enjoyed Martijn Pinkse’s and Maarten Altelaar’slectures. “I talked to Maarten after his lecture to ask aboutsome details on an experiment his group was doing that I havebeen trying to copy. During a day like this there are no barriersto making contact with other researchers and asking themdetails about their work.” Finally, Jeroen wants to suggest asmall change in the programme for next year: “I enjoyed thecombination of workshops and lectures. I think it would beuseful to have fewer lectures but give the speakers more timeto delve deeper into their subjects.”

NPC Progress Meeting 2012“Choosing a career”Utrecht researcher and co-organiser Serena Di Palma foundthe lectures very interesting and useful. “Today I realised thatthere are many more research groups with MS expertise inthe Netherlands than I thought.” She found Delft University’sMartijn Pinkse’s presentation gave a good example of researchin context. “He explained that the secretion of some frogs,the peptides of which he analyses, is also used in traditionalmedicine and for hunting in the Brazilian rain forest.” Serenaalso enjoyed Maarten Altelaar’s talk. “It was a good overviewof all the attempts and improvements achieved recently in theproteomics field and he showed how technology has advancedrapidly over the last few years. The analysis of the samesample using state-of-the-art techniques gives a much betterresult than using older apparatus.”Serena has developed several techniques for the analysis ofvery small sample sizes, just a few thousand stem cells. “Thetrick to making it possible is to miniaturise the system, forinstance employing nano LC columns. It is also important tominimise sample handling in order to avoid any loss duringthe preparation of the sample,” she explains. Upon finishingher thesis next year Serena will have to choose her career. “Intalking to my colleagues I found that many of us are strugglingwith the same question,” she says. “There are manyoptions. Do I start a business; do I choose a career in industryor in fundamental science at a university? Reinout Raijmakers’workshop was very useful in helping me understand that each“Learning new techniques”Despite his Dutch name, Georges Janssens is from California(US). He began his PhD study at Groningen eight months ago.A newcomer to the NPC, Georges is a geneticist working onyeast cells. He will be preparing old and young yeast cells inlarge enough quantities for proteomics analysis. Old yeastcells in particular are not abundant when grown as mostyeast cells in a population are young. From these cells theproteome will be analysed and compared to find clues onageing. Georges’ colleague Karin Wolters will be executingthe proteomics analyses, Multiple Reaction Monitoring inparticular (see her article on page 16 in this issue: ‘Targetedproteomics as a tool to study ageing in yeast’).Despite not being a proteomics specialist Georges is keen tounderstand the methods, hence his presence at the meeting.“Getting an overview of the different techniques availablehas been very useful; I can understand the big picture now.An overview such as Twan America gave of all the quantitativeMS analyses methods that are available was especiallySerena Di Palma, PhD student at Utrecht UniversityNPC Project E1 ‘New separation and enrichment tools inproteomics’path can be successful, in so far as we strive to pursue ourambition and passion.” She would like to continue her scientificcareer starting with a postdoctoral experience outsidethe Netherlands. “Other groups have different expertise andapproaches. I think it is essential to change one’s overall viewto gain experience and increase skills and knowledge. In theend I might return to the Netherlands, but the future is alwaysdifficult to predict.”Georges Janssens, PhD student at the University of GroningenNPC Project T3 ‘Proteome biology of micro-organisms’useful,” he says. He also found an overview of bioinformaticsmethods interesting.| 25

Alexander MakarovKeynote lecture at NPC ProgressMeeting 2012 (Utrecht, 7February) entitled ‘Frontiers ofOrbitrap Mass Spectrometry.’Orbitrap MS boosts proteomicsSomeday biologists will analyse proteomes with a devicethat fits in one’s hand. Alexander Makarov, director ofglobal research at Thermo Fisher Scientific, made a big steptowards this future when he invented the Orbitrap. Thismass analyser has already reduced the dimensions of a highresolution mass spectrometer to bench size. “If I hit thewall, I keep looking for a way around.”26 | NPC Highlights 15 | May 2012No, inventing the Orbitrap has not really madeAlexander Makarov a rich man. “But it is very agreeablewhen almost every researcher you meet thanksyou for making his or her work much easier,” says Makarov.These compliments do make him happy, but not satisfied. “Massspectrometry should become much simpler and cheaper,” hestresses. “But that requires a very complex technique.” As a littleboy Makarov was always imagining new machines that wouldmake life easier, things such as a 3D-printer. Makarov remembers:“My father always told me, ‘Go and make it.’ But I wasmore interested in thinking up ‘science fiction’ devices thanactually making them. Later I learned that one must realisehis own ambitious ideas. No one else has the same passion andperseverance.” The inventor spoke about the frontiers of massspectrometry at the NPC Progress Meeting.Completely new conceptMakarov studied physics in Moscow and joined the RussianAcademy of Science, from which he received a PhD in the early1990s. After the USSR fell apart, Russian science collapsed.“It is only very recently that I have seen a glimpse of thenotion that investing in fundamental research and technologymay be a wise idea,” sighs Makarov. After a postdoc positionat the University of Warwick, he joined a Manchester start-upcompany in mass spectrometry in 1996. Though the companystarted out in a cellar, the founders had high ambitions. Theyreasoned that Apple started in a garage too. As Makarov says:“I knew I had to come up with something extraordinary.”Makarov started working on a mass analyser that would bebased on electrostatic fields only: a completely new conceptthat would eliminate the huge magnet that every accuratemass spectrometer needed at that time. Starting point wasan obscure ion trap developed by Kingdon in the early 1920s.Makarov explains: “Trapping ions is classical physics; the ionscircle around their core just like the planets around the sun.However, measuring their masses with high accuracy requiresvery modern physics.” The solution Makarov found was a cleverlyformed spindle-like electrode surrounded by half-shells.Injected ions circle around the spindle electrode and bouncealong its axis with a frequency inversely proportional to thesquare root of the mass-to-charge ratio.Makarov and his Orbitrap moved from the cellar to a businesspark, was bought out by the Manchester branch of ThermoScientific, and later moved to the research facilities inBremen, Germany. Makarov relates: “There were momentswhen I thought of getting a regular job. I was working oneweek in Bremen and the other in Manchester, and the list ofproblems to solve seemed to become longer instead of shorter.But my family told me: ‘You can’t give up now.’” Followingtheir introduction in 2005, Orbitrap mass spectrometersquickly conquered the market, especially in proteomics. Topresent over 250 proteomics papers have been publishedin Nature and Science based on Orbitrap studies. That is anorder of magnitude larger than papers based on all other massspectrometers combined.USSRIt is no coincidence that the inventor of the newest generationof mass spectrometers is Russian. “Almost every mass spectrometrycompany in the world employs one or more Russianscientists of about my age,” according to physicist AlexanderMakarov (1966). The USSR definitely had its dark side, but itsucceeded in educating a generation of very good engineersand instrumentalists. Makarov recalls: “When you were gifted,every possible effort was made to give you an excellenteducation, irrespective whether you were rich or poor, lived inMoscow or in Irkutsk in Siberia, where I was born.”“No one else has the samepassion and perseverance.”

