Gene Section - Atlas of Genetics and Cytogenetics

Volume 16 1 - Number 2 1 

May February - September 2012 

1997

Atlas of Genetics and Cytogenetics 

in Oncology and Haematology 

Scope 

OPEN ACCESS JOURNAL AT INIST-CNRS 

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in 

open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. 

It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more 

traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, 

and educational items in the various related topics for students in Medicine and in Sciences. 

Editorial correspondance 

Jean-Loup Huret 

Genetics, Department of Medical Information, 

University Hospital 

F-86021 Poitiers, France 

tel +33 5 49 44 45 46 or +33 5 49 45 47 67 

jlhuret@AtlasGeneticsOncology.org or Editorial@AtlasGeneticsOncology.org 

Staff 

Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Maureen Labarussias, Vanessa Le 

Berre, Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. 

Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave 

Roussy Institute – Villejuif – France). 

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times 

a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of 

the French National Center for Scientific Research (INIST-CNRS) since 2008. 

The Atlas is hosted by INIST-CNRS (http://www.inist.fr) 

http://AtlasGeneticsOncology.org 

© ATLAS - ISSN 1768-3262 

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with 

the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific 

Research (CNRS) on its electronic publishing platform I-Revues. 

Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.



Atlas Genet Cytogenet Oncol Haematol. 2012; 16(2) 

Editor 


(Poitiers, France) 

Editorial Board 


Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section 

Alessandro Beghini (Milan, Italy) Genes Section 

Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections 

Judith Bovée (Leiden, The Netherlands) Solid Tumours Section 

Vasantha Brito-Babapulle (London, UK) Leukaemia Section 

Charles Buys (Groningen, The Netherlands) Deep Insights Section 

Anne Marie Capodano (Marseille, France) Solid Tumours Section 

Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections 

Antonio Cuneo (Ferrara, Italy) Leukaemia Section 

Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section 

Louis Dallaire (Montreal, Canada) Education Section 

Brigitte Debuire (Villejuif, France) Deep Insights Section 

François Desangles (Paris, France) Leukaemia / Solid Tumours Sections 

Enric Domingo-Villanueva (London, UK) Solid Tumours Section 

Ayse Erson (Ankara, Turkey) Solid Tumours Section 

Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections 

Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section 

Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections 

Anne Hagemeijer (Leuven, Belgium) Deep Insights Section 

Nyla Heerema (Colombus, Ohio) Leukaemia Section 

Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections 

Sakari Knuutila (Helsinki, Finland) Deep Insights Section 

Lidia Larizza (Milano, Italy) Solid Tumours Section 

Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section 

Edmond Ma (Hong Kong, China) Leukaemia Section 

Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections 

Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections 

Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section 

Fredrik Mertens (Lund, Sweden) Solid Tumours Section 

Konstantin Miller (Hannover, Germany) Education Section 

Felix Mitelman (Lund, Sweden) Deep Insights Section 

Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section 

Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections 

Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections 

Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section 

Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section 

Mariano Rocchi (Bari, Italy) Genes Section 

Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section 

Albert Schinzel (Schwerzenbach, Switzerland) Education Section 

Clelia Storlazzi (Bari, Italy) Genes Section 

Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections 

Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections 

Dan Van Dyke (Rochester, Minnesota) Education Section 

Roberta Vanni (Montserrato, Italy) Solid Tumours Section 

Franck Viguié (Paris, France) Leukaemia Section 

José Luis Vizmanos (Pamplona, Spain) Leukaemia Section 

Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections



Gene Section 


Volume 16, Number 2, February 2012 

Table of contents 


LMO1 (LIM domain only 1 (rhombotin 1)) 82 

Norihisa Saeki, Hiroki Sasaki 

MAP2 (microtubule-associated protein 2) 85 

Ashika Jayanthy, Vijayasaradhi Setaluri 

MIR200C (microRNA 200c) 90 

Sarah Jurmeister, Stefan Uhlmann, Özgür Sahin 

PXN (paxillin) 98 

Tiffany Pierson, Brendan C Stack Jr 

RPS27 (ribosomal protein S27) 101 


STAT5B (signal transducer and activator of transcription 5B) 104 

Amanda M Del Rosario, Teresa M Bernaciak, Corinne M Silva 

AAMP (angio-associated, migratory cell protein) 109 

Marie E Beckner 

BCL2L15 (BCL2-like 15) 113 

Maria-Angeliki S Pavlou, Christos K Kontos 

DUSP6 (dual specificity phosphatase 6) 117 

Zhenfeng Zhang, Balazs Halmos 

GZMA (granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)) 121 

Elena Catalan, Diego Sanchez-Martinez, Julián Pardo 

MIER1 (mesoderm induction early response 1 homolog (Xenopus laevis)) 125 

Laura L Gillespie, Gary D Paterno 

PA2G4 (proliferation-associated 2G4, 38kDa) 129 

Anne Hamburger, Arundhati Ghosh, Smita Awasthi 

PRDM1 (PR domain containing 1, with ZNF domain) 133 

Wayne Tam 

Leukaemia Section 

del(11)(q23q23) MLL/ARHGEF12 139 


t(3;11)(q21;q23) 141 

Jean-Loup Huret



t(11;14)(q13;q32) in multiple myeloma Huret JL, Laï JL 

Solid Tumour Section 



Head and Neck: Squamous cell carcinoma: an overview 143 

Audrey Rousseau, Cécile Badoual 

Cancer Prone Disease Section 

Rombo syndrome 154 


Deep Insight Section 

Cohesins and cohesin-regulators: Role in Chromosome Segregation/Repair 

and Potential in Tumorigenesis 155 

José L Barbero 

Mechanisms and regulation of autophagy in mammalian cells 163 

Maryam Mehrpour, Joëlle Botti, Patrice Codogno 

Case Report Section 

A new case of t(5;14)(q31;q32) in a pediatric acute lymphoblastic leukemia 

presenting with hypereosinophilia 181 

Marta Gallego, Mariela Coccé, María Felice, Jorge Rossi, Silvia Eandi, Gabriela Sciuccati, Cristina Alonso 

Chromosomal translocation t(X;11)(q22;q23) involving the MLL gene 183 

Adriana Zamecnikova, Soad Al Bahar, Hassan A Al Jafar, Rames Pandita




Mini Review 

LMO1 (LIM domain only 1 (rhombotin 1)) 

Norihisa Saeki, Hiroki Sasaki 


Genetics Division, National Cancer Center Research Institute, Tokyo 104-0045, Japan (NS, HS) 

Published in Atlas Database: August 2011 

Online updated version : http://AtlasGeneticsOncology.org/Genes/LMO1ID33ch11p15.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI LMO1ID33ch11p15.txt 

This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. 

© 2012 Atlas of Genetics and Cytogenetics in Oncology and Haematology 

Identity 

Other names: rhombotin 1, RBTN1, RHOM1, 

TTG1 

HGNC (Hugo): LMO1 

Location: 11p15.4 

Local order: Telomeric to STK33 gene; 

centromeric to RIC3 gene. 

DNA/RNA 

Description 

4,4 kb (from the beginning of the 1st exon to the 

end of the 5th exon) consisting of 5 exons. 

Transcription 

mRNA of approximately 700 - 1000 bp, depending 

on the splicing variants. 

Pseudogene 

Not reported. 

LMO1 gene is located between RIC3 and STK33 genes in Chromosome 11p15. The arrow indicates the orientation of the genes. 

Structure of LMO1 gene. The gene consists of 5 exons and several splicing variants were reported. 

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(2) 82

LMO1 (LIM domain only 1 (rhombotin 1)) Saeki N, Sasaki H 

Protein 

Description 

The protein contains two highly conserved, 

cysteine-rich motifs known as LIM domains, which 

interact with other proteins. As LMO1 has no 

DNA-binding domain, its DNA binding ability is 

dependent on the other proteins with which it 

interacts. The proteins known for binding to LMO1 

include TAL1/SCL and LDB1, and the molecules 

have an oncogenic function in T cell acute leukemia 

with the chromosomal translocation 

t(11;14)(p15;q11). 

Expression 

LMO1 expression is prominent in the central 

nervous system in both human and mouse. In mice 

it was observed by an in situ hybridization 

technique in the cerebral cortex, diencephalon, 

mesencephalon, cerebellum, myeloencephalon and 

spinal cord. Northern blot analysis revealed its 

expression in the thymus, kidney and placenta of 

adult mice. 

Localisation 

Nucleus. 

Function 

Transcription factor. 

Mutations 

Note 

Not reported. 

Implicated in 

Neuroblastoma 

Disease 

Genome-wide association studies revealed a 

corelation between neuroblastoma and a single 

nucleotide polymorphism in LMO1 gene, rs110419 

(A/G), of which the A allele was shown to promote 

LMO1 expression and to corelate the cases. The 

DNA copy number gain of the LMO1 locus due to 

duplication was also demonstrated to associate with 

the cases. These findings suggest that the gene has a 

role in the development and/or progression of 

neuroblastoma. It was also reported that LMO3 is a 

neuroblastoma oncogene. 

Apoptosis of the gastric epithelial 

cells 

Note 

In some gastric-cancer derived cell lines, LMO1 is 

upregulated by TGFbeta signalling and induces 

their apoptosis through enhancing GSDMA 

expression. This TGFbeta-LMO1-GSDMA cascade 

is considered a mechanism for apoptosis induction 

in the gastric epithelial cells, and has a role in 

maintaining their homeostasis. 

LMO1 induces apoptosis of the pit cells in TGFbeta 

signalling. This function is assumed to have a role in 

homeostasis of the gastric epithelium. 

T-cell acute lymphoblastic leukemia 

(T-ALL) 

Disease 

Originally, the LMO1 gene was identified at a 

break point of the translocation t(11;14)(p15;q11), 

which was frequently observed in T-ALL. Using 

LMO1 as a probe, LMO2 and LMO3 were 

identified. LMO1 is expressed in inmature T cells 

but suppressed in the mature cells, and 

overexpression of the gene in thymocytes, 

hematopoeitic progeniter cells located in the 

thymus, resulted in developing T-ALL in mice. 


LMO1 (LIM domain only 1 (rhombotin 1)) Saeki N, Sasaki H 

LMO1 acts cooperatively with SCL (Stem cell 

leukemia) as a transcriptional activator or represser, 

dependent on the genes and the cells, and enforced 

expression of LMO1 and SCL in the thymocytes 

inhibits T-cell differentiation and causes T-ALL. It 

is known that the LMO1-SCL complex regulates 

several genes, including suppression of NFKB1 

(nuclear factor of kappa light polypeptide gene 

enhancer in B-cells 1) and PTCRA (pre T-cell 

antigen receptor alpha), activation of NKX3.1 

(NK3 homeobox 1). 

References 

McGuire EA, Hockett RD, Pollock KM, Bartholdi MF, 

O'Brien SJ, Korsmeyer SJ. The t(11;14)(p15;q11) in a Tcell 

acute lymphoblastic leukemia cell line activates 

multiple transcripts, including Ttg-1, a gene encoding a 

potential zinc finger protein. Mol Cell Biol. 1989 

May;9(5):2124-32 

Boehm T, Foroni L, Kaneko Y, Perutz MF, Rabbitts TH. 

The rhombotin family of cysteine-rich LIM-domain 

oncogenes: distinct members are involved in T-cell 

translocations to human chromosomes 11p15 and 11p13. 

Proc Natl Acad Sci U S A. 1991 May 15;88(10):4367-71 

Boehm T, Spillantini MG, Sofroniew MV, Surani MA, 

Rabbitts TH. Developmentally regulated and tissue specific 

expression of mRNAs encoding the two alternative forms 

of the LIM domain oncogene rhombotin: evidence for 

thymus expression. Oncogene. 1991 May;6(5):695-703 

McGuire EA, Rintoul CE, Sclar GM, Korsmeyer SJ. Thymic 

overexpression of Ttg-1 in transgenic mice results in T-cell 

acute lymphoblastic leukemia/lymphoma. Mol Cell Biol. 

1992 Sep;12(9):4186-96 

Ono Y, Fukuhara N, Yoshie O. TAL1 and LIM-only proteins 

synergistically induce retinaldehyde dehydrogenase 2 

expression in T-cell acute lymphoblastic leukemia by 

acting as cofactors for GATA3. Mol Cell Biol. 1998 

Dec;18(12):6939-50 

Valge-Archer V, Forster A, Rabbitts TH. The LMO1 and 

LDB1 proteins interact in human T cell acute leukaemia 

with the chromosomal translocation t(11;14)(p15;q11). 

Oncogene. 1998 Dec 17;17(24):3199-202 

Herblot S, Steff AM, Hugo P, Aplan PD, Hoang T. SCL and 

LMO1 alter thymocyte differentiation: inhibition of E2A- 

HEB function and pre-T alpha chain expression. Nat 

Immunol. 2000 Aug;1(2):138-44 

Aoyama M, Ozaki T, Inuzuka H, Tomotsune D, Hirato J, 

Okamoto Y, Tokita H, Ohira M, Nakagawara A. LMO3 

interacts with neuronal transcription factor, HEN2, and acts 

as an oncogene in neuroblastoma. Cancer Res. 2005 Jun 

1;65(11):4587-97 

Chang PY, Draheim K, Kelliher MA, Miyamoto S. NFKB1 is 

a direct target of the TAL1 oncoprotein in human T 

leukemia cells. Cancer Res. 2006 Jun 15;66(12):6008-13 

Saeki N, Kim DH, Usui T, Aoyagi K, Tatsuta T, Aoki K, 

Yanagihara K, Tamura M, Mizushima H, Sakamoto H, 

Ogawa K, Ohki M, Shiroishi T, Yoshida T, Sasaki H. 

GASDERMIN, suppressed frequently in gastric cancer, is a 

target of LMO1 in TGF-beta-dependent apoptotic 

signalling. Oncogene. 2007 Oct 4;26(45):6488-98 

Kusy S, Gerby B, Goardon N, Gault N, Ferri F, Gérard D, 

Armstrong F, Ballerini P, Cayuela JM, Baruchel A, Pflumio 

F, Roméo PH. NKX3.1 is a direct TAL1 target gene that 

mediates proliferation of TAL1-expressing human T cell 

acute lymphoblastic leukemia. J Exp Med. 2010 Sep 

27;207(10):2141-56 

Wang K, Diskin SJ, Zhang H, Attiyeh EF, Winter C, Hou C, 

Schnepp RW, Diamond M, Bosse K, Mayes PA, Glessner 

J, Kim C, Frackelton E, Garris M, Wang Q, Glaberson W, 

Chiavacci R, Nguyen L, Jagannathan J, Saeki N, Sasaki 

H, Grant SF, Iolascon A, Mosse YP, Cole KA, Li H, Devoto 

M, McGrady PW, London WB, Capasso M, Rahman N, 

Hakonarson H, Maris JM. Integrative genomics identifies 

LMO1 as a neuroblastoma oncogene. Nature. 2011 Jan 

13;469(7329):216-20 

This article should be referenced as such: 

Saeki N, Sasaki H. LMO1 (LIM domain only 1 (rhombotin 

1)). Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):82-84. 





Mini Review 

MAP2 (microtubule-associated protein 2) 

Ashika Jayanthy, Vijayasaradhi Setaluri 


Department of Dermatology, University of Wisconsin-Madison, Madison, Wisconsin 53706, USA. 

(AJ, VS) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/MAP2ID44216ch2q34.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MAP2ID44216ch2q34.txt 



Identity 

Other names: DKFZp686I2148, MAP2A, 

MAP2B, MAP2C, 

HGNC (Hugo): MAP2 

Location: 2q34 

Note 

The protein encoded by this gene plays a role in 

dendrite morphogenesis in the vertebrate central 

nervous system. This function is accomplished by 

regulating microtubule stability and preventing the 

depolymerization of microtubules by stiffening 

them. It is known to have a number of distinctive 

isoforms. 

DNA/RNA 

Description 

The DNA consists of three or four tandem repeats 

that code for 31 amino acid long residues. 

The gene contains 15 exons and has a size of 

310064 base pairs. Alternative splicing of this gene 

gives rise to a large variety of transcripts and 

isoforms. 

Transcription 

Four transcription variants have been characterized. 

- MAP2 Isoform 5 (NM_001039538.1 --> 

NP_001034627.1): The difference in this isoform is 

characterized by the 5' UTR which results in the 

production of a longer protein when compared to 

isoform 2. 


NP_002365.3): This isoform is thought to be the 

longest encoded and contains three alternative inframe 

exons when compared to isoform 2. The 

tubulin binding and MAP2 projection domains are 

conserved. 


NP_114033.2): This is the shortest transcript. 


NP_114035.2): One alternate in-frame exon 

compared to isoform 2. 

Pseudogene 

None. 


MAP2 (microtubule-associated protein 2) Jayanthy A, Setaluri V 

Variant 5 mRNA Gene 

Exon Start End Length Start End Length 

1 1 230 230 1 230 230 

2 231 280 50 83546 83595 50 

3 281 345 65 155990 156054 65 

4 346 422 77 201007 201083 77 

5 423 713 291 229096 229386 291 

6 714 827 114 254526 254639 114 

7 828 905 78 256704 256781 78 

8 906 967 62 276231 276292 62 

9 968 1138 171 280404 280574 171 

10 1139 1286 148 281534 281681 148 

11 1287 1627 341 285868 286208 341 

12 1628 1720 93 299549 299641 93 

13 1721 1802 82* 301633 301744 112* 

14 1803 1915 113 305804 305916 113 

15 1916 5844 3929 306136 310064 3929 

TOTAL LENGTH : 5844* 



1 1 77 77 155633 155709 77 

2 78 142 65 155990 156054 65 

3 143 219 77 201007 201083 77 

4 220 510 291 229096 229386 291 

5 511 624 114 254526 254639 114 

6 625 702 78 256704 256781 78 

7 703 4428 3726 268579 272304 3726 

8 4429 4635 207 272496 272702 207 

9 4636 4770 135 272871 273005 135 

10 4771 4832 62 276231 276292 62 

11 4833 4980 148 281534 281681 148 

12 4981 5321 341 285868 286208 341 

13 5322 5403 82 301663 301744 82 

14 5404 5516 113 305804 305916 113 

15 5517 9445 3929 306136 310064 3929 

TOTAL LENGTH : 9445 





1 1 77 77 155633 155709 77 

2 78 142 65 155990 156054 65 

3 143 219 77 201007 201083 77 

4 220 510 291 229096 229386 291 

5 511 624 114 254526 254639 114 

6 625 702 78 256704 256781 78 

7 703 764 62 276231 276292 62 

8 765 912 148 281534 281681 148 

9 913 1253 341 285868 286208 341 

10 1254 1346 93 299549 299641 93 

11 1347 1428 82 301663 301744 82 

12 1429 1541 113 305804 305916 113 

13 1542 5470 3929 306136 310064 3929 



Exon Star End Length Start End Length 

1 1 77 77 155633 155709 77 

2 78 142 65 155990 156054 65 

3 143 219 77 201007 201083 77 

4 220 510 291 229096 229386 291 

5 511 624 114 254526 254639 114 

6 625 702 78 256704 256781 78 

7 703 764 62 276231 276292 62 

8 765 912 148 281534 281681 148 

9 913 1253 341 285868 286208 341 

10 1254 1335 82 301663 301744 82 

11 1336 1448 113 305804 305916 113 

12 1449 5377 3929 306136 310064 3929 


*There is a discrepancy between base pair numbers recorded for the transcript and the gene for this exon. 

Protein 

Note 

MAP2 is an approximately 1827 amino acid long 

protein with an estimated molecular weight of 200 

kDa, with the exact molecular weight varying by 

isoform. Four isoforms have been characterized, but 

additional ones are thought to exist. The protein 

undergoes post-translational phosphorylation upon 

DNA damage. The phosphorylation is hypothesized 

to be catalyzed by ATM or ATR. In the rat brain, 

the various isoforms were characterized at different 

stages of development - isoform MAP2B is found 

throughout rat brain development, while MAP2A 

appears towards the end of the second week of postnatal 

life. MAP2C is found during the early 

development of the brain, but after maturation is 

only found in the neural cells of the retina, olfactory 

bulb and the cerebellum. 



Description 

MAP2 is a mostly unfolded protein that changes 

conformation upon binding to its target molecule. A 

domain near its carboxyl terminus enables MAP2 

protein to bind to the microtubules. A 31 amino 

acid long repeating motif is characteristic of this 

protein. However, it is found that this motif is not 

sufficient by itself to bind to microtubules. Two 

contiguous sequences on either end of this 

repeating structure on both the amino and carboxyl 

ends enable the binding of this protein to the 

microtubules. A proline rich domain on the amino 

end is thought to be especially crucial in this 

process. The protein is known to have three tubulin 

binding domains spanning residues 1160-1691; 

1692-1722; 1723-1754. The protein also has a 

projection domain which extends from residues 

377-1505. All isoforms have a conserved Cterminal 

domain which contain tubulin binding 

repeats and a conserved N-terminal projection 

domain. The projection domain varies in size across 

isoforms, has a net negative charge and exerts a 

long range repulsive force. This gives a potential 

mechanism that explains how MAP2 regulates the 

spacing between microtubules. 

Expression 

MAP2 plays a major role in dendrite 

morphogenesis and is normally expressed in 

neurons. It has also been reported to be ectopically 

expressed in several cancers including melanoma 

and breast cancer. 

Localisation 

MAP2 mRNAs were found in the avian neuronal 

cell body cytoplasm; however the protein was 

found localized to the dendrites in mammals 

(Cristofanilli et al., 2004). The same report shows 

that avian neuronal MAP2 mRNA lacks a dendritic 

targeting element in its 3' UTR. Local expression 

within dendrites is hypothesized to be more suited 

to regulate need based synthesis. Tubulin, a protein 

expressed in both axons and dendrites is known to 

be expressed in the cytoplasm of the cell body 

showing that location specific expression of 

proteins is important to the maintenance of polarity 

of the neural cells. 

Function 

MAP2 stabilizes microtubule bundling and 

stiffening through the interactions of several weak 

binding sites to the microtubules on the protein. 

The strength of bundling of microtubules is directly 

correlated to the strength of the binding to MAP2. 

This enables the microtubules to support outgrowth 

from the cells. When MAP2 was expressed by 

transfection in non neuronal cells, it induced the 

rearrangement of the microtubules into long 

bundles. These bundles enabled outgrowths from 

the non neuronal cells. 

Experiments done with knockout mice show that 

the role of MAP2 in neuronal morphogenesis may 

be redundant (Teng et al., 2001). Single knockouts 

of MAP2 did not show any severe phenotypes but 

simultaneous knockouts of MAP2 and MAP1B died 

in the prenatal stage (Teng et al., 2001). There are 

several reports of functional redundancy amongst 

the MAP proteins. 

Homology 

A microtubule associated protein with similar 

function to MAP2 is known to be expressed in the 

rat (Rattus norvegicus), chicken (Gallus gallus) and 

lizard (Anolis carolinensis) with varying levels of 

sequence homology. In the fruit fly, the tau gene 

seems to perform a similar function. 

Mutations 

Note 

35 SNPs associated with MAP2 have been 

identified. The CAGs, which are a set of 

trinucleotide sequences starting at exon 1 of the 

MAP2 gene on the 5' UTR region, are conserved in 

the general population (Kalcheva et al., 1999). 

Implicated in 

Melanoma 

Note 

It has been found by Soltani et al. that primary 

melanomas that express the MAP2 gene have a 

lower rate of metastasis later on than primary 

melanomas that do not express the MAP2 gene. It 

has been proposed that MAP2 expression disrupts 

microtubule formation in cancer cells and interferes 

with cell cycle progression. 

Multiple sclerosis lesions 

Note 

Novel transcript of MAP2 that expresses exon 13 is 

shown to be up-regulated in multiple sclerosis 

lesions (Shafit-Zagardo et al., 1998). They 

proposed that this transcript is involved in 

remyelination of oligodendrocytes. 

Alzheimer's disease 

Note 

Abnormal hyperphosphorylation of several tau 

proteins, MAP1 and MAP2 have been implicated in 

leading to progressive degeneration and loss of 

connectivity between neurons. 

Various diseases 

Note 

MAP2 expression is altered in response to various 

illnesses and thus is used as a marker in the 

diagnosis of many specific illnesses and especially 

as a marker of neuronal differentiation. 



References 

Shafit-Zagardo B, Kalcheva N. Making sense of the 

multiple MAP-2 transcripts and their role in the neuron. Mol 

Neurobiol. 1998 Apr;16(2):149-62 

Kalcheva N, Lachman HM, Shafit-Zagardo B. Survey for 

CAG repeat polymorphisms in the human MAP-2 gene. 

Psychiatr Genet. 1999 Mar;9(1):43-6 

Shafit-Zagardo B, Kress Y, Zhao ML, Lee SC. A novel 

microtubule-associated protein-2 expressed in 

oligodendrocytes in multiple sclerosis lesions. J 

Neurochem. 1999 Dec;73(6):2531-7 

Teng J, Takei Y, Harada A, Nakata T, Chen J, Hirokawa N. 

Synergistic effects of MAP2 and MAP1B knockout in 

neuronal migration, dendritic outgrowth, and microtubule 

organization. J Cell Biol. 2001 Oct 1;155(1):65-76 

Cristofanilli M, Thanos S, Brosius J, Kindler S, Tiedge H. 

Neuronal MAP2 mRNA: species-dependent differential 

dendritic targeting competence. J Mol Biol. 2004 Aug 

20;341(4):927-34 

Dehmelt L, Halpain S. The MAP2/Tau family of 

microtubule-associated proteins. Genome Biol. 

