FlowChart

Chapter 33.1Observation: BeforeForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master

Chapter 3Observation: AfterForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master 3.2

Chapter 3CRIME SCENE SCHEMATIC with chapter designationsForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master3.3

Chapter 3Evidence TagsForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master3.4

Chapter 3Personal Information File (PIF)Name: Sex : M F Race:Address:Phone number:Email:Weight: Height: Date of Birth: Place:Location of scars: tattoos: piercings:Blood type: Color of hair: Facial hair:Occupation:Company:Pets:Hobbies:Other information:Fingerprints:R. THUMB R. INDEX R. MIDDLE R. RING R. LITTLEL. THUMB L. INDEX L. MIDDLE L. RING L. LITTLEForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master3.5

Chapter 3Name:Date:Matrix: Matching Clues to SuspectsCrime Scene Victim A B C D EFingerprints on glasswaremugcuppapernotematchcigarettebuttchairtablepenBlood on tablecorpseHair from corpseFiber from fabriccorpseSoil from floorShoe impression on floorDNA from mugcigarette buttcupGlass from floorPowder on tableHandwriting from noteInk from noteMatches from floorCigarette buttLipstick from cupN no match; Y a match; NA not availableForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master3.6

Chapter 3Name of Student:Grading Scheme for Expert Witness at Mock TrialType of Case:Date:Dress/Appearance (5 points maximum)Award all 5 points if witness is wearing dress clothes.Score:Comments:General behavior (25 points maximum)Score:Eye contact with questioner and jury (or judge). Sits up straight. Speaks clearly and loudly enoughto be heard by people in the back of the “courtroom.”Comments:Demonstrates expertise (30 points maximum)Score:Is knowledgeable about subjects of expertise. Gives clear, concise, scientifically correct answers toquestions.Comments:Responsiveness (30 points maximum)Score:Answers questions asked. Does not volunteer extra or extraneous information. Does not argue withquestioner. Does not become flustered.Comments:Effective use of demonstrative evidence (10 points maximum)Score:Do not award any points if “lawyers” do not call for demonstrative evidence to be used. Make a notebelow and grade the student on a 90-point basis. If no demonstrative evidence was brought into“court,” do not award any points.Comments:Total Score:[An adequate or average performance should earn about 75 points out of 100 total.]Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 3: The Crime SceneBlackline Master3.7

Chapter 4Laboratory Activity 4.110-print CardForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master4.1

Chapter 4Laboratory Activity 4.1Fingerprint Lab Activity: Grading RubricScore 4 3 2 110-PRINT CARDall prints clearand readable8 prints clearand readable5 prints clearand readableall prints on the10-print cardIDENTIFICATIONOF RIDGECHARACTERISTICS2 prints with 12points identified2 prints with 8points identified2 prints with 6points identified2 prints with 4points identifiedLATENT PRINTSLIFTED FROM ADARK SURFACE2 prints clear andreadable with 3points identified1 print clear andreadable with 3points identified1 print clear andreadable3 latent printslifted from a darksurfaceLATENT PRINTSLIFTED FROM ALIGHT SURFACE2 prints clear andreadable with 3points identified1 print clear andreadable with 3points identified1 print clear andreadable3 latent printslifted from a lightsurfaceCHEMICALLYDEVELOPEDPRINTSuse of all 4techniquesuse of 3techniquesuse of 2techniquesuse of 1techniqueRIDGE CHARACTERIS-TICS ON CHEMICALLYDEVELOPED PRINTS2 developedprints, clear andreadable with 3points identified1 developedprint, clear andreadable with 3points identified2 developedprints, clear andreadable1 developedprint, clear andreadableBEST DEVELOPEDPRINT12 pointsidentified8 pointsidentified6 pointsidentified3 pointsidentifiedForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master4.2

Chapter 4Laboratory Activity 4.1Permission LetterDear Parent/Guardian:During the week of, we will be studying fingerprints in Forensic Science. Your son or daughterwill be asked to create a set of prints, lift latent prints from various surfaces, and use physical and chemical techniques todevelop latent prints. Several identification systems will be used to compare fingerprints.The fingerprints will be kept in your student’s notebook. I will not keep or reproduce any of the prints for my records. Dueto state privacy laws, your permission is needed for your son or daughter to participate. Please sign the bottom of this letterand return it to me by .Thank you,I, , give my permission for my son/daughterto participate in the fingerprinting activities in Forensic Science class.DateNote: All fingerprints will be returned to the students or destroyed at the end of this exercise.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master4.3

Chapter 4Name:Date:Figure 4.9Fingerprint MinutiaeForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master 4.4

Chapter 4Figure 4.9Fingerprint Minutiae: AnswersForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master 4.5

Chapter 4Name:Date:Figure 4.12Identification AlgorithmDo these prints match?Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master 4.6

Chapter 4Figure 4.12Identification Algorithm: AnswersForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master 4.7

Chapter 4Checkpoint Question 18Case Study: Madrid Bombings. Comparison of fingerprints.MayfieldPrime suspectForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 4: FingerprintsBlackline Master 4.10

Chapter 4Puzzle 4.1: Answers1 2 3P S IA45 6 7 8LCOM RS9 1011 1213 14 15LEDI OP16 17FOAU2419FEE L I P F TTDT B OI LN EGYLBTLBSW18V E RISIBEMOE T20 21 22LTIAMPD OE RR I D G ERSCO23BM I TUHN CRL OSS URO I CI N U T I AIOL NPAR ERNEN KA RACROSS2 nitrate for use in developing prints on wood5 a fingerprint pattern6 reacts with iodine to form a blue color9 a government agency11 a minutia15 a minutia16 early pioneer in use of fingerprints18 fine structure of ridge characteristics19 number of types of arch20 area of body with distinctive patterns22 used to record fingerprints23 type of loop pattern24 a minutiaForensic Science for High School© Kendall/Hunt Publishing CompanyDOWN1 area of body with ridge patterns3 type of fingerprint4 area of a fingerprint7 subgroup of whorls8 a map of friction ridges9 area of body with ridge patterns10 a minutia12 one-millionth of an inch13 removing a fingerprint from an object14 loop, a whorl17 a minutia18 type of fingerprint21 area of the epidermisChapter 4: FingerprintsBlackline Master 4.12

Chapter 5Checkpoint Question 1Name:Date:Hair Examination FormTable B5.1 Human Hair Examination and Comparison FormCase Number or Name: _______________________________ Date: ______________Examined by: __________________________________________________________Known Hair of: ____________________ Sex: _____ Race: _____________ Age: ____Known Samples Taken by: _____________________________ Date: _____________Questioned Hair Found: __________________________________________________Found by: __________________________________________ Date: ______________Characteristic Known Questioned The Same? Y or NI. Type (human, animal)notes:II. Colornotes:III. Body Locationnotes:IV. Tip Condition (frayed, cut,etc.)notes:V. Lengthnotes:Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 5: HairBlackline Master 5.1a

Chapter 5Checkpoint Question 1Name:Date:Characteristic Known Questioned The Same? Y or NVI. Shaft Diameter (at root, tip,etc.)notes:VII. Configuration (wavy,straight, etc.)notes:VIII. Root (bulbous, absent,sheathed, etc.)notes:IX. Cross Section (round, oval,etc.)notes:X. Medulla (continuous, none,etc.)notes:XI. Medullary Indexnotes:XII. Scale Pattern (imbricate,etc.)notes:Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 5: HairBlackline Master 5.1b

Chapter 5Checkpoint Question 1Name:Date:Characteristic Known Questioned The Same? Y or NXIII. Cosmetic Treatment(bleached, dyed, etc.)notes:USE DRAWINGS AND NOTES TO FILL OUT THIS TABLE AND SUPPORT YOUR CONCLUSIONS.REMEMBER, YOU MAY HAVE TO USE THIS IN COURT TO REFRESH YOUR MEMORY OR TOSUBMIT AS EVIDENCE.Case Number or Name: __________________________________________________Date of Examination: ____________________________________________________Conclusions:Signature of Examiner: ___________________________________________________Hair Evidence Information:1. Label on known hair samples: _________________________________________2. Label on questioned hair samples: _____________________________________Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 5: HairBlackline Master 5.1c

Chapter 5Name:Date:Puzzle 5.1ACROSS4 found in hair root7 the part of the hair in the follicle8 a hair configuration9 key to solving the Ross case10 the inner portion of a hair12 possible evidence15 hair from epidermis to top16 important property of animal hairs18 protein polymer common to hair19 chemical by-product in the bodyDOWN1 tough outer layer of hair shaft2 a tip condition3 a cross section5 found in Napoleon’s hair6 cosmetic treatment9 telogen hair ends11 commonest stage of hair growth13 possible cause of deafness14 a hair configuration17 that part of a hair containing fusiForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 5: HairBlackline Master 5.2

Chapter 5Puzzle 5.1: AnswersCFUODNABR O O T W A V YRAIASYC B L A N K ETLEAELUNCDME D U LLAIHBNCLUEKS H AFTEDM I CGANOEDKYE R A T I NTMEXT A B O L I T EACROSS4 found in hair root7 the part of the hair in the follicle8 a hair configuration9 key to solving the Ross case10 the inner portion of a hair12 possible evidence15 hair from epidermis to top16 important property of animal hairs18 protein polymer common to hair19 chemical by-product in the bodyDOWN1 tough outer layer of hair shaft2 a tip condition3 a cross section5 found in Napoleon’s hair6 cosmetic treatment9 telogen hair ends11 commonest stage of hair growth13 possible cause of deafness14 a hair configuration17 that part of a hair containing fusiForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 5: HairBlackline Master 5.3