NPC Progress Meeting 2012“We will be in business for a while,” jokesbioinformatician Oliver Kohlbacher. “Datain proteomics is being produced faster andfaster. Unfortunately, bioinformatics is not yet equipped forhigh-throughput analysis of these mind-boggling amounts ofnumbers.” Therefore, bioinformatics is becoming more andmore the bottleneck in proteomics, just as it did in genomics,concludes Kohlbacher. And this accounts for the high demandfor bioinformaticians. “Actually, it is much harder to find goodbioinformaticians than to find the grant money for their appointment.”Oliver KohlbacherKeynote lecture at NPC Progress Meeting2012 (Utrecht, 7 February) entitled‘Going beyond the tip of the iceberg…Comprehensive identification andquantification of proteomes.’The biological topics studied in Kohlbacher’s group in Tübingenvary widely. They range from epitope discovery for vaccinesvia protein subcellular location prediction to systems biology.How does Kohlbacher choose his research topics? “Proteins aredefinitely a connecting thread, but otherwise my interests arevery broad. It fascinates me how molecular details of a biologicalsystem work out on a large scale. That is why we workon both ends of the biological spectrum: on details of proteinligandinteractions as well as on biological networks.” Many ofthe current projects can also be traced back to Kohlbacher’stime as a postdoc (2001-2002) at Celera, Personalising DiseaseManagement (CA, USA) in 1998 co-founded by Graig Venter.“It was one of, if not the, best bioinformatics groups backthen. After Graig Venter left the group fell apart. But I’m stillin touch with many of the members; most are in academicinstitutes around the world.”Mining well MS dataDiscovering proteins below the waterlineMost proteomics experiments merely uncover the tip ofthe iceberg; less than a quarter of the proteins present aremeasured and indentified with current standard analysistools. Smart bioinformatics can reveal much more of theproteome below the waterline, argues Oliver Kohlbacherprofessor of Applied Bioinformatics at the University ofTübingen, GermanyKohlbacher started his own research group just three yearsafter receiving his PhD degree in bioinformatics (summacum laude). He was only 31 years old when the University ofTübingen offered him a full professorship. “Not the averageage for a professor,” Kohlbacher agrees. “It is an advantage tobe a group leader when you are still the same age as the PhDstudents. But it also means that you are sucked into administrativeissues and university politics quite early. That burns upa lot of time you could otherwise have spent on science.”At the NPC Progress Meeting Kohlbacher showed how youcan mine mass spectrometry data to the best advantage.Surprisingly, the most common search engines show littleoverlap (about thirty percent) in the proteins they identifyin mass spectrometry data. A mixture model which combinesthe search engines can significantly increase the amount ofproteins that can be indentified with good reliability. Themajority of unidentified peptides that then remain are modifiedpeptides. Algorithms can reveal the most common typesof modifications in a proteome, and with this informationmany modified variants of already identified proteins canbe detected. Using this approach the percentage of identifiedspectra can be raised from approximately half to threequarters of the ten thousands of spectra. The costs: instead ofseconds, the data analysis will take around a hundred hours ofcomputing time.Greatest challengeAccording to Kohlbacher the greatest challenge in proteomicsis application in the clinic. His group is currently involved inone of the first attempts. “We are analysing the data for aclinical trial with cancer vaccines. We compare the mass spectrometrydata on antigenic peptides in healthy and tumour tissueand make suggestions on the optimal peptide cocktail forvaccination. Subsequently we will analyse data from treatedpatients. Very exciting.”Kohlbacher has been involved in the research project from thestart. “If we get involved in the study from scratch, we canoften save lots of time in the analyses just by suggesting smallalterations in the study design, for example how the samplesare scheduled for replication or how quality control is done.”“Bioinformatics has become thebottleneck in proteomics.”| 27

Hans SchölerKeynote lecture at NPC ProgressMeeting 2012 (Utrecht, 7February) entitled ‘Induction ofpluripotency.’Proteomics essential for investigating pluripotency“The discovery of a gene, Oct4, involved in maintainingpluripotency has played an important role in my scientificcareer,” says Professor Hans Schöler, director of theDepartment of Cell and Development Biology from the MaxPlanck Institute for Molecular Biomedicine in Münster. Hespoke at the NPC Progress Meeting on the germline cells hehas been studying for more than 20 years. With a long list ofpublications, Schöler has made an impressive contributionto this field.28 | NPC Highlights 15Hans Schöler is particularly interested in pluripotency,the ability of cells to transform into more than200 types of body cells. Until 2006 scientists didnot think that differentiated cells such as skin, hair and bloodcells could be transformed into one another. All the differentcells in the body were thought to be generated by pluripotentstem cells alone, which are transiently found in the earlyembryo. More than 20 years ago, Schöler and his researchteam discovered a transcription factor called Oct4 that plays acrucial role in pluripotency.The Oct4 gene is normally expressed only in embryonicstem cells (ESCs) and the precursors of egg and sperm cells.However, Schöler’s team recently found that Oct4 is transducedinto differentiated cells, such as neural stem cells,which can be reprogrammed into pluripotent stem cells.