Puzzle of Inheritance: Genetics and the Methods - SDSC Education

Copyright 1997 by BSCSAll rights reserved. B SCS grants permission to reproduce materials from this module for noncommercial, educationaluse. This permission, however, does not cover reproduction of these items for any other use. For permissions and otherrights under this copyright, please contact the Permissions Department, BSCS, 5415 Mark Dabling Blvd., ColoradoSprings, Colorado 80918-3842, U.S.A. FAX 719 531-9104.This material is based on work supported by the United States Department of Energy under grant numbers DE-FG03-93ER615884 and DE-FG03-95ER61989. Any opinions, findings, conclusions, or recommendations expressed in the publicationare those of the authors and do not necessarily reflect the views of the United States Department of Energy.

ForewordAs biology teachers, you have two large tasks before you: to help your students gain a conceptual understandingof living systems, and to help your students understand the nature and methods of science. This secondtask, conveying to your students a fundamental grasp of the ways of science, is vitally important regardless ofthe future career choices your students will make. If they are to become informed citizens, able to appreciateand use the knowledge put before them, your students must understand the nature of scientific explanationsand the power and rigor of the requirements of science.Science assumes that the universe and the natural phenomena it encompasses are ordered and predictable.Scientific explanations reflect that assumption; they are driven by data that are collected carefully and analyzedrigorously. The data must be reliable; that is, the same data must result when other investigators repeat theoriginal observations or experiments. Because science is a human endeavor, it is impossible (and perhaps noteven wise) to eliminate all subjective judgments from the processes of science. The methods of science andscientific habits of mind, however, help to minimize the negative influence of subjectivity by holding all scientistsand all scientific explanations to the same standards. If the corpus of scientific knowledge is to remain reliable,these standards must apply everywhere that science is done. From a school laboratory to the Pasteur Institute,from beginning students in North America to Nobel laureates from India, the requirements for validscientific explanations do not change. In this sense, science may be as close as the world comes to a universalset of values.We have designed this module to help convey some of these principles of science. We tested this moduleextensively and found it to be effective with high school and introductory college biology students. We hopeyou and your students find these materials interesting and helpful. We welcome your feedback and have provideda response form for that purpose. We look forward to hearing from you.Joseph D. McInerney, Principal InvestigatorB. Ellen Friedman, PhD, Project DirectorBiological Sciences Curriculum Study (BSCS)Summary of ContentsThe module contains two major components. The first is the Overview for Teachers, which introduces themodule, describes the Human Genome Project, and addresses issues in the philosophy of science and someof the ethical, legal, and social implications (ELSI) of research in genetics. This Overview also provides a surveyof fundamental genetics concepts and of new, nontraditional concepts of inheritance. The second component,Classroom Activities, provides six instructional activities appropriate for high school or introductory collegestudents. The first section of this component also is addressed to teachers; it contains specific suggestionsfor teaching each activity, including an annotated set of student materials. The other two sections of ClassroomActivities are to be photocopied and distributed to students. Use of instructional Activities 1-5 requires thatstudents have completed a basic study of genetics such as is found in an introductory biology course.iv

Evaluation Form forThe Puzzle of Inheritance: Genetics and the Methods of ScienceYour feedback is important. After you have used the module, please take a few minutes to complete andreturn this form to us. (BSCS, Attn: HGN3, 5415 Mark Dabling Blvd., Colorado Springs, Colorado 80918-3842)1. Please evaluate the Overview for Teachers by marking this form and providing written comments or suggestionson a separate sheet.Sections used not helpful very helpfulI. Introduction 1 2 3 4 5II. The Human Genome Project 1 2 3 4 5III. The Methods of Science 1 2 3 4 5IV. ELSI: Ethical, Legal, and Social 1 2 3 4 5Implications of Nontraditional InheritanceV. Genetics: Basic Concepts and 1 2 3 4 5Nontraditional InheritanceGlossary 1 2 3 4 52. Please evaluate the Classroom Activities by marking this form and providing written comments or suggestionson a separate sheet. Rate activities for their effectiveness at teaching NMS (nature and methods of science)concepts or genetics concepts.Activities used NMS Concepts Genetics Conceptsnot helpful very helpful not helpful very helpfulEngage Activity 1 2 3 4 5 1 2 3 4 5Activity 1 1 2 3 4 5 1 2 3 4 5Activity 2 1 2 3 4 5 1 2 3 4 5Activity 3 1 2 3 4 5 1 2 3 4 5Activity 4 1 2 3 4 5 1 2 3 4 5Activity 5 1 2 3 4 5 1 2 3 4 53. What are the major strengths of this module?v

4. What are the major weaknesses of this module?5. Please rate the overall effectiveness of this module: not effective very effective1 2 3 4 56. Please provide a description of the classes in which you used this module: (circle response)College: 2 year 4 year High school: grade 9 10 11 12Freshman Sophomore Junior Senior Level of class: basic honors 2nd yearHow many students used the module? ________How many students per class? ________Ethnicity: approximate % of minorities: ________________________________________________________Description of school: ______________________________________________________________________College: liberal arts science High school: urban suburban rural7. Have you used BSCS materials before? ❒ yes ❒ noHave you used the first BSCS genome module, Mapping and Sequencing the Human Genome: Science,Ethics, and Public Policy? ❒ yes ❒ no. If yes, please provide on a separate sheet feedback that youthink will help us if we revise that module.Have you used the second BSCS genome module, The Human Genome Project: Biology, Computers, andPrivacy? ❒ yes ❒ no8. Please provide your name and contact information below:Name _____________________________________________________________________________________School ____________________________________________________________________________________Mailing address _________________________________________________________ ❒ home or ❒ work______________________________________________________________________________________________________________________________________________________________________________________Phone__________________________________________________________________ ❒ home or ❒ workFAX_____________________________________________________________________ ❒ home or❒ workE-mail address______________________________________________________________________________Was the address on your mailing label for receipt of the module correct? ❒ yes❒ novi

ContentsForeword and Summary of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ivEvaluation Form. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vOVERVIEW FOR TEACHERS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1Section I: Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3Section II: The Human Genome Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9Section III: The Methods of Science. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13Section IV: ELSI: Ethical, Legal, and Social Implications of Nontraditional Inheritance. . . . . . . . . . 25Section V: Genetics: Basic Concepts and Nontraditional Inheritance . . . . . . . . . . . . . . . . . . . . . . . 33Glossary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55References and Related Literature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61CLASSROOM ACTIVITIES. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Teacher Pages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67Engage Activity: Scientific Investigation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69Activity 1: Standing on the Shoulders of Giants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73Activity 2: Puzzling Pedigrees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89Activity 3: Clues and Discoveries in Science. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99Activity 4: Should Teenagers Be Tested for the Mutant HD Gene?. . . . . . . . . . . . . . . . . . . . . . . . . 111Activity 5: What Do We Know? How Do We Know It?. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119Special Copymasters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127Activity 1: Standing on the Shoulders of Giants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129Activity 2: Puzzling Pedigrees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141Activity 3: Clues and Discoveries in Science. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149Activity 4: Should Teenagers Be Tested for the Mutant HD Gene?. . . . . . . . . . . . . . . . . . . . . . . . . 163Student Pages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165Engage Activity: Scientific Investigation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167Activity 1: Standing on the Shoulders of Giants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169Activity 2: Puzzling Pedigrees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173Activity 3: Clues and Discoveries in Science. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177Activity 4: Should Teenagers Be Tested for the Mutant HD Gene?. . . . . . . . . . . . . . . . . . . . . . . . . 181Activity 5: What Do We Know? How Do We Know It?. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183vii

Overviewfor TeachersThis component introduces the module and provides adiscussion of the Human Genome Project, the methods ofscience, and related ethical issues. It also reviews basicconcepts in genetics, including some nontraditionalexplanations of inheritance.

Section I:Introduction“Discovery is to see what everyone elsehas seen, but think what no one elsehas thought.”Albert Szent-GyörgyiDevelopment of this curriculum project for highschool and college biology classes grew out of theHuman Genome Project (HGP), described in SectionII of the O v e rview for Te a c h e r s. The HGP, a 15-year project, is an important step in our pursuit ofknowledge about inheritance and about the role ofgenes in a variety of biological processes rangingfrom evolution to human health and diseases.Although the HGP is not conceptually novel, it providesa new level of understanding through itsscope: a well-organized collection of genetic informationnow brings within reach many questionsthat previously were unaddressable. The motivationbehind the HGP, then, is twofold. It is drivenby the need for basic knowledge (a database containingmaps and sequence data for entiregenomes), and it is driven by applications of thisknowledge, such as clinical studies. Not only doesthe HGP contribute to discoveries about genetics,it also is a significant landmark in the history of science.It involves a large-scale collaboration of manyindependent groups of scientists, and each groupis interdisciplinary. Large scientific collaborationsare not new—the physics installation near Geneva,Switzerland (CERN, the European Center forNuclear Research) is one such example—but verylarge collaborations are unusual.The primary job of HGP scientists is to locate andidentify all the information stored in the humangenetic material. (A photomicrograph of all 46human chromosomes is presented in Figure 1.) Inaddition, the HGP will study the genomes of a varietyof nonhuman organisms.The HGP offers a fine opportunity to witness thedynamics of science. Those responsible for the stru c-ture of the HGP recognized that the impact of thislarge project will extend far beyond the genetics dataalone, and they established the Ethical, Legal, andSocial Implications (ELSI) component of the projectto address these concerns. ELSI provides a mechanismto inform the public about the discoveries ofthe HGP and offers a way for the public to voice itsinterests and concerns about this work during themany years of the project. As part of the ELSI effort ,the U.S. Department of Energy (DOE) has funded thedevelopment of this educational module, The Pu z z l eof Inheritance: Genetics and the Methods of Science,by the Biological Sciences Curriculum Study (BSCS).3

Section I ■ Introductiondevelopment for teachers who want to expandtheir understanding of the methods of science,of ELSI topics and their application to the classroom,and of a variety of nontraditional explanationsof inheritance. The O v e rview for Te a c h-e r s provides a discussion of this inform a t i o n ,and use of the Classroom Activities c o m p o n e n tof the module provides experience in communicatingsome of these topics. For some teachers,the activities-based approach to teachingalso will be new.Figure 1 A human karyotype: This photomicrographshows the full complement of 46 human chromosomesarranged by size, banding pattern, and chromosomenumber. Notice that there are two copies of each of the22 autosomes plus one copy of each type of sex chromosome(X and Y); this individual is a male.GOALS FOR THE MODULEThis module is designed to meet the following goals:■ The Nature and Methods of Science (NMS)The first goal is to involve students in classroomactivities that require explicit opportunities toapply scientific methods in a thought-provokingcontext, rather than as a cookbook-style list ofsteps. Students will glimpse the overarchingnature of science in the process.■ Concepts in Genetics The second goal is toupdate the genetics curriculum to include someof the nontraditional concepts of inheritancethat address processes not adequately explainedby classical Mendelian genetics. It is, of course,our view of inheritance that is “nontraditional”rather than the genetic mechanisms themselves.Indeed, some nontraditional topics, such asmitochondrial inheritance and genomic imprinting,are widespread phenomena.■ Professional Development A third major goalis to provide an opportunity for professionalOur rationale for these goals lies in the import a n c eof a scientifically literate public and in the need forc u rriculum materials that support an inquiry- b a s e dapproach to understanding the nature and methodsof science. In addition, we recognize thatalthough teachers have a perpetual need to ke e pabreast of new scientific knowledge, they have limitedtime to seek it out. We combined these goalsbecause recent discoveries of nontraditional modesof inheritance exemplify the processes scientistsuse to test and expand scientific explanations.When coupled with selected episodes from the histo ry of genetics, these newly discovered mechanismsof inheritance can provide compellinglessons in the nature of science.“We can never require that science beproductive; we can only require that itbe sound.”J. Michael BishopAlthough this module touches on the history ofgenetics, particularly in Activities 1 and 3, we feltthat we could not adequately present the history,the methods, and the overarching nature of sciencein one module. For this reason, we selected themethods of science as the main focus of our firstgoal, and we chose to present, to a lesser extent, thebroader view of the nature of science as an endeavorwith cultural ties. If you have time, we encourageyou to extend your study of biology to include theh i s t o ry of genetics. If you choose to expand yourtreatment of the history and nature of genetics orother aspects of biology, you may find the publicationtitled Teaching About the History and Nature4©1997 by BSCS.

Introduction ■ Section Iof Science and Te c h n o l o g y (Social Science EducationConsortium and BSCS, 1996 1 ) useful to yourplans. Students need to see that modern science isnot “better than”—or indeed qualitatively differentfrom—science of the previous several decades. Ourlimited presentation of some aspects of the historyof genetics emphasizes that history extends beyondnames and dates. Students can appreciate that currentscientific knowledge is the product of an intellectualexploration, and one that continues tochange. This module lets students see that scientificknowledge changes according to rigorous criteria,not by the whim of an influential individual or bypopular consensus.These materials were designed and written by curriculumdevelopers at BSCS working with an extern a lwriting team and with the guidance of an advisorycommittee. In addition to external reviews by a groupof specialists in teaching, bioethics, philosophy of science,and genetics, all materials in this module haveundergone extensive, formal field testing to ensuretheir efficacy in the classroom (see Figure 2). Themodule was tested with more than 1,000 students at14 high school and 2 college sites in the United Statesand Canada. Other high school and college teachersi n f o rmally tested specific components of the module.We used the large body of evaluation data—combinedwith direct observations from site visits, externalreview data, and the recommendations of oura d v i s o ry committee—to guide the revision (and insome cases rewriting) of the field-test materials inpreparing this final version of the module. The modulewill be distributed free of charge to tens of thousandsof high school and college biology teachersthrough the support of DOE.HOW TO USE THE MODULEThis module provides a detailed discussion for teachers(the O v e rview for Te a c h e r s) and six activities forstudents, complete with background material and suggestionsfor teaching (the Classroom Activities). Thematerial contained in the O v e rview for Te a c h e r sis foryour own use. It may extend your experience and thusFigure 2 Field-test orientation: Teacher and writerJohn Zola conducts Activity 5 in an orientation session forfield-test teachers at BSCS.be helpful for teaching the activities, but it is not essentialto your use of the instructional activities. Figure 3shows the layout of materials in these two components.Notice that within the Classroom Activities w eprovide these sections: the teacher pages (includingannotated student material), special copymasters foreach activity, and the regular student pages.A summary of the six activities is provided in Figure 4.Notice that these include a brief activity to introducethe methods of science (Engage Activity) and fivemore classroom activities that combine experiencewith scientific methods and genetics topics. Time maynot permit you to teach all six activities. We recommendthat you introduce the module with the EngageA c t i v i t y. You can use it early in the term, immediatelyprior to studying genetics, or immediately prior to1Available from Social Science Education Consortium, Inc., P. O. Box 21270, Boulder Colorado 80308-4270; ISBN 0-8 9 9 9 4 - 3 8 6 - 1 .5©1997 by BSCS.

Section I ■IntroductionOverview for TeachersI IntroductionII The Human Genome ProjectIII The Methods of ScienceI V ELSI: Ethical, Legal, and Social Implicationsof Nontraditional InheritanceV Genetics: Basic Concepts andNontraditional InheritanceIIIClassroom ActivitiesTeacher PagesEngage, Activities 1-5Special CopymastersActivities 1-4III Student PagesEngage, Activities 1-5Figure 3 The module at a glance: The module consistsof two large components, the Overview for Teachersand the Classroom Activities.using the other activities in the module. For the majorp a rt of the module, choose any or all of Activities 1-5.We present them in the recommended sequence, buteach activity is autonomous, and you can use theactivities effectively in a different order. If you teachActivity 4 without Activity 3, you may need to augmenti n f o rmation about trinucleotide repeats; if you teachboth activities, keep them in sequence. The final activit y, Activity 5, provides the best closure for the moduleand can serve as a perf o rmance assessment for evaluatingstudent progress for the module as a whole. Werecommend that you close with Activity 5 regardlessof the other activities you have selected. The timerequired to teach all the activities is approximately 7class periods of 50 minutes each. Please note thatActivities 1-5 require previous knowledge of fundamentalprinciples of genetics.Along with each classroom activity, the module providesbackground material and annotations that offerstrategies for the use of each activity. After you determinethe activities you will use, you will need to copythe student pages, including worksheets and othersupporting material provided as copymasters. Noticethat the section for copymasters (hand-outs used atvarious points during an activity) is separated fromthe section for regular student pages (for which youwill need one copy per student).These materials take a constructivist approach toteaching. (For an introductory discussion of constructivism,see Trowbridge and Bybee, 1990.) Thisapproach is based in part on forming a bridge fromwhat students already know to what they will learn.The approach also helps students to be active partnersin constructing their new knowledge ratherthan being told what they are to learn. The teacherguides students rather than simply telling them. Theconstructivist approach, which encourages inquiry,is apparent in this module in the way students areallowed to arrive at their conclusions in a step-wisefashion. For example, in Activity 2, the students usevarious data to build a concept of inheritance (mitochondrialinheritance) that is new to them. Thisapproach to teaching takes more time than traditionallectures, but it generally leads to longer-lastingresults. In addition, the active participation of studentsduring the learning process increases the likelihoodthat students will apply what they learn tonovel situations.In addition to the Classroom Activities, the moduleprovides a useful resource for teachers in theO v e rview for Te a c h e r s . You can use the O v e rv i e wfor Te a c h e r s as a stand-alone piece or as a supplementto the annotated activities to extend the backgroundmaterial provided for each activity. TheO v e rview discusses some of the interests ofphilosophers of science and of bioethicists. TheO v e rview also describes new discoveries in geneticsthat require nontraditional explanations of inheritance.The various sections of the O v e rview forTe a c h e r s go beyond the presentation of these topicsin student pages. As the Human Genome Projectand other areas of genetics progress, new inform a-tion likely will emerge about the nontraditionalexamples of inheritance presented in this module,and, in time, these topics may become part of thestandard biology curriculum. For now, these examplesnot only entice students (and teachers) withthe prospect of new insights into genetics, they alsodemonstrate how science works.6©1997 by BSCS.

Introduction ■ Section IFigure 4 Summary of the activitiesEngage ActivityStudents are stimulated to think about the methods of science through a simple exercise ofobservation and measurement. This activity does not require knowledge of genetics.Activity 1Standing on theShoulders of GiantsStudents build a logical sequence of milestone explanations of inheritance based on conceptualconnections rather than just chronology. Students also evaluate evidence for credibilityand correlate evidence to milestone explanations. The activity provides a review of fundamentalgenetics concepts and stimulates discussion of the nature and methods of science.Activity 2Puzzling PedigreesStudents study a collection of pedigrees to identify the inheritance pattern in each. Two pedigreesprovide a special challenge: they show a pattern of inheritance that is not readilyexplained by traditional Mendelian concepts. Students formulate hypotheses and collect statisticaldata (coin flips) to test their hypotheses. They also read two brief articles that provideinformation about mitochondrial inheritance to help them build a new explanation. Finally,students record their ideas about the nature and methods of science.Activity 3Clues and Discoveriesin ScienceThis activity is designed as a mystery. The task is to make discoveries about genetic anticipation.Students sort and analyze clues to build two pedigrees, one that shows a family historyof Huntington disease and one for a family affected by myotonic dystrophy. Studentslook for patterns of disease onset and correlate those to molecular data related to trinucleotiderepeats, thus building a nontraditional explanation of inheritance.Activity 4Should Teenagers Be Testedfor the Mutant HD Gene?The class reads a letter about the policy of withholding tests for Huntington disease fromasymptomatic minors and conducts an ethical analysis in the form of a debate about thevalue of this policy.Activity 5What Do We Know?How Do We Know It?The module concludes with a discussion of the differences between pseudoscience and science,using popular science and health claims. Students focus on observations about themethods of science made throughout the module. This activity provides a performanceassessment for the entire module.7©1997 by BSCS.

Section II:The HumanGenome Project“These are exciting and challengingtimes for biological researchers. Thewealth of information and capabilitiesnow being generated by the variousgenome projects and other biologicalendeavors will lead over the next twodecades to more insights into livingsystems than have been amassed in thepast two millennia. Biology is tru l yu n d e rgoing a revolution.”David A. Smith(retiring director, Health Effects and Life SciencesResearch Division, Office of Health and EnvironmentalResearch, DOE, 19 December 1996)At the time this module was being developed, in thewinter of 1996, the U.S. Department of Energy(DOE) held the fifth annual Contractor- G r a n t e eWorkshop. The workshop provided an opportunityfor participants in the Human Genome Project(HGP) who are supported by DOE to report on anddiscuss their progress. Through a series of brief oralpresentations and poster displays, participants builta picture of the current state of the project and discussednew collaborations that will further the effort.One of the most obvious characteristics of the eventwas the sense of cooperation among participants.The group was diverse, comprising geneticists andmolecular biologists, biochemists and physicalchemists, computer scientists, engineers, judges,lawyers, educators, and genetic counselors. Thenature of the project requires the expertise of individualsfrom many disciplines, and the HGP hashelped to spawn new areas of study, such as informatics,and new technologies, including capillarybasedequipment for multiplex DNA sequencing.Here, we offer a brief overview of some key featuresof the work. 2WHAT IS THE HUMAN GENOME PROJECT?The Human Genome Project is a large, intern a t i o n a l l ycoordinated effort in biological research directed atcreating a series of maps of the DNA of humans andseveral other species, with each map providing greaterdetail (resolution). Figure 5 shows the rate of progress2A more detailed description of the fundamental techniques and background for the HGP is available in the first twogenome curriculum modules that BSCS developed through DOE funding. The first module is a print curr i c u l u mtitled Mapping and Sequencing The Human Genome: Science, Ethics, and Public Po l i c y. The second module, T h eHuman Genome Project: Biology, Computers, and Privacy, combines print and soft w a r e .9

The Human Genome Project ■ Section IIFigure 6 Human Genome Program Centers (as of June 1996)Baylor College of MedicineCenterResearch FocusPhysical mapping; emphasis on chromosomes 6, 15, 17, XChildren’s Hospital of Philadelphia Genetic and physical maps of chromosome 22Lawrence Berkeley LaboratoryPhysical map of chromosome 21; improvements in sequencingautomation and informaticsLawrence Livermore National LaboratoryGenetic and physical maps of chromosome 19 (completed)Los Alamos National LaboratoryMaps of chromosome 16; techniques for high-speed mapping andsequencing (completed)Stanford University Maps of chromosome 4University of California, Berkeley,Drosophila Genome CenterPhysical map of the Drosophila genomeUniversity of Iowa CooperativeHuman Linkage CenterExpansion of the genetic linkage map for the entire human genomeUniversity of Texas Health Science Maps of chromosome 3Center at San AntonioUniversity of UtahDevelopment of genomic technologiesWashington University School of MedicineMaps of chromosomes 7 and X; sequencing of C. elegans genomeWhitehead Institute for Biomedical Researchand Massachusetts Institute of TechnologyMaps of the mouse genome; STS map of the entire human genomeE. coli Genome Project, University of Wisconsin Sequencing the chromosome of Escherichia coliHuman Genome Program Centers help focus andcoordinate the work. Involvement of different centerschanges as the project proceeds. Figure 6 listssome of the genome centers and the focus of theirwork. For an update, consult the DOE web site athttp://www.ornl.gov/hgmis or the NIH web site athttp://www.nchgr.nih.gov.In addition to direct efforts to map and sequencep a rticular human chromosomes or those of modelorganisms, these centers improve existing technologiesand develop new technologies to increase thespeed, accuracy, and cost-effectiveness of the HGP.These centers also act to stimulate and coordinatecollaboration among investigators not formally associatedwith the HGP. The work is not limited to theUnited States. The Human Genome Organization(HUGO), formed in 1988, coordinates intern a t i o n a lscientific collaboration between Canada, the UnitedStates, Italy, the United Kingdom, France, the Commonwealthof Independent States, the EuropeanC o m m u n i t y, and Japan. The United Nations Educational,Scientific, and Cultural Organization11©1997 by BSCS.

Section II ■ The Human Gemone Project( U N E SCO) promotes the continued involvement ofdeveloping nations in genome activities and alsos u p p o rts international conferences and exchanges.HOW IS THE HUMAN GENOME PROJECTRELATED TO THE NATURE OF SCIENCE?As David Smith’s quote (p. 9) indicates, the HumanGenome Project is expanding our collection of geneticdata enorm o u s l y. Simply mapping and sequencingthe entire human genome will not, however, provideus with answers to all of our questions about genetics.Knowing the sequence of a stretch of DNA or itslocation on a given chromosome does n o t reveal thesignificance of the region. If the region encodes protein,the DNA sequence will predict accurately thec o rresponding amino acid sequence of the protein,but neither sequence will tell us the biological functi o n of the protein in the absence of additional data.Fo rt u n a t e l y, much is known about the biologicalfunction of various proteins, and data are accumulatingrapidly. With the foundation of a detailed andorganized bank of genome data, biologists can const ruct a more complete picture of living systems.Although the HGP will not answer all questions aboutgenetics, it will provide an invaluable databank. Inaddition, as they collect data, researchers have madeand will continue to make discoveries about specificgenes, the organization of genetic information, evolu t i o n a ry relationships at the molecular level, andnew technologies in laboratory and computer applications.The genome map and sequence data wills e rve as powerful tools for future research in genetics,evolution, and medicine, in this way fueling thework of scientists in years to come.The HGP also provides a classic demonstration ofthe nature and methods of science. For example, theHGP shows one aspect of the nature of science—intermarriage of technology and science—in severalways. The decision to begin the HGP was based inpart on the availability of new technologies forcloning and sequencing DNA and for storing andanalyzing huge amounts of map and sequence data.The HGP continues to pursue and produce impressivenew technologies for these purposes.The HGP illustrates the power of cooperationamong groups of researchers and among professionalswho have different types of expertise. This largeproject shows the way in which new work is built onold work. The vast pre-existing body of knowledgeabout the behavior and location of many genes inthe organisms being studied is a critical resource forthe mapping and sequencing of the genome of eachof these species.The existence of the ELSI program is testimony tothe social context of scientific research. Society’sconcerns about genetic disorders such as cysticfibrosis and Huntington disease help to guide decisionsabout those areas of research that the HGP willsupport and pursue. In addition, the ELSI componentof the HGP shows the concern of the project’sdirectors and participants to acknowledge andexplore the impact of this work on society.(Reports on progress in specific scientific and ELSIareas of the HGP show the rapid change in knowledgeas a result of this work. A special Genome Issueof the publication Science [Vol. 274, 25 October1996] provides the latest available update as thismodule goes to press.)12©1997 by BSCS.

Section III:The Methodsof Science“The power of accurate observation isoften called cynicism, by those who donot possess it.”George Bernard Shaw“The goal of science is not to open thedoor to everlasting wisdom, but to seta limit on everlasting error.”Galileo,in the Bertolt Brecht play, GalileoAs thinking organisms, humans constantly observeand consciously interpret the world around them.Science offers a rigorous method of investigating thenatural world, a method that is based on carefulo b s e rvation and well-reasoned argument thatincludes the formation and testing of hypotheses.Science has demonstrated remarkable power todescribe the natural world accurately and to identifythe underlying causes of natural phenomena.TREATMENT OF THE METHODS OFSCIENCE IN THIS MODULEScientific knowledge endures because of thestrength of the methods used to obtain it. Thei n s t ructional activities provided by this moduledemonstrate the durability of scientific concepts andscientific methods. Some activities deal with geneticsconcepts never mentioned or observed by GregorMendel in his nineteenth-century work, yet thesenew discoveries also involve the fundamental principlesof genetics that he did report. New discoveriessometimes refute pre-existing scientific explanationsof natural processes, but much more often theyrefine or expand prior knowledge. New work generallybuilds on old work rather than razing the site.Too often the methods of science are presented as aset of steps to be memorized. Students recite themby rote, with little understanding and less application.This module takes a very different approach,providing activities that help students experiencethe methods of science and connect these methodswith events in their own lives. Presentation of themethods of science is interwoven into the learningexperience that reveals new concepts in genetics.Activity 5 is designed specifically to help studentsconnect their science process skills with familiarevents outside the classroom.THE GOALS OF SCIENCE ANDMETHODS USED TO MEET THEMIn this section of the module we present a discussionof the goals of science in order to provide a contextfor the discussion of scientific methods. In addition,13

Section III ■ The Methods of Sciencewe discuss the rationale for, and benefit of, the rigorouslydisciplined methods of science. The initialdiscussion of the nature and methods of science(NMS) is framed around six questions, summarizedin Figure 7. These questions reappear in variousways throughout the student activities and are usedfor student assessment in Activity 5.This discussion of the methods of science is notexhaustive; rather, it builds a view of science in thelanguage of questions and concerns that arise in thelaboratory and in the classroom. Please keep in mindthat this view of science is not new; early geneticistsused these methods, for example. The fact thatMendel used rigorous scientific methods and criteriato guide his work is the reason that MendelianFigure 7 A snapshot of the goals and methods ofscience1. What does science try to do?■ Science tries to provide causal explanations fornatural phenomena.2. How do we know that causal explanations are onthe right track?Causal explanations are on the right track when■ they demonstrate predictive power;■ other observations (evidence) rule out competingcausal explanations.3. What counts as evidence in science?Evidence in science includes■ empirical data;■ existing explanations about related phenomena thatare supported by independent data.4. What makes science objective?■ Science is conducted by a rigorous set of methods.■ Authority and fame by themselves are not sufficientto establish the scientific validity of an explanation.5. How and why does scientific knowledge change?■ Scientific explanations always are open to change.■ New evidence may show that an existing explanationis inadequate and that it needs to change.6. What is the difference between pseudoscienceand science?■ Pseudoscience fails to meet the intellectually rigorousrequirements of science.■ Internal consistency sets scientific knowledge apartfrom pseudoscience.genetics continues to provide reliable explanationsfor many of the fundamental processes of inheritance.These same methods that have recentlybrought to light some intriguing “nontraditional”explanations of genetic mechanisms will guidefuture scientists to new discoveries that will continueto change our understanding of inheritance.1. What does science try to do?■ Science tries to provide causal explanations fornatural phenomena.Science is an organized pursuit of knowledge pertainingto natural processes. Often, science seeks toprovide causal explanations of those processes.(Another term for a scientific explanation is “hypothesis.”A hypothesis is a scientific explanation that isbased on evidence, that is intended to account forsome aspect of a natural process, and that can betested.) A causal explanation proposes an account ofthe processes and mechanisms that produce a givenbiological phenomenon. One must establish a logicalor meaningful connection between a phenomenonand the event purported as its cause, and this connectionis made through observation, through testing(which often includes experimentation), and,often, through statistical analysis. These rigoroussteps are necessary to distinguish the actual causesfrom randomly or coincidentally associated events.It is not easy to establish causality. People who donot employ scientific reasoning, however, sometimesmistakenly assume that one event is the causeof a second event solely because it precedes the secondevent. Science requires a much stronger associationto establish a causal process. A classic examplefrom folklore states that eating strawberries whilepregnant can cause birthmarks on one’s newbornchild. The timing of the putative cause (eating strawberries)precedes the observed result (birthmark),but there is no credible and relevant evidence tosupport the first event as a cause of the second one.Constant and regular temporal association of eventss u p p o rts the proposal of a causal relationship, but sciencerequires further analysis. Geneticists use statisticalmethods to test large sets of evidence to determinewhether their regular and constant associationoccurs more frequently than chance would predict.Scientists also look for a step-wise biological process14©1997 by BSCS.

The Methods of Science ■ Section Ithat starts with the cause and ends with the observ e deffect. An example is a mutation in the gene phenylalaninehydroxylase. If an individual is homozygousfor this mutation, the enzyme will be deficient, blockingthe metabolism of phenylalanine to tyrosine.Phenylalanine is converted through an alternate pathwayto phenylpyruvic acid and other metabolites thatcan cause mental retardation, one symptom of thedisorder phenylketonuria (PKU). The associationsbetween these steps are well established; they constitutevalid evidence for the genetic causation of PKU .Evidence for a causal relationship also is strengthenedwhen it is observed by more than one person andwhen other lines of evidence point to the same conclusions.A good explanation of causation also displaysthe power to predict the outcome of related eventsa c c u r a t e l y.The causes of biological phenomena are complexand diverse, and we build our understanding ofthem in stages. Explanations often begin withsimple, accurate observations that do not immediatelyattempt to address causation. This point isbrought out for students in the Engage Activity ofthis module. Generally, however, scientists are lookingfor clues to the mechanisms that underlie specificbiological processes, and they begin to build anunderstanding of these processes by explainingwhatever mechanisms are accessible to their observationat a given time. This approach is analogous toteasing out the threads in a knot; it is easier andmore efficient to attack the knot bit by bit ratherthan trying to untie it all in one motion.The more fully we identify various aspects of thecauses of a given phenomenon, the more we reinforcethe validity of our explanation. As we unravelnew layers in a scientific puzzle, through new observationsor new reasoning, we test new explanationsagainst existing knowledge. If a new explanation isconsistent with previous knowledge, then the newwork reinforces the validity of the earlier work. If,however, the new explanation is not consistent withextant knowledge, we must either discard the newexplanation, or revise the prior knowledge.One key point to consider for students is their perceptionof the word “theory. ” Students often mistakenlythink that this word means about the same as anephemeral guess or a hunch; they see a theory as anunsubstantiated idea. A reference called Usage andAbusage, A Guide to Good English ( Pa rtridge, 1994)states that “theory is occasionally used loosely. . .where e x p e c t a t i o n or o p i n i o n would be preferable.”For instance, a student might say, “In theory, I shoulddo well on tomorr o w’s test.” The actual meaning of at h e o ry in a scientific context is very different, andyou need to emphasize this point explicitly for students.A theory, as scientists use the term, refers to alarge-scale explanation, or series of explanations, thatdescribes the causes of many natural processes(Rosenberg, 1985). An accepted scientific theory isv e ry well substantiated by evidence, it has been builtlogically upon valid assumptions, and it has beenextensively tested. If a theory were not substantiated,it would not be taken seriously by the scientific commu n i t y, no matter who proposed it. A scientific theoryis not established nor refuted on the basis of personalopinion that fails to follow the discipline ofscientific methods; rather, a theory is an explanationof far-reaching significance so well tested and suppo rted by such an abundance of credible evidencethat it becomes a broadly accepted and fundamentalscientific concept. There are a number of powerf u ltheories in biology: for example, cell theory, chromosometheory, germ theory, and the theory of evolution.Each is supported by overwhelming amounts ofevidence. The following discussion describes the roleof evidence and testing in the process of building scientificexplanations.2. How do we know that causal explanationsare on the right track?Causal explanations are on the right trackwhen■they demonstrate predictive power;■ other observations (evidence) rule out competingcausal explanations.The short answer is that explanations are on theright track when they enable us to predict what wecan later observe. This simple statement describes apowerful property of scientific explanation. By “predict,”scientists mean something very specific: theability to describe accurately and in precise detail anoutcome of a particular natural event based on theexplanation of the cause or causes of that event.Observation confirms the accuracy of the prediction.15©1997 by BSCS.

Section III ■ The Methods of ScienceFor example, if we hypothesize that a particular DNAsequence functions as an enhancer of transcription,we might predict that inserting that sequence nextto a gene will increase the amount of messenger RNAproduced from that gene. This outcome is testable,observable, and, indeed, quantifiable. If the amountof RNA does increase, this observation reinforces thehypothesized causal role of the enhancer sequence.Prediction in the scientific sense need not be solelyabout future events. Instead, we can ask whether aproposed causal explanation would have predictedphenomena that have already happened and can beobserved. By “predict” we mean that the explanationis consistent with the observed outcome. For example,the explanation of genetic code lets a scientistpredict how a particular point-mutation in a DNAsequence will have altered the amino acid order inthe encoded protein. By checking the actual aminoacid sequence of the mutant gene product, theresults can confirm or refute the predictive power ofthe explanation.Although accurate prediction helps to validate thatan explanation is on the right track, an accurate predictionis not by itself sufficient for this purpose.Two other criteria are important: a) we must ru l eout competing explanations of what we observ ebefore we can be confident that we have the corr e c tcause, and b) we must ensure that the proposedcausal explanations are consistent with what weknow about related biological processes or otherareas of knowledge, such as chemistry or physics. Insome cases, only a partial answer is possiblebecause the available data provide insight into a limitednumber of possible explanations. Perhaps theinvestigator can eliminate all but two or three explanations.Such scientific work has considerable valuein that it simplifies the questions to be addressed infuture work and allows scientists to focus theirenergies and resources on the most promising linesof inquiry.Ideally, competing explanations will be inconsistentwith the observed data, but still other criteria mustbe met before we can accept an explanation as valid.A proposed causal hypothesis that predicts the databut that is highly implausible on other grounds is notwell confirmed. In other words, a valid explanationmust be based on the combination of credible evidencethat is relevant to the hypothesis in question,on sound reasoning, and on reliable assumptions.Here, “relevant” means that the evidence has a rigorousconnection with the idea being tested, eitherto support or refute it. A conclusion or inference thatdoes not follow from the premise is a non sequitur,and it is not relevant evidence. An example of correctbut irrelevant evidence is found in Activity 1 withregard to sex determination; the observation thathuman females produce fewer gametes than dohuman males is correct, but it does not address theissue at hand.In summary, we know a scientific explanation is onthe right track when we can answer “yes” to the followingquestions:■Does the proposed causal mechanism predictwhat we observe?■ Does no other causal mechanism predict or fitwith that data?■ Is our hypothesis reasonable given scientificallyreliable knowledge about other related areas ofbiology (or any other science)?“The great tragedy of science: abeautiful hypothesis destroyed byan ugly fact.”T.H. HuxleyOne of the strengths of a scientific explanation is thatit is testable. Indeed, explanations that cannot betested do not count as scientifically valid. The ideasdiscussed in the preceding paragraphs explain whycontrolled experiments are important, particularly toestablish a causal relationship. If we propose that Acauses B, in the ideal case we would like to holdeverything fixed or unchanged except A. Then wecan change or manipulate A and observe the consequences.If B changes only when A does, we havegood evidence that A causes B.Controlled experiments in the laboratory attempt toget as close to the above ideal as possible, althoughno laboratory experiment literally controls or holdsfixed every possible confounding factor. For example,if you were studying the effects of light on plantgrowth, you might design an experiment in whichyou keep water and temperature constant and vary16©1997 by BSCS.

The Methods of Science ■ Section IIIlight intensity. You have not, of course, controlledpotential fluctuations in seismic activity, air pollution,or solar flare activity. Only the major and obvious factorsare addressed. Moreover, laboratory experimentsare not the only way to answer scientific questions.Observation of naturally occurring events,without manipulation by the investigator, can helpd e t e rmine the extent to which an explanation is onthe right track. In short, nature provides us with “naturalexperiments.” These kinds of tests are widespreadin science—cosmology and astronomy rely onthem heavily, as does, of course, biology. Often, studentsthink of evidence as being exclusively the property of manipulated experiments. It is important tohelp students appreciate the power of careful observationof natural events. Much of the initial work ofmapping and sequencing in the Human Genome Projectis essentially observational.3. What counts as evidence in science?Evidence in science includes■empirical data, and■ existing explanations about related phenomenathat are supported by independent data.Evidence in science is based on rigorous observationsthat must meet the criterion of being publiclyobservable. The fact that others can confirm orrefute what you claim to observe provides a crucialtest of the scientific validity of your explanation.Rumor, speculation, mystical experiences, and otherunsubstantiated information are not accepted ascredible scientific data. Students usually can recitethat scientific experiments must be “repeatable,” butit is important to challenge students to describewhat that statement actually means. Experimentalresults that are observable by other investigatorshave the highest scientific merit. If an experiment orobservation is repeated by the same or another person,and if the resultant data are the same, the credibilityof that evidence improves.Evidence is more compelling in its ability to supportan explanation when the following are true:a. An explanation is strengthened when we havemultiple lines of evidence—that is, when we haveevidence from different sources. Different lines ofevidence for the same hypothesis reduce the likelihoodthat we ignored confounding factors orthat we spuriously concluded that our hypothesispredicts the observable data.b. The more precise our data are and the more preciselyour causal hypotheses predict what weo b s e rve, the stronger is our evidence. To meetthese conditions, a hypothesis must be stated carefu l l y, particularly avoiding a focus that is too broad.If the scope of a hypothesis is excessive, too manyfactors come into play, and it is difficult to designmeaningful tests that rule out confounding causes.That is why one of the most important skills in scienceis the ability to ask a good question, that is, aquestion that is precise and that one can investigateby focusing on one or a few variables. Fo rexample, although biologists investigate the natureof life, they do not conduct experiments that askthe broad question, “What is life?” They ask, rather,more concise questions that address componentsof the larger question. For example, these questionsare more addressable:■ What are the major macromolecules found in livingsystems?■ What happens to a cell if we remove its geneticmaterial?■What genes must be present for a cell to functionproperly?Students often have trouble delineating their questionsfor term papers or science fairs. You shouldhelp them understand that good science begins witha good question.In addition, if our data are imprecise, then we shouldhave less confidence in our conclusions. An impreciseobservation, such as “The bacterial populationincreased quickly,” is much less useful than is a quantitativeobservation, such as “The population sizedoubled in 33 minutes.” A hypothesis may fail to predictthe observed data because those data are inaccurate.If a hypothesis fits with data we know to beinaccurate, we must lose confidence in the validity ofthe hypothesis in question.c. Evidence also comes from the application ofknowledge gained through previous work.Hypotheses that already have been tested successfullycan and should be used as background knowledgefor testing the validity of new causal explanations.A successful test provides reinforcement of17©1997 by BSCS.

Section III ■ The Methods of Scienceprevious conclusions at the same time that it helpsto establish the new idea. A test that fails shouldlead us to re-examine the old, as well as the new,idea. This situation should cause us to considerm o d i fying existing concepts if sufficient data warrantthe change. Scientific hypotheses usuallym a ke reference to other scientific explanations,and consistency between explanations is required.Indeed, internal consistency of scientific explanationsis an important criterion for validity.4. What makes science objective?■ Science is conducted by a rigorous set of methods.■ Authority and fame by themselves are not sufficientto establish the scientific validity of anexplanation.The world exists, regardless of our knowledge of it; sciencestrives to achieve a description of the naturalworld that accurately reflects reality. A scientist maywant to believe that his or her preferred hypothesis isc o rrect, but nature does not have to cooperate. Scientificmethods are designed to make the corr e l a t i o nbetween reality and our descriptions of reality as closeas is possible, considering that the descriptions arebuilt by humans with limited senses and within the limitedtime available to explore the universe. Scientificunderstanding of a natural process usually is built instages. For example, investigators recognized the existenceof blood as a liquid and the presence of cellsfloating in that liquid before they identified hemoglobinas the molecular carrier of oxygen in red bloodcells. Each stage of investigation narrowed the gapbetween the reality of how oxygen was being transpo rted and our knowledge of that process. The earliestviews were incomplete, but the fact that they werederived using rigorous scientific criteria resulted intheir durability: liquid blood in our vessels does,indeed, carry oxygen throughout the body, and continuedresearch has revealed many details of the process.Even when scientists attempt to be completelyobjective, they may find it difficult to do so. Oursenses are limited, although technologies greatlyexpand what we can detect. We also are influencedby our emotions, by societal views, by economics,and by job pressures.Scientific theories are built according to a rigorous, disciplinedprocess, but theories may not be perf e c treflections of nature. The possibility for this discrepancyunderlines the need for rigorous criteria in const ruction of scientific explanations. The methods ofscience include the requirement for publicly observableand repeatable evidence, the testing of an explanationby prediction and observation, the connectionbetween existing and new explanations, and therequirement to rule out competing explanations.These methods provide a standard that helps preventindividual scientists from finding only what they w a n tto see, whether consciously through ambition andpride, or subconsciously. The system is not perf e c t .The particular path that discovery takes is influencedby human values, particularly because cultural viewso ften determine to which arenas of work researchfunds will be directed. The methods of science, howev e r, are powerful—though not foolproof—safeguardsthat help to limit the impact of bias and subjectivityin the acquisition and application of scientificknowledge. A system planted on a firm foundation ofvalid premise, sound reasoning, and credible evidencehas the ability to endure.The collective nature of science also encourages objectivityin the field. The results of individual scientists ares c rutinized by the scientific community. Scientistsmust report their findings, and communication mustuse standardized descriptions so that results are meaningfulto any informed person to whom they are communicated.For example, in the Engage Activity of thismodule, students discover that imprecise or nonstandardunits of measure applied to a description of apeanut greatly diminish the ability of that descriptionto help another person to identify the same peanut.Scientific communications are subjected to peerreview in journals and meetings, and the award ofresearch grants also requires assessment by other scientists.In addition, the division of labor in scientificresearch provides further opportunities for critique ofresearch and for the development of multiple lines ofevidence and helps to build a more complete explanation.These procedural requirements contribute to theintellectual discipline and rigor of science.“To punish me for my contempt forauthority, Fate made me an authoritymyself.”Albert Einstein18©1997 by BSCS.

The Methods of Science ■ Section IIIScience is not monolithic; it attempts to be authoritative,but it is not authoritarian. Cert a i n l y, recognitionof an “authority” in a particular area of studyencourages other scientists to pay attention to whatis reported by that individual or research group,but the requirements for supporting evidence andall of the other criteria of valid science still apply. Afamous name in itself does not establish disciplinedmethods or produce the credible evidencerequired to substantiate an idea presented to thescientific community. The rules of science are thesame for everyone, and anyone who proposes anew explanation for a natural phenomenon ultimatelymust answer the same two questions fromany other scientist: “Where are your data?” and“How do you know they are sound?” The establishmentof valid scientific explanations depends uponreview and critique by the scientific community atlarge, but the critique begins with the individual scientist.Scientists are trained to be critics of theirown work. Indeed, the British biologist Pe t e rMedawar noted that “most of a scientist’s woundsare self-inflicted” (Pyke, 1996). In addition, at anygiven time, a minority view on some important scientificconcept usually exists. With time, if sufficientevidence is brought to light, even an unpopularview can be validated.5. How and why does scientific knowledgechange?■ Scientific explanations always are open to change.■ New evidence may show that an existing explanationis inadequate and that it needs to change.Most scientific explanations are reinforced by newo b s e rvations. For example, Mendelian geneticsremains durable because it explains an enorm o u snumber of observed phenomena. Not all aspects ofinheritance are explained adequately, however. Scientistsobserved that, despite the power ofMendelian genetics, these explanations alone cannotexplain phenomena such as variability in onsetand severity of some genetic diseases (geneticanticipation). An explanation for anticipationbecame possible with the discovery of unstabletrinucleotide repeats in mutant genes associatedwith disorders that exhibit anticipation, such asHuntington disease. (See Section V of theO v e rview for Te a c h e r s, page 43, for a detailed discussion.)In this process, geneticists did not rejectMendelian explanations; there was no scientific reasonto do so. Mendelian explanations endured, butgeneticists recognized that these explanations wereincomplete, and they remedied that problem withnew explanations.Because scientific knowledge is dynamic, as geneticsamply illustrates, scientists expect that explanationswill be extended and refined. “Scientists rarely concludethat a question is finally answered or that a naturalphenomenon is completely explained” (AAAS,1989). The corpus of accepted scientific knowledge,however, changes only when rigorous criteria aremet; it is not changed based on whim or to pleaseimportant people.Sometimes, new explanations must await new technology.For example, genetics could explain the generalinheritance of Huntington disease for manyyears before it could explain the variability in the ageof onset and severity of symptoms of this genetic disorder.With the use of molecular techniques forcloning and sequencing DNA, scientists discoveredunstable trinucleotide repeats, thus providing thefoundation of an explanation for genetic anticipation.Future work will pursue a more thoroughexplanation of the mechanisms through which largenumbers of trinucleotide repeats in particular genesbring about genetic disorders; at present our knowledgeis limited to the simple correlation of the presenceof repeats and the disorders.“The domain of ignorance includes allthe things we know we don’t know, allthe things we don’t know we don’tknow, and all the things we think weknow but don’t.”Ann Kerwin6. What is the difference between pseudoscienceand science?■ Pseudoscience fails to meet the intellectually rigorousrequirements of science.■ Internal consistency sets scientific knowledgeapart from pseudoscience.Pseudoscience can be defined as the promotion ofunsubstantiated, allegedly scientific opinions. Some19©1997 by BSCS.