Chapter 66.1Name:Date:Teacher Demonstration 6.1: Preparation of Nylon 66Advance PreparationYou could use this as a lab for the class; each lab groupwould receive a set of materials.You will need a 50-ml beaker and copper wire for a hook.You can also get the student engineer types to construct a rollercopper hookon which to wind the nylon filament as it is produced. You canpurchase hexamethylene diamine and adipoyl chlorideseparately for just such a demonstration from Flinn Scientific,collapsed filmP. O. Box 219, Batavia, IL 60510; (800) 452-1261; www.flinnsci.com. Flinn also sells a demonstration kit of the two chemicalsolutions (AP2088). When through, mix both layers well, pullout the remaining nylon, wash it, throw it away, and pour theliquid into a waste container. If you have a hood or a wellventilatedarea, let the liquid evaporate away. The aminesolution is slightly corrosive to the skin; the chloride solutionis flammable and corrosive and has a bit of a smell.Preparation of NylonOne set for demonstration:safety goggles 5M NaOH 5% adipoyl chloride in hexane5% hexamethylene diamine in water 50-ml beaker 6˝ copper wirepaper towels1. Pour 10 ml of a 5 percent aqueous solution of hexamethyleneOBOBdiamine into a 50-ml beaker.HOCOCH 2 OCOH NH 2 OCH 2 ONH 46 22. Add 10 drops of the 5M sodium hydroxide solution used in theAdipic acid Hexamethylenediaminechemical tests.O O H HB B A A3. Carefully add 10 ml of the adipoyl chloride in hexane to theOCOCH 2 OCONOCH 2 ONO4 6 nsolution by pouring it down the wall of the slightly tilted beaker.Nylon-66Two layers will form (see figure), and there will be an immediateformation of a polymer film at the liquid–liquid interface.4. Using a copper wire hook (a 6-in. piece of wire bent at one end), gently free the walls of the beaker frompolymer strings. Then hook the mass at the center and slowly raise the wire so that polyamide formscontinuously, producing a strand that can be drawn out for many feet or wound on a makeshift roller.Work carefully; you can break the thread by pulling it too fast.5. Rinse the polymer several times with water and lay it on a paper towel to dry.When you are finished making nylon strands, vigorously stir the remainder of the two-phase system toform additional polymer. Decant the liquid into a waste container; do not discard it in the sink. Wash thenylon thoroughly with water and allow it to dry. You can discard it as normal solid waste.The final product can be colored by adding 1 ml of methyl red, or methyl orange, or bromocresol greento the aqueous amine.Forensic Science for High School© Kendall/Hunt Publishing Companydiacid chloridein organic solventpolyamide film formingat interfacediamine in waterChapter 6: FibersBlackline Master

Chapter 6Name:Date:Laboratory Activity 6.5Table B6.1: Burn Test ResultsFIBERcottonBEHAVIORNEARINGFLAMEBEHAVIOR INFLAMEBEHAVIORREMOVEDFROM FLAMEODORASH ORRESIDUElinensilkwoolacetateacrylicnylonpolyesterrayonolefinfiberglassunknownForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master 6.2

Chapter 6Laboratory Activity 6.5Burn Test Results: AnswersFIBERBEHAVIORNEARINGFLAMEBEHAVIOR INFLAMEBEHAVIORREMOVEDFROM FLAMEODORASH ORRESIDUEcottonscorches, lightseasilyyellow, smokycontinues toburn, glowsburning paperlight gray,feathery ashlinenscorches, lightseasilyyellow, smokycontinues withafterglowburning papergray, featheryashsilksmolders, thenburnsmelts andsputtersgoes out easily burning hair black, shinybeadswoolsmolders, slowto catchsizzles as itburns, curlsgoes out easily burning hair crisp, dark ashacetatefuses away fromflame, blackenslights easily,flickers, meltscontinues toburn, smallsparks, dripsvinegar, burningwoodblack, hard,irregularlyshaped beadsacrylicfuses, shrinksawayflares, puckers,meltscontinues toburn and melt,sputtersacrid, fruitybrittle, hard,black beadsnylonfuses, shrinksawayburns slowly,drips, whitesmokedies out celery hard, round,grayish beadspolyesterfuses, shrinksawayburns slowly,meltsburns slowly,sooty smoketarhard, round,black beadsrayonscorches, lightseasilyburns fast,yellow flamecontinues toburn, no glowburning paperlight gray,feathery asholefinmelts, shrinksawayburns, yellowflameslowly dies outwax (pe),diesel fuel (pp)fused plasticfiberglasscoating burnsoffno reaction no reaction no odor may fuse solidunknownForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master 6.3

Chapter 6Name:Date:Laboratory Activity 6.6Table B6.2: Thermal Decomposition ResultsFABRIC LEAD ACETATE RED LITMUS BLUE LITMUS RESIDUE OTHERcottonlinensilkwoolacetateacrylicnylonpolyesterrayonolefinfiberglassunknownForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master 6.4

Chapter 6Laboratory Activity 6.6Thermal Decomposition Results: AnswersFABRIC LEAD ACETATE RED LITMUS BLUE LITMUS RESIDUE OTHERcottonno change no change turns red light gray ashlinenno change no change turns red fine gray ashsilkwoolacetateacrylicbrown black turns blue no change melts and fusestogetherbrown black turns blue no change black, hollowbeadsno change no change turns red irregular blackbeadsno change no change no change black gunknylonpolyesterno change turns blue no change sticky, thenhardens to beadno change no change turns red dark beadsrayonno change no change no change black tar, no asholefinno change no change no change black meltfiberglassno change no change no change no changeunknownForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master 6.5

Chapter 6Name:Date:Laboratory Activity 6.7Table B6.3: Chemical TestsFIBER ACETONE NaOCl NaOH HCl H 2SO 4cottonlinensilkwoolacetateacrylicnylonpolyesterrayonolefinfiberglassunknownIn blends, the warp or woof only may dissolve. Note which one because that can be a significant characteristic.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master 6.6

Chapter 6Laboratory Activity 6.7Chemical Tests: AnswersFIBER ACETONE NaOCl NaOH HCl H 2SO 4cottonno change no change no change no change no changelinenno change no change no change no change no changesilkno change dissolves no change no change no changewoolacetateacrylicno change dissolves yellow,disintegratestranslucent,disintegratesno changeno changeno change no change no change no changeno change no change may yellow no change no changenylonpolyesterno change no change no change shriveled up disintegrateswhite pptno change no change no change no change no changerayonno change no change may swell no change no changeolefinno change no change no change no change no changefiberglassno change no change no change no change no changeunknownIn blends, the warp or woof only may dissolve. Note which one because that can be a significant characteristic.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master6.7

Chapter 6Teacher Demonstration 6.2: FluorescenceAdd 500 ml of tonic water to a 600-ml beaker. Place a white background below and behind the beaker toaccentuate the color (or lack of) of the solution. Darken the room completely. Shine a black light on thesolution. It will fluoresce blue because of the quinine it contains.In more advanced classes, this can lead to an explanation of transmittance, absorption, emission, andexcitation at different wavelengths of light. (This is touched upon in Chapter 7 in the spectrophotometricanalysis of aspirin.)A further demonstration of these phenomena is taken from Flinn’s Chem Fax, Publication #10218 (FlinnScientific, www.flinnsci.com).1. Place the tonic water in one 600-ml beaker2. Add 15 ml of 1% fluorescein solution to a second 600-ml beaker and dilute to 500 ml with distilledwater. This will appear yellow-green.3. Add 5 ml 1% eosin Y solution to a third 600-ml beaker and dilute to 500 ml with ethyl alcohol. Thiswill appear yellow-orange.4. Add 1 ml of 1% rhodamine B solution to a fourth 600-ml beaker and dilute to 500 ml with distilledwater. This will appear pinkish-red.Place the four beakers in a row with a white background below and behind. With the room darkened, shinethe black light on the beakers. They will all fluoresce, but at colors different from those seen under whitelight. All the solutions can be safely flushed down the drain.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master 6.8

Chapter 6Laboratory Activity 6.11Procedure for Making Your Own TLC Plates1. Grind together with a mortar and pestle fine-mesh silica gel with about 10% plaster of paris. Add a littlezinc sulfide if you want it to fluoresce under UV light.2. Add about twice as much water and shake vigorously to make a slurry.3. Spread evenly on a glass or rigid aluminum or plastic sheet, at least 1 inch by 3 inches. A large syringe,without needle, can be used to spread the slurry evenly over the substrate. Then, vibrating or shaking itgently will even out the slurry even more. With some practice, running a knife edge across the plate canalso produce a uniform thickness, which should be 0.1–0.25 mm. It is important to have the samethickness on all the plates, otherwise R fvalues may vary.4. Let the plates air-dry overnight, then activate them in an oven at 110–120°C for 30–45 minutes.5. When you no longer need the used plates, scrape the silica into a bag or other container and discard assolid waste. Reuse the backing for the next batch of TLC plates.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 6: FibersBlackline Master6.9