“These so-called induced pluripotent stem cells, or iPSCs, areespecially useful in basic research for uncovering which factorscontribute to the different stages of cell development,”says Schöler. “However, they are not suitable for transplantationas they can form teratomas, a special kind of tumour.”In 2003, Schöler’s team made another important discovery byshowing that oocytes were generated in in vitro cultures ofESCs in the presence of Oct4. Oocytes were previously thoughtto be generated from oocyte precursors alone. “The publicationof these results even made it to an article in the New YorkTimes,” Schöler remarks proudly.Advanced techniquesDifferent newly developed proteomics techniques have beeninstrumental in the diverse discoveries made by the Schölergroup. For example, quantitative mass spectrometry usingSILAC labelling (stable isotope labelling by amino acids in cellculture) has allowed the researchers to identify and quantifymore than 5,000 distinct proteins present in mouse ESCs, oneof the largest quantified proteomes to date. For this workSchöler collaborated with the Matthias Mann research groupat the Max Planck Institute for Biochemistry in Martinsriedand found that proteins involved in cell proliferation wereabundant.Furthermore, Schöler’s group developed a combined functionaland quantitative proteomics (SILAC) screen for identifyingproteins and complexes that contribute to reprogramming.“In this study we showed that a specific chromatin-remodellingcomplex plays a role in the generation of iPSCs throughsomatic cell reprogramming.” Using in-house mass spectrometry,Schöler’s team zoomed-in on Oct4 to uncover the precisearea involved in reprogramming. Oct4 contains two somewhatconserved regions tethered by a linker of 17 amino acids.They found that a single point mutation in the linker abolishesreprogramming.Neural stem cellsSchöler is very excited about his latest discovery, described inthe 6 April issue (2012) of Cell Stem Cell. “We have shown forthe first time that fibroblasts can be directly turned into neuralstem cells using the right factors. Colleagues had alreadydemonstrated that fibroblasts could be turned into neurons,but the neural stem cell stage had not been reached. Theseneural stem cells proliferate rapidly in vitro and do not formtumours after transplantation, unlike iPSCs. Now we can actuallystart to think about transplantation. However, much workis needed before we can really translate this to the clinic, forexample, to renew waning muscle in older people. I hope thatI will be able to witness this before I retire.”“We found that proteinsinvolved in cell proliferationwere abundant.”

NPC Progress Meeting 2012Blighted by KenningA work in progressThe Netherlands Proteomics Centre is collaborating withthe UK artist Charlotte Jarvis on a new bio-art projectcalled Blighted by Kenning. The completed project will beexhibited at The Big Shed in Suffolk in August and after thisin the Netherlands. The bio-art project is funded by theNPC and the Netherlands Genomics Initiative (NGI).The project proposes to bio-engineer a bacteria which hasthe Universal Declaration of Human Rights encoded into itsDNA sequence. Apples which have been grown at The Hague,seat of the International Courts of Justice, will then be‘contaminated’ with the bacteria. The NPC will send these‘fruits from the tree of knowledge’ to genomics laboratoriesaround the world and ask participating scientists to sequencethe declaration and send back a translation.International networkIn addition a limited number of labs will be asked to producethe actual protein encoding the text and will be asked toEach letter of the alphabet will be represented by oneDNA codon (a tri-nucleotide unit consisting of a specificcombination of Adenine (A), Thymine (T), Guanine(G) and Cytosine (C)). Helpfully, most codons alreadycorrespond to one of 20 amino acids, each of which isdesignated by a single letter of the alphabet. Becausenot all letters are represented by amino acids, but someCharlotte Jarvis presented Blighted by Kenning atthe NPC Progress Meeting on 7 February 2012.analyse it and ship the protein back to the Netherlands ifthey are successful. The proteins will then be analysed bymass spectrometers in Utrecht to confirm their identity as theUniversal Declaration of Human Rights. The hypothetical 3Dstructure of the protein will also be predicted and visualised.The NPC hopes Blighted by Kenning will create a networkof international institutions all participating in the project,and as such making a statement about the importance ofgenomics research. The project aims to create a scenario inwhich science, technology and genetics literally and palpablypropagate humanitys most highly valued achievements.Symbolic gestureFinally, the artist also hopes to find scientists at participatinginstitutions who would like to eat the fruit. We hope that thisact could constitute a symbolic gesture rejecting the hysteriaassociated with genetics research in much of the popular pressand also more generally making a statement that says ‘I wantto partake of the tree of knowledge — because it is learning,science and technology — including genomics — that will makeour lives better’.Encoding the Universal Declaration of Human Rightsamino acids are encoded by multiple codons, we willneed to slightly adapt the ‘meaning’ of some codons. Forexample, ‘Article One’ could be written into the genomeas ‘GCTCGTACTATTTGTTTAGAAAGAATAAATGAA’.In thissequence, the codon AGA is used to designate a spaceand the codon ATA is used for the letter ‘O’, which has noassociated amino acid.| 29

Plant proteomicsSabbatical gives momentum to researchon pathogenic fungiBart Thomma’s scientific carreer is flourishing. Last yearhe won the NGI Young Visiting Scientist Stipend, giving himthe opportunity to study how pathogenic fungi use specificproteins to mislead their hosts. The VICI grant he recentlyreceived offers him the chance to further this researchand search for similar mechanisms of fungal infections inanimals and humans.In plant pathology it is broadly accepted that when fungi tryto infect a plant they secrete small proteins that suppress thehost’s immune system. “I was curious as to how exactly thisworks for a particular protein known as Ecp6. The NGI Stipendoffered me a great opportunity to work on the structureof the protein, which had been a bit sidelined,” says BartThomma, associate professor at the phytopathology laboratoryin Wageningen and involved in the Centre for BioSystemsGenomics (CBSG) and the NPC Plant Proteomics Hotel.Lucky strikeThomma has divided his sabbatical leave into three parts: twoperiods in Lübeck to work on the crystal structure in order togain insight into the protein structure and the mechanism bywhich it binds chitin and the third period to spend in Aberdeenfor biochemical research on the fungal cell wall. “We wantto know where the chitin molecules are located and how