Section III ■ The Methods of Scienceof these opinions may be very appealing and thusthey gain popularity, but they lack supporting, credibleevidence. Pseudoscientific ideas have not beentested reliably. Often, pseudoscientific ideas are builton inaccurate premises, or they do not follow logicallyfrom what is observable. Indeed, pseudosciencecould describe concepts that might be accurate,but the lack of scientific method in thepseudoscientific assertions prevents us from beingable to determine the validity of the ideas beingadduced. Pseudoscience often involves claims forwhich it is almost impossible to provide scientificevidence. Just as a poorly formulated hypothesiscannot easily be tested, pseudoscientific claims usuallyare so vague, ill-formed, and undetailed that theymake no specific predictions and cannot be testedthrough credible experiments.Pseudoscientists are those who refuse to adhere to scientificstandards—they do not try to rule out competingexplanations, they do not subject their results tothe scrutiny of the scientific community, they do notrely on publicly observable data, and they do not testtheir hypotheses against scientific results elsewhere.O ften, ideas based in pseudoscience are inconsistentwith other well-tested concepts. Indeed, pseudoscientificclaims may not be internally consistent. Wi t h o u trigorous criteria for evidence and reasoning, proponentsof pseudoscience are not likely to recognizethese inconsistencies. We may find ourselves drawntoward the ideas put forth by pseudoscientistsbecause they have an emotional appeal, but, when wedo so, often it is because we are being intellectuallyl a z y. Science is not easy, but it does provide soundresults. New scientific findings sometimes challengec o m f o rting, long-standing assumptions about the naturalworld, but scientists must go where the data takethem even if the destination is a bit unsettling. Many ofthe characteristics that establish the overarchingnature of science are summarized in Figure 8.THE STUDENT’S VIEW OF SCIENTIFIC METHODSToo often students see science as either a collectionof facts to be memorized or as a set of experiments,by which students mean manipulations of chemicalsand glassware in a laboratory. Students may not recognizethe rigorous thinking skills that go into thecareful observation, the reasoned explanation, or thedesign and interpretation of experiments as essentialelements in the practice of science. It is possible tohave students experience these and other elementsof scientific investigation by making the thoughtprocesses as evident and important as the processesFigure 8 Some characteristics of the nature of scienceScientific explanations arerooted in causal processes.Scientific knowledge isdurable but dynamic.A historical view of science showssimilarities between biology andother fields of study.Science provides explanations for naturalphenomena.Causal processes are often complexand thus cannot be summarized insimple, universal laws.Scientific explanations are based onevidence.Multiple lines of evidence strengthenan explanation.A scientific explanation is a continuumof understanding that expands as newevidence for causal processes comesto light.Different levels of evidence exist andthus provide different levels of confidencein an explanation.As new evidence appears, scientificexplanations are modified; explanatorypower generally increases through thisprocess.New work builds on old work.Science (at its best) is neither monolithicnor authoritarian.Science is open to new ideas, includingideas initially expressed by aminority of scientists.Scientists expect that explanations willbe extended and refined.Because science is a human endeavor,it reflects human behaviors and limitationsin human abilities.The views expressed in the othercolumns of this figure are true for scienceas a whole, but they may notapply consistently to each individualscientist.Not all good science must be experimental(“bench”) science; observationalstudies often provide powerful lines ofevidence and alter scientific explanations.This especially is the case for historicalsciences such as paleontology.©1997 by BSCS.20

The Methods of Science ■ Section IIIof physical manipulation. The following discussionelaborates four simple components of scientificinvestigation (see Figure 9). Students may benefitfrom your calling attention to these steps. As you doso, however, you should point out that these componentsdo not always—perhaps not even most ofthe time—occur in the sequence indicated. Theprocess is much more fluid than a simple listing ofsteps conveys, and a scientist may be engaged in anyor all of these steps at the same time. In fact, mostscientists probably do not proceed consciouslythrough these steps. It is, rather, their training andthe requirements of scientific validity that lead themto incorporate all of these steps at some point asthey pursue answers to a particular question. Thei m p o rtant point for students, then, is not thatresearch follows some prescribed, lock-step process,but rather that all research embraces the same habitsof mind.Careful and precise observation, coupled with accuratereporting, is a powerful scientific tool. Observ a-tions involve descriptions of events as they occur inthe natural world or as the outcome of experiments.O b s e rvations in science must be as accurate and reliableas possible. Precision in instrumentation is crucial;technology that malfunctions (for example, afaulty DNA sequencing machine or a bug in computersoftware) can lead to inaccurate observations. Reliableobservations are those that are reported bymore than one observer and that are, in principle,replicable by any future observ e r. Reports that cannotbe replicated at present have limited reliability, evenFigure 9 Simplified steps in the process of discoveryDefine a question based on previous knowledge andrigorous observation.Propose a potential explanation (a hypothesis). Thisexplanation must take into account what is alreadyknown, and it must be testable.Test the explanation. If evidence supports it, the explanationgains validity. If evidence does not support theexplanation, the explanation must be abandoned and anew one sought.Test new evidence against existing explanations. Ifcredible evidence shows that existing explanations areinadequate, they must be modified. The new explanationsmust meet scientific criteria, and they will requirerepeated testing to establish their predictive power.though they could be replicated at some point in thefuture. Until that occurs, such reports should playonly a very limited role in scientific investigation.Observations must be done carefully to minimize theeffect of extraneous factors. One must report observationswith precision. An example from Activity 3illustrates these points. If a student reports that aparticular person has a copy of the gene associatedwith Huntington disease containing trinucleotiderepeats, or even that the gene has many trinucleotiderepeats, the information is insufficient toindicate whether the symptoms of Huntington diseaselikely will result. It is more precise and moremeaningful to note that the gene has “more than 40trinucleotide repeats,” because about 40 copies ofthe CAG repeat represent a threshold level thatleaves the region very unstable and generally resultsin Huntington disease. It is even more precise toreport the exact number of CAG repeats, such as 95,thus supplying the data one needs to predict moreaccurately the age of onset of symptoms for the personin question.Careful observations can be the source by which ascientist’s attention is called to a particular problemor unexplained phenomenon. After recognizing aproblem or puzzle, a scientist must formulate atestable question (hypothesis). Often the question isa smaller part of the overall puzzle. Testing thehypothesis comes next, and testing requires additionalcareful observations and reporting. The proposedexplanation generally describes a causalprocess. As scientists pursue explanations for naturalphenomena, they also must take into accountexisting or durable knowledge. Students often aresurprised to learn that the first place to find an explanationor the answer to a question is the library, notthe laboratory. Because reinventing the wheel is nota good use of research time and funds, scientistslook for adequate explanations in the existing,durable knowledge that already has met the rigorouscriteria of scientific validity.The study of Huntington disease offers an exampleof the importance of scientific literature as part ofthe discovery process. Scientists investigating Huntingtondisease read reports that a molecular mechanismhad been found to explain genetic anticipation21©1997 by BSCS.

Section III ■ The Methods of Science(variability in age of onset and in severity of symptoms)for another autosomal dominant disorder,myotonic dystrophy. Sequencing the mutantmyotonic dystrophy gene revealed an expansion inthe number of trinucleotide repeats from one generationof affected individuals to their more severelyaffected offspring. This observation led investigatorsto look for unstable trinucleotide repeats in themutant Huntington disease gene. They tested thechromosomes of individuals known to have Huntingtondisease and confirmed the phenomenon ofexpanded repeats. Note that the establishment ofcausality for genetic anticipation occurred in stages.Scientists first established that anticipation occursand subsequently identified unstable trinucleotiderepeats as the generalized cause of anticipation. Studentsmodel this sequential process of discovery inthe procedural steps of Activity 3. The next step forscientists is to determine how this phenomenon ofunstable repeats brings about the related genetic disorder.In Activity 3, you can help students see thatpieces of the puzzle still are missing.Activity 2 addresses extranuclear inheritance in thef o rm of mitochondrial inheritance. In this activity,students initially may select a hypothesis from amongtraditional inheritance patterns to explain the patternin two pedigrees that show mitochondrial inheritance.Students must test their hypothesis, using statistics;they flip a coin to model the likelihood that agiven trait will occur according to the inheritance patte rn they have chosen. The failure of their hypothesisto predict the observed outcome with any significantdegree of accuracy will suggest that thehypothesis of a traditional inheritance pattern is notadequate. Students then must seek a new explanationoutside the durable and traditional patterns ofinheritance. This process of discovery leads the studentsto build a nontraditional explanation of inheritance—mitochondrialtransmission—to account forthe inheritance pattern they observe in the puzzlingp e d i g r e e s .The development of a new explanation usually doesnot negate existing knowledge. More often, new explanationsextend existing scientific knowledge. The disco v e ry of DNA and RNA as genetic material that housesthe genetic code did not refute the observation thatchromosomes are the location of genes; rather, themolecular data brought a more detailed and refinedview of the gene. Development of a new explanationrequires much more than imagination. New ideasneed to connect conceptually to existing knowledge,and they must be supported by a sufficiently largebody of evidence to make them convincing. Sometimesit is readily apparent that existing knowledgecannot explain the phenomenon in question. Fo rexample, Mendelian genetics assumes that genes arestable, and it explains Huntington disease on the basisof autosomal dominant transmission. Substantial evidencefrom family pedigrees and, more recently, fromdirect analysis of DNA supports this explanation.Mendelian genetics, however, has no explanation forvariation in age of onset and severity of Huntingtondisease. As a consequence, geneticists defined a newproblem: What characteristic in the mutant Huntingtondisease gene causes this variability?SUMMARYDisciplined scientific investigation is designed toproduce ever better explanations for how thingswork in the natural world. There are, however, limitationsto this process that are worth emphasizingfor students. This process does not, for example,lead to absolute truth, where “absolute” means finaland complete: scientific explanations always areopen to change. The foregoing review of geneticanticipation showed that Mendelian genetics is notthe final explanation for transmission of genetic disorders.Although scientists have added a new chapterabout trinucleotide repeats, this chapter remainsincomplete because we do not know how the numberof repeats increases nor do we know how therepeats influence basic cellular processes. We aretherefore helpless to alter the outcome other thanto choose not to reproduce. Thus, genetic explanations,like all scientific explanations, are openended.This does not mean that open-ended explanationsare false or poorly supported or wort h l e s s .Open-ended explanations that result from scientificinvestigation in all cases have greater intellectualweight and authority than proposed explanationsthat have not been subjected to the requirements ofscientific investigation. Scientific explanations maybe incomplete, but it is not true that anything goes.This is an important point for your students.22©1997 by BSCS.

The Methods of Science ■ Section IIIBecause science, at its best, produces powerful explanationsthat always are open to critical analysis andrevision—even if only in the direction of greater precision—scientiststhemselves must be open to thework of others. It is for this reason that science is apublic activity; it is not the private province of any onescientist. As a result of the collective nature of science,scientists expect other scientists will review and testtheir work. As a further result, science proceeds necessarilyalong multiple, and often complementary,lines of investigation, as we saw with the cross-fert i l-ization of research on Huntington disease andresearch on myotonic dystrophy. This collectivenature of science helps avoid bias and reduces subje c t i v i t y, and it imposes on all scientists the intellectualdiscipline that comes with being accountable toother scientists.Genetics also offers a look at the cultural and historicalcontext of science. The rediscovery of Mendel’swork 35 years after its publication demonstrates theimportance of precise communication in scienceand the role of a cultural context that is ready toaccept new knowledge. The examples of nontraditionalinheritance included in this module are notthe first examples of extensions of Mendel’s explanations;even genetic linkage was a new twist onMendel’s ideas made possible by the observation ofchromosome behavior.23©1997 by BSCS.

Section IVELSI: Ethical, Legal, andSocial Implications ofNontraditional InheritanceGenetic knowledge and technology raise numerousethical, legal, and social issues, and the U.S. Congresshas mandated approximately three percent ofthe annual budget for the Human Genome Project(HGP) to support research, discussion, and publiceducation about the social implications of thehuman genome research. The goals of the Ethical,Legal, and Social Implications (ELSI) program of theHGP are as follows:■ to anticipate and address the ethical, legal, andsocial implications for individuals and society ofmapping and sequencing the human genome;■ to stimulate public discussion of the issues; and■ to develop policy options to ensure that theinformation is used for the benefit of individualsand society.The activities in this module address all three goals,and Activity 4 particularly emphasizes these ideasthrough ethical and policy questions raised by genetictesting in conjunction with new genetics concepts.Research, including that supported by the HumanGenome Project, continues to uncover new mechanismsof inheritance, and with these discoveries willcome additional ELSI concerns.A central concept in this module is that new geneticknowledge has led to a rethinking of the concept ofthe gene. In classical Mendelian genetics, the gene isseen as a physically stable entity. The traditional conceptassumes that the gene does not change duringtransmission, nor does it move from a fixed place withinthe genome. Nontraditional inheritance extends theconcept of the gene to a much more flexible unit ofi n f o rmation. Genes are sometimes unstable, in term sof location and of sequence. One example of instabilityis the expansion or contraction of the number ofnucleotides in a given gene. Another example involvesgenetic elements, called transposons, that can movewithin the genome. Scientists did not predict thesechanges as they constructed the concept of the gene,a process that began with Mendel and resumed ine a rnest in the early decades of the twentieth centuryfollowing the rediscovery of his work. The central ELSIquestion in this module is: How does our changingconcept of the gene and inheritance raise ethical,legal, and social implications for individuals,communities, and society?This module focuses on ELSI topics that have notreceived a great deal of attention in the literature.These topics merit consideration in this module particularlybecause they concern the nature and methodsof science. For instance, questions of interest herei n c l u d e :■ What is the nature (and value) of genetic knowledgeproduced by the HGP and related geneticsresearch?25

Section IV ■ ELSI: Ethical, Legal, and Social Implications of Nontraditional Inheritance■ How does society perceive and use that knowledge?■ How does society influence research?Other topics of interest focus on ethical issues associatedwith the HGP, particularly the knowledge thatno one is free from the risk of genetically relatedhealth problems. One topic of particular concern forstudents is the question of how to evaluate scientificexplanations, including scientific reports in the laypress. Finally, ethical issues involve prudential judgmentsabout the clinical application of genetic informationand the decision-making capacity ofteenagers with respect to such information.DEVELOPING NEW CONCEPTS OF THE GENE,GENETIC HEALTH, AND GENETIC DISEASEA basic concept in genetics is that phenotype is afunction of genotype and environmental influences.For example, your potential height at adulthood hasa genetically determined upper limit, but a variety ofenvironmental factors such as nutrition and generalhealth help to determine to what extent you reachthat potential. To different degrees, genotype andenvironment account for the observed variations inhuman traits, including the human conditions thatwe call “health,” “disease,” “deform i t y,” “disorder, ”“sickness,” “normal,” or “abnormal.” Health generallyrefers to conditions that permit useful ranges of functionor activity, while normal is a quality based on statisticalconcepts and refers to a condition relative tothe majority of other humans. In addition, the termn o rmal can reflect societal values.We humans value certain species-typical functionsthat we regard as states of “health.” Having genesthat contribute to valued ranges of function can becharacterized as genetic health, with the proviso thatthe expression of such genes depends on environmentalfactors. Conditions labeled “disease” fall outsidevalued ranges of function; in cases where thereis a genetic basis for these conditions, they are usuallytermed “genetic disorders.” We disvalue theresults of these statistically abnormal functions ifthey hinder or prevent activity, comfort, or survival.Please note that students in general biology courseso ften encounter a misleading view of geneticsbecause of the widespread use of examples involvingsingle gene disorders. Students may think of theaction of genes solely in terms of mutations and disorders,overlooking the fact that the vast majority ofgenes function well; if they did not, we would not behere. For this reason, we de-emphasize the term“affected” in the review of traditional inheritance patternsat the start of Activity 2 and refer instead to thepresence or absence of a trait, which may or may notbe a genetic disorder.Humans may consider anatomic structure or physiologicalfunctions to be of diminished value on a numberof grounds, including: aesthetic (for example,polydactyly); instrumental, that is, conditions that donot allow us to achieve our goals (for example,dementia); and survival (for example, cystic fibrosis).Having genes that contribute to disvalued ranges offunction can be characterized as genetic disease.Sometimes, as in the case of Huntington disease, environmentdoes not play a significant role in the developmentof a disorder. For that reason, single-gene disorderssuch as Huntington disease, PKU, Ta y- S a c h sdisease, or cystic fibrosis will be expressed regardlessof the natural environment. The same observ a t i o napplies to some polygenic disorders, such as congenitalheart disease or cleft lip and palate. In some diseasesin which genetics plays a role, such as cancerand predisposition to heart disease, environmentalfactors significantly influence phenotype.It is worth reminding students that some s t a t i s t i c a l l ya b n o rmal traits are not labeled as such because we donot disvalue them. Valued and unusual traits includehaving superior intelligence, being very tall, or beingable to run very fast. Thus, perception of genetichealth and disease depends on values and statisticalconcepts, not just the latter. In the classroom, a discussionof values in this context must proceed withtact, particularly considering the likelihood that a studentor family member has a disvalued genetic condition.Students need to see that it is the t r a i t, and notthe i n d i v i d u a l, that has diminished value.In Mendelian genetics, genetic health and diseaseare defined in terms of whether an individual has aninherited malfunction that is disvalued. Some scholarshave noted an oversimplified application ofMendelian genetics with respect to human healthand disease. When oversimplified, genetic health26©1997 by BSCS.

ELSI: Ethical, Legal, and Social Implications of Nontraditional Inheritance ■ Section IVand disease are “either/or” phenomena: an individualeither has the phenotype in question (forinstance, Ta y-Sachs disease) or does not have it.Even classic, single-gene disorders, however, showvariation in expression, so this dichotomous view ofgenetics is not very accurate or helpful. Nontraditionalinheritance provides an opportunity toexpand our explanations of complex and nuancedconcepts of genetic health and disease that will continueto evolve. For example, an understanding oftrinucleotide repeat expansion provides inform a-tion about the variable age of onset and severity ofsymptoms of genetic disorders that exhibit anticipation.Recognition of variability often is excludedfrom the more simple concept of genetic health anddisease drawn from Mendelian genetics. Va r i a b i l i t ycan be a function of penetrance, the proportion ofindividuals with a given genotype who exhibit a n yof the phenotypic features of the related trait. Va r i-ability also can be a function of variable expressivity,the range of phenotypic effects in individuals with agiven genotype (see O v e rview for Te a c h e r s, page37, and the introduction to Activity 3 for more informationon penetrance and variable expressivity).Keep in mind, however, that human perceptions ofgenetic health and disease are not equivalent to thee v o l u t i o n a ry advantage or disadvantage of specifictraits. For instance, the selective advantage (part i a lresistance to the malarial parasite) of heterozygosityfor the sickle-cell trait is present regardless ofwhether the individual or society recognizes it.New concepts of genes, health, and disease alsorequire recognition that some individuals carry genesthat may result in their developing a genetic disorder,even if they do not yet manifest any symptoms of thed i s o r d e r. Breast cancer is a case in point. A youngwoman who has the B RC A 1 gene has an 80 percentlife-time risk of breast cancer, even though she maybe symptom-free at present. Should we view thisasymptomatic woman as diseased because we knowthe B RC A 1 gene likely will make her sick at somepoint? The classification of asymptomatic individualschallenges us to revise our traditional understandingof health and disease from a concept of polar oppositesto a view of endpoints on a complex continuum.An important implication of the Human GenomeProject is that we likely will discover that each of ushas genetic risk factors for one or another disorder.In other words, we need to confront the fact that noone is free of genetically based risk for disease andd i s a b i l i t y. Genetic health is, therefore, a relative term .A perception of health does not support genetic perfection,and we should discard a concept of genetichealth that aims to eliminate a l l risk factors. Pu tanother way, the concept of genetic health will haveto include the presence of risk factors for at leastsome genetic diseases. The more serious the diseaseor the higher the risk, the lower the genetic health.Students may find the idea of risk factors to be a challengingconcept. The difficulty results because, at thispoint in the history of genetics, there is no consensuson the concepts of genetic health and disease thataddresses these challenges. You may want to take theoccasion, if time permits, to discuss with students thechallenge of formulating scientifically sound conceptsof health and disease. For example, you mightask, “Given an individual who has a large number oftrinucleotide repeats and who will not develop symptomsuntil later in life, at what point do we considerthat individual to be diseased?” The answers willdepend on the point at which anatomy and physiologyare statistically abnormal, on which values studentsthink are relevant to assessing the individual’scondition, and on whether students can defend therelevance and application of those values.THE SOCIAL SETTING FOR SCIENCEScience has a social aspect, seen in the need for communicationand collaboration among scientists and inthe reciprocal influences between science and societ y. There is, however, a distinction between the ideathat science is culturally “conditioned” and the claimthat science is culturally “constru c t e d .” 3 This distinctionis very important. The former view, which is consistentwith the material presented in this module,holds that scientific explanations describe fundamentalprocesses and causal relationships that are3The claim that science is culturally constructed is made by some individuals who are known as postmodernists ord e c o n s t ru c t i o n i s t s .27©1997 by BSCS.

Section IV ■ ELSI: Ethical, Legal, and Social Implications of Nontraditional Inheritancegrounded in natural phenomena. As such, scientificexplanations have predictive power. Engineers,physicians, and technicians can manipulate naturalphenomena using the knowledge gained from science.Because scientific knowledge is constru c t e daccording to rigorous criteria, it should, for the mostp a rt, withstand the fads and popular beliefs of anyp a rticular society at any point in history. Yet the pathby which scientific discovery proceeds is cert a i n l yconditioned by history and culture. Social and politicalvalues do help to shape science, particularly theagenda of research at any given time, because modern scientific research often requires large amountsof money. Those values also shape the ways in whichwe apply scientific knowledge. Examples includedecisions about genetic testing, which reflect our valuesabout autonomy and privacy, and decisions aboutthe preservation of global biodiversity, which reflectour values about obligations to future generations.To assert that the practice and application of sciencereflect social and cultural values is different, however,from asserting that those values are so influential thatthey render the methods of science ineffectual. Thissituation would make it nearly impossible to know,with cert a i n t y, anything about the natural world. Thisidea is an extreme representation of the view that scienceis culturally constructed, but it could suggestthat any explanation for a natural phenomenon isvalid, even if it has no scientifically reliable, evidenti a ry basis. The material presented in this modulecontradicts this extreme view, proposing instead thatthe rigorous discipline of scientific methods limitsthe effects of cultural influences on the validity of scientificexplanations. Physicist A. Sokal states, “Thelaws of nature...are not social constructions; the universeexisted long before we did. Our theories aboutthe laws of nature are social constructions. The goalof science is for the latter to approximate as closely aspossible the form e r” (unpublished letter to the N e wYork Ti m e s, 22 May 1996).There also is a danger in allowing students and thegeneral public to think that debates about scientificknowledge are conducted in a manner similar to thatapplied to political issues, by popular vote. Science isbuilt through intellectually disciplined consensus, butnot through the consensus of voting. Scientific consensusoccurs when a sufficient segment of the scientificcommunity, having followed rigorous scientificmethods, is convinced by evidence and well-reasonedargument to accept an idea. To “vote” in sciencewould ignore the intellectual discipline of scientificmethods, for example, the role of evidence in scientificinvestigation. (The patient awaiting an appendectomymay hope that the surgeon’s knowledge ofanatomy is well founded in evidence and is closelyaligned with reality and not the result of whim or popularviews alone.) We encourage you to help studentssee the difference in these views; Activity 5 providessome classroom applications.Scientific knowledge is established as a result of scientiststesting their methods and their results againstthe criticisms of their colleagues, a process thatshows the collective nature of most scientificresearch. Students probably will experience difficultyin learning how to step back from their ideas sothat they will not take personally conscientious critiquesby other students. Your task as teacher is toinsist that such critiques are never personal—what iscalled the ad hominem fallacy in logic—and that thecritique always is directed to the idea expressed inwhat was said, and not to the student who said it.Students whose ideas are criticized should be asked,“How would you respond to the criticism of youridea?” In this way, students are taught that critiquesshould focus on ideas, and that ideas, onceexpressed, become public property for carefulassessment. Participating in such disciplined discourseprepares students to be responsible citizens.Although critiques of new ideas can establish theirscientific validity, society’s response to new scientificknowledge will depend on society’s values.ETHICAL AND POLICY IMPLICATIONSThe ELSI program has led to the identification anddiscussion of many important ethical, legal, andsocial implications of the Human Genome Project.These include privacy and confidentiality of genetici n f o rmation, uses and misuses of genetics in the pastand their relevance to current situations, preventionof discrimination in employment and insurance, andthe intrusion of genetic information into reproductivedecision-making. The first two modules developedby BSCS —Mapping and Sequencing theHuman Genome: Science, Ethics, and Public Po l i c y28©1997 by BSCS.

ELSI: Ethical, Legal, and Social Implications of Nontraditional Inheritance ■ Section IVand The Human Genome Project: Biology, Computers,and Po l i c y—address a number of these issues.The student activities in this module raise ethical andpolicy issues about access by teenagers to genetictesting and information about themselves. You canorganize student discussion of these issues effectivelyaround two major concepts: prudential decisionmakingand developmental autonomy of teenagers.In Activity 4, Should Teenagers Be Tested for theMutant HD Gene?, students will encounter the presentpolicy of not testing asymptomatic minors whoare at risk for Huntington disease. The justification forthis policy is as follows. First, it may be harmful to giveparents (or their child) the news of a genetic diagnosisfor which there is no medical treatment at present. Toprovide such information could adversely affect howparents raise their child, and it may be cruel to informa child that he or she has an untreatable disorder. Second,in all likelihood, even with a high number of CAGrepeats, the onset of Huntington disease will occura fter the child has reached legal majority, that is, theage of eighteen. Testing will be available at that time,and the individual, who then will be a legal adult, candecide whether to be tested. Third, before the age ofm a j o r i t y, children, including teenagers, do not possessthe autonomy of adults and so should not be regardedas having a right to the information or the ability tohandle that information in a competent, adult fashion.The first two justifications involve prudential judgments,a way to make reliable, well-reasoned decisionsunder conditions of uncert a i n t y. The third justificationinvolves developmental autonomy,p a rticularly the decision-making capacity of teenagersin the context of access to genetic inform a t i o n .The first two justifications concern avoiding unnecessa ry risk when it is uncertain that the event actually willo c c u r. For example, the first justification assumes thatmost children and most parents will react very badly tothe news of a diagnosis of a disorder for which there isno treatment. The second justification buttresses thisconsideration by pointing out that it is unnecessary togive parents of at-risk children genetic inform a t i o nthat will have no significance until the child reachesadulthood. Prudential judgments are the tools that weuse to manage uncert a i n t y, always a feature of genetici n f o rmation because our knowledge of genetics isincomplete. In addition, we use prudential judgmentsto make decisions about an uncertain future, whenour or someone else’s future interests are at risk inways that are to some degree unknown (in Huntingtondisease, as to likelihood of occurrence) but whosenegative value is known (for example, causing someoneto despair or become depressed). Prudential judgmentsare not linear, but nuanced and complex. Prudentialjudgments balance the perceived likelihood ofthe occurrence of an event against its known disvalue.In simple terms, how bad is the outcome and how likelyis it to occur? When the issues are weighed, differentoutcomes are possible, depending on one’s estimateof the incidence of occurrence and how much one disvaluesthe risk. Such estimates should be based on scientificinformation and challenged in reasoned publicdiscourse. Students should appreciate this variability ifa s ked to justify these two aspects of their judgment.Thus, prudential judgments enable one to deal withthe ethical issues raised by the activity.The third justification involves developmental autonomy.Students likely will resist the proposition that,just because they are not yet eighteen, they cannotmake decisions for themselves. Remind studentsthat the legal age of majority is based on a roughsense of when most people should be treated likeadults and on the need for a very simple legal criterion.Age meets the latter test very readily; one hasonly to look at someone’s driver’s license to determinethe number of years since that individual wasborn. The problem, of course, is that some peoplehave adult decision-making capacity before legalmajority, some acquire that capacity long after reachinglegal majority, and some never attain it. Thisproblem raises the need for a definition of decisionmakingcapacity. Recent work in bioethics has developedan account of this capacity, shown in Figure 10.Notice that there is no age requirement in thisdescription of autonomous decision-making. In themedical care of adolescents having various kinds ofc a n c e r, most physicians are willing to regard ateenaged patient as an adult in the management ofthe cancer if the teenager can display the six skillslisted above. Many teenagers can and do displaythese skills. In some cases, the young person hasgrown up with the disease and can take adultresponsibility for its management.29©1997 by BSCS.

Section IV ■ ELSI: Ethical, Legal, and Social Implications of Nontraditional InheritanceFigure 10 Skills in capacity for decision-making1. An individual can learn and recall information aboutthe topic at hand.2. An individual can reason from present events to theirlikely future effects; that is, an individual displays theability to reason causally.3. An individual has and can use values to assess theworth of those likely future effects.4. An individual can express a preference based on thefirst three skills and, if asked, can give an acceptableaccount of how he or she arrived at the preference.5. An individual can carry out his or her preference.6. An individual is prepared to live with the effects of his orher preference in his or her own life and in others’ l i v e s ;that is, one is prepared to be accountable to others,even in situations in which one injures others’ interests.It is a fact that teenagers sometimes display difficultywith skill 2 because they have not gained sufficientm a s t e ry of causal reasoning. With respect to skill 3,their values may be unstable because they still aredeveloping their identities and plans for the future.With respect to skill 5, some may be unwilling toaccept genetic testing. With respect to skill 6, theymay be unwilling to assume responsibility for theconsequences of their decisions for themselves andothers. Learning that one has the gene for a disorderat any age involves implications for others, for example,siblings or cousins who may be at risk, friendshipsthat may be altered or even broken, and parentswho frequently take on the burden of caregivingfor their children when they become chronically ill intheir late 20s or 30s. The latter complication is illustratedin the case of another chronic illness, AIDS.Many young adults with AIDS-related diseases haver e t u rned to their parents’ homes for care and suppo rt. Students should be encouraged to take seriouslythese limitations on the developmental autonomyof teenagers and to show convincingly why these limitationsdo not apply in their own case. Unlike adults,who may face few burdens of proof about their decision-makingcapacity, teenagers must demonstratetheir capacity, especially when the stakes are high.The situation described in Activity 4 is such an example,in which a teenager may learn that she or he hasa fatal, nontreatable genetic disorder.Skill 6 raises a challenge beyond the problem of thedecision-making capacity of teenagers. If one learnsas a result of genetic testing that one has a mutantHD gene with more than 50 trinucleotide repeats,then one’s offspring will be at greater risk for developingHuntington disease than if this gene has alower number of repeats. In the former case, thegene is likely to expand to larger sizes in future generationsof offspring who inherit the gene. In ethics,concern for the well-being of one’s offspring is called“obligations to future generations.” This term also isused in the literature of environmental ethics torefer to our obligations to those not yet born,regardless of whether they are one’s own offspring.There are a number of conceptual issues concerningobligations to future generations. First, to whom areyou obligated in the future? If you contribute to anindividual’s genes, then you are one of the causes ofthat outcome. Normally, in ethics, each of us isresponsible for the events that we cause as a result ofpresent decisions and actions. Knowing that one hasa gene for an autosomal dominant genetic disorder,and procreating in light of that knowledge, makesone accountable if one’s children get the gene anddevelop the disorder.Second, how far into the future are you obligated?This matter becomes difficult because the transmissionof an autosomal dominant genetic disorder toone’s grandchildren and beyond is not entirely afunction of one’s own decisions; these results followfrom the decisions of others (for example, affectedmembers of the family). The issue, therefore,becomes the extent to which one has an ethicalobligation to attempt to influence the choices of others.There is little consensus on this complex ethicalissue because the scholarly literature on this topic isjust now developing. Students should be encouragedto think through this issue together, attemptingto identify lines of argument that are well supportedby scientific information and by criteria forethical argument.Third, suppose that an individual has been testedand found to have a mutant HD gene that contains40 CAG repeats, a number at the threshold for instability.On transmission to children, this number ofrepeats is likely to expand, particularly if the parentin question is male. What is the individual’s obligationto children who, if they are affected, likely will30©1997 by BSCS.

ELSI: Ethical, Legal, and Social Implications of Nontraditional Inheritance ■ Section IVhave an earlier and more severe form of the disorder?This question is an issue of the ethical significanceof genetic anticipation in determining ourobligations to future generations. The dilemmainvolves the degree to which we should disvalue diseasesin their more severe forms. It seems obviousthat we should. Students can consider how the qualitativedimensions of genetic disorders should beincluded in our concepts of genetic health and diseaseand evaluated in our determination of ourobligations to future generations.The fourth issue also is controversial. Is there anobligation to avoid having children who will have anautosomal dominant genetic disorder? A relativelynew biomedical technology, pre-implantation diagnosis,allows couples at risk to use in vitro fertilizationto produce embryos and then test theseembryos genetically when they reach the morulastage in vitro. Embryos found to have the gene forHuntington disease can be discarded, and theembryo transferred to the woman’s uterus will befree of the mutant gene.SUMMARYChanging concepts of the gene, a central theme ofthe student activities, requires us to rethink conceptsof genetic health and disease. In addition to“either/or” issues of whether an individual has thegene for a disease, there are now issues of the variableof age of onset and severity of disease to betaken into account, as well as phenomena such asimprinting and uniparental disomy (see Overviewfor Teachers, Section V). As the Human Genome Projectand other lines of research continue to expandour understanding of inheritance, we must confrontthe fact that no one is free of genetically based risk.Genetic health and disease thus come to be viewedas the endpoints of a complex continuum.The social setting for science c o n c e rns the culturaland historical conditioning of genetic knowledge.Students need to develop some comfort with theidea that at any one moment scientific knowledge isa function of its history to date. As a consequence,scientific knowledge is durable but not necessarilyadequate to explain all our future observations. Scientificknowledge is incomplete in principle; it isnever certain and final. Science requires constantcritique of new and existing information; thisrequirement means that science is a self- c o rr e c t i n ge n t e r p r i s e .Ethical issues in the student activities concern prudentialjudgments and developmental autonomy.P rudential judgments require students to beginwith the best information that science offers andthen weigh the value and disvalue of future, butu n c e rtain, consequences. Students must becomec o m f o rtable with the idea that uncert a i n t y — w h i c heven the most rigorous science cannot eliminatecompletely—can be managed in an intellectuallyserious manner.We have defined developmental autonomy by sixdiscrete but related skills that one can observe inindividuals. Based on this definition, a person whocan demonstrate those skills should be accorded theright (moral if not legal) to make personal decisionsabout access to genetic testing. Unlike adults, forwhom the law and ethics assume such capacity, studentsmust become comfortable with the idea that,as teenagers, they face the burden of proof for beingaccorded such a right.31©1997 by BSCS.

Section V:Genetics: Basic Conceptsand NontraditionalInheritance“To be humane, we must ever be readyto pronounce that wise, ingenious andmodest statement, ‘I do not know.’”GalileoThis teaching module uses examples of nontraditionalinheritance to illustrate the nature and methodsof science. By “nontraditional” we mean modesof inheritance that are not fully explained byMendel’s laws and the classic understanding ofgenetics that scientists have constructed in the yearssince Mendel. It is not, however, the actual methodsof inheritance that are nontraditional; rather, it isthat our initial understanding of inheritance did notencompass these processes. This section of theOverview for Teachers reviews classic concepts ingenetics that are a prerequisite for using this module.These concepts typically are taught in an introductorybiology course. This section also describesmore unusual types of inheritance. Two of the latter,mitochondrial inheritance (extranuclear inheritance)and expansion of trinucleotide repeats (relatedto genetic anticipation), serve as examples in theClassroom Activities.As reflected in the opening genetics activity of themodule, Activity 1, Standing on the Shoulders ofG i a n t s, modern genetics is being built on a foundationof discovery that spans more than a hundredyears. Figure 11, Milestones in the Understandingof Inheritance, provides a snapshot of the history ofgenetics through a chronological account of someof the major concepts of inheritance that have beendeveloped during the past 150 years. The dates aremuch less important than the intellectual history,that is, the connections between ideas and discoveries.These milestones demonstrate the durabilityof most genetics concepts, and they suggest thedependence of discoveries on pre-existing knowledgeand on technology available at the time of thed i s c o v e ry. The conclusions reported here were suppo rted by evidence derived from observation and/orexperimentation. For the most recent years, wehave selected a few of the vast number of discoveriesnow being published. One criterion was tochoose work that marks the first of a series of discoveries.Many human genes related to complex diseasessuch as cancer are being identified as part ofthe HGP, and biologists are beginning to understandthe genetic basis of complex traits, including cert a i nbehaviors. Activity 1 uses a small set of milestoneexplanations to challenge students to think abouthow our understanding of genetics has been const ructed. Students examine the relationshipbetween ideas without, we hope, undo concernabout dates or exact chronology.33

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceFigure 11 Milestones in the understanding of inheritance1865 Mendel proposed laws of inheritance based on his experiments with garden pea plants and was largelyignored.1 8 8 3 Roux proposed that filaments (later named “chromosomes”) in the nucleus are the bearers of hereditary factors.1883 van Beneden studied meiosis in a round worm and showed that gametes contain half as many chromosomesas somatic cells and that the somatic number of chromosomes is reestablished at fertilization.1890 Altmann discovered what later were called mitochondria.1900 Mendel’s work was independently rediscovered by Correns, de Vries, and von Tschermak, who also did experi -ments in plant breeding.1901 de Vries adopted the term “mutation” to describe alterations in the hereditary material by studying primroses.1902 McClung argued from observations in insects that sex is determined at the time of fertilization and is dependentupon the sex determinant acquired.1902-1909 Bateson introduced the terms “genetics,” “homozygote,” “heterozygote,” “F1,” and “F2.”1903 Sutton and Boveri independently correlated Mendel’s theory of independent assortment with the behavior ofchromosomes during meiosis and proposed what came to be known as the “chromosome theory of heredity.”1906 Bateson, Saunders, and Punnett reported the first case of linkage (in the sweet pea).1909 Janssens suggested that exchanges between chromosomes occur during crossing over in meiosis.1909 Johannsen realized the distinction between the appearance of an organism and its genetic constitution, andinvented the terms “phenotype” and “genotype” to describe these. He also coined the word “gene.”1911 Morgan proposed that three fruit-fly genes are linked on the X chromosome, strongly supporting the chromosometheory of heredity.1911 Greenfield observed “anticipation” in myotonic dystrophy pedigrees by noticing cataracts in the earlier generationsof these families. Many argued that anticipation was an artifact because of bias in finding parent-child pairs.1914 Bridges discovered a rare meiotic error in fruit flies and thus associated a specific gene with a specific chromosome.This discovery established the chromosome theory of heredity.1915 J.B.S. Haldane, Sprunt, and N.M. Haldane described the first example of linkage in vertebrates (mice).1927 Muller induced mutations by exposing fruit flies to X rays.1931 Stern and, independently, Creighton and McClintock provided cytological proof of crossing over during meiosis.1933 Morgan received a Nobel Prize for his development of the theory of the gene based on his work on fruit flies.1944 Avery, MacLeod, and McCarty transformed the phenotype of pneumococcus and proposed that DNA (not protein)is the hereditary chemical.1950 McClintock discovered transposable genetic elements in maize and initially was ignored.1952 Hershey and Chase showed that phage DNA enters the bacterial cell on infection, but that most phage proteinremains outside.1953 Watson and Crick proposed a chemical structure for DNA.1956 Tjio and Levan demonstrated that humans have 46 chromosomes.1959 Chävremont, Chävremont-Comhaire, and Baeckeland demonstrated that mitochondria have DNA.1961 Crick, Barnett, Brenner, and Watts-Tobin showed that the genetic language is made up of three-letter words.Nirenberg, Matthaei, Ochoa, and Khorana worked out the DNA code for each amino acid.©1997 by BSCS.34