2005;6(1):204 

Soltani MH, Pichardo R, Song Z, Sangha N, Camacho F, 

Satyamoorthy K, Sangueza OP, Setaluri V. Microtubuleassociated 

protein 2, a marker of neuronal differentiation, 

induces mitotic defects, inhibits growth of melanoma cells, 

and predicts metastatic potential of cutaneous melanoma. 

Am J Pathol. 2005 Jun;166(6):1841-50 

Iqbal K, Liu F, Gong CX, Alonso Adel C, Grundke-Iqbal I. 

Mechanisms of tau-induced neurodegeneration. Acta 

Neuropathol. 2009 Jul;118(1):53-69 


Jayanthy A, Setaluri V. MAP2 (microtubule-associated 

protein 2). Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):85-89. 





Review 

MIR200C (microRNA 200c) 

Sarah Jurmeister, Stefan Uhlmann, Özgür Sahin 


Division of Molecular Genome Analysis, German Cancer Research Center (DKFZ), Division of 

Molecular Genome Analysis, Im Neuenheimer Feld 580, Heidelberg, Germany (SJ, SU, ÖS) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR200CID51054ch12p13.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR200CID51054ch12p13.txt 



Identity 

Other names: hsa-mir-200c, MIRN200C, mir-200c 

HGNC (Hugo): MIR200C 


Local order: Based on Mapviewer Genes on 

Sequence, genes flanking MIRN200C oriented 

from centromere to telomere on 12q13.31 are: 

- ATN1; Atrophin 1, 12q13.31 

- U7; U7 small nuclear 1, 12q13.31 

- C12orf57; Chromosome 12 open reading frame 

57, 12q13.31 

- PTPN6; Protein tyrosine phosphatase, nonreceptor 

type 6, 12q13.31 

- MIRN200C; microRNA 200c, 12q13.31 

- MIRN141; microRNA 141, 12q13.31 

- snoU89; small nucleolar RNA U89, 12q31.1 

- PHB2; Prohibitin 2, 12q31.1 

DNA/RNA 

Description 

miR-200c belongs to the miR-200 family, which 

consists of 5 members with two different 

chromosomal locations: miR-200c and miR-141 are 

A. Stem-loop structure of hsa-mir-200c (precursor miRNA). 

located on chromosome 12p13 and miR-200a, miR- 

200b and miR-429 are located on 1p36. This family 

is frequently downregulated upon the progression 

of tumors and maps to fragile chromosomal 

regions. Members of this family are important 

regulators of epithelial-to-mesenchymal transition 

(EMT) and metastasis. 

Transcription 

miRNAs are generally transcribed by RNA 

polymerase II. 

hsa-mir-200c (precursor miRNA) 

Accession: MI0000650 

Length: 68 bp 

Sequence:5'-CCCUCGUCUUACCCAGCAGUG 

UUUGGGUGCGGUUGGGAGUCUCUAAUACU 

GCCGGGUAAUGAUGGAGG-3' 

hsa-miR-200c (mature miRNA) 

Accession: MIMAT0000617 

Length: 23 

Sequence: 5'-UAAUACUGCCGGGUAAUGAU 

GGA-3' 

Pseudogene 

No reported pseudogenes. 


MIR200C (microRNA 200c) Jurmeister S, et al. 

B. The miR-200 family members. The human miR-200 family is located in two fragile chromosomal regions on 1p36.33 (200b, 

200a and 429) and 12p13.31 (200c and 141), respectively. It consists of two clusters based on seed sequence similarity: miR- 

200bc/429 (red) and 200a/141 (blue), distinguished by a single nucleotide change (U to C). (Source: Uhlmann et al., 2010, 

Oncogene). 

Protein 

Note 

microRNAs are not translated into amino acids. 

Mutations 

Note 

Gene mutations have not been described. 

Implicated in 

Bladder cancer 

Prognosis 

Loss of miR-200c expression was found to be 

associated with disease progression and poor 

outcome in 100 stage T1 bladder tumor patients 

(Wiklund et al., 2011). 

Oncogenesis 

Deep sequencing of nine bladder urothelial 

carcinomas and matched normal urothelium 

revealed that the miR-200c/141 cluster is 

upregulated in bladder cancer (Han et al., 2011). 

Consistently, a study comparing miRNA expression 

patterns by microarray in 27 invasive and 30 

superficial bladder tumors with 11 normal urothelia 

found that miR-200c was upregulated in bladder 

tumors compared to normal urothelium; however, 

expression of miR-200c was reduced in invasive 

compared to non-invasive tumors due to promoter 

hypermethylation (Wiklund et al., 2011). 

Furthermore, microarray miRNA analysis of 43 

primary tumors (10 colon, 10 bladder, 13 breast and 

10 lung cancers) and matched lymph node 

metastases revealed that miR-200c and other miR- 

200 family members are downregulated in 

metastases compared to primary tumors (Baffa et 

al., 2009). This suggests that while miR-200c may 

have oncogenic function in bladder cancer, it 

interferes with invasion and metastasis. 

Mechanistically, miR-200c has been implicated in 

the regulation of epithelial-to-mesenchymal 

transition (EMT) in bladder cancer cells. A 

comparison of nine bladder cancer cell lines 

revealed a correlation between high expression of 

miR-200c (and fellow miR-200 family member 

miR-200b) and epithelial phenotype (Adam et al., 

2009). The same study also reported that miR-200c 

expression reverses resistance to anti-EGFR 

therapy in bladder cancer cell lines through 

targeting ERRFI-1. 

Breast cancer 

Oncogenesis 

A double-negative feedback loop between ZEB 

family transcription factors and the miR-200 family 

was shown to regulate EMT in different cell 

systems, including breast cancer cells (Burk et al., 

2008). Moreover, expression of miR-200c was 

revealed to be activated by p53, resulting in 

induction of EMT in mammary epithelial cells upon 

loss of p53 (Chang et al., 2011). Loss of p53 was 

positively correlated with expression of ZEB1 and 

negatively correlated with expression of miR-200c 

and E-Cadherin in 106 breast tumor specimens. 

miRNA microarray analysis of 43 primary tumors 

(10 colon, 10 bladder, 13 breast and 10 lung 

cancers) and matched lymph node metastases 

revealed that miR-200c and other miR-200 family 

members are downregulated in metastases 

compared to primary tumors (Baffa et al., 2009). 

Moreover, miR-200c and other miR-200 family 

members were shown to be underexpressed in the 

aggressive claudin-low subtype of breast cancer, 

which displays an EMT-like gene expression 

signature (Herschkowitz et al., 2011). In contrast, 

luminal breast cancers, which have a more 

epithelial-like phenotype and a better clinical 

prognosis, express high levels of miR-200c 

(Bockmeyer et al., 2011). 

Re-expression of the miR-200 family in aggressive 

breast cancer cells was shown to inhibit 

experimental lung metastasis (Ahmad et al., 2011). 

In contrast, another study reported that miR-200c 

promotes colonization of breast cancer cells 

(Dykxhoorn et al., 2009). In in vitro assays, miR- 

200c suppresses migration and invasion of breast 

cancer cells through various mechanisms, including 

targeting of ZEB1/ZEB2, PLCG1, moesin and 

fibronectin (Korpal et al., 2008; Uhlmann et al., 

2010; Howe et al., 2011). 

miR-200c also targets stem cell factors such as 

BMI1, and downregulation of miR-200c was shown 

to be characteristic of breast cancer stem cells 

(Shimono et al., 2009). Furthermore, miRNA 

microarray analysis revealed that miR-200c is 



downregulated in breast cancer cells with acquired 

resistance to cisplatin (Pogribny et al., 2010). 

Colorectal cancer 

Prognosis 

Kaplan-Meier survival analysis of 24 colorectal 

cancer patients suggested that high expression of 

miR-200c was associated with decreased overall 

survival (Xi et al., 2006). 

Oncogenesis 

Analysis of miR-200c expression in 24 colorectal 

cancer biopsies and matched normal samples by 

qRT-PCR revealed that miR-200c is overexpressed 

in colorectal tumors compared to normal tissue (Xi 

et al., 2006). Furthermore, microarray miRNA 

analysis of 43 primary tumors (10 colon, 10 

bladder, 13 breast and 10 lung cancers) and 

matched lymph node metastases revealed that miR- 

200c and other miR-200 family members are 

downregulated in metastases compared to primary 

tumors (Baffa et al., 2009). 

Endometrial cancer 

Disease 

Endometrial carcinoma; endometrial 

carcinosarcoma. 

Oncogenesis 

miRNA microarray analysis of four endometrial 

endometrioid carcinomas and four normal 

endometrial tissue samples showed that miR-200c 

and other miR-200 family members were 

overexpressed in cancerous compared to normal 

tissue (Lee et al., 2011). Inhibition of miR-200c 

decreased the growth of endometrial carcinoma 

cells (Lee et al., 2011). In contrast, an analysis of 

miR-200c expression levels in five endometrial 

cancer and normal endometrial cell lines suggested 

that miR-200c is lower in cell lines derived from 

aggressive cancer compared to those derived from 

less aggressive cancer or normal endometrial 

epithelium (Cochrane et al., 2009). Restoration of 

miR-200c expression in aggressive endometrial 

cancer cells reduced their migration and invasion 

and increased their sensitivity to microtubuletargeting 

chemotherapeutic agents, at least in part 

through targeting TUBB3 (Cochrane et al., 2009; 

Cochrane et al., 2010; Howe et al., 2011). In a panel 

of 23 endometrial carcinosarcomas, which are 

composed of mixed populations of epithelial-like 

and mesenchymal-like cells, miR-200c and other 

miR-200 family members were found to be 

downregulated in the mesenchymal components of 

the tumors compared to the epithelial components 

(Castilla et al., 2011); this is consistent with the 

established role of the miR-200 family in 

suppression of epithelial-to-mesenchymal 

transition. 

Esophageal cancer 

Prognosis 

In a panel of 98 esophageal cancer patients treated 

with preoperative chemotherapy and surgery, 

expression of miR-200c was associated with 

shortened overall survival and poor response to 

chemotherapy, potentially through upregulation of 

the Akt signaling pathway (Hamano et al., 2011). 

Oncogenesis 

qRT-PCR analysis of miR-200 expression levels in 

17 patients with Barrett's esophagus and 20 patients 

with esophageal adenocarcinoma indicated that 

miR-200c is downregulated during cancer 

progression from normal epithelium through 

Barrett's esophagus to esophageal adenocarcinoma 

(Smith et al., 2011). In contrast, another study on 

98 esophageal cancer patients treated with 

preoperative chemotherapy and surgery found that 

miR-200c was expressed at higher levels in the 

tumor than in normal tissue (Hamano et al., 2011). 

Germ cell tumors 

Disease 

Germinoma; yolk sac tumors. 

Oncogenesis 

Diagnosis. Microarray analysis of 25 germ cell 

tumors and subsequent validation by qRT-PCR in 

10 independent samples identified miR-200c as 

overexpressed in yolk sac tumors compared to 

germinoma (Murray et al., 2010). 

Head and neck cancer 

Disease 

Squamous cell carcinoma; spindle cell carcinoma. 

Oncogenesis 

miR-200c was significantly downregulated in a 

panel of 30 spindle cell carcinomas (which display 

a mesenchymal-like phenotype) compared to 

normal mucosa as determined by qRT-PC (Zidar et 

al., 2011). In contrast, expression levels of miR- 

200c in 30 squamous cell carcinomas were 

comparable to normal tissue. 

Liver cancer 

Oncogenesis 

Diagnosis. Due to its low expression in liver 

compared to other tissues, miR-200c has been 

suggested as a biomarker to distinguish 

hepatocellular carcinoma from liver metastases 

(Barshack et al., 2010). 

miRNA microarray analysis of 92 primary 

hepatocellular carcinomas and 9 hepatocellular 

carcinoma cell lines identified miR-200c as a 

microRNA that is upregulated by p53 (Kim et al., 

2011). Increased expression of miR-200c results in 

downregulation of transcriptional repressors ZEB1 



and ZEB2, suggesting a role for p53-mediated 

regulation of miR-200c in suppression of EMT. 

miR-200c was reported to be underexpressed in 

benign liver tumors compared to hepatocellular 

carcinoma (Ladeiro et al., 2008); miR-200c levels 

were determined by qRT-PCR in two sets of tumors 

(first set: 18 benign tumors, 28 hepatocellular 

carcinomas; second set: 12 benign tumors, 22 

hepatocellular carcinomas). 

Lung cancer 

Prognosis 

qRT-PCR analysis of miR-200c expression levels 

in 70 non-small cell lung cancer (NSCLC) patients 

revealed that high expression of miR-200c was 

associated with reduced overall survival (Liu et al., 

2011). 

Oncogenesis 

Treatment of immortalized human bronchial 

epithelial cells with tobacco carcinogens was shown 

to induce an EMT-like phenotype and stem-cell like 

properties (Tellez et al., 2011). Quantification of 

miRNA levels by qRT-PCR in combination with 

bisulfite sequencing and chromatin 

immunoprecipitation revealed that these changes 

are accompanied by epigenetic silencing of miR- 

200c and other EMT-regulating microRNAs, 

suggesting that loss of miR-200c contributes to 

transformation of lung epithelial cells. In contrast, 

miRNA microarray analysis of six NSCLCs and 

matched adjacent normal tissue revealed that miR- 

200c is upregulated in NSCLC compared to healthy 

tissue (Liu et al., 2011). This finding was further 

validated in 70 lung carcinomas and matched 

normal tissue by qRT-PCR. 

Several studies have reported that miR-200c can 

repress invasion and metastasis of lung cancer cells. 

Firstly, low expression of miR-200c and other miR- 

200 family members was associated with increased 

metastatic potential in a syngeneic mouse model of 

lung adenocarcinoma, and re-expression of miR- 

200 family members in these cell lines prevented 

EMT and metastasis (Gibbons et al., 2009). 

Secondly, miR-200c was shown to be 

downregulated by promoter hypermethylation in 

invasive NSCLC cell lines, and re-expression of 

miR-200c reduced the invasive potential of these 

cell lines (Ceppi et al., 2010). Furthermore, 

microarray miRNA analysis of 43 primary tumors 

(10 colon, 10 bladder, 13 breast and 10 lung 

cancers) and matched lymph node metastases 

revealed that miR-200c and other miR-200 family 

members are downregulated in metastases 

compared to primary tumors (Baffa et al., 2009). 

Finally, low expression of miR-200c in 69 primary 

lung tumors was correlated with lymph node 

metastases (Ceppi et al., 2010). 

Mechanistically, the Notch ligand Jagged2 was 

shown to suppress expression of miR-200 family 

members, resulting in induction of EMT and 

increased metastatic potential (Yang et al., 2011). 

Moreover, miR-200c and fellow miR-200 family 

member miR-200b target VEGFR, which also 

contributes to invasion and metastasis (Roybal et 

al., 2011). 

Malignant pleural mesothelioma 

Oncogenesis 

Diagnosis. miR-200c has been proposed as a 

biomarker to distinguish malignant pleural 

mesothelioma from lung adenocarcinoma and lung 

metastases of other carcinomas. miRNA microarray 

expression profiling of 10 lung adenocarcinomas 

and 15 mesotheliomas revealed that miR-200c is 

reduced in mesothelioma (Gee et al., 2010). This 

result was further confirmed by qRT-PCR in a set 

of 100 mesotheliomas and 32 lung 

adenocarcinomas. Similarly, microRNA microarray 

analysis of 7 malignant pleural mesotheliomas and 

97 carcinomas of various origins also identified 

miR-200c as underexpressed in mesotheliomas 

compared to the carcinoma samples, and 

differential expression levels of miR-200c and two 

other microRNAs could successfully be used to 

distinguish between malignant pleural 

mesothelioma and other types of cancer (Benjamin 

et al., 2010). 

Melanoma 

Oncogenesis 

Analysis of miR-200c expression levels in a panel 

of 10 melanoma cell lines by qRT-PCR showed that 

miR-200c is overexpressed in many of these cell 

lines compared to normal melanocytes (Elson- 

Schwab et al., 2010). Overexpression of miR-200c 

in melanoma cell lines resulted in a shift towards 

amoeboid type of migration, possibly through 

targeting of MARCKS. 

Ovarian cancer 

Prognosis 

High expression of miR-200c was found to be 

correlated with decreased progression-free and 

overall survival in a panel of 20 serous ovarian 

cancer patients (Nam et al., 2008). In contrast, a 

study investigating microRNA expression profiles 

in a total of 144 patients with epithelial ovarian 

cancer found that low expression of miR-200c was 

associated with increased progression-free and 

overall survival (Marchini et al., 2011). Similarly, 

high expression of miR-200c was correlated with 

response to chemotherapy and decreased risk of 

disease recurrence in a panel of 57 patients with 

serous ovarian carcinoma (Leskela et al., 2010). 

Oncogenesis 

miR-200c was found to be overexpressed in a panel 

of 20 serous ovarian carcinomas compared to 8 

normal ovarian tissues by miRNA microarray 

analysis (Nam et al., 2008). Similarly, increased 

expression of miR-200c compared to normal ovary 

(n=15) was reported for serous, endometroid and 



clear cell ovarian carcinoma in a series of 69 cancer 

specimens. 

Expression of miR-200c was correlated with E- 

Cadherin levels in 36 primary ovarian carcinomas 

(Park et al., 2008). The regulatory effect of miR- 

200c on EMT has been shown to be mediated 

through targeting of ZEB1 and ZEB2, which 

transcriptionally repress E-Cadherin (Gregory et al., 

2008; Korpal et al., 2008; Park et al., 2008). Reexpression 

of miR-200c in aggressive ovarian 

cancer cell lines was shown to reduce their 

migratory capacity; however, this effect appears to 

be independent of E-Cadherin expression 

(Cochrane et al., 2010). Furthermore, forced 

expression of miR-200c has been reported to 

sensitize ovarian cancer cells to paclitaxel treatment 

due to downregulation of miR-200c target gene 

TUBB3 (Cochrane et al., 2009; Cochrane et al., 

2010). 

miR-200c was also shown to be downregulated in a 

subpopulation of the ovarian cancer cell line 

OVCAR3 expressing the cancer stem cell marker 

CD133 (Guo et al., 2011). 

Pancreatic cancer 

Prognosis 

In a panel of 99 pancreatic cancer patients, high 

expression of miR-200c was associated with 

increased overall survival (Yu et al., 2010). 

Oncogenesis 

Downregulation of miR-200c and other miR-200 

family members has been observed in gemcitabineresistant 

pancreatic cancer cell lines (Li et al., 2009; 

Ali et al., 2010). miR-200c has also been suggested 

to have a stemness-inhibiting function in pancreatic 

cancer cells through targeting of stem cell factors 

such as Bmi1 (Wellner et al., 2009). 

A double-negative feedback loop between ZEB 

family transcription factors and the miR-200 family 

was shown to regulate EMT in different cell 

systems, including pancreatic cancer cells (Burk et 

al., 2008). Consistently, high expression of miR- 

200c was shown to be associated with decreased 

invasive behavior in a panel of six pancreatic 

cancer cell lines, and miR-200c expression was 

correlated with E-Cadherin levels in pancreatic 

cancer specimens and cell lines (Yu et al., 2010). 

Overexpression of miR-200c in pancreatic cancer 

cell lines resulted in upregulation of E-Cadherin 

expression and reduced invasion but stimulated 

proliferation. 

miRNA expression profiling of various stages in a 

mouse model of multistep tumorigenesis of the 

pancreas revealed that miR-200c is downregulated 

in metastases and metastasis-like tumors (Olson et 

al., 2009). Moreover, miR-200c also targets 

components of the Notch pathway, which is 

aberrantly activated in pancreatic cancer (Brabletz 

et al., 2011). Undifferentiated, aggressive 

pancreatic adenocarcinomas were shown to have 

higher expression of ZEB1 and Notch pathway 

components and lower expression of miR-200c 

compared to differentiated tumors. 

In contrast to the studies described above, which 

suggest a metastasis-suppressing function for miR- 

200c in pancreatic cancer, a comparison of 16 

pancreatic ductal adenocarcinoma cell lines found 

that miR-200c expression was upregulated in the 

highly metastatic cell lines (Mees et al., 2010). 

Prostate cancer 

Oncogenesis 

Prostate cancer cells with EMT phenotype were 

found to have stem-cell like properties and express 

low levels of miR-200 family members (Kong et 

al., 2010). Overexpression of miR-200c reversed 

EMT and stem-cell like properties, in part due to 

targeting of Notch-1. miR-200c was also shown to 

target the Notch ligand Jagged1, resulting in 

decreased proliferation of metastatic prostate cancer 

cells (Vallejo et al., 2011). 

Renal cancer 

Disease 

Clear cell carcinoma (CCC); Chromophobe renal 

cell carcinoma (ChCC). 

Oncogenesis 

Diagnosis. miR-200c has been found to be 

specifically expressed in chromophobe renal cell 

carcinoma and has been suggested as one of a set of 

microRNAs that can be used to distinguish between 

renal cell carcinoma subtypes (Fridman et al., 

2010). 

miR-200c was found to be significantly 

downregulated in clear cell carcinoma compared to 

normal kidney in a panel of 16 CCCs, 4 ChCCs and 

6 normal kidneys both by microarray analysis and 

by qRT-PCR (Nakada et al., 2008). Furthermore, 

miR-200c expression was inversely correlated with 

expression of its target gene ZEB1 in these 

specimens. The downregulation of miR-200c in 

CCC was also confirmed by a second study 

comparing a total of 25 clear cell carcinomas and 

matched adjacent normal tissue (Liu et al., 2010). 

Thyroid carcinoma 

Oncogenesis 

The expression of miR-200 family members, 

including miR-200c, was found to be 

downregulated in undifferentiated, aggressive 

anaplastic thyroid carcinoma compared to both 

normal tissue and well-differentiated papillary and 

follicular thyroid carcinomas (Braun et al., 2010). 

Overexpression of the miR-200 family induced 

mesenchymal-to-epithelial transition and reduced 

invasion of ATC cells. 



Various cancers 

References 

miR-200c target genes regulate numerous processes involved in cancer development and progression. 

Xi Y, Formentini A, Chien M, Weir DB, Russo JJ, Ju J, 

Kornmann M, Ju J. Prognostic Values of microRNAs in 

Colorectal Cancer. Biomark Insights. 2006;2:113-121 

Burk U, Schubert J, Wellner U, Schmalhofer O, Vincan E, 

Spaderna S, Brabletz T. A reciprocal repression between 

ZEB1 and members of the miR-200 family promotes EMT 

and invasion in cancer cells. EMBO Rep. 2008 

Jun;9(6):582-9 

Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, 

Farshid G, Vadas MA, Khew-Goodall Y, Goodall GJ. The 

miR-200 family and miR-205 regulate epithelial to 

mesenchymal transition by targeting ZEB1 and SIP1. Nat 

Cell Biol. 2008 May;10(5):593-601 

Korpal M, Lee ES, Hu G, Kang Y. The miR-200 family 

inhibits epithelial-mesenchymal transition and cancer cell 

migration by direct targeting of E-cadherin transcriptional 

repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 

30;283(22):14910-4 

Ladeiro Y, Couchy G, Balabaud C, Bioulac-Sage P, 

Pelletier L, Rebouissou S, Zucman-Rossi J. MicroRNA 

profiling in hepatocellular tumors is associated with clinical 

features and oncogene/tumor suppressor gene mutations. 

Hepatology. 2008 Jun;47(6):1955-63 

Nakada C, Matsuura K, Tsukamoto Y, Tanigawa M, 

Yoshimoto T, Narimatsu T, Nguyen LT, Hijiya N, Uchida T, 

Sato F, Mimata H, Seto M, Moriyama M. Genome-wide 

microRNA expression profiling in renal cell carcinoma: 

significant down-regulation of miR-141 and miR-200c. J 

Pathol. 2008 Dec;216(4):418-27 

Nam EJ, Yoon H, Kim SW, Kim H, Kim YT, Kim JH, Kim 

JW, Kim S. MicroRNA expression profiles in serous 

ovarian carcinoma. Clin Cancer Res. 2008 May 

1;14(9):2690-5 

Park SM, Gaur AB, Lengyel E, Peter ME. The miR-200 

family determines the epithelial phenotype of cancer cells 

by targeting the E-cadherin repressors ZEB1 and ZEB2. 

Genes Dev. 2008 Apr 1;22(7):894-907 

Adam L, Zhong M, Choi W, Qi W, Nicoloso M, Arora A, 

Calin G, Wang H, Siefker-Radtke A, McConkey D, Bar-Eli 

M, Dinney C. miR-200 expression regulates epithelial-tomesenchymal 

transition in bladder cancer cells and 

reverses resistance to epidermal growth factor receptor 

therapy. Clin Cancer Res. 2009 Aug 15;15(16):5060-72 

Baffa R, Fassan M, Volinia S, O'Hara B, Liu CG, Palazzo 

JP, Gardiman M, Rugge M, Gomella LG, Croce CM, 

Rosenberg A. MicroRNA expression profiling of human 

metastatic cancers identifies cancer gene targets. J Pathol. 