Chapter 7Appendix ASCHEDULES OF CONTROLLED SUBSTANCESSchedule I—Substances that have no accepted medical use in the U.S. and have a high abuse potential. May not be prescribed.Schedule II—Substances that have a high abuse potential with severe psychic or physical dependence liability. Schedule IIcontrolled substances consist of certain narcotic, stimulant, and depressant drugs. Prescriptions must be written in ink ortypewritten and signed by the practitioner except in a genuine emergency, in which case written confirmation within 72 hours isrequired. No renewals.Schedule III—Substances that have an abuse potential less than those in Schedules I and II, including compounds containinglimited quantities of certain narcotic and non-narcotic drugs. Prescriptions may be oral or written, and up to 5 renewals arepermitted within 6 months.Schedule IV—Substances that have an abuse potential less than those in Schedule III. Prescriptions may be oral or written, andup to 5 renewals are permitted within 6 months.Schedule V—Substances that have an abuse potential less than those in Schedule IV. Controlled substances consist ofpreparations containing limited quantities of certain narcotic drugs generally for antitussive and antidiarrheal purposes. Thesedrugs are subject to state and local regulation and a prescription may not be required.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master7.1

Chapter 7Appendix BFEDERAL TRAFFICKING PENALTIES: MARIJUANADescription Quantity 1st Offense 2nd OffenseMarijuanaMarijuana1, 000 kg ormore mixture;or1,000 ormore plants.100 to 999 kgmixture;or100 to 999plants.• Not less than 10 years,Not more than life.• If death or serious injury,Not less than 20 years,Not more than life.• Fine not more than $4 million individ ual,$10 million other than individual.• Not less than 5 years,Not more than 40 years.• If death or serious injury,Not less than 20 years,Not more than life.• Fine not more than $2 million individ ual,$5 million other than individual.• Not less than 20 years,Not more than life.• If death or serious injury,Not more than life.• Fine not more than $8 millionindividual,$20 million other than individual.• Not less than 10 years,Not more than life.• If death or serious injury,Not more than life.• Fine not more than $4 millionindividual, $10 million other thanindividual.Marijuana50 to 99 kgmixture;or50 to 99 plants.• Not more than 20 years.• If death or serious injury,Not less than 20 years,Not more than life.• Fine $1 million individual,$5 million other than individual.• Not more than 30 years.• If death or serious injury,Not more than life.• Fine $2 million individual,$10 million other than individual.MarijuanaHashishLess than 50 kgmixture10 kg or more• Not more than 5 years.• Fine not more than $250,000 individual,$1 million other than individual.• Not more than 10 years.• Fine $500,000 individual,$2 million other than individual.Hashish Oil1 kg or more*Marijuana is a Schedule I controlled substance.*Includes hashish and hash oil.www.usdoj.gov/dea/concern/abuse/chap1/penal/chart2.htmForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master 7.2

Chapter 7Appendix C: Federal Trafficking PenaltiesCSA2ndOffense1stOffenseQuantity Drug Quantity1stOffense2ndOffenseIandII• Not less than10 years,Not morethan life.• If death orserious injury,not less thanlife.• Fine of notmore than$4 millionindividual,$10 millionother thanindividual.• Not less than5 years,Not morethan40 years.• If death orserious injury,not less than20 years, ormore thanlife.• Fine of notmore than$2 millionindividual,$5 millionother thanindividual.10–99 g pureor 100–999 gmixture100–999 gmixture500–4,999 gmixture5–49 gmixture10–99 g pureor 100–999 gmixture1–9 gmixture40–399 gmixtureMethamphetamineHeroinCocaineCocaine BasePCPLSDFentanyl100 g or morepure or 1 kg ormore mixture1 kg or moremixture5 kg or moremixture50 g or moremixture100 g or morepure or 1 kg ormore mixture10 g or moremixture400 g or moremixture• Not less than10 years,Not morethan life.• If death orserious injury,not less than20 years, ormore thanlife.• Fine of notmore than$4 millionindividual,$10 millionother thanindividual.• Not less than20 years,Not morethan life.• If death orserious injury,not less thanlife.• Fine of notmore than$8 millionindividual,$20 millionother thanindividual.10–99 gmixtureFentanyl Analogue100 g or moremixtureDrugQuantity1st Offense2nd OffenseOthers(Law does notinclude marijuana,hashish, or hashoil.)Any• Not more than 20 years.• If death or serious injury, not less than20 years, not more than life.• Fine $1 million individual,$5 million not individual.• Not more than 30 years.• If death or serious injury, life.• Fine $2 million individual, $10 million notindividual.IIIAll (Includesanabolicsteroids as of2-27-91.)Any• Not more than 5 years.• Fine not more than $250,000 individual,$1 million not individual.• Not more than 30 years.• If death or serious injury, life.• Fine $2 million individual, $10 million notindividual.IV All Any• Not more than 3 years.• Fine not more than $250,000 individual,$1 million not individual.• Not more than 30 years.• If death or serious injury, life.• Fine $2 million individual, $10 million notindividual.V All AnySource: www.usdoj.gov/dea/concern/abuse/chap1/penal/chart1.htmForensic Science for High School© Kendall/Hunt Publishing Company• Not more than 1 year.• Fine not more than $100,000 individual,$250,000 not individual.• Not more than 30 years.• If death or serious injury, life.• Fine $2 million individual, $10 million notindividual.Chapter 7: DrugsBlackline Master 7.3

Chapter 77.4Appendix D: Infrared Spectra100TRANSMITTANCE|%|50caffeine04000 3000 2000 1500WAVE NUMBER|-1|1001000 500TRANSMITTANCE|%|TRANSMITTANCE|%|50100ephedrine04000 3000 2000 1500 1000 500WAVE NUMBER|-1|50100amphetamine04000 3000 2000 1500 1000 500WAVE NUMBER|-1|TRANSMITTANCE|%|50ibuprofen04000 3000 2000 1500 1000 500WAVE NUMBER|-1|Source: SDBSWeb: http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of Advanced Industrial Science and Technology, 2005)Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master

Chapter 7Appendix D, continued100TRANSMITTANCE|%|50acetaminophenTRANSMITTANCE|%|04000 3000 2000 1500WAVE NUMBER|-1|100501000 500phenobarbital04000 3000 2000 1500 1000 500WAVE NUMBER|-1|100TRANSMITTANCE|%|50barbital04000 3000 2000 1500 1000 500WAVE NUMBER|-1|100TRANSMITTANCE|%|50cocaine04000 3000 2000 1500 1000 500WAVE NUMBER|-1|Source: SDBSWeb: http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of Advanced Industrial Science and Technology, 2005)Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master 7.5

Chapter 7Appendix D, continued100TRANSMITTANCE|%|50quinine04000 3000 2000 1500WAVE NUMBER|-1|1001000 500TRANSMITTANCE|%|TRANSMITTANCE|%|50methamphetamine04000 3000 2000 1500 1000 500WAVE NUMBER|-1|10050phencyclidene (PCP)04000 3000 2000 1500 1000 500WAVE NUMBER|-1|100TRANSMITTANCE|%|50aspirin04000 3000 2000 1500 1000 500WAVE NUMBER|-1|Source: SDBSWeb: http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of Advanced Industrial Science and Technology, 2005)Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master 7.6

Chapter 7Appendix E: Mass SpectraRelative Intensity10080604020caffeineO BH NO K N ANNDRelative Intensity01008060402020 40 60 80amphetamine100 120 140 160 180 200m/zH 2 NO025 50 75m/z100 125 150Relative Intensity10080604020barbitalO NNBOK ON02550 75 100 125 150 175m/zRelative Intensity10080604020aspirinO N E OH OK O020 40 60 80 100 120 140 160 180 200 220 240m/zSource: SDBSWeb: http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of Advanced Industrial Science and Technology, 2005)Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master 7.7

Relative Intensity10080604020H /NH 3 CPCH H HEHO LG HH 3 COO HHOONPOE N E OH050 100 150 200m/z250 300Relative Intensity10080604020acetominophen025 50 75m/zChapter 77.8Appendix E, continuedquinine100 125 150Relative IntensityRelative Intensity10080604020010080604020ibuprofen20 40 60 80ascorbic cacidCOOH100 120 140 160 180 200 220m/zHOHOOHOON O0Forensic Science for High School© Kendall/Hunt Publishing Company2550 75 100 125 150 175m/zSource: SDBSWeb: http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of Advanced Industrial Science and Technology, 2005)Chapter 7: DrugsBlackline Master

Chapter 7Appendix E, continuedRelative Intensity10080604020phenobarbitalO NN KONBORelative Intensity01008060402020 40 60 80N100 120 140 160 180 200 220 240m/zmethamphetamine hydrochloride025 50 75m/z100 125 150Relative Intensity10080604020heroinO KOOOO JN D040 80 120 160 200 240 280 320 360 400m/zRelative Intensity10080604020morphineHO HOHO EN040 80120 160 200 240280m/zSource: SDBSWeb: http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of Advanced Industrial Science and Technology, 2005)Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 7: DrugsBlackline Master7.9