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section V1962 Watson, Crick, and Wilkins received Nobel Prizes for their studies on the structure of DNA.1968 Holley, Khorana, and Nirenberg received Nobel Prizes for discoveries concerning interpretation of the geneticcode and its function in protein synthesis.1974 Hutchison, Newbold, Potter, and Edgell demonstrated the maternal inheritance of mitochondrial DNAin horsedonkeyhybrids.1980 Engel proposed the concept of “uniparental disomy,” where both chromosomes of a pair are inherited from thesame parent.1981 A group of scientists worked out the complete nucleotide sequence of the human mitochondrial genome.1983 McClintock received a Nobel Prize for her discovery of transposable genetic elements.1983 Gusella, et al. found a DNAmarker on chromosome 4 that lay close to the Huntington disease gene. Genetictesting based on linkage analysis became possible.1983 Rastan and Cattanarch used the term “imprinting” with reference to X chromosome behavior.1 9 8 4 Pohlman, Federoff, and Messing determined the nucleotide sequence of a maize transposable geneticelement.1986 Surani used the term “genomic imprinting” to describe the differential expression of maternal or paternal geneticmaterial located on autosomes.1988 Spence, et al. documented a case of cystic fibrosis caused by uniparental disomy.1990 Blum, Bakalara, and Simpson described RNAediting in trypanosomes.1991 Expanding trinucleotide repeats were found to play a role in fragile X syndrome and Kennedy disease.1992 An unstable trinucleotide repeat region was found in the myotonic dystrophy gene, and a correlation betweenthe size of the repeat region and the severity of the disease was demonstrated, thus explaining the molecularbasis of anticipation.1993 The Huntington Disease Collaborative Group discovered the Huntington disease gene and found that it containsan unstable trinucleotide repeat that is the basis of the mutation.1994 Miki and co-workers announced the identification of a human gene, BRCA1, that influences susceptibility tobreast and ovarian cancer.1995 Fleischmann and co-workers published the first complete DNA sequence of a free-living organism, the bacteriumHaemophilus influenzae, as part of the HGP.1996 Brown and co-workers identified a gene in mice, the fosB gene, that is required for an essential behavior, nurturingtheir young.1996 More than 600 scientists worked together to complete the sequencing of a eukaryotic species, yeast(Saccharomyces cerevisiae).TRADITIONAL CONCEPTS IN GENETICSOur modern understanding of inheritance is const ructed around an ever-growing collection of fundamentalconcepts. Figure 12 lists the traditionalconcepts of inheritance on which this modulebuilds. A student of genetics generally encountersat one time the entire array of basic ideas thatexplain what we know of inheritance. In contrast,researchers in genetics have had to build this pictureone concept at a time, without the advantageof seeing beyond the currently available evidence.These concepts are discussed here with emphasison their historical development.Alleles segregate. Although Gregor Mendel, workingin the 1850s and 1860s, did not know about genes orchromosomes, he deduced many of their fundamentalcharacteristics and functions from his studies oftraits in peas. (See Figure 1-1 in Activity 1 for a port r a i t35©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceFigure 12 Traditional concepts of inheritance■ Alleles segregate (Mendel’s law of segregation).■ Non-alleles assort independently (Mendel’s law of independentassortment) except when loci are linked.■ Traits can show a dominant or recessive pattern ofinheritance.■ Genotype gives rise to phenotype.■ Chromosomes carry hereditary information.■ DNAis the informational component of chromosomes.Rare events (mutations) can change this information.■ Inheritance is nuclear and vertical (from parent tooffspring).■ The genetic contribution from each parent is equal (insexually reproducing species).■ Genes are the units of inheritance and are the sourceof heritable biological variation.■ Genes occur at fixed locations (loci) distributed alongchromosomes.■ During meiosis, chromosomes can exchange geneticmaterial through a process called crossing over.■ Genes on the same chromosome are “linked.” Thecloser they are, the lower is the chance that they willseparate during crossing over.■ The laws of probability help to explain patterns ofinheritance.of Mendel.) Mendel’s first law (the law of segregation)states that the two alleles of a gene separate from eachother during the formation of gametes so that agamete carries one allele or the other, but not both.Progeny are then produced by the random combinationof gametes from the two parents. The sophisticationof Mendel’s reasoning is remarkable given thesparse information he had available. E. van Beneden’slater studies of meiosis (see the 1883 entry for vanBeneden in Figure 11) showed that gametes containhalf as many chromosomes (the haploid number) asdo somatic cells, and that the diploid number of chromosomesis reestablished at fertilization. This workprovided further evidence for Mendel’s hypotheses.In 1904, Lucien Cuénot studied coat color in mice andfound that a gene can have more than two alleles. Anygiven individual, however, has only two of those alleles,one on each of the homologous chromosomeswhere the gene in question resides.Non-alleles assort independently, except when lociare linked. Mendel’s second law, the law of independentassortment, concerns the inheritance of two ormore traits. The law states that the genes for differenttraits behave independently in the production ofgametes so long as those genes are on different chromosomes.Mendel found, for example, that the determinationof color in his pea plants—yellow orgreen—was independent of the determination ofshape—smooth or wrinkled. Independent studies byWalter S. Sutton and Theodor Boveri in 1903 corr e l a t-ed the behavior of chromosomes during meiosis withboth of Mendel’s laws of inheritance. They recognizeda resemblance between the separation of homologouschromosomes at meiosis and Mendel’s proposedseparation of trait determinants at gamete formation(the law of segregation). They also suggestedthat chromosomes act independently in their movementduring meiosis, which would explain Mendel’slaw of independent assortment. A gamete receivesp a t e rnally and maternally derived chromosomes;thus one trait can be inherited from the mother whileanother comes from the father. Independent assortmentincreases genetic variation by creating new combinationsof alleles in gametes.Traits can show a dominant or recessive pattern ofi n h e r i t a n c e . Mendel deduced from his pea studiesthat the trait determined by one allele masked theexpression of its partner because he did not observ ephenotypes that were a mixture of the traits determinedby the two different alleles of a gene. Manyinherited human traits, including disorders such asHuntington disease (dominant) and cystic fibrosis(recessive), display dominant or recessive inheritance.In your teaching, take care to distinguishbetween the inheritance of a g e n e and a t r a i t. It is notgenes themselves that are dominant or recessive, northe way genes are inherited. Instead, it is the inheritancepattern of a t r a i t that is either dominant orrecessive. In other words, the effect of genes on phenotypefollows a dominant or recessive pattern. Fu r-t h e rmore, different mutations in the same gene canhave different patterns of inheritance. For example,the disorder osteogenesis imperfecta exhibits dominantinheritance as a result of certain mutations anddisplays recessive inheritance as a result of differentmutations in the same gene (Scriver, et al., 1995, T h eMetabolic and Molecular Bases of Inherited Disease,Chapters 1 and 134).36©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VAs Lucien Cuénot showed in 1904, a gene can havemore than two alleles, even though a diploid organismn o rmally can possess only two of those alleles. Not allgenes have alleles that show a clearly dominant orrecessive pattern of inheritance. In multiple allelic systems,the pattern of inheritance can vary according tothe particular combination of alleles in the organism.For instance, a particular allele might result in dominantinheritance in combination with one partner butrecessive inheritance if paired with another allele.Some alleles result in codominant inheritance, meaningthat heterozygotes display a mixture of the phenotypesthat would be present in the two differenthomozygous conditions. A good example is thehuman ABO blood antigen system, where A and B allelescan be expressed simultaneously. An individualwho has two copies (doses) of the same alleles for agiven trait is said to be homozygous for that trait. Anindividual with different alleles for a given trait is saidto be heterozygous; William Bateson introduced thoselabels in the first decade of the twentieth century.Genotype gives rise to phenotype. In many ways, thisconcept is the most basic view of inheritance. The“genotype” is the genetic composition of an organism,which, at its finest level of detail, means thesequence of nucleotides in the DNA. The “phenotype”comprises the physical characteristics of anorganism, including internal characteristics thatrequire special detection methods to be observed.The terms genotype and phenotype were inventedby Wilhelm L. Johannsen in 1909 when he realizedthe distinction between the appearance of an organismand its genetic constitution. Phenotype resultsfrom a combination of genotypic and environmentalinfluences. The contribution of environmental influencesvaries for different traits.There are several examples of single genes whoseexpression is modified by other factors, such that thephenotypic expression of the gene is variable. Theterms “penetrance” and “variable expressivity” areused to describe this phenomenon. Penetrance isthe proportion of individuals with a given genotypewho express any of the phenotypic features of thetrait. Variable expressivity is the range of phenotypiceffects in individuals with a given genotype. Anexample of a genetic disorder that displays incompletepenetrance is the dominant trait ectrodactyly;some people carrying the mutant allele do not havethe deformity called “lobster claw” hand, and yetthey can pass it on to their children. Myotonic dystrophyis an example of a genetic disorder that displaysvariable expressivity, with symptoms that rangefrom cataracts to extreme muscle disorders andmental retardation. In this example, variable expressivityresults from an unusual genetic mechanism:differences in the degree of expansion of the unstabletrinucleotide repeat within the mutant gene formyotonic dystrophy. Penetrance and variable expressivitydepend on a variety of factors including environmentalinfluences, the action of other genes, orchance. These phenomena continually cloud ourability to make exact predictions about the likely outcomesof particular genotypes.Counterbalancing these effects is the knowledgethat, for certain disorders, a particular genotype goesa long way towards predicting an ultimate outcome.For example, someone who inherits both alleles forTay-Sachs disease will die of that disorder sometimein childhood. In Huntington disease, a greater numberof trinucleotide repeats makes it more likely thatthe affected person will show signs and symptoms ofthe disorder earlier in life. Unfortunately, at present,it is not possible to determine exactly when symptomswill first appear, or the rate at which the disorderwill progress.Chromosomes carry hereditary inform a t i o n . A searly as 1883, biologists proposed that chromosomescarry genetic information. Wilhelm Roux proposedthis hypothesis after observing filaments withinthe nucleus that stained with basic dyes. In 1888,W. Waldeyer gave these filaments the name “chromosomes,”for “colored bodies,” because the chromosomesstained very darkly. The first experimentalevidence that there is a constant and regular associationbetween chromosomes and observable characteristicsof the organism came from C.E. McClung’swork in grasshoppers. He suggested in 1902 that thepresence of a distinctive chromosome (the X chromosome)is related to sex determination becausefemales have two copies of this chromosome andmales have only one.DNA is the informational component of chromoso m e s . Chromosomes in eukaryotes are composed of37©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceDNA and associated proteins. Prokaryotic chromosomesgenerally consist of a single molecule of DNA.In 1939, E. Knapp and H. Schreiber obtained prelimin a ry evidence that the DNA component of chromosomesis responsible for the transmission of genetici n f o rmation when they correlated mutations to ultravioletlight. They noticed that the wavelength of ultravioletlight that most effectively generated mutationsin the sperm of a type of liverw o rt corresponded tothe absorption spectrum of DNA. In 1944, Oswald T.Av e ry, Colin M. MacLeod, and Maclyn McCarty providedmore conclusive evidence by transforming thephenotype of pneumococcus bacteria with a purifiedsubstance that they showed to be DNA. In 1952,Alfred D. Hershey and Martha Chase showed that theDNA component of bacteriophage viruses enteredthe host bacterial cell, whereas the protein componentremained outside the cell and was not involvedin viral infection of the bacterium. These discoveriessuggested that DNA might be the carrier of heredita ry information in higher organisms as well.In 1953, James D. Watson and Francis H.C. Crick proposeda structure for the DNA molecule, which hassince been confirmed by electron microscopy. Wa t-son and Crick’s proposed double helical stru c t u r ewith complementary strands was based on severallines of evidence that had accumulated during thefew years prior to their proposal. (The icon used todenote the titles in the Overview and classroom activitiesdepicts this structure.) Erwin Chargraff noticedin 1950 that the amounts of adenine and thymine inDNA are equal, as are the amounts of cytosine andguanine. The proportions of the two pairs variedwidely between species, however. This observ a t i o n ,together with the X-ray crystallographic studies bythe research group of Maurice H. F. Wilkins and byRosalind E. Franklin and R. G. Gosling, led Wa t s o nand Crick to propose their structural model. The significanceof the structure of DNA is that it provides amechanism adequate to explain the storage andtransmission of genetic inform a t i o n .Because DNA is the molecule responsible for thetransmission of genetic information, then it followsthat changes in DNA structure (mutations) can resultin altered characteristics of an organism. Mutation isan essential feature of heredity because it increasesgenetic variation, the raw material of evolution.Inheritance is nuclear and vertical (from parent tooffspring). Mendel’s laws of inheritance provided alarge piece of the answer to the age-old question,“Why do offspring resemble their parents?” His lawsare based on the principle that heritable factors (thegenotype) that influence characteristics (the phenotype)are passed from parent to progeny in a randombut mathematically explainable manner. Genetici n f o rmation is encoded in the sequence ofnucleotides in DNA. Prokaryotic cells (bacteria) haveone large DNA molecule and, in many cases, severalsmall circles of DNA known as plasmids. In eukaryoticcells, DNA is the major informational componentof thread-like structures called chromosomes,which are found in the nucleus. Because chromosomesare observable by light microscopy, their connectionto inheritance was recognized earlier thanwas that of DNA. These observations, coupled withthe phenomena discussed in the next two paragraphs,support and help to explain Mendel’s observations,and they account for the predominant patternsof inheritance.The genetic contribution from each parent is equal(in sexually reproducing species). In 1883, E. vanBeneden showed that meiosis produces gametesthat have half the number of chromosomes (haploidnumber, N) of that found in somatic cells (diploidnumber, 2N) of the same organism. This reductionin chromosome number, from 2N to N, is essentialfor gametes to function in sexual reproduction.Without the reduction, each generation woulddouble the number of chromosomes and hencedouble the genetic information.T. H. Montgomery studied spermatogenesis in variousspecies of H e m i p t e r a ( t rue bugs) and concludedin 1901 that maternal chromosomes pair only withp a t e rnal chromosomes during meiosis. In studyingsea urchin embryos in 1903, Theodor Boveri foundthat this organism needs a full set of chromosomes todevelop normally and deduced that individual chromosomescarry different essential elements. Thiso b s e rvation led him to conclude not only that meiosisreduces the number of chromosomes by half, butthat meiosis specifically halves each pair of chromosomes.Therefore, it follows that the combination oftwo gametes in fertilization produces a zygote thathas an equal genetic contribution from each parent.38©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VGenes are the units of inheritance and are thesource of heritable biological variation. The view ofthe gene is constantly evolving, as described in PetterPortin’s review (Portin, 1993). First conceived asan abstract unit of inheritance, the gene now is seenas a complex molecular entity whose properties arebecoming known. A gene is a portion of DNA thatencodes information needed for the production of afunctional product. This product is either a proteinor a functional RNA, such as a ribosomal component.Protein is produced by the translation of an intermediatemolecule, mRNA. Features of a typical eukaryoticgene, illustrated in Figure 13, include the codingregion (the part that determines the final proteinsequence) and various control regions that determinewhen, where, and how much of the gene productis made. The coding region may contain noncodinginserts called introns, which are excisedduring RNA processing. The portions of the codingregion that correspond to the final version of theRNA message (mRNA) are called exons. The initialRNA product contains copies of exons and introns,but the mRNA has been processed to remove intronsprior to translation.There are about 80,000 genes in the completehuman genetic endowment (the genome), but theseaccount for less than five percent of the total DNAcontent (see For Your Information: How many genesdo humans have?). Scientists do not clearly knowthe significance of the remainder of the DNA at thistime. There may exist slightly different forms of aparticular gene—a function of slight variations inbase sequences—and more than one version can bepresent in a diploid organism. These different forms(alleles) lead to variation in the expression of traitsamong individuals within a species.There are many differences in the DNA sequencebetween individuals, most of which make no differenceto the phenotype. Some variations withingenes, however, can have biological consequences.Some genetic variations lead to harmless phenotypicdifferences such as variations in hair and eye color,whereas others can have more serious consequences,either advantageous or disadvantageous. ADNA variation that causes a gene product to bealtered or deficient in some way can manifest itself asa genetic disorder such as cystic fibrosis. These heri-Figure 13 Features of a gene: Notice that the mRNA,when fully processed, may be shorter than the gene fromwhich it was copied. In addition to removal of introns, processinginvolves two chemical modifications, a “cap” stru c-ture and a polyA tail, that are required for stability andt r a n s l a t i o n .table changes in the DNA sequence result from mutationsin germline cells. (Some mutations occur insomatic cells and are n o t heritable, as August We i s s-man demonstrated in the late 1800s. Germ cells areseparated from somatic cells. Weissman’s workhelped to disprove Lamarckian’s notions about theinheritance of acquired characteristics.)Heritable genetic variation is an essential prerequisiteto biological evolution in that it provides the39©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceFor Your InformationHow many genes do humans have?Estimates of the number of genes in the human genome have varied over the years. Scientists havetried several approaches to determine the precise number, including estimating the number of proteinsexpressed in a particular cell type, estimating the number of different RNA molecules produced,and estimating the density of genes on chromosomes by looking at the DNA sequence. All ofthese approaches have severe limitations. For example, not all genes are expressed in any one celltype; some gene products are not proteins; variable RNA splicing allows the same gene to producedifferent mRNAs; and the density of genes on chromosomes varies. The sequence-based approach isthe most accurate method for determining where a given gene begins and ends, and, once theHuman Genome Project has achieved its goal of sequencing the entire genome, we will have a betterestimate of the number of human genes. Note that it may not be possible to tell from the DNAsequence whether a gene actually is functional. As more of the genome is sequenced, the predictednumber of genes is decreasing, perhaps because the regions first examined happened to be particularlygene-rich. One recent estimate is that the human genome contains approximately 80,000 genes.array of random but transmissable changes on whichnatural selective pressure acts. Changes in genesgive rise to differences in phenotype, and some ofthese may be selected for or against in the struggleto leave viable offspring that constitutes Darwinianfitness. The great evolutionary biologist Ernst Mayrreminds us that natural selection is a two-stepprocess. The first step is the production of newgenetic and phenotypic variations in a population oforganisms. The second step is selection itself, whichtests those variations against the environment. Gradually,the collection of genes in a species shifts, anexample of the process of evolution at work. Considerthe situation at the level of proteins. For someproteins, such as histones, sequence and, consequently,structure are highly conserved. We infer thatthe function of these proteins remains essentiallyunchanged, and that almost any change (mutation)is a disadvantage for the organism. Other proteins,however, are much more tolerant of variation, andmore differences accumulate in the genes thatencode them.Genes occur at fixed locations (loci) distributedalong chromosomes. Implicit in the classic view ofinheritance is the assumption that a gene remains ina fixed location on its chromosome, with the notedexception of recombination during meiosis. Even inthat case, the relative position of a gene compared tothe location of its neighbors is generally fixed (seenext discussion). Mendel’s observations and theother principles of genetics described here are basedlargely on this assumption.During meiosis, chromosomes can exchange geneticmaterial through a process called crossing over.Crossing over of chromosomes during meiosis wasfirst observed in 1909, when F.A. Janssens suggestedthat exchanges between nonsister (paternal andmaternal) chromatids produced chiasmata (crossshapedjunction points). In 1931, Curt Sternobtained cytological evidence of crossing over, ano b s e rvation confirmed independently by H.B.Creighton and Barbara McClintock in the same year.J.H. Taylor provided the most convincing evidencein 1965—by radioisotope labeling of grasshopperchromosomes—that there is an exchange of DNA atchiasmata. Crossing over results in genetic recombinationand the production of novel combinations ofalleles. This recombination is one source of the intraspecificgenetic variation that makes evolution possible.The unique combination of genetic informationderived from two parents also provides a variety ofcharacteristics on which natural selection acts.Genes on the same chromosome are “linked.” I n1906, William Bateson, E.R. Saunders, and ReginalC. Punnett—while studying inheritance in the40©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section Vsweet pea—discovered the first exception toMendel’s law of independent assortment. Theyfound that purple flowers and long pollen—bothdominant traits—were inherited together moreo ften than predicted by Mendel’s second law. (Thelaws of probability were essential for these scientiststo notice that something unusual was happening;see the discussion under the next heading.)The reason for this discrepancy is that these investigatorswere looking at two genes on the samechromosome, whereas five of the seven traits thatMendel studied are located on different chromosomes(the other two are far apart on the samechromosome and effectively behave independently).The two sweet-pea traits were not always inheritedtogether because they sometimes were separatedby crossing over during meiosis, but theywere inherited together more often than Mendelpredicted because they are close together on thesame chromosome. Genes that lie close togetheron a chromosome are said to be more closelyl i n ked than those that are farther apart. The fart h e ra p a rt loci are on the same chromosome, the moretheir behavior is independent in meiosis because ofthe crossing over that can occur between them.Thomas Hunt Morgan was instrumental in developingthe chromosome theory of heredity by formulatingthe concept of gene linkage. In 1911, he proposedthat the fruit-fly genes for white eyes, yellowbody, and miniature wings are linked on the X chromosome.He and his colleagues subsequently foundthat the number of linkage groups is equal to thehaploid number of chromosomes, and that the lineararrangement of genes within the linkage groupcorresponds to the linear cytological structure of thechromosome. Morgan, who did so much to developthe concept of gene linkage, is immortalized in theterm “centimorgan.” This term is a unit of distanceused in linkage maps. Two loci that are one centimorganapart are separated by recombination anaverage of one in one hundred times (or one percentof the time, that is, in one gamete out of onehundred).Substantiation of the chromosome theory of hereditycame in 1914 from the work of one of Morgan’sstudents, Calvin Bridges, who found a rare exceptionto the linkage of genes on the fruit-fly X chromosome.He noticed that the exceptional inheritance ofthe sex-linked white eye color was accompanied bysimilar exceptional behavior of the sex chromosomes;he proposed meiotic nondisjunction as amechanism for this unusual inheritance. (Meioticnondisjunction refers to the improper separation ofhomologues during meiotic cell division. It isresponsible for some cases of the common chromosomaldisorder known as Down syndrome.)The laws of probability help to explain patterns ofinheritance. In analyzing his pea-breeding experiments,Mendel was a pioneer in the use of rigorousmathematical analysis of his biological data. Thenumbers of the various phenotypes of his plants ledhim to propose that each “particulate factor” (gene)has two “alternative forms” (alleles) and that the distributionof alleles among gametes is random. In1889, Francis Galton (a cousin of Charles Darwin)and his associate Karl Pearson demonstrated thatthere is a statistical association between traits shownby parents and their offspring, even when the traitshows a continuous variation such as that for heightor weight. In 1909, nine years after the rediscovery ofMendel’s work, Herman Nilsson-Ehle studied seedcoatcolor in wheat. He proposed that continuoustraits are determined by multiple genes, each ofwhich segregates according to Mendelian principles,and each of which has a small but additive effect.Your students presumably have encountered the lawsof probability in their study of Mendel’s experiments.In revisiting these principles, stress that the laws ofprobability are applicable only when the sample numberis large enough. For example, a small sample sizemay not display the predicted Mendelian distributionsfor a given gene or trait. Independent probability,another important concept, states that the outcomeof one independent event does not influence the outcomeof subsequent independent events. This conceptoften is summarized by the phrase, “probabilityhas no memory.” For instance, when considering theinheritance of an autosomal recessive disorder suchas cystic fibrosis, the chance that each child of heterozygousparents will be affected is one in four; it isnot correct to say that the birth of one affected childmeans that the next three will be unaffected. You canemphasize this point by examining the traditionalpedigrees (A-H) in Activity 2, Puzzling Pe d i g r e e s.41©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceMathematical principles also were central to thederivation and application of the Hardy-Weinbergequilibrium in population genetics. W.E. Castle, in1903, recognized a relationship between gene andgenotype frequencies. Then, in 1908, Godfrey H.Hardy and Wilhelm Weinberg independently discovereda mathematical relationship that explains thegeneral stability of gene and genotype frequencies ina population as genes are passed from generation togeneration. The Hardy-Weinberg equilibrium shows,contrary to prior assertions, that a dominant trait willnot drive its recessive counterpart from a populationof organisms. Equilibrium—stability in gene andgenotype frequencies—is the rule, assuming theabsence of evolutionary forces such as selection orgenetic drift, and if there is minimal mutation.GENETICS AND EVOLUTIONNo overview of classical genetics, even so brief atreatment as presented here, is complete without adiscussion of the relationship between genetics andevolution, the conceptual thread that binds all of biolog y. Charles Darwin realized that variation among themembers of any population of organisms is fuel forthe fires of natural selection. In fact, Ernst Mayra s s e rts that one of Darwin’s most important contributionswas the firm establishment among biologiststhat a species is not composed of one fixed, identicaltype, but rather of unique individuals that differ fromone another in a variety of ways. Fu rt h e rmore, Darwinrealized that the only variations that are importantto natural selection and speciation are those thatcan be passed from generation to generation.D a rwin had a vexing problem, however: he could notdefine a valid mechanism by which variations couldbe transmitted unchanged from one generation tothe next. The prevailing wisdom of the time—thelate-nineteenth century—was blending inheritance,the view that the characteristics of both parentsblend together in the offspring, producing progenythat are intermediate in character between the twoparents. Fleeming Jenkin, an engineer, argued in the1860s that blending inheritance would make differentialselection impossible because all members of apopulation would be the same. Fu rt h e rmore, withina few generations, blending inheritance would vitiatethe effects of any new variations that arose.Darwin, who published The Origin of Species in1859, could have found substantial help in the workof his contemporary, Gregor Mendel, who publishedhis paper “Experiments in Plant-Hybridization” in1865. Although Mendel almost certainly was awareof Darwin’s work, most historians of science agreethat Darwin never read Mendel’s paper, for, had hedone so, he likely would have recognized thatMendel’s experiments provided solutions to his naggingproblem. Mendel had demonstrated the particulatenature of inheritance, showing that hereditaryinformation is carried by some discrete elements inthe germ cells. These discrete elements permit thetransmission of traits in unchanged form. We nowcall these elements genes.Ironically, the rediscovery of Mendel’s work in 1900(about two decades after Darwin’s death) causedserious problems for Darwin’s theory. As evolutionarybiologist Douglas Futuyma (1986) explains, biologistsof that era “dismissed continuous variationamong individuals as inconsequential and largelynongenetic, and emphasized the role of discontinuousvariants that displayed Mendelian ratios andclearly particulate inheritance.” In 1918, however,Ronald A. Fisher found supporting evidence forNilssan-Ehle’s proposition about multiple genes.Fisher showed that continuous variation (height, forexample) results from multiple genes that are inheritedin Mendelian fashion and that have small, additiveeffects.The growth of population genetics and its accompanyingmathematical models led to the Modern Synthesisof Evolution during the 1930s and 1940s. Thisreconciliation of Mendel and Darwin involved someof this century’s greatest biologists, among themSewall Wright, J.B.S. Haldane, Ronald Fisher, ErnstM a y r, George Gaylord Simpson, TheodosiusDobzhansky, and G. Ledyard Stebbins.The 1944 discovery by Av e ry, McCart y, and MacLeodthat DNA is the genetic material and the 1953 delineationof DNA’s structure by Watson and Crick providedadditional opportunities to investigate geneticaspects of organic evolution, including the causes,rates, and effects of mutation. One obvious and currentexample of the relationship between geneticsand evolutionary biology is the ability to compare42©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VDNA base sequences among species to help establishphylogenetic relationships.In summary, the growth of genetics and the growthof evolution theory are intimately related. Becausegenetics is the study of the root source of biologicalvariation, which is central to evolutionary mechanisms,an understanding of basic principles in geneticsis central to an understanding of evolution itself.NONTRADITIONAL CONCEPTS IN GENETICSThe following sections describe some of the conceptsof inheritance that have been discovered sincethe development of the classical understanding ofinheritance in the late nineteenth and early twentiethcenturies. Keep in mind that it is not the inheritancethat is nontraditional, but rather our understandingof the inheritance that is new. Figure 14lists the nontraditional concepts of inheritancedescribed in this Overview.Some heritable traits are extranuclear. Mendelianprinciples of inheritance apply to chromosomes thatare found in the nucleus, but not to DNA that islocated elsewhere in the cell. For instance, mitochondrialDNA is packaged into a circular chromosome,of which there are thousands of copies perFigure 14 New (nontraditional) concepts ofinheritance■ Some heritable traits are extranuclear (mitochondrialinheritance, cytoplasmic inheritance).■ Genetic anticipation (increased severity of a geneticdisorder in later generations) correlates with expansionof trinucleotide repeats.■ Genomic imprinting can alter the expression of geneticinformation and distinguish its parental origin.■ Both chromosomes of a pair may, in rare cases, comefrom one parent (uniparental disomy).■ Some genes are mobile and can insert themselves innew chromosomal locations.■ Genes may, in rare cases, undergo horizontal transferbetween individuals or species.■ Many traits result from expression of more than onegene combined with environmental factors (multifactorialinheritance).■ Genetic information specified by genomic sequencemay be altered during RNAediting.cell. All of the mitochondria in a fertilized zygote arecontributed by the ovum; none come from thesperm. Activity 2 introduces students to the conceptof maternal inheritance of mitochondrial genes.(Copymaster 2-5 in Activity 2 includes an illustrationof mitochondrial inheritance.) A similar phenomenonof extranuclear inheritance occurs in the inheritanceof chloroplast DNA.Genetic anticipation correlates with expansion oftrinucleotide repeats. Traditional principles of geneticspredict that the structure of a gene remains stableas it passes from parent to child. Even in situationswhere a mutation arises in a gene, the alteredstructure generally remains fixed and is inherited inthat form. The recent discovery of unstable trinucleotiderepeats, however, has shown that parts ofthe gene are not so stable.The term “trinucleotide repeat” refers to a specificDNA sequence of three nucleotides that is repeatedover and over again, one after the other. The precisenumber of these repeated trinucleotides at part i c u l a rlocations in the genome varies from person to person.These so-called “polymorphic” (multiple form s )repeat regions are largely stable; that is, when a particularchromosome is passed from parent to child,the number of repeated trinucleotides remains thesame. The size of the repeated unit can vary from twoto several hundred nucleotides. The variability andstability of these polymorphic repeat regions providethe basis of DNA fingerprinting, which is used inforensic and medical application (see For Your Information:DNA fingerprinting, p. 44).Most regions of trinucleotide repeats stay the samelength. Some trinucleotide repeat regions are unusual,however, in that they are unstable once theyexceed a particular size. Phenotypic effects of thisphenomenon are evident in cases where the unstabletrinucleotide repeat region lies within the portionof a gene that is transcribed to RNA (althoughnot necessarily in the coding region, see Figure 13).Molecular biologists uncovered the first example ofthis phenomenon in 1991 with the discovery of thegene causing fragile X syndrome, an X- l i n ked disorderthat is the most common cause of inheritedmental retardation (see For Your Inform a t i o n :Fragile X syndrome, p. 45). Here, research43©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceFor Your InformationDNA fingerprintingSome DNA differences between two individuals can be detected only by comparing nucleotidesequences. There are, however, two basic kinds of DNA variation, or polymorphism, that are detectedmore easily, as shown in the illustration. One of these types of polymorphism is the restrictionfragment length polymorphism (RFLP)—the variable length of DNA fragments produced by the presenceor absence of a recognition site for a specific restriction endonuclease.A second type of DNA polymorphism is an array of repeated DNA sequences that varies in the numberof repeated units. Not all the arrays of repeated sequences are polymorphic, but those that are serve asexcellent markers for tracing the inheritance of particular regions of the genome. One of the reasonsthat repeat polymorphisms are more useful than RFLPs is that the number of alleles at a particularlocus can be highly variable. In contrast, an RFLP usually has only two alleles (the presence or absenceof restriction-endonuclease recognition site). Repeat polymorphisms are therefore very informative.If one investigates a repeat polymorphism by Southern analysis, the location of the probe determinesthe nature of the result. If the probe corresponds to the repeated sequence itself, then bands representinga l l genomic locations of the polymorphism will be evident. This approach is the nature of the DNAfingerprinting method developed byAlec Jeffreys in 1985, where each DNAsample from an individual looks like abar code. This technique can be usedfor forensic purposes by matchingDNA from specimens at a crime scenewith DNA isolated from suspects.A l t e r n a t i v e l y, DNA fingerprinting canbe used to rule out or provide strongevidence for parentage, because eachband in someone’s “bar code” hasbeen inherited from one or the otherparent. For instance, if there arebands in a child’s DNA fingerprintthat do not appear in the DNA patterneither of the supposed father or theknown mother, then the paternitymust be questioned.Another way to follow repeat polymorphismsis to use a probe just outsidethe repeat region, where theDNA sequence is unique, or to usethe polymerase chain reaction (PCR)for specific isolation of the repeatregion. This method can be useful infinding DNA markers linked to diseasegenes.DNA polymorphisms. (a) RFLP: In allele 2, a missing recognitionsite for a restriction enzyme results in digestion of fewer sites and inthe generation of a different pattern of fragments. (b) Repeat Po l y-morphism: The number of sequence repeats may very between alleles.When the repeat region in each allele is cut out using a specificrestriction enzyme or amplified by PCR, the number of repeats can bec o m p a r e d .44©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VFor Your InformationFragile X syndromeclinical featuresThe principal features of fragile X syndrome in affected males are mental retardation, long face, andlarge testes after puberty. Carrier females do not have a distinctive appearance, but about one-thirdare mildly mentally retarded.incidenceFor human males, this disorder is the most common cause of inherited mental retardation, occurringin 1:1000-2000 male births. Incidence in females is lower, around 1:8000.inheritanceFragile X syndrome, as the name implies, is an X-linked trait; it shows variable penetrance andexpressivity. About one-fifth of males who transmit the mutant gene have no symptoms themselves.About one-third of heterozygous females show some clinical features. The likelihood that symptomswill appear in family members increases in later generations. This observation originally was calledthe “Sherman paradox.” Because of new molecular data, the Sherman paradox now is attributed toexpansion of a trinucleotide repeat region.gene and proteinThe gene responsible for fragile X syndrome lies on the X chromosome and was isolated in 1991. The geneproduct is a protein that has RNA-binding properties, but its precise function in the cell is still being investigated.The gene contains a polymorphic and unstable CGG trinucleotide repeat in the portion of the genethat is transcribed, although the repeat region lies outside the coding region. The normal range of variationin the trinucleotide repeat number is 5-50; beyond that, the repeat becomes unstable and can expand duringtransmission from parent to child. Expansion is more pronounced when an unstable allele is inheritedfrom the mother. (The number of repeats correlates to the presence of symptoms see Figure 15).disease mechanismExpansion of the trinucleotide repeat in fragile X syndrome disrupts production of the protein product,which under normal circumstances is found at highest levels in the brain and testes. Lack of this proteinpresumably prevents normal development of these tissues in particular.diagnosisDiagnosis based on clinical manifestations generally occurs in infancy or early childhood. Large ears andslow development are indications. Diagnosis has been possible by cytogenetic analysis; this test uses lymphocytesand can be done at any age, including prenatally. Cytogenetic analysis relies on detection offragility of the X chromosome characteristic of this mutation. A preferable diagnosis uses molecular geneticanalysis of the associated repeats in the gene associated with fragile X mental retardation (F M R 1).treatmentNo treatment is available for fragile X syndrome.revealed a polymorphic CGG trinucleotide repeatthat lies in the region of the gene transcribed intomRNA but outside the coding region. Studies of thefragile X gene revealed a correlation between thenumber of CGG repeats and the phenotype. Allmale patients with fragile X syndrome had morethan 200 CGG repeats, whereas unaffected peoplefrom outside these families had between 5 and 50CGG repeats. A third group of people withbetween 50 and 200 CGG repeats were those familymembers who were unaffected carriers of thed i s o r d e r. Alleles with greater than 50 CGG repeats45©1997 by BSCS.

Section V ■Genetics: Basic Concepts and Nontraditional InheritanceFigure 15 The number of trinucleotide repeatscorrelates to phenotype for certain genetic disorders:Notice the overlap of symbols, suggesting that thenumber of repeats is not the only factor to influencemanifestation of the disorder.usually increased in size during passage from parentto child, especially when the unstable allelecame from the mother. Generally, the greater thenumber of repeats, the higher the likelihood thatexpansion will occur during transmission to thenext generation. We do not know the precisemechanism of the instability (which is usually, butnot always, expansion) and the reason for the differencesin parental inheritance.Soon after the discovery of the fragile X gene andits unstable trinucleotide repeats, biologists discoveredthe same type of mutation in several otherdisorders (Figure 15). Two of these, myotonic dystrophyand Huntington disease, serve as examplesin Activity 3, Clues and Discoveries in Science ( s e eFor Your Information on each of these topics:Myotonic dystrophy, Huntington disease and P r e-dictive testing for HD). Myotonic dystrophy andFigure 16 Correlation between the trinucleotiderepeat number and the clinical features ofmyotonic dystrophy: The numbers represent howmany copies of the trinucleotide repeats are present ineach allele.Huntington disease exhibit “anticipation,” which isthe increasing severity and/or earlier onset ofsymptoms in generations of an affected family. Thisphenomenon is particularly apparent in myotonicd y s t r o p h y, where there is a good corr e l a t i o nbetween the length of the unstable trinucleotiderepeat and the severity of the symptoms (see Fi g-ure 16). As with fragile X syndrome, the relationshipbetween the larger number of repeats andmore severe symptoms in myotonic dystrophy isu n c l e a r. Fu rt h e r, as with fragile X syndrome,myotonic dystrophy and Huntington disease showincreased anticipation when the passage is througha parent of one particular sex. Anticipation isgreater when the passage is through mothers whohave myotonic dystrophy; in the case of Hunting-46©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VFor Your InformationMyotonic dystrophyclinical featuresThe symptoms of myotonic dystrophy (DM) are extremely variable. In late onset of DM, symptomsinclude a hollow facial appearance accompanied by sagging facial muscles. Other symptoms includecataracts, frontal balding, heart arrhythmia, myotonia (inability to release a grip), muscle weakness,defective speech, bronchitis, and mental retardation. A severe congenital form has major muscle weakness,moderate mental retardation, and exhibits myotonia in early childhood.incidenceDM is the most common adult muscular dystrophy, occurring at roughly 1:1,800-8,000 in Europeanand American populations, 1:18,000 in Japan, and very rarely in Africa. Reports of incidence varydepending on the criteria used to establish that an individual is affected.inheritanceDM is inherited as an autosomal dominant disorder that shows anticipation. Expressivity of the mutantgene varies, and penetrance can be incomplete. Congenital DM is inherited maternally.gene and proteinThe mutation has been mapped to a location on chromosome 19 (19q 13.2-13.3). The affectedgene has a region of unstable trinucleotide repeats (CTG). Ranges from 50 to several thousandcopies of the repeat are associated with affected individuals. The locus is referred to as D M P K(myotonic dystrophy protein kinase). The gene product is a protein kinase, sometimes calledmyotonin kinase.disease mechanismThe exact mechanism is not understood. Symptoms develop as a result of weakness, atrophy, andmyotonia of affected muscles, especially in the face and neck muscles and in the extremities. For congenitalDM, the major cause of death likely is from the involvement of respiratory muscles.diagnosisDiagnosis of adult-onset DM is based on the presence of the clinical features described above, coupledwith family history, molecular genetic data, and, possibly, evidence of myotonia based on a test by electromyography.Congenital DM is diagnosed by the presence of this disorder in the mother, seen togetherwith reduced fetal movements, muscle weakness, respiratory difficulties, and mental retardation.DM can be diagnosed by prenatal genetic tests combined with ultrasound.treatmentPhysical therapy and surgery for cataracts are useful for mild adult symptoms. External pacemakersmay help patients who have atrioventricular blocks.ton disease, anticipation is greater through affectedfathers. We do not know the mechanisms forthese sex differences, but they could involve differentialinstability of the trinucleotide repeats duringmeiosis; another possible mechanism is imprinting(see the following discussion).Several other genetic disorders are associated withunstable trinucleotide repeats. A review in the1995 Annual Review of Genetics “ Tr i n u c l e o t i d eRepeat Expansion and Human Disease,” by C.T.A s h l e y, Jr., and S.T. Wa rren, describes nine diseasesin which expansion of trinucleotide repeats is47©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional InheritanceFor Your InformationHuntington diseaseclinical featuresHuntington disease (HD) produces chorea (twitching or twisting involuntary movements that occurwhen the affected person attempts voluntary movement) and dementia. Speech often is affected,and memory lapses may occur. HD is a late-onset disease that usually manifests itself in middle ageor later, although the age of onset varies from one generation to another.incidenceApproximately 1:10,000-20,000 for predominately Caucasian populations; 1:333,000 in Asian populations(particularly in Japan); incidence is lowest among African Black populations.inheritanceHD is inherited as an autosomal dominant disorder that exhibits genetic anticipation.gene and proteinThe mutant gene for HD was isolated in 1993, although detection by linkage analysis was availableabout 10 years earlier. The gene is called IT-15, and it is located on chromosome 4, in the 4p16.3region. The trinucleotide CAG is repeated a variable number of times, in tandem, in this gene.Repeat numbers in the range 40-100 are unstable and result in HD. There is evidence of incompletepenetrance for people with alleles carrying repeats in the range 36-39. The protein encoded by thisgene is named huntingtin.disease mechanismHD is a neurological disorder, but we do not yet know the exact biochemical mechanism.diagnosisDiagnosis is made by the combined presence of chorea and dementia, positive family history, and/orgenetic test results showing more than 40 trinucleotide repeats in the associated gene.treatmentThere is no treatment to alter the progress of this disorder, although we can manage the symptomsto some degree with drugs.known to play a role. Since that time, research hasshown that another disorder, Friedreich ataxia, isassociated with an unstable GAA repeat. This disorderoften begins in childhood or adolescencewith clumsiness involving the extremities. Generally, there is no mental deficiency, but the neurologicalproblems progress steadily. Death generallyresults in the mid to late thirties. It is usually inheritedas an autosomal recessive disorder, but about10 percent of cases indicate autosomal dominanti n h e r i t a n c e .Genomic imprinting can alter the expression ofgenetic information and distinguish its parental origi n . Mendelian principles predict that each parentcontributes one copy of a particular autosomal geneto offspring. Implicit in this prediction is the assumptionthat the two copies of a given autosomal genebehave in the same way, such that the parental originof a particular allele does not affect its expression.Although this assumption appears to be correct formost genes, there are exceptions. In some genes, allelesare differentially expressed, depending on their48©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VFor Your InformationPredictive testing for Huntington diseaseMolecular biologists have known since 1983 that the gene responsible for Huntington disease (HD) liesnear one end of human chromosome 4. At that time, the gene itself had not been found, but there was apolymorphic DNA marker whose pattern of inheritance closely matched that of HD in affected families,and which therefore was closely linked to the gene. Research soon identified additional polymorphicmarkers close to the HD gene, and predictive testing by linkage analysis became an option for families in1986. Linkage analysis uses the presence of identifiable markers located quite near a gene of interest toidentify the presence of that gene as being highly probable. This illustration shows predictive testing ofHuntington disease by linkage analysis. The mutant gene is traveling with the “aw” haplotype.There were a number of limitations to predictive testing by linkage analysis. Although the markersaround the HD gene were linked closely, there was a 4 percent probability that they would be separatedby recombination.That situation meantthat if a person at riskfor HD inherited thesame alleles for themarkers that anotheraffected member oftheir family had, thisperson could be toldwith only 96 percentcertainty that he orshe also would developthe disease. Anotherproblem with linkageanalysis was thatthe polymorphic markerswere not “informative”in some families.For instance, if anaffected parent hadidentical polymorphicmarkers on both chromosomes,it was not possible to tell which of the chromosomes had been passed on to his or her children—thechromosome with the HD gene, or the one without the HD gene. Therefore, it was impossibleto predict who in the family would develop HD. In addition, linkage analysis usually was notpossible in the absence of DNA from an affected individual or other key family members.The discovery of the mutant HD gene made direct predictive testing possible. By using Southernanalysis or the polymerase chain reaction (PCR), scientists can measure the length of the trinucleotiderepeat region in this gene. A person who has more than 40 trinucleotide repeats eventuallywill develop HD, unless death occurs by some other cause first. See Figure 15 for an indication ofthe range of repeat numbers seen in the HD gene.49©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional Inheritanceparental source. This phenomenon is called “genomicimprinting” (Figure 17). For each imprinted gene,either the paternal or maternal allele, or both, arem a r ked in some way that influences gene expression.It is usually the marked allele that is suppressed. Wedo not understand the imprinting process completely, but it gives an allele a distinctive behavior thatreflects the parental source. 4A primary imprint likely is acquired at the particulargenetic location during meiosis, and this imprint ismaintained on the particular chromosome in thehaploid gamete. After fertilization, the imprint ismaintained on the paternal or maternal chromosomethroughout DNA replication in the diploidzygote. That imprint then leads to functional differencesbetween the paternal and maternal alleles insomatic cells. Imprinting is reversible in that theimprint is erased during the production of germcells, from which gametes are derived. Imprintingmay involve DNA methylation, although evidence is,at present, insufficient to establish the molecularmechanism with certainty.P r a d e r-Willi syndrome and Angelman syndromeillustrate genomic imprinting in humans. Prader-Willi syndrome is characterized by obesity, excessiveappetite, small hands and feet, short stature,small sexual organs, and mental retardation. In contrast,Angelman syndrome is characterized bysevere mental retardation, inappropriate laughter,seizures, and uncoordinated movements. Thegenes responsible for these disorders are in thesame region of chromosome 15 (15q11-13). A tinydeletion in this region can result either in Prader-Figure 17 Genomic imprinting: (a.) The pedigreeshows the pattern of inheritance of an imprinted genethat behaves differently in individual 3 than it did in individual2. ( b . ) A gene in the gametes of individual 1 has afemale imprint that affects its behavior when it is inheritedmaternally by individual 2. In his germ cells, theimprint will be erased, to be replaced by his own imprint.4The term imprinting has an interesting history. It was used earlier in a genetic context to refer to the selective eliminationof a paternal chromosome or to the selective inactivation of the X chromosome derived from the male parent.©1997 by BSCS.50

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VWilli syndrome or Angelman syndrome; the disorderthat results depends, in part, on the parentalorigin of the chromosome carrying the deletion(see Figure 18). If the chromosome 15 deletion is ofm a t e rnal origin, Angelman syndrome results. Prader-Willi syndrome results if the chromosome 15deletion is paternal in origin. This difference suggeststhat the region containing the genes associatedwith these disorders normally carries an imprintthat distinguishes the maternal and paternal allelesand that influences gene expression.Additional evidence for imprinting comes from extensivestudies in mice. Embryos that have a full set ofchromosomes derived from only one parent invariablyfail to develop properly, even though they have a completeset of genes. Without a maternal set of chromosomes,the embryo is abnormal, and without a paternalset of chromosomes, the placenta fails to develop.That phenomenon also occurs in humans. Theseo b s e rvations suggest that the parental source of achromosome can influence its effect; normal cellsrequire a complement of maternal and paternal genes.It also is not possible to generate a viable embryo fromthe fusion of two female ova, or from the fusion ofoocyte chromosomes with chromosomes from thefirst polar body (a by-product of meiosis).Both chromosomes of a pair may, in rare cases, comefrom one parent. Mendelian principles predict that, ina pair of chromosomes, one homolog has been contributedfrom each parent. In rare situations, however,this pattern is not the case, and both chromosomes ofa pair are inherited from the same parent. This unusualform of inheritance is called “uniparental disomy. ”This situation may arise from a starting condition of trisomy—theextra chromosome then is lost. If it was theonly homolog from one of the parents, uniparentaldisomy results. If the remaining pair of chromosomescame from one parent and are i d e n t i c a l, the conditionis called uniparental “i s od i s o m y.” If the remaining pairof chromosomes came from one parent and are d i f-f e r e n t homologs, the result is uniparental “h e t e r od i s-o m y.” Errors in chromosome replication can result inthese unusual patterns of inheritance.Figure 18 Genomic imprinting results in differentphenotypic expression in these two human geneticd i s o r d e r s : Deletion in the same region of human chromosome15 behaves differently depending on the parentof origin. Maternal inheritance results in Angelman syndrome;paternal inheritance causes Prader-Willi syndrome.Uniparental disomy can produce a similar effect.The phenotypic consequences of uniparental disomyinclude the unusual inheritance of autosomal recessivetraits and aberrations related to imprinting. Uniparentaldisomy in humans was first recognized in thelate 1980s, when a girl with cystic fibrosis and shortstature was found to have two identical copies of muchor all of the maternal chromosome 7. Her mother wasa heterozygous carrier of a cystic fibrosis allele, and thedaughter maternally inherited a duplicate copy of themutant allele, resulting in uniparental isodisomy forchromosome 7. The short stature probably resultedfrom an imprinting effect. This cystic fibrosis exampleshows one pattern that can signal uniparental disomy:a child expresses a recessive trait but, surprisingly, it isnot true that b o t h parents carry the recessive allele, aswould be expected based on traditional concepts ofrecessive inheritance.If the chromosome pair for which there is uniparentaldisomy includes an imprinted gene, and ifthe donor parent is the one whose alleles are suppressed,then that gene will not be expressed in theoffspring. That situation is one of the mechanisms bywhich Prader-Willi syndrome can occur, since theinheritance of two maternal chromosomes 15 hasthe same effect as a localized deletion in the appropriatepart of the paternal chromosome 15. Prader-Willi syndrome can occur as a result of (maternal)uniparental isodisomy or heterodisomy.51©1997 by BSCS.

Section V ■Genetics: Basic Concepts and Nontraditional InheritanceSome genes are mobile and can insert themselves innew chromosomal locations. Classic laws of inheritanceassume that a gene occurs at a fixed location inthe genome. There are, however, “transposablegenetic elements” that are mobile. Barbara McClintock,while performing breeding experiments inmaize (Zea mays) in the 1940s, was one of the firstscientists to recognize that genes could movearound in the genome. She saw odd patterns in theinheritance of pigments in maize kernels that onecould not explain by conventional genetic theories.She eventually concluded that a few genes do nothave fixed locations in the genome but instead movefrom one location to another during the passagefrom parent to progeny.Barbara McClintock’s discovery of transposablegenetic elements is a good example of the natureand methods of science. She made observations inthe 1940s that did not fit the classic understanding ofinheritance, and she proposed new explanations forthose observations. Although her hypotheses werenot widely accepted at first, she continued her workand, gradually, with the accumulation of more evidence,her views gained strength. In the 1970s,experiments in molecular biology provided a mechanismfor the behavior of transposons. Moleculardata demonstrated that small pieces of DNA sometimesmove around the genome, triggering changesin gene expression. McClintock’s hypothesis is nowwidely acknowledged, and she won the Nobel Prizefor Physiology or Medicine in 1983. McClintock isone among many scientists, male and female, whostruggle to gain acceptance of revolutionary ideasthat contradict the prevailing wisdom. Science isinherently self-correcting, so one expects that accurateexplanations ultimately will prevail.Since the original discovery of transposable geneticelements in maize, research has uncovered similarfactors in other species, including bacteria, fruit flies,and humans. Transposable genetic elements are likeviruses in that they can incorporate themselves intothe host genome; they do not, however, have a proteincoat and therefore are restricted to movementwithin a single cell. In moving, a transposable geneticelement breaks away from its site in the genomeand inserts itself somewhere else, either in the sameor a different chromosome. Sometimes a copy of theelement is left in the original location; other times itis excised completely. Not surprisingly, the movementof transposable genetic elements can be quitedisruptive. Insertion of a transposable genetic elementinto a gene can turn off its expression (whichis what was happening in McClintock’s genes formaize pigment). Inaccurate repair of the DNA at theoriginal site can cause a gene mutation.Genes may, in rare cases, undergo horizontaltransfer between individuals or species. Mendelianpatterns of inheritance apply to the vertical transmissionof genes from parent to child. Genes can betransmitted horizontally, however, as in the transferof genes between individuals or species. The classicexample of this is the demonstration that one canchange the phenotype of bacteria by transferringDNA from one strain to another (see the entry for1944 in Figure 11). Whereas gene transfer betweenprokaryotes is not uncommon, there is little evidenceto show that it has happened in eukaryotes.Nevertheless, it is possible that a transposable geneticelement called a P element was passed from onespecies of fruit fly to another sometime in the last 50years. It is possible that this DNA transfer occurredthrough the mouthpiece of a parasitic mite. Anotherpossibility for cross-species gene transfer is throughviral vectors.Many traits result from expression of more thanone gene combined with environmental factors(multifactorial inheritance). Classic inheritancepatterns are more easily recognized in traits thatresult from single genes than in those traits thatresult from more than one gene (polygenic) and thatare influenced significantly by environmental factors.This combination of environmental influence andaction of multiple genes is called multifactorial inheritance.These types of traits might appear to run infamilies, but without any recognizable pattern. Figure19 illustrates the concept of a multifactorial trait.(Many single gene traits are subject to environmentalinfluences. Although multiple factors are at workin such circumstances, the term multifactorial generallyis reserved for polygenic traits that are influencedby environment.)When Mendel’s laws were rediscovered at the turn ofthe twentieth century, the factors of inheritance52©1997 by BSCS.