2009 Oct;219(2):214-21 

Cochrane DR, Spoelstra NS, Howe EN, Nordeen SK, 

Richer JK. MicroRNA-200c mitigates invasiveness and 

restores sensitivity to microtubule-targeting 

chemotherapeutic agents. Mol Cancer Ther. 2009 

May;8(5):1055-66 

Dykxhoorn DM, Wu Y, Xie H, Yu F, Lal A, Petrocca F, 

Martinvalet D, Song E, Lim B, Lieberman J. miR-200 

enhances mouse breast cancer cell colonization to form 

distant metastases. PLoS One. 2009 Sep 29;4(9):e7181 

Gibbons DL, Lin W, Creighton CJ, Rizvi ZH, Gregory PA, 

Goodall GJ, Thilaganathan N, Du L, Zhang Y, Pertsemlidis 

A, Kurie JM. Contextual extracellular cues promote tumor 



cell EMT and metastasis by regulating miR-200 family 

expression. Genes Dev. 2009 Sep 15;23(18):2140-51 

Li Y, VandenBoom TG 2nd, Kong D, Wang Z, Ali S, Philip 

PA, Sarkar FH. Up-regulation of miR-200 and let-7 by 

natural agents leads to the reversal of epithelial-tomesenchymal 

transition in gemcitabine-resistant 

pancreatic cancer cells. Cancer Res. 2009 Aug 

15;69(16):6704-12 

Olson P, Lu J, Zhang H, Shai A, Chun MG, Wang Y, Libutti 

SK, Nakakura EK, Golub TR, Hanahan D. MicroRNA 

dynamics in the stages of tumorigenesis correlate with 

hallmark capabilities of cancer. Genes Dev. 2009 Sep 

15;23(18):2152-65 

Shimono Y, Zabala M, Cho RW, Lobo N, Dalerba P, Qian 

D, Diehn M, Liu H, Panula SP, Chiao E, Dirbas FM, Somlo 

G, Pera RA, Lao K, Clarke MF. Downregulation of miRNA- 

200c links breast cancer stem cells with normal stem cells. 

Cell. 2009 Aug 7;138(3):592-603 

Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, 

Sonntag A, Waldvogel B, Vannier C, Darling D, zur 

Hausen A, Brunton VG, Morton J, Sansom O, Schüler J, 

Stemmler MP, Herzberger C, Hopt U, Keck T, Brabletz S, 

Brabletz T. The EMT-activator ZEB1 promotes 

tumorigenicity by repressing stemness-inhibiting 

microRNAs. Nat Cell Biol. 2009 Dec;11(12):1487-95 

Ali S, Ahmad A, Banerjee S, Padhye S, Dominiak K, 

Schaffert JM, Wang Z, Philip PA, Sarkar FH. Gemcitabine 

sensitivity can be induced in pancreatic cancer cells 

through modulation of miR-200 and miR-21 expression by 

curcumin or its analogue CDF. Cancer Res. 2010 May 

1;70(9):3606-17 

Benjamin H, Lebanony D, Rosenwald S, Cohen L, Gibori 

H, Barabash N, Ashkenazi K, Goren E, Meiri E, 

Morgenstern S, Perelman M, Barshack I, Goren Y, 

Edmonston TB, Chajut A, Aharonov R, Bentwich Z, 

Rosenfeld N, Cohen D. A diagnostic assay based on 

microRNA expression accurately identifies malignant 

pleural mesothelioma. J Mol Diagn. 2010 Nov;12(6):771-9 

Barshack I, Meiri E, Rosenwald S, Lebanony D, Bronfeld 

M, Aviel-Ronen S, Rosenblatt K, Polak-Charcon S, 

Leizerman I, Ezagouri M, Zepeniuk M, Shabes N, Cohen 

L, Tabak S, Cohen D, Bentwich Z, Rosenfeld N. 

Differential diagnosis of hepatocellular carcinoma from 

metastatic tumors in the liver using microRNA expression. 

Int J Biochem Cell Biol. 2010 Aug;42(8):1355-62 

Braun J, Hoang-Vu C, Dralle H, Hüttelmaier S. 

Downregulation of microRNAs directs the EMT and 

invasive potential of anaplastic thyroid carcinomas. 

Oncogene. 2010 Jul 22;29(29):4237-44 

Ceppi P, Mudduluru G, Kumarswamy R, Rapa I, Scagliotti 

GV, Papotti M, Allgayer H. Loss of miR-200c expression 

induces an aggressive, invasive, and chemoresistant 

phenotype in non-small cell lung cancer. Mol Cancer Res. 

2010 Sep;8(9):1207-16 

Cochrane DR, Howe EN, Spoelstra NS, Richer JK. Loss of 

miR-200c: A Marker of Aggressiveness and 

Chemoresistance in Female Reproductive Cancers. J 

Oncol. 2010;2010:821717 

Elson-Schwab I, Lorentzen A, Marshall CJ. MicroRNA-200 

family members differentially regulate morphological 

plasticity and mode of melanoma cell invasion. PLoS One. 

2010 Oct 4;5(10) 

Fridman E, Dotan Z, Barshack I, David MB, Dov A, Tabak 

S, Zion O, Benjamin S, Benjamin H, Kuker H, Avivi C, 

Rosenblatt K, Polak-Charcon S, Ramon J, Rosenfeld N, 

Spector Y. Accurate molecular classification of renal 

tumors using microRNA expression. J Mol Diagn. 2010 

Sep;12(5):687-96 

Gee GV, Koestler DC, Christensen BC, Sugarbaker DJ, 

Ugolini D, Ivaldi GP, Resnick MB, Houseman EA, Kelsey 

KT, Marsit CJ. Downregulated microRNAs in the 

differential diagnosis of malignant pleural mesothelioma. 

Int J Cancer. 2010 Dec 15;127(12):2859-69 

Kong D, Banerjee S, Ahmad A, Li Y, Wang Z, Sethi S, 

Sarkar FH. Epithelial to mesenchymal transition is 

mechanistically linked with stem cell signatures in prostate 

cancer cells. PLoS One. 2010 Aug 27;5(8):e12445 

Leskelä S, Leandro-García LJ, Mendiola M, Barriuso J, 

Inglada-Pérez L, Muñoz I, Martínez-Delgado B, Redondo 

A, de Santiago J, Robledo M, Hardisson D, Rodríguez- 

Antona C. The miR-200 family controls beta-tubulin III 

expression and is associated with paclitaxel-based 

treatment response and progression-free survival in 

ovarian cancer patients. Endocr Relat Cancer. 

2011;18(1):85-95 

Liu H, Brannon AR, Reddy AR, Alexe G, Seiler MW, 

Arreola A, Oza JH, Yao M, Juan D, Liou LS, Ganesan S, 

Levine AJ, Rathmell WK, Bhanot GV. Identifying mRNA 

targets of microRNA dysregulated in cancer: with 

application to clear cell Renal Cell Carcinoma. BMC Syst 

Biol. 2010 Apr 27;4:51 

Mees ST, Mardin WA, Wendel C, Baeumer N, Willscher E, 

Senninger N, Schleicher C, Colombo-Benkmann M, Haier 

J. EP300--a miRNA-regulated metastasis suppressor gene 

in ductal adenocarcinomas of the pancreas. Int J Cancer. 

2010 Jan 1;126(1):114-24 

Murray MJ, Saini HK, van Dongen S, Palmer RD, 

Muralidhar B, Pett MR, Piipari M, Thornton CM, Nicholson 

JC, Enright AJ, Coleman N. The two most common 

histological subtypes of malignant germ cell tumour are 

distinguished by global microRNA profiles, associated with 

differential transcription factor expression. Mol Cancer. 

2010 Nov 8;9:290 

Pogribny IP, Filkowski JN, Tryndyak VP, Golubov A, 

Shpyleva SI, Kovalchuk O. Alterations of microRNAs and 

their targets are associated with acquired resistance of 

MCF-7 breast cancer cells to cisplatin. Int J Cancer. 2010 

Oct 15;127(8):1785-94 

Uhlmann S, Zhang JD, Schwäger A, Mannsperger H, 

Riazalhosseini Y, Burmester S, Ward A, Korf U, Wiemann 

S, Sahin O. miR-200bc/429 cluster targets PLCgamma1 

and differentially regulates proliferation and EGF-driven 

invasion than miR-200a/141 in breast cancer. Oncogene. 

2010 Jul 29;29(30):4297-306 

Yu J, Ohuchida K, Mizumoto K, Sato N, Kayashima T, 

Fujita H, Nakata K, Tanaka M. MicroRNA, hsa-miR-200c, 

is an independent prognostic factor in pancreatic cancer 

and its upregulation inhibits pancreatic cancer invasion but 

increases cell proliferation. Mol Cancer. 2010 Jun 28;9:169 

Ahmad A, Aboukameel A, Kong D, Wang Z, Sethi S, Chen 

W, Sarkar FH, Raz A. Phosphoglucose 

isomerase/autocrine motility factor mediates epithelialmesenchymal 

transition regulated by miR-200 in breast 

cancer cells. Cancer Res. 2011 May 1;71(9):3400-9 

Bockmeyer CL, Christgen M, Müller M, Fischer S, Ahrens 

P, Länger F, Kreipe H, Lehmann U. MicroRNA profiles of 

healthy basal and luminal mammary epithelial cells are 

distinct and reflected in different breast cancer subtypes. 

Breast Cancer Res Treat. 2011 Mar 17; 

Brabletz S, Bajdak K, Meidhof S, Burk U, Niedermann G, 

Firat E, Wellner U, Dimmler A, Faller G, Schubert J, 

Brabletz T. The ZEB1/miR-200 feedback loop controls 

Notch signalling in cancer cells. EMBO J. 2011 Feb 

16;30(4):770-82 

Castilla MÁ, Moreno-Bueno G, Romero-Pérez L, Van De 

Vijver K, Biscuola M, López-García MÁ, Prat J, Matías- 



Guiu X, Cano A, Oliva E, Palacios J. Micro-RNA signature 

of the epithelial-mesenchymal transition in endometrial 

carcinosarcoma. J Pathol. 2011 Jan;223(1):72-80 

Chang CJ, Chao CH, Xia W, Yang JY, Xiong Y, Li CW, Yu 

WH, Rehman SK, Hsu JL, Lee HH, Liu M, Chen CT, Yu D, 

Hung MC. p53 regulates epithelial-mesenchymal transition 

and stem cell properties through modulating miRNAs. Nat 

Cell Biol. 2011 Mar;13(3):317-23 

Guo R, Wu Q, Liu F, Wang Y. Description of the CD133+ 

subpopulation of the human ovarian cancer cell line 

OVCAR3. Oncol Rep. 2011 Jan;25(1):141-6 

Hamano R, Miyata H, Yamasaki M, Kurokawa Y, Hara J, 

Moon JH, Nakajima K, Takiguchi S, Fujiwara Y, Mori M, 

Doki Y. Overexpression of miR-200c induces 

chemoresistance in esophageal cancers mediated through 

activation of the Akt signaling pathway. Clin Cancer Res. 

2011 May 1;17(9):3029-38 

Han Y, Chen J, Zhao X, Liang C, Wang Y, Sun L, Jiang Z, 

Zhang Z, Yang R, Chen J, Li Z, Tang A, Li X, Ye J, Guan 

Z, Gui Y, Cai Z. MicroRNA expression signatures of 

bladder cancer revealed by deep sequencing. PLoS One. 

2011 Mar 28;6(3):e18286 

Herschkowitz JI, Zhao W, Zhang M, Usary J, Murrow G, 

Edwards D, Knezevic J, Greene SB, Darr D, Troester MA, 

Hilsenbeck SG, Medina D, Perou CM, Rosen JM. 

Comparative oncogenomics identifies breast tumors 

enriched in functional tumor-initiating cells. Proc Natl Acad 

Sci U S A. 2011 Jun 1; 

Howe EN, Cochrane DR, Richer JK. Targets of miR-200c 

mediate suppression of cell motility and anoikis resistance. 

Breast Cancer Res. 2011 Apr 18;13(2):R45 

Kim T, Veronese A, Pichiorri F, Lee TJ, Jeon YJ, Volinia S, 

Pineau P, Marchio A, Palatini J, Suh SS, Alder H, Liu CG, 

Dejean A, Croce CM. p53 regulates epithelialmesenchymal 

transition through microRNAs targeting 

ZEB1 and ZEB2. J Exp Med. 2011 May 9;208(5):875-83 

Lee JW, Park YA, Choi JJ, Lee YY, Kim CJ, Choi C, Kim 

TJ, Lee NW, Kim BG, Bae DS. The expression of the 

miRNA-200 family in endometrial endometrioid carcinoma. 

Gynecol Oncol. 2011 Jan;120(1):56-62 

Liu XG, Zhu WY, Huang YY, Ma LN, Zhou SQ, Wang YK, 

Zeng F, Zhou JH, Zhang YK. High expression of serum 

miR-21 and tumor miR-200c associated with poor 

prognosis in patients with lung cancer. Med Oncol. 2011 

Apr 24; 

Marchini S, Cavalieri D, Fruscio R, Calura E, Garavaglia D, 

Nerini IF, Mangioni C, Cattoretti G, Clivio L, Beltrame L, 

Katsaros D, Scarampi L, Menato G, Perego P, Chiorino G, 

Buda A, Romualdi C, D'Incalci M. Association between 

miR-200c and the survival of patients with stage I epithelial 

ovarian cancer: a retrospective study of two independent 

tumour tissue collections. Lancet Oncol. 2011 

Mar;12(3):273-85 

Roybal JD, Zang Y, Ahn YH, Yang Y, Gibbons DL, Baird 

BN, Alvarez C, Thilaganathan N, Liu DD, Saintigny P, 

Heymach JV, Creighton CJ, Kurie JM. miR-200 Inhibits 

lung adenocarcinoma cell invasion and metastasis by 

targeting Flt1/VEGFR1. Mol Cancer Res. 2011 

Jan;9(1):25-35 

Smith CM, Watson DI, Leong MP, Mayne GC, Michael MZ, 

Wijnhoven BP, Hussey DJ. miR-200 family expression is 

downregulated upon neoplastic progression of Barrett's 

esophagus. World J Gastroenterol. 2011 Feb 

28;17(8):1036-44 

Tellez CS, Juri DE, Do K, Bernauer AM, Thomas CL, 

Damiani LA, Tessema M, Leng S, Belinsky SA. EMT and 

stem cell-like properties associated with miR-205 and miR- 

200 epigenetic silencing are early manifestations during 

carcinogen-induced transformation of human lung 

epithelial cells. Cancer Res. 2011 Apr 15;71(8):3087-97 

Vallejo DM, Caparros E, Dominguez M. Targeting Notch 

signalling by the conserved miR-8/200 microRNA family in 

development and cancer cells. EMBO J. 2011 Feb 

16;30(4):756-69 

Wiklund ED, Bramsen JB, Hulf T, Dyrskjøt L, Ramanathan 

R, Hansen TB, Villadsen SB, Gao S, Ostenfeld MS, Borre 

M, Peter ME, Ørntoft TF, Kjems J, Clark SJ. Coordinated 

epigenetic repression of the miR-200 family and miR-205 

in invasive bladder cancer. Int J Cancer. 2011 Mar 

15;128(6):1327-34 

Yang Y, Ahn YH, Gibbons DL, Zang Y, Lin W, 

Thilaganathan N, Alvarez CA, Moreira DC, Creighton CJ, 

Gregory PA, Goodall GJ, Kurie JM. The Notch ligand 

Jagged2 promotes lung adenocarcinoma metastasis 

through a miR-200-dependent pathway in mice. J Clin 

Invest. 2011 Apr 1;121(4):1373-85 

Zidar N, Boštjančič E, Gale N, Kojc N, Poljak M, Glavač D, 

Cardesa A. Down-regulation of microRNAs of the miR-200 

family and miR-205, and an altered expression of classic 

and desmosomal cadherins in spindle cell carcinoma of 

the head and neck--hallmark of epithelial-mesenchymal 

transition. Hum Pathol. 2011 Apr;42(4):482-8 


Jurmeister S, Uhlmann S, Sahin Ö. MIR200C (microRNA 

200c). Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):90-97. 





Mini Review 

PXN (paxillin) 



Department of Otolaryngology-Head and Neck Surgery, University of Arkansas for Medical Sciences, 

AR 72205, USA (TP, BCJrS) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/PXNID41953ch12q24.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PXNID41953ch12q24.txt 



Identity 

Other names: FLJ16691 

HGNC (Hugo): PXN 

Location: 12q24.23 

Local order: Information about the local order of 

PXN can be found at ensembl.org. 

DNA/RNA 

Description 

The PXN gene is 55.314 kb and consists of 12 

exons. This gene is a member of the Human CCDS 

set: CCDS44996, CCDS44997, CCDS44998. 

Transcription 

The transcript is 3788 base pairs long. 4 isoforms 

have been identified. 

Pseudogene 

Not known. 

Protein 

Description 

4 isoforms have been identified by alternative 

splicing. The 1st isoform is the normal variant and 

is comprised of 591 AA and weighs 68 kDa. The 

amino terminus region contains 5 LD-motifs, while 

the carboxy terminus contains 4 LIM-zinc binding 

domains. The protein also contains a proline rich 

region and several potential phosphorylation sites. 

Expression 

Epithelium. 

Localisation 

Found in the cytoplasm closely apposed to the 

plasma membrane at sites of focal adhesion to the 

extracellular matrix. 


PXN (paxillin) Pierson T, Stack BCJr 

Function 

Focal adhesion protein: This protein is a 

cytoskeletal component involved in focal actinmembrane 

attachments to the extracellular matrix. 

PXN can interact with multiple structural molecules 

and regulatory proteins to modulate adhesion, 

motility and survival of the cell by changing actin 

dynamics. Some PXN binding proteins have 

oncogenic equivalents, allowing cells to bypass 

normal adhesion and GF signaling cascades. 

Regulation: PXN activity is regulated by various 

kinases. Adhesion and GF's stimulate these kinases 

to phosphorylate LD motifs or LIM domains. 

Molecules such as Vinculin, FAK and SRC 

phosphorylate tyrosine residues of the N-terminal 

LD motifs. This results in recruitment of 

downstream effectors (like CRK) to mediate 

changes in cell motility or in modulation of gene 

expression via MAPK pathways. N-terminal serine 

phosphorylation has also been identified. 

Phosphorylation of serine and threonine residues of 

C-terminal LIM domains results in recruitment to 

focal adhesions. Identification of the C-terminal 

kinases is currently under investigation. 

Abbreviations: CRK (CT10 sarcoma oncogene 

cellular homolog ); FAK (focal adhesion kinase); 

GF (growth factor); MAPK (mitogen activated 

protein kinase); SRC (Rous sarcoma oncogene 

cellular homolog). 

Homology 

Member of the paxillin family, containing the 4 

LIM-zinc binding domains. 

Mutations 

Germinal 

Not known. 

Somatic 

Several single nucleotide polymorphisms have been 

identified. Point mutations between the LD1 and 

LD2 motifs have been associated with lung cancer, 

the A127T mutation being the most frequent 

mutation (Jagadeeswaran, et al., 2008). 

Implicated in 

Head and neck cancers 

Note 

PXN overexpression has been reported in various 

head and neck cancers (Li et al., 2008; Dai et al., 

2010; Shi et al., 2010). Metallopanstimulin-1 

expression has been associated with reduced PXN 

levels and tumor growth rate (Dai et al., 2010). 

Lung cancer 

Note 

A significant correlation was found between the 

presence of the A127T mutation between the LD1 

and LD2 regions of PXN with non small cell lung 

cancer (Jagadeeswaran et al., 2008). A possible 

mechanism is that mutations between the LD1 and 

2 regions confer resistance to calpain mediated 

proteolysis of PXN (Cortesio et al., 2011). 

However, two later studies did not find this 

mutation to exist in lung cancer or any other solid 

tumor (Pallier et al., 2009; Kim et al., 2011). 

Overexpression of PXN in non small cell lung 

cancer has been reported with less controversy 

(Jagadeeswaran et al., 2008; Zhao et al., 2010; 

Mackinnon et al., 2011). The overexpression could 

possibly be due to rearrangements on chromosome 

12 (Wu et al., 2010). 

Breast cancer 

Note 

Metastatic potential was found to be directly related 

to PXN levels (Cai et al., 2010). The relationship 

between PXN and Her-2 expression is 

controversial. A study in 2007 found a direct 

relationship between the 2 markers (Short et al., 

2007) while a 2011 study found no such link 

(Panousis et al., 2011). 


Note 

PXN up regulation was found to promote adhesion 

and motility of prostate cancer cells (Bokobza et al., 

2010). 

To be noted 

Note 

The link between PXN mutations and increased 

growth rate and invasion of cancer cells is 

controversial. On the contrary, amplification and/or 

overexpression of PXN has been consistently 

reported in the literature. 

References 

Sattler M, Pisick E, Morrison PT, Salgia R. Role of the 

cytoskeletal protein paxillin in oncogenesis. Crit Rev 

Oncog. 2000;11(1):63-76 

Brown MC, Turner CE. Paxillin: adapting to change. 

Physiol Rev. 2004 Oct;84(4):1315-39 

Conway WC, Van der Voort van Zyp J, Thamilselvan V, 

Walsh MF, Crowe DL, Basson MD. Paxillin modulates 

squamous cancer cell adhesion and is important in 

pressure-augmented adhesion. J Cell Biochem. 2006 Aug 

15;98(6):1507-16 

Short SM, Yoder BJ, Tarr SM, Prescott NL, Laniauskas S, 

Coleman KA, Downs-Kelly E, Pettay JD, Choueiri TK, 

Crowe JP, Tubbs RR, Budd TG, Hicks DG. The expression 

of the cytoskeletal focal adhesion protein paxillin in breast 

cancer correlates with HER2 overexpression and may help 

predict response to chemotherapy: a retrospective 

immunohistochemical study. Breast J. 2007 Mar- 

Apr;13(2):130-9 

Deakin NO, Turner CE. Paxillin comes of age. J Cell Sci. 

2008 Aug 1;121(Pt 15):2435-44 


PXN (paxillin) Pierson T, Stack BCJr 

Jagadeeswaran R, Surawska H, Krishnaswamy S, 

Janamanchi V, Mackinnon AC, Seiwert TY, Loganathan S, 

Kanteti R, Reichman T, Nallasura V, Schwartz S, Faoro L, 

Wang YC, Girard L, Tretiakova MS, Ahmed S, Zumba O, 

Soulii L, Bindokas VP, Szeto LL, Gordon GJ, Bueno R, 

Sugarbaker D, Lingen MW, Sattler M, Krausz T, 

Vigneswaran W, Natarajan V, Minna J, Vokes EE, 

Ferguson MK, Husain AN, Salgia R. Paxillin is a target for 

somatic mutations in lung cancer: implications for cell 

growth and invasion. Cancer Res. 2008 Jan 1;68(1):132- 

42 

Li BZ, Lei W, Zhang CY, Zhou F, Li N, Shi SS, Feng XL, 

Chen ZL, Hang J, Qiu B, Wan JT, Shao K, Xing XZ, Tan 

XG, Wang Z, Xiong MH, He J. Increased expression of 

paxillin is found in human oesophageal squamous cell 

carcinoma: a tissue microarray study. J Int Med Res. 2008 

Mar-Apr;36(2):273-8 

Sheibani N, Tang Y, Sorenson CM. Paxillin's LD4 motif 

interacts with bcl-2. J Cell Physiol. 2008 Mar;214(3):655- 

61 

Pallier K, Houllier AM, Le Corre D, Cazes A, Laurent-Puig 

P, Blons H. No somatic genetic change in the paxillin gene 

in nonsmall-cell lung cancer. Mol Carcinog. 2009 

Jul;48(7):581-5 

Bokobza SM, Ye L, Kynaston HG, Jiang WG. Growth and 

differentiation factor-9 promotes adhesive and motile 

capacity of prostate cancer cells by up-regulating FAK and 

Paxillin via Smad dependent pathway. Oncol Rep. 2010 

Dec;24(6):1653-9 

Dai Y, Pierson SE, Dudney WC, Stack BC Jr. 

Extraribosomal function of metallopanstimulin-1: reducing 

paxillin in head and neck squamous cell carcinoma and 

inhibiting tumor growth. Int J Cancer. 2010 Feb 

1;126(3):611-9 

Cai H, Zhang T, Tang WX, Li SL. [Expression of paxillin in 

breast cancer cell with high and low metastatic 

potentiality]. Sichuan Da Xue Xue Bao Yi Xue Ban. 2010 

Jan;41(1):91-4 

Shi J, Wang S, Zhao E, Shi L, Xu X, Fang M. Paxillin 

expression levels are correlated with clinical stage and 

metastasis in salivary adenoid cystic carcinoma. J Oral 

Pathol Med. 2010 Aug 1;39(7):548-51 

Wu DW, Cheng YW, Wang J, Chen CY, Lee H. Paxillin 

predicts survival and relapse in non-small cell lung cancer 

by microRNA-218 targeting. Cancer Res. 2010 Dec 

15;70(24):10392-401 

Zhao Y, Zhang X, Guda K, Lawrence E, Sun Q, Watanabe 

T, Iwakura Y, Asano M, Wei L, Yang Z, Zheng W, Dawson 

D, Willis J, Markowitz SD, Satake M, Wang Z. Identification 

and functional characterization of paxillin as a target of 

protein tyrosine phosphatase receptor T. Proc Natl Acad 

Sci U S A. 2010 Feb 9;107(6):2592-7 

Cortesio CL, Boateng LR, Piazza TM, Bennin DA, 

Huttenlocher A. Calpain-mediated proteolysis of paxillin 

negatively regulates focal adhesion dynamics and cell 

migration. J Biol Chem. 2011 Mar 25;286(12):9998-10006 

Kim MS, Yoo NJ, Lee SH. Absence of paxillin gene 

mutation in lung cancer and other common solid cancers. 