theplant immune receptors detect them at the moment of infection.”The first ‘Lübeck period’ is behind him. “We were lucky rightfrom the start when we discovered that we had protein crystalsin our hands. We also found that other plant pathogenicfungi made similar proteins that act in the same way. One ofthese proteins not only captures the loose chitin moleculesbut covers the chitin in the cell wall and protects the fungusthat produces it against chitinase as well. How is that possible?Unfortunately, we were not so lucky as to have succeededin crystallising this protein in our first attempt. Hopefully, wewill succeed in the upcoming second period.”30 | NPC Highlights 15 | May 2012Fungi have a firm cell wall containing chitin, a compoundalso common in insects and crustaceans but not in plants,animals or humans. “This compound is sensed by plants asforeign and activates their immune system. One of the antimicrobialagents the plant starts to produce is the enzymechitinase, which degrades chitin thereby initiating the fungi’sdemise.”Vacuum cleanerTwo years ago Thomma found a protein of a fungal tomatopathogen that masks chitin. “This Ecp6 protein acts like avacuum cleaner and catches the loose chitin molecules. As aconsequence the receptors on the cell surface of the plantdon’t sense any chitin, the immune system stays inactive andthe fungus can penetrate the plant. To find out exactly howthe chitin-binding protein works, having the structure of thatprotein can be very helpful.” One complication with Ecp6is that it involves a glycoprotein, which proteins are oftennot easy to crystallise. By searching the literature, Thommafound that a group at the Lübeck University in Germany hadexpertise in this field, and coincidentally a nephew he had notseen for 20 years was one of the authors. “Straight away hewas keen to collaborate. But since a medical lab was involved,working on a protein of a fungal plant pathogen was nottheir immediate top priority. The NGI Young Visiting ScientistStipend provided the prospect of putting significantly moreeffort into this research project.”Direct spinoffA few months ago Thomma won a prestigious VICI grant fromthe Netherlands Organisation for Scientific Research (NWO),which he is dedicating to follow-up research. “What we aregoing to do, and this is a direct spinoff of our project, is tostudy how fungi succeed in deceiving the immune systemin plants as well as in animals or human. The mechanismcould be very similar,” he says, inspired by the course of hisresearch. “We can make new strides in understanding theconflict between fungi and their hosts, which may lead to newways to fight fungal infections: from alternative approaches tofungicides to new targets for development of antibiotics.”Foto: Erik BorstBart ThommaI am interested in fungalpathogenicity mechanisms, inparticular of the vascular wiltfungus Verticillium dahliae. Thisfungus infects a wide range ofhost plants including numerouscrops, ornamentals and trees.

Jan Hoeijmakers was awarded the 2011 Charles Rudolph Brupbacher Stiftung(Zürich) Cancer Research Prize for research on the role of genome stabilityin cancer and ageing. Furthermore, in 2011 he was awarded the KoninginWilhelmina Onderzoeksprijs (KWO) for his pioneering cancer research and wasappointed KNAW Academy Professor as a lifetime achievement award.“Proteomics and moleculargenetics are a perfect match”During the past decade much progress has been made in elucidating thebiology of ageing. Jan Hoeijmaker’s team focuses on the impact of DNAdamage and demonstrates the prominent role of DNA repair mechanismsin healthy ageing. Cooperation with NPC has recently led to expansion ofthe biological research using proteomics. “Both disciplines reinforce eachother,” Hoeijmakers asserts.Jan Hoeijmakers is professor of Molecular Genetics atthe Department of Cell Biology and Genetics at ErasmusUniversity, Rotterdam. His primary interests are in the biologyof ageing and he speaks passionately about the scientific challengesof unravelling the underlying molecular mechanisms.Showing the rapidly rising life expectancy curves, he explains:“Due to improvements in public health, nutrition and medicinein developed countries, the average lifespan of a newborn increasedtwo and half years every decade during the twentiethcentury. That is almost one weekend every week or fifteenminutes every hour!”Everyone would like to live a long life, remaining active andhealthy for as long as possible. By studying the molecularbasis of ageing and longevity, scientists are trying to uncoverthe means to achieve that goal. Hoeijmakers’ group hasdiscovered the crucial role of well-functioning DNA repairmechanisms; maintenance of DNA integrity having proven tobe essential for cell viability and health. “Incorrectly repairedor unrepaired DNA damage may result in genomic mutationsand cellular malfunctioning, which enhance cancer risks andaccelerate aging processes,” he explains.Mouse modelsThe genome is under continuous attack from both metabolicallyproduced substances such as reactive oxygen speciesand environmental factors such as chemicals and UV light. Tocounteract the deleterious effects of DNA damage, cells areequipped with various DNA repair systems. The nucleotide excisionrepair (NER) system, which provides protection againsta wide spectrum DNA injury, is one such system.Hoeijmakers and colleagues discovered that certain raredisorders in which individuals exhibit typical features of ageingearly in life are related to faulty DNA repair mechanismscaused by an inherited defect. Malfunctioning NER for onemay lead to TTD (trichothiodystrophy), a syndrome oftenaccompanied by symptoms such as brittle hair, scaly skin anda disturbed gait at a young age. “Our research focuses ongaining insight into mechanisms of DNA repair and on associatingfailing DNA repair with early ageing and cancer. To this endmouse models have proven very useful,” Hoeijmakers says.His team succeeded in developing a variety of mouse mutantscorresponding to various DNA repair syndromes in humans, forexample TTD mice bearing early ageing features like their humancounterparts. “These mouse models provide an enormousamount of information on DNA repair systems and their role in(early) ageing and cancer risks. However, there are still manychallenges for translating biological insights into moleculartruth. For that you need to