Genetics: Basic Concepts and Nontraditional Inheritance ■ Section VFigure 19 Interaction of genotype, phenotype, and environmental influences: Many traits result from the combinedinfluence of several genes plus environmental factors.were viewed as particulate and fixed so that outcomesfrom any given genotype would be similar, ifnot identical. Since that time, we have learned that avariety of factors can affect the phenotype in additionto what is prescribed by the genotype. Environment,for example, often influences genotypicexpression. Plants or people that inherit genotypesfor tall adult stature will show that phenotype only ifplaced in an environment where nutritional factorsallow them to reach the potential of their genotype.If placed in a nutritionally restricted setting, no genotypewill allow them to reach great stature. Similarly,we know that genes can act on each other or contributedirectly to phenotype. For example, someinherited anemias may be less severe in individualswho have counterbalancing genes for the increasedproduction of red blood cells. Finally, there is astrong element of chance in the expression of manygenes, an element that is not yet well understood.Chance may play a role in the time at which a certaingene is turned on or off, which can affect the timingof the appearance or relative degree of expression ofa trait.Multifactorial traits (as distinct from single-gene traitsthat show variable expression) can be divided intothree classes characterized by continuous variation,threshold traits, and complex adult disorders. In traitsthat show continuous variation, an “abnormal” phenotypesimply represents an extreme variation of then o rmal range. Examples include many kinds of nonspecificmental retardation and unusual height (very53©1997 by BSCS.

Section V ■ Genetics: Basic Concepts and Nontraditional Inheritances h o rt or very tall). In multifactorial threshold traits,there is a clear distinction between normal anda b n o rmal phenotypes. In these cases, there may bean underlying continuous variation until a part i c u l a rthreshold is reached, at which point the abnorm a lphenotype appears. This model has been proposedto explain several common congenital abnorm a l i t i e ssuch as cleft lip and palate and neural tube defects(such as spina bifida). In complex adult disorderssuch as coronary art e ry disease and diabetes mellitus,there is a variety of genetic and environmental influences.Here, a person is genetically predisposed to ap a rticular illness, but can impose a strong influenceon the outcome by lifestyle choices (such as diet).Genetic information specified by genomic sequencemay be altered during RNA editing. Classic geneticprinciples predict that an mRNA molecule, whichdirects the synthesis of a protein from amino acidcomponents, is faithfully transcribed from its parentgene. Biologists have known for about 20 years thatthe coding region of a eukaryotic gene is usuallyi n t e rrupted by introns that are excised during mRNAprocessing, but they assumed that the coding port i o nof mRNA remained unaltered during the conversionfrom precursor RNA to mature mRNA.Research in recent years has uncovered a phenomenoncalled RNA editing, where crucial coding informationis added to the mRNA after its transcriptionfrom DNA. The best understood example of RNAediting is that seen in trypanosome parasites, whichcause sleeping sickness and other illnesses. In 1986,molecular biologists made the baffling observationthat mRNAs from some of the mitochondrial genesare longer than the genes from which they arederived. Additional (uridine) bases had been addedat specific points throughout the mRNAs, makingsense of what, at the DNA level, was nonsense.Research done in 1990 proposed an explanation forthis observation: smaller circles of DNA in the trypanosomemitochondria, whose function was previouslyunknown, produce small “guide RNAs” thatfind and correct omissions in the mRNA. The evolutionarysignificance of such a mechanism is still amystery. Perhaps RNA editing is related to the wellknownability of the trypanosome to change its antigenicstructure and thereby confound the immuneresponse of the host organism.SUMMARYThis section of the O v e rview for Te a c h e r s e m p h a-sizes that our understanding of inheritance since thetime of Mendel has endured and changed—and,indeed, is still changing. Traditional Mendeliangenetics continues to describe accurately the majorityof what we observe in inheritance, and new discoveriescontinue to refine and extend our level ofunderstanding of the gene and of genetics.For additional information on some human geneticdisorders, contact the following organizations.Alliance of Genetic Support Groups35 Wisconsin Circle, Suite 440Chevy Chase, MD 20815-70151-301-652-5553FAX: 1-301-654-0171E-mail: alliance@capaccess.orghttp://medhlp.netusa.net/www/agsg.htmHuntington’s Disease Society of America140 West 22nd Street, Sixth FloorNew York, NY 10011-24201-800-345-HDSA (4372)1-212-242-1968h t t p :// n e u r o - w w w 2 . m g h vard.edu/hdsa/hdsamain.nclk. h a rThe National Fragile X Foundation1441 York Street, Suite 215Denver, CO 802061-800-688-87651-303-333-6155Muscular Dystrophy Association3300 East Sunrise DriveTucson, AZ 85718-32081-602-529-2000http://www.mdausa.orgFor CompuServe users, you can use the CommunicationService Forum and ask the experts online.Get into the system and type GO MDA.54©1997 by BSCS.

GlossaryWe have provided this glossary for your convenience.The memorization of these terms is not anobjective of this module, and we encourage you notto turn this list, or any portion of it, into a test.affected: the condition of having a particular trait,usually used in the context of a disadvantageoustrait, as for a disease symptom.allele: one of the alternative forms of a gene at agiven locus.anticipation: earlier onset or increased severity ofan inherited disorder in subsequent generations.(See trinucleotide repeats.)autosome: a chromosome other than a sex chromosome.Humans have 22 pairs of autosomes.c h i a s m a : (plural is chiasmata) the point of crossingover during prophase I of meiosis in which there is anactual exchange of genetic material between thepaired maternal and paternal copies of chromosomes.coding region: a stretch of DNA sequence (in agene) that encodes protein.codominant: the condition in which a pair of allelesfor a given locus equally contributes to the phenotypeof the heterozygote who bears them.congenital: existing from birth (note that this termdoes not distinguish whether the condition is inherited,or environmental, or both).c r e d i b l e : (in the context of scientific methods)the condition of being reliable and based onacceptable methods, as in reference to evidencethat meets scientific criteria for accuracy andr e p r o d u c i b i l i t y.cytogenetics: a subdiscipline of genetics that combinesthe study of the cell with the study of genetics,often focusing on the structure, function, and behaviorof chromosomes.deletion: (in the context of molecular genetics) theabsence of one or more nucleotides normally foundin a gene, resulting in a mutation.developmental autonomy: (in the context ofethics) having sufficient mental and emotional maturityto be capable of informed consent.diploid: having two copies of each chromosome; adiploid cell has a chromosome number of 2N. Inhumans, the diploid number is 46.D M : abbreviation for the human genetic disordermyotonic dystrophy. This disorder shows variablee x p r e s s i v i t , ywith symptoms ranging from cataracts and55

Glossarymild muscle weakness to extreme muscle wasting andcontraction, impairment of some organ function, andmental retardation. DM displays genetic anticipation asa result of unstable trinucleotide repeats in the mutantgene associated with the disorder.DOE: the United States Department of Energy.dominant: the pattern of inheritance in which anallele expresses its phenotypic effect even in heterozygotesand masks that of some other allele at thesame locus. A trait expressed by dominant inheritanceis called a dominant trait.ELSI: Ethical, Legal, and Social Implications, a divisionof the Human Genome Project.e u ka ry o t e : an organism in which cells have amembrane-bound nucleus. Eukaryotes have othersubcellular organelles, such as mitochondria or, inthe case of plant cells, chloroplasts. Humans aree u k a ry o t e s .expression: in the molecular context, the transcriptionof a gene into RNA products, some of which arealso translated into proteins. In a larger genetic context,expression refers to the phenotypic manifestationof an allele.extranuclear inheritance: inheritance from DNAsources external to the chromosomes found in thenucleus. Extranuclear inheritance can derive frommitochondrial DNA or chloroplast DNA. Other termsused for this phenomenon are maternal inheritance(for mitochondrial inheritance), cytoplasmic inheritance,or extrachromosomal inheritance.gamete: a sexual reproductive cell. Gametes arehaploid, having a single (N) complement of geneticmaterial. In humans, the gametes are ova and sperm.g e n e : the basic unit of heredity, in terms of functionand in the physical sense. A gene is a region of DNAthat is transcribed (into RNA) plus the regulatory DNAsequences necessary for transcription. (Not all genesencode protein. For example, in the genes for ribosomalRNA, the transcript is the functional product.)genome: the entire complement of genetic material.The Human Genome Project defines the humangenome as a single haploid set of nuclear chromosomes,plus the mitochondrial genome.g e n o t y p e :the genetic make-up of a cell or organism.Genotype can be contrasted with the phenotype (thedetectable attributes). Genotype also can refer to thep a rticular allelic make-up for a given gene.haploid: a cell (or organism) having only one chromosomeset (N). (See gamete and diploid.)HD: abbreviation for the human genetic disorderHuntington disease. HD is a disorder of the nervoussystem, usually with adult onset of symptoms. Thedisorder displays genetic anticipation as a result ofunstable trinucleotide repeats in the mutant gene.The disorder is fatal.heritable: capable of being transmitted to offspring.heterodisomy: a particular example of uniparentaldisomy (q.v.) in which the two chromosomes arenonidentical homologs. (See also isodisomy.)heterozygous: the condition of having two differentalleles at a particular locus on a pair of chromosomes(homologs).HGP: the Human Genome Project; a large, collaborative,scientific research effort funded in the UnitedStates by the U.S. Department of Energy (DOE) andthe National Institutes of Health (NIH).homolog: one of a pair of chromosomes that containequivalent genetic information. In germ l i n ecells, homologs pair with one another during meiosis.One homolog is derived from the mother andone from the father.homozygous: the condition of having identical allelesfor a particular gene at a given locus in a chromosomepair.hypothesis: a testable idea or explanation proposedin response to previous knowledge and specificobservations.imprinting: (in the context of genetics) a processthrough which a gene becomes marked chemicallyin a manner that reflects the sex of the parent transmittingthe gene. Imprinting alters the function of aparticular allele such that an allele inherited from themale parent behaves differently from an allele that isinherited from the female parent. Not all genes areimprinted. The exact mechanism for imprinting isnot known.56©1997 by BSCS.

Glossaryinformatics: the study of information processing.In the field of biology, informatics generally refers tothe study of genetic sequence data.isodisomy: a particular example of uniparental disomy(q.v.) in which the two chromosomes are identical.(See also heterodisomy.)karyotype: the entire set of chromosomes of anindividual cell made visible by staining andmicroscopy and arranged by size and chromosomenumber.l i n kage analysis: a laboratory technique that determinesthe presence of a gene of interest by the presenceof identifiable markers located close to the gene.linked genes: genes located on the same chromosome.Genes that are close together—tightlylinked—are less likely to be separated during recombination.locus: the location of a gene on a chromosome.marker: (in the context of genetics) an identifiableallele that expresses a known phenotype or a moleculartag (such as a DNA or RNA fragment) to signalthe presence of an allele or chromosomal location ofinterest. DNA or RNA fragments also are used to bindto, and thus identify, a particular genetic sequence ina nucleic acid fragment.meiosis: a specialized process of cell division thatreduces the chromosome number to the single(haploid) complement (N). Meiosis takes place ingermline cells. Meiosis produces 4 haploid daughtercells from one diploid cell, involving one round ofDNA replication.Mendelian genetics: the fundamental concepts ofgenetic transmission put forward by Mendel andexpanded to include knowledge of genetic linkageand sex chromosomes.methylation: a chemical process that adds a methylgroup to a molecule; this process can be carried outin living systems by enzymes called methylases. DNAcan be methylated at specific sites, a process thatmay regulate gene expression. Methylation has beensuggested as a possible mechanism of genomicimprinting. Methylation is involved in X-chromosomeinactivation.mitochondrial DNA: the DNA found in mitochondria,the organelles of eukaryotic cells that are importantin energy-related reactions. Mitochondrial DNAcan replicate independently of the genomic DNA foundin the nucleus, and cells have many mitochondria. Inhumans, mitochondria are transmitted matern a l l y.mRNA: messenger RNA, the fully processed form ofthe transcript copied from the DNA sequence of agene and used to direct protein synthesis.multifactorial inheritance: inheritance in whichthe phenotype results from combined action ofmore than one gene (polygenes) with additionalenvironmental influences.mutation: a physical change in genetic material,such as a base-pair substitution or deletion in DNA.Chromosome breaks or rearrangements involvelarge-scale mutations. If the mutation occurs in body(somatic) cells, the results affect only the individualbearing those cells; if the mutation is in germlinecells, the change can be transmitted to offspring.n o n d i s j u n c t i o n :improper separation of homologsor sister chromatids during meiosis or mitosis. Duringmeiosis, this process can result in a diploid conditionfor a particular chromosome in one gamete and theabsence of that chromosome in another gamete.nontraditional inheritance: an informal term thatrefers to new concepts of inheritance that describeprocesses that were not traditionally understood ortaught in Mendelian genetics. For example, imprintingis a process not explained by traditional Mendelianc o n c e p t s .ovum: a female gamete, commonly called an “egg.”PCR: polymerase chain reaction. A laboratory techniquethat exploits DNA polymerases (enzymes thathelp replicate DNA) derived from bacteria that live athigh altitudes. The technique permits the in vitroproduction of large amounts of DNA copied from avery small amount of sample DNA.penetrance: the proportion of individuals with agiven genotype who express any of the phenotypicfeatures of the trait. Incomplete penetrance refers tothe situation in which less than 100 percent of individualswith a given genotype express the associatedphenotype.57©1997 by BSCS.

Glossaryphenotype: the externally or internally detectablecharacteristics of an organism that represent theinfluences of environment and genetic information(the genotype).polygenic: a condition that results from the interactionof several genes, each of which contributes asmall effect to the trait in question.polymerase chain reaction: see PCR.polymorphic: literally, having more than one form,such as different lengths for restriction fragments ofDNA, or the presence of two or more genetically distincttypes in a population.probe: (in the context of molecular genetics) a substancelabeled with radioactivity or a fluorescingcompound that is used to identify a gene, transcript,or protein through a binding reaction.prokaryote: a colonial or single-celled organismwhose cells lack a membrane-bound nucleus. Aprokaryote has a relatively simple cell structure withoutorganelles such as mitochondria or chloroplasts.Bacteria are prokaryotes.p rudential decision-making: the ethical term thatrefers to making a choice through a disciplined analysisinvolving well-reasoned discourse, a considerationof various aspects of an issue, and a weighing of risk.recessive: a pattern of inheritance in which the phenotypiceffects of an allele are masked in heterozygoteswhen one of certain other alleles is present. Atrait expressed by recessive inheritance is termed arecessive trait. A recessive trait is expressed only inhomozygotes.relevant: (in the context of science) the conditionof relating to or addressing a particular idea. Relevantevidence is evidence that is useful to support orcontradict an explanation.restriction endonuclease recognition site: a specificDNA sequence that is recognized and cut(digested) by specific members of a class of bacterialenzymes known as restriction enzymes. This processsupplies a naturally occurring immune function forbacteria and is exploited in the laboratory to makepossible cloning and other molecular techniquesinvolving specifically sized DNA fragments.restriction fragment length polymorphisms(RFLPs): the small differences in the length of DNAfragments produced through cutting with restrictionenzymes (enzymes that cut DNA at specificsequences). Genetic variation between individuals isreflected in small differences in the length of DNAbetween the sites recognized by restriction enzymes,thus producing RFLPs. These differences can beexploited to map the location of genes.ribosome: structure within cells on which proteinsynthesis occurs. Ribosomes are composed of ribosomalRNA (rRNA) and proteins.somatic cell: a cell that does not produce gametes.In humans, somatic cells are all cells except thegermline cells in ovaries and testes that will undergomeiosis. A mutation in a somatic cell affects the functionof that cell and all body cells derived from it, butit is not passed on to offspring.spermatogenesis: the development of sperm, aprocess that involves meiosis.t h e o ry : (in the context of science) an explanation ofa fundamental principle that has been so thoroughlytested and supported by multiple lines of evidencethat it is accepted by the scientific community.transcription: the process through which an RNAmolecule is synthesized by complementary basepairing using DNA as a template. For example, messengerRNA (mRNA) is a product of transcription.translation: the process of synthesizing a proteinmolecule. An RNA message (mRNA) directs theorder of amino acids being bonded together to forma protein. This process takes place on structuresknown as ribosomes.transposable genetic element: a transposon; thiselement is a small sequence of DNA that does notnecessarily remain at a fixed locus within the chromosome.A transposon can jump to a new location,exerting its influence on genes near the new locus.trinucleotide repeat: a specific sequence of threenucleotides (subunits of DNA) that is repeated, oftenin large numbers, in a continuous stretch of DNA inparticular genes. The mutant gene for Huntingtondisease, for instance, contains the trinucleotide CAGrepeated many times. When the number of repeats58©1997 by BSCS.

Glossarypasses a threshold number (around 40 in Huntingtondisease) the stretch of trinucleotide repeatsbecomes unstable and may increase (or, rarely,decrease) between one generation and the next.Large numbers of repeats result in disease. Trinucleotiderepeats are part of the biological explanationfor genetic anticipation (q.v.).uniparental disomy: a relatively rare geneticprocess through which both copies of a particularchromosome (both homologs) are derived from thesame parent.validity: (in the context of science) the condition ofhaving met scientific criteria, such as being supportedby credible evidence, being built on correctpremises, and showing sound reasoning.variable expressivity: the range of phenotypiceffects in individuals with a given genotype. (Notethat small differences in the genotype may be presentbut not obvious.)X-linked trait: a pattern of inheritance in which theallele for the trait in question is present on the Xchromosome. Males have only one X chromosome,inherited from the mother. For this reason, X-linkedtraits cannot be passed from father to son.zygote: the cell that results from the fusion of amale and a female gamete. A fertilized ovum (eggcell) is a zygote.59©1997 by BSCS.

References andRelated LiteratureAmerican Association for the Advancement ofScience (AAAS). (1989). Science for All Americans.Washington, D.C.: American Association for theAdvancement of Science.American Association for the Advancement ofScience (AAAS). (1993). Benchmarks for ScienceLiteracy. New York: Oxford University Press.American Society of Human Genetics (ASHG) andAmerican College of Medical Genetics (ACMG).(1995). Points to consider: Ethical, legal, and psychologicalimplications of genetic testing in childrenand adolescents. American Journal ofHuman Genetics 57:1233-1241.Ashley, C.T. and S.T. Warren. (1995). Trinucleotiderepeat expansion and human disease. AnnualReview of Genetics 29:703-728.Barlow, D.P. (1993). Methylation and imprinting:From host defense to gene regulation? Science260(5106):309-310.Barlow, D.P. (1994). Imprinting: A gamete’s point ofview. Trends in Genetics 10(6):194-199.B a rtolomei, M.S. (1994). The search for imprintedgenes. News and Views, Nature Genetics 6 ( 3 ) : 2 2 0 - 2 2 1 .Bell, J. (1947). Dystrophia myotonia and allied disease,in The Tr e a s u ry of Human Inheritance IV. Nerv o u sDiseases and Muscular Dystrophies. Vol. 5, p. 343.Brown, J.R., et al. (1996). A defect in nurturing inmice lacking the immediate early gene fosB. Cell86(2):297-309.Bult, C.J., et al. (1996). Complete genome sequenceof the methanogenic archaeon, Methanococcusjannaschii. Science 273(5278):1058-1073.Buxton, J., et al. (1992). Detection of an unstablefragment of DNA specific to individuals withmyotonic dystrophy. Nature 355(6360):547-548.Cann, R.L., M. Stoneking, and A.C. Wilson. (1987).Mitochondrial DNA and human evolution. Nature325(6099):31-36.Chakraborty, R., et al. (1996). Segregation distortionof the CTG repeats at the myotonic dystrophylocus. American Journal of Human Genetics59(1):109-118.Collins, F.S. (1995). Ahead of schedule and underbudget: The Genome Project passes its fifth birthday.Proc. Natl. Acad. Sci. USA 92:10821-10823.Cooper, N.G. (ed.) (1994). The Human GenomeProject: Deciphering the Blueprint of Heredity. MillValley, CA: University Science Books.61

References and Related LiteratureDriscoll, D.J. (1993). Genomic imprinting andhuman disease. International Pediatrics 8(1):6-13.Edelson, E. (1991). Tracing human linages. Mosaic2(3):56-63.Futuyma, D.J. (1986). Evolutionary Biology.Sunderland, MA: Sinauer Associates, Inc.Goffeau, A., et al. (1996). Life with 6000 genes.Science 274(5287):546-567.Gossman, L.I. (1990). Invited editorial: MitochondrialDNA in sickness and in health. American Journal ofHuman Genetics 4 6 ( 3 ) : 4 1 5 - 4 1 7 .Griffiths, A.J.F., J.H. Miller, D.T. Suzuki, R.C.Lewontin, and W.M. Gelbart. (1993). AnIntroduction to Genetic Analysis, 5th edition. NewYork: W.H. Freeman and Company.Hall, J.G. (1990). Genomic imprinting: Review andrelevance to human disease. American Journal ofHuman Genetics 46(5):857-873.Hall, J.G. (1992). Genomic imprinting and its clinicalimplications. New England Journal of Medicine326(12):827-829.Hamshere, M.G. and J.D. Brook. (1996). Myotonicdystrophy, knockouts, warts and all. Trends inGenetics 12(9):332-334.Harley, H.G., et al. (1992). Expansion of an unstableDNA region and phenotypic variation in myotonicdystrophy. Nature 355(6360):345-346.Harpending, H. (1994). Gene frequencies, DNAsequences, and human origins. Perspectives inBiology and Medicine 37(3):384-394.Harris, S., C. Moncrieff, and K. Johnson. (1996).Myotonic dystrophy: will the real gene please stepforward! Human Molecular Genetics 5:1417-1423.Holton, G. (1993). Science and Anti-science.Cambridge, MA: Harvard University Press.Jorde, L.B., J.C. Carey, and R.L. White. (1995). M e d i c a lG e n e t i c s. St. Louis, MO: Mosby-Year Book, Inc.King, R.C. and W.D. Stansfield. (1990). A Dictionaryof Genetics, 4th Edition. New York: OxfordUniversity Press, Inc.Lyon, M.F. (1993). Epigenetic inheritance in mammals.Trends in Genetics 9(4):123-128.MacDonald, M.E., et al. (1993). Capturing a CAGeykiller. Genome Analysis Volume 7: GenomeRearrangement and Stability, 25-41. Cold SpringHarbor, NY: Cold Spring Harbor Laboratory Press.Mange, E.J. and A.P. Mange. (1994). Basic HumanGenetics. Sunderland, MA: Sinauer Associates, Inc.Martin, J.B. (1993). Molecular genetics of neurologicaldiseases. Science 262(5134):674-676.Mayr, E. (1991). One Long Argument: CharlesDarwin and the Genesis of Modern EvolutionaryThought. Cambridge, MA: Harvard University Press.McBride, G. (1991). Nontraditional inheritance—II:The clinical implications. Mosaic 22(3):12-25.McInerney, J.D. and R. Moore. (1993). Voting in science:Raise your hand if you want humans to have48 chromosomes (editorial). The American BiologyTeacher 55(3):132-133.McInnis, M.G. (1996). Invited editorial. Anticipation:An old idea in new genes. American Journal ofHuman Genetics 59:973-979.McKusick, V.A. (1992). Mendelian Inheritance inMan: Catalogs of Autosomal Dominant, AutosomalRecessive, and X-linked Phenotypes, 10th Edition.Vol. 1 & 2. Baltimore and London: The JohnsHopkins University Press.Miki, Y., et al. (1994). A strong candidate for thebreast and ovarian cancer susceptibility geneBRCA1. Science 266(5182):66-71.Monckton, D.G. and C.T. Caskey. (1995).Anticipation and repeat expansion in myotonic dystrophy.Circulation 91:513-520.Moore, J.A. (1994). Science as a Way of Knowing:The Foundations of Modern Biology. Cambridge,MA: Harvard University Press.Morell, V. (1993). The puzzle of the triple repeats.Science 260(5113):1422-1423.Mott, F.W. (1911). A lecture on heredity and insanity.Lancet 1:1251-1259.Nance, M.A. (1996). Invited editorial: Huntington62©1997 by BSCS.

References and Related Literaturedisease—Another chapter rewritten. AmericanJournal of Human Genetics 59(1):1-6.National Research Council (NRC). (1994). NationalScience Education Standards Draft Document(Life Science Standards K-12). Washington, D.C.:National Research Council.National Research Council (NRC). (1996). NationalScience Education Standards. Washington, D.C.:National Academy Press.Nelson, D. L. (1993). Six human genetic disordersinvolving mutant trinucleotide repeats. GenomeAnalysis Volume 7: Genome Rearrangement andStability (ed. Kay E. Davies and Stephen T. Warren).Cold Spring Harbor, NY: Cold Spring HarborLaboratory Press.Partridge, E. (1994). Usage and Abusage: A GuideTo Good English, J. Whitcut (Revision ed.). London,England: Penguin Books Ltd.Penrose, L. (1947). The problem of anticipation inpedigrees of dystrophia myotonica. AnnalsEugenics 14:125-132.Peterson, K. and C. Sapienza. (1993). Imprinting thegenome: Imprinted genes, imprinting genes, and ahypothesis for their interaction. Annual Review ofG e n e t i c s, 27:7-31. Palo Alto, CA: Annual Reviews Inc.Portin, P. (1993). The concept of the gene: Shorthistory and present status. The Quarterly Review ofBiology 68(2):173-223.Pyke, D. (1996). Peter Medawar and the English language.Perspectives in Biology and Medicine39(4):555-568.Ranen, et al. (1995). Anticipation and instability ofIT-15 (CAG)N repeats in parent-offspring pairs withHuntington disease. The American Journal ofHuman Genetics 57(3):593-602.Rastan, S. and B.M. Cattanach. (1983). Interactionbetween the XCE locus and imprinting of the paternalX chromosome in mouse yolk-sac endoderm.Nature 303(5918):635-637.Rennie, J. (1993). DNA’s new twists. S c i e n t i f i cA m e r i c a n2 6 9 ( 3 ) : 1 2 2 - 1 3 2 .Rosenberg, A. (1985). The Structure of BiologicalS c i e n c e. Cambridge, MA: Cambridge University Press.Rossiter, B.J.F. and C.T. Caskey. (1995). Humangenetic predisposition to disease. In: MolecularBiology and Biotechnology. R.A. Meyers (ed.). NewYork, NY: VCH Publishers, Inc.Rubinsztein, D.C., et al. (1996). Phenotypic characterizationof individuals with 30-40 CAG repeats inthe Huntington disease (HD) gene reveals HDcases with 36 repeats and apparently normal elderlyindividuals with 36-39 repeats. American Journal ofHuman Genetics 59(1):16-22.Scriver, C.R., et al. (1995). The Metabolic andMolecular Bases of Inherited Disease Vol. 1. NewYork: McGraw-Hill, Inc.Shreeve, J. (1995). Chapter 3, The NeandertalEnigma. New York: William Morrow and Company.Singer, M. and P. Berg. (1991). Genes & Genomes: AChanging Perspective. Mill Valley, CA: UniversityScience Books.Smeets, D.E., et al. (1992). Prader-Willi syndrome andAngelman syndrome in cousins from a family with atranslocation between chromosomes 6 and 15. N e wEngland Journal of Medicine 3 2 6 ( 1 2 ) : 8 0 7 - 8 1 1 .Social Science Education Consortium (SSEC) andBiological Sciences Curriculum Study (BSCS).(1996). Teaching about the History and Nature ofScience and Technology. Boulder, CO: SocialScience Education Consortium.Tamarin, R.H. (1993). Principles of Genetics, 4thedition. Dubuque, IA: Wm. C. Brown Publishers.Tarleton J. (1993/94). New inheritance patterns:New counseling dilemmas. Perspectives in GeneticCounseling 15(4):1, 8.Thorne, A.G. and M.H. Wolpoff. (1992). The multiregionalevolution of humans. Scientific American266(4):76-83.Trowbridge, L.W. and R.W. Bybee. (1990). BecomingA Secondary Science Teacher. Columbus, OH:Merrill Publishing Company.U.S. Department of Health and Human Services andU.S. Department of Energy. (1990). U n d e r s t a n d i n gOur Genetic Inheritance. The U.S. Human Genome63©1997 by BSCS.

ClassroomActivitiesThis component of the module providessix classroom activities. Material is divided into■ teacher pages, containing suggestions to teach eachactivity and including annotated student pages;■ special copymasters, containing material needed for handoutsor to make overhead transparencies;■ student pages, containing procedural material to copyfor the students’ use.Please see Section I, pages 5-7 of the O v e rview for Te a c h e r s,for a description of how to use the activities.

TEACHER PAGES FORCLASSROOM ACTIVITIESPlease note that we provide a summaryof the nature and methods of science(NMS) concepts and genetics conceptsused in each activity.

Engage ActivityScientific InvestigationNMS CONCEPTS■ Science depends on data derived from carefulobservation and experimentation.■Scientifically useful observations and experimentsare those that others can repeat.■ The measurements and descriptions that scientistsuse must be universal so that one scientistcan understand or repeat the work of others.■ These requirements help scientists to communicateeffectively, to verify work done by others,and to detect errors in their own work and in thework of others.GENETICS CONCEPTSThis activity does not address genetics concepts.FOCUSThis brief and easy activity helps students to thinkabout one of the hallmarks of scientific investigation:careful observation, carefully recorded. Theactivity provides a mechanism to introduce the generaltopic of the nature and methods of science.U n l i ke the other activities of this module, theEngage Activity does n o t require any knowledge ofgenetics. For this reason, the activity can be used atthe start of a biology course, prior to a study ofgenetics, to introduce how science works. Altern a-t i v e l y, the Engage Activity can introduce the otheractivities of the module.OBJECTIVESAs students complete this activity, they should1. understand that careful observation, measurement,and recording of data are essential to science;2. make their own observations, measurements, andrecordings;3. use their own observations, measurements, andrecordings, and those of other students, to comparethe utility of different types of data;4. experience the importance of standardized measurement;and5. discuss the difference between observation andinference.ESTIMATED TIME30 minutesPREPARATION AND MATERIALSYou will need to provide the following for each teamof 3 students:■ metric ruler■ 20-cm piece of string69

Engage Activity ■Scientific Investigation■unshelled peanuts to fill one small bowl (removeall discolored, cracked, or broken peanuts)■ balance■ magnifying glassINTRODUCTIONAlthough students often read about the methods ofscience at the start of a science course, few studentsinternalize and use that knowledge without directexperience. The Engage Activity does not addresscausal explanations of natural processes, but it doesshow a number of the fundamental methods of science,including the need for careful observation andprecise note-taking if scientific work is to be communicatedto other scientists and repeated (see SectionIII of the Overview for Teachers). Standardizedmeasurements and terminology also help with thisprocess. This activity shows some characteristics ofcareful observation and of the power of accuratelyrecorded evidence.STRATEGIES FOR TEACHING THE ACTIVITYThe Engage Activity should be simple and fun,although its message is very powerful. Keep a quickpace. You may want to compare the issues addressedin Questions 5 and 6 of the Analysis with the sixquestions posed in Section III of the Overview forTeachers.Annotated Student MaterialSeparate student pages contain the material shown in bold typeface.Here, we provide an annotated version of student materials to help you conduct the activity.PROCEDUREDivide the class into teams of 3 and provide eachteam with a set of the materials. Students within ateam share materials, but students work individually. Each student observes the peanut he or shec h o o s e s .1. Share materials with your team, but workindividually. Select a peanut and carefullyobserve it to determine the distinguishingcharacteristics that identify this particularpeanut. Record your observations on apiece of paper. Do not mark or crack thepeanut. You may use the equipment providedto help you with your observations.Allow no more than 5 minutes for this step.2. Return each team member’s peanut to thebowl. Mix up the peanuts.3. Use your notes to find your peanut again.Allow no more than 2 minutes for this step.4. Raise your hand if you are absolutely certainyou have found your own peanut.Have one student calculate the percentage of studentswho raised their hands and write this numberon the chalkboard.5. What evidence did you use to locate yourpeanut and distinguish it from the others inthe bowl?Sample student responses:■ I measured it.■ I described its shape.■ I drew it.■ I traced it.■ I described how it smelled or looked.■ I found its mass.6. E xchange your team’s bowl of peanuts ando b s e rvation notes with those from anotherteam. Now work individually with one set ofo b s e rvations from another student and try tofind the particular peanut it describes.Allow no more than 5 minutes for students to identifythe new peanuts.7. Raise your hand if you are absolutely cert a i nthat you have found the correct peanut.Again, have a student calculate the percentage andrecord this number on the chalkboard.70©1997 by BSCS.

Scientific Investigation ■ Engage ActivityANALYSIS1. What observations were most valuable infinding a specific peanut?Students should recognize that the most helpful informationwas that which others could easily understandand apply. This information is objective and has universal,transferable value—for example, length, circumference,width measured in centimeters, or mass measuredin grams. Quantitative information is helpful ifaccurate and standardized. The least helpful inform a-tion likely was qualitative, that is, information whoseinterpretation is more subjective—for example, “It’spretty big; it smelled good; it has an interesting shape.”2. What role did your notes or the notes of anotherstudent play in helping you to locate a particularpeanut? (If your memory was a betterguide, what does that say about your notes?)If students’ memories were more helpful than theirnotes, their observations likely did not produce quantitativedata. Notes preserve the accuracy of observ a-tions and make them transferable. This issue providesan opportunity to emphasize the importance ofcareful note taking and of communication in science.3. People often confuse o b s e r v a t i o n s w i t hi n f e r e n c e s. O b s e r v a t i o n s are collectedusing your senses, either directly or expandedby technology using devices such asmicroscopes, X-ray machines, or microwavesensors on satellites. Inferences are ideas orconclusions based on what you observe oralready know. Using this distinction, whichof the following statements are observationsand which are inferences?■ If this peanut is roasted, the seeds will notgerminate.-inference■ The shell has a rough surface.-observation■ The shell is uniformly colored.-observation■ The peanuts came from a plant.-inference■ The shell has two lobes and is smaller indiameter between them.-observation■ This peanut will taste good.-inference■ Squirrels would eat these peanuts.-inference■ The surface markings on the shell are inrows, running lengthwise.-observation4. Now, look at your notes and label any inferencesthat you included.Emphasize that both observation and inference areimportant in science, but that these two processesshould not be confused. Furthermore, the validity ofan inference generally increases with the amount ofsupporting data. For example, the inference that agiven trait is genetic becomes more valid if the traitalso occurs in many offspring.Sometimes, however, even many repeated observ a-tions do not confirm an inference beyond question,and we must, therefore, always be cautious aboutour inferences. For example, we infer that dogs wagtheir tails because they are happy, and there aremany thousands of observations that support thisinference. Without direct (and unlikely) confirm a-tion from dogs, however, our inference remains ass u c h .5. What counts as evidence in science?At this early stage, you may want to use this questionprimarily to stimulate thinking about what isrequired of scientific evidence. Students already maysee that careful observation and measurement, universalunits of measure, reliance on data, and theability to repeat an investigation with the sameresults are a few of the things that characterize a scientificapproach to asking questions and seekinganswers about the natural world.6. What makes science objective? Why is objectivityimportant?Use the question to poll student opinion, ratherthan looking for specific answers. Objectivity in sciencedepends on rigorous methods, such as theneed for credible evidence. Objectivity helps buildthe durability of scientific knowledge by connectingit closely to reality rather than to unsubstantiatedo p i n i o n .71©1997 by BSCS.

Activity 1Standing on theShoulders of GiantsNMS CONCEPTSNew work builds on old work; the scientific communityrequires supporting, credible evidence to accept anexplanation; credibility depends on the rigor of investigation(precision and replicability); science reflectsthe culture in which it takes place (minor concept).GENETICS CONCEPTSThe activity reviews fundamental (Mendelian) conceptstraditionally taught in genetics and in basicmolecular genetics. (See Section V of the Overviewfor Teachers.) These concepts are listed below.■ parental source for inheritance■ chromosome theory of inheritance■ segregation■ independent assortment■ DNA as the genetic material■ sex determination■ genetic code■ linkage■ mutationFOCUSStudents combine a brief review of basic geneticswith an initial exploration of how scientists use evidenceto support explanations of genetic phenomena.The activity directly addresses the first four of thesix questions raised in the discussion of methods ofscience in the Overview for Teachers (Section III).Students also indirectly consider the cultural contextof the history of scientific discovery.Students arrange milestone explanations in a conceptualsequence to see that ideas in genetics are interconnected.They then compare their sequences to theactual history of these genetics milestones. Studentsalso evaluate the relative worth of different types ofevidence on two levels: credibility and usefulness.OBJECTIVESAs students complete this activity, they should1. review some of the basic concepts of genetics;2. recognize and use criteria for determining thecredibility of scientific evidence, including precision,replicability, and controlled observation;3. recognize the association (relevance) betweencredible evidence and a particular scientific explanation(milestone concept);4. recognize that new work builds on old work; and5. build an understanding that genetics has a historybased on accumulated knowledge and a strongrecord of evidence.ESTIMATED TIMEOne 50-minute class period73