Tumori. 2011 Mar-Apr;97(2):211-3 

Mackinnon AC, Tretiakova M, Henderson L, Mehta RG, 

Yan BC, Joseph L, Krausz T, Husain AN, Reid ME, Salgia 

R. Paxillin expression and amplification in early lung 

lesions of high-risk patients, lung adenocarcinoma and 

metastatic disease. J Clin Pathol. 2011 Jan;64(1):16-24 

Panousis D, Patsouris E, Lagoudianakis E, Pappas A, 

Kyriakidou V, Voulgaris Z, Xepapadakis G, Manouras A, 

Athanassiadou AM, Athanassiadou P. The value of 

TOP2A, EZH2 and paxillin expression as markers of 

aggressive breast cancer: relationship with other 

prognostic factors. Eur J Gynaecol Oncol. 2011;32(2):156- 

9 


Pierson T, Stack BCJr. PXN (paxillin). Atlas Genet 

Cytogenet Oncol Haematol. 2012; 16(2):98-100. 





Mini Review 

RPS27 (ribosomal protein S27) 



Department of Otolaryngology-Head and Neck Surgery, University of Arkansas for Medical Sciences, 

AR 72205, USA (TP, BCJrS) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/RPS27ID45550ch1q21.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI RPS27ID45550ch1q21.txt 



Identity 

Other names: MPS-1, MPS1, S27 

HGNC (Hugo): RPS27 


Local order: Human RPS27 is found on 

chromosome 1: 153963235 - 153964626 bp from 

pter. Information about the local order for RPS27 

can be found at ensembl.org. Four transcripts have 

been identified, but only the first will be discussed 

below. 

DNA/RNA 

Description 

The RPS27 gene is comprised of 1.39 kb and 

consists of 4 exons. This gene is a member of the 

Human CCDS set: CCDS1059. 

Transcription 

The transcript is 350 base pairs long. 

Pseudogene 

Multiple RPS27 pseudogenes are dispersed 

throughout the genome. The RPS27L pseudogene, 

located at 15q22.2, is known to encode a protein 

that shares 96% of its amino acid sequence with 

RPS27 (Balasubramanian et al., 2009). 

Protein 

Description 

RPS27 is a 9461 Da protein composed of 84 amino 

acids. The protein contains a C4 zinc finger 

domain, similar to steroid and thyroid hormones, 

which enables DNA binding. RPS27 is found in 

both the cytoplasm and the nucleus. 

Expression 

Ubiquitous expression. Expressed at high levels in 

actively dividing cells and in cancers of ectodermal 

origin, as well as in melanoma (Fernandez-Pol et 

al., 1993). When overexpressed, it is secreted into 

serum (Lee et al., 2004). 

Function 

1. Component of the 40S ribosomal subunit in the 

cytoplasm: ribosomes carry out translation of 

proteins. The eukaryotic ribosome is made up of a 

small 40S and a large 60S subunit. Together these 

subunits are comprised of 4 different rRNA species 

and almost 80 different RP's (ribosomal proteins). 

As a component of the 40S subunit, RPS27 is found 

near RPS18 and covalently bound to translation 

initiation factor eIF3. 

2. A mediator of cellular proliferation and survival: 

expression is induced by a variety of growth factors 

and other signaling molecules, including TGF-beta 

and cAMP; RPS27 can bind to cAMP response 

elements of DNA (Fernandez-Pol et al., 1993). 

3. Oncogenesis (see below). 

Homology 

Member of the ribosomal protein S27e family. 

Mutations 

Note 

Single nucleotide polymorphisms have been 

identified, but have not been linked to disease. 


RPS27 (ribosomal protein S27) Pierson T, Stack BCJr 

Implicated in 

Various carcinomas and melanoma 

Note 

RPS27 overexpression has been reported in many 

cancers including prostate cancer (Fernandez-Pol et 

al., 1997), colorectal cancer (Ganger et al., 1997), 

liver cancer (Ganger et al., 2001), breast cancer 

(Atsuta et al., 2002), head and neck squamous cell 

cancer (HNSCC) (Stack et al., 1999; Stack et al., 

2004; Lee et al., 2004), gastric cancer (Wang, et al., 

2006), as well as, melanoma (Santa Cruz et al., 

1997). 

Since high serum levels of RPS27 have been found 

in cancer patients, especially in head and neck 

squamous cell carcinoma (HNSCC), the protein can 

be used as a tumor marker (Fernandez-Pol et al., 

1996; Lee et al., 2004; Stack et al. 2004). 

Prognosis 

It was reported that RPS27 levels correlate with 

tumor stage in patients with gastric cancer, thus 

high levels serve as a poor prognostic indicator 

(Wang et al., 2006). 

Oncogenesis 

The mechanism behind RPS27 overexpression is 

currently under investigation. One explanation 

recently offered arises from the relationship 

between RPS27, MDM2 and p53: RPS27 is a p53 

repressible protein (He and Sun, 2007; Li et al., 

2007). A 2011 study found that it competes with 

p53 for a central acidic binding domain on MDM2. 

Once bound, MDM2 is stimulated to ubiquinate and 

degrade the RPS27 or p53, whichever it is bound 

to. When RPS27 levels are elevated, it can outcompete 

p53 for MDM2 binding and subsequent 

degradation, thus stabilizing p53 levels. This would 

be an appropriate cellular response to genotoxic 

stress. The same study also found that mutant p53 

cannot suppress RPS27, only the wild-type can. 

Since mutated p53 is found in almost 50% of all 

human cancers, RPS27 overexpression logically 

follows. Furthermore, stabilization of mutant p53 

levels associated with RPS27 abundance could 

provide malignant cells with a growth advantage 

(Xiong et al., 2011). 

RPS27 knockdown was found to enhance 

spontaneous apoptosis of tumor cells via caspase-3 

activation (Wang et al., 2006; Yang et al., 2011). 

HNSCC: some have questioned if RPS27 

overexpression is the cause or result of cancer. A 

2010 study overexpressed RPS27 in a line of 

HNSCC cells to study the impact on tumor 

behavior. They found that RPS27 overexpression 

resulted in reduced cancer cell growth, proliferation 

rate and angiogenesis. RPS27 overexpression was 

also found to reduce the mRNA of Paxillin, a focal 

adhesion protein up regulated in HNSCC and many 

other cancer cells. RPS27 induced Paxillin 

repression offers a possible explanation for the 

decreased HNSCC growth (Dai et al., 2010). 

References 

Fernandez-Pol JA, Klos DJ, Hamilton PD. A growth factorinducible 

gene encodes a novel nuclear protein with zinc 

finger structure. J Biol Chem. 1993 Oct 5;268(28):21198- 

204 

Fernandez-Pol JA, Fletcher JW, Hamilton PD, Klos DJ. 

Expression of metallopanstimulin and oncogenesis in 

human prostatic carcinoma. Anticancer Res. 1997 May- 

Jun;17(3A):1519-30 

Ganger DR, Hamilton PD, Fletcher JW, Fernandez-Pol JA. 

Metallopanstimulin is overexpressed in a patient with 

colonic carcinoma. Anticancer Res. 1997 May- 

Jun;17(3C):1993-9 

Santa Cruz DJ, Hamilton PD, Klos DJ, Fernandez-Pol JA. 

Differential expression of metallopanstimulin/S27 

ribosomal protein in melanocytic lesions of the skin. J 

Cutan Pathol. 1997 Oct;24(9):533-42 

Stack BC Jr, Dalsaso TA, Lee C Jr, Lowe VJ, Hamilton 

PD, Fletcher JW, Fernandez-Pol JA. Overexpression of 

MPS antigens by squamous cell carcinomas of the head 

and neck: immunohistochemical and serological 

correlation with FDG positron emission tomography. 

Anticancer Res. 1999 Nov-Dec;19(6C):5503-10 

Ganger DR, Hamilton PD, Klos DJ, Jakate S, McChesney 

L, Fernandez-Pol JA. Differential expression of 

metallopanstimulin/S27 ribosomal protein in hepatic 

regeneration and neoplasia. Cancer Detect Prev. 

2001;25(3):231-6 

Atsuta Y, Aoki N, Sato K, Oikawa K, Nochi H, Miyokawa N, 

Hirata S, Kimura S, Sasajima T, Katagiri M. Identification 

of metallopanstimulin-1 as a member of a tumor 

associated antigen in patients with breast cancer. Cancer 

Lett. 2002 Aug 8;182(1):101-7 

Lee WJ, Keefer K, Hollenbeak CS, Stack BC Jr. A new 

assay to screen for head and neck squamous cell 

carcinoma using the tumor marker metallopanstimulin. 

Otolaryngol Head Neck Surg. 2004 Oct;131(4):466-71 

Stack BC Jr, Hollenbeak CS, Lee CM, Dunphy FR, Lowe 

VJ, Hamilton PD. Metallopanstimulin as a marker for head 

and neck cancer. World J Surg Oncol. 2004 Dec 14;2:45 

Gilkes DM, Chen L, Chen J. MDMX regulation of p53 

response to ribosomal stress. EMBO J. 2006 Nov 

29;25(23):5614-25 

Wang YW, Qu Y, Li JF, Chen XH, Liu BY, Gu QL, Zhu ZG. 

In vitro and in vivo evidence of metallopanstimulin-1 in 

gastric cancer progression and tumorigenicity. Clin Cancer 

Res. 2006 Aug 15;12(16):4965-73 

He H, Sun Y. Ribosomal protein S27L is a direct p53 target 

that regulates apoptosis. Oncogene. 2007 Apr 

26;26(19):2707-16 

Li J, Tan J, Zhuang L, Banerjee B, Yang X, Chau JF, Lee 

PL, Hande MP, Li B, Yu Q. Ribosomal protein S27-like, a 

p53-inducible modulator of cell fate in response to 

genotoxic stress. Cancer Res. 2007 Dec 1;67(23):11317- 

26 

Balasubramanian S, Zheng D, Liu YJ, Fang G, Frankish A, 

Carriero N, Robilotto R, Cayting P, Gerstein M. 

Comparative analysis of processed ribosomal protein 

pseudogenes in four mammalian genomes. Genome Biol. 

2009;10(1):R2 

Dai Y, Pierson SE, Dudney WC, Stack BC Jr. 

Extraribosomal function of metallopanstimulin-1: reducing 


RPS27 (ribosomal protein S27) Pierson T, Stack BCJr 

paxillin in head and neck squamous cell carcinoma and 

inhibiting tumor growth. Int J Cancer. 2010 Feb 

1;126(3):611-9 

Xiong X, Zhao Y, He H, Sun Y. Ribosomal protein S27-like 

and S27 interplay with p53-MDM2 axis as a target, a 

substrate and a regulator. Oncogene. 2011 Apr 

14;30(15):1798-811 

Yang ZY, Qu Y, Zhang Q, Wei M, Liu CX, Chen XH, Yan 

M, Zhu ZG, Liu BY, Chen GQ, Wu YL, Gu QL. Knockdown 

of metallopanstimulin-1 inhibits NF-κB signaling at different 

levels: The role of apoptosis induction of gastric cancer 

cells. Int J Cancer. 2011 Jul 27; 


Pierson T, Stack BCJr. RPS27 (ribosomal protein S27). 

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(2):101- 

103. 





Review 


STAT5B (signal transducer and activator of 

transcription 5B) 

Amanda M Del Rosario, Teresa M Bernaciak, Corinne M Silva 

Department of Biological Engineering, Massachusetts Institute of Technology, 77 Massachusetts 

Avenue, Cambridge, MA 02139, USA (AMDR), NIAID/NIH/DHHS, 6610 Rockledge Drive, 

Bethesda, MD 20817, USA (TMB), DEM/NIDDK/NIH, 6707 Democracy Blvd, Bethesda, MD 

20892, USA (CMS) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/STAT5BID217ch17q21.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI STAT5BID217ch17q21.txt 



Identity 

Other names: STAT5 

HGNC (Hugo): STAT5B 


DNA/RNA 

Description 

The STAT5b gene is composed of 77229 base pairs 

and contains 19 exons. As exon 1 contains only the 

5' UTR, there are 18 coding exons. The mRNA is 

composed of 5090 base pairs. 

Transcription 

There is one major transcript. 

The STAT5b gene. The STAT5b gene is composed of 19 exons that are transcribed as a 5090 nucleotide RNA transcript. The 

RNA is translated into the STAT5b protein containing 787 amino acids. 


STAT5B (signal transducer and activator of transcription 5B) Del Rosario AM, et al. 

Schematic of the STAT5b protein. The STAT5b protein contains several conserved domains: the coiled-coil domain, the DNA 

binding domain, the SH2 domain, and the carboxy-terminal transactivation domain. While phosphorylation of Y699 is required for 

transcriptional activity, there are multiple tyrosine and serine phosphorylation sites that have been identified under specific 

conditions and in certain cell types. 

Protein 

Note 

STAT5b is composed of 787 amino acids (92 kD). 

Description 

STAT5b is a member of the signal transducer and 

activator of transcription (STAT) family. The 

STAT proteins contain several conserved domains: 

the coiled-coil domain, the DNA binding domain, 

the SH2 domain, and the carboxy-terminal 

transactivation domain. STATs remain latent in the 

cytoplasm until the binding of a cytokine or growth 

factor to its receptor, resulting in recruitment of the 

STAT to the ligand receptor complex (Levy and 

Darnell, 2002; Herrington et al., 1999; Heim et al., 

1995). The STAT protein is then phosphorylated by 

receptor tyrosine kinases or non-receptor tyrosine 

kinases, such as Janus kinases (JAKs) and Src 

family members. This phosphorylation results in 

SH2 domain mediated dimerization of STATs and 

their translocation to the nucleus. In the nucleus, 

STAT dimers bind to consensus DNA sequences 

and recruit additional transcription machinery to 

initiate specific gene regulation. To date, seven 

members of the STAT family have been identified 

(STAT1, STAT2, STAT3, STAT4, STAT5a, 

STAT5b, and STAT6) (Silva, 2004; Calò et al., 

2003; Moriggl et al., 1996; Liu et al., 1996; Liu et 

al., 1997). 

STAT5b is activated by a variety of stimuli, 

including interleukins, erythropoietin, growth 

hormone (GH), prolactin (Prl), and epidermal 

growth factor (EGF). Activation of STAT5b results 

in phosphorylation of tyrosine 699. Phosphorylation 

of this tyrosine is required for DNA binding and 

transcriptional activity. Mutation of Y699 of 

STAT5b inhibits stimulant-induced tyrosine 

phosphorylation, DNA binding, and transcriptional 

activity (Gebert et al., 1997; Gouilleux et al., 1994; 

Kloth et al., 2003). Additional tyrosine 

phosphorylation sites (Y679, Y725, Y740, and 

Y743) and serine phosphorylation sites (S715, 

S731) have been shown to alter STAT5b 

transcriptional activity (Kloth et al., 2002; Weaver 

and Silva, 2006; Yamashita et al., 2001; Park et al., 

2001; Decker and Kovarik, 2000). 

While no classic nuclear localization signal (NLS) 

composed of a cluster of basic amino acids has been 

reported for the STAT5b, the STAT5b dimer is 

actively translocated through the nuclear pore 

complex and accumulates in the nucleus upon 

phosphorylation (Xu and Massagué, 2004). 

STAT5b can be negatively regulated by 

phosphatase-mediated dephosphorylation, 

ubiquitination-promoting proteosome degradation, 

or by negative feedback loops. 

Expression 

Ubiquitous. 

Localisation 

STAT5b is localized in the cytoplasm and 

translocates to the nucleus upon phosphorylation of 

Y699. However, unphosphorylated STAT5b has 

also been reported to be found in the nucleus 

(Brown and Zeidler, 2008; Iyer and Reich, 2008; 

Zeng et al., 2002). 

Function 

Transcription factor. STAT5b mediates the 

transcription of numerous genes in various cell 

signaling pathways involved in cellular 

proliferation, differentiation, and cell survival. The 

STATs bind TTC(N3)GAA gamma-interferonactivating 

sequence (GAS) sites in the promoters of 

target genes. 

Homology 

Shares homology with the other STAT family 

members (STAT1, 2, 3, 4, 5a, and 6). Additionally, 

STAT5a and STAT5b are 94% similar at the amino 

acid level, differing primarily at the C-terminus 

(Teglund et al., 1998; Silva et al., 1996; Lin et al., 

1996; Liu et al., 1995). 

Mutations 

Note 

To date, there are 6 reported cases of humans 

having a mutant STAT5b, and these cases result 

from five different STAT5b mutations. The first 

STAT5b mutation in a human to be reported was 

the A630P STAT5b mutant. This single point 

mutation in the SH2 domain causes missfolding of 

STAT5b. A nonsense mutation in the coiled-coil 



domain (R152X) results in the absence of 

detectable STAT5b protein. Insertion of a 

nucleotide in the DBD at position 1102 

(Q368fsX376) or 1191 (N398E) causes a frameshift 

mutation resulting in a non-functional truncated 

STAT5b. Likewise, a single nucleotide deletion in 

the linker domain at position 1680 (E561R) also 

results in a truncated STAT5b. In each of the 6 

cases, STAT5b protein is not detectable, but 

STAT5a protein levels are unchanged. These 

reports are from homozygous patients while the 

parents are heterozygous for the STAT5b mutation 

and display a normal phenotype. The phenotype of 

each STAT5b mutant is similar: pronounced short 

stature, growth hormone insensitivity despite 

normal to high levels of GH in the serum, and 

extremely low IGF-I and IGFBP-3 levels (Chia et 

al., 2006; Hwa et al., 2007; Nadeau et al., 2011). 

Implicated in 

Solid tumors 

Note 

STAT5b is implicated in prostate cancer (Koptyra 

et al., 2011; Clevenger, 2004), breast cancer 

(Bernaciak et al., 2009; Peck et al., 2011; Strauss et 

al., 2006; Sultan et al., 2005; Yamashita et al., 

2003), lung cancer (Sánchez-Ceja et al., 2006), 

head and neck cancer (Koppikar et al., 2008), 

ovarian cancer (Chen et al., 2004), hepatocellular 

carcinoma (Lee et al., 2006), cervical cancer (Lopez 

et al., 2011), and colorectal cancer (Du et al., 2011). 

Leukemias and lymphomas 

Note 

STAT5b is involved in the proliferation of chronic 

myeloid leukemia (CML) and acute myeloid 

leukemia (AML) cells (Baśkiewicz-Masiuk and 

Machalińkski, 2004; Sternberg and Gilliland, 2004; 

Hoover et al., 2001; de Groot et al., 1999). 

Additionally, STAT5b has been found to fuse with 

the retinoic acid receptor-alpha (RARalpha) gene in 

a subset of acute promyelocytic leukemias (APLL) 

(Arnould et al., 1999). Furthermore, STAT5b plays 

a role in the development of lymphoblastic 

lymphoma (Bessette et al., 2008; Nieborowska- 

Skorska et al., 2001). 

Laron type dwarfism II 

Note 

Laron type dwarfism II (LTD2) is mediated by 

defects in STAT5b (Nadeau et al., 2011; Freeth et 

al., 1998; Chia et al., 2006). 

Graft-versus-host disease 

Note 

Constitutively active STAT5b increases expansion 

of regulatory T cells (Treg), and these Tregs are 

more potent suppressors of graft-versus-host 

disease in vivo, compared to wild-type Tregs 

(Vogtenhuber et al., 2010). 

Crohn's disease/colitis 

Note 

Growth hormone reduces mucosal inflammation in 

colitis by activating STAT5b, such that STAT5b 

deficient mice demonstrated more severe colitis 

compared to wild-type mice (Han et al., 2006). 

Diabetes and metabolic disorder 

Note 

Upon leptin stimulation, the leptin receptor can 

mediate STAT5b tyrosine phosphorylation and 

transcriptional activity in the liver, gastrointestinal 

tract, and brain (Mütze et al., 2007; Ghilardi et al., 

1996; Gong et al., 2007). 

References 

Gouilleux F, Wakao H, Mundt M, Groner B. Prolactin 

induces phosphorylation of Tyr694 of Stat5 (MGF), a 

prerequisite for DNA binding and induction of transcription. 

EMBO J. 1994 Sep 15;13(18):4361-9 

Heim MH, Kerr IM, Stark GR, Darnell JE Jr. Contribution of 

STAT SH2 groups to specific interferon signaling by the 

Jak-STAT pathway. Science. 1995 Mar 3;267(5202):1347- 

9 

Liu X, Robinson GW, Gouilleux F, Groner B, 

Hennighausen L. Cloning and expression of Stat5 and an 

additional homologue (Stat5b) involved in prolactin signal 

transduction in mouse mammary tissue. Proc Natl Acad 

Sci U S A. 1995 Sep 12;92(19):8831-5 

Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, 

Skoda RC. Defective STAT signaling by the leptin receptor 

in diabetic mice. Proc Natl Acad Sci U S A. 1996 Jun 

25;93(13):6231-5 

Lin JX, Mietz J, Modi WS, John S, Leonard WJ. Cloning of 

human Stat5B. Reconstitution of interleukin-2-induced 

Stat5A and Stat5B DNA binding activity in COS-7 cells. J 

Biol Chem. 1996 May 3;271(18):10738-44 

Liu X, Robinson GW, Hennighausen L. Activation of Stat5a 

and Stat5b by tyrosine phosphorylation is tightly linked to 

mammary gland differentiation. Mol Endocrinol. 1996 

Dec;10(12):1496-506 

Moriggl R, Gouilleux-Gruart V, Jähne R, Berchtold S, 

Gartmann C, Liu X, Hennighausen L, Sotiropoulos A, 

Groner B, Gouilleux F. Deletion of the carboxyl-terminal 

transactivation domain of MGF-Stat5 results in sustained 

DNA binding and a dominant negative phenotype. Mol Cell 

Biol. 1996 Oct;16(10):5691-700 

Silva CM, Lu H, Day RN. Characterization and cloning of 

STAT5 from IM-9 cells and its activation by growth 

hormone. Mol Endocrinol. 1996 May;10(5):508-18 

Gebert CA, Park SH, Waxman DJ. Regulation of signal 

transducer and activator of transcription (STAT) 5b 

activation by the temporal pattern of growth hormone 

stimulation. Mol Endocrinol. 1997 Apr;11(4):400-14 

Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw- 

Boris A, Hennighausen L. Stat5a is mandatory for adult 

mammary gland development and lactogenesis. Genes 

Dev. 1997 Jan 15;11(2):179-86 

Freeth JS, Silva CM, Whatmore AJ, Clayton PE. Activation 

of the signal transducers and activators of transcription 

signaling pathway by growth hormone (GH) in skin 

fibroblasts from normal and GH binding protein-positive 

Laron Syndrome children. Endocrinology. 1998 

Jan;139(1):20-8 



Teglund S, McKay C, Schuetz E, van Deursen JM, 

Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, 

Ihle JN. Stat5a and Stat5b proteins have essential and 

nonessential, or redundant, roles in cytokine responses. 

Cell. 1998 May 29;93(5):841-50 

de Groot RP, Raaijmakers JA, Lammers JW, Jove R, 

Koenderman L. STAT5 activation by BCR-Abl contributes 

to transformation of K562 leukemia cells. Blood. 1999 Aug 

1;94(3):1108-12 

Herrington J, Rui L, Luo G, Yu-Lee LY, Carter-Su C. A 

functional DNA binding domain is required for growth 

hormone-induced nuclear accumulation of Stat5B. J Biol 

Chem. 1999 Feb 19;274(8):5138-45 

Yamashita H, Nevalainen MT, Xu J, LeBaron MJ, Wagner 

KU, Erwin RA, Harmon JM, Hennighausen L, Kirken RA, 

Rui H. Role of serine phosphorylation of Stat5a in 

prolactin-stimulated beta-casein gene expression. Mol Cell 

Endocrinol. 2001 Oct 25;183(1-2):151-63 

Arnould C, Philippe C, Bourdon V, Gr goire MJ, Berger R, 

Jonveaux P. The signal transducer and activator of 

transcription STAT5b gene is a new partner of retinoic acid 

receptor alpha in acute promyelocytic-like leukaemia. Hum 

Mol Genet. 1999 Sep;8(9):1741-9 

Decker T, Kovarik P. Serine phosphorylation of STATs. 

Oncogene. 2000 May 15;19(21):2628-37 

Hoover RR, Gerlach MJ, Koh EY, Daley GQ. Cooperative 

and redundant effects of STAT5 and Ras signaling in 

BCR/ABL transformed hematopoietic cells. Oncogene. 

2001 Sep 13;20(41):5826-35 

Nieborowska-Skorska M, Slupianek A, Xue L, Zhang Q, 

Raghunath PN, Hoser G, Wasik MA, Morris SW, Skorski T. 

Role of signal transducer and activator of transcription 5 in 

nucleophosmin/ anaplastic lymphoma kinase-mediated 

malignant transformation of lymphoid cells. Cancer Res. 