find out which proteins are involved,and why and in which amounts. In this respect currentproteomics techniques offer promising possibilities.”Proteome of DNA repairErik de Graaf is an NPC PhD student in Albert Heck’sBiomolecular Mass Spectrometer and Proteomics Group inUtrecht. He works closely with Hoeijmakers’ team and focuseson unravelling the proteome of DNA repair. “We use nanoLC‐MS based methods and dimethyl labelling strategies toidentify and quantify protein expression profiles in healthyand ill subjects,” Erik explains. An initial joint researchproject concerns studying mouse mutants in which DNA repairin purkinje cells has been switched off. These cerebellumneurons are involved in guiding the locomotor apparatus thatfrequently shows defects in ageing. “Our proteomics screeningexperiments reveal what proteins actually appear or disappearin the affected purkinje layer during ageing.” Erik reports onthe preliminary results: “In these mice we detected decreasinglevels of proteins that are indispensable for neuronalcommunication in locomotion, which consequently leads toa gradually failing motor system. Furthermore, we observedincreased immune response in the cerebellum which indicatescell damage due to malfunctioning DNA repair.”SynergyWhereas molecular genetics enable unravelling DNA repairsystems and its role in cellular processes, proteomics providesinsight into the identity, structure and function of involvedproteins. Hoeijmakers concludes: “Both disciplines clearlycreate synergy, which will accelerate the discovery of newbiomarkers for the early detection of age related diseases aswell as new therapeutic targets for efficient treatment.”| 31

Top publications with NPC contributionIn this NPC HighLights we provide a short list ofpapers that appeared recently in some of the topjournals and to which NPC participants contributed.With the guarantee of being by far notcomprehensive, this overview shows some elegantground-breaking research.NKX2-5 is expressed in the heart throughout life. We targetedeGFP sequences to the NKX2-5 locus of human embryonic stemcells (hESCs); NKX2-5(eGFP/w) hESCs facilitate quantification ofcardiac differentiation, purification of hESC-derived committedcardiac progenitor cells (hESC-CPCs) and cardiomyocytes(hESC-CMs) and the standardization of differentiation protocols.We used NKX2-5 eGFP(+) cells to identify VCAM1 and SIRPA ascell-surface markers expressed in cardiac lineages.Screening ethnically diverse humanembryonic stem cells identifies achromosome 20 minimal amplicon conferringgrowth advantageAmps, K. et. alNat Biotechnol. 2011 Nov 27;29(12):1132-44.doi: 10.1038/nbt.2051.Centre for Stem Cell Biology, Department of BiomedicalScience, The University of Sheffield, Sheffield, UK.The International Stem Cell Initiative analyzed 125 human embryonicstem (ES) cell lines and 11 induced pluripotent stem(iPS) cell lines, from 38 laboratories worldwide, for genetic32 | NPC changes Highlights occurring 15 during | May culture. 2012 Most lines were analyzedat an early and late passage. Single-nucleotide polymorphism(SNP) analysis revealed that they included representativesof most major ethnic groups. Most lines remained karyotypicallynormal, but there was a progressive tendency to acquirechanges on prolonged culture, commonly affecting chromosomes1, 12, 17 and 20. DNA methylation patterns changedhaphazardly with no link to time in culture. Structural variants,determined from the SNP arrays, also appeared sporadically.No common variants related to culture were observed onchromosomes 1, 12 and 17, but a minimal amplicon in chromosome20q11.21, including three genes expressed in human EScells, ID1, BCL2L1 and HM13, occurred in >20% of the lines. Ofthese genes, BCL2L1 is a strong candidate for driving cultureadaptation of ES cells.NKX2-5eGFP/w hESCs for isolation of humancardiac progenitors and cardiomyocytesElliott, D.A., Braam, S.R., Koutsis, K., Ng, E.S., Jenny, R.,Lagerqvist, E.L., Biben, C., Hatzistavrou, T., Hirst, C.E., Yu,Q.C., Skelton, R.J.P., Ward-van Oostwaard, D., Lim, S.M.,Khammy, O., Li, X., Hawes, S.M., Davis, R.P., Goulburn, A.L.,Passier, R., Prall, O.W.J., Haynes, J.M., Pouton, C.W., Kaye,D.M., Mummery, C.L., Elefanty, A.G., Stanley, E.G.Nat Methods. 2011 Oct 23;8(12):1037-40.doi: 10.1038/nmeth.1740.Monash Immunology and Stem Cell Laboratories, MonashUniversity, Clayton, Victoria, Australia.Characterization of MADS-domaintranscription factor complexes in Arabidopsisflower developmentSmaczniak, C., Immink, R.G., Muiño, J.M., Blanvillain,R., Busscher, M., Busscher-Lange, J., Dinh, Q.D., Liu, S.,Westphal, A.H., Boeren, S., Parcy, F., Xu, L., Carles, C.C.,Angenent, G.C., Kaufmann, K.Proc Natl Acad Sci U S A. 2012 Jan 31;109(5):1560-5.Epub 2012 Jan 11.Laboratory of Molecular Biology, Wageningen University,6708PB Wageningen, The Netherlands.Floral organs are specified by the combinatorial action ofMADS-domain transcription factors, yet the mechanisms bywhich MADS-domain proteins activate or repress the expressionof their target genes and the nature of their cofactors arestill largely unknown. Here, we show using affinity purificationand mass spectrometry that five major floral homeotic MADSdomainproteins (AP1, AP3, PI, AG, and SEP3) interact in floraltissues as proposed in the “floral quartet” model. In vitrostudies confirmed a flexible composition of MADS-domain proteincomplexes depending on relative protein concentrationsand DNA sequence. In situ bimolecular fluorescent complementationassays demonstrate that MADS-domain proteinsinteract during meristematic stages of flower development.By applying a targeted proteomics approach we were able toestablish a MADS-domain protein interactome that stronglysupports a mechanistic link between MADS-domain proteinsand chromatin remodeling factors. Furthermore, members ofother transcription factor families were identified as interactionpartners of floral MADS-domain proteins suggesting variousspecific combinatorial modes of action.A barcode screen for epigenetic regulatorsreveals a role for the NuB4/HAT-B histoneacetyltransferase complex in histoneturnoverVerzijlbergen, K.F., van Welsem, T., Sie, D., Lenstra, T.L.,Turner, D.J., Holstege, F.C.P., Kerkhoven, R.M., van Leeuwen, F.PLoS Genet. 2011 Oct;7(10):e1002284. Epub 2011 Oct 6.Department of Gene Regulation, Netherlands Cancer Institute,Amsterdam, The Netherlands.