Activity 1 ■Standing on the Shoulders of GiantsPREPARATION AND MATERIALSStudents will work in 8 teams. To save paper, youmay want to laminate the Milestone Cards and EvidenceCards so that you can reuse them. You willneed to provide the following:■ 8 sets of Copymaster 1-1, Milestones in UnderstandingGenetics, cut apart (1 set per team)■ 1 overhead transparency of Copymaster 1-2, HistoricSequence of Milestones, or 1 copy for eachstudent■ 1 copy of Evidence Cards corresponding to aparticular milestone for each team; there will bea different set of cards for each team (see Copymaster1-3)■ chalkboard, flip chart, large sheet of paper, oroverhead projector to display the milestoneconcepts in Part I■ flip chart or butcher paper for an NMS poster(optional)COPYMASTERS USED IN THIS ACTIVITYCopymaster 1-1Milestones in Understanding GeneticsCopymaster 1-2Historic Sequence of MilestonesCopymaster 1-3Evidence CardsINTRODUCTIONThis activity challenges students to explore themethods of science during a review of fundamentalconcepts in genetics. A brief discussion of the methodsof science is included here for your convenience.For a more detailed discussion, see SectionIII in the Overview for Teachers.How do we know what we know? This activity dealswith two aspects of science that help to answer thatquestion: (1) scientific explanations require credibleevidence, and (2) new work builds on old work.The relationship between evidence and explanation isbuilt on several assumptions. The evidence must becredible according to scientific criteria such as accuracyand repeatability. Authority or fame alone does notestablish validity for a particular hypothesis or foropinions offered as evidence. Recognition of theauthority or fame of the proponent of a scientific ideamay attract attention, but this notoriety in itself is notsufficient for the scientific community to accept theidea unless sufficient credible evidence supports theclaim. Evidence also must relate to the issue in question;even credible evidence is not useful when it doesnot address the question under consideration.Another step to determine what we know scientificallyis to examine an explanation for the soundnessof its reasoning. A good explanation starts with accurateassumptions, is guided by credible evidence,and is built through logical connections. If thisprocess is done well, the explanation will have predictivepower. Because many scientific explanationsaim to discover causal relationships, explanationscan be tested according to their ability to predictspecific outcomes of the proposed causal event.Causality is a related, but not central, concept inActivity 1, and you may want to expand your discussionsto include it. Question 1 of the Analysis is agood place to help students understand what isimportant about causality and how to establish it. Adescription of causality is included in Section III ofthe Overview for Teachers.Finally, science is embedded in cultural history. Scienceproceeds as a chronological sequence of discoveries,but the paths it follows largely reflect theculture that supports it. Topics of concern to scientistsat a particular time reflect many aspects of societalvalues. For example, if society views cancer,heart disease, and AIDS as important problems,agencies in the public and private sector will makefunds available for research in those areas. Researchthat attracts attention also depends on the currentlevel of technology for acquiring, storing, and analyzingdata. Sometimes, a creative idea or questioncannot be formulated as a testable hypothesisbecause of the limitations in technology, resources,or existing information. In these cases, the great ideamust wait until history creates the right setting for it.STRATEGIES FOR TEACHING THE ACTIVITYThe foregoing aspects of science are incorporatedinto the tasks of this activity. Although the NMS conceptsmay not be entirely new to students, these74©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1concepts often are not presented in a way thatmakes them useful. A student may have a concretedefinition of how science works, but may not be ableto apply the concept either in thinking or action.This activity, like much of the module, is designed totake the students’ understanding of the methods ofscience that extra step into experience.In Pa rt I of this activity, students see how new workbuilds on old work and how milestone explanationsattempt to establish a causal relationship. Studentsa rrange the milestones into a sequence that make sconnections between ideas, focusing on the conceptsrather than on the dates of discovery. (Knowingthe dates of the discoveries is n o t the objective.)Ask students to describe the basis for thesequence of milestones they construct—for example,simple to complex or general to specific—andto speculate why this sequence might differ fromthe historical sequence. Emphasize that the historicalsequence is not necessarily “the right answer, ”but do not hesitate to challenge what appear to beconceptual flaws in a student’s sequence. For example,molecular details about mutation and thegenetic code would not precede knowledge thatDNA is the genetic material.In Part II, students focus on the role of credible evidenceto support a valid scientific explanation. Ineach team, students study four pieces of evidence tojudge their credibility and their usefulness relative toa particular milestone explanation in genetics. Eachteam has a different milestone. You may want to havethe class define “credible” in terms of evidence. Inthe Annotated Student Material, we suggest questionsat the start of Part II to stimulate thinking aboutthis topic before the teams begin their work.The questions in the Analysis help to make theaspects of the nature of science e x p l i c i t for your students,but do not assume that students will recognizethese characteristics without reinforcement. At thistime, students may begin to brainstorm ideas for aposter about the nature and methods of science. Ifyou use this technique, students will add ideas to thisNMS poster throughout the module. You will need away to display the collection of student ideas aboutscience, perhaps using a large sheet of butcher paper.The task of adding ideas to this poster should beopen-ended, and student responses will vary widely.Note from the field test: Teachers found that thetask of putting milestones into a meaningfulsequence drew comments from some students whonormally were nonparticipatory.The following summary of the structure of this activityshould help you understand the intent of each part .ACTIVITY 1 AT A GLANCEPart I:Part II:Analysis:Milestones in Understanding GeneticsIn a jigsaw fashion, teams build a meaningful sequence of the milestone explanations.Students compare the actual history of the milestone explanations with their own sequenceand think about the significance of any differences.How Good Is the Evidence?Students review the concept of credible scientific evidence. Each team evaluates four evidencecards for credibility and judges whether the credible evidence supports the team’sone milestone explanation in genetics, thus exploring the requirements for an explanationto be accepted as scientifically valid.Students reflect on many aspects of the nature of science. They may begin to summarizethese ideas on a poster to be used throughout the module.75©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsAnnotated Student MaterialSeparate student pages contain the material shown in bold typeface.Here, we provide an annotated version of student materials to help you conduct the activity.If you make a scientific discovery, will peoplestill rely on it one hundred years later? Scientistscontinue to use the theories of inheritancedescribed by Gregor Mendel (Figure 1-1)—they are remarkably durable after morethan a century. Since the rediscovery ofMendel’s work in about 1900, biologists havemade great strides in determining the mechanismsof heredity. Knowledge about geneticshas expanded in the last two decades withtechnical advances in molecular biology and,most recently, with the work of the HumanGenome Project (HGP). This huge project willi d e n t i fy genetic relationships (maps) andchromosomal locations of all human genesand will attempt to determine the DNAsequence for the entire genome of H o m os a p i e n s. Mapping and sequencing will bedone for other species, too, including selectedbacteria, yeast, a plant, and several animals p e c i e s .D i s c o v e ry in the HGP or any field of scienceoccurs in stages. Similarly, the history ofgenetics is much more than a simple recordof dates, names, and discoveries; it is anaccount of how our understanding of inheritanceand the gene has grown and changed.M o d e rn geneticists (Figure 1-2) are “standingon the shoulders of giants” who came beforet h e m .PROCEDUREOptional IntroductionYou may want to introduce this activity with a briefpreliminary discussion about how scientific knowledgeis built. An interesting way to start the discussionis to ask, “Can you recall a scientific explanationthat was once held to be valid and later found to beinaccurate? Describe that explanation and how itchanged.”Figure 1-1 Gregor Mendel (1822-1884), a pioneerin the study of inheritance: His explanations werebased on observation of traits, use of careful records,and the mathematical analysis of his data.If students do not respond, suggest an explanationsuch as the geocentric conception of the cosmos.Point out that it appeared sensible to assume thatthe sun, moon, stars, and planets revolved aroundthe Earth because they appeared to move across thesky while the Earth felt stationary to the observer.The astronomer Copernicus gathered evidencethrough careful observation and mathematical calculationsto provide a different explanation: the Earthand the other planets orbit the sun (a heliocentricview). Although the center was perceived differently,the idea of orbits remained. Another example of anidea that changed is that of a flat Earth. Studentsshould be able to cite evidence (such as Magellan’s76©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1voyage around the world 1 and photographs fromspace) that refutes this idea.Another explanation that changed in light of new evidenceis that for the cause of disease. For years,people thought factors such as bad air, getting caughtin the rain, or having evil spirits caused disease.These views gradually changed and, in the mid-nineteenthcentury, scientists provided convincing proofof the germ theory as the basis for communicabledisease. The central assumption of germ theory isthat microorganisms can invade other organisms andcause illness. The French scientist Louis Pasteur tookone large step toward acceptance of that explanationwhen he dispelled the notion of spontaneous generation.Pa s t e u r, in a series of experiments using thinne c ked flasks and sterile techniques, showed thatorganisms did not grow spontaneously from nonlivingmatter. He also found direct evidence to supportthe germ theory of disease when he identified threetypes of microorganisms that were pathogenic fors i l k w o rms, showing the causal connection between apathogen and a disease. A German scientist, RobertKoch, also supplied evidence for this theory with hisd i s c o v e ry of the bacterial pathogen that causesanthrax in cattle. 2Earlier notions about causes of disease, such as gettingcold and tired, are not without some merit.These conditions are not primary agents of infectiousdisease, but our improved understanding ofimmunology shows us that these factors do contributeto disease by impairing immune function.Most changes in scientific knowledge reflect theexpansion of inadequate explanations rather than theexpulsion of entirely inaccurate ones.If your students have a fairly good understanding ofmolecular genetics, they may appreciate the additionalexample of discovering introns in eukaryotic genes.Because early molecular biology focused mainly onFigure 1-2 Modern studies in genetics: Althoughmodern geneticists use molecular techniques such ascloning and sequencing, geneticists continue to usemicroscopic techniques, particularly in cytogenetics.bacteria, most of which lack introns, the discovery ofintrons came as a surprise and required a modificationin our description of genes. (Figure 13 in the O v e rv i e wfor Te a c h e r sillustrates introns in gene stru c t u r e . )Indicate that, as they work through this module, studentswill come to understand more about how scientificknowledge changes and develops, and abouthow scientists go about their work. Students also willlearn about some new findings in genetics.Part I: Milestones inUnderstanding GeneticsMuch of the information about genetics inyour biology textbook would have amazed1. Magellan’s voyage also resulted in a reconceptualization of time. Although Magellan was killed in the Philippines beforethe end of the voyage, his crew kept careful records of dates during the 3-year journey. When they returned to theirhome port in Spain, they found that they had lost a day. This led to understanding that the Earth’s rotation results indifferent time zones—and even a different day—on some parts of the globe. We now acknowledge and correct for thisphenomenon with the International Date Line.2. The article by P.A. Small and N.S. Small, Mankind’s Magnificent Milestone: Smallpox Eradication, The American BiologyTeacher, 58(5):264-271, provides a nice overview of the application of scientific process to the eradication of an infectiousdisease.77©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of Giantsbiologists a hundred years ago. Those scientists,driven by curiosity to answer complexquestions of heredity, slowly pieced togetherlayer after layer of the milestone explanationsthat we now accept as valid. The most significantexplanations stand as milestone events,each of which marks a great shift in our understanding.Think about what scientists neededto know before they could add each new milestoneto the body of genetics knowledge. Youare going to build a sequence of milestoneexplanations. When you do, your sequencemay reflect the actual progress of genetics duringthe last hundred or so years, or it mayreflect other ways that history could haveplayed itself out during these early years ofdiscovery.Assign students to teams and distribute a set of milestoneexplanations to each team.1. Your team will receive a set of eight milestoneexplanations of inheritance. Decide how thesemilestone explanations could form a meaningfulsequence, and be prepared to reportyour sequence and the reasons you chose it.After the teams have had a chance to build asequence, poll the class for examples of the choiceseach team has made. You may want to have eachteam turn in a written sequence, or you may want tocall on two or three teams to report. Ask the studentsto explain the criteria they used to sequencethe milestones. A handy way to display results of differentteams is to prepare a poster for each milestoneand have a student place the posters insequence, or prepare a set of milestones strips onoverhead transparency film for display. To start thediscussion, you could display a milestone from themiddle of the actual sequence, choose another milestone,and ask whether it should come before orafter the first one.Important: Keep in mind (and emphasize for thestudents) that their job is not to guess the dates andchronology of these events. Instead, their task is toreason how the milestone explanations might buildin a logical way. Keep the discussion brief, and do notpress for consensus.2. Your teacher will show you the actualsequence of milestone events that occurredin the history of genetics. Compare it to thesequence you helped build with the class.Might the events have occurred just as easilyin the order you built?Display an overhead made from Copymaster 1-2 thatshows the historical sequence of milestone conceptsand/or distribute a copy to each student. Emphasizeto the class that the connections between discoveriesare far more important than the dates on whichthe discoveries occurred.The historical sequence for these events is given inCopymaster 1-2, and the sequence presented is somewhatarbitrary in that some ideas gained strength frommultiple experiments that occurred over a number ofyears. For instance, an early experiment that indicatedthat DNA is the genetic material took place in 1944,but additional evidence provided in 1952 convincedthe scientific community. The work of Mendel, whichmight have influenced research in genetics in the latterpart of the nineteenth century, failed to do sobecause it was not recognized widely and understooduntil around 1900. The actual sequence of events inscientific history does not necessarily represent theo n l y, or even the best, sequence in terms of logicalconnections because scientists are at times limited bytechnology or make imperfect choices about the nextquestion to be answered.3. What technologies or cultural issues mighthave influenced the timing of the milestonesand other discoveries in genetics?Sample student responses include:■ the use of a microscope,■ staining techniques,■ computers, and■ the laboratory techniques of molecular biology.Less obvious answers include:■ better communication among scientists,■ money available to support research,■ political interests at the time,■ rediscovery and openness to Mendel’s paper,■ the development of more sophisticated statistics,and■ the use of computers to store and compare data.78©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Part II: How Good Is the Explanation?The milestone explanations you have beenusing have lasted for many years. Why? Usethis part of the activity to explore how weknow whether a scientific explanation is onthe right track and, thus, whether it will survivethe test of time.If your students have a basic grasp of what is meantby credible evidence, continue to Steps 4 and 5. Ifnot, conduct a brief discussion to establish this idea.You may want to use Question 3 from the Analysishere as an introduction. Otherwise, this questionwill serve as a review of this part of the activity.The student version of the Evidence Cards and theircorresponding Milestone Explanation is provided inCopymaster 1-3. An annotated version appears inthese teacher pages.4. Your teacher will give your team a set of EvidenceCards and one Milestone Card. Yourfirst task is to evaluate the Evidence Cardsand keep only those that are credible. Todetermine whether the information on anygiven Evidence Card is credible, discusswith your teammates the criteria you canuse to evaluate the evidence. Write your reasonsfor accepting or rejecting the statedevidence.Allow a few minutes for teams to make their choices.This step is brief because the “bogus” evidence cardsare fairly obvious. The value of this step is that studentsmust articulate their criteria. Ask a few teamsto give examples of why they accepted or rejectedevidence.5. Now decide whether the evidence youretained is helpful in supporting or refutingthe milestone explanation. Explain yourdecision. (Hint: Some evidence will be helpful;other evidence may not be related tothe milestone explanation.)Allow enough time for students to compare ideasabout the relationship between evidence and thegenetics concept on the Milestone Card, but keeptheir discussion brief. Ask several teams to justify thehelpfulness of the evidence relative to the milestoneexplanations. (To keep the activity moving, you maynot want to have all the teams do this.)You may need to remind students that, for evidenceto support a scientific explanation, the evidencemust be related to the main ideas in that explanation.Related evidence should help to distinguishbetween one explanation and competing views. Ifthe explanation discusses causality, supporting evidenceneeds to show a constant and regular associationbetween the stated cause and effect. For example,in 1927, after H.J. Muller exposed fruit flies toheavy doses of X rays, offspring of the exposed fliesexhibited mutations. This experiment can be repeatedwith the same results, supporting the notion thatradiation is a causal agent of mutations. Later experimentsprovided a more detailed explanation of thecause by demonstrating the molecular damage inDNA that results from exposure to X rays.ANALYSISNot all scientific discoveries are great milestonesthat change our understanding of thenatural world. Scientists put an enormousamount of work into even relatively simplediscoveries, as you would expect when youconsider the rigors of investigation. Thesesmall pieces provide a valuable part of a largerpuzzle. Gradually, we build our understandingof inheritance. The rarity of great leaps inunderstanding can be a frustrating aspect ofscientific work.Science is carried out by people who mustearn a living and who want to fulfill personalgoals, factors that might influence their work.Think about the social and cultural setting inwhich research takes place as you respond tothese questions.1. What does science try to do?Sample student responses include:■ It makes discoveries.■ It finds facts.■ It explains things.For additional discussion, see Section III of theOverview for Teachers, page 14. You may want tointroduce the idea of causal explanations.79©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of Giants2. How do we know an explanation is on theright track?Sample student responses include:■ The explanation predicts events accurately.■ An explanation is supported by good evidence.■ More than one line of evidence supports theexplanation.■ The explanation is consistent with other scientificknowledge.For a full discussion, see Section III of the Overviewfor Teachers, page 15.3. What counts as credible evidence in science?Sample student responses include:■ The evidence was the result of laboratory work(an experiment).■ There is statistical evidence (numbers) or theexperiment yields the same result whenr e p e a t e d.■ Experiments include adequate controls.■ The evidence survives challenges by the scientificcommunity.■ The evidence is accurate.You might want to record some of the responses onthe chalkboard or on a large sheet of paper underthe heading “Criteria for Credible Evidence.” Keepthe list visible in the classroom as a prompt for Steps4 and 5.4. Mendel developed a simple, yet elegant, systemto explain inheritance. What has happenedto his system?Mendel’s work has endured because it still explains agreat many of our observations about inheritance.Scientists, however, have proposed many new explanationsabout inheritance since Mendel’s time. Thosethat satisfied the requirements of scientific investigationhave become incorporated into an ever- e x p a n d-ing body of knowledge about inheritance.5. Begin to make a poster that records yourideas about the characteristics of science, ifyour teacher instructs you to do so.Have students brainstorm ideas and record them onposter paper under the heading “Nature and Methodsof Science.” Display this NMS poster in the classroom.Encourage students to add ideas throughoutthe module.Sample student responses about the characteristicsof science include:■ More than one source of evidence makes anexplanation stronger.■ Evidence needs to be repeatable.■ Explanations show the connection between acause and the resulting event.■ Mendel’s explanations are valid today.■ A new discovery must fit with an existing explanationor the explanation would have to change.■ New work builds on old work.■ When people are concerned about inheriteddisease, there will be more money for geneticsresearch.■ A famous name is not enough to get your explanationaccepted.■ You have to do experiments.■ You have to share your data.ANNOTATIONS TO THE COPYMASTERS:COPYMASTERS 1-1 AND 1-3Here, we number each milestone in sequence, followedby its corresponding evidence. Actual copymastersomit numbers to avoid influencing students.MILESTONES IN UNDERSTANDINGGENETICS - NO. 1Question:Why do offspring resemble their parents?Milestone Explanation:Parents contribute genetic material totheir offspring.Evidence 1A:A scientist looked through a microscopeat dividing cells in the tail fins ofa salamander. As mitosis proceeded,she saw that chromosomes movedapart in equal numbers into the newlyforming daughter cells. Other scientistsobserved this phenomenon incells undergoing mitosis.80©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1This evidence is■ credible; the statement is based on carefulobservation and is repeatable.■ helpful, but only partly supportive because,although it shows a possible role for chromosomesin passing information to daughter cells,mitosis and cell division in tail fins have nothingto do with inheritance from parents to offspring.(This is one of the observations that led to an explanationof DNA replication and cell division [W. Flemming,1879].)Evidence 1B:A scientist crossed pea plants and carefullyrecorded the appearance of cert a i ntraits in the offspring. When he crosseda strain that has only purple flowerswith one that has only white flowers,the offspring always had purple flowers.When he crossed these offspring to producethe next generation, however, hesaw both colors of flower in the newoffspring in regular proport i o n s .This work was repeated later by otherscientists who saw the same results.This evidence is■ credible; this experiment is repeatable with thesame results.■ helpful; this information provides evidence thatflower color is a trait inherited from parents, andthat both parents may contribute to the phenotypeof future offspring. The white color trait isnot lost, but hidden; there must be at least twofactors involved, one from each parent.(This is one of Mendel’s classic experiments, reportedin 1865 and repeated by others in 1900. Theimplication is that each parent contributes one ofthe alleles for flower color, but that purple color isthe dominant trait.)Evidence 1C:Jorge noticed that a classmate, Susan,has curly hair. When he met her mother,he noticed that she also has curly hair.This evidence is scientifically bogus; although it suggeststhat genetic information passes from parentsto the offspring (Susan), the evidence is so limited inits scope that it is not of much value. The curly hairmay result from other than genetic influences; forexample, maybe Susan and her mother have usedperms to curl their hair.Evidence 1D:Mendel said that characteristics of offspringlikely come from something theoffspring get from their parents.This evidence is scientifically bogus; stated this way,the information is unclear and unsubstantiated. If itsaid “Tom” instead of “Mendel,” people would beeven less likely to credit the statement. Authoritywithout a basis in scientific evidence is not meaningfulin supporting a scientific explanation.MILESTONES IN UNDERSTANDINGGENETICS - NO. 2Question:How are traits distributed in offspring?Milestone Explanation:Alleles of one gene segregate in theformation of gametes.(Reproductive cells [gametes] formduring meiosis. Each gamete containsone allele from the pair of alleles presentin the parent.)Evidence 2A:People say that sons express the traitsof the father, while daughters have allthe mother’s characteristics.This evidence is scientifically bogus; it is based onhearsay and lacks a scientific basis.Evidence 2B:Offspring in each generation arei d e n t i c a l .81©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsThis evidence is scientifically bogus; the statement isnot correct, and there is no information about howthe observation was made. Even if it were credible,the evidence would not be helpful because the evidencedoes not address the distribution of traits.Evidence 2C:Mendel speculated that traits are inheritedbased on discrete units of inheritance.He tested the law of segregationby observing height in several generationsof pea plants. He saw a distributionof tall to dwarf in the F2 generationof 3:1. Then the F2 plants werefertilized with their own pollen (selfed).Mendel found that the dwarf F2plants produced dwarf F3 plants, buttwo-thirds of the tall F2 plants producedmixed offspring, dwarf and tall.This F3 test of segregation has beenrepeated many times with the sameresults.This evidence is■ credible; the evidence is drawn from carefulobservation and collections of quantitative data;it is repeatable.■ helpful; the ratios in F2 and F3 generations fitthe predictions based on the segregation of allelesin the production of gametes.Evidence 2D:A scientist named W.S. Sutton observedchromosomes in cells undergoingmeiosis. He noticed that the chromosomesbehaved in a way that is consistentwith Mendel’s observations aboutinheritance patterns. Many otherobservations of meiosis by other scientistsconfirmed this behavior of chromosomesin the nucleus.This evidence is■ credible; other scientists have replicated Sutton’sfindings.■ helpful; this is evidence that chromosomesbehave in a way that is consistent with Mendel’slaws of inheritance and will fit with their mathematicalpredictions.(This observation by Walter S. Sutton in 1903 helpedestablish the chromosome theory of inheritance.This same evidence was used to support anothermilestone explanation; this overlap is a commonoccurrence in science.)MILESTONES IN UNDERSTANDINGGENETICS - NO. 3Question:Where are genes located?Milestone Explanation:Genes are located on chromosomes.(This idea is the chromosome theory ofinheritance. In euka ryotic cells, geneticmaterial is located in the nucleus ins t ructures called chromosomes, for theirdark-staining characteristic. The namecomes from the Greek words c h r o m a[color] and s o m a [body].)Evidence 3A:Using staining techniques and a microscope,C. Nageli discovered a set ofstructures in the nuclei of cells. Otherscientists observed that these structureschange and become visible with amicroscope at certain times in the cellcycle. Years after Nageli’s observation,a developmental biologist, W. Roux,observed these structures in the cellnucleus, and another scientist, W.Waldeyer, saw the structures andnamed them chromosomes.This evidence is■ credible; other scientists have replicatedNageli’s findings.■ somewhat helpful in that it establishes that chromosomesexist. It is not conclusive, however,because there is no evidence about their geneticrole.(C. Nageli discovered chromosomes in 1842; Wi l h e l mRoux saw them in 1883, but did not have evidence of82©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1their role in inheritance. W. Waldeyer gave chromosomestheir name in 1888.)Evidence 3B:A scientist named W.S. Sutton observedchromosomes in cells undergoingmeiosis. He noticed that the chromosomesbehaved in a way that is consistentwith Mendel’s observations aboutinheritance patterns. Many otherobservations of meiosis by other scientistsconfirmed this behavior of chromosomesin the nucleus.This evidence is■ credible; other scientists have replicated Sutton’sfindings.■ helpful; this is evidence that chromosomesbehave in a way that is consistent with Mendel’slaws of inheritance and will fit with their mathematicalpredictions.(This observation by Walter S. Sutton in 1903 helpedestablish the chromosome theory of inheritance.)This evidence is scientifically bogus because it isimprecise. The professor has provided no details,and the evidence is based on the fame of the universityalone. There is no substantiating scientific evidence.Perhaps the professor is a specialist in somethingunrelated to biology and knows little aboutgenetics.MILESTONES IN UNDERSTANDINGGENETICS - NO. 4Question:What determines the sex of ano r g a n i s m ?Milestone Explanation:In most sexually reproducing organisms,special chromosomes determ i n esex.(Humans have sex chromosomes, designatedX and Y. The combination ofsex chromosomes in an organismdetermines its sex.)Evidence 3C:A scientist, T. Boveri, showed that seaurchin embryos develop normally onlywhen they have a full set of chromosomes.Embryos with more or fewerchromosomes than the normallyobserved number did not developproperly. Many other scientists havemade the same observations in otherorganisms.This evidence is■ credible; it is precise, testable, and repeatable.■ helpful; it connects cause and effect to genotypeand phenotype.(This observation by T. Boveri in 1903 was one lineof evidence that led to the chromosome theory ofinheritance.)Evidence 3D:A professor at Harvard thinks thatchromosomes contain genes.Evidence 4A:Many studies have shown that humanfemales have two X chromosomes, andhuman males have one X chromosomeand one Y chromosome. PatriciaJacobs and other scientists alsoshowed that, although the normalhuman sex chromosome complementis XX or XY, other patterns do occurrarely. For instance, in humans, XXYindividuals are male, and XO individualsare female.This evidence is■ credible; it is precise, and several lines of investigationsupport it.■ helpful, especially when added to our knowledgethat chromosomes are the mediators ofinheritance. This is evidence that sex determinationresults from the lack of the Y chromosomein females, or the presence of the Y chromosomein human males.83©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsEvidence 4B:During their lifetime, human malesproduce many sperm, but females produceonly a few eggs. Many years ofstudies showed that females are bornwith all the egg cells they will everhave (although the eggs must matureindividually during successive menstrualcycles). Males, however, producemillions of new sperm cells every fewdays until a very advanced age.This evidence is■ credible; the conclusions are based on “manyyears of studies.”■ not helpful; the information is correct, but it hasnothing to do with sex determination.Evidence 4C:A scientist named C.E. McClung foundthat grasshoppers produce equal quantitiesof two different types of sperm ,one of which contains an extra chromosome.Three years later, two other scientists,N. Stevens and E.B. Wi l s o n ,d e t e rmined that female grasshoppershave two copies of one particular chromosome,whereas males have only one.This evidence is■ credible; it is precise, and other scientists canreplicate the data.■ helpful; this is evidence that the extra chromosomein grasshopper females determines sex.(These are the studies of C.E. McClung in 1902, andN. Stevens and E.B. Wilson in 1905.)Evidence 4D:There is a saying that a pregnantwoman can determine the sex of herchild by eating spicy foods to producea male or cool foods to produce afemale.This evidence is scientifically bogus; this evidence isbased on hearsay and folklore. In addition, the questionand milestone explanation address the geneticdetermination of sex in offspring; by the time awoman knows she is pregnant, the genotype of thepotential offspring already is determined. What sheeats or drinks can affect the developing phenotypeof her fetus, sometimes adversely (alcohol, for example,can cause a variety of problems in the developingfetus, including low birth weight and retardation),but it cannot affect the sex of the fetus.MILESTONES IN UNDERSTANDINGGENETICS - NO. 5Question:Why do some traits occur together inoffspring?Milestone Explanation:Some genes are located on the samechromosome (linkage).Evidence 5A:The host of a popular talk-show aboutsports says that the best baseball pitchershave brown eyes.This evidence is scientifically bogus; this comment isbased on hearsay rather than scientific evidence, so it isnot credible. At first glance, the comment may appearrelevant to students because it suggests that two traits,pitching well and eye color, are related. Even if therewere data to support the statement, many other factorsmight be involved, for example, light sensitivity in blueeyedplayers. This situation does not indicate a geneticconnection between two heritable traits.Evidence 5B:Many microscopic studies show thatchromosome pairs can exchange materialduring meiosis, resulting in a newcombination of alleles in that pair ofchromosomes. This phenomenon isgenetic recombination, which resultsfrom crossing over.This evidence is■ credible; it is based on “many microscopic studies.”■ somewhat helpful, but not strongly supportive.This observation suggests that some genes on84©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1one chromosome may not behave as thoughthey are linked when they are separated by asubstantial distance, such that recombinationcan occur.Evidence 5C:Three scientists demonstrated thatpurple flowers and long pollen wereinherited together in the sweet peamore often (more than 75% of thetime) than predicted by Mendel’s lawof independent assortment (50%).This evidence is■ credible; the scientists conducted experimentsand kept track of their data.■ helpful; this is evidence that these genes areassociated in some way.(The experiment is the 1906 observation of W. Bateson,E.R. Saunders, and R.C. Punnett; it demonstrateslinkage—a noted exception to Mendel’s lawof independent assortment. The two genes are onthe same chromosome and are not always separatedby crossing over during meiosis.)Evidence 5D:A study of human pedigrees shows thatcertain traits such as hemophilia andcolor blindness occur at a much higherfrequency in males than in females.These traits appear to depend on theinheritance of mutations located onthe X chromosome. When a man hasboth of these traits, studies show thatthere is a greater than 50% chance thatany brothers will have both disorders,or neither one.This evidence is■ credible; it relies on the observation of multiplecases and on careful mathematical analysis.■ helpful; in this case, the two traits are on thesame chromosome (X) and are not inheritedindependently, supporting the idea that they arelinked. The distance between genes on onechromosome determines how tightly they arelinked. If the genes are very tightly linked, theprobability is low that they will be separated duringcrossing over.(This work was done by Julia Bell and J.B.S. Haldanein the 1930s and was the first to show linkage inhumans. It provided early groundwork for the impetusof the Human Genome Project to map all humangenes and identify those that are disease-related.)MILESTONES IN UNDERSTANDINGGENETICS - NO. 6Question:What molecular component in chromosomescarries genetic information?Milestone Explanation:DNA carries genetic information.Evidence 6A:Three scientists purified DNA frombacteria that grew in smooth colonies.They put this DNA into bacteria thatnormally grew in rough colonies. Thebacteria that had been given the DNAproduced many generations of offspringthat formed smooth colonies.This experiment produced the sameresults when repeated.Other scientists (many years later)transferred a specific fragment of DNAfrom bacteria to a plant, and a bacterialtrait appeared in the plant.This evidence is■ credible; it is based on experimentation, andothers have replicated the results.■ helpful; this is evidence that DNA containsi n f o rmation that determines phenotype, suchas traits that affect the appearance of a bacterialcolony or particular genes in a plant. The a c c u-m u l a t i o n of evidence that supports an explanationmany years after it was first proposed iscommon and shows the durability of scientificknowledge. You may want to point out this phenomenonafter the students have assembledtheir conceptual sequence of milestone explanations.85©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of Giants(The first observation is the classic experiment byO.T. Avery, C.M. MacLeod, and M. McCarty, performedin 1944. They transformed pneumococcusby transferring DNA from one strain to another.Modern genetic engineering provides many examplesof transformation by DNA, even across speciesboundaries. For instance, the gene for a toxin fromBacillus thurengensis that is effective against insectshas been inserted into several species of plantsincluding tobacco, tomato, and cotton.)Evidence 6B:Two scientists studied viruses to determinehow they infect bacteria. Theylabeled the DNA and the protein componentsof the viruses using radioactivechemicals. This allowed them totrace the movement of the DNA andprotein. Only labeled DNA entered thebacterial cells during the infectionprocess. Other investigations repeatedthese studies.This evidence is■ credible; the evidence results from experimentsthat others have replicated.■ helpful; this is evidence that DNA, not protein,is responsible for infection by bacteriophagev i ruses.(This is the 1952 experiment of A.D. Hershey and M.Chase.)Evidence 6C:Scientists have extracted DNA frommany different cell types in one organismand from the cells of many differentspecies.This evidence is■ credible; it is based on work with numeroussamples.■ helpful, but certainly not conclusive. The factthat all cells appear to have DNA supports thehypothesis that DNA is the genetic material. Allcells, however, also have proteins, carbohydrates,and lipids, so this evidence is in no wayconclusive.Evidence 6D:Scientist Francis Crick and a studentnamed James Watson agreed that DNAmight be the genetic material.This evidence is scientifically bogus. Without scientificevidence, the opinion of these men provesnothing. Students might be naive about this bogusevidence because these scientists did go on to discoverthe structure of DNA (although even that evidencealone does not prove its role as geneticm a t e r i a l ) .MILESTONES IN UNDERSTANDINGGENETICS - NO. 7Question:How is the genetic information used tomake proteins encoded?Milestone Explanation:In DNA, a triplet of nucleotide basesencodes each amino acid in the resultantprotein.Evidence 7A:To determine how the genetic codemight work, scientists noted thatDNA has four different bases that canbe arranged in various sequences.The code must be able to specify the20 different amino acids found inproteins. Mathematical principlespredict the following about the geneticcode:one-base codetwo-base codes p e c i f i e s 4 amino acids at mosts p e c i f i e s 16 amino acids at mostthree-base code s p e c i f i e s 64 amino acids at mostf o u r-base codeThis evidence iss p e c i f i e s 256 amino acids at most■ credible; it is based on mathematical principlesthat are clearly demonstrable and testable.■ helpful; the three-base code has the minimalcomplexity required to encode twenty aminoacids. This evidence does not prove the tripletnature of the genetic code, but it is supportiveand it suggests a testable hypothesis.86©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Evidence 7B:Investigators found that removal ofthree nucleotides from a gene causesthe resulting protein to lose one aminoacid. However, removal of one or twonucleotides from a gene causes muchmore disruption in the resulting proteinstructure. Other scientists quicklyrepeated these experiments and gotthe same results.This evidence is■ credible; it is based on experiments that othershave replicated.■ helpful; this is evidence that the protein-codingi n f o rmation occurs in groups of threenucleotides.(This is the 1961 experiment where Francis Crick, L.Barnett, S. Brenner, and S.J. Watts-Tobin, used amutagenic chemical [proflavin] that adds or removesnucleotides from DNA. A one- or two-nucleotidechange results in a frameshift of the protein-codinginformation; removal of three nucleotides simplyremoves one amino acid from the protein and usuallyis less disruptive to protein function. You maywant to take time to discuss this idea of a frameshiftmutation and the significance of a triplet code.)Evidence 7C:Many types of chemical analysis haveshown that DNA contains about equalamounts of four different components(the nucleotides, which contain basesabbreviated A, G, C, and T). In contrast,proteins are made of 20 different components(amino acids), and they vary inamount in different proteins.This evidence is■ credible; it is based on “many types of chemicalanalysis.”■ not directly supportive of the milestone explanation.In fact, this early observation led manyscientists to conclude that protein is the geneticmaterial because its structure appeared to becapable of more variation. DNA appeared to betoo regular. The difficulty arose because scientistsdid not know the actual structure of DNAthat permits the sequence of four bases to producean enormous number of variations (hence,different genes). The variation evident in protein(phenotype) is actually the result of geneticinformation rather than its source.Evidence 7D:A shampoo is advertised as containingDNA and able to enrich hair.This evidence is scientifically bogus (but typical);the claims included in advertisements are notalways substantiated, although they are supposedto be. Sometimes, advertising combines two unrelatedphenomena in the hope that the consumerwill infer a connection. For example, this advert i s e-ment combines “contains DNA” (which could bet rue) and “enriches hair” (which implies but doesnot state that DNA does this; it is a questionableclaim in any event). In addition, there is no scientificevidence to support this association. Fu rt h e r-more, even if DNA did enrich hair, that fact doesnot address DNA’s role as genetic material (hair isprotein, not a living cell).MILESTONES IN UNDERSTANDINGGENETICS - NO. 8Question:How does a new, heritable trait appearin a population?Milestone Explanation:Mutations change the structure of DNAin reproductive cells (gametes).Evidence 8A:People who build large musclesthrough exercise will have childrenwho also have large muscles.This evidence is scientifically bogus; it is not substantiatedby any data from careful observation andmeasurement. In addition, even if it were credible,this evidence would not be helpful as an explanationof heritable change. Strong parents may pass along agenetic makeup for heavy build to their children, but87©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of Giantsthis transfer does not depend on the acquired trait ofmuscle building from exercise by the parent.Evidence 8B:A scientist named Hermann J. Mullerexposed fruit flies to increasing dosesof radiation in the form of X rays. Hekept careful records of the number ofmutant traits that appeared in theiroffspring. Muller found that there wasa direct correlation between the numberof mutations and the amount ofradiation: more X rays produced moremutant offspring. (Later researchshowed that X rays damage chromosomes.)Other scientists have repeatedthis experiment, and similar experimentshave been repeated many times.This evidence is■ credible; it is based on careful observation and aprecise record of results. Others have replicatedMuller’s results.■ somewhat helpful; it suggests a causal relationship,although it does not directly address DNAstructure as the basis for physical change.(Muller received the 1946 Noble Prize for this [andrelated] work, which he reported in 1927.)Evidence 8C:Investigators found that removal ofthree nucleotides from a gene causesthe resulting protein to lose one aminoacid. However, removal of one or twonucleotides from a gene causes muchmore disruption in the resulting proteinstructure. Other scientists quicklyrepeated these experiments and gotthe same results.This evidence is■ credible; it is based on evidence that others havereplicated.■ helpful; this is evidence that the protein-codinginformation occurs in groups of threen u c l e o t i d e s .(This is the 1961 experiment where Francis Crick, L.Barnett, S. Brenner, and S.J. Watts-Tobin, used amutagenic chemical [proflavin] that adds or removesnucleotides from DNA. A one- or two-nucleotidechange results in a frameshift of the protein-codinginformation; removal of three nucleotides simplyremoves one amino acid from the protein and usuallyis less disruptive to protein function. This sameevidence was used to support another milestoneexplanation; this overlap is a common occurrence inscience.)Evidence 8D:Investigators at the Toronto Hospitalfor Sick Children studied the DNA ofchildren who have cystic fibrosis (CF).The investigators also studied the parentsof these children. They found thatthese children and their parents havechanges in their DNA that are not presentin unaffected children or in personswho do not carry the CF gene.Further investigation has revealedmore than 600 different DNA mutationsin the CF gene.This evidence is■ credible. The investigators collected data on CFpatients and their parents and compared thosedata to other data from unaffected persons andnoncarriers. Other investigators found additionalmutations in the CF gene.■ helpful; the evidence shows a relationshipbetween changes in genotype and changes inphenotype. In addition, the work builds on ourbasic understanding of Mendelian genetics, inthis case, autosomal recessive inheritance.(This is the 1989 work of Lap Chee Tsui and his colleaguesin Toronto. This group isolated the CFgene.)88©1997 by BSCS.

Activity 2Puzzling PedigreesNMS CONCEPTSExisting explanations are tested with new evidence;new evidence is used to build hypotheses.GENETICS CONCEPTSThis activity reviews traditional (Mendelian) inheritancepatterns, and introduces the concept ofextranuclear (mitochondrial) inheritance.FOCUSActivity 2 permits students to review pedigrees andmajor patterns of traditional (Mendelian) inheritance.Students also discover a pattern of inheritancethat does not “fit” those with which they aref a m i l i a r. The students use pedigrees that show thisnew pattern and related data to discover that thereare modes of genetic transmission, such as mitochondrialinheritance, that do not follow Mendelianp a t t e rns. The activity lets students experience thecycle of evidence and explanation through whichscientific knowledge is built, tested, used, and modified.When reliable data do not fit with existingexplanations, the data are n o t discarded; instead,existing explanations change or new explanationsare built.OBJECTIVESAs students complete this activity, they should1. review familiar patterns of inheritance: autosomaldominant and recessive, X-linked dominant andrecessive;2. discover that some patterns of inheritance do notfollow Mendelian patterns;3. use some of the methods of science: observe, gatherevidence, propose explanations for patterns oftransmission in the puzzling pedigrees, and look foradditional evidence to support or refute their newexplanation; and4. add to the NMS poster (optional; see Activity 1).ESTIMATED TIMEOne 50-minute class periodPREPARATION AND MATERIALSYou will need to provide the following:■ overhead projector■overhead transparency of Copymaster 2-1, PedigreesA-H (optional)■overhead transparency of Copymaster 2-2, PedigreesI and J (optional)89

Activity 2 ■ Puzzling Pedigrees■overhead transparency of Copymaster 2-3, PedigreesI´ and J´ (optional)■coins for simple statistical model (at least 1 coinper team)■ Copymaster 2-4, Building an Explanation (1 copyper student)■ Copymaster 2-5, Science Art i c l e s (1 copy pers t u d e n t )COPYMASTERS USED IN THIS ACTIVITYCopymaster 2-1Pedigrees A-H (optional)Copymaster 2-2Pedigrees I and J (optional)Copymaster 2-3Pedigrees I´ and J´ (optional)Copymaster 2-4Building an Explanation (worksheet)Copymaster 2-5Science ArticlesINTRODUCTIONThis activity forms a bridge between what studentsalready know about fundamental patterns of inheritanceand modes of transmission that likely are newto them. The activity challenges students to understandthat scientific knowledge in genetics is bothlasting and flexible, with emphasis on the developmentof new explanations when explanations basedon our current understanding are not adequate toaccount for new observations. Students review traditionalpatterns of inheritance, discover a new andpuzzling pattern (mitochondrial inheritance) thatthey attempt to explain, and articulate the way theyhave used scientific processes in this activity. (SeeSection V in the Overview for Teachers for informationabout extranuclear inheritance.)An interesting consequence of our awareness of mitochondrialinheritance is the ability to trace matern a llineages for the human species back to ancient times.The topic is popularly called “the mitochondrial Eves t o ry,” and it has received much media attention. Yo umight direct students to the following articles aboutthis interesting and somewhat controversial topic:■ Thorne, A.G and M.H. Wolpoff. The multiregionalevolution of humans, Scientific American266(4):76-83, April 1992;■Wilson, A.C. and R.L. Cann. The recent Africangenesis of humans, Scientific American,266(4):68-73, April 1992; and■ Chapter 3 of The Neandertal Enigma, by JamesShreeve, 1995, William Morrow and Company.Primary literature sources for your own use include:■ Cann, R.L., M. Stoneking, and A.C. Wilson. MitochondrialDNA and human evolution, Nature325:31-36, 1987;■ Vigilant, L., et al. African populations and theevolution of human mitochondrial DNA, Science253:1503-1507, 1991.STRATEGIES FOR TEACHING THE ACTIVITYA chart summarizing the structure of this activity isincluded at the end of the Strategies discussion. Itshould help you understand the intent of each partof the activity.Prior to using this module, students must have completeda basic study of genetics. Please see Figure 12in the Overview for Teachers for a list of fundamentalgenetics concepts; we assume that students arefamiliar with these ideas. Part I of Activity 2 reviewsbasic Mendelian inheritance to provide a contrastwith mitochondrial inheritance. If your students arenot familiar with the information presented in Figure2-2, or if they are not experienced in using pedigrees,you should teach that basic material beforeusing this activity. For simplicity of comparison, wehave maintained the same family structure in thepedigrees. Ask students to justify their choices asthey assign known patterns of inheritance to PedigreesA-H.In Activity 2, the constructivist approach to teaching isobvious in the way students search for a new conceptof inheritance (mitochondrial inheritance) to explainsome puzzling data. (See Section I of the O v e rv i e wfor Te a c h e r s for a brief discussion of constru c t i v i s tteaching.) Students’ t h i n k i n g is as important as theirfinding the correct answer. They exercise their powersof observation and reasoning as they propose and testvarious hypotheses to explain a surprising pattern ofinheritance. In so doing they experience the methods90©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2of science. Help make this aspect of the activity overtso that students recognize the ways in which they are“doing science.”In Parts II and III, allow students to explore possibleexplanations, but insist on carefully stated hypotheses,testing, and sound reasoning. Discourage guessing.You can help students distinguish hypothesisformation from guessing by probing for students’justifications of their responses. “It’s autosomaldominant” could be a scientific hypothesis or a wildguess. If students offer this explanation, ask them todescribe the evidence. (This approach also is usefulin the review in Part I.)A scientific hypothesis is based on existing observ a-tions, and then it is tested through additional observ a-tion and experimentation. Emphasize that sometimeswe make an observation that is not adequatelyexplained by existing concepts; we then must seek anew explanation. In Pa rt III, remind students that it isokay not to have a final answer, but they must documenttheir observations and their reasoning carefullyon the worksheet in Copymaster 2-4. Students neednot reach the explanation of mitochondrial inheritanceprior to the Analysis. If all students reach the correctconclusion prior to completing all the steps, skipahead to the Analysis, but do insist that students justifytheir conclusions. The articles titled “Extra” DNAand Fe rtilization: Sperm Meets Ovum (Copymaster 2-5) describe extranuclear DNA as a concept larger thanthe example of mitochondrial inheritance alone. Thisconceptual approach will help students contrast whatthey learn about extranuclear inheritance with themore traditional view of nuclear inheritance.This activity affords many opportunities to make studentsconscious of the methods of science they areputting to use. For example, the suggestions offered inFigure T2-2 (page 96 of the Annotated Student Material)show one way to call students’ attention to the methodsof science at work in their own hands and mind.Please note that in the pedigrees and throughout theactivity we have consciously avoided the usual term i-nology of “an affected individual” to refer to peoplewho show the trait in question. Our reason is that“affected” generally refers to a disorder, and all tooo ften students come away from their study of inheritancethinking that genetics is only about genes thatdo not work properly. We want to help students realizethat m o s t genes we inherit are functional, asshown by the fact that we are functional organisms. Toaccomplish this awareness, we indicate that a “trait ispresent” instead of saying an “individual is affected.”The final emphasis of the Analysis is to show how scienceworks. Students reflect on what they have donein this activity and add to the NMS wall poster begunin Activity 1 (optional; see Activity 1, page 80 for anexplanation).ACTIVITY 2 AT A GLANCEPart I:Part II:Part III:Analysis:Review of Inheritance PatternsAs a review, students examine Pedigrees A-H and identify them according to traditional patternsof inheritance with which they are familiar.Puzzling PedigreesStudents examine Pedigrees I and J, which do not fit traditional patterns, and recognize theneed for a new explanation.Testing an ExplanationStudents develop hypotheses to explain the puzzling pedigrees. They use a coin toss to test theirinitial hypothesis, and they use new information (science articles) to refine their explanation.Students discuss how they have used the methods of science in this activity, thinking abouthow scientific explanations arise.Hints to shorten the activity: Assign the review of Pedigrees A-H as homework, and follow this assignment with a brief classdiscussion. Alternatively, have students analyze only four pedigrees for the review, including one example of each traditionalpattern of inheritance.91©1997 by BSCS.

Activity 2 ■ Puzzling PedigreesAnnotated Student MaterialSeparate student pages contain the material shown in bold typeface.Here, we provide an annotated version of student materials to help you conduct the activity.How do scientists decide the direction for theirresearch? For example, scientists want to knowhow genes are involved in cancer. This problemis too large and complex to tackle all at once.Scientists, therefore, break large problemsinto smaller, focused parts. They propose atestable explanation, called a hypothesis, totry to answer one of the smaller questions.These hypotheses show where and how tolook for answers.As scientists make observations and recorddata, they usually find that the new evidencereinforces what they already know. Sometimes,however, the new data do not fit what isknown. If the evidence is reliable, scientistscannot just ignore it. Instead, they must lookfor new explanations to extend or modify whatis known. In this activity, you will put yourskills of observation and your previous knowledgeof heredity to work to study some puzzlingpatterns of inheritance.PROCEDUREPart I: Review of Inheritance Patterns1. D e t e rmine the most likely p a t t e rn of inheritancefor each of the pedigrees shown in Figure2-1. To help you, Figure 2-2 lists the characteristicsof the four patterns of inheritancethat you studied in the genetics unit of yourbiology class. Your teacher will direct you towork on this task alone or with a part n e r. Yo uwill have 10 minutes to complete this task.Figure 2-1 Pedigrees showing the inheritance of eight human traits©1997 by BSCS.92

Puzzling Pedigrees ■ Activity 2Figure 2-2 Four patterns of inheritanceAutosomal dominantMales and females are equally likely to have the trait.Traits do not skip generations (generally).The trait is present whenever the corresponding gene ispresent (generally).There is male-to-male transmission.X-linked dominantAll daughters of a male who has the trait will alsohave the trait.There is no male-to-male transmission.A female who has the trait may or may not pass the genefor that trait to her son or daughter.Autosomal recessiveMales and females are equally likely to have the trait.Traits often skip generations.Often, both parents of offspring who have the trait are heterozygotes(they carry at least one copy of the allele).Only homozygous individuals have the trait.Traits may appear in siblings without appearing in their parents.If a parent has the trait, those offspring who do not have itare heterozygous carriers of the trait.X-linked recessiveThe trait is far more common in males than in females.All daughters of a male who has the trait are heterozygouscarriers.The son of a female carrier has a 50 percent chance of havingthe trait.There is no male-to-male transmission.Mothers of males who have the trait are either heterozygouscarriers or homozygous and express the trait.Daughters of female carriers have a 50 percent chance ofbeing carriers.Note from the field test: Students found the summaryof traditional inheritance patterns presented inFigure 2-2 to be very useful. You may want to incorporatethis chart into your earlier study of Mendelianinheritance and have students refer to it when theydo Activity 2.Decide whether individual or team work will bemore productive and, if appropriate, form teams.Limit the work to 10 minutes and then conduct abrief class discussion so each student can determinethe accuracy of their work. Projecting an overheadtransparency of pedigrees A-H (Copymaster 2-1) mayaid discussion. Insist that students provide evidenceand reasoning to support their choices and do notjust list the answer. Remind students that theyshould propose the most likely pattern of inheritance.Some pedigrees may demonstrate more thanone pattern.The most likely patterns of inheritance for the PedigreesA-H are given in Figure T2-1. (Pedigrees I and Jwill be presented to students in Part II).Part II: Puzzling Pedigrees2. Study two new pedigrees (Pedigrees I and J)shown in Figure 2-3. Both pedigrees illustratethe same trait. Try to identify the inheritancep a t t e rn illustrated by these two pedigrees.Explain your responses, stating specific examplesto support your explanation.Pedigrees I and J demonstrate mitochondrial inheritance(Figure T2-1). To help with the discussion,you might want to project an overhead transparencyof Pedigrees I and J (Copymaster 2-2). Make certainthat students understand that both pedigreesshow the same trait. Solicit a variety of responses.Figure T2-1 Pa t t e rns of inheritance for the pedigreesA & GD & FB & EC & HI & Jautosomal dominantautosomal recessiveX-linked dominantX-linked recessivemitochondrial (presented later)93©1997 by BSCS.

Activity 2 ■ Puzzling PedigreesFigure 2-3 Two puzzling pedigreesPedigree J should be a real puzzle to the studentsbecause there is no obvious connection to the patte rns in Figure 2-2. Students might identify Pe d i g r e eI as autosomal dominant. If not, ask a few questionsso that students propose this pattern. For example:“Does the trait skip generations?” (Students maysay it does in pedigree J; actually, it vanishes.) “Dothe parents of individuals with the trait have the traitthemselves?” (Female parents have the trait.) Alternativelyy o u could propose autosomal dominantinheritance as a challenge to students.NOTE: These data do not rule out a dominant,maternal-effect allele, but students are unlikely tosuggest this explanation.Part III: Testing an ExplanationHow good is the explanation of inheritanceyou suggested in Part II? When you suggestedan inheritance pattern, you were making ahypothesis. A scientific hypothesis is a testableexplanation. To determine how good yourhypothesis is, use evidence to test it.3. Analyze the data (evidence) you haveobserved from the pedigrees to see whetherthey support or conflict with your hypothesis.(Your teacher will provide a worksheetfor your convenience.) Record your explanationfor the inheritance patterns in PedigreesI and J as “Hypothesis 1.” (Rememberthat both pedigrees demonstrate the sametrait.) Next, list evidence that supports yourexplanation and evidence that conflicts withit. Refer specifically to Pedigree I or J as youreport this evidence.Distribute a copy of the worksheet (Copymaster 2-4)to each student to help them organize their explanations.If students choose autosomal dominant, conflictingevidence includes the fact that all six childrenof the second generation in Pedigree I have the trait.This situation could suggest that the mother ishomozygous for the trait. In that case, however,Pedigree J does not fit the same pattern.4. You can reason, calculate, or do experimentsto test a hypothesis. For example, assumethat the mother in the first generation ofPedigree I is heterozygous. For a hypothesisof “autosomal dominant”:a. Consider each child singly. What is the94©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2probability that the mother will transmitthe gene in question? (You can calculate theprobability based on what you know aboutautosomal dominant inheritance.)The probability is 1/2 (50%) for each conception.b. You actually can model the events in thepedigree and use the data to test thishypothesis. Use a coin to represent thetwo alleles involved in this trait. Heads willrepresent the allele responsible for thetrait. Tails will represent the allele thatdoes not produce the trait. Model theinheritance shown in the second generationby tossing the coin six times, once foreach child. Record the results, using ac h a rt like the one illustrated in Figure 2-4.Occasionally, a student will get six heads in the cointoss. If so, the following analysis of the third generationshould clarify this point. Lead a class discussionthat ties the model of the coin toss to the proposedgenotypes based on the hypothesis and to the actualphenotypes shown in the second generation ofPedigree I. The data likely will show that there is onlya small chance—(1/2) 6 or 1/64—that all six children inthe second generation of Pedigree I will inherit theallele responsible for the trait, as would be true forautosomal dominant inheritance.Record results from each toss in the appropriate column.heads(allele for trait is present)tails(allele for trait is absent)Reminder: In autosomal dominant inheritance, if theallele is present, the trait will be present.Figure 2-4 A coin-toss modeling experimentIf you want to emphasize the importance of samplesize for accurate data, or in case a student gets sixheads, you may choose to analyze the next generationfor additional data. Do this with Pedigrees I andJ or use Pedigrees I´ and J´ (Copymaster 2-3), whichshow an extra generation.This analysis can best be done family by family sothat students can see the pattern in terms of the sexof each parent for that generation. Again, data fromthe coin toss should refute the likelihood that theobserved phenotypes result from autosomal dominantinheritance. This conclusion forces the studentsto return to the original problem because ourpresent knowledge of inheritance patterns does notprovide an explanation for inheritance shown inthese pedigrees.c. Your coin toss gave you empirical(observable) data. You also can calculatethe likelihood that all six children inheritedthe trait from the female parent.(Hint: Recall your answer to Question4a, and remember that the probabilityfor each child is based on a separateevent. Use the product rule, based on thesecond law of probability, to find theprobability for all six children.)If students are familiar with the second law of probability,they should be able to calculate the probabilityas (1/2) 6 or 1/64. If they are not familiar with thislaw, explain it to them and let them do the calculations.(The second law of probability states that theprobability that independent events will occurtogether is the product of their individual probabilities.)After discussing the results of the coin tosses and whatthey may mean, you may find it helpful to review whatthe students have done to this point. Emphasize thatthey have used several important methods of sciencein their work, as shown in Figure T2-2, on page 96.5. Suppose that the mother exhibiting the traitin the first generation of Pedigree I ishomozygous for a dominant trait. Wouldthat explanation be consistent with theresults you observed in her offspring (thesecond generation)? Use the data from thecoin test to support your conclusion. Whatabout the results in the third generation ofPedigree I?95©1997 by BSCS.