Chapter 7Name:Date:Puzzle 7.11 2 3 45 67 8910 11 12 1314151617 18 192021 22242325 26302927 283132ACROSS2 cocaine7 a unit of measure in mass spectrometry8 what this chapter is all about9 pill dictionary10 a stimulant15 charged particle16 “just say ___”17 reagent for developing salicylates20 a type of medicine22 a Mideastern stimulant25 possible end of a bad trip27 abbreviation for marijuana28 found in a molecule, or James29 a lysergic acid derivative30 an analytical spectroscopy method31 abbreviation for part of the EMS32 reagent used in spot testing 10 acrossForensic Science for High School© Kendall/Hunt Publishing CompanyDOWN1 a hallucinogen2 required for 21 down3 part of the name for a presumptive color test4 Saturday night’s supper or ____5 “Angel ____”6 a common diluent for heroin11 contains oxycodon12 name of a test for 26 down13 abbreviation for an instrument used in confirmatory testing14 type of spectrophotometer18 abbreviation for part of the EMS19 name of a screening test for 27 across21 abbreviation for a separatory technique23 active ingredient of marijuana24 a very small amount26 LSD27 a club drugChapter 7: DrugsBlackline Master7.10

Chapter 7Puzzle 7.1: Answers1 2 3 4914155 67 810 11 12 1317 18 192025 2630P C O KCPIFAD RREROPAI21 22GE29MCE S I32CHO N E HSY R RRR GO I F UN A LR S C EETDEIN EAF T IACDRLS DMMSHLCHDA M U D R U GSP H E T A M I NO2427 28RPPM J B OUENO31A R Q U I SIDQI16QIINEADREO23THCACROSS2 cocaine7 a unit of measure in mass spectrometry8 what this chapter is all about9 pill dictionary10 a stimulant15 charged particle16 “just say ___”17 reagent for developing salicylates20 a type of medicine22 a Mideastern stimulant25 possible end of a bad trip27 abbreviation for marijuana28 found in a molecule, or James29 a lysergic acid derivative30 an analytical spectroscopy method31 abbreviation for part of the EMS32 reagent used in spot testing 10 acrossForensic Science for High School© Kendall/Hunt Publishing CompanyDOWN1 a hallucinogen2 required for 21 down3 part of the name for a presumptive color test4 Saturday night’s supper or ____5 “Angel ____”6 a common diluent for heroin11 contains oxycodon12 name of a test for 26 down13 abbreviation for an instrument used in confirmatory testing14 type of spectrophotometer18 abbreviation for part of the EMS19 name of a screening test for 27 across21 abbreviation for a separatory technique23 active ingredient of marijuana24 a very small amount26 LSD27 a club drugChapter 7: DrugsBlackline Master7.11

Chapter 8Material Safety Data Sheet (MSDS)ARSENIC TRIOXIDE1. Product IdentificationSynonyms: Arsenic (III) oxide; arsenic sesquioxide; arsenous trioxide, white arsenicCAS No.: 1327-53-3Molecular Weight: 197.84Chemical Formula: As2O32. Composition/Information on IngredientsIngredient CAS No Percent Hazardous------------------------------------------------------------------------------------------ArsenicTrioxide 1327-53-3 99–100% Yes3. Hazards IdentificationEmergency Overview--------------------------------------------------------------------------------------------------------------------------------------DANGER! MAY BE FATAL IF SWALLOWED OR INHALED. CANCER HAZARD. CONTAINSINORGANIC ARSENIC WHICH CAN CAUSE CANCER. Risk of cancer depends on duration andlevel of exposure. CAUSES IRRITATION TO SKIN, EYES AND RESPIRATORY TRACT. MAYCAUSE LIVER AND KIDNEY DAMAGE. USE ONLY WITH ADEQUATE VENTILATION ANDRESPIRATORY EQUIPMENT.--------------------------------------------------------------------------------------------------------------------------------------Health Rating: 4—Extreme (Cancer-Causing)Flammability Rating: 0—NoneReactivity Rating: 1—SlightContact Rating: 1—SlightLab Protective Equip: GOGGLES; LAB COAT; PROPER GLOVESStorage Color Code: Blue (Health)--------------------------------------------------------------------------------------------------------------------------------------Potential Health Effects-------------------------------Inhalation:Arsenic may cause inflammation of the mucous membranes with cough and foamy sputum,restlessness, dyspnea, cyanosis, and rales. Symptoms like those from ingestion exposure may follow.May cause pulmonary edema.Ingestion:Arsenic is highly toxic! May cause burning in esophagus, vomiting, and bloody diarrhea. Symptoms ofcold and clammy skin, low blood pressure, weakness, headache, cramps, convulsions, and coma mayfollow. May cause damage to liver and kidneys. A suspected fetal toxin. Death may occur fromcirculatory failure. Estimated lethal dose 120 milligrams.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1a

Chapter 8Skin Contact:May cause irritation, symptoms including redness, itching, and pain.Eye Contact:May cause irritation with itching, burning, watering of eyes; may cause conjunctiva damage.Chronic Exposure:Arsenic on repeated or prolonged skin contact may cause bronzing of the skin, edema, dermatitis,and lesions. Repeated or prolonged inhalation of dust may cause damage to the nasal septum.Chronic exposure from inhalation or ingestion may cause hair and weight loss, a garlic odor tothe breath and perspiration, excessive salivation and perspiration, central nervous system damage,hepatitis, gastrointestinal disturbances, cardiovascular damage, and kidney and liver damage.Arsenic compounds are known human carcinogens and may be teratogenic based on effects inlaboratory animals.Aggravation of Pre-existing Conditions: No information found.4. First-Aid MeasuresInhalation:Remove to fresh air. If not breathing, give artificial respiration. If breathing is difficult, giveoxygen. Get medical attention.Ingestion:Induce vomiting immediately as directed by medical personnel. Never give anything by mouth toan unconscious person. Get medical attention immediately.Skin Contact:Immediately flush skin with plenty of water for at least 15 minutes while removing contaminatedclothing and shoes. Get medical attention immediately. Wash clothing before reuse. Thoroughlyclean shoes before reuse. Contaminated work clothes should be laundered by individuals whohave been informed of the hazards of exposure to this substance.Eye Contact:Immediately flush eyes with plenty of water for at least 15 minutes, lifting lower and uppereyelids occasionally. Get medical attention immediately.Note to Physician:If emesis if unsuccessful after two doses of Ipecac, consider gastric lavage. Monitor urine arsenic level.Alkalization of urine may help prevent disposition of red cell breakdown products in renal tubular cells. Ifacute exposure is significant, maintain high urine output and monitor volume status, preferably withcentral venous pressure line. Abdominal X-rays should be done routinely for all ingestions. Chelationtherapy with BAL, followed by n-penicillamine is recommended, but specific dosing guidelines are notclearly established.5. Fire-Fighting MeasuresFire:Not considered to be a fire hazard. Toxic fumes of arsenic trioxide and arsine may be formed infire situations.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1b

Chapter 8Explosion:Not considered to be an explosion hazard.Fire Extinguishing Media:Use any means suitable for extinguishing surrounding fire.Special Information:In the event of a fire, wear full protective clothing and NIOSH-approved self-contained breathingapparatus with full facepiece operated in the pressure demand or other positive pressure mode.6. Accidental Release MeasuresVentilate area of leak or spill. Wear appropriate personal protective equipment as specified inSection 8. Spills: Sweep up and containerize for reclamation or disposal. Vacuuming or wetsweeping may be used to avoid dust dispersal. US Regulations (CERCLA) require reporting spillsand releases to soil, water and air in excess of reportable quantities. The toll-free number for theUS Coast Guard National Response Center is (800) 424-8802.7. Handling and StorageKeep in a tightly closed container, stored in a cool, dry, ventilated area. Protect against physicaldamage. Isolate from incompatible substances. Wear special protective equipment (Sec. 8) formaintenance break-in or where exposures may exceed established exposure levels. Wash hands,face, forearms and neck when exiting restricted areas. Shower, dispose of outer clothing, changeto clean garments at the end of the day. Avoid cross-contamination of street clothes. Wash handsbefore eating and do not eat, drink, or smoke in workplace. Containers of this material may behazardous when empty since they retain product residues (dust, solids); observe all warnings andprecautions listed for the product.8. Exposure Controls/Personal ProtectionAirborne Exposure Limits:• OSHA Permissible Exposure Limit (PEL): 10 ug(As)/m3 ppm (TWA)• ACGIH Threshold Limit Value (TLV): 0.01 mg(As)/m3 (TWA), listed as A1, confirmed humancarcinogen.Ventilation System:A system of local and/or general exhaust is recommended to keep employee exposures below theAirborne Exposure Limits. Local exhaust ventilation is generally preferred because it can controlthe emissions of the contaminant at its source, preventing dispersion of it into the general workarea. Please refer to the ACGIH document, Industrial Ventilation, A Manual of RecommendedPractices, most recent edition, for details.Personal Respirators (NIOSH Approved):If the exposure limit is exceeded, a half-face high- efficiency dust/mist respirator may be worn forup to ten times the exposure limit or the maximum use concentration specified by the appropriateregulatory agency or respirator supplier, whichever is lowest. A full-facepiece high-efficiencydust/mist respirator may be worn up to 50 times the exposure limit, or the maximum useForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1c