Dynamic modification of histone proteins plays a key role inregulating gene expression. However, histones themselves canalso be dynamic, which potentially affects the stability of histonemodifications. To determine the molecular mechanismsof histone turnover, we developed a parallel screening methodfor epigenetic regulators by analyzing chromatin states on DNAbarcodes. Histone turnover was quantified by employing a geneticpulse-chase technique called RITE, which was combinedwith chromatin immunoprecipitation and high-throughputsequencing. In this screen, the NuB4/HAT-B complex, containingthe conserved type B histone acetyltransferase Hat1, wasfound to promote histone turnover. Unexpectedly, the threemembers of this complex could be functionally separated fromeach other as well as from the known interacting factor andhistone chaperone Asf1. Thus, systematic and direct interrogationof chromatin structure on DNA barcodes can lead tothe discovery of genes and pathways involved in chromatinmodification and dynamics.The quantitative proteomes of human-inducedpluripotent stem cells and embryonicstem cellsMunoz, J., Low, T.Y., Kok, Y.J., Chin, A., Frese, C.K., Ding, V.,Choo, A., Heck, A.J.Mol Syst Biol. (2011) Nov 22;7:550. doi: 10.1038/msb.2011.84.Biomolecular Mass Spectrometry and Proteomics Group,Bijvoet Center for Biomolecular Research and Utrecht Institutefor Pharmaceutical Sciences, Utrecht University, Utrecht, TheNetherlands.Assessing relevant molecular differences between human-inducedpluripotent stem cells (hiPSCs) and human embryonicstem cells (hESCs) is important, given that such differencesmay impact their potential therapeutic use. Controversysurrounds recent gene expression studies comparing hiPSCsand hESCs. Here, we present an in-depth quantitative massspectrometry-based analysis of hESCs, two different hiPSCsand their precursor fibroblast cell lines. Our comparisonsconfirmed the high similarity of hESCs and hiPSCS at the proteomelevel as 97.8% of the proteins were found unchanged.Nevertheless, a small group of 58 proteins, mainly related tometabolism, antigen processing and cell adhesion, was foundsignificantly differentially expressed between hiPSCs andhESCs. A comparison of the regulated proteins with previouslypublished transcriptomic studies showed a low overlap, highlightingthe emerging notion that differences between bothpluripotent cell lines rather reflect experimental conditionsthan a recurrent molecular signature.Other highlighted publicationsAltelaar, A.F., Navarro, D., Boekhorst, J., van Breukelen, B.,Snel, B., Mohammed, S., Heck, A.J.Database independent proteomics analysis of the ostrich andhuman proteomeProc Natl Acad Sci U S A. (2012) Jan 10;109(2):407-12.Spedale, G., Timmers, H.T., Pijnappel, W.W.ATAC-king the complexity of SAGA during evolutionGenes Dev. 2012 Mar 15;26(6):527-41.Choukrallah, M.A., Kobi, D., Martianov, I., Pijnappel, W.W.,Mischerikow, N., Ye, T., Heck, A.J., Timmers, H.T., Davidson, I.Interconversion between active and inactive TATA-bindingprotein transcription complexes in the mouse genomeNucleic Acids Res. (2012) Feb 1;40(4):1446-59. Epub 2011 Oct 19.Shi, J., Knevel, R., Suwannalai, P., van der Linden, M.P.,Janssen, G.M., van Veelen, P.A., Levarht, N.E., van der HelmvanMil, A.H., Cerami, A., Huizinga, T.W., Toes, R.E., Trouw,L.A.Autoantibodies recognizing carbamylated proteins are presentin sera of patients with rheumatoid arthritis and predict jointdamage.Proc Natl Acad Sci U S A. (2011) Oct 18;108(42):17372-7. Epub2011 Oct 10.Alves, R.D.A.M., Demmers, J.A.A., Bezstarosti, K., van derEerden, B.C.J., Verhaar, J.A.N., Eijken, M., van Leeuwen,J.P.T.M.Unraveling the Human Bone microenvironment beyond theclassical extracellular matrix proteins: a human bone proteinlibrary.J Proteome Res. (2011) Oct 7;10(10):4725-33. Epub 2011 Sep 21.Rosenling, T., Stoop, M. P., Smolinska, A., Muilwijk, B., Coulier,L., Shi, S., Dane, A., Christin, C., Suits, F., Horvatovich, P. L.,Wijmenga, S., Buydens, L., Vreeken, R., Hankemeier, T., vanGool, A. J., Luider, T. M., Bischoff, R.The impact of delayed storage on the proteome andmetabolome of human cerebrospinal fluid (CSF).Clin Chem. (2011) Dec;57(12):1703-11. Epub 2011 Oct 13.Willems, L.I., van der Linden, W.A., Li, N., Li, K.Y., Liu, N.,Hoogendoorn, S., van der Marel, G.A., Florea, B.I., Overkleeft, H.S.Bioorthogonal chemistry: applications in activity-based proteinprofiling.Acc Chem Res. (2011) Sep 20;44(9):718-29.Marreddy, R.K.R., Pinto, J.P.C., Wolters, J.C., Geertsma, E.R.,Fusetti, F., Permentier, H.P., Kuipers, O.P., Kok, J., Poolman, B.The response of Lactococcus lactis to membrane proteinproduction.PLoS One. (2011) 6(8):e24060.| 33Krijgsheld,. P, Altelaar, A.F., Post, H., Ringrose, J.H., Müller,W.H., Heck, A.J., Wösten, H.A.Spatially resolving the secretome within the mycelium of thecell factory Aspergillus nigerJ Proteome Res. (2012) Mar 26.Albers, H.M., Hendrickx, L.J., van Tol, R.J., Hausmann, J.,Perrakis, A., Ovaa, H.Structure-based design of novel boronic acid-based inhibitorsof autotaxin.J Med Chem. (2011) 54(13):4619-26.