Activity 2 ■ Puzzling PedigreesFigure T2-2 Methods of science used in Activity 2■ Students may have noticed that Pedigrees I and J donot fit any of the four classic patterns of inheritance,and thus they identified a problem or question.■ The examination of the pedigrees is an example ofobservation.■ The proposal that Pedigree I could illustrate autosomaldominant inheritance is a testable hypothesis. (Studentsmay have other hypotheses as well.)■ Coin tossing is designed to test this hypothesis by col -lecting data.■ Coin tossing is an example of a model system.The observation that all six offspring in the secondgeneration show the trait is consistent with autosomaldominant inheritance if the first-generationmother is homozygous. However, the results in thethird generation are inconsistent with this explanationbecause offspring of males who have the trait donot inherit and express it. To be certain, however,more examples (a larger sample size) would be helpful.Once again, you may want to use Pedigree I´.6. Examine Pedigrees I and J again carefullyand summarize your observations on yourworksheet.Students may use the additional data in Pedigrees I´and J´ if you have introduced this material.a. Indicate whether your tests confirm orrefute the pattern you hypothesized.Record your response as your “conclusions.”(Hint: Your conclusion could be inthe form of a question.)b. If your earlier choice was refuted, canyou now propose a new explanation? Ifso, record it under “Hypothesis 2” onyour worksheet. If not, do not worry.Steps 7-9 may help you.In Pedigree J, only the father in the first generationhas the trait. None of his children or grandchildrenhas it. In Pedigree I, the mother in the first generationhas the trait and all of her children have it. In thethird generation of Pedigree I, all children of the second-generationfemales have the trait. None of thechildren of the second-generation males has thetrait.7. Use Questions 7a and 7b to help you find anew explanation:a. Examine each instance where the trait ispassed to offspring. What do you observeabout the source of the inherited trait?The source is the mother.b. Mendelian genetics assumes that in allcases each parent contributes equally tothe genotype of the offspring. Do the datashown in Pedigrees I and J demonstratethis idea?No. Based on these pedigrees it appears that the traitshows up more often if it is inherited from the mother;of course, these data are limited.Modify your conclusions or propose a newhypothesis if your ideas have changed.At this point, do not expect students to have a completeexplanation of the mechanism they are observing.A good response might be:O b s e rv a t i o n : The trait in each pedigree shows upwith surprising frequency in later generations. It is toofrequent in I and too rare in J to be explained easily.Conclusion: There may be some unknown inheritancepattern or process at work here that makesthis allele transfer from the mother only. (Or, statedas a question, “What mechanisms of inheritancewould result in a pattern of inheritance exclusivelyfrom the mother?”)As a final attempt to build a new explanation,use Questions 8 and 9 to guide your thinking.When you have recorded your best explanation,continue to the Analysis. (Your explanationmay be incomplete. What is important isthat you justify your reasoning with evidence.)8. Could the inheritance of an allele carried onthe X or Y chromosome explain the patternof inheritance in Pedigrees I and J? Explainyour response.Females have the trait, so the allele is not carried onthe Y chromosome. Pedigree J shows no transmissionof the gene in question; if the allele were on96©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2the X chromosome, you would predict presence ofthe trait in offspring unless the inheritance wererecessive. In the latter case, the pattern shown inPedigree I is not likely: too many offspring have thet r a i t .9. Consider the four patterns of inheritance inFigure 2-2. What do they assume about thelocation of genetic material in the cell?These patterns result from the behavior of geneticmaterial in the nucleus.a. In humans, sperm cells and egg cellstransmit genetic information to offspring.How do these cells differ?Discussion should focus eventually on one of themajor differences between the egg and sperm: size.An egg cell is about 1,000 times larger than a spermcell. An egg consists of a nucleus and a considerableamount of cytoplasm. The sperm essentially is anucleus with a tail. The illustration included in thenews article, Fe rtilization: Sperm Meets Ovum(Copymaster 2-5), will help establish this point whenyou distribute copies later in the activity.b. In addition to a complete set of chromosomes(46), what does the developingzygote need to grow and develop? (Hint:What structures are in the cytoplasm?)A constant source of energy is necessary for growthand differentiation. Do not be too concerned if studentsdo not mention all the organelles and structures,but they should mention mitochondria.ANALYSISDistribute Copymaster 2-5, which includes two sciencearticles to be used in the Analysis. Have studentsread the introductory paragraph of theAnalysis. If you are approaching the end of a classperiod, assign the questions as homework. Ask thestudents to respond to the questions in the Analysis.Follow this assignment with a brief discussionto address any problems students have understandingthe mechanism involved in mitochondriali n h e r i t a n c e .1. Read the two articles your teacher distributes.What bearing does the information inthe articles have on your explanation ofPedigrees I and J?If students have not already identified mitochondrialinheritance as the explanation for Pedigrees Iand J, they should do so now. The first art i c l e ,“Extra” DNA, informs students that organellessuch as mitochondria and chloroplasts containtheir own DNA. The second article, Fe rt i l i z a t i o n :S p e rm Meets Ovum, reminds students that onlythe maternal mitochondria survive in the zygote.Combined, these ideas should lead students to theexplanation of mitochondrial inheritance for Pe d i-grees I and J.If they have made this explanation earlier, these articlesprovide additional support.2. What lasting scientific knowledge aboutinheritance did you use in this activity?Sample student responses include:■ Parents contribute genetic material to their offspring.■ Alleles of one gene segregate in the formation ofgametes.■ A special pair of chromosomes determines sexin humans.■ DNA carries genetic information. This is a lastingexplanation that is part of the understanding ofmitochondrial inheritance.■ Mutations change the structure of DNA.■ Some traits show dominant inheritance whilesome show recessive inheritance.3. What new explanations for inheritance didyou use in this activity?Sample student responses include:■ Mitochondria have their own DNA (mtDNA).■ Some human traits result from the action ofgenes in mtDNA.■ There is genetic material (DNA) in addition tothat in the nucleus (extranuclear inheritance).■ Some traits are inherited from the maternalsource exclusively.■ Mitochondria are inherited maternally.Help students view mitochondrial inheritance as anexample of the broader concept that genetic materialis not limited to the nucleus.97©1997 by BSCS.

Activity 2 ■ Puzzling Pedigrees4. What methods of science did you use in thisactivity?Sample student responses include:■ I used observation, as in the work with the pedigreesand the coin toss.■ I acquired evidence (pedigree, coin toss, articleon mitochondrial DNA).■ I tested new evidence against existing explanations.■ I formulated a hypothesis.■ I modeled an experiment about like l i h o o d(coin toss).98©1997 by BSCS.

Activity 3Clues and Discoveriesin ScienceNMS CONCEPTSExplanations that do not account for new evidenceare inadequate; careful observation and data collectionprovide credible evidence; new work builds onold work; cultural influences can affect scientificresearch.GENETICS CONCEPTSStudents use traditional Mendelian patterns of inheritanceand learn that gene alteration can occur duringinheritance. They learn that unstable trinucleotiderepeats help to explain genetic anticipation.FOCUSIn this activity, students encounter genetic anticipationin the human genetic disorders Huntington disease(HD) and myotonic dystrophy (DM) and discoverthat traditional genetics concepts do notreadily explain this phenomenon. Students then useevidence at several levels to demonstrate anticipationand to provide an explanation of the geneticmechanisms that underlie the process. The activity isdesigned as a mystery, where students use clues tosolve the mystery of genetic anticipation. Studentsreflect on (1) the connection between evidence andexplanation in describing causal processes; (2) thelasting yet new nature of our genetics knowledge;and (3) the historical context of scientific understanding.OBJECTIVESAs students complete this activity, they should1. develop a brief historical perspective of ourunderstanding of Huntington disease andmyotonic dystrophy and their impact on families;2. acknowledge the lasting ability of Mendelian andother traditional genetics concepts to explainmost of the genetic processes involved in thesedisorders;3. use case-history evidence, pedigree construction,and new molecular data to demonstrate geneticanticipation and to construct an explanation for itsunderlying mechanism (instability of trinucleotiderepeat sequences in genes associated with Huntingtondisease and myotonic dystrophy);4. recognize and experience the cooperative natureof scientific research by reviewing the historical,step-wise construction of genetics explanationsand by cooperating with other students to solvethe mystery; and5. think about how our evolving understanding ofthe gene influences our perceptions of health anddisease.99

Activity 3 ■ Clues and Discoveries in ScienceESTIMATED TIME75-100 minutesPREPARATION AND MATERIALSStudents will work in 8 teams. You will need to providethe following:■ 1 copy of Copymaster 3-1, HD Clues PresentingFamilial Relationships and Health Data, cutapart to distribute to each team as indicated■ 8 copies of Copymaster 3-2, HD Clues PresentingMolecular Data (1 copy per team)■ 1 overhead transparency of Copymaster 3-3,Template for the HD Pedigree (optional)■ 8 copies of Copymaster 3-3 (1 copy per team)■ 1 copy per student of Copymaster 3-4, ScienceArticle about a Genetics Discovery■ 8 copies of Copymaster 3-5, DM Clues Presenting(A) Familial Relationships and Health; and(B) Molecular Data (1 copy of parts A and B perteam)■ 8 copies of Copymaster 3-6, Template for the DMPedigree (1 copy per team)■ 8 copies of Copymaster 3-7, Completed Pedigrees(optional; 1 copy per team)■ 8 copies of Copymaster 3-8, H i s t o ry of HuntingtonDisease - Vi g n e t t e s(optional; 1 copy per team)Students will work in eight teams of approximatelyfour each. Students will assemble the Huntingtondisease pedigree in a jigsaw fashion as a class activity,using clues contributed from the eight teams. Youwill need one complete set of familial and healthclue slips for HD (Copymaster 3-1) distributed asindicated among the teams, and one copy of themolecular clues for HD (Copymaster 3-2) for eachteam. The molecular clues can be cut into separatestrips for each student in a team or used as a singlesheet that the team consults. You may want to laminatethe clues so that they can be reused easily.For the myotonic dystrophy pedigree, we suggestthat you have each team use a complete set of familialhealth clues and molecular data (Copymaster 3-5)and quickly put together the pedigree as a team. Youcan cut clues apart so that each student in the teamworks with several clues, or you can use the clues asa single sheet that the team consults. If you like, providea template for each pedigree (Copymasters 3-3and 3-6) to help students organize the data. You alsomay find it useful to make a transparency of the templatesso that you can coordinate the class discussion.We have provided the completed HD and DMpedigrees in Copymaster 3-7 for your convenienceand in the event you wish to shorten this activity bystarting with completed pedigrees.COPYMASTERS USED IN THIS ACTIVITYCopymaster 3-1HD Clues Presenting Familial Relationshipsand Health DataCopymaster 3-2HD Clues Presenting Molecular DataCopymaster 3-3Template for the HD Pedigree (optional)Copymaster 3-4Science Article about a Genetics DiscoveryCopymaster 3-5DM Clues Presenting ( A ) Familial Re l a t i o n s h i p sand Health; and (B) Molecular DataCopymaster 3-6Template for the DM Pedigree (optional)Copymaster 3-7Completed Pedigrees (optional)Copymaster 3-8History of Huntington Disease - Vignettes(optional)INTRODUCTIONGenetic anticipation is a term introduced in 1911 byF. W. Mott to describe earlier onset of symptoms orgreater severity of symptoms in subsequent generationswith certain genetic disorders. This phenomenonprovides a powerful example of the sequential natureof scientific explanation and the relationship betweenexisting explanations and new evidence. New evidenceo ften challenges existing explanations. For example,scientists observed an unusual feature of severalhuman genetic disorders, including Huntington diseaseand myotonic dystrophy, that is, the age of onsetor severity of symptoms often shifted in subsequentgenerations of families with these disorders. Many100©1997 by BSCS.

Clues and Discoveries in Science ■ Activity 3years passed, however, before sufficient evidence accumulatedto establish the phenomenon clearly. Oneproblem was that traditional Mendelian genetics didnot explain genetic anticipation. A better explanationhad to await the development of new technologies thatwould contribute additional lines of evidence, a situationcommon in scientific investigations.In the case of genetic anticipation, an initial debatecentered on whether the evidence from the casehistories represented a legitimate biological phenomenonor resulted from bias in data collection.Given the limitations on collecting data from andabout humans, one must be especially careful toavoid bias in the analysis of case histories. Earlyideas about anticipation appear in work by the nineteenthcentury “psychiatrist” Benedict Au g u s t eMorel (the term psychiatrist was not then in use).He spoke of the theory of degeneration, in whichprogressive severity and earlier onset of an illnessfrom parent to offspring was seen. (See McInnis,1996, for an excellent review of early ideas aboutanticipation.) Even when there was enough evidenceto confirm the existence of genetic anticipation,existing genetics concepts did not explain howthis anticipation could occur. With the developmentof sophisticated molecular techniques, however, scientistsidentified the fundamental molecular mechanismsassociated with this phenomenon. The genesin several disorders that display anticipation havebeen shown to contain unstable stretches of a particulartrinucleotide repeated many times. (See page43 in Section V of the O v e rview for Te a c h e r s for amore detailed discussion.)Transmission of the genes associated with HD or DMmay result in a change in the number of repeats.There is a threshold level at which instabilitybecomes marked; when the trinucleotide expansionreaches a critical level, severe phenotypic effectsresult. For example, individuals with more than 39copies of the trinucleotide repeat CAG found in themutant HD gene are scored as positive on genetictests; most likely, they will develop the disorder,unless they die from some other cause first. Whenthe mutant HD gene has many more than 50 repeats,the age of onset is likely to be earlier than in caseswith a smaller number of repeats. In addition, thereis evidence that the parent of origin makes some differencein the behavior of the mutant HD gene. Theage of onset is somewhat earlier if the gene is inheritedpaternally (Ranen, et al. Anticipation and instabilityof IT-15 (CAG)N repeats in parent-offspringpairs with Huntington Disease. The American Journalof Human Genetics 57(3):593-602, 1995). Apparently,the expansion in repeats is more likely to begreater with transmission from the father than fromthe mother.Genetic anticipation in DM results in a change in theage of onset, and in a dramatic difference in symptomsfrom one generation to another. The unstablerepeats in the mutant DM gene contain the trinucleotideCTG. As the number of CTG repeats reaches50-80, mild symptoms, including cataracts, appear fairlylate in life. The repeat number can reach the thousands,and severe symptoms can appear from birt h ,including muscle disfunction and mental retardation.Modification of the traditional view of dominantinheritance to include anticipation may seem quiteremarkable, but scientists have continued to add toand modify their understanding of genetics sincethe early twentieth century. When Mendel’s lawswere rediscovered in 1900, the factors of inheritancewere viewed as particulate and fixed so thatoutcomes from any given genotype would be verys i m i l a r, if not identical. Over the years, we havel e a rned that a variety of nongenetic factors canaffect the phenotype. Environment, for example,o ften influences gene expression. Organisms reachtheir full potential height, based on genotype, onlyif placed in an environment where nutritional andother environmental factors are optimal. Anotherinfluence on gene expression results from genesthat play a role in the expression of other genes. Fo rexample, some inherited anemias may be lesssevere in individuals with counterbalancing geneswhose expression increases the production of redblood cells. Fi n a l l y, there is a strong element ofchance in the expression of many genes in the formof environmental factors or other elements we donot yet understand thoroughly. The genotype establishesthe limits of a given phenotype, but the ultimatephenotype reflects a variety of influences.Some differences in the expression of traits appearas phenomena known as penetrance and variable101©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in Scienceexpressivity. Penetrance refers to the proportion ofindividuals with a given genotype who express theassociated phenotype. Penetrance is an all-or-nonephenomenon; one either expresses the trait or doesnot. If every individual with a particular genotype ina given population expresses the trait in question,the trait is said to be completely penetrant. If lessthan 100 percent of the people with that genotypeexpress the trait, the trait is incompletely penetrant.Variable expressivity refers to the range of physicaleffects and to the timing of expression for the characteristicsof a genetic disorder. Environmental variables,other genes, and chance may influenceexpressivity and penetrance; these factors can cloudour ability to make exact predictions about the likelihoodof particular outcomes of genotypes. Observationsrelated to penetrance and variable expressivityrequired modifications of early Mendelianmodels. Although geneticists now take penetranceand variable expressivity for granted, they were asremarkable at the time of their discovery as arerecent discoveries such as unstable trinucleotiderepeats or genomic imprinting. Section V of theOverview for Teachers provides an extensive discussionof the changing concepts of inheritance.For a more detailed explanation of HD and DM, theirclinical aspects, and the discovery of the molecularmechanisms, also see the Overview for Teachers,Section V, pages 43-49. In addition, the first genomemodule from BSCS, Mapping and Sequencing theHuman Genome: Science, Ethics, and Public Policy,has an extensive description of HD.One final consideration is an examination of themethods for establishing causation in a scientificexplanation. Consider a simple analogy. You go toyour car one morning and notice the tire is flat—that is an observation. You examine the tire and finda large nail embedded in it. The evidence suggests acause for the flat, because you can show the presenceof the nail and because sound reasoning (andperhaps the experience from previous flats) shows amechanism by which a nail could cause the flat—itcreates a hole through which air escapes. Unfort u-n a t e l y, while the principle is the same, showing acausal relationship in science often is not so easy. Inthis activity, students consider the relationshipbetween a large number of trinucleotide repeatsand the manifestation of a genetic disorder. Thea s s o c i a t i o n — l i ke the nail in the tire—begins toestablish cause, but the reasoning to show how thepresence of repeats causes disease is not yet established.A more extensive discussion of causality isincluded in Section III of the O v e rview for Te a c h e r s,page 14.STRATEGIES FOR TEACHING THE ACTIVITYIn this activity, the reasoning process is primary. Studentsuse evidence to justify and to modify scientificexplanations. Students must propose answers andideas, but they also must j u s t i fy how they arrived attheir conclusions. Students should see that,although the explanation for a new genetic mechanismmust be added to the existing body of geneticsknowledge to account for genetic anticipation, ourfundamental understanding of dominant inheritanceis lasting and explains most other features ofHuntington disease and myotonic dystrophy. In thisa c t i v i t y, students build their explanation of geneticanticipation in stages. First, they use pedigree evidenceto support the existence of anticipation.Next, they use molecular evidence to suggest theunderlying mechanism.This procedure offers opportunities for you to makeexplicit to students several key aspects of scientificinvestigations. Emphasize that observational data,such as the information from case histories or pedigrees,are important scientific evidence. Many studentsmistakenly think of experiments as the onlysource of useful data, but in studies of human genetics,scientists are limited in the types of experimentsthey can do using human subjects. People marry andhave children with whomever they choose, so usefulobservation of the resultant patterns of inheritanceis particularly important.The activity begins as an inquiry patterned after amystery and is structured to demonstrate the needto use information in a precise manner. The mysteryapproach and use of clue slips serve mainly to makethe activity fun and to arouse interest, although thisstructure does provide some aspects that modelhow science is done. For example, the jigsawapproach used for building the HD pedigree reflectsthe need for communication among scientists and102©1997 by BSCS.

Clues and Discoveries in Science ■ Activity 3gives students some practice with quantitative dataas they work out dates of birth, death, and othercharacteristics of the people in the pedigrees. However,if you prefer not to devote class time to this initialgame-like process, skip Steps 2-4 in Part II, andmove ahead by distributing the completed HD andDM pedigrees (Copymaster 3-7).The mystery approach may seem a bit unstru c t u r e dand even noisy at first, and it is important to keep studentsfocused on the task. We recommend that youkeep an open, somewhat unstructured style so thatthe opening steps (Pa rt II, Steps 2-3) have the feel ofa game. In part i c u l a r, in Step 2, give individual teamsonly 1-2 minutes to see how their clues could fittogether and, perhaps, to suggest a pedigree as a usefulway to organize data. You may want to wait untilstudents make the suggestion to build a pedigree(possibly prompted by a question from you abouthow to organize clues) before you hand out the templates.Keep assembly of the pedigree an active andexciting aspect of this part of the procedure. You canhelp keep a quick and fun pace by asking questionsabout specific relationships in the pedigree. For example,ask “Who are these twins?” or “Who is Andrew’ sfather?” Suggestions for subtle guidance of the inquiryappear at several steps in the Procedure. You also canuse this part of the procedure as an opportunity tochallenge students to read, reason, and calculate carefullyas they determine the details of the pedigree.Students build an explanation of anticipation in thefollowing sequence:■The opening dialogue establishes the mystery ofwhether anticipation is real or a function of biasin observation.■ The health data in the HD pedigree support theexistence of genetic anticipation in this disorder.■ The molecular data in the pedigree for HDand the science article about trinucleotiderepeat expansion suggest a mechanism fora n t i c i p a t i o n .■ The data for the DM pedigree supply an additionalline of evidence.■ The vignettes provide a historical context fordiscovery about genetic anticipation (optional).“Activity 3 at a Glance” follows and it summarizes thestructure and goals of each part of the activity. Noticethat the information available at each major step isseparated by 20 years of research in genetics.We have separated the examination of clues into twophases to correspond to two discoveries: identifyingthe existence of genetic anticipation, and identifyingevidence for the underlying molecular mechanism.In this way, the activity has the essence of an openinquiry while offering some guidance to help studentsmake these discoveries. For the activity to beeffective, it is essential that students distinguishthese two levels of discovery.ACTIVITY 3 AT A GLANCEPart I:Part II:Identifying the MysteryStep 1: Students read a dialogue set in 1957.Outcome: Students recognize the mystery of genetic anticipation.Gathering Clues to the MysterySteps 2-4: Students in each team receive clues about familial relationships and generalhealth in the HD family. Students build a pedigree to analyze the clues.Outcome: Students recognize evidence for genetic anticipation. (They lack evidence forthe underlying mechanism.)Steps 5-7: Students in each team receive additional clues that provide molecular data aboutmembers of the HD family.Outcome: Students identify evidence for a genetic mechanism that causes genetic anticipation(unstable trinucleotide repeats). This evidence also strengthens the case for genetic anticipation.103©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceACTIVITY 3 AT A GLANCEStep 8: Students repeat the process for a DM family.Outcome: Additional evidence strengthens the students’ explanations.Part III:Analysis:Discovering the History of Genetic Anticipation (optional)Students study vignettes that help them see the conceptual history of our understanding ofgenetic anticipation.Students summarize what they have learned and make connections to NMS.Annotated Student MaterialSeparate student pages contain the material shown in bold typeface.Here, we provide an annotated version of student materials to help you conduct the activity.How do you know that a new scientific idea isc o rrect? Lots of people have good ideas abouthow to explain what they observe in living systems,but a good idea alone is not enough. Scientistsconstantly have to decide whether a newidea is valid, and they do so by using the requirementsof science. To meet these criteria, a goodidea must be based on logical reasoning, and itmust be tested, preferably many times and inmany different ways. A scientist draws an idea(hypothesis) from early observations of a problemand then collects evidence to determ i n ewhether the idea is scientifically valid. If thehypothesis seems to be valid, the scientist willshare it with other scientists. They, in turn, mayrepeat the tests to see whether the evidence isreproducible, or they may add new lines of evidencefrom different tests. If enough evidenceaccumulates, the scientific community acceptsthe hypothesis as valid, and it becomes part ofthe established body of scientific knowledge. Insimple terms, people then refer to the new ideaas part of “what they know about genetics.”This approach to building an explanation for anatural process sounds fairly simple, but it canbe complicated. For example, how do you tellthe difference between discovery of a newprocess and misinterpretation of data? Such adebate arose in genetics among people whostudied two inherited disorders, Huntington disease(HD) and myotonic dystrophy (DM). In thisa c t i v i t y, you will step into the shoes of the scientistsinvolved in this debate and use therequirements of science to follow the history ofthis intriguing investigation. Read the descriptionsof HD and DM in Figures 3-1 and 3-2 if youare not familiar with these disorders.Note: Your students likely have studied Huntingtondisease. If so, have them summarize what they knowabout this genetic disorder before using Figure 3.1.PROCEDUREPart I: Identifying the MysteryThe following fictitious dialogue and series of questionsintroduce students to the idea of genetic anticipation.Call the students’ attention to the date forthe opening dialogue, which is 1957.1. The dialogue below takes you back in historyto the year 1957. Read the dialogue andthen answer Questions 1a-1e.Note that in this dialogue we use the term“chorea”; this name for HD was the commonterm used in the 1950s.The year is 1957. This dialogue isp a rt of a discussion that mighthave taken place between aphysician and a geneticist; wewill call them Dr. A. and Dr. B.As you read their discussion, thinkabout w h y they have different views.104©1997 by BSCS.

Clues and Discoveries in Science ■ Activity 3Dr. A: “I’ve been seeing a patient named Allenwho may have Huntington’s chorea. Ifso, I think he is a good example ofgenetic anticipation.”Dr. B: “You mean that this disease runs in hisfamily, but is showing up at an earlierage in Allen than it did in his parents orgrandparents?”D r. A: “ E x a c t l y. Allen is only 40, and already hehas short periods of memory loss andsudden problems with awkward movementof his legs. When I interviewed him,I learned that his mother died when shewas 65, but, starting at age 55, peoplewho knew her said she was a bit ‘odd’ inher thinking. She spent her last five yearsin a wheelchair, suffering from severemuscle and movement problems. Sheappeared to have Huntington’s chorea.”D r. B: “But that doesn’t prove that geneticanticipation is a real phenomenon. Whatdo you know about Allen’s matern a lgrandparents and great-grandparents?”Dr. A: “Not much. His mother’s mother diedwhen she was very young, during childbirth,so all we know is that she did notshow signs of Huntington’s chorea up tothe age of 24. Allen’s grandfather livedto be about 70, but Allen knew nothingabout his general health. But you knowgeneticists have reported cases of anticipationfor years. What about Dr. Bell’sdiscussion of it in her 1947 publicationin The Treasury of Human Inheritance?She makes a good argument for geneticanticipation in another genetic disease,myotonic dystrophy.”Dr. B: “You mean her mention that patients inan earlier generation of a known pedigreegenerally had only mild symptoms,such as cataracts, when they weremiddle-aged, while —”D r. A: “— while their children and grandchildrenhad muscle wasting and mental illness,more severe in each subsequent generation—anexample of genetic anticipation.”Figure 3-1 Huntington Disease (HD): Summary of SymptomsHuntington disease came to public attention in the 1940s when the well-known folk singer Woody Guthrie began to showsymptoms of this fatal genetic disorder. Huntington disease received notoriety again in the 1980s and early 1990s whenresearchers, including Dr. Nancy Wexler, hunted for and located the mutant gene that causes HD. Dr. Wexler caught the public’sinterest in part because she had a direct and personal concern with this genetic killer: her mother died of Huntington disease,so Dr. Wexler knew she was at risk.HD is inherited as an autosomal dominant disorder. It is rare, occurring at a frequency of about 1/20,000 in Western countriesand less often in Asia and elsewhere. The onset of symptoms generally occurs in adulthood, but the age varies among individualsand between generations of affected people. The disease involves neurological function, and early symptoms includetwitchy muscles, awkwardness of movement, and memory dysfunction. Eventually symptoms become severe, and deathresults. The gene is located on chromosome 4.Figure 3-2 Myotonic Dystrophy (DM): Summary of SymptomsMyotonic dystrophy is a fairly rare inherited human disorder that occurs in 1/8000 Caucasians and even less frequently inother groups. DM shows a large degree of variability in the type and severity of symptoms. The age of onset may vary fromone family member to another of those affected. In its mildest forms, DM leaves the individual asymptomatic until late in adulthood.Then it may show up only as cataracts on the eyes, which affect vision. Because cataracts are not uncommon in elderlypeople, many individuals with extremely mild DM symptoms may not realize they have inherited this disorder. (Conversely, justbecause a relative of yours has had cataracts, do not assume that DM occurs in your family.)More serious symptoms include muscle abnormalities such as a breakdown of muscle tissue and the inability to relax a muscleafter it has been contracted. Other symptoms involve damage to the heart or the sexual organs (gonads). Some individualswho have inherited DM show mental retardation as children. A less severe form results in unusual drowsiness and inattentivenessin adults.Myotonic dystrophy is inherited as an autosomal dominant disorder. The gene is located on chromosome 19.105©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceD r. B: “ ( Laughing) Perhaps. But you haven’tmentioned a different publication fromthat year, the one by that geneticist Pe n-rose. He mentions Bell’s work andr e p o rts from other geneticists, but hepoints out that simple Mendelian inheritanceof a dominant trait won’t result inthe increasing problems of the diseasein children and grandchildren of someonewho has the disease gene.”Dr. A: “Then how do you explain the observedanticipation?”Dr. B: “I don’t, at least, not yet. It may be anerror in observation. Besides, I wouldneed more data.”References:J. Bell (1947), Dystrophia myotonica and allied disease,in The Tr e a s u ry of Human Inheritance IV.Nervous diseases and muscular dystrophies, vol 5,p. 343; and L.S. Penrose (1947), The problem ofanticipation in pedigrees of dystrophia myotonica,Annals of Eugenics 14:125-132.Think about the dialogue as you respond tothese questions.a. What is genetic anticipation?The term refers to a pattern of earlier onset andmore severe symptoms of a genetic disorder in latergenerations.b. Why does Dr. B. want more data?The sampling error decreases in a study when thereare more data. (Remind students of their coin-tossexperiment in Activity 2.) In addition, multiple linesof evidence either strengthen an explanation orshow that it is inadequate or inaccurate. Either way,more data generally help. The anecdotal case discussedin the fictitious dialogue would have had lesssignificance than the research publications to whichDr. A. and Dr. B. refer, because these publications arebased on more than one case.c. Dr. B. refers to “an error in observation.”How might such an error arise? Whatcould be done about it?If a physician thinks genetic anticipation occurs, heor she might look for it in at-risk offspring, thus seeingdisease symptoms earlier than might otherwisebe the case. This pattern could result in a falseimpression of the earlier onset of symptoms in childrenand grandchildren of an affected individual. Acontrolled case study would provide for offspring tobe examined at the same ages in a large number offamilies. In addition, the study would need to bedone by more than one physician, perhaps with a“blind” study, where the physicians examine patientswithout being told what disease is suspected.d. What have you learned about dominantinheritance? Why is genetic anticipationnot explained by this genetic concept?Dominant inheritance predicts that one-half of theoffspring of affected parents will be affected and thepresence of one allele will result in phenotypicexpression. The concept of dominant inheritancedoes not explain genetic anticipation because thistraditional concept does not include any mechanismthat would result in affected individuals in differentgenerations manifesting the disorder at an earlierage, or with more severe symptoms, than did theirancestors.e. What else could be done to solve thismystery?Collect additional data; analyze patterns in morefamilies to see whether there is consistent evidencefor genetic anticipation. Urge students to articulatewhat patterns they might look for in the data hereand with data in the next part of the activity. Thesepatterns include the age at which symptoms appear,the age of death, and the degree of severity for HDand DM.Part II: Gathering Clues to the MysteryDistribute the first set of HD clues (from Copymaster3-1) among the teams.The year is 1977. You have collected interv i e wdata from many of the membersof Allen’s family. Use what youknow from the dialogue andfrom this new case-historyi n f o rmation to answer the ChallengeQuestions in Figure 3-3.106©1997 by BSCS.

Clues and Discoveries in Science ■ Activity 3Figure 3-3 Challenge QuestionsScientists had to think about genetic anticipation in severalsteps. They needed to break the problem intoaddressable questions.■ What evidence do you have to support or refute theexistence of genetic anticipation?■ Do you have evidence that supports a possible explanationfor the genetic mechanism that causes anticipation?If yes, explain.2. Each team has different clues obtained fromcase histories. You only have a few minutes toconsider your team’s clues before you poolyour information with that from other teams.Prompt your students to suggest building a pedigreebefore you give each team the template for the HDpedigree (Copymaster 3-3). Give students onlyabout two minutes to see how their clues fit togetherbefore you begin the team jigsaw to build thewhole pedigree.3. Follow your teacher’s instructions abouthow to report your preliminary findings.Devise a way to display the clues from all teams,assembled in a jigsaw fashion. You may write on theboard or on an overhead transparency of the pedigreetemplate (Copymaster 3-3). Remember thatthe clues for each team represent one section of thepedigree. Notice that the individual from the dialogue,Allen, is marked on the template. Ask studentsto volunteer information about the identitiesand health data for each family member, perhapss t a rting with someone directly related to Allen. Fo rexample, you could point to Allen’s twin daughtersand ask, “Does any team have information aboutthese family members?” Make this step very quickand fun. You may find it most effective to haveteams volunteer information in an inform a l ,u n s t ructured way.If you prefer a more orderly approach (and lessnoise), try calling on students by teams to ask forspecific information. When the pedigree is complete,move to the next step.4. What does this evidence tell you about theChallenge Questions in Figure 3-3 (if anything)?Students should be able to cite evidence for the e x i s-tence of genetic anticipation; they do not yet have evidencefor the causal mechanism. If students have difficultydoing this, use some intermediate questions tohelp them structure their thinking. For example, askthem to compare the health and lifespan of Mart h a ,her son Allen, and her grandson Andrew, paying particularattention to their ages when symptoms appear.Distribute the article from Copymaster 3-4 and theHD molecular clues from Copymaster 3-2. Each teamwill have one complete set of these clues.Now the year is 1997. M o l e c u-lar biologists have devised atest to identify the mutantgene for HD and to determ i n esome of its special properties.In addition, many of thefamily members have had the test; in somecases blood samples stored from older,deceased members were tested. Your teacherwill supply you with an article that describesthe new molecular test for HD and the resultsof this test when perf o rmed on the membersof Allen’s family.5. Read the article and record the inform a t i o nfrom the HD molecular clues on your HDpedigree. Report this information to the classwhen your teacher instructs you to do so.Give students a few minutes to read the article andrecord the information on their pedigrees, thenquickly have the class volunteer the molecular datato add to the class pedigree.6. Why does each person tested have t w o r e p e a tn u m b e r s ?There are two copies of each chromosome and consequentlytwo copies of the gene being tested.7. Using this new evidence, once again addressthe Challenge Questions in Figure 3-3.Now students have a new line of evidence to supportthe existence of genetic anticipation, plus evidence107©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in Scienceto suggest a possible mechanism (expansion of trinucleotiderepeats). You could help stimulate the students’thinking by asking a question such as, “Whymight the results of his parents’ test cause Evan todecide against being tested?” (The parents have onlya few trinucleotide repeats in the gene associatedwith HD.)Challenge Questions (from Figure 3-3)■ What evidence do you have to support or refutethe existence of genetic anticipation?There is evidence to support the existence of geneticanticipation. The pattern of disease corresponds tothe number of CAG repeats, and the number ofrepeats increases in some individuals in later generations.For example, in the HD pedigree, Allen has 46repeats in the mutant copy of the mutant HD gene,and he dies of Huntington disease. Linda, his wife,has only 22 copies of the repeats at most, and shedoes not develop the disease. Their oldest child,A n d r e w, dies of Huntington disease at an even earlierage than did his father, while a second child, Debbie,does not have the disease well past the age at whichAllen became ill with HD. Andrew has 69 repeats ina copy of the mutant HD gene; Debbie has, at most,13 CAG repeats associated with the mutant HD gene.Students may provide many other examples.■ Do you have evidence that supports a possibleexplanation for the genetic mechanism thatcauses anticipation? If yes, explain.Yes. The instability of trinucleotide repeats from onegeneration to the next suggests the molecular basisfor the pattern of genetic anticipation.8. One of the strengths of a good scientificexplanation is that it is supported by multiplelines of evidence. Use a set of clues for adifferent family to look for additional evidencethat supports your answers to thepreceding questions.Distribute a complete set of the DM familial/healthclues (part A from Copymaster 3-5) and a copy of thetemplate for the DM pedigree (Copymaster 3-6) toeach team. You may want to have teams race to seewhich one can complete the pedigree first, or assignthe pedigree as homework, giving each student acopy of the clues and the template. After studentsset up the pedigree, distribute the molecular cluesfor myotonic dystrophy (part B from Copymaster 3-5) to each team. Give each team time to organize itsclues before asking for the students’ response to thechallenge questions.The pedigree for myotonic dystrophy provides additionalevidence to support the existence of geneticanticipation, plus additional evidence to supportthe explanation that unstable trinucleotide repeatsin the mutant gene are part of the mechanismunderlying genetic anticipation. Emphasize thisi m p o rtant aspect of scientific methods by askingstudents how the DM data affect their explanationof anticipation.Part IV: Discovering the Historyof Genetic AnticipationThis section is optional, but it provides a rich contextfor the history of our understanding of genetic anticipation.As such, the examples show many features ofthe nature of science, including how new work buildson old work, and the need for sufficient evidence tos u p p o rt a new explanation. (Sufficient evidence ismore than limited anecdotal evidence or unsubstantiatedideas offered by an individual scientist who hasconsiderable status in the scientific community. )The sequence of discovery demonstrated bythe clues you used reflects the history of discoveryabout genetic anticipation. Use thebrief scenes (vignettes) that your teacher willgive you to build a more complete picture ofthe history of discovery about HD and geneticanticipation. As you read, try to determine atwhat point in the sequence the opening dialoguebetween the fictitious Drs. A. and B.might have taken place. What additionalvignettes might follow these in the future?Distribute one copy of the vignettes to each team(Copymaster 3-8).9. Read the vignettes and discuss with yourteammates what they tell you about thehistory of our understanding of HD.10. As a team, draw up a brief outline of thehistory of discovery about HD.108©1997 by BSCS.

Clues and Discoveries in Science ■ Activity 311. Individually, write a new vignette that representswhat you predict may be the nextlevel of discovery about HD.12. After you complete the vignette, explainthe aspects of science on which you basedyour predictions.ANALYSIS1. What is the relationship between the numberof trinucleotide repeats in the mutantHD or DM gene and the resulting phenotype?There is a threshold number in the case of HD. Individualswho have about 39 or more repeats almostcertainly develop the disease unless they die fromsome other cause first. Usually there are not morethan 120 repeats in the HD mutation. In the case ofDM, the threshold number is about 50-80 for mildsymptoms. Those who have severe symptoms of DMhave inherited hundreds to more than 2,000 trinucleotiderepeats in their mutant DM gene. The morerepeats above the threshold number, the more likelythe disease phenotype will develop, the more likelythe onset will be early, and the more likely theaffected person will display more severe symptoms.2. How does what you know about geneticanticipation contrast with the traditional,Mendelian view of autosomal dominantinheritance?The traditional understanding of autosomal dominantinheritance includes no assumptions about theability of an allele to change its size and does not,therefore, identify a mechanism that explains geneticanticipation.3. How have you used the methods of sciencein this activity?Sample student responses include:■ We collected and analyzed data.■ We reviewed earlier work done on this problem.■ We made our data and conclusions available foranalysis by others.■ We assumed that these observations are explainablein terms of natural causes.You may want to have students add to or consult theNMS poster.4. Write a vignette (brief scene or part of a story )about the future health of Pe t e r, Cathy, andSean. Use your case-history data and the art i-cle you read to support your description.Student responses may be more creative, but thebasic information should show the following: IfPeter has inherited HD from his father, his symptomsmay occur at an early age, because his fatherhad a large number of repeats. The trinucleotidenumber could, however, decrease. DNA analysiswould determine Pe t e r’s number of repeats andprovide a better prediction. Cathy is not likely tohave HD because her mother, Paula, has at mostonly 13 repeats, and at that number the gene is generallystable. In the DM family, severe symptomsshould already be apparent for Sean because he hasa large number of repeats.109©1997 by BSCS.

Activity 4Should TeenagersBe Tested for theMutant HD Gene?NMS CONCEPTSNew discoveries in science and new technologiessometimes raise difficult ethical questions.GENETICS CONCEPTSGenetic anticipation in Huntington disease corr e l a t e sto the number of unstable trinucleotide repeats;genetic testing for Huntington disease can predictwhat is likely to happen to a person with the disease.FOCUSThis activity challenges students to explore a policycommonly followed by genetic-testing centers towithhold genetic tests for Huntington disease (HD)from asymptomatic patients under the age of 18. Studentswill use their prior knowledge about HD andreflect on their own decision-making capabilities asthey analyze a policy that raises significant ethicalissues.OBJECTIVESAs the students complete this activity, they should1. revisit the scientific and clinical implications ofHD;2. gather and evaluate information and make andanalyze arguments as tools for ethical inquiry;3. take and defend a position on whether to recommendthat genetic-testing centers offer genetictesting for HD to asymptomatic teenagers; and4. state alternative viewpoints on an accepted policyamong genetic-testing centers.ESTIMATED TIME30-45 minutes plus homeworkThis activity can be taught as a fairly brief, focuseddiscussion of ethical issues; the estimated classroomtime of 30-45 minutes reflects this approach. Theactivity has the potential, however, to generate muchdeeper discussion. You may want to explore in moredetail some of the concerns that students raise.PREPARATION AND MATERIALSYou will need to provide the following:■ 1 copy per student of Copymaster 4-1, Worksheetfor a Discussion about PolicyIf you have not taught Activity 3 prior to beginningthis activity, you may want to review some characteristicsof HD, including the role of trinucleotiderepeat expansion. For details, see Activity 3 and page43 in Section V of the Overview for Teachers. If youplan to teach Activities 3 and 4, we strongly recommendpresenting them in numerical order.111

Activity 4 ■ Should Teenagers Be Tested for the Mutant HD Gene?COPYMASTERS USED IN THIS ACTIVITYCopymaster 4-1Worksheet for a Discussion about PolicyINTRODUCTIONAn important responsibility of the Human GenomeProject (HGP) is to examine the effects of the projecton individuals, communities, and society. Bothmajor funding sources for the HGP (the UnitedStates Department of Energy [DOE] and theNational Institutes of Health [NIH]) provideresources to support the investigation of relatedissues. This component of the HGP is called ELSI(Ethical, Legal, and Social Implications; see SectionIV in the O v e rview for Te a c h e r s for more inform a-tion about ELSI). Activity 4 addresses ELSI issuesconnected with genetic testing and related specificallyto analysis of trinucleotide repeats in Huntingtondisease.Issues Associated with Genetic Testing: Thedecision for a health-care provider to conduct agenetic test is based on a variety of factors. Healthcareprofessionals are trained to reduce risks to theirpatients, including psychosocial risks. Such risks arereal in testing for the HD mutation. Anxiety anddepression may arise in response to a positive testresult. A similar issue received attention in the mid-1980s, when health-care professionals had to decidehow to handle testing for exposure to the AIDSvirus, HIV. At that point, the connection between apositive test for exposure to HIV and developmentof the fatal disease AIDS was not yet clear (althoughthe correlation has since been established to the satisfactionof virtually all scientists). Keep in mind thatthere is a distinction between having the HD geneand having the HD mutation. (Everyone has thegene; it is the presence of a mutation in that genethat results in the genetic disorder known as Huntingtondisease.)Other factors that a health-care provider considerswhen making a decision about genetic testinginclude the following questions:■ Can the disorder, once diagnosed, be treated?■ Does the patient exhibit symptoms, or is theorder for a test based on family history alone?■ What is the balance of benefit versus harmbrought about by knowledge of the test results?The issue becomes even more complex when thepatient to be tested is a minor, that is, under 18 yearsof age.The request for a genetic test may come from theparents or from the minor. When the minor is anadolescent, the issue becomes particularly complicatedbecause the patient may exhibit a considerabledegree of autonomy regarding his or her health-caredecisions. A report from the American Society ofHuman Genetics (ASHG) and the American Collegeof Medical Genetics (ACMG), titled Points to Consider:Ethical, Legal, and Psychological Implications ofGenetic Testing in Children and Adolescents, is auseful resource for teaching this activity (Am. J.Hum. Genet. 57:1233-1241, 1995). The report pointsout that in these cases “...the primary goal of genetictesting should be to promote the well-being of thechild.” The report also addresses the impact on familymembers: “Presymptomatic diagnosis in childrenalso has the potential to alter the relationships thatexist between parents and their offspring and amongsiblings.” The child who tests positive may beoverindulged or may be treated as a scapegoat. Bothof these problems can occur, however, even in theabsence of testing. The testing of a child (or indeedany other family member) also has implications forall members of the family. In some cases, this forewarningwill be welcomed; in others, it may beunwanted. Genetic testing of a child will ease someaspects of uncertainty, but people differ greatly intheir response to such news.In the case of genetic testing for the Huntingtonmutation, most health-care providers and genetictesting centers adhere to a policy that denies tests tominors who do not exhibit symptoms. This denialextends to requests from the parents, who are thelegal guardians of the child’s health. The rationale forthis policy is that HD generally occurs in the adultyears (particularly during middle-age), and there isno treatment. For these reasons, there is no immediate,physical health benefit from a specific diagnosisbased on genetic testing for a minor. The psychologicaleffects can be mixed. While some individuals preferthe release from uncert a i n t y, others could view a112©1997 by BSCS.

Should Teenagers Be Tested for the Mutant HD Gene? ■ Activity 4positive result as a death sentence and react in waysthat are destructive to themselves or their families.Genetic testing requires informed consent, and somegeneticists argue that this requirement automaticallyrules out children, and even teenagers, who generallyare judged incapable of providing such consent. Asthe ASHG/ACMG report makes clear, however, thisview of minors is far too broad and may not be realistic.Some specialists are beginning to recognize thatsome adolescents and young children have sufficientautonomy in consent and decision-making, and theauthors suggest that the desires of these youthsshould be taken into account. In any event, one mustweigh the b a l a n c e of potential harm and benefit.The current policy is to delay the decision to test forthe HD mutation until the individual is an adult andcan make the decision, rather than letting parentsremove this option by making the choice themselves.Note that a change in policy most likelywould result in parents being permitted to make thedecision, rather than leaving the decision to theminor in question. This situation is reflected in Step2 of this activity. Either way, issues of ethical decisionmaking(discussed in the following paragraphs) willarise. To keep Activity 4 focused, we have structuredit around our assumption that this change is themost likely alternative to the current policy. Otheroptions for a new policy are worth considering, however.For example, the new policy could allow competentminors to make the choices, either as a generalrule or in special cases. (See comments underStrategies for Teaching the Activity.)Ethical Decision-making in the Classroom: Ethicaldecision-making is a complex process thatincludes many variables, but one can examine theprocess in concrete terms that teenagers can understand.Activity 4 involves students in a discussion ofethical issues surrounding a debate about a genetictestingpolicy. Although this discussion is not a formalethical analysis, it is grounded, in prominentways, in the ethics of problem-solving. This activityraises two central issues: “prudential judgment” and“developmental autonomy.” The former refers to thefactors necessary for judging an issue wisely; the latterinvolves criteria for judging that someone is sufficientlycapable of making his or her own decisions,independent of parents or guardians.We use prudential judgments when our future interestsare at risk in uncertain or unknown ways. Prudentialjudgments concern the probability that theevents for which we are at risk will occur. Such judgmentsalso weigh the benefits against the harmsinherent in particular outcomes or consequences.Hopefully, the act of judgment is followed by choosingto pursue the option that, at least, minimizesharm and, at best, provides benefit. Prudential judgmentsdo not necessarily involve situations with a“right” or “wrong” answer. They will exhibit variabilityby their very nature because they involve humanvalues, probability, and relative risk. Prudential judgmentscan be made sloppily or rigorously. Rigorouslymade prudential judgments follow a process ofintellectual discipline in which one weighs risks andbenefits carefully. Sloppily made judgments are morelikely to result in surprises, because the ramificationsof a decision are not examined carefully beforehand.The ethical criteria one employs in this intellectualprocess will determine the quality of the judgmentsone makes.Developmental autonomy, in the context of thisactivity, concerns the decision-making capacity ofteenagers with regard to access to genetic informationand the larger issue of whether a minor is ableto make informed decisions about personal healthand medical services. Elements of this ability includeprocessing information, reasoning causally, assessingthe worth of likely future events using value judgmentsthat are based on facts and that have beenwell considered, expressing a preference in light ofthose judgments, carrying out preferences, andaccepting responsibility for one’s choice or action. Aformal discussion of these issues is provided in theOverview for Teachers (Section IV; see especiallypages 29-31).STRATEGIES FOR TEACHING THE ACTIVITYAs indicated in the Introduction, this activity is simplifiedbecause it chooses the most likely alternativeto current policy (this alternative being that parentsnormally will decide for their children) and lets studentscompare that alternative to the current policy.This comparison begins in Step 2 of Part I of theactivity. There are, however, many other interestingoptions, such as a change in policy that would put113©1997 by BSCS.