Chapter 8concentration specified by the appropriate regulatory agency or respirator supplier, whichever islowest. For emergencies or instances where the exposure levels are not known, use a full-facepiecepositive-pressure, air-supplied respirator. WARNING: Air- purifying respirators do not protectworkers in oxygen-deficient atmospheres.Skin Protection:Wear impervious protective clothing, including boots, gloves, lab coat, apron or coveralls, asappropriate, to prevent skin contact.Eye Protection:Use chemical safety goggles and/or full-face shield where dusting or splashing of solutions ispossible. Maintain eye wash fountain and quick-drench facilities in work area.Other Control Measures:Any area where inorganic arsenic is stored, handled, used, etc., must be established as a “Regulated Area”with controlled access, limited to authorized persons. Containers of inorganic arsenic and Regulated Areasmust be labeled to show a CANCER SUSPECT AGENT is present. Eating, drinking, and smoking shouldnot be permitted in areas where solids or liquids containing arsenic or lead compounds are handled,processed, or stored. See OSHA substance- specific standard for more information on personal protectiveequipment, engineering and work practice controls, medical surveillance, record keeping, and reportingrequirements. (arsenic: 29 CFR 1910.1018; lead: 29 CFR 1910.1025).9. Physical and Chemical PropertiesAppearance: Transparent crystals, or white powder.Boiling Point: 465C (869F)Odor: Odorless.Taste: TastelessMelting Point: 315C (599F)Solubility: 3.7 g/l00 ml water @ 20C (68F)Very slightly soluble in diethyl ether.Soluble in dilute hydrochloric acid, in alkali hydroxide.Soluble in carbonate solution.Practically insoluble in alcohol.Practically insoluble in chloroform.Soluble in gylcerin.Vapor Density (Air=1): No information found.Specific Gravity: 3.74Vapor Pressure (mm Hg): No information found.pH (1% soln/water): No information found.Evaporation Rate (BuAc=1): No information found.% Volatiles by Volume @ 21C (70F): 0Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1d

Chapter 810. Stability and ReactivityStability: Stable under ordinary conditions of use and storage.Hazardous Decomposition Products: Emits toxic fumes of arsenic when heated to decomposition.Hazardous Polymerization: Will not occur.Incompatibilities: Oxidizers, tannic acid, infusion cinchona and other vegetable astringentinfusions and decoctions, iron solutions, rubidium carbide, chlorine trifluoride, fluorine, hydrogenfluoride, oxygen difluoride, acids, bases, sodium chlorate, zinc filings, other reactive metals andmercury. Corrosive to metals in the presence of moisture.Conditions to Avoid: Incompatibles.11. Toxicological InformationToxicological Data: Oral rat LD50: 14.6 mg/kg; investigated as a mutagen, tumorigen,reproductive effector.Reproductive Toxicity: Has shown teratogenic effects in laboratory animals.12. Ecological InformationEnvironmental Fate: When released into the soil, this material may biodegrade to a moderateextent. When released into water, this material may biodegrade to a moderate extent. Thismaterial is not expected to significantly bioaccumulate.Environmental Toxicity:No information found.13. Disposal ConsiderationsWhatever cannot be saved for recovery or recycling should be handled as hazardous waste andsent to a RCRA approved waste facility. Processing, use or contamination of this product maychange the waste management options. State and local disposal regulations may differ fromfederal disposal regulations. Dispose of container and unused contents in accordance with federal,state and local requirements.14. Transport InformationDomestic (Land, D.O.T.)-------------------------------------------------------------------Proper Shipping Name: RQ, ARSENIC TRIOXIDEHazard Class: 6.1UN/NA: UN1561Packing Group: IIInformation reported for product/size: 500G15. Regulatory InformationFederal and State Regulations:California Prop. 65: This product contains the following ingredients which the State of CaliforniaForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1e

Chapter 8has found to cause cancer, birth defects or other reproductive harm, which would require awarning under the statute: Arsenic trioxideCalifornia Prop. 65: This product contains the following ingredients which the State of California hasfound to cause birth defects which would require a warning under the statute: Arsenic trioxideCalifornia Prop. 65: This product contains the following ingredients which the State of Californiahas found to cause cancer which would require a warning under the statute: Arsenic trioxideConnecticut hazardous material survey: Arsenic trioxideIllinois Chemical Safety Act: Arsenic trioxideNew York release reporting list: Arsenic trioxideRhode Island RTK hazardous substances: Arsenic trioxidePennsylvania RTK: Arsenic trioxideMassachusetts RTK: Arsenic trioxideMassachusetts spill list: Arsenic trioxideNew Jersey: Arsenic trioxideNew Jersey spill list: Arsenic trioxideLouisiana RTK reporting list: Arsenic trioxideLouisiana spill reporting: Arsenic trioxideCalifornia Director’s List of Hazardous Substances: Arsenic trioxideTSCA 8(b) inventory: Arsenic trioxideSARA 302/304/311/312 extremely hazardous substances: Arsenic trioxideSARA 313 toxic chemical notification and release reporting: Arsenic trioxideCERCLA: Hazardous substances: Arsenic trioxide: 1 lb. (0.4536 kg)Other Regulations:OSHA: Hazardous by definition of Hazard Communication Standard (29 CFR 1910.1200).EINECS: This product is on the European Inventory of Existing Chemicals16. Other InformationNFPA Ratings:Health: 3, Flammability: 0, Reactivity: 0Label Hazard Warning:DANGER! MAY BE FATAL IF SWALLOWED OR INHALED. CANCER HAZARD.CONTAINS INORGANIC ARSENIC WHICH CAN CAUSE CANCER. Risk of cancer dependson duration and level of exposure. CAUSES IRRITATION TO SKIN, EYES ANDRESPIRATORY TRACT. MAY CAUSE LIVER AND KIDNEY DAMAGE. USE ONLY WITHADEQUATE VENTILATION AND RESPIRATORY EQUIPMENT.Label Precautions:Do not get in eyes, on skin, or on clothing. Do not breathe dust. Keep container closed. Use onlywith adequate ventilation. Wash thoroughly after handling.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1f

Chapter 8Label First Aid:If swallowed, induce vomiting immediately as directed by medical personnel. Never give anything bymouth to an unconscious person. Get medical attention immediately. If inhaled, remove to fresh air. If notbreathing, give artificial respiration. If breathing is difficult, give oxygen. In case of contact, immediatelyflush eyes or skin with plenty of water for at least 15 minutes. Remove contaminated clothing and shoes.Wash clothing before reuse. In all cases, get medical attention.Product Use:Laboratory Reagent.Revision Information:No Changes.The information above is believed to be accurate and represents the best information currently available tous. However, we make no warranty of merchantability or any other warranty, express or implied, withrespect to such information, and we assume no liability resulting from its use. Users should make their owninvestigations to determine the suitability of the information for their particular purposes. In no event shallwe be liable for any claims, losses, or damages of any third party or for lost profits or any special, indirect,incidental, consequential or exemplary damages, howsoever arising, even if we have been advised of thepossibility of such damages.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 8: Toxicology: Poisons and AlcoholBlackline Master 8.1g

Chapter 99.1Name:Date:Laboratory Activity 9.1Identification of MetalsMetal HNO 3NaOHAlConfirmatorytests Magnetic DensityMgCrCuZnFePbNiUnknown #1Unknown #2Unknown #3Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 9: Trace EvidenceBlackline Master

Chapter 9Laboratory Activity 9.1Figure 9.1: Metals Analytical SchemeAl, Mg, Cr, Cu, Zn, Fe, Pb, NiyesmagneticnoFe, NiAl, Mg, Cr, Cu, Zn, PbbrownHNO 3greensinksDensity (bromoform)floatsFeNiCu, Cr, Zn, PbAl, MgblueHNO 3NaOHrxn, br gasn.r.rxnn.r.Cu Zn Pb, Cr Al MgHClgreenn.r.CrPbForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 9: Trace EvidenceBlackline Master 9.2

Chapter 99.3Name:Date:Laboratory Activity 9.2Chromatography VisualizationMetal UV NH 3Oxine-UV Na 2S Other R fAlCoCuNiZnUnknown#1Unknown#2Unknown#3Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 9: Trace EvidenceBlackline Master

Figure 9.4: Qualitative Analytical SchemeLaboratory Activity 9.3Chapter 9NaHCO 3 , CaSO 4 , Sucrose, CaCO 3 ,NaOHNaCI, Cornstarch, MgSO 4 , H 3 BO 3 , Na 2 CO 3Water9.4Deep blueIodineInsolubleCaSO 4 , CaCO 3 ,CornstarchBrownishCaSO 4 , CaCO 3 ,CornstarchPinkSolubleNa 2 CO 3 , NaHCO 3 , Sucrose,NaCI, MgSO 4 , H 3 BO 3 , NaOHPhenolphthallinCornstarchBubblesCaSO 4 , CaCO 3VinegarBubblesNaOH, Na 2 CO 3VinegarNaHCO 3 , Sucrose,NaCl, H 3 BO 3 , MgSO 4Sodium HydroxideCaCO 3 CaSO 4Na 2 CO 3 NaOHPrecipitateSucrose, H 3 BO 3NaHCO 3 , NaClMgSO 4VinegarBubblesSolubleNaCl, H 3 BO 3 , Sucrose NaHCO 3AlcoholInsolubleSucrose, NaClH 3 BO 3Hot WaterSucrose NaClVery solubleLess solubleForensic Science for High School© Kendall/Hunt Publishing CompanyModified from Solomon et. al., Qualitative Analysis ofEleven Household ChemicalsChapter 9: Trace EvidenceBlackline Master