Dutch Techcentre for Life SciencesEnabling technologies for the life sciencesCurrent research into living organisms is getting increasinglycomplex. More and more, research approaches includedifferent systemic levels, while advances in technologydevelopment lead to a vast amount of highly specific data.These technologies require high level of expertise, togetherwith substantial investments in infrastructure, as well asoptimised experimental design to allow the integration ofcorresponding data streams.DTL participantsNetherlands Bioinformatics Centre (NBIC)Netherlands Consortium of Systems Biology (NCSB)Netherlands Metabolomics Centre (NMC)Netherlands Proteomics Centre (NPC)Centre for Genome Diagnostics (CGD)Netherlands Society for Advanced Light MicroscopyTo address this challenge, a number of key technologies inthe Netherlands have organised themselves as the DutchTechcentre for Life Sciences (DTL). DTL aims to promotetechnology development and to provide access to high-levelexpertise and infrastructure in the areas of next generationsequencing, proteomics, metabolomics, systems biology,bioinformatics and advanced microscopy. DTL intend tointerconnect academic research groups, industrial providers oftechnology, technology users and service providers.34 | NPC Highlights 15 | May 2012FrameworkIt is evident that no single research group, institute, university,or company will be able to maintain these big life sciencestechnologies at a sufficiently high level, due to rapid developmentsand high costs of infrastructure in all these interactingtechnological fields. To secure the frontline position of DutchDutch Techcentre for Life Sciences:Next generation LS technology research infrastructureKey technologies• genomics (NGS)• proteomics• metabolomics• boimaging• bioinformatics, systems biology & e-scienceExpertise and easy access for collaborations• cutting-edge technology research• cross-technology data integration• expertise & infrastructures• support & training• single framework• cross-sector tuning• international link and impact• public-private partnershipsR&D, a new approach is needed to employ these essentialtechnologies in a more efficient and cost-effective way. DTLoffers the framework for this new approach. It offers dedicatedtechnology expertise and collaborative research facilitiesthat are coordinated at the national level and effectivelylinked to international initiatives. Besides, it offers dedicatedtraining of experts and users, thereby broadening the capacitybase in these advanced technologies in academia and industry.The translation of novel technologies to (commercial) servicesand in high-end technology products and applications withmarketpotential will follow from a focussed DTL valorisationapproach.DTL builds upon existing technology centres and other collaborativetechnology initiatives (see Table). These centreshave started to play a crucial role in employing top-technologyexpertise and equipment in a growing number of life sciencesprogrammes in the Netherlands. DTL bundles their capacityand collective experience into a single comprehensive nextgeneration research infrastructure for life sciences R&D.Roadmap Lifesciences & InfrastructureThe DTL concept has been shaped in close consultation witha large number of individuals and organisations, includingrepresentatives of the NFU, VSNU, research centres and topinstitutes, biobanking initiatives, e-science initiatives, industry,NWO, ZonMW, NGI and ministries. Recently, DTL has beenpositioned within the top sector Life Sciences & Health, aspart of the roadmap Life Sciences & Infrastructure.With support of NGI, a preparatory DTL executive team hasbeen set up to guide the DTL concept towards implementation,including the appropriate governance and fundingmodels. A comprehensive DTL business plan will be developedin the course of 2012, in close connection to the life sciencesbased partners in the private and the public sectors.More information, Werner Most, managing director NPCmost@npc.genomics.nl; T +31 30 253 9340

13.5 M€ investment for large-scaleproteomics research facilityThe Proteins@Work project has received financing from the Ministry ofEducation, Culture and Science (OCW) to set up a large scale researchfacility. On March 2 State Secretary Halbe Zijlstra of OCW and Jos Engelen,chairman of NOW, presented the 13.5 M€ cheque. “The grant providesa clear perspective for the development and application of proteomicstechnologies in the Netherlands,” argues Albert Heck, scientific director ofthe Netherlands Proteomics Centre and coordinator of the project.Proteins@Work belongs to one of the five programmes thathave been awarded for NWO funding within the National RoadMap for Large-scale Research Facilities. In total almost 80M€ ismade available for the awarded projectsincluding: Mouse Clinic for Cancer andAgeing Research (18.6 M€); Ultra-HighField NMR Facility (18.5M€); SAFARI, anadvanced IR facility for space studies(18 M€); Proteins@Work, a large-scaleproteomics facility (13.5M€); High FieldMagnet Laboratory (11M€). The selectedprojects fit excellently within the Dutch‘topsectoren plan’ according to the StateSecretary: “The investments will boostour scientific research efforts and contributeto solving major challenges forAlbert Heck (l) receives the 13.5M€ cheque the future, such as health questions andfrom State Secretary Halbe Zijlstra. the search for new materials.”WorkhorsesThe project Proteins@Work, in which various Dutch researchinstitutes collaborate, is of great benefit to Dutch LifeSciences (see Scheme). The research programme will focus oncancer and other ageing diseases, developmental biology andplant biology. “The participating partners will make stateof-the-arttechnology, equipment and expertise available tobiological and biomedical researchers,” explains Albert Heck,initiator of Proteins@Work.Proteomics deals with large scale analysis of proteins and theirinteractions