Fitting Statistical models to data with many more variables than ...

More documents

Recommendations

Info

Example 2: Perlegen SNP <strong>data</strong>Reference:Whole-Genome Patterns of Common DNA Variation in ThreeHuman Populations.(2005) Hinds et al, Nature (2005).http://genome.perlegen.com/browser/download.html71 individuals ~1.5 million SNPS33 males 23 African Americans38 females 24 European Americans24 Han Chinese
Single Nucleotide PolymorphismsSNPAGCTCCTAAGCTTAAGCTACTAGCTCCTAACCTTAAGCTACTAGCTCCTAAGCTTAAGCTACTAGCTCCTAAGCTTAAGCTACT
Page 2: Talk outline1. Introduction, motiva
Page 5: IntroductionResponse ModellingEach
Page 9 and 10: Some issues1. Artefacts - apparent
Page 11 and 12: Cross validationBoxplotC ross valid
Page 13 and 14: Parameters in the modelsThe models
Page 15 and 16: The prior - special casesk=1 (Lasso
Page 21 and 22: An EM algorithmWant to find (local)
Page 23 and 24: E- step continuedThe conditional ex
Page 25 and 26: CommentsStructure can be used to ma
Page 27 and 28: GeneRave in Action
Page 29 and 30: Êÿëáÿúÿð ÿðàçèñèíä
Page 31: Example 1: St Jude’s Leukaemia da
Page 35 and 36: Data and modelWe fit a sparse “ma
Page 37 and 38: Two SNP race classifierafd0860639
Page 39 and 40: Independent validation of resultsTh
Page 41 and 42: CodeR Library available for downloa

Fitting Statistical models to data with many more variables than ...

Create successful ePaper yourself

Delete template?

Save as template?