Chapter 10Laboratory Activity 10.2Additional Soil TestsIn the case of class evidence, the more tests that show association, the greater the probative value of theevidence. You may wish to add a few more tests:A. Testing for nutrients such as nitrate, potassium, and phosphate using a commercial soil or water testkit can sometimes provide comparative information. Kits are readily available from local, county, orstate agencies as well as from scientific supply houses. This can relate to soil nutrients, environmentalscience, and agriculture.B. Specific chemical tests, such as “salting ” a sample, may be necessary for effect. For example, a solublelead salt added to a soil sample would allow a chromate test; a Fe +3 salt could be identified with thebright red thiocyanate complex; reactive metal particles such as Al, Mg, and Zn will produce H 2uponaddition of acid, while carbonates (such as limestone, shells, or coral) will form CO 2. Specific ion teststrips can be used rather than reagents. Specific chemical test strips are available from Fisher Scientific(www.fishersci.com) as EM Quant Test Strips, but they are rather expensive. You may wish to deviseyour own. One method would be to take a small amount of soil in a 4˝ test tube, shake it with 1 MHNO 3, allow the mixture to settle, pour the supernatant through a filter, and divide it into severalaliquots. A 0.1–M solution of silver nitrate will give a milky white precipitate in the presence of chlorideion. Addition of ammonia will give a blue color indicative of copper. Thiocyanate solution (0.1 MKSCN) gives a bright red color with Fe 3 . Ammonium oxalate (0.1 M) will produce a white precipitatewith Ca 2 , as does 0.1 M barium hydroxide with SO 42. Many heavy metal sulfides are black. Zincsulfide, however, is white or may be slightly yellow and is formed by the addition of 0.1 M Na 2S. Solublelead can be detected by shaking a sample of soil in water, not acid, adding a little acetic acid to thefiltrate and 0.1 M K 2CrO 4. A yellow precipitate indicates lead. Test strips for lead in soil can bepurchased from some lab suppliers or made (see pages 214–216 in Chapter 8, “Toxicology: Poisons andAlcohol”).C. Mineralogy: The coarse sands still retain their original mineral composition. Despite identification ofmore than 2,000 different minerals, only 20 or so are common in soils. Quartz is the most common,with feldspars probably next. Vigorously washing the 20 mesh sieve fraction in water (better is a sonicbath) and then drying yields cleaner particles. Immersion of the sample in oil with a refractive index of1.53 (mineral oil will do) and observation even under a stereomicroscope can be informative when usingcrossed polarizers. Tape a film polarizer (such as supplied by Flinn or Edmund Scientific, or borrow onefrom your physics teacher) over the objective; place another on the lighted stage and rotate it such thatno light is transmitted to the eyepiece, then tape it. Most of the common transparent minerals areanisotropic and will show birefringence when the petri dish containing the coarse sand or soil fractionis rotated between the polarizers; however, they cannot be specifically identified in this manner.Nevertheless, the relative number of such particles can be useful; the colors are pretty, and this can leadinto a discussion of optical properties of solids, refractive index, optical mineralogy, and the like.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 10: Soil and Glass AnalysisBlackline Master 10.1

Chapter 10Laboratory Activity 10.3Figure 10.4: Topographic Map of the Martinsville-Mount Horeb AreaForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 10: Soil and Glass AnalysisBlackline Master 10.2

Chapter 10Laboratory Activity 10.3Figure 10.5: The Mount Horeb SwampForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 10: Soil and Glass AnalysisBlackline Master 10.3

Chapter 10Laboratory Activity 10.6©1996, Flinn Scientific, Inc. All Rights Reserved. Reproduced for one-time use with permission from Flinn Scientific, Inc., Batavia, IL, USA. No part of this material maybe reproduced or transmitted in any form or by any means, electronic or mechanical, including, but not limited to photocopy, recording, or any information storage andretrieval system, without permission in writing from Flinn Scientific, Inc.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 10: Soil and Glass AnalysisBlackline Master 10.4

Chapter 11Angle of Impact of Blood DropsLaboratory Activity 11.4Forensic Science for High SchoolChapter 11: Blood© Kendall/Hunt Publishing Company Blackline Master 11.1

Chapter 11Name:Date:Checkpoint Questions15. Calculate the angle of impact for the bloodstains below:wlwlwlangleangleangleA B CwlwlwlangleangleangleD E F16. Identify what may have caused these types of stains:ABCCAB17. Deduce what happened here:ABCABCForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 11: BloodBlackline Master11.2a

Chapter 11Name:Date:Checkpoint QuestionsDED18. Sometimes a transfer pattern can indicate the weapon used in an assault. Guess what madethe following:ECABABCDEFDEFGHIJKLGHIKLJForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 11: BloodBlackline Master11.2b

Chapter 12Activity 12.3DNA Sequence for Use in Activity“Simulation of DNAReplication Using PCR”Matt:AACTGTTGGCAGGCATTACCGGTTCACTGCTAGCCATGGTAATCCGGACTACGCTATACCGGATCACTATCCGGGCATATCCGGCATTommy:CGTAGGTCATTGCAATGACTTATCCGGTACCTAGCATTAATGTCCGGCATTCAGTTAGCCGGCAACTAGTCCGGCTTAGACCGGATACindy:GCTATTACATTCAATAGGTATGTCCGGCAGGTATCGCTCCGGTCGCTATACGTAATGACCGGATCAGCTACCGGAGTAGCCGGCTCMike:ATAGCGTTAGTTACCATATGTTACCGGATTAGCATTAATGGATCCGGTACTGATAGTACCGGTAGCATATCCGGTCTACTCCGGCATKatie:TTAGCAGGTATTCGGTAATGCTACCGGATCTATGTTCGATCAGCCGGTAGCTTAGATACCGGCATCTAAGCCGGTGCATACCGGCATNuk:ATTGGGATAGCTATCGAGGTTAGCCGGCTAAGCTTACCATGATCCGGTAGCATATGATCCGGATCATATGCCGGTCATTACCGGTAADNA from the crime scene:TACTGTAGGCAGGCATTGCCGGTACACCGCTAGCATTGGTTATCCGGACAACGCTATACCGGATCACTATCCGGGCATATCCGGCATForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 12: DNA AnalysisBlackline Master12.1

Chapter 13Activity 13.1Name:Date:Test Your Knowledge of the Insect WorldCircle the letter of the correct answer or true or false.1. What is a bug? a) an insect b) a pest c) a hidden microphone d) any or all of the above, dependingwho you are talking to2. A person who studies insects is an: a) etymologist. b) insectologist. c) entomologist. d) erythologist.3. Insects are the most numerous living things on earth: true or false?4. Taxonomy is: a) the science of taxicabs. b) the classification of things. c) a book in the Bible.d) income tax evasion.5. What is the proper name for insects with a hard, outer-body casing and jointed legs? a) arthropodsb) snails c) mammals d) lobsters6. Most insects live on land: true or false?7. The three basic body parts of an insect are: a) head, eyes, tail b) head, wings, legs c) head, abdomen,wings d) head, thorax, abdomen.8. How many legs does an insect have? a) four b) six c) eight d) any of the above9. All adult insects have four wings: true or false?10. Which is not an insect? a) spider b) ant c) bee d) beetle11. Metamorphosis is: a) a change in the body of insects. b) Sting’s new CD. c) the middle earth.d) a process of extraterrestrial travel.12. Larva is: a) a Hindu god. b) a volcanic rock. c) the immature stage of insect development. d) a skindisease.13. Exoskeleton is: a) the outer structure of a spacecraft. b) the tough outer covering of insects.c) X-man’s skeleton. d) bones found in the woods.14. Hypothetically, if a pair of houseflies bred in April, and all offspring lived, how many flies would therebe by August? a) 10 5 b) 10 10 c) 10 15 d) 10 20Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master13.1a

Chapter 13Name:Date:Activity 13.115. Label the parts of this house fly as indicated in the diagram:16. Label the parts of this beetle as indicated in the diagram:Forensic Science for High SchoolChapter 13: Forensic Entomology© Kendall/Hunt Publishing Company Blackline Master 13.1b

Chapter 13Laboratory Activity 13.1Name:Date:Table 13.1: Soil SpecimensNo.FoundNo. of BodySegmentsNo. of Pairs ofLegsNo. of Pairs ofWingsCommon NameClass & Order12345678910Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master13.2

Chapter 13Laboratory Activity 13.1Key to Insect OrdersKey to the Adult Stage of Insect Orders1. (a) Insect with wings ............................................... 2(b) Insect without wings ........................................ 282. (a) Front wings hardened, leathery or parchmentlike,at least at the base .................................... 3(b) Front wings membranous .................................. 86. (a) Jumping insects; hind femur enlarged; tarsi withfour or fewer segments (crickets, katydids,grasshoppers) ............................ ORTHOPTERA3. (a) Chewing mouthparts ......................................... 4(b) Walking insects; hind femur not enlarged; tarsiwith five segments (roaches, mantids, walkingsticks) ........................................ DICTYOPTERA(b) Sucking mouthparts .......................................... 77. (a) Front wings leathery at base, membranous atend (true bugs) ............................... HEMIPTERA4. (a) Without pincer-like cerci .................................... 5(b) With pincer-like cerci (earwigs) .. DERMAPTERA(b) Front wings of uniform texture (leafhoppers,treehoppers, spittlebugs, cicadas, aphids) ............................................................... HOMOPTERA5. (a) Front wings with branched veins ....................... 68. (a) Two wings ......................................................... 9(b) Four wings ....................................................... 139. (a) Pronotum extending over abdomen (pigmygrasshoppers) ............................ ORTHOPTERA(b) Front wings hard, without veins (beetles) ............................................................... COLEOPTERA(b) Pronotum not extended over abdomen ........... 1010. (a) End of abdomen without noticeableappendages .................................................... 12(b) End of abdomen with style or thread-like tails . 11Forensic Science for High SchoolChapter 13: Forensic Entomology© Kendall/Hunt Publishing Company Blackline Master 13.3a