2001 Sep 1;61(17):6517-23 

Park SH, Yamashita H, Rui H, Waxman DJ. Serine 

phosphorylation of GH-activated signal transducer and 

activator of transcription 5a (STAT5a) and STAT5b: impact 

on STAT5 transcriptional activity. Mol Endocrinol. 2001 

Dec;15(12):2157-71 

Kloth MT, Catling AD, Silva CM. Novel activation of 

STAT5b in response to epidermal growth factor. J Biol 

Chem. 2002 Mar 8;277(10):8693-701 

Levy DE, Darnell JE Jr. Stats: transcriptional control and 

biological impact. Nat Rev Mol Cell Biol. 2002 

Sep;3(9):651-62 

Zeng R, Aoki Y, Yoshida M, Arai K, Watanabe S. Stat5B 

shuttles between cytoplasm and nucleus in a cytokinedependent 

and -independent manner. J Immunol. 2002 

May 1;168(9):4567-75 

Calò V, Migliavacca M, Bazan V, Macaluso M, Buscemi M, 

Gebbia N, Russo A. STAT proteins: from normal control of 

cellular events to tumorigenesis. J Cell Physiol. 2003 

Nov;197(2):157-68 

Kloth MT, Laughlin KK, Biscardi JS, Boerner JL, Parsons 

SJ, Silva CM. STAT5b, a Mediator of Synergism between 

c-Src and the Epidermal Growth Factor Receptor. J Biol 

Chem. 2003 Jan 17;278(3):1671-9 

Yamashita H, Iwase H, Toyama T, Fujii Y. Naturally 

occurring dominant-negative Stat5 suppresses 

transcriptional activity of estrogen receptors and induces 

apoptosis in T47D breast cancer cells. Oncogene. 2003 

Mar 20;22(11):1638-52 

Baśkiewicz-Masiuk M, Machaliński B. The role of the 

STAT5 proteins in the proliferation and apoptosis of the 

CML and AML cells. Eur J Haematol. 2004 Jun;72(6):420- 

9 

Chen H, Ye D, Xie X, Chen B, Lu W. VEGF, VEGFRs 

expressions and activated STATs in ovarian epithelial 

carcinoma. Gynecol Oncol. 2004 Sep;94(3):630-5 

Clevenger CV. Roles and regulation of stat family 

transcription factors in human breast cancer. Am J Pathol. 

2004 Nov;165(5):1449-60 

Silva CM. Role of STATs as downstream signal 

transducers in Src family kinase-mediated tumorigenesis. 

Oncogene. 2004 Oct 18;23(48):8017-23 

Sternberg DW, Gilliland DG. The role of signal transducer 

and activator of transcription factors in leukemogenesis. J 

Clin Oncol. 2004 Jan 15;22(2):361-71 

Xu L, Massagué J. Nucleocytoplasmic shuttling of signal 

transducers. Nat Rev Mol Cell Biol. 2004 Mar;5(3):209-19 

Sultan AS, Xie J, LeBaron MJ, Ealley EL, Nevalainen MT, 

Rui H. Stat5 promotes homotypic adhesion and inhibits 

invasive characteristics of human breast cancer cells. 

Oncogene. 2005 Jan 27;24(5):746-60 

Chia DJ, Subbian E, Buck TM, Hwa V, Rosenfeld RG, 

Skach WR, Shinde U, Rotwein P. Aberrant folding of a 

mutant Stat5b causes growth hormone insensitivity and 

proteasomal dysfunction. J Biol Chem. 2006 Mar 

10;281(10):6552-8 

Han X, Osuntokun B, Benight N, Loesch K, Frank SJ, 

Denson LA. Signal transducer and activator of transcription 

5b promotes mucosal tolerance in pediatric Crohn's 

disease and murine colitis. Am J Pathol. 2006 

Dec;169(6):1999-2013 

Lee TK, Man K, Poon RT, Lo CM, Yuen AP, Ng IO, Ng KT, 

Leonard W, Fan ST. Signal transducers and activators of 

transcription 5b activation enhances hepatocellular 

carcinoma aggressiveness through induction of epithelialmesenchymal 

transition. Cancer Res. 2006 Oct 

15;66(20):9948-56 

Sánchez-Ceja SG, Reyes-Maldonado E, Vázquez- 

Manríquez ME, López-Luna JJ, Belmont A, Gutiérrez- 

Castellanos S. Differential expression of STAT5 and BclxL, 

and high expression of Neu and STAT3 in non-smallcell 

lung carcinoma. Lung Cancer. 2006 Nov;54(2):163-8 

Strauss BL, Bratthauer GL, Tavassoli FA. STAT 5a 

expression in the breast is maintained in secretory 

carcinoma, in contrast to other histologic types. Hum 

Pathol. 2006 May;37(5):586-92 

Weaver AM, Silva CM. Modulation of signal transducer 

and activator of transcription 5b activity in breast cancer 

cells by mutation of tyrosines within the transactivation 

domain. Mol Endocrinol. 2006 Oct;20(10):2392-405 

Gong Y, Ishida-Takahashi R, Villanueva EC, Fingar DC, 

Münzberg H, Myers MG Jr. The long form of the leptin 

receptor regulates STAT5 and ribosomal protein S6 via 

alternate mechanisms. J Biol Chem. 2007 Oct 

19;282(42):31019-27 

Hwa V, Camacho-Hübner C, Little BM, David A, Metherell 

LA, El-Khatib N, Savage MO, Rosenfeld RG. Growth 

hormone insensitivity and severe short stature in siblings: 

a novel mutation at the exon 13-intron 13 junction of the 

STAT5b gene. Horm Res. 2007;68(5):218-24 

Mütze J, Roth J, Gerstberger R, Hübschle T. Nuclear 

translocation of the transcription factor STAT5 in the rat 

brain after systemic leptin administration. Neurosci Lett. 

2007 May 7;417(3):286-91 

Bessette K, Lang ML, Fava RA, Grundy M, Heinen J, 

Horne L, Spolski R, Al-Shami A, Morse HC 3rd, Leonard 



WJ, Kelly JA. A Stat5b transgene is capable of inducing 

CD8+ lymphoblastic lymphoma in the absence of normal 

TCR/MHC signaling. Blood. 2008 Jan 1;111(1):344-50 

Brown S, Zeidler MP. Unphosphorylated STATs go 

nuclear. Curr Opin Genet Dev. 2008 Oct;18(5):455-60 

Iyer J, Reich NC. Constitutive nuclear import of latent and 

activated STAT5a by its coiled coil domain. FASEB J. 

2008 Feb;22(2):391-400 

Koppikar P, Lui VW, Man D, Xi S, Chai RL, Nelson E, 

Tobey AB, Grandis JR. Constitutive activation of signal 

transducer and activator of transcription 5 contributes to 

tumor growth, epithelial-mesenchymal transition, and 

resistance to epidermal growth factor receptor targeting. 

Clin Cancer Res. 2008 Dec 1;14(23):7682-90 

Bernaciak TM, Zareno J, Parsons JT, Silva CM. A novel 

role for signal transducer and activator of transcription 5b 

(STAT5b) in beta1-integrin-mediated human breast cancer 

cell migration. Breast Cancer Res. 2009;11(4):R52 

Vogtenhuber C, Bucher C, Highfill SL, Koch LK, Goren E, 

Panoskaltsis-Mortari A, Taylor PA, Farrar MA, Blazar BR. 

Constitutively active Stat5b in CD4+ T cells inhibits graftversus-host 

disease lethality associated with increased 

regulatory T-cell potency and decreased T effector cell 

responses. Blood. 2010 Jul 22;116(3):466-74 

Du W, Wang YC, Hong J, Su WY, Lin YW, Lu R, Xiong H, 

Fang JY. STAT5 isoforms regulate colorectal cancer cell 

apoptosis via reduction of mitochondrial membrane 

potential and generation of reactive oxygen species. J Cell 

Physiol. 2011 Aug 8; 

Koptyra M, Gupta S, Talati P, Nevalainen MT. Signal 

transducer and activator of transcription 5a/b: biomarker 

and therapeutic target in prostate and breast cancer. Int J 

Biochem Cell Biol. 2011 Oct;43(10):1417-21 

Lopez TV, Lappin TR, Maxwell P, Shi Z, Lopez-Marure R, 

Aguilar C, Rocha-Zavaleta L. Autocrine/paracrine 

erythropoietin signalling promotes JAK/STAT-dependent 

proliferation of human cervical cancer cells. Int J Cancer. 

2011 Dec 1;129(11):2566-76 

Nadeau K, Hwa V, Rosenfeld RG. STAT5b deficiency: an 

unsuspected cause of growth failure, immunodeficiency, 

and severe pulmonary disease. J Pediatr. 2011 

May;158(5):701-8 

Peck AR, Witkiewicz AK, Liu C, Stringer GA, Klimowicz 

AC, Pequignot E, Freydin B, Tran TH, Yang N, Rosenberg 

AL, Hooke JA, Kovatich AJ, Nevalainen MT, Shriver CD, 

Hyslop T, Sauter G, Rimm DL, Magliocco AM, Rui H. Loss 

of nuclear localized and tyrosine phosphorylated Stat5 in 

breast cancer predicts poor clinical outcome and increased 

risk of antiestrogen therapy failure. J Clin Oncol. 2011 Jun 

20;29(18):2448-58 


Del Rosario AM, Bernaciak TM, Silva CM. STAT5B (signal 

transducer and activator of transcription 5B). Atlas Genet 






Review 

AAMP (angio-associated, migratory cell 

protein) 

Marie E Beckner 


Department of Pathology, Louisiana State University Health Sciences Center - Shreveport, USA 

(MEB) 

Published in Atlas Database: September 2011 

Online updated version : http://AtlasGeneticsOncology.org/Genes/AAMPID533ch2q35.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI AAMPID533ch2q35.txt 



Identity 

HGNC (Hugo): AAMP 


DNA/RNA 

Note 

The NCBI RefSeq (Aug-2011) consensus sequence 

for AAMP differs at the 5-prime end from the 

manually sequenced version published initially. A 

diagram of the NCBI ReqfSeq (Aug-2011) version 

for rAAMP is shown here. 

Description 

The AAMP gene (NCBI RefSeq, Aug-2011) 

encompasses 6042 bp; 11 exons. 

Transcription 

1859 bp mRNA (NCBI RefSeq, Aug-2011). 

Pseudogene 

None are known. 

rAAMP encoding a 434 aa protein in normal cells. The codon for AAMP's initiating methionine, the stop codon, and the polyadenylation 

sites are indicated at 85-87, 1387-1389, and 1774-1779, respectively. Untranslated sequence is indicated in the 

hatched regions at the 3' end of exon 1 and the 5' end of exon 11. The poly-adenosine tail, 1793-1859, is included. 

The bulk of AAMP's sequence is constituted by WD40 domains that are known to commonly fold to form a platform for active 

portions of a protein. Thus the stretch of contiguous glutamic acid residues should be available for interactions with other 

proteins. Also, binding of other proteins may occur to regions of these repeats. The WD40 repeats are known to mediate 

aggregation of subunits to form complex, multi-protein structures. Two immunoglobulin-type domains are designated by pairs of 

cysteines, (C96 - C130) and (C216 - C265). AAMP may play a negative role in Nod2-mediated NF-kB activation via a physical 

interaction in the region indicated. A physical interaction between AAMP and thromboxane A2 receptors (TPalpha and TPbeta) 

has been suggested to occur via multiple sites with no particular domain identified in localization studies. 


AAMP (angio-associated, migratory cell protein) Beckner ME 

Protein 

Note 

The NCBI RefSeq (Aug-2011) consensus sequence 

for AAMP (434 aa) is shorter than initially reported 

(452 aa, 52 kDa). 

Description 

434 amino acids, 49 kDa protein (NCBI RefSeq, 

Aug-2011). 

Expression 

AAMP is widely expressed among many types of 

mammalian cells and has been conserved in 

evolution. 

Localisation 

AAMP was initially detected in the cytoplasm of 

many types of nucleated mammalian cells and was 

strongly expressed in endothelial cells, 

cytotrophoblasts, and poorly differentiated colon 

adenocarcinoma cells in lymphatics. AAMP has 

been observed at the luminal edges of endometrial 

cells and has been found in the extracellular 

environment of vascular-associated mesenchymal 

cells. 

Function 

Functional studies and associations suggest roles 

for AAMP in angiogenesis, including endothelial 

tube formation, migration of endothelial and 

smooth muscle cells, neointima formation, and 

thromboxane A receptor interactions. In immune 

cells AAMP may be involved in the regulation of 

NF-kappaB activation mediated by Nod2. The 

common occurrence of WD40 domains in signaling 

proteins supports a signaling function as a 

possibility for AAMP. The epitope, ESESES, that 

AAMP shares with alpha-actinin and a smaller 

protein specific for fast skeletal muscle, suggests 

that it may have cytoskeletal interactions. Although 

AAMP was described as having heparin-binding 

capacity in melanoma cells, the NCBI RefSeq 

(Aug-2011) version of AAMP does not include the 

heparin-binding sequence (encodes RRLRR) in the 

coding sequence. The RefSeq version of AAMP 

identifies the initiating methionine (85-87) as being 

3' to the sequence encoding RRLRR (70-84). 

Homology 

AAMP shares homology with the other members of 

the WD40 repeat superfamily. Several of the WD40 

repeat proteins also contain an amino terminal run 

of glutamic acid residues outside of their WD 

repeats. The two immunoglobulin-type domains in 

AAMP resemble those of the immunoglobulin 

superfamily members, including domains of 

NCAM, DCC, NgCAM, etc. 

Mutations 

Note 

AAMP was initially cloned and sequenced as a 

transcript for a 452 aa, 52 kDa protein. It was 

obtained from an expression library derived from 

melanoma cells of a brain metastasis. However the 

amino terminus was missing from the library clone. 

AAMP's amino terminus was determined by 5' 

RACE from human brain mRNA. Two versions 

were obtained and both differed from the NCBI 

RefSeq (Aug-2011) version of AAMP. The one 

shown contains coding sequence upstream from the 

initiating methionine in the RefSeq version. This 

alternative form may represent a fusion protein due 

to an in-frame insertion or a chromosomal 

rearrangement. AAMP potentially gains heparin 

binding functionality when sequence upstream from 

AUG at nucleotides 85-87 is preceded by an 

alternative initiating methionine codon that enables 

translation of the codons for RRLRR. 

Germinal 

None are known. 

Somatic 

Chromosomal rearrangements or insertions that 

place an initiating methionine codon further 

upstream than the methionine at 85-87 permit 

AAMP to gain heparin binding function when 

nucleotides 70-84 are translated. 

rAAMP encoding a 452 aa protein (alternative form). An alternative AUG was detected when the amino terminus was 

manually sequenced with 5' RACE using brain mRNA. It is shown in red. Its upstream location permits 17 codons to encode 

amino acids, including 5 codons for RRLRR, a heparin-binding site. Sequences of the alternative forms described for AAMP are 

the same as the NCBI RefSeq (Aug-2011) version of AAMP for nucleotides 34-1792 and the first 25 adenosines in the poly-A 

tail. 



Implicated in 

Gastrointestinal stromal tumor (GIST) 

Note 

GISTs are the most common mesenchymal tumors 

of the digestive tract and are believed to arise from 

the interstitial cells of Cajal. They respond to 

imitanib, a tyrosine kinase inhibitor, which is also 

used to treat myeloid leukemia. Expression of 

AAMP was found to be increased in GISTs with 

mutated KIT. Expression of AAMP among various 

soft tissue sarcomas and normal tissues was highest 

in the GISTs. AAMP ranks high among the 

upregulated genes in GISTs. 

Myeloid leukemia (chronic (CML) and 

acute (AML) forms) 

Note 

AAMP is expressed in myeloid leukemia cell lines 

and its expression is repressed by imitanib 

(mainline treatment drug for chronic myeloid 

leukemia), deferasirox (iron chelator that decreases 

cell proliferation), and anisomycin, an inducer of 

apoptosis. 

Lymphoma (B and T cell origins, non- 

Hodgkins and Hodgkins types) 

Note 

AAMP is expressed in activated T lymphocytes, 

monocytes, and lymphoma cells. Compared to 

normal B cells, AAMP is increased in non- 

Hodgkins lymphomas and in classical Hodgkins 

lymphoma. 

Melanoma (melanocyte origin, 

usually skin) 

Note 

In lysates of a melanoma cell line obtained from a 

brain metastasis, the size of the protein that reacted 

with anti-AAMP was 52 kDa, thus corresponding to 

the size predicted by an alternative transcript. The 

alternative version of AAMP could have resulted 

from a chromosomal rearrangement due to 2q35 

breakage in the amino terminal region of AAMP. 

Placement of AUG at the 5' end of nucleotide 34 to 

serve as an alternative initiating methionine codon 

permits expression of the heparin binding site, 

RRLRR (nucleotides 70-84 in the NCBI ReqSeq 

(Aug-2011) version of AAMP) as a gain of 

function. 

Breast cancer (ductal cell origin most 

common) 

Note 

Expression profiling of human breast cancer cells 

versus mammary epithelial cells revealed higher 

expression of AAMP in the tumor cells. AAMP 

expression is higher in ductal carcinoma in situ 

(DCIS) with necrosis compared to DCIS without 

necrosis. However, expression profiling of DCIS 

and invasive ductal carcinoma (IDC) paired 

specimens from the same patients revealed 

decreased AAMP in IDC. AAMP expression may 

be relevant for the development of DCIS. 

Glial brain tumors (neuroectodermal 

cell origin) 

Note 

When compared with normal, glioblastomas (Grade 

IV astrocytomas) and oligodendrogliomas (Grades 

II - III) demonstrated slightly elevated levels of 

AAMP expression. Expression of AAMP was 

increased in drug resistant glioblastomas, primary 

and recurrent. 

Colon neoplasia (benign adenomas 

and carcinoma arise from glandular 

cells of the mucosa in the 

gastrointestinal tract) 

Note 

Expression profiling of normal mucosa and 

colorectal adenomas from the same patients showed 

that AAMP was slightly increased in the adenomas. 

However, a small dataset of colon tubular 

adenomas harboring focal adenocarcinomas, with 

microdissections of paired samples from each, 

showed that AAMP may become decreased in the 

incipient carcinomas. Although AAMP may play a 

role in the development of colonic neoplasia, it has 

not been shown to be positively involved in 

progression of adenomas to malignancy. 

Epidermoid carcinoma (keratinocyte 

origin if arises in skin) 

Note 

AAMP is expressed in squamous carcinoma cell 

lines. In one cell line studied with PTEN knocked 

down, the expression of AAMP also fell 

significantly. Also, for tumors from a radiosensitive 

cell line, AAMP expression fell significantly in 

radioresistant tumors derived from the sensitive cell 

line. 

Cervical cancer (usually arises from 

squamous type cells) 

Note 

In a study of cervical carcinoma HeLa cells treated 

with epidermal growth factor in a time course, 

expression of AAMP was increased at 2-8 hours. 

Ovarian cancer (often arises from 

serous cells) 

Note 

Cancer cells prepared from primary cultures of 

ovarian papillary serous adenocarcinomas revealed 

increased AAMP expression in 2 of 3 carboplatin 

resistant tumors whereas none of the tumors from 3 

patients with sensitivity to carboplatin 

demonstrated comparable levels. 



Papillary thyroid carcinoma (arises 

from cells in thyroid follicles) 

Note 

Analysis of papillary thyroid carcinoma tumors 

matched with normal thyroid from nine patients 

found that AAMP expression fell slightly in the 

tumors. 

Pulmonary carcinoma (multiple types 

of cells can be the origin) 

Note 

AAMP's expression in a lung alveolar 

adenocarcinoma cell line was down-regulated by 

TGF-beta that was added to induce an epithelialmesenchymal 

transition. 

Chromosomal rearrangements at 

2q35 

Note 

The location of AAMP at 2q35 imparts 

susceptibility to chromosomal rearrangements 

involving the terminal region of chromosome 2's 

long arm, q. Terminal regions are more susceptible 

to rearrangements than the midregions of 

chromosomes. Fusion transcripts and proteins result 

from breakage and rearrangements that occur in 

unstable genomes. Several fusion proteins resulting 

from rearrangements involving other genes in this 

region have been reported in association with 

malignancy. Rearrangements that place in-frame 

coding sequence upstream from nucleotides 70-84 

in the NCBI ReqSeq (Aug-2011) version of AAMP 

permit a gain of function, i.e. heparin-binding, to 

occur. 

Breakpoints 

Note 

Clones obtained in 5' RACE studies of AAMP's 

amino terminus revealed a breakpoint between 

nucleotides 30 and 31 with inclusion of upstream 

sequence that did not match the NCBI RefSeq 

(Aug-2011) form of AAMP and also another 

version with a breakpoint between nucleotides 33 

and 34 and introduction of an alternative AUG. A 

schematic of the latter alternative form was shown 

earlier. The location of AAMP at 2q35 places it in a 

region near the end region of the chromosomal arm 

where breakpoints are more likely compared to the 

centromeric region. Importantly, in the sequences 

of the consensus and variant forms, in-frame 

codons are present for a heparin binding region that 

can be translated if an alternative initiating 

methionine is introduced upstream. 

References 

Beckner ME, Krutzsch HC, Stracke ML, Williams ST, 

Gallardo JA, Liotta LA. Identification of a new 

immunoglobulin superfamily protein expressed in blood 

vessels with a heparin-binding consensus sequence. 

Cancer Res. 1995 May 15;55(10):2140-9 

Beckner ME, Krutzsch HC, Klipstein S, Williams ST, 

Maguire JE, Doval M, Liotta LA. AAMP, a newly identified 

protein, shares a common epitope with alpha-actinin and a 

fast skeletal muscle fiber protein. Exp Cell Res. 1996 Jun 

15;225(2):306-14 

Beckner ME, Liotta LA. AAMP, a conserved protein with 

immunoglobulin and WD40 domains, regulates endothelial 

tube formation in vitro. Lab Invest. 1996 Jul;75(1):97-107 

Beckner ME, Krutzsch HC, Tsokos M, Moul DE, Liotta LA. 

The aggregated form of an AAMP derived peptide behaves 

as a heparin sensitive cell binding agent. Biotechnol 

Bioeng. 1997 May 20;54(4):365-72 

Beckner ME, Peterson VA, Moul DE. Angio-associated 

migratory cell protein is expressed as an extracellular 

protein by blood-vessel-associated mesenchymal cells. 

Microvasc Res. 1999 May;57(3):347-52 

Allander SV, Nupponen NN, Ringnér M, Hostetter G, 

Maher GW, Goldberger N, Chen Y, Carpten J, Elkahloun 

AG, Meltzer PS. Gastrointestinal stromal tumors with KIT 

mutations exhibit a remarkably homogeneous gene 

expression profile. Cancer Res. 2001 Dec 15;61(24):8624- 

8 

Adeyinka A, Emberley E, Niu Y, Snell L, Murphy LC, 

Sowter H, Wykoff CC, Harris AL, Watson PH. Analysis of 

gene expression in ductal carcinoma in situ of the breast. 

Clin Cancer Res. 2002 Dec;8(12):3788-95 

Beckner ME, Jagannathan S, Peterson VA. Extracellular 

angio-associated migratory cell protein plays a positive 

role in angiogenesis and is regulated by astrocytes in 

coculture. Microvasc Res. 2002 May;63(3):259-69 

Blindt R, Vogt F, Lamby D, Zeiffer U, Krott N, Hilger- 

Eversheim K, Hanrath P, vom Dahl J, Bosserhoff AK. 

Characterization of differential gene expression in 

quiescent and invasive human arterial smooth muscle 

cells. J Vasc Res. 2002 Jul-Aug;39(4):340-52 

Francis P, Namløs HM, Müller C, Edén P, Fernebro J, et 

al. Diagnostic and prognostic gene expression signatures 

in 177 soft tissue sarcomas: hypoxia-induced transcription 

profile signifies metastatic potential. BMC Genomics. 2007 

Mar 14;8:73 

Holvoet P, Sinnaeve P. Angio-associated migratory cell 

protein and smooth muscle cell migration in development 

of restenosis and atherosclerosis. J Am Coll Cardiol. 2008 

Jul 22;52(4):312-4 

Vogt F, Zernecke A, Beckner M, Krott N, Bosserhoff AK, 

Hoffmann R, Zandvoort MA, Jahnke T, Kelm M, Weber C, 

Blindt R. Blockade of angio-associated migratory cell 

protein inhibits smooth muscle cell migration and 

neointima formation in accelerated atherosclerosis. J Am 

Coll Cardiol. 2008 Jul 22;52(4):302-11 

Bielig H, Zurek B, Kutsch A, Menning M, Philpott DJ, 

Sansonetti PJ, Kufer TA. A function for AAMP in Nod2mediated 

NF-kappaB activation. Mol Immunol. 2009 

Aug;46(13):2647-54 

Reid HM, Wikström K, Kavanagh DJ, Mulvaney EP, 

Kinsella BT. Interaction of angio-associated migratory cell 

protein with the TPα and TPβ isoforms of the human 

thromboxane A₂ receptor. Cell Signal. 2011 

Apr;23(4):700-17 


Beckner ME. AAMP (angio-associated, migratory cell 

protein). Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):109-112. 





Mini Review 

BCL2L15 (BCL2-like 15) 

Maria-Angeliki S Pavlou, Christos K Kontos 


Westfalische Wilhelms-Universitat Munster, ZMBE, Institute of Cell Biology, Stem Cell Biology and 

Regeneration Group, Von-Esmarch-Str 56, 48149 Munster, Germany (MASP), Department of 

Biochemistry and Molecular Biology, Faculty of Biology, University of Athens, 15701, 

Panepistimiopolis, Athens, Greece (CKK) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/BCL2L15ID46259ch1p13.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI BCL2L15ID46259ch1p13.txt 



Identity 

Other names: Bfk, C1orf178, FLJ22588 

HGNC (Hugo): BCL2L15 


Local order: Centromere to telomere. 