Activity 4 ■ Should Teenagers Be Tested for the Mutant HD Gene?the burden of decision on the minor. To provide amore open-ended approach, you could ask studentsat Step 2 to decide whether the policy shouldchange and, if so, to what alternative. Do not get intoan involved discussion at this point. Just identify analternative suggested by the class and then call for avote based on the two options: to maintain the currentpolicy or to change the policy to one suggestedby the class. With this open-ended approach, thesample responses provided in Question 4a of theAnnotated Student Material may change.Please note that we refer to choices that involve childrenor their parents, but many of your students maylive in households that do not have a traditional setof parents. A student, for example, may live with asingle parent or with grandparents. Please be sensitiveto these differences where possible.The following aspects of prudential decision-makingare important in the context of this activity. Considerthe policy to deny genetic testing to asymptomaticteenagers who are at risk for HD. Is this policy unjustifiablebecause it prevents risks that prudent peoplecould take for themselves? Is the policy justifiablebecause it protects the right of minors to make thesedecisions later in adulthood, rather than beingsuperseded by parental authority? As you explorethese issues, help your students to recognize thatthere is a wide range of prudential judgments, fromthose that are highly risk-averse to those that aremuch less so. You can do so by contrasting examplesfrom each end of the spectrum.The distinction between genetic testing for minorsor adults also rests in part on developmental autonomywith regard to decision-making. Help studentstest their own developmental autonomy by using thedebate in this activity. Students can record theirresponses on Copymaster 4-1. We provide somesample responses on the annotated version of Copymaster4-1, page 117. Questions 1 and 2 of the Analysisalso allude to developmental autonomy.The following summary of this activity will give you asnapshot of the procedure.ACTIVITY 4 AT A GLANCEPart I:Part II:Analysis:Identifying the IssueStudents learn about an actual health-care policy that withholds genetic testing for asymptomaticteenagers who are at risk for HD. The students express their opinions about thepolicy by voting to retain it or amend it.Using Ethical Decision-makingStudents apply skills in ethical decision-making and analyze the topic in depth before theyvote again.Students examine the usefulness of scientific evidence and look at other ethical issuesrelated to new discoveries in genetics; they personalize their discussion of the policy ongenetic testing.114©1997 by BSCS.

Should Teenagers Be Tested for the Mutant HD Gene? ■ Activity 4Annotated Student MaterialSeparate student pages contain the material shown in bold typeface.Here, we provide an annotated version of student materials to help you conduct the activity.How should you go about making good choicesabout important issues in life? Should youbase your decisions on a whim, a coin toss, ora call to a psychic hot line? Or should you relyon well-informed, well-reasoned analysis? Scientificreasoning is a disciplined way to understandevents in the natural world. Similarly, adiscussion of ethical issues brings reason anddiscipline to decisions that involve preferencesbased on values. We draw our valuesfrom many sources, including history, law,religion, and family. Part of the task of ethicsis to identify these values clearly and to showwhy others should regard them as important.A discussion of ethical issues may apply towhat we do as individuals or to how publicpolicy is made. In this activity, you will use theprinciples of sound decision-making andethics to decide whether a policy that excludesteenagers from genetic testing is a good publicpolicy.PROCEDUREPart I: Identifying the Issue1. People often express their opinions or concernsthrough a letter to the editor of anewspaper. Read the letter shown in Figure4-1.If students have completed Activity 3, they will guessthat the letter is from Jean Wu, and that it refers toher husband, Nathaniel, and son, Peter. Because theletter is personal, she likely would omit their namesand her surname.2. Assume that a change in policy would giveparents the right to request an HD test for aperson who is under 18 years of age. Decidewhether you think the policy of not testingminors should stand or be changed. Registeryour vote when your teacher polls theclass.Give students just enough time to read the letter,then restate the issue and call for a vote. Record theclass poll “for” and “against” changing the policy.Part II: Using Ethical Decision-making3. Form teams as directed by your teacher toconduct a discussion of the ethical issues inthe letter. Regardless of your personalopinion on this issue, work with your teamto draw up two lists of opposing ideas aboutthis policy, using the worksheet provided byyour teacher. In the left column, list reasonsthe current policy is good. In the right column,list reasons the policy should changeor why the new policy is better. Record allof your team’s ideas.Distribute Copymaster 4-1 to each student. Ask studentsto form teams of three or four. Have studentsdiscuss and record their reasons. Allow about 10minutes to complete this exercise.4. Present your team’s ideas to the class. Addnotes to your own worksheet of new ideas thatarise during the discussion with other teams.Record the students’ responses on the chalkboard,on a transparency, or on a large sheet of paper. Youmay want to remind students that HD is a late-onsetcondition; teenagers, therefore, may not show symptomseven if they will develop the disease later on.Thus, they could make a decision about testing afterthey are adults. In addition, there is currently notreatment for HD even though the disorder can bediagnosed; there is considerable emotional stressassociated with testing. Future research, however,may find therapies that help.The following questions may help you guide this discussion.Be certain to leave enough time for a secondvote.a. Reflect on the reasons the class offered for makinga decision about testing for HD. What major115©1997 by BSCS.

Activity 4 ■ Should Teenagers Be Tested for the Mutant HD Gene?Figure 4-1 Letter to the editor of a city newspaperethical issues or common areas of concern didthe class identify ?You may find that this case raises at least two areas ofconcern, the first involving prudential decision-makingand the second involving developmental autonomy(for example, right to know, competence, andmaturity). The Introduction to this activity reviewsthese topics. Sample responses are provided in FigureT4-1, the annotated version of Copymaster 4-1.Students may express these same ideas in much simplerlanguage. Responses will vary depending onwhat option you and your class chose for the policychange (parents decide, or minors decide, or someother plan).b. How would retaining the current policy help orinjure the teenagers in question, or their familymembers? How would changing the policy helpor injure the teenagers or their family members?How should we evaluate those outcomes?Ask students to defend their selection.Note from the field test: Most field-test teachersfound that a few students change their votes, whichshows the importance of the discussion.116©1997 by BSCS.

Should Teenagers Be Tested for the Mutant HD Gene? ■ Activity 4Figure T4-1 Annotated Worksheet for a Discussion about PolicyCurrent policy: To withhold genetic testing for Huntington disease for asymptomatic minors.Reasons to maintain policyReasons to change policy(Prudential Judgments)Bad events could result (such as depression, divorce, orloss of employment).Bad events should be avoided even if the risks are low.Testing won’t change the outcome.There is no treatment at present.Parents might not want to pay for college.Testing later may be done in a context of (future)treatment.Testing could adversely affect one’s status as an insurancecarrier.Bad events do not necessarily follow.We have an obligation to know about our genes for thesake of future generations.Parents and teenagers have a right to know.Teenagers may find out that they tested negative for HD.If tested, teenagers might choose to live differently, knowingthey will become ill later.Knowledge of one’s genetic status can help with planning,such as whether to develop relationships.(Developmental Autonomy)Many teenagers cannot make informed decisions.The majority of teenagers are neither cognitively noremotionally mature.Genetic causality is too complex for teenagers to understand.Some teenagers are self-centered and ignoreconsequences to others.Many teenagers have values that are too unstable.Teenagers found to have the mutant HD gene might notchoose to go to college or to seek employment.Knowing could adversely affect other children in the familywho are too young to deal with the problem.Many teenagers can make informed decisions.Some teenagers can understand genetic causal relations,if they choose to learn.Early onset could mean that symptoms will appear only afew years after the age of consent. Knowing sooner couldgive the teenager more time to make important decisions.There are some teenagers who are cognitively andemotionally mature.Knowing could affect other children in the family or closerelatives, perhaps reducing worry.5. Consider the discussion of ethical issuesperformed by the class and vote again: Isthe current policy good and worth maintaining,or should it be changed so that parentsof minors at risk for HD can have theirchildren tested?Point out to students the important differencebetween deciding for or against a policy and decidingwhether one actually would agree to be tested.An individual can vote to allow testing and still electnot to be tested personally. Take a vote to establishwhat most students think should be done.Even if you have taught the activity as written, youmay want to challenge students with a question suchas, “In what other ways could the policy bechanged?”ANALYSIS1. Given that there is no treatment at presentfor HD, how does acquiring scientific evidenceabout the presence or absence of theHD mutation (from a genetic test) changethe discussion of the issue?Fears or concerns about developing HD will be basedon family history. If this case-history information isthorough and coupled with an informed scientific117©1997 by BSCS.

Activity 4 ■ Should Teenagers Be Tested for the Mutant HD Gene?understanding, speculation is limited to a considerationof the odds. For example, a child has a 50:50chance of inheriting the mutation if one parent isknown to be affected; the issue is less clear if a grandparentis known to have HD. With the results of thegenetic test, direct evidence is available, and theissue is reduced to one of two possibilities: (a) theindividual has not inherited the mutation and will notdevelop HD; or (b) the individual has the mutationand, short of death by another means or the adventof a medical treatment, the individual almost cert a i n-ly will develop HD. The number of trinucleotiderepeats present in the mutant gene also helps to predictthe age of onset. (See Activity 3 and Section V ofthe O v e rview for Te a c h e r s for more detail about thisf o rm of genetic evidence.)2. What additional social and ethical issuesmight new knowledge in genetics raise?Responses will vary, but may include the following:■ How much information should we be allowed tohave access to and when? For example, shouldwe regulate access to genetic information byschools, insurance companies, or by agencies ofthe government?■ What constitutes genetic discrimination?■ How should we respond to pressure imposed fortesting by families, employers, or institutions?■ Who pays for predictive testing?■ How much funding should we devote to developinggenetic tests and treatments?■ If you are found to carry a disease-related genebut are asymptomatic, are you sick? What wouldothers (your family, your teacher, your employer,your health-insurance company) think aboutyour state of health?■ What issues concerning reproductive decisionmakingdoes new knowledge in genetics raise?3. As a homework assignment, write a responseto Jean W.’s letter. You might let her knowwhether y o u would choose to be tested, andw h y. In your letter, describe what scientificevidence from a genetic test will tell you andhow that information affects your choice. Inaddition, show how the discussion of ethicalissues that your class conducted has influencedyour ideas.Student responses should reflect an understanding ofthe scientific significance of testing, an understandingof the behavior of the HD allele, and a well-reasoned,clearly supported, personal opinion about testing.118©1997 by BSCS.

Activity 5What Do We Know?How Do We Know It?NMS CONCEPTSThis activity reviews all concepts addressed in themodule, with particular emphasis on the following:■ A scientifically valid explanation contains supportingevidence, is well reasoned, is based on asound premise, is testable, and demonstrates acausal relationship.■ An explanation can be tested for scientific validity.■ The scientific enterprise reflects the culture inwhich it is embedded and may raise issues ofethical concern.■ Much of scientific knowledge is long-lasting,but new explanations arise in response to newe v i d e n c e .■ Scientific knowledge and skill are relevant tononscientists.GENETICS CONCEPTSThis activity reviews traditional genetics and somenontraditional explanations of inheritance introducedin the module, including extranuclear (mitochondrial)inheritance, genetic anticipation, andinstability of trinucleotide repeats.FOCUSActivity 5 serves three purposes: (1) it is a synthesisthat helps students evaluate what they havel e a rned in the module about the methods of scienceand about genetics; (2) it provides a bridgebetween these studies in the classroom and issuesin the world outside of school; and (3) it providesan opportunity to assess student progress. Studentsexamine popular claims that may be scientificor pseudoscientific and critique these claimsfor scientific validity. The last part of the activityassesses students’ understanding of how scienceworks, of genetics concepts, and of the culturalaspects of science. It also assesses the ability ofindividual students to evaluate popular claims forscientific validity.OBJECTIVESAs students complete this activity, they should1. review their understanding of genes and inheritance;2. consider how and why genetics explanationschange;3. evaluate popular media topics for scientific validity;and4. draw together their ideas about the nature andmethods of science from throughout the module.ESTIMATED TIMEOne 50-minute class period, plus homework119

Activity 5 ■ What Do We Know? How Do We Know It?PREPARATION AND MATERIALSAdvance preparation: Several days before conductingthe activity, ask students to find articles thatm a ke claims about popular science or pseudosciencetopics that pique their curiosity. These articlesshould come from a variety of media sources,some reliable, some less so. Alternatively, you maywant to supply a sample of publications (for example,local newspapers, National Enquirer, or Discover)or specific articles to ensure a good selection.Have students bring to class the articles or notesabout the articles (if they were reported in nonprintsources). Encourage selection of diverse topics, suchas reports of UFOs, crystal power, diet claims, orreports of medical treatments.On the day of the activity, students will work in 4teams. You will need to provide the following:■ 4 large sheets of paper (for charts, plus maskingtape to post them)■ markers of 4 different colors (one color for eachteam)■ articles about popular claims that the studentsor you supply (the source of the articles must beindicated)Before class, post the sheets of paper where studentscan see them and can write on them. Allowsufficient room around each chart so that a team cangather when the students are listing their ideas.INTRODUCTION“Science is a way to call the bluff ofthose who only pretend to knowledge.It is a bulwark against mysticism,against superstition, against religionmisapplied to where it has no businessbeing. If we’re true to its values, it cantell us when we’re being lied to.”“Finding the occasional straw of truthawash in a great ocean of confusionand bamboozle requires vigilance,dedication, and courage. But if wedon’t practice these tough habits ofthought, we cannot hope to solve thetruly serious problems that face us—and we risk becoming a nation ofsuckers, a world of suckers, up forgrabs by the next charlatan who sauntersalong.”Carl Sagan,The Demon-haunted World: Science as a Candlein the Dark, New York: Random House, 1995.Activities 1, 2, and 3 in this module emphasize thatthe principles of inheritance established by Mendeland other geneticists have proven remarkablydurable for more than a century. Continued researchin genetics builds on the robust foundation const ructed by these early workers. In recent years,geneticists and molecular biologists have addede n o rmous amounts of new knowledge to that foundation.For example, advances in molecular biology—whichallow scientists to isolate, sequence, modify, and transfer DNA or RNA—have formed ap o w e rful conduit between traditional genetics andb i o c h e m i s t ry. Now, we can explain at a molecularlevel concepts such as mutation and linkage. Byextending our knowledge to cover the completegenomes of several species, the Human Genome Projectwill enhance our understanding of basic geneticsas it generates new technologies, provides insightsinto disease processes, sheds light on gene regulation,and increases our knowledge of evolution.In light of these, and other, modern technologies anddiscoveries, the durability of fundamental principlesestablished by Mendel and other early geneticists iseven more remarkable. Their ideas have enduredbecause these scientists held themselves accountableto the basic tenets of scientific exploration. Mostn o t a b l y, early geneticists insisted—as do all scientists—thatnew explanations be supported by evidencethat meets the requirements of science. Thisclosing activity of the module is intended to remindyour students of these important aspects of science.Although some of your students may somedaybecome physicians, genetic counselors, or researchgeneticists, not all will have a direct need for sophisticatedknowledge of genetics. They a l l, however, willneed to understand and apply the methods of scienceas they interpret news reports, listen to advice fromphysicians, or make decisions about public policy.120©1997 by BSCS.

What Do We Know? How Do We Know It? ■ Activity 5This activity asks students to demonstrate theirunderstanding of the methods of science by challengingthem to critique media reports of populartopics that either mimic science or are scientific.Note in particular the issue raised by the discussionquestion at the end of Part I of the Analysis. If scientificexplanations were voted upon, they would nolonger count as science, and the corpus of scientificknowledge would be subject to the whims of politicsand popularity. We recommend an editorial publishedin The American Biology Teacher titled “Votingin Science: Raise Your Hand If You Want Humansto Have 48 Chromosomes” (J.D. McInerney and R.Moore, ABT 55(3), March 1993, pp. 132-133). Yourstudents may enjoy reading it as a follow-up to thislast activity in the module. Even reading the title tostudents could challenge them to think about thedistinction between voting on an issue in a club or apolitical setting versus voting on results to establishscientific outcomes. (The funding of scientificresearch is somewhat subject to the whims of politics.That process is different, however, from subjectingscientific knowledge itself to acceptance orrejection on the basis of politics or popularity.)History records two particularly significant episodeswhere voting, in a sense, influenced the corpus ofscientific knowledge, neither to beneficial effect. Inthe seventeenth century, the Catholic Church haddecreed that the biblical account of the nature of theheavens, an account that presented Earth as the centerof the universe, was the inerrant word of Godand, as such, not open to question. The greatastronomer Galileo had data to the contrary, but theChurch had the power, including the power of lifeand death, and thus its “vote” prevailed.From the late 1940s through the mid-1960s, theunfounded, Lamarckian views of Trofim Lysenkoheld sway over Soviet genetics, indeed, all of Sovietbiology. Lysenko’s unsupported belief in the inheritanceof acquired characteristics appealed to Stalin’sviews of a society that could be molded into a Communistcollective. Ly s e n koist views were forcedupon all Soviet biologists and those biologists incountries that were under Soviet domination. Asgenetics and molecular biology were exploding inthe West, the Soviet government turned its back onbiology and embraced ideology. Western journalswere forbidden or severely censored, and Sovietgeneticists who refused to adhere to Lysenko’s viewswere stripped of their positions. Some died in laborcamps. The impact of this perversion of scienceextended beyond the scientific community. Becausethe Soviet five-year agricultural plans were derivedfrom Lysenko’s misguided views of heredity, theywere doomed to fail. Some political historiansbelieve that the collapse of Soviet agriculture ultimatelyled to the downfall of Nikita Khrushchev,Soviet premier from 1958 to 1964.This activity provides students with a chance to placetheir understanding of the nature and methods ofscience into a cultural setting through the analysis ofscience in the popular media. In doing so, studentscement their own understanding of the requirementsof science and exercise their ability to thinkcritically and make informed decisions.STRATEGIES FOR TEACHING THE ACTIVITYBegin by telling students that this activity brings themodule to a close by asking them to evaluate whatthey have learned and to use that new knowledge toanalyze current issues of their choice. Students likelywill find the popular articles engaging. Note thatthis activity works best when the rotation from chartto chart is crisp and quick. The goal is to generatelots of information in a short time, leaving plenty oftime to analyze it. Students also have a sense of ownershipbecause they select the popular media topicsto be critiqued.It is critical to keep this discussion focused on criteriafor a good s c i e n t i f i c explanation. The discussionshould not be an emotional exchange ofu n s u p p o rted opinions, because then it only willmodel shared ignorance. The important issue ishow to judge the scientific validity of a claim basedon the information available. Some popular claims,such as the effect of garlic on fighting various infections,may be valid but reported in an unreliablew a y. For example, if a report makes extravagantclaims for the healing power of garlic without providingany scientific evidence, the source is not reliableand students should not conclude that theclaim has been shown to be valid. You could askstudents what is missing in these situations (such as121©1997 by BSCS.

Activity 5 ■ What Do We Know? How Do We Know It?scientific tests, extensive observations, or reasoningabout how a process takes place). In many cases,students could pursue this missing information inmore reliable sources.Use the Assessment to evaluate different aspects ofstudent learning. Question 2b in the Assessmentshould help students see that scientific knowledgecontinues to grow with new work building on old.Question 3 is very open-ended; it provides a chancefor students to see the influence of society in scienceand vice versa. Finally, the exercise in Question 4provides an opportunity to test each student’s abilityto use the methods of science to critique reportsencountered in the popular media. This performanceassessment mimics real-life needs for scientificunderstanding.The following summary provides a snapshot of theactivity.ACTIVITY 5 AT A GLANCEPart I:Part II:Part III:Critique of popular media topicsTeams work in carousel fashion to list examples and evaluate them for scientific merit.AnalysisThe class discusses the merits of popular media topics and considers how science appliesto their own lives.AssessmentStudents review what they have learned about how science works and about lasting andnew explanations in genetics. They apply their skills individually to evaluate popularmedia topics.122©1997 by BSCS.

What Do We Know? How Do We Know It? ■ Activity 5Annotated Student MaterialSeparate student pages contain the material shown in bold typeface.Here, we provide an annotated version of student materials to help you conduct the activity.“They say getting too much suncan give you cancer.”Who are “they”? Should you believe what“they” say, and, if so, should you change yourbehavior in any way?All of us must assume responsibility for makingdecisions that affect us and others, butthis responsibility does not guarantee that wewill make good decisions. That skill requireslots of practice and careful reasoning, and itrequires intelligent analysis of inform a t i o n .For health-related comments, such as the precedingquote, you should consider the scientificvalidity of the statement to determ i n ewhether you think the statement is reliable.Even if you decide that it is reliable, thechoice of what to do about it still remainsyours. (Is having a tan or relaxing in the sunlightworth the risk of getting skin cancer?How can you reduce the risk?) Whatever youdecide, the ability to determine the scientificvalidity of a popular claim is a valuable skillfor any person.As you work through this last activity, you willevaluate what you have learned in the previousactivities.PROCEDUREPart I: Critique of Popular Media TopicsYou are going to critique claims from the popularpress for their scientific validity.1. Recall from the previous activities therequirements of a good scientific explanationand list them.Spend one or two minutes polling students to makea collective class list. See Section III of the Overviewfor Teachers for a detailed discussion.2. Join your team and look at the articles theteam members have collected. Choose oneto present to the class. Discuss the reasonsthe article gives (if any) to support the claimbeing reported. (Be prepared to list the ideafrom the article and to give supporting evidence,if any, on a chart in the classroom.You have 5-10 minutes to prepare.)You may let students work from articles they bring toclass, or you may want to provide a collection of art i-cles yourself. To avoid redundancy on the charts, youcan circulate during the preparation time andencourage students not to pick similar topics.Note from the field test: Some students had difficultylooking for supporting evidence and acknowledgingsources, such as a reference to a report in arefereed technical journal. Offer helpful suggestions,but keep the activity moving quickly. Omissions orweaknesses in understanding can be addressed comfortablyin Part II, the Analysis.3. When your teacher gives the signal, movewith your team to one chart and quickly listthe claim from your team’s article and indicatethe source. Next show w h y this claim issupposed to be correct, according to the art i-cle. Spend only 2 minutes at this task.123©1997 by BSCS.

Activity 5 ■ What Do We Know? How Do We Know It?Time the steps and stop each team after two minutes.Next, have teams quickly rotate to the nextchart.4. Move with your team to the next chart. Readthe ideas listed by the previous team andcritique this claim for its scientific validity.You have 3 minutes.Stop the task at three minutes. Note that a team’scomments can be identified by the color of its markingpen.Part II: AnalysisRespond to the following questions as theclass discusses the charts.This discussion should n o t be an emotionalexchange of opinions and beliefs. Instead, it shouldmodel a scientific analysis. The task is not to determinewhich students value each claim, but rather toevaluate the potential scientific validity of each claim.First, help students decide whether the claim isaddressable by science or remains in the realm ofuntestable belief, religion, or other nonscientificways of knowing. If a claim is testable scientifically,students should determine the weight of evidence, ifany is available. The following questions may guidethe discussion.1. What is the difference between a belief andan explanation that meets the requirementsof science?This distinction is important for your students.Encourage them to see that some ideas, such as creationism,the use of Tarot cards, or other means offortune-telling, may appeal to people emotionallyand thus may encourage belief. Such beliefs, however,are based on faith, or belief in supernaturalevents, or on revealed knowledge; they are notbased on reliable, scientific evidence. Such beliefsabsolutely do not meet the requirements of scientificvalidity and thus are not taught as a part of scienceor recognized as legitimate subjects for scientificresearch. The question of an individual’s belief insuch topics, particularly religious subjects, is a matterof personal choice, completely external to a studyof, and respect for, scientific knowledge. If any studentshave listed creationism as a science-basedclaim, this discussion may provide an opportunityfor you to help the class understand that evolution isa scientifically valid explanation of biological changethat is fully accepted by the scientific community,while creationism is not. Ongoing scientific debatesabout some of the subtleties of evolutionary processdo not constitute any fundamental disagreementabout the validity of evolution itself. The issue in abiology class is not whether a student should believein creationism or whether it is “right or wrong”; theissue is that it is not supported by scientific evidenceand thus is not a scientific explanation. Evolution iswell-supported scientifically and is accepted as a scientificexplanation; therefore it is suitable for studyin a biology class.You also may encounter concern about the term “theory.” Students frequently misunderstand the meaningof this word in a scientific setting. Students may thinka theory is a “guess.” In informal use, one may hear anexchange such as this: “In theory, I was going to winthe lottery.” This lighthearted use of the word “theory”may leave students with the incorrect idea that at h e o ry is an unfounded speculation. In science, a theory is a well-supported conceptual framework thatexplains a large number of observations about the naturalworld. Scientific theories also have predictivep o w e r, that is, they can help to predict the occurr e n c eof natural phenomena. Chromosome theory, forexample, predicts the occurrence of Mendelian ratios.Students generally accept atomic theory and chromosometheory without discomfort. The theory of evolutionis no different in its scientific validity, althougho ften it is singled out as a topic of concern because itconflicts with the religious beliefs of some people.Evolution theory is a well-reasoned scientific explanationthat is supported by an overwhelming and evergrowingbody of evidence as diverse as the fossilrecord or molecular experiments that demonstrateselection. (See Section III of the O v e rview for Te a c h-e r s for more discussion of the use of scientific evidenceto address scientific explanations.)Many popular beliefs persist because it is easy to beintellectually lazy. If it is not easy to demand andlocate supporting or refuting evidence, people maytend to follow the easier path and respond based ona whim rather than evidence. In addition, somepeople embrace unsubstantiated explanations124©1997 by BSCS.

What Do We Know? How Do We Know It? ■ Activity 5simply because they feel better doing so—they findcomfort in their beliefs. It is extremely importantthat students learn to distinguish well-reasoned, scientificallyjustified explanations from those that arerooted in unsupported assertions.2. Based on the information presented on thecharts, are any of the claims scientificallyvalid?Students will offer a variety of opinions about whichtopics are scientifically sound and which are not.3. How could your actions be influenced byknowing whether a claim is scientificallyvalid?A student who understands the criteria for a scientificallyvalid claim may be less likely to be swayed byfalse claims that appear in the media or that havegeneral public currency. The choice to buy certainover-the-counter medications, for example, might beinfluenced by assessing the efficacy of these products.Some topics, such as religious beliefs, fall outsidethe reach of science and should not be treatedas scientific explanations.4. Many health or science claims have significancein society because they are popular;that is, they have emotional appeal for manypeople. How would the work of scientists bedifferent if scientific explanations were v o t e du p o n for popularity rather than held up tothe scientific standards discussed in thism o d u l e ?This question may provoke considerable discussion; ifso, judge whether it is worth taking the time to pursueit. At this point, you could introduce the editorial citedon p. 121 (“Voting in Science: Raise Your Hand If Yo uWant Humans to Have 48 Chromosomes”).You might want to close the module with a final lookat the NMS poster.Part III: AssessmentRespond to the following questions or assignmentsaccording to your teacher’s instru c t i o n s .Students can be assessed individually or as a team,using written or oral responses.1. Recall your experiences from the module asyou answer the following questions:a. What does science try to do?b. How do we know that our scientificexplanations are on the right track?c. What counts as evidence in science?d. What makes science objective?e. How and why does scientific knowledgechange?f. What is the difference between pseudoscienceand science?This material is based on Section III of the Overviewfor Teachers. That section may help you evaluate studentresponses.2. The previous activities used genetics examplesto show how science works.a. What genetics concepts did you discussin this module?Traditional genetics concepts are presented as milestoneexplanations in Activity 1. Expect students tolist many of those or similar concepts. Figure 12 onpage 36 of the Overview for Teachers also summarizestraditional concepts. Students also should listsome new genetics concepts if they have used Activity2 or Activity 3. Samples of how students mightstate these concepts follow:■ Some genetic information is inherited from themother without equivalent information from thefather.■ Offspring inherit some genes that are not part ofthe nuclear chromosomes.■ Some organelles have their own genes.■Some genetic disorders get worse or showdecreased age of onset in subsequent generations.■ Some genes change as they pass to the next generation.■ Mutant genes that cause Huntington disease andmyotonic dystrophy have unstable trinucleotiderepeats.■ The severity of HD and DM is related to thenumber of trinucleotide repeats in the mutantgene associated with each disorder.■ The number of repeats in mutant HD or DM125©1997 by BSCS.

Activity 5 ■ What Do We Know? How Do We Know It?genes helps predict whether an individual willdevelop the disease, the likely age of onset, andhow severe the symptoms may be.b. Were any of the genetics concepts you listednew to you? Identify them and indicatetheir relationship to earlier knowledge.Concepts related to extranuclear (mitochondrial)inheritance or to genetic anticipation likely are newto students. These concepts connect to and extendexisting knowledge. For example, explanations ofanticipation also take into account what we knowabout dominant inheritance. Ideas such as these maybe standard textbook material in the future becausethey have become so widely accepted that they areno longer novel. This process parallels the growth ofscientific understanding.3. How are science and society related? Give atleast two examples.Responses will vary. For example, scientific discoveriesin genetics and other fields (such as decipheringthe genetic code, identifying the function of specificgenes, or developing the computer chip) actuallychange the way a society functions. These discoverieshave altered diagnosis and treatment of disease,thus changing attitudes toward disease, and theyhave changed the way we store and use informationin our business and leisure activities. Similarly, theconcerns of a society help determine the path thatresearch takes. Issues considered important by societyare more likely to receive funding or to bebrought to the attention of scientists. In some cases,society’s interest takes the form of guidelines orrestrictions in science, such as restrictions on theuse of human subjects or safety precautions in laboratoriesthat work with recombinant DNA.4. Your job is to critique two claims that you seer e p o rted in popular media. One should be ascience or health report that you consider tobe scientifically reliable, and the other shouldbe a claim that you think is not scientificallysubstantiated. (Remember, a claim could bebased on a correct idea but reported poorly,making the r e p o rt scientifically unsound.)Assessment of the student responses should includethese criteria:■ Is the critique clearly presented?■ Does the student recognize the role and significanceof scientific evidence (or its lack)?■Does the student recognize the importance ofreliable reasoning and relevance of evidence?■ Does the student see the predictive power of scientificexplanations?■ Does the student appreciate the power of multiplelines of evidence?■Does the student distinguish between crediblescientific evidence and unreliable information?■ Does the student distinguish between an explanationthat is well-supported by scientific evidenceand an opinion?■Does the critique clearly cite the source of thereports?126©1997 by BSCS.

SPECIAL COPYMASTERS FORCLASSROOM ACTIVITIESThese copymasters are used as hand-outsor to make overhead transparencies.

Standing on the Shoulders of Giants ■ Activity 1Copymaster 1-1: Milestones in Understanding GeneticsHere, we omit numbers for milestones to avoid directing students to a particular sequence.MILESTONES INUNDERSTANDING GENETICSQuestion:Why do offspring resemble their parents?Milestone Explanation:Parents contribute genetic material to theiroffspring.MILESTONES INUNDERSTANDING GENETICSQuestion:How are traits distributed in offspring?Milestone Explanation:Alleles of one gene segregate in the formationof gametes.(Reproductive cells [gametes] form duringmeiosis. Each gamete contains one allelefrom the pair of alleles present in thep a r e n t . )MILESTONES INUNDERSTANDING GENETICSQuestion:Where are genes located?Milestone Explanation:Genes are located on chromosomes.(This idea is the chromosome theory ofinheritance. In eukaryotic cells, geneticmaterial is located in the nucleus in structurescalled chromosomes, for their darkstainingcharacteristic. The name comesfrom the Greek words chroma [color] andsoma [body].)MILESTONES INUNDERSTANDING GENETICSQuestion:What determines the sex of an organism?Milestone Explanation:In most sexually reproducing organisms, specialchromosomes determine sex.(Humans have sex chromosomes, designatedX and Y. The combination of sex chromosomesin an organism determines its sex.)129©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsCopymaster 1-1: Milestones in Understanding GeneticsHere, we omit numbers for milestones to avoid directing students to a particular sequence.MILESTONES INUNDERSTANDING GENETICSQuestion:Why do some traits occur together in offspring?Milestone Explanation:Some genes are located on the same chromosome(linkage).MILESTONES INUNDERSTANDING GENETICSQuestion:What molecular component in chromosomescarries genetic information?Milestone Explanation:DNA carries genetic information.MILESTONES INUNDERSTANDING GENETICSQuestion:How is the genetic information used tomake proteins encoded?Milestone Explanation:In DNA, a triplet of nucleotide basesencodes each amino acid in the resultantprotein.MILESTONES INUNDERSTANDING GENETICSQuestion:How does a new, heritable trait appear in apopulation?Milestone Explanation:Mutations change the structure of DNA inreproductive cells (gametes).130©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Copymaster 1-2: Historic Sequence of Milestones1. Parents contribute genetic material to theiroffspring.2. Alleles of one gene segregate in the formationof gametes.3. Genes are located on chromosomes.4. In most sexually reproducing organisms, specialchromosomes determine sex.5. Some genes are located on the samechromosome (linkage).6. DNA carries genetic information.7. In DNA, a triplet of nucleotide bases encodeseach amino acid in the resultant protein.8. Mutations change the structure of DNA in reproductivecells (gametes).131©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsCopymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:Why do offspring resemble their parents?Milestone Explanation:Parents contribute genetic material to theiroffspring.parents and offspringEvidence A:A scientist looked through a microscope atdividing cells in the tail fins of a salamander.As mitosis proceeded, she saw that chromosomesmoved apart in equal numbers intothe newly forming daughter cells. Other scientistsobserved this phenomenon in cellsundergoing mitosis.parents and offspringEvidence B:A scientist crossed pea plants and carefullyrecorded the appearance of certain traits inthe offspring. When he crossed a strain thathas only purple flowers with one that hasonly white flowers, the offspring always hadpurple flowers. When he crossed these offspringto produce the next generation, however,he saw both colors of flower in the newoffspring in regular proportions.This work was repeated later by other scientistswho saw the same results.parents and offspringEvidence C:Jorge noticed that a classmate, Susan, hascurly hair. When he met her mother, henoticed that she also has curly hair.parents and offspringEvidence D:Mendel said that characteristics of offspringlikely come from something the offspringget from their parents.132©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Copymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:How are traits distributed in offspring?Milestone Explanation:Alleles of one gene segregate in the formationof gametes.(Reproductive cells [gametes] form duringmeiosis. Each gamete contains one allelefrom the pair of alleles present in the parent.)segregationEvidence A:People say that sons express the traits of thefather, while daughters have all the mother’scharacteristics.segregationEvidence B:Offspring in each generation arei d e n t i c a l .segregationEvidence C:Mendel speculated that traits are inheritedbased on discrete units of inheritance. Hetested the law of segregation by observingheight in several generations of pea plants.He saw a distribution of tall to dwarf in theF2 generation of 3:1. Then the F2 plantswere fertilized with their own pollen (selfed).Mendel found that the dwarf F2 plantsproduced dwarf F3 plants, but two-thirds ofthe tall F2 plants produced mixed offspring,dwarf and tall. This F3 test of segregationhas been repeated many times with thesame results.segregationEvidence D:A scientist named W.S. Sutton observed chromosomesin cells undergoing meiosis. Henoticed that the chromosomes behaved in away that is consistent with Mendel’s observationsabout inheritance patterns. Many otherobservations of meiosis by other scientistsconfirmed this behavior of chromosomes inthe nucleus.133©1997 by BSCS.

Activity I ■ Standing on the Shoulders of GiantsCopymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:Where are genes located?Milestone Explanation:Genes are located on chromosomes.(This idea is the chromosome theory ofinheritance. In eukaryotic cells, geneticmaterial is located in the nucleus in structurescalled chromosomes, for their darkstainingcharacteristic. The name comesfrom the Greek words chroma [color] andsoma [body].)genes on chromosomesEvidence A:Using staining techniques and a microscope, C.Nageli discovered a set of structures in thenuclei of cells. Other scientists observed thatthese structures change and become visiblewith a microscope at certain times in the cellcycle. Years after Nageli’s observation, a developmentalbiologist, W. Roux, observed theses t ructures in the cell nucleus, and another scientist,W. Wa l d e y e r, saw the structures andnamed them chromosomes.genes on chromosomesEvidence B:A scientist named W.S. Sutton observed chromosomesin cells undergoing meiosis. Henoticed that the chromosomes behaved in away that is consistent with Mendel’s observationsabout inheritance patterns. Many otherobservations of meiosis by other scientistsconfirmed this behavior of chromosomes inthe nucleus.genes on chromosomesEvidence C:A scientist, T. Boveri, showed that sea urchinembryos develop normally only when theyhave a full set of chromosomes. Embryoswith more or fewer chromosomes than thenormally observed number did not developproperly. Many other scientists have madethe same observations in other organisms.genes on chromosomesEvidence D:A professor at Harvard thinks that chromosomescontain genes.134©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Copymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:What determines the sex of an organism?Milestone Explanation:In most sexually reproducing organisms, specialchromosomes determine sex.(Humans have sex chromosomes, designatedX and Y. The combination of sex chromosomesin an organism determines its sex.)sex determinationEvidence A:Many studies have shown that humanfemales have two X chromosomes, andhuman males have one X chromosome andone Y chromosome. Patricia Jacobs andother scientists also showed that, althoughthe normal human sex chromosome complementis XX or XY, other patterns do occurrarely. For instance, in humans, XXY individualsare male, and XO individuals are female.sex determinationEvidence B:During their lifetime, human males producemany sperm, but females produce only a feweggs. Many years of studies showed thatfemales are born with all the egg cells theywill ever have (although the eggs mustmature individually during successive menstrualcycles). Males, however, produce millionsof new sperm cells every few days untila very advanced age.sex determinationEvidence C:A scientist named C.E. McClung found thatgrasshoppers produce equal quantities of twodifferent types of sperm, one of which containsan extra chromosome. Three years later,two other scientists, N. Stevens and E.B. Wi l-son, determined that female grasshoppershave two copies of one particular chromosome,whereas males have only one.sex determinationEvidence D:There is a saying that a pregnant woman candetermine the sex of her child by eatingspicy foods to produce a male or cool foodsto produce a female.135©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsCopymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:Why do some traits occur together in offspring?Milestone Explanation:Some genes are located on the same chromosome(linkage).linkageEvidence A:The host of a popular talk-show about sportssays that the best baseball pitchers havebrown eyes.linkageEvidence B:Many microscopic studies show that chromosomepairs can exchange material duringmeiosis, resulting in a new combination ofalleles in that pair of chromosomes. Thisphenomenon is genetic recombination,which results from crossing over.linkageEvidence C:Three scientists demonstrated that purpleflowers and long pollen were inheritedtogether in the sweet pea more often (morethan 75% of the time) than predicted byMendel’s law of independent assortment(50%).linkageEvidence D:A study of human pedigrees shows that certaintraits such as hemophilia and color blindnessoccur at a much higher frequency inmales than in females. These traits appear todepend on the inheritance of mutations locatedon the X chromosome. When a man hasboth of these traits, studies show that there isa greater than 50% chance that any brotherswill have both disorders, or neither one.136©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Copymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:What molecular component in chromosomescarries genetic information?Milestone Explanation:DNA carries genetic information.DNA as genetic materialEvidence A:Three scientists purified DNA from bacteriathat grew in smooth colonies. They put thisDNA into bacteria that normally grew inrough colonies. The bacteria that had beengiven the DNA produced many generationsof offspring that formed smooth colonies.This experiment produced the same resultswhen repeated.Other scientists (many years later) transferreda specific fragment of DNA from bacteriato a plant, and a bacterial trait appearedin the plant.DNA as genetic materialEvidence B:Two scientists studied viruses to determinehow they infect bacteria. They labeled theDNA and the protein components of theviruses using radioactive chemicals. Thisallowed them to trace the movement of theDNA and protein. Only labeled DNA enteredthe bacterial cells during the infectionprocess. Other investigations repeated thesestudies.DNA as genetic materialEvidence C:Scientists have extracted DNA from manydifferent cell types in one organism andfrom the cells of many different species.DNA as genetic materialEvidence D:Scientist Francis Crick and a student namedJames Watson agreed that DNA might be thegenetic material.137©1997 by BSCS.

Activity 1 ■ Standing on the Shoulders of GiantsCopymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:How is the genetic information used tomake proteins encoded?Milestone Explanation:In DNA, a triplet of nucleotide basesencodes each amino acid in the resultantprotein.genetic codeEvidence A:To determine how the genetic code mightwork, scientists noted that DNA has four differentbases that can be arranged in varioussequences. The code must be able to specifythe 20 different amino acids found in proteins.Mathematical principles predict thefollowing about the genetic code:one-base code specifies 4 amino acids at mosttwo-base code specifies 16 amino acids at mostthree-base code s p e c i f i e s 64 amino acids at mostf o u r-base code s p e c i f i e s 256 amino acids at mostgenetic codeEvidence B:Investigators found that removal of threenucleotides from a gene causes the resultingprotein to lose one amino acid. However,removal of one or two nucleotides from agene causes much more disruption in theresulting protein structure. Other scientistsquickly repeated these experiments and gotthe same results.genetic codeEvidence C:Many types of chemical analysis have shownthat DNA contains about equal amounts offour different components (the nucleotides,which contain bases abbreviated A, G, C, andT). In contrast, proteins are made of 20 differentcomponents (amino acids), and theyvary in amount in different proteins.genetic codeEvidence D:A shampoo is advertised as containing DNAand able to enrich hair.138©1997 by BSCS.

Standing on the Shoulders of Giants ■ Activity 1Copymaster 1-3: Evidence CardsMILESTONES INUNDERSTANDING GENETICSQuestion:How does a new, heritable trait appear in apopulation?Milestone Explanation:Mutations change the structure of DNA inreproductive cells (gametes).mutationsEvidence A:People who build large muscles throughexercise will have children who also havelarge muscles.mutationsEvidence B:A scientist named Hermann J. Muller exposedf ruit flies to increasing doses of radiation inthe form of X rays. He kept careful records ofthe number of mutant traits that appeared intheir offspring. Muller found that there was adirect correlation between the number ofmutations and the amount of radiation: moreX rays produced more mutant offspring.(Later research showed that X rays damagechromosomes.) Other scientists have repeatedthis experiment, and similar experimentshave been repeated many times.mutationsEvidence C:Investigators found that removal of threenucleotides from a gene causes the resultingprotein to lose one amino acid. However,removal of one or two nucleotides from agene causes much more disruption in theresulting protein structure. Other scientistsquickly repeated these experiments and gotthe same results.mutationsEvidence D:Investigators at the Toronto Hospital for SickChildren studied the DNA of children whohave cystic fibrosis (CF). The investigators alsostudied the parents of these children. Theyfound that these children and their parentshave changes in their DNA that are not presentin unaffected children or in persons whodo not carry the CF gene. Fu rther investigationhas revealed more than 600 differentDNA mutations in the CF gene.139©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2Copymaster 2-1: Pedigrees A-H141©1997 by BSCS.

Activity 2 ■ Puzzling PedigreesCopymaster 2-1: Pedigrees A-H142©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2Copymaster 2-2: Pedigrees I and J143©1997 by BSCS.

Activity 2 ■ Puzzling PedigreesCopymaster 2-3: Pedigrees I´ and J´144©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2Copymaster 2-4: Building an ExplanationHypothesis 1:Supporting Evidence:Conflicting Evidence:Conclusions:Hypothesis 2:Supporting Evidence:Conflicting Evidence:Conclusions:145©1997 by BSCS.

Activity 2 ■ Puzzling PedigreesCopymaster 2-5 Science ArticlesHow much DNA is enough? Humans have 46 DNAcontainingchromosomes in each diploid-cell nucleus;the peas that Mendel studied have only 14 chromosomes.In contrast, a bacterium, which is a prokaryote,contains one large molecule of DNA that serves as itschromosome. (To compare eukaryotic and prokaryoticcells, see the illustration.) Each species has a specificamount of DNA in its chromosome set, but this DNA isnot the whole story. Many cells contain “extra” DNA inaddition to the major genome. Of course, this DNA is“extra” only in the way people may view it. For instance,students of genetics usually begin by studying thegenes found on chromosomes in the nucleus of aeukaryotic cell. In this article, we describe the existenceof DNA in addition to the chromosome set.In some bacterial cells, DNA outside the genomeoccurs as tiny circular molecules known as plasmids.The plasmid DNA replicates on its own, and it has beenused by scientists as a tool for cloning.In eukaryotic cells, some DNA is found outside thenucleus. For example, green plant cells that carry outphotosynthesis have small organelles called chloroplasts.Chloroplasts contain the green pigment neededfor photosynthesis. In addition, chloroplasts have theirown DNA, separate from the chromosomes found inthe cell nucleus.All species of eukaryotes have other organellesknown as mitochondria, which also have their own DNA(mtDNA). Mitochondria help generate energy for thecell. A human muscle cell, for instance, may contain severalhundred mitochondria in its cytoplasm. Mitochondriahelp provide energy for the muscle to contract. ThemtDNA in each of these mitochondria can replicate onits own, separate from the DNA of chromosomes in then u c l e u s .Human mitochondrial DNA has been fairly wellstudied. Each mitochondrion has multiple copies ofits mtDNA, and each copy is made up of 16,569 basepairs arranged as a double-stranded, circular molecule.The entire mtDNA sequence was identified inthe 1980s. It includes genes that code for transferRNAs, ribosomal RNAs (different from those in therest of the cell), and a few enzymes needed for thee n e r g y-related functions of the mitochondria. MtDNA“Extra” DNA?has a higher rate of mutation than does nuclear DNA,and molecular biologists have identified some disordersin humans that result from mutant mitochondrialgenes. As you might expect, given the role of mitochondria,these disorders often involve defects inenergy production. Others involve problems relatedto muscles and nerves.ReferencesEdelson, E. (1991). Tracing human linages. Mosaic 2(3):56-63.Gossman, L.I. (1990). Invited editorial: Mitochondrial DNA insickness and in health. Am. J. Hum. Genet. 46(3):415-417.Harpending, H. (1994). Gene frequencies, DNA sequences,and human origins. Persp. Biol. Med. 37(3):384-394.Lyon, M.F. (1993). Epigenetic inheritance in mammals. TrendsGenet. 9(4):123-128.Martin, J.B. (1993). Molecular genetics of neurological diseases.Science 262:674-676.McBride, G. (1991). Nontraditional inheritance—the clinicalimplications. Mosaic 22(3):12-25.Rennie, J. (1993). DNA’s new twists. Sci. Am. 269(3):122-132.Tarleton, J. (1993/94). New inheritance patterns: New counselingdilemmas. Persp. Genet. Coun. 15(4):1, 8.©1997 by BSCS.146

Puzzling Pedigrees ■ Activity 2Copymaster 2-5 Science ArticlesSperm Meets OvumWhat happens when sperm(male gametes) contact the ovum(female gamete)? Although manysperm reach the ovum, only a singles p e rm enters and fertilizes thefemale gamete. What enables thes p e rm to reach this destination?Sperm are propelled by a whiplikemotion of the sperm tail. Once inthe vicinity of the ovum, spermmove specifically toward it.To reach the ovum, sperm haveto pass through the uterus and intothe fallopian tubes, where fertilizationoccurs. This path is an enormousdistance compared with thetiny size of the sperm, and thesperm require much energy duringthis journey. Sperm rely on energyrelease in the mitochondria topower their movement. Mitochondriaare found in the upper tail sectionof sperm.Sperm are tiny compared to theovum, which is a very large cell. Theovum’s cytoplasm contains chromosomesthat have partially completedmeiosis, structures that helpprocess new proteins, and manymitochondria.Once a sperm successfullyenters and fertilizes the ovum, it nolonger needs its long tail. The tailsection disintegrates after the spermpenetrates the ovum, and only thesperm nucleus, which carries thep a t e rnal chromosomes, surv i v e sinside the ovum. Other dramaticchanges take place in the membraneof the ovum that prevent the entryof any additional sperm. Changesinduced by the entry of the singlesperm include the formation of aprotective layer around the newlyfertilized ovum. In addition, entry ofthe sperm stimulates completion ofmeiosis in the ovum in preparationfor the final combination of paternaland maternal chromosomes in thenucleus of the new zygote.147©1997 by BSCS.