Chapter 13Laboratory Activity 13.111. (a) Style-like tail (male scales) ........... HOMOPTERA14. (a) Very slender wing with fringe of hairs as long aswing is wide (thrips) ............... THYSANOPTERA(b) Two or three thread-like tails (mayflies) ......................................................... EPHEMEROPTERA12. (a) With haltere-like organs in front of wings (malestylopids) ................................. STREPSIPTERA(b) No fringe of hairs, or if present, not as long aswing is wide ..................................................... 1515. (a) Hind wings equal to, or larger than front wings ........................................................................... 21(b) Hind wings smaller than front wings ................ 1616. (a) No long abdominal tail-like appendages ......... 17(b) Abdomen with two or three thread-like tails(mayflies)............................ EPHEMEROPTERA17. (a) Tarsi two or three segmented ......................... 18(b) With halteres behind wings (mosquitoes, flies,gnats, midges) ..................................... DIPTERA(b) Tarsi with more than three segments (usually 5)........................................................................ 2018. (a) Piercing-sucking mouthparts (leafhoppers, planthoppers, spittlebugs, aphids, cicadas) ..................................................................... HOMOPTERA13. (a) Wings usually covered with scales; mouthpartsconsist of a coiled proboscis (butterflies, moths)................................................... LEPIDOPTERA(b) Chewing mouthparts ....................................... 19(b) Wings with few or no scales; without coiledproboscis ......................................................... 14Forensic Science for High SchoolChapter 13: Forensic Entomology© Kendall/Hunt Publishing Company Blackline Master 13.3b

Laboratory Activity 13.119. (a) Cerci present (zorapterans) .......... ZORAPTERA23. (a) Bristle-like inconspicuous antennae (dragonflies,damselflies) ....................................... ODONATAChapter 13(b) Cerci absent (booklice, barklice) PSOCOPTERA20. (a) Antennae shorter than body, not noticeablescales (bees, wasps, ichneumons) ..................................................................... HYMENOPTERA13.3c(b) Antennae apparently with several segments .. 2424. (a) Hind wings with enlarged anal area folded fanlike;wings tend to curl around the body lengthwise(dobsonflies, fishflies, alderflies) ................................................................. MEGALOPTERA(b) Antennae as long as body; wings and body oftenwith hairs (caddisflies) ............... TRICHOPTERA(b) Hind wings without enlarged, folded area; wingsdo not tend to curl around body lengthwise(lacewings, mantispids, ant lions, owl flies)............................................................ NEUROPTERA21. (a) Mouthparts close to eye .................................. 2225. (a) All legs of walking type .................................... 26(b) Hind legs modified for jumping (tree crickets) ........................................................ ORTHOPTERA(b) Mouthparts at end of beak-like structure somedistance from the eye (scorpionflies) ....................................................................... MECOPTERA26. (a) Basal segment of front tarsus has swollenappearance (webspinners) .......... EMBIOPTERA22. (a) Wings never held flat over abdomen............... 23(b) Wings held flat over abdomen ......................... 25(b) All tarsal segments approximately equal in size ......................................................................... 27Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master➔

Laboratory Activity 13.127. (a) Cerci usually long; more than 8 segments(stoneflies) ................................... PLECOPTERA33. (a) Body flattened laterally (fleas) . SIPHONAPTERA(b) Cerci short; with 2 to 8 segments or absent(termites) .......................................... ISOPTERA(b) Body flattened dorsoventrally .......................... 3434. (a) Sucking mouthparts externally visible ............. 35(b) No sucking mouthparts externally visible ........ 3635. (a) Antennae longer than head (true bugs) ..................................................................... HEMIPTERA28. (a) Antennae present ............................................ 29(b) Antennae absent ............................................. 4029. (a) Mouthparts usually withdrawn or enclosed in thehead and not apparent .................................... 30(b) Mouthparts usually distinctly apparent ............ 3130. (a) Collophore present; spring-like organ usuallypresent (springtails).................... COLLEMBOLA(b) Antennae shorter than head (louse flies, batflies)..................................................... DIPTERA(b) Both collophore and spring-like organ absent;distinct cerci present ........................... DIPLURA31. (a) Long tail-like appendages absent ................... 32(b) Three tail-like appendages present (silverfish,firebrats) ........................................ THYSANURAChapter 1336. (a) Antennae longer than head ............................. 37(b) Antennae shorter than head............................ 3937. (a) Basal segment of front tarsus swollen (webspinners) ..................................... EMBIOPTERA13.3d(b) Basal segment of front tarsus not swollen ...... 3832. (a) Body flattened laterally or dorsoventrally ........ 33(b) Body not flattened ........................................... 43Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master

Laboratory Activity 13.138. (a) Tiny insects; tarsi 2 to 3 segmented (booklice,barklice)...................................... PSOCOPTERA43. (a) Abdomen and thorax narrowly joined together(ants) ....................................... HYMENOPTERA(b) Large insects; tarsi five segmented (cockroaches).................................... DICTYOPTERA(b) Abdomen and thorax broadly joined together ............................................................................. 4444. (a) Body covered with scales (female cankerworms)................................................... LEPIDOPTERA39. (a) Head wider than thorax at point of attachment tothorax (chewing lice) .................. MALLOPHAGA(b) Body not covered with scales.......................... 4545. (a) Tarsal claws absent (thrips) .. THYSANOPTERAChapter 13(b) Head narrower than thorax at point of attachmentto thorax (sucking lice) ........... ANOPLURA40. (a) Legs present ................................................... 41(b) Legs absent..................................................... 4241. (a) Fewer than 12 abdominal segments (bat flies,louse flies) ........................................... DIPTERA13.3e(b) Tarsal claws present ....................................... 4646. (a) Piercing-sucking mouthparts ........................... 47(b) Chewing mouthparts ....................................... 4947. (a) Cornicles usually present (aphids or plant lice)........................................................ HOMOPTERA(b) Twelve abdominal segments (proturans) ...................................................................... PROTURA(b) Cornicles absent ............................................. 4842. (a) Head and thorax separate (scale insects)................................................................ HOMOPTERA(b) Head and thorax fused (female stylopids).......................................................... STREPISIPTERAForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master

Laboratory Activity 13.148. (a) With distinct head and eyes (bed bugs) ..................................................................... HEMIPTERA52. (a) Antennae longer than one-third of body length(booklice, barklice) ......................PSOCOPTERA(b) Without distinct head and eyes (female scales) ....................................................... HOMOPTERA(b) Antennae shorter than one-fourth of body length(female stylopids) ..................... STREPSIPTERA49. (a) Abdominal forceps present (earwigs) ...................................................................... DERMAPTERA53. (a) Body leathery and usually grey or dark colored ............................................................................ 54(b) Body soft and pale colored ............................. 5754. (a) Hind legs adapted for jumping ....ORTHOPTERA(b) Hind legs not adapted for jumping .................. 55(b) Abdominal forceps absent .............................. 5050. (a) Mouthparts at end of beak like structure somedistance from eye (scorpionflies).. MECOPTERAChapter 1355. (a) Pronotum narrow, body pencil-like or stick-like ............................................................ PHASMIDA(b) Body not elongated and stick-like ................... 5613.3f56. (a) Front legs enlarged grasping type (mantid) .............................................................DICTYOPTERA(b) Mouthparts not elongated, close to eyes......... 5151. (a) Cerci present ................................................... 53(b) Cerci absent .................................................... 52(b) Front legs not enlarged, pronotum broad andflattened, frequently pronotum covers head(cockroach) ................................DICTYOPTERAForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master

Chapter 13Laboratory Activity 13.157. (a) Two tarsal segments (zorapterans) ........................................................................... ZORAPTERA58. (a) Basal segment of front tarsai with swollenappearance (webspinners) .......... EMBIOPTERA(b) Three to five tarsal segments .......................... 5858. (a) Basal segment of front tarsai with swollenappearance (webspinners) .......... EMBIOPTERA(b) Basal segment of front tarsi about same size asones immediately following (termites) ........................................................................... ISOPTERAForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master13.3g

Chapter 13Laboratory Activity 13.2Graph PaperForensic Science for High SchoolChapter 13: Forensic Entomology© Kendall/Hunt Publishing Company Blackline Master 13.4

Chapter 13Name:Date:Laboratory Activity 13.3The Effects of Temperature on Rearing of MaggotsLocation: _________________________________ Genus: ______________________ Group:_____________Date Time Elapsedtime, hrsT, °F Appearance Size, mm Comments InitialsForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master13.5

Chapter 13Laboratory Activity 13.3Effect of Temperature on GrowthTime to 3rd Instar, number of days10987654321010 20 30 40Temperature, degrees CentigradeForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master13.6

Chapter 13Laboratory Activity 13.3Larvae GrowthLarvae Length, mm18161412108640 1 2 3 4 5 6 7 8 9 10 11Time, day numberForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 13: Forensic EntomologyBlackline Master13.7