DNA/RNA 

Description 

The BCl2L15 gene has a total length of 10734 nt 

and consists of 4 exons and 3 intervening introns 

(Coultas et al., 2003). The organization of the 

BCL2L15 gene, with the BH3 domain located on a 

single exon (exon 2) and the BH2 domain split 

between two exons (exons 3 and 4), is similar to 

that of other BCL2 family members, including 

BCL2, BCL2L1 (BCLX), BAX, and BAK1 (BAK) 

(Petros et al., 2004). 

Figure 1. Schematic representation of the BCL2L15 gene. Exons are shown as boxes and introns as connecting lines. The 

coding sequences are highlighted as red, while 5' and 3' untranslated regions (UTRs) are shown in white. Numbers inside or 

outside boxes indicate lengths (nt) of exons and introns, respectively, while numbers in parentheses indicate lengths (aa) of 

protein isoforms. Arrows (↓) show the position of the start codons (ATG) and asterisks (*) denote the position of the stop codons 

(TGA). Question marks (?) indicate that the full-length sequence was not determined. Roman numerals indicate intron phases. 

The intron phase refers to the location of the intron within the codon; I denotes that the intron occurs after the first nucleotide of 

the codon, II denotes that the intron occurs after the second nucleotide, and 0 means that the intron occurs between distinct 

codons. The figure is drawn to scale, except for the introns containing the (//) symbol. 


BCL2L15 (BCL2-like 15) Pavlou MAS, Kontos CK 

Transcription 

The BCL2L15 gene is subjected to alternative 

splicing, generating four splice variants, three of 

which are considered as coding transcripts. Each 

coding splice variant consists of a distinctive exon 

combination and encodes a different protein 

isoform. The predominant transcript, consisting of 

4973 nt, includes all 4 exons and encodes isoform 

a. The second transcript, predicted to encode 

isoform b, contains exons 1, 2 and 4. The deletion 

of exon 3 does not result in frameshifting. The third 

transcript, putatively encoding isoform d, consists 

of exons 1 and 4. The lack of exons 2 and 3 shifts 

the open reading frame. 

As aforementioned, except for alternatively spliced 

BCL2L15 coding variants, another noncoding 

transcript has also been identified. This one is 

composed of exons 1, 3 and 4, and was initially 

considered to encode isoform c. Nonetheless, this 

transcript is a nonsense-mediated mRNA decay 

(NMD) candidate, since deletion of exon 2 

generates a premature translation termination codon 

in exon 3. 

Interestingly, transcription of all BCL2L15 

alternatively spliced variants was noticed only in 

colon, while the full-length transcript was also 

detected in stomach, rectum, small intestine, 

cerebellum, testis and uterus (Dempsey et al., 

2005). Moreover, despite the fact that a p53 

consensus binding site was identified upstream of 

the transcription initiation site of BCL2L15, this 

gene does not constitute a transcriptional target of 

p53 (TP53) (Ozören et al., 2009). 

Pseudogene 

Not identified so far. 

Protein 

Description 

The full-length BCL2L15 isoform (isoform a) is the 

predominant one. It consists of 163 amino acid 

residues and has a molecular mass of 17.7 kDa. 

BCL2L15 isoform a contains a BH3 and a BH2 

domain, but no BH1, BH4 or hydrophobic tail 

(Coultas et al., 2003). Isoform a is the predominant 

BCL2L15 isoform and the only one that has been in 

vivo detected so far. 

The amino acid sequences of isoforms b and c are 

deduced from the mRNA sequences of the 

BCL2L15 alternatively spliced variants, and remain 

to be experimentally validated and in vivo detected. 

Isoform b is a putative BH3-only protein of 88 

amino acid residues, with a calculated molecular 

mass of 9.6 kDa. This isoform shares the same 

termini with BCL2L15 isoform; still, it bears no 

BH2 domain. Finally, isoform d is the smallest 

predicted BCL2L15 isoform. This protein of 56 

amino acid residues, with a molecular mass of 6.3 

kDa, possesses no BCL2-homology (BH) domains 

(Dempsey et al., 2005). 

The N-terminal region of all BCL2L15 isoforms 

shares partial homology (ECIxNxLxxxFL peptide) 

with BID (Dempsey et al., 2005), a BH3-only 

proapoptotic member of the BCL2 family 

(Lomonosova and Chinnadurai, 2008). Moreover, 

all BCL2L15 isoforms contain a caspase-3/caspase- 

7 cleavage site (DEVD peptide) (Dempsey et al., 

2005). This tetrapeptide, corresponding to amino 

acid residues 38-41, is responsible for the removal 

of an N-terminal peptide fragment and the 

subsequent activation of the predominant BCL2L15 

isoform, at least during DNA damage-induced 

apoptosis (Dempsey et al., 2005; Ozören et al., 

2009). 

Figure 2. Alignment of amino acid sequences and structural motifs of the BC2L15 protein isoforms. Light blue and pink 

denote the BH2 and BH3 domains, respectively, while the amino acid residues constituting the consensus sequence of each 

BCL2 homology domain are shown in dark blue and red color. Yellow highlights the site of caspase-3/7 cleavage (DEVD 

tetrapeptide), which is considered to be critical for the activation of the proapoptotic action of BCL2L15, at least in certain cell 

types and/or after certain stimuli, including DNA damage-induced apoptosis. Finally, light green highlights the ECIxNxLxxxFL 

peptide, which BCL2L15 isoforms share with BID; its conserved amino acid residues are shown in dark green. 



Expression 

The BCL2L15 protein is mainly expressed in 

tissues of the gastrointestinal tract, including the 

stomach, small intestine, colon and rectum 

(Dempsey et al., 2005; Ozören et al., 2009). The 

full-length isoform has also been detected in several 

colorectal cancer cell lines, such as SW480, HT-29 

and HCT116 (Ozören et al., 2009). 

Localisation 

The BCL2L15 protein is localized to the cytoplasm 

of intestinal epithelial cells (Ozören et al., 2009). It 

does not possess any signal peptide or C-terminal 

membrane anchor and, consequently, it is not 

associated with any cellular organelles (Coultas et 

al., 2003; Ozören et al., 2009), unlike other 

members of the BCL2 family (Thomadaki and 

Scorilas, 2006). The localization of the cleaved 

BCL2L15 has not been elucidated yet. 

Function 

BCL2L15 is a weakly proapoptotic member of the 

BCL2 family (Coultas et al., 2003; Dempsey et al., 

2005; Pujianto et al., 2007). When overexpressed, 

the full-length BCL2L15 isoform interacts with 

BCL2L1 long isoform (BCLXL) and BCL2L2 

(BCLW), but not with BCL2 or BAD, as revealed 

by co-immunoprecipitation experiments (Ozören et 

al., 2009). Furthermore, it has been speculated that 

BCL2L15 acts most probably as an amplifier of the 

apoptotic signal rather than a trigger of 

programmed cell death (Pujianto et al., 2007; 

Ozören et al., 2009). 

Given the weak proapoptotic activity of BCL2L15, 

it was initially suggested that the full-length 

BCL2L15 could represent the latent form of a 

potent BH3-only protein exerting its proapoptotic 

action once activated through proteolytic cleavage 

(Coultas et al., 2003), like caspase-8 cleavage of 

BID (Li et al., 1998; Luo et al., 1998), at least in 

certain cell types or after certain stimuli. In support 

of this notion, it was shown that BCL2L15 becomes 

cleaved in a caspase-dependent manner during 

DNA damage-induced apoptosis and that truncated 

BCL2L15 (~13 kDa), corresponding to the part of 

protein downstream of the caspase-3/7 cleavage 

site, is capable of inducing apoptosis in HCT116 

cells, in contrast to the full-length BCL2L15 

isoform, which seems to be incapable of inducing 

apoptosis in HCT116 or SW480 colorectal cancer 

cells. Interestingly, the ability of the cleaved form 

of the BCL2L15 protein to induce apoptosis is 

dependent on the presence of the BAX or BAK1 

(BAK). Furthermore, co-expression of the 

antiapoptotic BCL2L1 long isoform (BCLXL) or 

BCL2L2 (BCLW) antagonizes efficiently the 

killing activity of truncated BCL2L15 (Ozören et 

al., 2009). 

On the other hand, it has been proposed that the 

proapoptotic role of BCL2L15 may resemble more 

that of BAX and BAK1 (BAK) than that of BH3only 

proteins, since it most probably has a structure 

similar to that of BCL2 and BAX. In fact, the 

position of BH3 and BH2 domains in the BCL2L15 

protein is conserved relative to BAX and BCL2 

(Coultas et al., 2003). 

Potential phosphorylation at Ser-96 and/or Ser-42 

as well as other post-translational modifications of 

BCL2L15 might change its subcellular localization 

and further regulate its physiological function 

(Dempsey et al., 2005; Pujianto et al., 2007). 

Homology 

Human BCL2L15 shares 71% amino acid identity 

and 80% similarity with the mouse ortholog. 

BCL2L15 bears the same combination of BCL2homology 

domains (BH2 and BH3) as the 

BCL2L14 long isoform (BCLGL) and BCL2L12 

full-length isoform, thus lacking other domains that 

are common among BCL2 family members (BH1 

and BH4) or a hydrophobic tail (Youle and 

Strasser, 2008). 

Mutations 

Note 

A single nucleotide polymorphism (SNP) has been 

detected in the coding sequence (GAC→AAC) of 

the BCL2L15 gene, which results in the substitution 

of an amino acid residue bearing a negatively 

charged side chain by an amino acid with a polar 

uncharged side chain (D→N). 

Implicated in 

Gastrointestinal cancer, particularly 

colorectal carcinoma 

Prognosis 

BCL2L15 mRNA expression is clearly reduced in a 

wide range of gastrointestinal malignancies. 

BCL2L15 mRNA levels are lower in colon tumors, 

compared to levels detected in matched normal 

colon tissue. Moreover, BCL2L15 mRNA 

expression is significantly downregulated in tumors 

of the small intestine, stomach and rectum. This 

reduction of BCL2L15 mRNA levels in 

gastrointestinal neoplasms implies that BCL2L15 

may contribute to the protective effect of 

proapoptotic BCL2 family proteins against 

malignant transformation of the gastrointestinal 

tract (Dempsey et al., 2005). 

References 

Li H, Zhu H, Xu CJ, Yuan J. Cleavage of BID by caspase 8 

mediates the mitochondrial damage in the Fas pathway of 

apoptosis. Cell. 1998 Aug 21;94(4):491-501 



Luo X, Budihardjo I, Zou H, Slaughter C, Wang X. Bid, a 

Bcl2 interacting protein, mediates cytochrome c release 

from mitochondria in response to activation of cell surface 

death receptors. Cell. 1998 Aug 21;94(4):481-90 

Coultas L, Pellegrini M, Visvader JE, Lindeman GJ, Chen 

L, Adams JM, Huang DC, Strasser A. Bfk: a novel weakly 

proapoptotic member of the Bcl-2 protein family with a BH3 

and a BH2 region. Cell Death Differ. 2003 Feb;10(2):185- 

92 

Petros AM, Olejniczak ET, Fesik SW. Structural biology of 

the Bcl-2 family of proteins. Biochim Biophys Acta. 2004 

Mar 1;1644(2-3):83-94 

Dempsey CE, Dive C, Fletcher DJ, Barnes FA, Lobo A, 

Bingle CD, Whyte MK, Renshaw SA. Expression of proapoptotic 

Bfk isoforms reduces during malignant 

transformation in the human gastrointestinal tract. FEBS 

Lett. 2005 Jul 4;579(17):3646-50 

Thomadaki H, Scorilas A. BCL2 family of apoptosis-related 

genes: functions and clinical implications in cancer. Crit 

Rev Clin Lab Sci. 2006 Jan;43(1):1-67 

Pujianto DA, Damdimopoulos AE, Sipilä P, Jalkanen J, 

Huhtaniemi I, Poutanen M. Bfk, a novel member of the 

bcl2 gene family, is highly expressed in principal cells of 

the mouse epididymis and demonstrates a predominant 

nuclear localization. Endocrinology. 2007 Jul;148(7):3196- 

204 

Lomonosova E, Chinnadurai G. BH3-only proteins in 

apoptosis and beyond: an overview. Oncogene. 2008 

Dec;27 Suppl 1:S2-19 

Youle RJ, Strasser A. The BCL-2 protein family: opposing 

activities that mediate cell death. Nat Rev Mol Cell Biol. 

2008 Jan;9(1):47-59 

Ozören N, Inohara N, Núñez G. A putative role for human 

BFK in DNA damage-induced apoptosis. Biotechnol J. 

2009 Jul;4(7):1046-54 


Pavlou MAS, Kontos CK. BCL2L15 (BCL2-like 15). Atlas 

Genet Cytogenet Oncol Haematol. 2012; 16(2):113-116. 





Review 

DUSP6 (dual specificity phosphatase 6) 

Zhenfeng Zhang, Balazs Halmos 


Division of Hematology/Oncology, Herbert Irving Comprehensive Cancer Center, New York 

Presbyterian Hospital-Columbia University Medical Center, New York, NY, USA (ZZ, BH) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/DUSP6ID46105ch12q21.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI DUSP6ID46105ch12q21.txt 



Identity 

Other names: MKP-3, MKP3, PYST1, rVH6 

HGNC (Hugo): DUSP6 


DNA/RNA 

Description 

The human DUSP6 gene is located on chromosome 

12q21.33 and consists of 3 exons. The full-length 

coding sequence of DUSP6 contains 1146 

nucleotides. The functional phosphatase domain of 

DUSP6 is encoded by half of exon 2 and almost the 

entire sequence of exon 3. 

Transcription 

DUSP6 gene transcription can start from either the 

first ATG or alternatively the second ATG (Met14), 

and therefore two protein products are generated 

which usually demonstrate a double-band 

appearance in regular immunoblotting assays 

(Dowd et al., 1998; Zhang et al., 2010). 

Protein 

Description 

The full-length DUSP6 protein contains 381 amino 

acids and has a molecular weight of 44 kDa. 

DUSPs are characterized by a common structure 

comprising a C-terminal phosphatase domain that 

are defined by the active-site signature motif 

HCXXXXXR. The structure of DUSP proteins 

confers phosphatase activity for both 

phosphoserine/threonine and phosphotyrosine 

residues. An enzyme-dead DUSP6 expression 

construct can be generated via a 293 Cysteine to 

Serine/Glycine (C293S/G) point mutation (Wishart 

et al., 1995; Zhang et al., 2010; Zhou et al., 2006). 

Expression 

DUSP6 is expressed usually at low level in resting, 

nonstimulated cells in a variety of tissues and is 

induced as an early response gene after activation 

of the ERK-MAPK signaling pathway. 

The diagram depicts the structure of the DUSP6 gene (bottom) roughly aligned with its corresponding functional protein domains 

(middle and top). DUSP6 comprises a C-terminal catalytic domain and an N-terminal non-catalytic domain (middle). The 3 exons 

of DUSP6 (rectangles) are connected with lines representing introns. 


DUSP6 (dual specificity phosphatase 6) Zhang Z, Halmos B 

The diagram depicts the structural features of DUSP6. The highly conserved C-terminal domain of DUSP6 contains the 

canonical tyrosine/threonine-specific phosphatase signature sequence HCXXXXXR at the active site, where the cysteine acts as 

the essential enzymatic nucleophile and arginine interacts directly with the phosphate group on phosphotyrosine or 

phosphothreonine (Farooq et al., 2001). The amino-terminal domain of DUSP6 contains a specific arginine-rich kinase 

interaction motif (KIM) (Tárrega et al., 2005) and a leucine-rich nuclear export signal (NES) necessary and sufficient for nuclear 

export of the phosphatase (Karlsson et al., 2004). 

Localisation 

DUSP6 is a cytoplasmic dual specificity protein 

phosphatase. 

Function 

Mitogen-activated protein kinases (MAPK) 

constitute a highly conserved family of kinases that 

relay information from extracellular signals to 

downstream effectors that control diverse cellular 

processes such as proliferation, differentiation, 

migration, survival and apoptosis (Wada and 

Penninger, 2004). A balance between the activities 

of upstream activators and various negative 

regulatory mechanisms of MAPK signaling, which 

terminate its activation, determines its biological 

outcomes. DUSP6 is a prototypical member of a 

subfamily of cytoplasmic MKPs, which includes 

DUSP7 and DUSP9 as well. These enzymes all 

display a high degree of substrate selectivity for 

ERK1 and ERK2 (Keyse, 2008). DUSP6 has been 

shown to act as a central feedback regulator 

attenuating ERK levels in developmental programs 

(Echevarria et al., 2005; Li et al., 2007). The 

cytoplasmic localization of DUSP6 is mediated by 

a chromosome region maintenance-1-dependent 

nuclear export pathway. DUSP6 appears to play a 

role in determining the subcellular localization of 

ERK by serving as a cytoplasmic anchor for ERK, 

thereby mediating a spatio-temporal mechanism of 

ERK signaling regulation. Cytoplasmic retention of 

ERK requires both a functional kinase interaction 

motif and nuclear export site. Defects of these 

feedback regulation steps are thought to contribute 

to ERK-MAPK related oncogenesis. An in vivo 

study has identified DUSP6 as a negative feedback 

regulator of fibroblast growth factor-stimulated 

ERK signaling during murine development (Li et 

al., 2007). Several in vitro studies have 

demonstrated that DUSP6 acts as a negative 

regulator of fibroblast growth factor receptor 

signaling and endothelial cell platelet-derived 

growth factor receptor signaling via termination of 

ERK activation (Ekerot et al., 2008; Jurek et al., 

2009). 

Homology 

DUSP6 belongs to a subfamily of ten more closely 

related dual-specificity MAPK phosphatases 

(MKPs) within the larger cysteine-dependent dual 

specificity phosphatase (DUSP) family (Keyse, 

2008). While DUSP1 (MKP-1), DUSP4 (MKP-2), 

and DUSP9 (MKP4) dephosphorylate both ERKs, 

p38 and JNK, the phosphatases DUSP5 (Hvh-3), 

DUSP6 (MKP-3), and DUSP7 (MKP-X) 

exclusively target ERK1/2 MAPKs (Keyse, 2008). 

The N-terminal domain of all DUSPs has two 

regions of homology with the Cdc25 cell cycle 

regulatory phosphatase. The more conserved 

catalytic domain within DUSPs contains an active 

site sequence related to the prototypic VH-1 

phosphatase encoded by the vaccinia virus. 

Specificity of MKPs toward MAPKs relies on the 

KIM domain. Although each MKP targets different 

subsets of MAPKs, there is an overlap between 

their specificities (Bermudez et al., 2010). 

Mutations 

Note 

Although DUSP6 has been implicated as a 

candidate tumor suppressor in several cancer 

setting, no mutations in the gene have been 

identified so far. 

Implicated in 

Various cancers 

Note 

DUSP6 null mice demonstrate enhanced ERK1/2 

phosphorylation leading to increased myocyte 

proliferation and cardiac hypercellularity (Maillet et 

al., 2008). DUSP6 has been identified as a potential 

novel tumor suppressor gene in pancreatic cancer 

since loss of DUSP6 expression might synergize 

with activating-mutated k-Ras resulting in 

increased activation of ERK1/2 MAP kinase and 

thus contribute to the development of the malignant 

and invasive phenotype in pancreatic cancer 

(Furukawa et al., 2003). Loss of DUSP6 expression 

caused by oxidative stress-mediated degradation 

was also noted in ovarian cancer and correlated 

with high ERK1/2 activity (Chan et al., 2008). 

DUSP6 has also been identified as one of only three 

genes which are uniquely expressed in myeloma 

cells harboring a constitutively active mutant N-ras 

gene and is also overexpressed in human melanoma 



cell lines with potent activating mutations in B-raf 

and in breast epithelial cells stably expressing H- 

Ras (Bloethner et al., 2005; Croonquist et al., 2003; 

Warmka et al., 2004), suggesting that the overexpression 

of DUSP6 seen in response to 

activating-mutated Ras or Raf might represent a 

compensatory increase in the negative feedback 

control of the ERK1/2 MAPK pathway, which lies 

downstream of these activated oncogenes. In 

support of this, the tetracycline-induced expression 

of a functional fusion protein between DUSP6 and 

green fluorescent protein in H-ras transformed 

fibroblasts following injection into nude mice 

resulted in a large delay in tumor emergence and 

growth as compared to the untreated control group 

(Marchetti et al., 2004 ). DUSP6 has been reported 

to be one of the most highly regulated genes in 

chronic myeloid leukemia cells upon imatinib 

treatment (Hakansson et al., 2008) and similarly 

DUSP6 is overexpressed upon inducible expression 

of the EGFRvIII oncogene in glioblastoma cells 

(Ramnarain et al., 2006). DUSP6 has also been 

demonstrated to be positively correlated with the 

activity of the oncogenic ERK pathway in nonsmall 

cell lung cancer tissue and is an ETSregulated 

negative feedback mediator of ERK 

signaling in lung cancer cells (Zhang et al., 2010). 

Prognosis 

Elevated DUSP6 RNA expression was reported to 

be a major negative predictor of survival in patients 

with resected non-small cell lung cancer as part of a 

five-gene signature model (Chen et al., 2007). 

References 

Wishart MJ, Denu JM, Williams JA, Dixon JE. A single 

mutation converts a novel phosphotyrosine binding domain 

into a dual-specificity phosphatase. J Biol Chem. 1995 Nov 

10;270(45):26782-5 

Dowd S, Sneddon AA, Keyse SM. Isolation of the human 

genes encoding the pyst1 and Pyst2 phosphatases: 

characterisation of Pyst2 as a cytosolic dual-specificity 

MAP kinase phosphatase and its catalytic activation by 

both MAP and SAP kinases. J Cell Sci. 1998 Nov;111 ( Pt 

22):3389-99 

Farooq A, Chaturvedi G, Mujtaba S, Plotnikova O, Zeng L, 

Dhalluin C, Ashton R, Zhou MM. Solution structure of 

ERK2 binding domain of MAPK phosphatase MKP-3: 

structural insights into MKP-3 activation by ERK2. Mol 

Cell. 2001 Feb;7(2):387-99 

Croonquist PA, Linden MA, Zhao F, Van Ness BG. Gene 

profiling of a myeloma cell line reveals similarities and 

unique signatures among IL-6 response, N-ras-activating 

mutations, and coculture with bone marrow stromal cells. 

Blood. 2003 Oct 1;102(7):2581-92 

Furukawa T, Sunamura M, Motoi F, Matsuno S, Horii A. 

Potential tumor suppressive pathway involving 

DUSP6/MKP-3 in pancreatic cancer. Am J Pathol. 2003 

Jun;162(6):1807-15 

Alonso A, Sasin J, Bottini N, Friedberg I, Friedberg I, 

Osterman A, Godzik A, Hunter T, Dixon J, Mustelin T. 

Protein tyrosine phosphatases in the human genome. Cell. 

2004 Jun 11;117(6):699-711 

Karlsson M, Mathers J, Dickinson RJ, Mandl M, Keyse SM. 

Both nuclear-cytoplasmic shuttling of the dual specificity 

phosphatase MKP-3 and its ability to anchor MAP kinase 

in the cytoplasm are mediated by a conserved nuclear 

export signal. J Biol Chem. 2004 Oct 1;279(40):41882-91 

Marchetti S, Gimond C, Roux D, Gothié E, Pouysségur J, 

Pagès G. Inducible expression of a MAP kinase 

phosphatase-3-GFP chimera specifically blunts fibroblast 

growth and ras-dependent tumor formation in nude mice. J 

Cell Physiol. 2004 Jun;199(3):441-50 

Wada T, Penninger JM. Mitogen-activated protein kinases 

in apoptosis regulation. Oncogene. 2004 Apr 

12;23(16):2838-49 

Warmka JK, Mauro LJ, Wattenberg EV. Mitogen-activated 

protein kinase phosphatase-3 is a tumor promoter target in 

initiated cells that express oncogenic Ras. J Biol Chem. 

2004 Aug 6;279(32):33085-92 

Bloethner S, Chen B, Hemminki K, Müller-Berghaus J, 

Ugurel S, Schadendorf D, Kumar R. Effect of common B- 

RAF and N-RAS mutations on global gene expression in 

melanoma cell lines. Carcinogenesis. 2005 Jul;26(7):1224- 

32 

Echevarria D, Martinez S, Marques S, Lucas-Teixeira V, 

Belo JA. Mkp3 is a negative feedback modulator of Fgf8 

signaling in the mammalian isthmic organizer. Dev Biol. 

2005 Jan 1;277(1):114-28 

Tárrega C, Ríos P, Cejudo-Marín R, Blanco-Aparicio C, 

van den Berk L, Schepens J, Hendriks W, Tabernero L, 

Pulido R. ERK2 shows a restrictive and locally selective 

mechanism of recognition by its tyrosine phosphatase 

inactivators not shared by its activator MEK1. J Biol Chem. 

2005 Nov 11;280(45):37885-94 

Ramnarain DB, Park S, Lee DY, Hatanpaa KJ, Scoggin 

SO, Otu H, Libermann TA, Raisanen JM, Ashfaq R, Wong 

ET, Wu J, Elliott R, Habib AA. Differential gene expression 

analysis reveals generation of an autocrine loop by a 

mutant epidermal growth factor receptor in glioma cells. 