in relation to biological functions. Following technicaland scientific breakthroughs, proteomics is now becomingmore integrated with genetic information and clinical data.The Proteins@Work facility will be essential for making progressin life sciences and health research and will contribute to theinnovative climate in the Netherlands. “We cooperate with anyonewho wants to know how proteins work, for example, howproteins can cause diseases but also how these compounds stemcells can turn into healthy bodies,” says Heck. “Proteins arestill the essential working horses in the cell, and to understandthe life we must map out how proteins work together.”Firmly-rootedProteins@Work will elaborate on the NPC which has firmly beenrooted in the international proteomics research. The NPC has wonits spurs, according to the Committee Meijer that advised NWOabout the National Roadmap Strategy. Their explanatory memorandumreads: “The NPC is the 2nd most important proteomics facilityin Europe and highly regarded worldwide. The applicants areleaders in the field, and many of the proposed research questionswill benefit from their expertise and from the already ongoingproteomics research at the laboratories. In addition, because theproposed facility will be similar in concept and execution to manyother excellent proteomics facilities world-wide, the technicalrisk is well under control. Conversely, the social and commercialrelevance of research in proteomics is evident, ranging from thesearch for novel medicines to applications in the food industry.”Under the umbrella of the Netherlands Genomics Initiative(NGI) the NPC was initiated in 2003. Over the last decaderesearch groups from all over the country and in all branchesof the Life Sciences have become involved in proteomics-associatedresearch programmes within the framework of NPC.The result of this nationwide effort is that Dutch proteomicsresearch is ranked 5th in the world (2nd in Europe) based onscientific output.Future perspectiveSince current funding by the coordinated effort of NGI andNWO will end in 2013, the NPC is very much focused nowon continuation. “Therefore we are highly pleased with theawarded Proteins@Work project that will start in 2014 fora period of five years. It indisputably helps us to secure ourway into the future,” concludes Albert Heck. “The NPC maycontinue its key role in the increasingly challenges withinproteomics research.”More info: www.proteinsatwork.nl/The Large Scale Proteomics Research Facility is hosted by the UU Science facultyand supported by committed users from leading research institutes in the LifeSciences in the Netherlands. These partners all commit significant resources toa collective proteomics associated research programme that is estimated 50M€in the period 2014-2020. Proteins@Work will provide open, albeit competitive,high-quality access to research institutes (e.g. RIVM, TNO, PRI), universities,academic hospitals and industry, including SME’s. The core facility will also bepart of the European Union FP7 initiative PRIME-XS.| 35

upcoming events20-24 May 20129-12 July 201219 August 201220 November 201211-12 February 2013|||||60th ASMS Conference, Vancouver, BC, CanadaEuPA/BSPR Proteomics Meeting, Glasgow, Scotland6th EU Summer School in Proteomics Basics, Brixen/Bressanone, ItalyLife Sciences Momentum, The NetherlandsNPC Progress Meeting, Utrecht, The NetherlandsPromising proteomicsin stem cell biologyMajor breakthroughs over the last several years have catapultedstem cell research to centre stage in the field of regenerativemedicine. A new era has clearly dawned. However, whilst weunderstand a great deal about which genes change stem cellidentity as they differentiate and grow, we know much lessabout how these genes are regulated, how epigenetic statuscontrols cell function and how cells age and mature. Severalrecent international meetings have clearly shown that proteomicscan be a huge help in understanding these processes.The phosphorylation status of signalling pathway componentscan tell us which pathways are active at any given time; analysisof the secretome can tell us the identity of candidate ligandsfor activating those pathways, and the methylome can tell ussomething about the relationship between chromatin structureand gene expression as cells differentiate.Christine MummeryProfessor of DevelopmentalBiologyDept. of Anatomy &EmbryologyLeiden UMCTwo things changed the landscape and turned mass spectrometryinto a tool really applicable to stem cell biology. One is mass spectrometryitself, which has steadily increased in sensitivity so thatmuch less input material is necessary for analysis. Stem cell biologistswere used to thinking that a million cells was a lot. The otheris stem cell biology in which it is now possible to scale up culturessignificantly under defined and reproducible conditions and isolatepure populations of stem and progenitor cells in their billions at allstages of differentiation. Bioinformatics has provided new methodsfor clustering data to understand how genes and proteins are coregulated,and new databases are providing options for storing allof this data so that information can be mined to identify the mostimportant protein and gene interactomes in any cell response.Whether it is for creating disease models based on patientderived induced pluripotent stem cells, determining proteomicand genomic profiles of these cells to control growth and differentiationor turning them into functional tissues for organ repair,the recreation or maintenance of cell function is an essentialpart of achieving the goals immediately to hand. Proteomicshas now become the toolbox stem cell biologists need. NPC isamong the world leaders in proteomics technology and throughits strategic alliances with prominent stem cell researchers, itis poised to contribute not only to regenerative medicine butalso to drug discovery in disease prevention and cure.15