Chapter 13Name:Date:Puzzle 13.112 3 4 567 8 91011 12 1314 1516 17181920212223ACROSS1 shedding insect’s outer skeleton (4)3 government agency (3)4 harvest larvae to find ______ (5)6 self-destruction of a cell (9)9 goes with 3 across (5)10 a corpse (7)11 founder of the Body Farm (4)14 family of the cheese skipper (11)18 a smelly chemical of death (10)19 type of fly (5)21 a unit of measure of absorbed biological energy (9)22 fly family (7)23 hardened forewing of a beetle (7)Forensic Science for High School© Kendall/Hunt Publishing CompanyDOWN2 mid-portion of an insect (6)3 first to arrive at a corpse (3)4 used to identify fly eggs and early instar (3)5 a taxonomic category (5)6 killing solution (7)7 flesh flies (13)8 the family of carrion beetles (9)12 unit of biological energy input (3)13 final taxonomic classification (7)14 related to time of death (3)15 fly bait (5)16 late 3rd instar (7)17 preferred corpse for entomological research (3)19 a corpse to beetles (4)20 type of beetle last to arrive at corpse (4)Chapter 13: Forensic EntomologyBlackline Master 13.8

Chapter 13Puzzle 13.1: Answers1M O L T2 3 4 5F B ID R U G S6AUTHLO L Y7 8 9SISNAGEENTL10CADRAVEARIL11 12 13BAUSSOHXC PD14 15PIOPHIL I DAPEOM P I ICL1916 17PRI20F L E S H18CHDVA D A V E R I P EG E R G SPIOO22DIPUPATIDERI2123D E G R E E D A YAE L Y T R O NACROSS1 shedding insect’s outer skeleton (4)3 government agency (3)4 harvest larvae to find ______ (5)6 self-destruction of a cell (9)9 goes with 3 across (5)10 a corpse (7)11 founder of the Body Farm (4)14 family of the cheese skipper (11)18 a smelly chemical of death (10)19 type of fly (5)21 a unit of measure of absorbed biological energy (9)22 fly family (7)23 hardened forewing of a beetle (7)Forensic Science for High School© Kendall/Hunt Publishing CompanyDOWN2 mid-portion of an insect (6)3 first to arrive at a corpse (3)4 used to identify fly eggs and early instar (3)5 a taxonomic category (5)6 killing solution (7)7 flesh flies (13)8 the family of carrion beetles (9)12 unit of biological energy input (3)13 final taxonomic classification (7)14 related to time of death (3)15 fly bait (5)16 late 3rd instar (7)17 preferred corpse for entomological research (3)19 a corpse to beetles (4)20 type of beetle last to arrive at corpse (4)Chapter 13: Forensic EntomologyBlackline Master 13.9

Chapter 14Activity 14.1Name:Date:Skeleton1.2.3.4.5.6.7.8.9.10.11.12.13.14.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 14: Human RemainsBlackline Master 14.1

Chapter 14Laboratory Activity 14.1Name:Date:Determining Sex Using the Os PubisForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 14: Human RemainsBlackline Master14.2

Chapter 14Activity 14.3Name:Date:Determining Sex Using Skull FeaturesLook at the two skull diagrams below, noting the differences. Circle the differences and use an anatomytextbook to name the points circled. Determine the sex of the skeleton provided for class observationbased on skull features.Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 14: Human RemainsBlackline Master14.3

Chapter 14Activity 14.4Name:Date:Determining Age Using the Epiphyses (Medial Clavicle)4. Determine the age of the model skeleton based on the various epiphyses.CiCiiCiiiCivCvForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 14: Human RemainsBlackline Master14.4

Chapter 14Activity 14.4Name:Date:Determining Age Using the Epiphyses (Iliac Crest)7. Use Table 14.2 to determine the approximate age of each specimen in the photo below.Parts of femur. Where is the femur found?Parts of humerus. Where is the humerus found?Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 14: Human RemainsBlackline Master14.5

Chapter 15Name:Date:Laboratory Activity 15.1Bullet WorksheetDesignation or Exhibit #Condition (entire, deformed, etc.)Diameter, inchesDiameter, mmLength, mmdetailed drawing of entire bulletCaliberWeight, gramsWeight, grainsType (jacketed, round nose, etc.)Number of lands or groovesWidth of land, mmWidth of grooveDirection of twist (left or right)detailed drawing of one set of striaeStriae present (Y or N)Number of rows of canneluresRemarks:Signed Date Supervisor’s initialsForensic Science for High SchoolChapter 15: Firearms, Toolmarks, and Impressions© Kendall/Hunt Publishing Company Blackline Master 15.1

Chapter 15Name:Date:Laboratory Activity 15.1Cartridge Case WorksheetDesignation or Exhibit #Condition (clean, rusty, etc.)Diameter, inchesDiameter, mmLength, mmdetailed drawing of entire cartridge caseCaliberHead stampor imprintCase finish (brass, nickel, etc.)Centerfire or rimfireFiring pin impression (rectangular, round, etc.)Breech mark pattern (parallel, circular, etc.)Extractor mark descriptionEjector mark descriptionMagazine scratches (Y or N)Chamber marks (Y or N)Remarks:drawing extractor markdrawing ejector markSigned Date Supervisor’s initialsForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 15: Firearms, Toolmarks, and ImpressionsBlackline Master15.2

Chapter 15Laboratory Activity 15.3Simulated Sodium Rhodizonate TestForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 15: Firearms, Toolmarks, and ImpressionsBlackline Master15.3

Chapter 15Name:Date:Checkpoint Question 18: Matching ShoeprintsDo any of these shoeprints match?Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 15: Firearms, Toolmarks, and ImpressionsBlackline Master15.4

Forensic Science for High School© Kendall/Hunt Publishing CompanyName:Date:Puzzle 15.115.5Chapter 15: Firearms, Toolmarks, and ImpressionsBlackline MasterChapter 15ATFballisticsbariumborebreechbulletcannelurescasecastchamberejectorextractorgaitgaugegraingroovesGSRhollowpointIBISlandsleadobliqueprimerrestorationrifledSEMEDXserialslugstancestriaetwistVINIERNMBOUWEJACPRIRAWTUYTBRJJATAURTUCENASMAETCIGGFLXEIOTIHMRALMESSRLUGSAAGVNEWBTOOLHLTNOPTIDRRRAESISHSQKERGMBMCHLHRVUTEOWFLSSJBRACSILISTLBRTCHEAHAJMEEPAMAALASVAHXIRCSNLNTLSTNYUEGIADDGCOTUODEVNRASOSEBEWXRGEERGSLOFFPBIBRARZXSLECP

Forensic Science for High School© Kendall/Hunt Publishing CompanyPuzzle 15.1: Answers15.6Chapter 15: Firearms, Toolmarks, and ImpressionsBlackline MasterChapter 15IERNMBOUWEJACPRIRAWTUYTBRJJATAURTUCENASMAETCIGGFLXEIOTIHMRALMESSRLUGSAAGVNEWBTOOLHLTNOPTIDRRRAESISHSQKERGMBMCHLHRVUTEOWFLSSJBRACSILISTLBRTCHEAHAJMEEPAMAALASVAHXIRCSNLNTLSTNYUEGIADDGCOTUODEVNRASOSEBEWXRGEERGSLOFFPBIBRARZXSLECP

Chapter 16Name:Date:Activity 16.2Simulated ForgeryA. Write your name (signature):B. Write your name again:C. (Leave blank):D. (Leave blank):E. Have someone copy your signature (after practicing on scrap paper):F. Have someone else copy your signature (after practicing onscrap paper):G. Disguise your signature:H. Write “Cleopatra”:I. Have person E copy this:J. Write “Cleopatra” but disguise your handwriting:K. Write “ninety-six”:Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 16: Document and Handwriting AnalysisBlackline Master16.1a

Chapter 16Activity 16.2Name:Date:L. Have person F copy this:M. Write “ninety-six,” but disguise your handwriting:N. Write the numerals 0, 1, 2, 3, 4, 5, 6, 7, 8, and 9:O. Have E copy the numerals:P. Have F copy the numerals:Q. Write the numerals in disguised writing:R. Go back to C and D and write your signature again. Examine your four signatures and note the differences based onthe 12 characteristics described in the text:S. Note similarities between your normal handwriting and your disguised handwriting in G, J, M, and R. Normally youalter the major characteristics of your handwriting, but the minor ones give you away. What major characteristicsfrom the 12 points did you change? What minor ones remain?T. Examine some of the signatures made by your classmates in E, F, L, I, O, and P. Comment on some of the primary signsof forgery, and note which ones have:a. the appearance of being written slowlyb. blunt line endings and beginningsc. poor line quality, with wavering and tremors of the lined. retracing and patchinge. stops in places where writing should be free and smoothf. inconsistent letter formationForensic Science for High School© Kendall/Hunt Publishing CompanyChapter 16: Document and Handwriting AnalysisBlackline Master16.1b

Chapter 16Activity 16.4Letter Angle Template1230°35°5°10°15°20°25°30°40°45°50°55°60°30° 25° 20° 15° 10° 5° 0°Forensic Science for High School© Kendall/Hunt Publishing CompanyChapter 16: Document and Handwriting AnalysisBlackline Master16.2