Cancer Res. 2006 Jan 15;66(2):867-74 

Zhou B, Zhang J, Liu S, Reddy S, Wang F, Zhang ZY. 

Mapping ERK2-MKP3 binding interfaces by 

hydrogen/deuterium exchange mass spectrometry. J Biol 

Chem. 2006 Dec 15;281(50):38834-44 

Chen HY, Yu SL, Chen CH, Chang GC, Chen CY, Yuan A, 

Cheng CL, Wang CH, Terng HJ, Kao SF, Chan WK, Li HN, 

Liu CC, Singh S, Chen WJ, Chen JJ, Yang PC. A fivegene 

signature and clinical outcome in non-small-cell lung 

cancer. N Engl J Med. 2007 Jan 4;356(1):11-20 

Li C, Scott DA, Hatch E, Tian X, Mansour SL. Dusp6 

(Mkp3) is a negative feedback regulator of FGF-stimulated 

ERK signaling during mouse development. Development. 

2007 Jan;134(1):167-76 

Chan DW, Liu VW, Tsao GS, Yao KM, Furukawa T, Chan 

KK, Ngan HY. Loss of MKP3 mediated by oxidative stress 

enhances tumorigenicity and chemoresistance of ovarian 

cancer cells. Carcinogenesis. 2008 Sep;29(9):1742-50 

Ekerot M, Stavridis MP, Delavaine L, Mitchell MP, Staples 

C, Owens DM, Keenan ID, Dickinson RJ, Storey KG, 

Keyse SM. Negative-feedback regulation of FGF signalling 

by DUSP6/MKP-3 is driven by ERK1/2 and mediated by 

Ets factor binding to a conserved site within the 

DUSP6/MKP-3 gene promoter. Biochem J. 2008 Jun 

1;412(2):287-98 

Håkansson P, Nilsson B, Andersson A, Lassen C, Gullberg 

U, Fioretos T. Gene expression analysis of BCR/ABL1dependent 

transcriptional response reveals enrichment for 

genes involved in negative feedback regulation. Genes 

Chromosomes Cancer. 2008 Apr;47(4):267-75 



Keyse SM. Dual-specificity MAP kinase phosphatases 

(MKPs) and cancer. Cancer Metastasis Rev. 2008 

Jun;27(2):253-61 

Maillet M, Purcell NH, Sargent MA, York AJ, Bueno OF, 

Molkentin JD. DUSP6 (MKP3) null mice show enhanced 

ERK1/2 phosphorylation at baseline and increased 

myocyte proliferation in the heart affecting disease 

susceptibility. J Biol Chem. 2008 Nov 7;283(45):31246-55 

Jurek A, Amagasaki K, Gembarska A, Heldin CH, 

Lennartsson J. Negative and positive regulation of MAPK 

phosphatase 3 controls platelet-derived growth factorinduced 

Erk activation. J Biol Chem. 2009 Feb 

13;284(7):4626-34 

Bermudez O, Pagès G, Gimond C. The dual-specificity 

MAP kinase phosphatases: critical roles in development 

and cancer. Am J Physiol Cell Physiol. 2010 

Aug;299(2):C189-202 

Zhang Z, Kobayashi S, Borczuk AC, Leidner RS, 

Laframboise T, Levine AD, Halmos B. Dual specificity 

phosphatase 6 (DUSP6) is an ETS-regulated negative 

feedback mediator of oncogenic ERK signaling in lung 

cancer cells. Carcinogenesis. 2010 Apr;31(4):577-86 


Zhang Z, Halmos B. DUSP6 (dual specificity phosphatase 

6). Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):117-120. 





Review 


GZMA (granzyme A (granzyme 1, cytotoxic Tlymphocyte-associated 

serine esterase 3)) 

Elena Catalan, Diego Sanchez-Martinez, Julián Pardo 

Dpto Bioquimica y Biologia Molecular y Celular, Fac Ciencias, Univ Zaragoza, Spain (EC, DSM), 

Dpto Bioquimica y Biologia Molecular y Celular, Fac Ciencias, Univ Zaragoza, Spain; Fundacion 

Aragon I+D (ARAID), Zaragoza, Spain (JP) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/GZMAID51130ch5q11.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI GZMAID51130ch5q11.txt 



Identity 

Other names: CTLA3, HFSP 

HGNC (Hugo): GZMA 


Local order: Size: 7607 bases. Coordinates: 

54398473. 

DNA/RNA 

Description 

The GZMA gene, with 7607 bases in length, 

consists of 5 exons and 4 introns. GZMA gene is 

located in a gene cluster together with granzyme K 

(figure 1) (Grossman et al., 2003). 

Transcription 

There are at least two transcripts of human GZMA 

whose expression is differentially regulated by 

glucocorticoid (Ruike et al., 2007). These 

transcripts generate two isoforms, GZMAα and 

GZMAβ, which have respective first exons: exon 

1a and exon 1b (figure 1): 

GZMAα (exon 1a): canonical sequence, 

GZMAβ (exon 1b): lack aa 1-17; aa 18-23 LLLIPE 

--> MTKGLR. 

Figure 1. Genomic organization of human GZMA. A, human GZMA cluster. Arrow indicate the direction of transcription. B, 

representation of the GZMA genetic locus. White: untranslated regions; Blue: leader sequence; Green: mature enzyme. Solid 

lanes: splicing between the first and second exons. gre: glucocorticoid response element (adapted from Ruike et al., 2007). 


GZMA (granzyme A (granzyme 1, cytotoxic T-lymphocyteassociated 


Catalan E, et al. 

Figure 2. Diagram of the crystal structure of human granzyme A dimer (Bell et al., 2003; Hink-Schauer et al., 2003). The 

cystein groups involved in disulphide bond-mediated dimer (green) and the three aminoacids forming the catalytic triad (red, blue 

and yellow) are shown. Representation from PDB (accession code 1OP8) deposited by Hink-Schauer C, Estébanez-Perpiñá E, 

Kurschus FC, Bode W, Jenne DE. Nat Struct Biol. 2003 Jul;10(7):535-40. 

Protein 

Description 

Granzyme A is a tryptase (cleave proteins after Lys 

or Arg residues) expressed mainly in cytotoxic cells 

(cytotoxic T and Natural Killer cells) (Masson et 

al., 1986; Simon et al., 1986; Young et al., 1986). 

Protein is expressed as a preproenzyme (Jenne et 

al., 1988) containing a signal sequence that 

mediates targeting of the nascent enzyme to the ER. 

Cleavage of the signal peptide produces an inactive 

proenzyme that contains an N-terminal dipeptide 

that needs to be cleaved to produce an active 

protease. In the Golgi, a mannose-6-phosphate tag 

is added for transporting the proenzyme to 

cytotoxic granules. Within the cytotoxic granule, 

the N-terminal dipeptide is removed by cathepsin C 

(dipeptidyl peptidase I) (Pham et al., 1999), 

producing the active enzyme that is kept inactive at 

low pH. Native granzyme A is expressed as a dimer 

(Bell et al., 2003; Hink-Schauer et al., 2003). 

Expression 

Cytotoxic CD8+ T cells, Natural Killer cells, CD4+ 

T cells, gamma-delta T cells, type II pneumocytes, 

alveolar macrophages, bronchiolar epithelial cells. 

Localisation 

Cytotoxic granules. 

Function 

Granzyme A is delivered from CTL or NK 

cytotoxic granules to the cytoplasm of target cell by 

a mechanism dependent on perforin (Baran et al., 

2009; Praper et al., 2011; Thiery et al., 2011). 

There are some controversial findings about the 

physiological function of gzmA. 

It has been reported that human GzmA induces 

perforin-mediated caspase-independent cell death in 

some tumors cell lines (Hayes et al., 1989; Shi et 

al., 1992; Beresford et al., 1999; Shresta et al., 

1999; Pardo et al., 2004). GzmA translocates to the 

nucleus and mitochondria where key substrates 

such as mitochondrial complex I protein, NADH 

dehydrogenase Fe-S protein 3 (NDUFS3) is 

cleaved, inducing the production of Radical 

Oxygen Species (ROS). ROS production induces 

the activation of the SET complex that translocates 

into the nucleus in order to repair DNA damage 

induced by ROS. Once there, granzyme A cleaves 

components of the endoplasmic reticulumassociated 

SET complex, releasing the 

endonuclease NM23H1 that induces single strand 

nicks in the DNA and ultimately cell death 

(Lieberman, 2011). 

Other authors have reported that the cytotoxic 

potential of granzyme A is low, but induce 

expression of pro-inflammatory cytokines in 

monocytes-like cells by a caspase-1 dependent 

mechanism (Metkar et al., 2008). 

Granzyme A is able to cleave several extracellular 

substrates like thrombin receptor, fibronectin, 

collagen IV, proteinase-activated receptor-2, Prourokinase 

plasminogen activator and myelin basic 

protein (Kramer et al., 1987; Buzza et al., 2006; 

Hendel et al., 2011). 

Granzyme and granzyme B double deficient mice 

are more susceptible than granzyme B deficient 

mice to transplanted tumors suggesting a 

contribution of granzyme A to tumor control in 

vivo (Pardo et al., 2002; Cao et al., 2007). 

Homology 

Mouse granzyme A; Rat granzyme A; Chicken 

granzyme A; Fish granzyme A (Common Carp, 

Atlantic cod, Channel catfish) (Praveen et al., 2006; 

Praveen et al., 2006; Wernersson et al., 2006). 




Mutations 

Note: Not known. 

Implicated in 

Sepsis (Froelich et al., 2009; Hendel et al., 2011) 

Disease 

Several findings suggest that gzmA contributes to 

septic shock. Native and recombinant human 

granzyme A as well as a human NK cell line 

expressing gzmA induces human adherent 

peripheral blood mononuclear cells to express 

proinflammatory cytokines including interleukin- 

1beta interleukin-6, inteleukin-8 and TNF-alpha 

(Sower et al., 1996; Metkar et al., 2008). Granzyme 

A deficient mice are more resistant than wild type 

mice to septic shock induced by LPS (Metkar et al., 

2008). 

Rheumatoid arthritis 

Prognosis 

Granzyme A levels are higher in serum and 

synovial fluid of patients with rheumatoid arthritis 

(Griffiths et al., 1992; Nordstrom et al., 1992; 

Kummer et al., 1994; Tak et al., 1994; Muller- 

Ladner et al., 1995; Spaeny-Dekking et al., 1998; 

Tak et al., 1999). 

Chronic obstructive pulmonary 

disease 

Prognosis 

Granzyme A is expressed in type II pneumocytes of 

patients with severe chronic obstructive pulmonary 

disease (Vernooy et al., 2007). 

Hypersensitivity pneumonitis 

Prognosis 

Granzyme A is elevated in bronchoalveolar lavage 

fluid from patients with hypersensitivity 

pneumonitis (Tremblay et al., 2000). 

Sjögren's syndrome 

Prognosis 

Granzyme A is expressed in salivary glands from 

patients with Sjögren's syndrome (Alpert et al., 

1994). 

Poxvirus infection 

Disease 

Granzyme A deficient mice are more susceptible 

than wild type mice to mousepox virus (ectromelia) 

(Mullbacher et al., 1996). 

Herpes virus infection 

Disease 

Granzyme A deficient mice are more susceptible 

than wild type mice to herpes simplex virus type 1 

(HSV-1) (Pereira et al., 2000) and mouse 

cytomegalovirus (CMV) infection (Riera et al., 

2000). 

References 


Masson D, Zamai M, Tschopp J. Identification of granzyme 

A isolated from cytotoxic T-lymphocyte-granules as one of 

the proteases encoded by CTL-specific genes. FEBS Lett. 

1986 Nov 10;208(1):84-8 

Simon MM, Hoschützky H, Fruth U, Simon HG, Kramer 

MD. Purification and characterization of a T cell specific 

serine proteinase (TSP-1) from cloned cytolytic T 

lymphocytes. EMBO J. 1986 Dec 1;5(12):3267-74 

Young JD, Hengartner H, Podack ER, Cohn ZA. 

Purification and characterization of a cytolytic pore-forming 

protein from granules of cloned lymphocytes with natural 

killer activity. Cell. 1986 Mar 28;44(6):849-59 

Kramer MD, Simon MM. Are Proteinases Functional 

Molecules of T Lymphocytes? Immunol Today. 

1987;8:140-2. (REVIEW) 

Jenne DE, Tschopp J.. Granzymes, a family of serine 

proteases released from granules of cytolytic T 

lymphocytes upon T cell receptor stimulation. Immunol 

Rev. 1988 Mar;103:53-71. (REVIEW) 

Hayes MP, Berrebi GA, Henkart PA.. Induction of target 

cell DNA release by the cytotoxic T lymphocyte granule 

protease granzyme A. J Exp Med. 1989 Sep 1;170(3):933- 

46. 

Griffiths GM, Alpert S, Lambert E, McGuire J, Weissman 

IL.. Perforin and granzyme A expression identifying 

cytolytic lymphocytes in rheumatoid arthritis. Proc Natl 

Acad Sci U S A. 1992 Jan 15;89(2):549-53. 

Nordstrom DC, Konttinen YT, Sorsa T, Nykanen P, 

Pettersson T, Santavirta S, Tschopp J.. Granzyme Aimmunoreactive 

cells in synovial fluid in reactive and 

rheumatoid arthritis. Clin Rheumatol. 1992 Dec;11(4):529- 

32. 

Shi L, Kraut RP, Aebersold R, Greenberg AH.. A natural 

killer cell granule protein that induces DNA fragmentation 

and apoptosis. J Exp Med. 1992 Feb 1;175(2):553-66. 

Alpert S, Kang HI, Weissman I, Fox RI.. Expression of 

granzyme A in salivary gland biopsies from patients with 

primary Sjogren's syndrome. Arthritis Rheum. 1994 

Jul;37(7):1046-54. 

Kummer JA, Tak PP, Brinkman BM, van Tilborg AA, Kamp 

AM, Verweij CL, Daha MR, Meinders AE, Hack CE, 

Breedveld FC.. Expression of granzymes A and B in 

synovial tissue from patients with rheumatoid arthritis and 

osteoarthritis. Clin Immunol Immunopathol. 1994 

Oct;73(1):88-95. 

Tak PP, Kummer JA, Hack CE, Daha MR, Smeets TJ, 

Erkelens GW, Meinders AE, Kluin PM, Breedveld FC.. 

Granzyme-positive cytotoxic cells are specifically 

increased in early rheumatoid synovial tissue. Arthritis 

Rheum. 1994 Dec;37(12):1735-43. 

Muller-Ladner U, Kriegsmann J, Tschopp J, Gay RE, Gay 

S.. Demonstration of granzyme A and perforin messenger 

RNA in the synovium of patients with rheumatoid arthritis. 

Arthritis Rheum. 1995 Apr;38(4):477-84. 

Mullbacher A, Ebnet K, Blanden RV, Hla RT, Stehle T, 

Museteanu C, Simon MM.. Granzyme A is critical for 

recovery of mice from infection with the natural cytopathic 

viral pathogen, ectromelia. Proc Natl Acad Sci U S A. 1996 

Jun 11;93(12):5783-7. 

Sower LE, Klimpel GR, Hanna W, Froelich CJ.. 

Extracellular activities of human granzymes. I. Granzyme 

A induces IL6 and IL8 production in fibroblast and 

epithelial cell lines. Cell Immunol. 1996 Jul 10;171(1):159- 

63. 




Spaeny-Dekking EH, Hanna WL, Wolbink AM, Wever PC, 

Kummer JA, Swaak AJ, Middeldorp JM, Huisman HG, 

Froelich CJ, Hack CE.. Extracellular granzymes A and B in 

humans: detection of native species during CTL responses 

in vitro and in vivo. J Immunol. 1998 Apr 1;160(7):3610-6. 

Beresford PJ, Xia Z, Greenberg AH, Lieberman J.. 

Granzyme A loading induces rapid cytolysis and a novel 

form of DNA damage independently of caspase activation. 

Immunity. 1999 May;10(5):585-94. 

Pham CT, Ley TJ.. Dipeptidyl peptidase I is required for 

the processing and activation of granzymes A and B in 

vivo. Proc Natl Acad Sci U S A. 1999 Jul 20;96(15):8627- 

32. 

Shresta S, Graubert TA, Thomas DA, Raptis SZ, Ley TJ.. 

Granzyme A initiates an alternative pathway for granulemediated 

apoptosis. Immunity. 1999 May;10(5):595-605. 

Tak PP, Spaeny-Dekking L, Kraan MC, Breedveld FC, 

Froelich CJ, Hack CE.. The levels of soluble granzyme A 

and B are elevated in plasma and synovial fluid of patients 

with rheumatoid arthritis (RA). Clin Exp Immunol. 1999 

May;116(2):366-70. 

Pereira RA, Simon MM, Simmons A.. Granzyme A, a 

noncytolytic component of CD8(+) cell granules, restricts 

the spread of herpes simplex virus in the peripheral 

nervous systems of experimentally infected mice. J Virol. 

2000 Jan;74(2):1029-32. 

Riera L, Gariglio M, Valente G, Mullbacher A, Museteanu 

C, Landolfo S, Simon MM.. Murine cytomegalovirus 

replication in salivary glands is controlled by both perforin 

and granzymes during acute infection. Eur J Immunol. 

2000 May;30(5):1350-5. 

Tremblay GM, Wolbink AM, Cormier Y, Hack CE.. 

Granzyme activity in the inflamed lung is not controlled by 

endogenous serine proteinase inhibitors. J Immunol. 2000 

Oct 1;165(7):3966-9. 

Pardo J, Balkow S, Anel A, Simon MM.. Granzymes are 

essential for natural killer cell-mediated and perf-facilitated 

tumor control. Eur J Immunol. 2002 Oct;32(10):2881-7. 

Bell JK, Goetz DH, Mahrus S, Harris JL, Fletterick RJ, 

Craik CS.. The oligomeric structure of human granzyme A 

is a determinant of its extended substrate specificity. Nat 

Struct Biol. 2003 Jul;10(7):527-34. 

Grossman WJ, Revell PA, Lu ZH, Johnson H, Bredemeyer 

AJ, Ley TJ.. The orphan granzymes of humans and mice. 

Curr Opin Immunol. 2003 Oct;15(5):544-52. 

Hink-Schauer C, Estebanez-Perpina E, Kurschus FC, 

Bode W, Jenne DE.. Crystal structure of the apoptosisinducing 

human granzyme A dimer. Nat Struct Biol. 2003 

Jul;10(7):535-40. 

Pardo J, Bosque A, Brehm R, Wallich R, Naval J, 

Mullbacher A, Anel A, Simon MM.. Apoptotic pathways are 

selectively activated by granzyme A and/or granzyme B in 

CTL-mediated target cell lysis. J Cell Biol. 2004 Nov 

8;167(3):457-68. 

Buzza MS, Bird PI.. Extracellular granzymes: current 

perspectives. Biol Chem. 2006 Jul;387(7):827-37. 

(REVIEW) 

Praveen K, Leary JH 3rd, Evans DL, Jaso-Friedmann L.. 

Molecular characterization and expression of a granzyme 

of an ectothermic vertebrate with chymase-like activity 

expressed in the cytotoxic cells of Nile tilapia (Oreochromis 

niloticus). Immunogenetics. 2006 Feb;58(1):41-55. Epub 

2006 Feb 9. 


Praveen K, Leary JH 3rd, Evans DL, Jaso-Friedmann L.. 

Nonspecific cytotoxic cells of teleosts are armed with 

multiple granzymes and other components of the granule 

exocytosis pathway. Mol Immunol. 2006 Mar;43(8):1152- 

62. Epub 2005 Aug 30. 

Wernersson S, Reimer JM, Poorafshar M, Karlson U, 

Wermenstam N, Bengten E, Wilson M, Pilstrom L, Hellman 

L.. Granzyme-like sequences in bony fish shed light on the 

emergence of hematopoietic serine proteases during 

vertebrate evolution. Dev Comp Immunol. 

2006;30(10):901-18. Epub 2005 Dec 27. 

Cao X, Cai SF, Fehniger TA, Song J, Collins LI, Piwnica- 

Worms DR, Ley TJ.. Granzyme B and perforin are 

important for regulatory T cell-mediated suppression of 

tumor clearance. Immunity. 2007 Oct;27(4):635-46. Epub 

2007 Oct 4. 

Ruike Y, Katsuma S, Hirasawa A, Tsujimoto G.. 

Glucocorticoid-induced alternative promoter usage for a 

novel 5' variant of granzyme A. J Hum Genet. 

2007;52(2):172-8. Epub 2006 Dec 19. 

Vernooy JH, Moller GM, van Suylen RJ, van Spijk MP, 

Cloots RH, Hoet PH, Pennings HJ, Wouters EF.. 

Increased granzyme A expression in type II pneumocytes 

of patients with severe chronic obstructive pulmonary 

disease. Am J Respir Crit Care Med. 2007 Mar 

1;175(5):464-72. Epub 2006 Nov 30. 

Metkar SS, Menaa C, Pardo J, Wang B, Wallich R, 

Freudenberg M, Kim S, Raja SM, Shi L, Simon MM, 

Froelich CJ.. Human and mouse granzyme A induce a 

proinflammatory cytokine response. Immunity. 2008 Nov 

14;29(5):720-33. Epub 2008 Oct 23. 

Baran K, Dunstone M, Chia J, Ciccone A, Browne KA, 

Clarke CJ, Lukoyanova N, Saibil H, Whisstock JC, 

Voskoboinik I, Trapani JA.. The molecular basis for 

perforin oligomerization and transmembrane pore 

assembly. Immunity. 2009 May;30(5):684-95. Epub 2009 

May 14. 

Froelich CJ, Pardo J, Simon MM.. Granule-associated 

serine proteases: granzymes might not just be killer 

proteases. Trends Immunol. 2009 Mar;30(3):117-23. Epub 

2009 Feb 13. (REVIEW) 

Hendel A, Hiebert PR, Boivin WA, Williams SJ, Granville 

DJ.. Granzymes in age-related cardiovascular and 

pulmonary diseases. Cell Death Differ. 2010 

Apr;17(4):596-606. Epub 2010 Feb 5. (REVIEW) 

Lieberman J.. Granzyme A activates another way to die. 

Immunol Rev. 2010 May;235(1):93-104. (REVIEW) 

Praper T, Sonnen A, Viero G, Kladnik A, Froelich CJ, 

Anderluh G, Dalla Serra M, Gilbert RJ.. Human perforin 

employs different avenues to damage membranes. J Biol 

Chem. 2011 Jan 28;286(4):2946-55. Epub 2010 Oct 2. 

Thiery J, Keefe D, Boulant S, Boucrot E, Walch M, 

Martinvalet D, Goping IS, Bleackley RC, Kirchhausen T, 

Lieberman J.. Perforin pores in the endosomal membrane 

trigger the release of endocytosed granzyme B into the 

cytosol of target cells. Nat Immunol. 2011 Jun 

19;12(8):770-7. doi: 10.1038/ni.2050. 


Catalan E, Sanchez-Martinez D, Pardo J. GZMA 

(granzyme A (granzyme 1, cytotoxic T-lymphocyteassociated 

serine esterase 3)). Atlas Genet Cytogenet 

Oncol Haematol. 2012; 16(2):121-124. 





Mini Review 


MIER1 (mesoderm induction early response 1 

homolog (Xenopus laevis)) 

Laura L Gillespie, Gary D Paterno 

Terry Fox Cancer Research Labs, Division of Biomedical Sciences, Faculty of Medicine, Memorial 

University, St John's, NL, Canada (LLG, GDP) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/MIER1ID50389ch1p31.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIER1ID50389ch1p31.txt 

This article is an update of : 

Gillespie LL, Paterno GD. MIER1 (mesoderm induction early response 1 homolog (Xenopus laevis)). Atlas Genet Cytogenet 

Oncol Haematol 2010;14(10) 



Identity 

Other names: ER1, Er1, KIAA1610, MGC150641, 

MGC131940, MGC150640, MI-ER1, hMI-ER1, 

RP5-944N15.1, DKFZp781G0451 

HGNC (Hugo): MIER1 


Note 

MIER1 was identified by differential display as an 

immediate-early gene activated during fibroblast 

growth factor (FGF) induction of mesoderm 

differentiation in Xenopus laevis. 

DNA/RNA 

A. Schematic illustrating the exon-intron organization of the human MIER1 gene. Exons are shown as red bars/vertical 

lines and introns as horizontal lines; exon numbers are indicated below each schematic. The light red bar indicates the 

facultative intron 16 and the position of the alpha and beta carboxy-terminal coding regions are indicated. Note that the beta 

coding region is located within the facultative intron. The three alternate starts of translation, ML-, MF- and MAE- are indicated as 

are the three polyadenylation signals (PAS): i, ii and iii. 


MIER1 (mesoderm induction early response 1 homolog 

(Xenopus laevis)) 

Gillespie LL, Paterno GD 

B. Schematic illustrating the variant 5' and 3' ends of human MIER1 transcripts. Alternate 5' ends are generated from 

differential promoter usage (P1 or P2) or alternate inclusion of exon 3A. This leads to three alternate starts of translation, 

indicated as ML-, MF- and MAE-, and produces three distinct amino termini. The four variant 3' ends, a, bi, bii and biii, produced 

by alternative splicing or alternate PAS usage, result in transcripts readily distinguished by size (1.7 kb, 2.5 kb, 3.4 kb and 4.8 kb, 

respectively) on a Northern blot. It should be noted that three of the variant 3' ends, bi, bii and biii encode the same protein 

sequence and differ only in their untranslated region. * indicates beta encoding transcript that contains the alpha exon in its 

3'UTR. The locations of the alpha and beta carboxy-terminal coding regions and PAS i, ii and iii are indicated. The combination 

of three possible 5' ends with four possible 3' ends gives rise to 12 distinct transcripts, but only 6 distinct protein isoforms. In 

most adult tissues, the most abundant transcript is 4.8 kb. Additional transcripts have been reported in Ensembl. 