Clues and Discoveries in Science ■ Activity 3Copymaster 3-1: HD Clues Presenting Familial Relationships and Health DataHD CLUES FOR TEAM 11Horace had only one child, a son named Allen, who was born in 1916.1Martha married Horace in 1910, when she was 24 years old. Horace was 29 at the time.1Martha’s granddaughter, Kristen, was the twin who never married,but her identical twin sister, Ann, did marry.1Ann’s father, Allen, died of Huntington disease at the age of 60, 10 years after symptoms appeared.HD CLUES FOR TEAM 22Ann’s paternal grandmother, Martha, began to show signs of confused thought at the age of 55.2Horace’s only son was married to Linda.2The twins’ older brother, Andrew, looked a lot like his mother, Linda.2Kristen was not as close emotionally to her identical twin sister, Ann, afterAnn married Greg in 1961. Ann was 17 and Greg was 19. Kristen never married.149©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-1: HD Clues Presenting Familial Relationships and Health DataHD CLUES FOR TEAM 33Martha died in 1951 at the age of 65, of what might have been Huntington disease.She died before her youngest grandchild, Debbie, was born.3When Bill married Andrew’s youngest sister, Debbie, in 1974, she was 19 and he was 22. Bill had no idea hewas marrying into a family with a history of HD. He knew of no one in his family who had the disease.3Debbie and her husband, Bill, bought a savings bond for their granddaughter,Cathy. Cathy’s mother, Paula, thanked her parents for this gift.3Andrew was one year older than his twin sisters, but he was 12 years older than his sister Debbie.HD CLUES FOR TEAM 44Horace was born in 1881 and died at the age of 72.He was very active and had a clear mind throughout his life.4Ann and Greg realized when their son, Nathaniel, was born in 1962 that Ann’s father had Huntingtondisease. Ann may have inherited it too. Ann and Greg were so poor and so worried about Ann’s healththat they placed their son, Nathaniel, for adoption by the Wu family.4Jean’s husband, Nathaniel, wanted her to name their son after him, but she insisted on the name “Peter”instead. The year was 1992. Jean was 32 years old.4Debbie was only 7 years old when her older sister, Ann, and her husband,Greg, placed their son for adoption.©1997 by BSCS.150

Clues and Discoveries in Science ■ Activity 3Copymaster 3-1: HD Clues Presenting Familial Relationships and Health DataHD CLUES FOR TEAM 55When Christina was a little girl, her father, Andrew, began to show symptoms of HD.His movements became awkward and his muscles twitched. Andrew was 37 years old.5Martha’s grandson, Andrew, died of HD when he was 50 years old,13 years after his symptoms first appeared. The year was 1993.5Allen’s grandson, Joseph, was born in 1970. Joseph was three years younger than his sister,Christina, and five years older than his cousin, Paula.5Joseph feared Huntington disease. His big sister, Christina, began to show symptoms when she was only 26years old. Joseph passed his 27th birthday, however, without showing symptoms of the disease.HD CLUES FOR TEAM 66Evan’s Aunt Kristen got sick soon after his Aunt Ann. At the time she showed symptoms of HD, Ann was 39years old. Kristen was 40 when her HD symptoms appeared. Evan’s mother, Debbie, was healthy.6When she was a teenager, Paula liked to “give orders” to her younger brother,Evan, who was born in 1982. She was seven years older than Evan.6When Paula gave birth to Cathy in 1997, Paula’s mother, Debbie, became a grandmother.She did not feel like a grandmother; she was only 42 years old, and kept active physically and mentally,attending dance class and running her own business.6Evan is younger than his cousins, Joseph, Christina, and Nathaniel. Evan is 8 years younger than his brotherin-law,Bob, and only 10 years older than Nathaniel’s son, Peter.151©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-1: HD Clues Presenting Familial Relationships and Health DataHD CLUES FOR TEAM 77Jama gave birth to a daughter, Christina, in 1967. Jama was 22 years old.7Paula and her brother, Evan, are healthy. Their cousin, Christina, is not as lucky; she has suffered from twitchymuscles and other symptoms of HD since 1993, when she was 26 years old.7Jama married Andrew in 1965, when she was 20, long before she knew that Andrewhad inherited the fatal disorder known as Huntington disease.7Bob and his father-in-law, Bill, took photos the day Bob’s daughter,Cathy, took her first steps. Bob’s wife, Paula, was away, visiting her brother, Evan.HD CLUES FOR TEAM 88Paula’s mother, Debbie, has not shown any symptoms of HD as of the age of 42, although Debbie’s twin sistersbegan to show symptoms before this age.8When Nathaniel was 33 years old, in 1995, he began to suffer from lapses of memory. His mother, Ann, andher twin sister still appeared healthy when they were 33. Later, they developed HD.8Linda was alert and active in sports throughout her fifties. By the time she reached 70,in 1992, she no longer played tennis, but she was still healthy.8Nathaniel’s mother, her twin sister, and Nathaniel’s Uncle Andrew all showed symptoms ofHD when they were fairly young. Nathaniel’s mother was 39, his Aunt Kristen was 40,and his Uncle Andrew was 37 when they showed HD symptoms.©1997 by BSCS.152

Clues and Discoveries in Science ■ Activity 3Copymaster 3-2: HD Clues Presenting Molecular Data (one copy per team)In 1993, researchers developed a test for the mutant HD gene. A particular trinucleotide may berepeated many times in the mutant gene. The following clues provide molecular data about the familyyou have been studying.HD PEDIGREE - MOLECULAR DATABy the time Bob married Paula, he knew that the genetic data for her trinucleotide repeat countwere (13, 12). He wasn’t tested because his family had no history of HD.When Evan heard the results of the genetic tests done on his parents and sister, he chose not to be tested.Christina was tested for HD the year her father died of the disease. Her trinucleotide repeats counts were (93, 7).Joseph had a genetic test for HD before he would ask Becky to marry him. When he found out his testresults were (7, 6), he asked her right away. The year was 1993; Becky was 24 years old.Although Becky’s family had no history of HD, she offered to be tested because she knew how concernedher husband, Joseph, was about this disease. Her counts were (20, 8).Andrew’s wife, Jama, had these counts for trinucleotides in the gene associated with HD: (7, 18).In 1992, at age 30, Nathaniel Wu applied for a job as a laboratory technician. As part of the applicationprocess, he was tested for several genetic disorders and was shocked to find out that he had inheritedan HD mutation. His trinucleotide repeat counts are (72, 19).Dr. Engle had been so curious about the possibility of genetic anticipation in Allen’s family that hepreserved a tissue sample from Allen and his wife, Linda, in 1957. Forty years later, an HD researchertested the samples and found these results: Allen (46, 13); Linda (6, 22).In 1993, the year Andrew died of Huntington disease, the diagnosis was confirmed by a genetic test thatshowed he had one mutant HD gene with 69 trinucleotide repeats. The homologous copy had only 6repeats, apparently inherited from his mother.The twins, Kristen and Ann, were tested for HD. Here are the results: Kristen (64, 22), Ann (64, 22).Greg’s counts were (11, 19).Nathaniel knew his son, Peter, had a 50 percent chance of inheriting HD. The chance could havebeen higher, except that his wife’s counts for trinucleotide repeats in this gene were only (8, 19).Debbie was terrified that she had inherited HD, as had her three elder siblings.When she was tested, she found out that her trinucleotide counts were (13, 6).Bill’s counts were (8, 12).We have no record of the trinucleotide repeat counts for Horace or Martha; they lived too long ago to be tested.153©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-3: Template for the HD Pedigree©1997 by BSCS.154

Clues and Discoveries in Science ■ Activity 3Copymaster 3-4: Science Article About a Genetics DiscoveryNew Genetics Discovery:Trinucleotide Repeat ExpansionAlthough most DNA sequences are transmitted fromparent to child as exact copies, there are occasionalexceptions. There can be an increase or decrease, forexample, in the number of copies of a repeated trinucleotidesequence found in certain genes. The changeoccurs when the gene is passed from parent to offspring.Instability of the trinucleotide repeats increases if thegene has a critical number of copies of the trinucleotiderepeats in a row. This phenomenon is called trinucleotiderepeat expansion, and it plays a role in theinheritance of several genetic disorders in humans.Two of these disorders, myotonic dystrophy (DM)and Huntington disease (HD), are inherited as autosomaldominant traits, but the features of the diseases canvary widely from one person to another, and from onegeneration to another. The mutant genes for both DMand HD have been identified. The mutant HD gene islocated on chromosome 4, and the mutation that causesDM is on chromosome 19.Both mutant genes contain a region of DNA wherethree specific nucleotides of DNA are repeated over andover—many times more than the number found in normalcopies of these genes. The number of copies of thetrinucleotide repeat influences symptoms in the associateddisorder.Genetic tests can determine the number of repeats ineach copy of the DM- or HD-associated gene. (An individualinherits one copy of a gene from the mother and onefrom the father.) The higher the number of repeats, theearlier the symptoms appear, and the symptoms may bemore severe, particularly with DM. For example, DMpatients with about 50-80 copies of the trinucleotideCTG have mild symptoms such as cataracts late in adulthood.Other DM patients have more severe symptoms,such as muscle wasting and retardation as young adults.These patients generally have 80 to a few hundredcopies of CTG in the mutant gene. The most severelyaffected patients show characteristic muscle problemsand retardation when they are children. Individuals withsevere DM have hundreds to more than 2,000 copies ofthe CTG trinucleotide repeat.People who have HD can have anywhere from about39 copies of the sequence CAG to more than 120 copies.Two-thirds of HD patients have 40-50 copies of the CAGtrinucleotide in the HD mutant gene. A copy of thenucleotides in the gene associated with HD is passedfrom parent to child without change, except for thosenucleotides represented by the letters in bold in theillustration. The number of times CAG is repeated canchange during transmission, either expanding or contracting.As a result of this change, the child who inheritsthe mutant HD gene could exhibit a different phenotypefrom that of his or her parent, perhaps with adifferent age of onset. The chance that the number ofrepeats will expand is greater if the mutant HD gene isinherited from the father than it is from the mother.ReferencesChakraborty, R., et al. (1996). Segregation distortion of theCTG repeats at the myotonic dystrophy locus. Am. J. Hum.Genet. 59:109-118.MacDonald, M.E. et al. (1993). Capturing a CAGey killer.Genome Analysis Volume 7: Genome Rearrangement andStability. Cold Spring Harbor, NY: Cold Spring Harbor LaboratoryPress.Nance, M.A. (1996). Invited Editorial: Huntington disease—Another chapter rewritten. Am. J. Hum. Genet.59:1-6.DNA sequence from a mutant gene for HD, with the CAG repeat in the middle:AG C TAG C AGAC T GAT C GAT GTAC GTAC GTTAG C TAGT G C AT GAG C GAT G C TAG C TTAG C TAGTC TAT G C ATTAG C ATC AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG CC AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AGC AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AG C AGCAG C AG C AG C AG C AG C AGT G G C AT C GAT G C AT GAT C TAG C ATAG GAC T C TAGAGAC C C C ATGCATTACGATTACGATTATCGACCCCATAGGGATCGTACGATGCATCGATGCAGCATG155©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-5 Part A:DM Clues Presenting Familial Relationships and Health DataSean gets a lot of attention from his grandparents, Kevin and Elizabeth, because he is their only grandchild.Elizabeth was 55 when Sean was born. Kevin was 54 and ill.Sean spent weeks at birth in 1991 in intensive care because his severe weakness made breathing difficult.Doctors suspected he had a severe form of myotonic dystrophy. His parents,Maureen and Jonathan, were very worried.Amelda and Bob had three children. Their oldest son, Kevin, and youngest son, David, were 6 years apart.A middle child, Miriam, was born in 1938, 1 year after Kevin. She had cataracts when shewas 36 and suffered from muscle weakness.When Kevin was 36, in 1973, he began to go bald and his eyesight weakened. The doctor discovered he hadcataracts, which are unusual in an adult that young. Kevin also had moderate muscle weakness. His onlydaughter, Maureen, was 9 years old at that time.Kevin’s mother, Amelda, had cataracts by the time she reached age 45 in 1967. His father,Bob, was healthy all his life and died at age 80, in 1994, the same year Kevin died.Amelda suffered from mild muscle weakness, but she lived to be 71 years old, dying in 1993,when her oldest son, Kevin, was 56 years old.Amelda’s mother, Bertha, developed cataracts in her late 50s, but otherwise she had no serious healthproblems until she had a heart attack at age 72. She died in 1965, at age 73.When Bob married Amelda in 1940, he was 26 years old, and she was 18. They had 3 children andwere happy together for 53 years, until Amelda died. Bob died a year later.Wilbur was strong and active, but he died in a train crash in 1942 at age 52. His widow,Bertha, was devastated, as was his only child, Amelda.Kevin’s daughter, Maureen, married Jonathan in 1985, when she was 21 years old.Six years later their son, Sean, was born.In 1997, at the age of 47, Jonathan is very athletic, with strong muscles, good coordination, and sharp eyesight.His wife, Maureen, was less fortunate. She had several miscarriages before her son, Sean, was born.A few years after her marriage at age 25, Maureen got cataracts. A year later doctors discovered she had a heart -rhythm problem and muscle weakness. She died young, at age 33, when her son Sean was only 6 years old.David married Julie in 1965. She was 20 years old, 2 years younger than David. As of 1997,both are healthy and happy.©1997 by BSCS.156

Clues and Discoveries in Science ■ Activity 3Copymaster 3-5 Part B:DM Clues Presenting Molecular DataDavid and Julie had two daughters: Cindy (born in 1965) and Jean (born in 1968).Both daughters are healthy and active in sports.A genetic test can show the number of trinucleotide repeats in the gene whose mutant form causes DM. Theresults for Sean’s parents were Jonathan (10, 15); Maureen (621, 12).The year Amelda died, she was tested to determine the number of trinucleotide repeats in her mutant DMgene. The results were (211, 6). Her husband, Bob, was also tested. His results were (6, 10).The year Kevin’s mother died, Kevin and his wife, Elizabeth, had genetic testing done.The results showed the number of trinucleotide repeats in the gene associated with DM.For Elizabeth, the numbers were (12, 14); for Kevin, they were (400, 6).Although Sean was a baby, his severe symptoms and the health problems of his mother alerted doctors totest him for DM. He had a remarkably high number of trinucleotide repeats in one copy of the gene.His test results were (1232, 15).David was tested for DM. His trinucleotide repeat numbers were (6, 10). His wife, Julie, was tested, too.Her results were (18, 19).Cindy’s test results were (6, 19) for trinucleotide repeats in the gene associated with DM.Her sister’s results were (10, 18).157©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-6: Template for the DM Pedigree©1997 by BSCS.158

Clues and Discoveries in Science ■ Activity 3Copymaster 3-7: Completed HD Pedigree159©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-7: Completed DM Pedigree©1997 by BSCS.160

Clues and Discoveries in Science ■ Activity 3Copymaster 3-8: History of Huntington Disease - VignettesMiriam was tested for the mutant DM gene. Her trinucleotide repeats were (430, 10).VIGNETTE ONE: THE YEAR IS 1914Jeffrey, an enthusiastic young medical student, sits down at the cafe table already occupied by his two friends,Joe and Morris. Jeffrey excitedly shows them a translation of a medical report originally published by aNorwegian doctor, Johan Lund, in 1860. He tells Morris and Joe that one of his professors brought the articleto class. Joe reads it quickly and hands it to Morris.“This is a report of the same genetic disorder described by Dr. Huntington in 1872. But Dr. Lund called the condition‘twitches’ instead of ‘hereditary chorea,’” Jeffrey points out.“No, Lund just says that ‘twitches’ is the common name,” Morris replies. “He calls it ‘chorea of St. Vitus.’”“The name isn’t the issue,” Joe comments. “Both reports are based on multiple case histories and several generations.Huntington mentions a slightly earlier age of onset than does Lund. They both mention the combinationof neurological symptoms, including uncontrolled muscle movements, memory loss, and even dementia.And both doctors report the hereditary nature of the disease.”“But neither doctor offers any explanation for the variation in progress of the disease—rapid decline in mostpatients, but later and slower decline in others. And neither doctor can explain the mechanism that causes theawful symptoms,” Jeffrey notes.“And no one has any idea of a cure...” says Morris. The three young men finish their coffee in silence.VIGNETTE TWO: THE YEAR IS 1957Allen and Linda enter the house in silence. Both are thinking about what the neurologist, Dr. Engle, had toldthem after he examined Allen. The doctor suspected that Allen had inherited a frightening illness he calledHuntington’s chorea. They had just heard the name of this disorder on the news. The famous folk singer,Woody Guthrie, had this illness. And now, perhaps, Allen had it, too.Dr. Engle’s tentative diagnosis was based in part on the memory losses Allen had been experiencing. At his relativelyyoung age of 40, Allen should not have these lapses. In addition, Linda had mentioned to the doctor thatAllen sometimes moved oddly, in an awkward “twitchy” way. When Dr. Engle asked about Allen’s parents, helearned that Allen’s mother had shown similar symptoms, but they had not even started until she was 55, some15 years older than Allen is now. She had lived another ten years after the symptoms appeared. Dr. Englethought that Allen had inherited Huntington’s chorea from his mother. That would fit with its pattern of autosomaldominant inheritance. And it would fit with the pattern of genetic anticipation that Dr. Engle had readabout in cases of Huntington’s chorea and myotonic dystrophy. However, he knew that his colleague, Dr. Randall,was skeptical that genetic anticipation really occurred. It could just be a misperception because of a lackof scientific rigor in the way data were collected as case histories.However, this scientific debate was far from the reality of life for Allen and Linda. They thought only aboutAllen’s symptoms and the danger that might be ahead for Allen and their four young children. Had they unwit-161©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in ScienceCopymaster 3-8: History of Huntington Disease - Vignettestingly passed on this terrible legacy to them?VIGNETTE THREE: THE YEAR IS 1986Ann and Greg visit a genetic counselor. Ann has begun to show symptoms of Huntington disease, a disorderthat runs in her family. Her brother Andrew is very ill with it, and her father died of the disease. Ann wants toknow if she should try to have an adoption agency contact her biological son, Nathaniel, who was placed foradoption when he was a newborn. Should she warn him that he is at risk? Now that Ann knows that she hasthe disorder, the known risk for Nathaniel is 50 percent. He is 24 years old, an adult who might want to be tested.The counselor explains to Ann that, although the gene for HD had just been mapped to chromosome 4,there is still no widely available test, although one might be available soon. She suggests that Ann should waituntil that time to tell Nathaniel of his biological family and the risk of HD.VIGNETTE FOUR: THE YEAR IS 1997Jean Wu makes an appointment with a genetic counselor. She had been to this office several times because herhusband, Nathaniel, has Huntington disease in its early stages. This time, however, she has come to talk to Dr.Feynmann about her son, Peter. She wants to have her son tested for the disease. She worries constantly aboutnot knowing her son’s fate with regard to HD. Dr. Feynmann explains that, although Jean and her husband havebeen tested, the current policy of the clinic (and most clinics) is to withhold testing for children who are minorsand who do not show any symptoms. That way the minors can make the choice to be tested for themselveswhen they are adults, rather than having a parent decide for them.©1997 by BSCS.162

Should Teenagers Be Tested for the Mutant HD Gene? ■ Activity 4Copymaster 4-1 Worksheet for a Discussion About PolicyCurrent policy: To withhold genetic testing for Huntington disease for asymptomatic minorsReasons to maintain policyReasons to change policy163©1997 by BSCS.

STUDENT PAGES FORCLASSROOM ACTIVITIESPhotocopy these pages for student use.

Engage ActivityScientific InvestigationPROCEDURE1. Share materials with your team, but work individually.Select a peanut and carefully observe it todetermine the distinguishing characteristics thatidentify this particular peanut. Record your observationson a piece of paper. Do not mark or crackthe peanut. You may use the equipment providedto help you with your observations.2. Return each team member’s peanut to the bowl.Mix up the peanuts.3. Use your notes to find your peanut again.4. Raise your hand if you are absolutely certain youhave found your own peanut.5. What evidence did you use to locate your peanutand distinguish it from the others in the bowl?6. Exchange your team’s bowl of peanuts and observationnotes with those from another team. Nowwork individually with one set of observationsfrom another student and try to find the particularpeanut it describes.7. Raise your hand if you are absolutely certain thatyou have found the correct peanut.ANALYSIS1. What observations were most valuable in finding aspecific peanut?2. What role did your notes or the notes of anotherstudent play in helping you to locate a particularpeanut? (If your memory was a better guide, whatdoes that say about your notes?)3. People often confuse observations with inferences.Observations are collected using your senses,either directly or expanded by technologyusing devices such as microscopes, X- r a ymachines, or microwave sensors on satellites.Inferences are ideas or conclusions based on whatyou observe or already know. Using this distinction,which of the following statements are observationsand which are inferences?■ If this peanut is roasted, the seeds will notgerminate.■ The shell has a rough surface.■ The shell is uniformly colored.■ The peanuts came from a plant.■ The shell has two lobes and is smaller indiameter between them.■ This peanut will taste good.■ Squirrels would eat these peanuts.■ The surface markings on the shell are inrows, running lengthwise.4. Now, look at your notes and label any inferencesthat you included.5. What counts as evidence in science?6. What makes science objective? Why is objectivityimportant?167

Activity 1Standing on theShoulders of GiantsIf you make a scientific discovery, will people still relyon it one hundred years later? Scientists continue touse the theories of inheritance described by GregorMendel (Figure 1-1)—they are remarkably durableafter more than a century. Since the rediscovery ofMendel’s work in about 1900, biologists have madegreat strides in determining the mechanisms ofheredity. Knowledge about genetics has expanded inthe last two decades with technical advances in molecularbiology and, most recently, with the work ofthe Human Genome Project (HGP). This huge projectwill identify genetic relationships (maps) andchromosomal locations of all human genes and willattempt to determine the DNA sequence for theentire genome of Homo sapiens. Mapping andsequencing will be done for other species, too,including selected bacteria, yeast, a plant, and severalanimal species.D i s c o v e ry in the HGP or any field of science occursin stages. Similarly, the history of genetics is muchmore than a simple record of dates, names, and discoveries;it is an account of how our understandingof inheritance and the gene has grown andchanged. Modern geneticists (Figure 1-2) are“standing on the shoulders of giants” who camebefore them.PROCEDUREPart I: Milestones inUnderstanding GeneticsMuch of the information about genetics in yourbiology textbook would have amazed biologists ahundred years ago. Those scientists, driven bycuriosity to answer complex questions of heredity,slowly pieced together layer after layer of the milestoneexplanations that we now accept as valid. Themost significant explanations stand as milestoneevents, each of which marks a great shift in ourunderstanding. Think about what scientists neededto know b e f o r e they could add each new milestoneto the body of genetics knowledge. You are goingto build a sequence of milestone explanations.When you do, your sequence may reflect the actualprogress of genetics during the last hundred or soyears, or it may reflect other ways that history couldhave played itself out during these early years ofd i s c o v e ry.1. Your team will receive a set of eight milestoneexplanations of inheritance. Decide how thesemilestone explanations could form a meaningfulsequence, and be prepared to report yoursequence and the reasons you chose it.169

Activity 2Puzzling PedigreesHow do scientists decide the direction for theirresearch? For example, scientists want to know howgenes are involved in cancer. This problem is toolarge and complex to tackle all at once.Scientists, therefore, break large problems intos m a l l e r, focused parts. They propose a testableexplanation, called a hypothesis, to try to answer oneof the smaller questions. These hypotheses showwhere and how to look for answers.As scientists make observations and record data,they usually find that the new evidence reinforceswhat they already know. Sometimes, however, thenew data do not fit what is known. If the evidence isreliable, scientists cannot just ignore it. Instead, theymust look for new explanations to extend or modifywhat is known. In this activity, you will put your skillsof observation and your previous knowledge ofheredity to work to study some puzzling patterns ofinheritance.PROCEDUREPart I: Review of Inheritance Patterns1. Determine the most likely pattern of inheritancefor each of the pedigrees shown in Figure 2-1 onpage 174. To help you, Figure 2-2 lists the characteristicsof the four patterns of inheritance thatyou studied in the genetics unit of your biologyclass. Your teacher will direct you to work on thistask alone or with a partner. You will have 10 minutesto complete this task.Part II: Puzzling Pedigrees2. Study two new pedigrees (Pedigrees I and J) shownin Figure 2-3. B o t hpedigrees illustrate the same trait.Try to identify the inheritance pattern illustrated bythese two pedigrees. Explain your responses, statingspecific examples to support your explanation.Part III: Testing an ExplanationHow good is the explanation of inheritance you suggestedin Part II? When you suggested an inheritancepattern, you were making a hypothesis. A scientifichypothesis is a testable explanation. To determinehow good your hypothesis is, use evidence to test it.3. Analyze the data (evidence) you have observedfrom the pedigrees to see whether they supportor conflict with your hypothesis. (Your teacher willprovide a worksheet for your convenience.)Record your explanation for the inheritance patternsin Pedigrees I and J as “Hypothesis 1.”(Remember that both pedigrees demonstrate thesame trait.) Next, list evidence that supports your173

Activity 2 ■ Puzzling PedigreesFigure 2-1 Pedigrees showing the inheritance of eight human traitsFigure 2-2 Four patterns of inheritanceAutosomal dominantMales and females are equally likely to have the trait.Traits do not skip generations (generally).The trait is present whenever the corresponding gene ispresent (generally).There is male-to-male transmission.X-linked dominantAll daughters of a male who has the trait will alsohave the trait.There is no male-to-male transmission.A female who has the trait may or may not pass the genefor that trait to her son or daughter.Autosomal recessiveMales and females are equally likely to have the trait.Traits often skip generations.Often, both parents of offspring who have the trait are heterozygotes(they carry at least one copy of the allele).Only homozygous individuals have the trait.Traits may appear in siblings without appearing in their parents.If a parent has the trait, those offspring who do not have itare heterozygous carriers of the trait.X-linked recessiveThe trait is far more common in males than in females.All daughters of a male who has the trait are heterozygouscarriers.The son of a female carrier has a 50 percent chance of havingthe trait.There is no male-to-male transmission.Mothers of males who have the trait are either heterozygouscarriers or homozygous and express the trait.Daughters of female carriers have a 50 percent chance ofbeing carriers.174©1997 by BSCS.

Puzzling Pedigrees ■ Activity 2Figure 2-3 Two puzzling pedigreesexplanation and evidence that conflicts with it.Refer specifically to Pedigree I or J as you reportthis evidence.4. You can reason, calculate, or do experiments to testa hypothesis. For example, assume that the motherin the first generation of Pedigree I is heterozygous.For a hypothesis of “autosomal dominant”:a. Consider each child singly. What is the probabilitythat the mother will transmit the gene inquestion? (You can calculate the probabilitybased on what you know about autosomal dominantinheritance.)b. You actually can model the events in the pedigreeand use the data to test this hypothesis.Use a coin to represent the two alleles involvedin this trait. Heads will represent the alleleresponsible for the trait. Tails will represent theallele that does not produce the trait. Model theinheritance shown in the second generation bytossing the coin six times, once for each child.Record the results, using a chart like the oneillustrated in Figure 2-4.c. Your coin toss gave you empirical (observ a b l e )data. You also can calculate the likelihood that allsix children inherited the trait from the femaleparent. (Hint: Recall your answer to Question4a, and remember that the probability for eachchild is based on a separate event. Use the productrule, based on the second law of probability,to find the probability for all six children.)5. Suppose that the mother exhibiting the trait in thefirst generation of Pedigree I is homozygous for adominant trait. Would that explanation be consistentwith the results you observed in her offspringRecord results from each toss in the appropriate column.heads(allele for trait is present)tails(allele for trait is absent)Reminder: In autosomal dominant inheritance, if theallele is present, the trait will be present.Figure 2-4 A coin-toss modeling experiment175©1997 by BSCS.

Activity 2 ■ Puzzling Pedigrees(the second generation)? Use the data from thecoin test to support your conclusion. What aboutthe results in the third generation of Pedigree I?6. Examine Pedigrees I and J again carefully and summarizeyour observations on your worksheet.a. Indicate whether your tests confirm or refutethe pattern you hypothesized. Record yourresponse as your “conclusions.” (Hint: Yourconclusion could be in the form of a question.)b. If your earlier choice was refuted, can you nowpropose a new explanation? If so, record itunder “Hypothesis 2” on your worksheet. Ifnot, do not worry. Steps 7-9 may help you.7. Use Questions 7a and 7b to help you find a newexplanation:a. Examine each instance where the trait is passedto offspring. What do you observe about thesource of the inherited trait?b. Mendelian genetics assumes that in all caseseach parent contributes equally to the genotypeof the offspring. Do the data shown inPedigrees I and J demonstrate this idea?Modify your conclusions or propose a new hypothesisif your ideas have changed.As a final attempt to build a new explanation, useQuestions 8 and 9 to guide your thinking. When youhave recorded your best explanation, continue tothe Analysis. (Your explanation may be incomplete.What is important is that you justify your reasoningwith evidence.)8. Could the inheritance of an allele carried on the Xor Y chromosome explain the pattern of inheritancein Pedigrees I and J? Explain your response.9. Consider the four patterns of inheritance in Figure2-2. What do they assume about the location ofgenetic material in the cell?a. In humans, sperm cells and egg cells transmitgenetic information to offspring. How do thesecells differ?b. In addition to a complete set of chromosomes(46), what does the developing zygote need togrow and develop? (Hint: What structures arein the cytoplasm?)ANALYSIS1. Read the two articles your teacher distributes.What bearing does the information in the articleshave on your explanation of Pedigrees I and J?2. What lasting scientific knowledge about inheritancedid you use in this activity?3. What new explanations for inheritance did youuse in this activity?4. What methods of science did you use in thisa c t i v i t y ?176©1997 by BSCS.

Activity 3Clues and Discoveriesin ScienceHow do you know that a new scientific idea is correct?Lots of people have good ideas about how toexplain what they observe in living systems, but agood idea alone is not enough. Scientists constantlyhave to decide whether a new idea is valid, andthey do so by using the requirements of science. Tomeet these criteria, a good idea must be based onlogical reasoning, and it must be tested, preferablymany times and in many different ways. A scientistdraws an idea (hypothesis) from early observ a t i o n sof a problem and then collects evidence to determinewhether the idea is scientifically valid. If thehypothesis seems to be valid, the scientist willshare it with other scientists. They, in turn, mayrepeat the tests to see whether the evidence isreproducible, or they may add new lines of evidencefrom different tests. If enough evidenceaccumulates, the scientific community accepts thehypothesis as valid and it becomes part of theestablished body of scientific knowledge. In simplet e rms, people then refer to the new idea as part of“what they know about genetics.”This approach to building an explanation for a naturalprocess sounds fairly simple, but it can be complicated.For example, how do you tell the differencebetween discovery of a new process andmisinterpretation of data? Such a debate arose ingenetics among people who studied two inheriteddisorders, Huntington disease (HD) and myotonicdystrophy (DM). In this activity, you will step intothe shoes of the scientists involved in this debateand use the requirements of science to follow theh i s t o ry of this intriguing investigation. Read thedescriptions of HD and DM in Figures 3-1 and 3-2 ifyou are not familiar with these disorders.PROCEDUREPart I: Identifying the Mystery1. The dialogue below takes you back in history to1957. Read the dialogue and then answer Questions1a-1e.Note that in this dialogue we use the term “chorea”;this name for HD was the common term used in the1950s.The year is 1957. This dialogue ispart of a discussion that mighthave taken place between a physicianand a geneticist; we will callthem Dr. A. and Dr. B. As you readtheir discussion, think about whythey have different views.Dr. A: “I’ve been seeing a patient named Allen whomay have Huntington’s chorea. If so, I thinkhe is a good example of genetic anticipation.”177

Activity 3 ■ Clues and Discoveries in ScienceDr. B: “You mean that this disease runs in his family,but is showing up at an earlier age in Allenthan it did in his parents or grandparents?”Dr. A: “ E x a c t l y. Allen is only 40, and already he hass h o rt periods of memory loss and suddenproblems with awkward movement of hislegs. When I interviewed him, I learned thathis mother died when she was 65, but, startingat age 55, people who knew her said shewas a bit ‘odd’ in her thinking. She spenther last five years in a wheelchair, sufferingfrom severe muscle and movement problems.She appeared to have Huntington’schorea.”Dr. B: “But that doesn’t prove that genetic anticipationis a real phenomenon. What do youknow about Allen’s maternal grandparentsand great-grandparents?”Dr. A: “Not much. His mother’s mother died whenshe was very young, during childbirth, so allwe know is that she did not show signs ofHuntington’s chorea up to the age of 24.Allen’s grandfather lived to be about 70, butAllen knew nothing about his general health.But you k n o w geneticists have report e dcases of anticipation for years. What about Dr.Bell’s discussion of it in her 1947 publicationin The Treasury of Human Inheritance? Shemakes a good argument for genetic anticipationin another genetic disease, myotonicdystrophy.”D r. B: “You mean her mention that patients in an earliergeneration of a known pedigree generallyhad only mild symptoms, such as cataracts,when they were middle-aged, while — ”Dr. A: “— while their children and grandchildrenhad muscle wasting and mental illness, moresevere in each subsequent generation — anexample of genetic anticipation.”D r. B: “(Laughing) Perhaps. But you haven’t mentioneda different publication from that year,the one by that geneticist Penrose. He mentionsBell’s work and reports from other geneticists,but he points out that simple MendelianFigure 3-1 Huntington Disease (HD): Summary of SymptomsHuntington disease came to public attention in the 1940s when the well-known folk singer Woody Guthrie began to showsymptoms of this fatal genetic disorder. Huntington disease received notoriety again in the 1980s and early 1990s whenresearchers, including Dr. Nancy Wexler, hunted for and located the mutant gene that causes HD. Dr. Wexler caught the public’sinterest in part because she had a direct and personal concern with this genetic killer: her mother died of Huntington disease,so Dr. Wexler knew she was at risk.HD is inherited as an autosomal dominant disorder. It is rare, occurring at a frequency of about 1/20,000 in Western countriesand less often in Asia and elsewhere. The onset of symptoms generally occurs in adulthood, but the age varies among individualsand between generations of affected people. The disease involves neurological function, and early symptoms includetwitchy muscles, awkwardness of movement, and memory dysfunction. Eventually symptoms become severe, and deathresults. The gene is located on chromosome 4.Figure 3-2 Myotonic Dystrophy (DM): Summary of SymptomsMyotonic dystrophy is a fairly rare inherited human disorder that occurs in 1/8000 Caucasians and even less frequently inother groups. DM shows a large degree of variability in the type and severity of symptoms. The age of onset may vary fromone family member to another of those affected. In its mildest forms, DM leaves the individual asymptomatic until late in adulthood.Then it may show up only as cataracts on the eyes, which affect vision. Because cataracts are not uncommon in elderlypeople, many individuals with extremely mild DM symptoms may not realize they have inherited this disorder. (Conversely, justbecause a relative of yours has had cataracts, do not assume that DM occurs in your family.)More serious symptoms include muscle abnormalities such as a breakdown of muscle tissue and the inability to relax a muscleafter it has been contracted. Other symptoms involve damage to the heart or the sexual organs (gonads). Some individualswho have inherited DM show mental retardation as children. A less severe form results in unusual drowsiness and inattentivenessin adults.Myotonic dystrophy is inherited as an autosomal dominant disorder. The gene is located on chromosome 19.©1997 by BSCS.178

Clues and Discoveries in Science ■ Activity 3inheritance of a dominant characteristic won’tresult in the increasing problems of the diseasein children and grandchildren of someone whohas the disease gene.”Dr. A: “Then how do you explain the observedanticipation?”D r. B: “I don’t, at least, not yet. It may be an error ino b s e rvation. Besides, I would need moredata.”References:J. Bell (1947), Dystrophia myotonica and allied disease,in The Tr e a s u ry of Human Inheritance IV. N e rvous diseasesand muscular dystrophies, vol 5, p. 343; and L.S.Penrose (1947), The problem of anticipation in pedigreesof dystrophia myotonica, Annals of Eugenics14:125-132.Think about the dialogue as you respond to thesequestions.a. What is genetic anticipation?b. Why does Dr. B. want more data?c. Dr. B. refers to “an error in observation.” Howmight such an error arise? What could be doneabout it?d. What have you learned about dominant inheritance?Why is genetic anticipation n o texplained by this genetic concept?e. What else could be done to solve this mystery?Part II: Gathering Clues to the MysteryThe year is 1977. You have collectedinterview data from many ofthe members of Allen’s family. Usewhat you know from the dialogueand from this new case-historyinformation to answer the ChallengeQuestions in Figure 3-3.2. Each team has different clues obtained from casehistories. You only have a few minutes to consideryour team’s clues before you pool your informationwith that from other teams.3. Follow your teacher’s instructions about how toreport your preliminary findings.Figure 3-3 Challenge QuestionsScientists had to think about genetic anticipation in severalsteps. They needed to break the problem intoaddressable questions.■ What evidence do you have to support or refute theexistence of genetic anticipation?■ Do you have evidence that supports a possible explanationfor the genetic mechanism that causes anticipation?If yes, explain.4. What does this evidence tell you about the ChallengeQuestions in Figure 3-3 (if anything)?Now the year is 1997. Molecularbiologists have devised a test toidentify the mutant gene for HDand to determine some of its specialproperties. In addition, manyof the family members have had thetest; in some cases blood samples stored from older,deceased members were tested. Your teacher willsupply you with an article that describes the newmolecular test for HD and the results of this testwhen performed on the members of Allen’s family.5. Read the article and record the information fromthe HD molecular clues on your HD pedigree.Report this information to the class when yourteacher instructs you to do so.6. Why does each person tested have two repeatnumbers?7. Using this new evidence, once again address theChallenge Questions in Figure 3-3.8. One of the strengths of a good scientific explanationis that it is supported by multiple lines of evidence.Use a set of clues for a different family tolook for additional evidence that supports youranswers to the preceding questions.Part IV: Discovering the Historyof Genetic AnticipationThe sequence of discovery demonstrated by theclues you used reflects the history of discovery about179©1997 by BSCS.

Activity 3 ■ Clues and Discoveries in Sciencegenetic anticipation. Use the brief scenes (vignettes)that your teacher will give you to build a more completepicture of the history of discovery about HDand genetic anticipation. As you read, try to determineat what point in the sequence the opening dialoguebetween the fictitious Drs. A. and B. mighthave taken place. What additional vignettes mightfollow these in the future?9. Read the vignettes and discuss with your teammateswhat they tell you about the history of ourunderstanding of HD.10. As a team, draw up a brief outline of the historyof discovery about HD.11. Individually, write a new vignette that representswhat you predict may be the next level of discoveryabout HD.1 2 .After you complete the vignette, explain the aspectsof science on which you based your predictions.ANALYSIS1. What is the relationship between the number oftrinucleotide repeats in the mutant HD or DMgene and the resulting phenotype?2. How does what you know about genetic anticipationcontrast with the traditional, Mendelian viewof autosomal dominant inheritance?3. How have you used the methods of science in thisactivity?4. Write a vignette (brief scene or part of a story)about the future health of Peter, Cathy, and Sean.Use your case-history data and the article you readto support your description.180©1997 by BSCS.

Activity 4Should TeenagersBe Tested for theMutant HD Gene?How should you go about making good choicesabout important issues in life? Should you base yourdecisions on a whim, a coin toss, or a call to a psychichot line? Or should you rely on well-informed, wellreasonedanalysis? Scientific reasoning is a disciplinedway to understand events in the naturalworld. Similarly, a discussion of ethical issues bringsreason and discipline to decisions that involve preferencesbased on values. We draw our values frommany sources, including history, law, religion, andfamily. Part of the task of ethics is to identify thesevalues clearly and to show why others should regardthem as important. A discussion of ethical issues mayapply to what we do as individuals or to how publicpolicy is made. In this activity, you will use the principlesof sound decision-making and ethics to decidewhether a policy that excludes teenagers from genetictesting is a good public policy.PROCEDUREPart I: Identifying the Issue1. People often express their opinions or concernsthrough a letter to the editor of a newspaper. Readthe letter shown in Figure 4-1.2. Assume that a change in policy would give parentsthe right to request an HD test for a person who isunder 18 years of age. Decide whether you thinkthe policy of not testing minors should stand or bechanged. Register your vote when your teacherpolls the class.Part II: Using Ethical Decision-making3. Form teams as directed by your teacher to conducta discussion of the ethical issues in the letter.Regardless of your personal opinion on this issue,work with your team to draw up two lists ofopposing ideas about this policy, using the worksheetprovided by your teacher. In the left column,list reasons the current policy is good. In theright column, list reasons the policy shouldchange or why the new policy is better. Record allof your team’s ideas.4. Present your team’s ideas to the class. Add notesto your own worksheet of new ideas that ariseduring the discussion with other teams.5. Consider the discussion of ethical issues performedby the class and vote again: Is the currentpolicy good and worth maintaining, or should itbe changed so that parents of minors at risk forHD can have their children tested?181

Activity 4 ■ Should Teenagers Be Tested for the Mutant HD Gene?Figure 4-1 Letter to the editor of a city newspaperANALYSIS1. Given that there is no treatment at present for HD,how does acquiring scientific evidence about thepresence or absence of the HD mutation (from agenetic test) change the discussion of the issue?2. What additional social and ethical issues mightnew knowledge in genetics raise?3. As a homework assignment, write a response toJean W.’s letter. You might let her know whetheryou would choose to be tested, and why. In yourletter, describe what scientific evidence from agenetic test will tell you and how that informationaffects your choice. In addition, show how the discussionof ethical issues that your class conductedhas influenced your ideas.182©1997 by BSCS.

Activity 5What Do We Know?How Do We Know It?“They say getting too much sun cangive you cancer.”Who are “they”? Should you believe what “they” say,and, if so, should you change your behavior in anyway?All of us must assume responsibility for making decisionsthat affect us and others, but this responsibilitydoes not guarantee that we will make good decisions.That skill requires lots of practice and carefulreasoning, and it requires intelligent analysis of information.For health-related comments, such as thepreceding quote, you should consider the scientificvalidity of the statement to determine whether youthink the statement is reliable. Even if you decidethat it is reliable, the choice of what to do about itstill remains yours. (Is having a tan or relaxing in thesunlight worth the risk of getting skin cancer? Howcan you reduce the risk?) Whatever you decide, theability to determine the scientific validity of a popularclaim is a valuable skill for any person.As you work through this last activity, you will evaluatewhat you have learned in the previous activities.PROCEDUREPart I: Critique of Popular Media TopicsYou are going to critique claims from the popularpress for their scientific validity.1. Recall from the previous activities the requirementsof a good scientific explanation and listthem.2. Join your team and look at the articles the teammembers have collected. Choose one to presentto the class. Discuss the reasons the article gives(if any) to support the claim being reported. (Beprepared to list the idea from the article and togive supporting evidence, if any, on a chart in theclassroom. You have 5-10 minutes to prepare.)3. When your teacher gives the signal, move withyour team to one chart and quickly list the claim183

Activity 5 ■ What Do We Know? How Do We Know It?from your team’s article and indicate the source.Next show why this claim is supposed to be correct,according to the article. Spend only 2 minutesat this task.4. Move with your team to the next chart. Read theideas listed by the previous team and critiquethis claim for its scientific validity. You have 3m i n u t e s .Part II: AnalysisRespond to the following questions as the class discussesthe charts.1. What is the difference between a belief and an explanationthat meets the requirements of science?2. Based on the information presented on thecharts, are any of the claims scientifically valid?3. How could your actions be influenced by knowingwhether a claim is scientifically valid?4. Many health or science claims have significance insociety because they are popular; that is, theyhave emotional appeal for many people. Howwould the work of scientists be different if scientificexplanations were voted upon for popularityrather than held up to the scientific standards discussedin this module?Part III: AssessmentRespond to the following questions or assignmentsaccording to your teacher’s instructions.1. Recall your experiences from the module as youanswer the following questions:a. What does science try to do?b. How do we know that our scientific explanationsare on the right track?c. What counts as evidence in science?d. What makes science objective?e. How and why does scientific knowledge change?f. What is the difference between pseudoscienceand science?2. The previous activities used genetics examples toshow how science works.a. What genetics concepts did you discuss in thismodule?b. Were any of the genetics concepts you listednew to you? Identify them and indicate theirrelationship to earlier knowledge.3. How are science and society related? Give at leasttwo examples.4. Your job is to critique two claims that you seereported in popular media. One should be a scienceor health report that you consider to be scientificallyreliable, and the other should be a claimthat you think is not scientifically substantiated.(Remember, a claim could be based on a correctidea but reported poorly, making the report scientificallyunsound.)184©1997 by BSCS.

NONPROFIT ORG.U.S. POSTAGEPA I DCOLO. SPGS., CO.PERMIT NO. 461INNOVATIVE SCIENCE EDUCATION SINCE 19585415 Mark Dabling Blvd.Colorado Springs, CO 80918-3842ADDRESS CORRECTION REQUESTEDRETURN POSTAGE GUARANTEEDFREE - A monograph for the biology classroom(the third genome module from BSCS)The Puzzle of Inheritance:Genetics and the Methods of ScienceContains ■ an extensive Overview for Teachers, including discussion ofmany new discoveries in genetics■ Classroom Activities , with teacher background material,copymasters, and student pages for six activitiesDesigned to ■ provide materials to teach about the nature and methods ofscience; update the content of the genetics curriculum; andprovide professional development for teachersDeveloped by ■ BSCS (Biological Sciences Curriculum Study)Supported by ■ The United States Department of Energy, as part of theHuman Genome Project