Description 

63 kb gene; 2 promoters controlling 2 distinct 

transcriptional start sites; 17 exons; intron 16 is 

facultative; 3 polyadenylation sites. 

Protein 

Description 

The six human MIER1 isoforms: M-3A-alpha (457 

aa), M-3A-beta (536 aa), ML-alpha (432 aa), MLbeta 

(511 aa), MAE-alpha (433 aa), and MAE-beta 

(512 aa), range in predicted molecular size from 

47.5 kDa-59 kDa; however all isoforms migrate 

slower than predicted on SDS-PAGE, with 

calculated molecular sizes ranging 78 kDa-90 kDa. 

Expression 

MIER1beta protein is expressed ubiquitously, while 

MIER1alpha protein is expressed mainly in a subset 

of endocrine organs and endocrine responsive 

tissues, including the pancreatic islets, adrenal 

glands, testis, ovary, hypothalamus, pituitary, 

parafollicular cells of the thyroid and mammary 

ductal epithelium. 

Localisation 

MIER1beta is nuclear in all adult cell types but is 

retained in the cytoplasm of the pre-gastrula 

Xenopus embryo. MIER1alpha is cytoplasmic in 

most cell types, but localized in the nucleus in 

normal mammary ductal epithelium. During 

progression to invasive breast carcinoma, its 

subcellular localization shifts from nuclear to 

exclusively cytoplasmic. 

Function 

MIER1alpha and beta function in transcriptional 

repression by at least two distinct mechanisms: 

recruitment and regulation of chromatin modifying 

enzymes, including HDAC1, HDAC2, CBP and 

G9a; interaction with transcription factors, such as 

Sp1 and ERalpha, to repress transcription of their 

respective target genes. MIER1alpha inhibits 

estrogen-stimulated anchorage-independent growth 

of breast carcinoma cells. 

Homology 

The MIER1 gene family contains two other 

members, MIER2 and MIER3. The MIER1 gene is 

conserved in chimpanzee, dog, cow, mouse, rat, 

chicken, frog, zebrafish, fruit fly, and C. elegans. 





Schematic illustrating the common internal domains of the MIER1 isoforms and the variant amino- (N-) and carboxy- (C- 

) termini. Transcription from the P1 promoter produces proteins that either begin with M-L- or with the sequence encoded by 

exon 3A (MFMFNWFTDCLWTLFLSNYQ). Transcription from the P2 promoter produces a protein that begins with M-A-E-. The 

variant N-termini of the MIER1 isoforms are followed by common internal sequence containing several distinct domains: acidic, 

which function in transcriptional activation (Paterno et al., 1997); ELM2, responsible for recruitment of HDAC1 (Ding et al., 2003); 

SANT, which interacts with Sp1 (Ding et al., 2004) and PSPPP, which is required for MIER1 activity in the Xenopus embryo 

(Teplitsky et al., 2003). The two alternate C-termini, alpha and beta, result from removal or inclusion and read-through of intron 

16, respectively. The alpha C-terminus contains a classic LXXLL motif for interaction with nuclear receptors; the beta C-terminus 

contains a nuclear localization signal (NLS). 

Implicated in 

Breast cancer 

Note 

Initial studies showed that total MIER1 mRNA 

levels were increased in breast carcinoma cell lines 

and tumour samples (Paterno et al., 1998); in a 

more recent study, no consistent difference in 

MIER1alpha protein expression levels between 

normal breast and tumour samples was detected 

(McCarthy et al., 2008). Immunohistochemical 

analysis of patient biopsies revealed that 

MIER1alpha protein is expressed primarily in 

ductal epithelial cells in normal breast tissue, with 

little or no expression in the surrounding stroma; in 

breast carcinoma samples, its expression is 

restricted to tumour cells. While there is no 

difference in expression levels, the subcellular 

localization of MIER1alpha changes dramatically 

during tumour progression: MIER1alpha is nuclear 

in 75% of normal breast samples and in 77% of 

hyperplasia, but in breast carcinoma, only 51% of 

ductal carcinoma in situ, 25% of invasive lobular 

carcinoma and 4% of invasive ductal carcinoma 

contained nuclear MIER1alpha (McCarthy et al., 

2008). This shift from nuclear to cytoplasmic 

localization of MIER1alpha during breast cancer 

progression suggests that loss of nuclear 

MIER1alpha contributes to the development of 

invasive breast carcinoma. MIER1alpha inhibits 

ERalpha transcriptional activity and overexpression 

of MIER1alpha in breast carcinoma cells inhibits 

estrogen-stimulated anchorage-independent growth 

(McCarthy et al., 2008). 

References 

Paterno GD, Li Y, Luchman HA, Ryan PJ, Gillespie LL. 

cDNA cloning of a novel, developmentally regulated 

immediate early gene activated by fibroblast growth factor 

and encoding a nuclear protein. J Biol Chem. 1997 Oct 

10;272(41):25591-5 

Paterno GD, Mercer FC, Chayter JJ, Yang X, Robb JD, 

Gillespie LL. Molecular cloning of human er1 cDNA and its 

differential expression in breast tumours and tumourderived 

cell lines. Gene. 1998 Nov 5;222(1):77-82 

Luchman HA, Paterno GD, Kao KR, Gillespie LL. 

Differential nuclear localization of ER1 protein during 

embryonic development in Xenopus laevis. Mech Dev. 

1999 Jan;80(1):111-4 

Post JN, Gillespie LL, Paterno GD. Nuclear localization 

signals in the Xenopus FGF embryonic early response 1 

protein. FEBS Lett. 2001 Jul 27;502(1-2):41-5 

Paterno GD, Ding Z, Lew YY, Nash GW, Mercer FC, 

Gillespie LL. Genomic organization of the human mi-er1 

gene and characterization of alternatively spliced isoforms: 

regulated use of a facultative intron determines subcellular 

localization. Gene. 2002 Jul 24;295(1):79-88 

Ding Z, Gillespie LL, Paterno GD. Human MI-ER1 alpha 

and beta function as transcriptional repressors by 

recruitment of histone deacetylase 1 to their conserved 

ELM2 domain. Mol Cell Biol. 2003 Jan;23(1):250-8 

Teplitsky Y, Paterno GD, Gillespie LL. Proline365 is a 

critical residue for the activity of XMI-ER1 in Xenopus 

embryonic development. Biochem Biophys Res Commun. 

2003 Sep 5;308(4):679-83 

Beausoleil SA, Jedrychowski M, Schwartz D, Elias JE, 

Villén J, Li J, Cohn MA, Cantley LC, Gygi SP. Large-scale 

characterization of HeLa cell nuclear phosphoproteins. 

Proc Natl Acad Sci U S A. 2004 Aug 17;101(33):12130-5 

Ding Z, Gillespie LL, Mercer FC, Paterno GD. The SANT 

domain of human MI-ER1 interacts with Sp1 to interfere 

with GC box recognition and repress transcription from its 

own promoter. J Biol Chem. 2004 Jul 2;279(27):28009-16 

Post JN, Luchman HA, Mercer FC, Paterno GD, Gillespie 

LL. Developmentally regulated cytoplasmic retention of the 

transcription factor XMI-ER1 requires sequence in the 

acidic activation domain. Int J Biochem Cell Biol. 2005 

Feb;37(2):463-77 

Thorne LB, Grant AL, Paterno GD, Gillespie LL. Cloning 

and characterization of the mouse ortholog of mi-er1. DNA 

Seq. 2005 Jun;16(3):237-40 




Nousiainen M, Silljé HH, Sauer G, Nigg EA, Körner R. 

Phosphoproteome analysis of the human mitotic spindle. 

Proc Natl Acad Sci U S A. 2006 Apr 4;103(14):5391-6 

Blackmore TM, Mercer CF, Paterno GD, Gillespie LL. The 

transcriptional cofactor MIER1-beta negatively regulates 

histone acetyltransferase activity of the CREB-binding 

protein. BMC Res Notes. 2008 Aug 22;1:68 

McCarthy PL, Mercer FC, Savicky MW, Carter BA, Paterno 

GD, Gillespie LL. Changes in subcellular localisation of MI- 

ER1 alpha, a novel oestrogen receptor-alpha interacting 

protein, is associated with breast cancer progression. Br J 

Cancer. 2008 Aug 19;99(4):639-46 


Thorne LB, McCarthy PL, Paterno GD, Gillespie LL. 

Protein expression of the transcriptional regulator MI-ER1 

alpha in adult mouse tissues. J Mol Histol. 2008 

Feb;39(1):15-24 

Wang L, Charroux B, Kerridge S, Tsai CC. Atrophin 

recruits HDAC1/2 and G9a to modify histone H3K9 and to 

determine cell fates. EMBO Rep. 2008 Jun;9(6):555-62 


Gillespie LL, Paterno GD. MIER1 (mesoderm induction 

early response 1 homolog (Xenopus laevis)). Atlas Genet 






Review 


PA2G4 (proliferation-associated 2G4, 38kDa) 

Anne Hamburger, Arundhati Ghosh, Smita Awasthi 

University of Maryland School of Medicine, Department of Pathology and University of Maryland 

Greenebaum Cancer Center, Baltimore, USA (AH, AG, SA) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/PA2G4ID41628ch12q13.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PA2G4ID41628ch12q13.txt 



Identity 

Other names: EBP1, HG4-1, ITAF45, p38-2G4 

HGNC (Hugo): PA2G4 


Note 

PA2G4 encodes a cell-cycle regulated protein 

capable of interacting with DNA, RNA and protein. 

The gene was isolated as a DNA binding protein 

(p38-2g4) (Radomski and Jost, 1995) and also as an 

ErbB3-interacting protein (EBP1) (Yoo et al., 

2000). Two different isoforms of EBP1 play a role 

in cell survival, cell cycle arrest and differentiation. 

The long form may have an oncogenic function 

when overexpressed, and the short form acts as a 

tumor suppressor (Liu et al., 2006). EPB1 also 

functions as a transcriptional repressor of E2F1regulated 

genes (Zhang et al., 2004) and the 

androgen receptor (AR) (Zhang et al., 2005) 

through its interactions with histone deacetylases 

and Sin3A. 

DNA/RNA 

The alignment of PA2G4 mRNA to its genomic sequence. 

Description 

The PA2G4 gene contains 13 exons. The sizes of 

the exons 1-13 are 88, 128, 105, 69, 92, 63, 78, 78, 

133, 94, 127, 53 and 65 bp (to the stop codon). 

Exon 1 contains the translation initiation ATG. 

Exon 13 contains the stop codon. 

Transcription 

The human PA2G4 promoter contains several 

putative transcription factor binding sites. The 

major transcript length is 2643 nt. Two proteins are 

translated due to alternative splicing (Liu et al., 

2006). An alternatively spliced version missing 29 

NT between the first and third ATGs has been 

observed. 

The PA2G4 promoter contains two tandem DNA 

elements that bind E2F1. E2F1 increases 

endogenous EBP1 mRNA levels in cancer cells, but 

decreases EBP1 mRNA abundance in non 

transformed cells (Judah et al., 2010). 

Pseudogene 

Six pseudogenes, located on chromosomes 3, 6, 9, 

18, 20 and X, have been identified. 


PA2G4 (proliferation-associated 2G4, 38kDa) Hamburger A, et al. 

The linear schematic of EBP1. Functional domains, including Nucleolar Localization Signal (NuLS), σ70 RNA binding region 

(σ70), amphipathic helical domain (AHD), LXXLL nuclear receptor binding motif (LX) and demonstrated in vivo phosphorylation 

sites (*). 

Protein 

Description 

p38-2G4 was initially isolated as a DNA binding 

protein from mouse Ehrlich ascites cells (Radomski 

and Jost, 1995). The MW of this protein is 

predicted to be 38058 D, consisting of 340 amino 

acids. The human orthologue EBP1 was later 

identified as an ErbB3 binding protein of the same 

MW as the mouse protein (Yoo et al., 2000). This 

form migrates at approximately 42 kD in SDS- 

PAGE gels. Later, a larger 394 amino acid form 

(predicted MW 43787 D, migrating at 48 kD) was 

observed in mammalian cells (Xia et al., 2001). The 

two forms have been demonstrated to be the result 

of alternative splicing (Liu et al., 2006) or usage of 

alternative translation initiation sites (Xia et al., 

2001). Amino acids 1-48 are required for nucleolar 

localization and the C terminal domain (aa 364- 

394) is required for interactions with nucleic acids 

(Moonie et al., 2007) and protein (Zhang et al., 

2002). 

EBP1 is post translationally modified at several 

phosphorylation sites (Ser 360 (Ahn et al., 2006), 

Ser 363 (Akinmade et al., 2007) and Thr 261 

(Akinmade et al., 2008)) in vivo. The protein 

stability of the short form is regulated by 

ubiquitination (Liu et al., 2009). The short form is 

also sumoylated by the TLF/FUS E3 ligase and this 

sumoylation is required for the anti-proliferative 

effects of EBP1 (Oh et al., 2010). 

The crystal structure of both murine (Monie et al., 

2007) and human (Kowalinski et al., 2007) EBP1 

has been solved. There is a core domain that is 

homologous to methionine aminopeptidases, 

although no enzymatic activity has been reported. 

The C terminal domain containing a Lys-rich 

nuclear hormone receptor binding motif (LKALL) 

was reported to mediate RNA binding (Monie et al., 

2007). 

Expression 

EBP1 has been found to be ubiquitously expressed 

with high expression levels in skeletal muscle (Yoo 

et al., 2000). 

Localisation 

Under logarithmically growing conditions in cell 

culture, EBP1 localizes to the nucleolus and the 

cytoplasm (Xia et al., 2001; Squatrito et al., 2004). 

Upon stimulation with the ErbB3 ligand heregulin, 

the short form of EBP1 is recruited to the nucleus in 

AU565 breast cancer cells (Yoo et al., 2000). 

Sumoylation is required for nuclear translocation 

(Oh et al., 2010). In primary normal epithelial cells, 

EBP1 is confined to the cytoplasm (Zhang et al., 

2008b). 

Function 

EBP1 was initially isolated as a cell cycle-regulated 

DNA binding protein (Radomski and Jost, 1995) 

and has been shown to induce cell cycle arrest in 

the G2/M phase of the cell cycle (Zhang et al., 

2005). EBP1 acts as a corepressor for several 

proliferation-associated genes including Cyclin D1, 

E2F1 (Zhang and Hamburger, 2004) and the 

androgen receptor (Zhang et al., 2005). EBP1 

inhibits transcription of these genes by recruiting 

HDAC2 via Sin3A to the E2F1 and AR-regulated 

promoters (Zhang et al., 2005). EBP1 interacts with 

RB1 and the interaction is enhanced upon EBP1 

dephosphorylation (Xia et al., 2001). 

EBP1 was isolated as an ErbB3 binding protein 

using a yeast-two hybrid screen (Yoo et al., 2000). 

The interactions of EBP1 with ErbB3 is disrupted 

by the ErbB3 ligand heregulin, leading to EBP1 

nuclear translocation. This leads to the eventual 

inhibition of heregulin-stimulated proliferation, 

presumably due to the repression of proliferation 

associated genes (Zhang et al., 2008a). 

EBP1 also binds RNA and associates with 28S, 18S 

and 5.8S mature rRNAs, several rRNA precursors 

and probably U3 small nucleolar RNA. It has been 

implicated in the regulation of intermediate and late 

steps of rRNA processing (Squatrito et al., 2004; 

Squatrito et al., 2006). EBP1 also mediates capindependent 

translation of specific viral IRES 

(internal ribosome entry site) (Pilipenko et al., 

2000). EBP1 regulates translation of AR mRNA 

(Zhou et al., 2010). 

EBP1 has also been implicated in protein stability 

via its interaction with the proteasome. 



Overexpression of EBP1 results in decreased 

stability of ErbB2 protein in breast cancer cells via 

a proteasome-mediated pathway (Lu et al., 2011). 

The long form of EBP1 binds to the p53 E3 ligase 

HDM2, enhancing HDM2-p53 interactions and 

promoting p53 degradation (Kim et al., 2011). 

The long (p48) and short (p42) forms of EBP1 have 

opposing biological effects, with the longer form 

inducing cell survival and the shorter form 

inhibiting cell growth (Liu et al., 2006). The long 

form binds HDM2, promoting degradation of p53 

(Kim et al., 2010). 

Homology 

Similar (30% identity) to the 42 kDA DNA binding 

protein SF00553 in S. pombe yeast (Yamada et al., 

1994) and StEBP1 in potato (Horvath et al., 2006). 

The orthologue in potatoes (StEBP1) has 69% 

sequence similarity to human EBP1 and can inhibit 

growth of human breast cancer cell lines and E2F1 

expression in these cells. 

Mutations 

Germinal 

No mutations in the PA2G4 gene have been 

reported. 

Somatic 

None reported. 

Implicated in 


Prognosis 

Decreased expression of EBP1 is associated with 

higher tumor grade and metastasis in prostate 

cancer (Zhang et al., 2008b). However, another 

study indicated EBP1 expression increased with 

disease progression (Gannon et al., 2008). 

Breast cancer 

Prognosis 

Deletion of EBP1 results in tamoxifen resistance in 

breast cancer (Zhang et al., 2008a). However, 

patients with a high level of EBP1 protein have a 

poor clinical outcome (Ou et al., 2006). 

Glioblastoma 

Prognosis 

Glioblastoma patients expressing a high level of 

p48 EBP1 have a worse prognosis than those 

expressing lower levels of the protein (Kim et al., 

2010; Kwon and Ahn, 2011). 

References 

Yamada H, Mori H, Momoi H, Nakagawa Y, Ueguchi C, 

Mizuno T. A fission yeast gene encoding a protein that 

preferentially associates with curved DNA. Yeast. 1994 

Jul;10(7):883-94 

Radomski N, Jost E. Molecular cloning of a murine cDNA 

encoding a novel protein, p38-2G4, which varies with the 

cell cycle. Exp Cell Res. 1995 Oct;220(2):434-45 

Pilipenko EV, Pestova TV, Kolupaeva VG, Khitrina EV, 

Poperechnaya AN, Agol VI, Hellen CU. A cell cycledependent 

protein serves as a template-specific translation 

initiation factor. Genes Dev. 2000 Aug 15;14(16):2028-45 

Yoo JY, Wang XW, Rishi AK, Lessor T, Xia XM, Gustafson 

TA, Hamburger AW. Interaction of the PA2G4 (EBP1) 

protein with ErbB-3 and regulation of this binding by 

heregulin. Br J Cancer. 2000 Feb;82(3):683-90 

Xia X, Cheng A, Lessor T, Zhang Y, Hamburger AW. 

Ebp1, an ErbB-3 binding protein, interacts with Rb and 

affects Rb transcriptional regulation. J Cell Physiol. 2001 

May;187(2):209-17 

Squatrito M, Mancino M, Donzelli M, Areces LB, Draetta 

GF. EBP1 is a nucleolar growth-regulating protein that is 

part of pre-ribosomal ribonucleoprotein complexes. 

Oncogene. 2004 May 27;23(25):4454-65 

Zhang Y, Hamburger AW. Heregulin regulates the ability of 

the ErbB3-binding protein Ebp1 to bind E2F promoter 

elements and repress E2F-mediated transcription. J Biol 

Chem. 2004 Jun 18;279(25):26126-33 

Zhang Y, Akinmade D, Hamburger AW. The ErbB3 binding 

protein Ebp1 interacts with Sin3A to repress E2F1 and ARmediated 

transcription. Nucleic Acids Res. 

2005;33(18):6024-33 

Ahn JY, Liu X, Liu Z, Pereira L, Cheng D, Peng J, Wade 

PA, Hamburger AW, Ye K. Nuclear Akt associates with 

PKC-phosphorylated Ebp1, preventing DNA fragmentation 

by inhibition of caspase-activated DNase. EMBO J. 2006 

May 17;25(10):2083-95 

Horváth BM, Magyar Z, Zhang Y, Hamburger AW, Bakó L, 

Visser RG, Bachem CW, Bögre L. EBP1 regulates organ 

size through cell growth and proliferation in plants. EMBO 

J. 2006 Oct 18;25(20):4909-20 

Liu Z, Ahn JY, Liu X, Ye K. Ebp1 isoforms distinctively 

regulate cell survival and differentiation. Proc Natl Acad 

Sci U S A. 2006 Jul 18;103(29):10917-22 

Ou K, Kesuma D, Ganesan K, Yu K, Soon SY, Lee SY, 

Goh XP, Hooi M, Chen W, Jikuya H, Ichikawa T, Kuyama 

H, Matsuo E, Nishimura O, Tan P. Quantitative profiling of 

drug-associated proteomic alterations by combined 2nitrobenzenesulfenyl 

chloride (NBS) isotope labeling and 

2DE/MS identification. J Proteome Res. 2006 

Sep;5(9):2194-206 

Squatrito M, Mancino M, Sala L, Draetta GF. Ebp1 is a 

dsRNA-binding protein associated with ribosomes that 

modulates eIF2alpha phosphorylation. Biochem Biophys 

Res Commun. 2006 Jun 9;344(3):859-68 

Akinmade D, Lee M, Zhang Y, Hamburger AW. Ebp1mediated 

inhibition of cell growth requires serine 363 

phosphorylation. Int J Oncol. 2007 Oct;31(4):851-8 

Kowalinski E, Bange G, Bradatsch B, Hurt E, Wild K, 

Sinning I. The crystal structure of Ebp1 reveals a 

methionine aminopeptidase fold as binding platform for 

multiple interactions. FEBS Lett. 2007 Sep 

18;581(23):4450-4 

Monie TP, Perrin AJ, Birtley JR, Sweeney TR, 

Karakasiliotis I, Chaudhry Y, Roberts LO, Matthews S, 

Goodfellow IG, Curry S. Structural insights into the 

transcriptional and translational roles of Ebp1. EMBO J. 

2007 Sep 5;26(17):3936-44 

Akinmade D, Talukder AH, Zhang Y, Luo WM, Kumar R, 

Hamburger AW. Phosphorylation of the ErbB3 binding 



protein Ebp1 by p21-activated kinase 1 in breast cancer 

cells. Br J Cancer. 2008 Mar 25;98(6):1132-40 

Gannon PO, Koumakpayi IH, Le Page C, Karakiewicz PI, 

Mes-Masson AM, Saad F. Ebp1 expression in benign and 

malignant prostate. Cancer Cell Int. 2008 Nov 24;8:18 

Zhang Y, Akinmade D, Hamburger AW. Inhibition of 

heregulin mediated MCF-7 breast cancer cell growth by 

the ErbB3 binding protein EBP1. Cancer Lett. 2008a Jul 

8;265(2):298-306 

Zhang Y, Linn D, Liu Z, Melamed J, Tavora F, Young CY, 

Burger AM, Hamburger AW. EBP1, an ErbB3-binding 

protein, is decreased in prostate cancer and implicated in 

hormone resistance. Mol Cancer Ther. 2008b 

Oct;7(10):3176-86 

Liu Z, Oh SM, Okada M, Liu X, Cheng D, Peng J, Brat DJ, 

Sun SY, Zhou W, Gu W, Ye K. Human BRE1 is an E3 

ubiquitin ligase for Ebp1 tumor suppressor. Mol Biol Cell. 

2009 Feb;20(3):757-68 

Judah D, Chang WY, Dagnino L. EBP1 is a novel E2F 

target gene regulated by transforming growth factor-β. 

PLoS One. 2010 Nov 10;5(11):e13941 

Kim CK, Nguyen TL, Joo KM, Nam DH, Park J, Lee KH, 

Cho SW, Ahn JY. Negative regulation of p53 by the long 

isoform of ErbB3 binding protein Ebp1 in brain tumors. 

Cancer Res. 2010 Dec 1;70(23):9730-41 

Oh SM, Liu Z, Okada M, Jang SW, Liu X, Chan CB, Luo H, 

Ye K. Ebp1 sumoylation, regulated by TLS/FUS E3 ligase, 

is required for its anti-proliferative activity. Oncogene. 2010 

Feb 18;29(7):1017-30 

Zhou H, Mazan-Mamczarz K, Martindale JL, Barker A, Liu 

Z, Gorospe M, Leedman PJ, Gartenhaus RB, Hamburger 

AW, Zhang Y. Post-transcriptional regulation of androgen 

receptor mRNA by an ErbB3 binding protein 1 in prostate 

cancer. Nucleic Acids Res. 2010 Jun;38(11):3619-31 

Kwon IS, Ahn JY. P48 Ebp1 acts as a downstream 

mediator of Trk signaling in neurons, contributing neuronal 

differentiation. Neurochem Int. 2011 Feb;58(2):215-23 

Lu Y, Zhou H, Chen W, Zhang Y, Hamburger AW. The 

ErbB3 binding protein EBP1 regulates ErbB2 protein levels 

and tamoxifen sensitivity in breast cancer cells. Breast 

Cancer Res Treat. 2011 Feb;126(1):27-36 


Hamburger A, Ghosh A, Awasthi S. PA2G4 (proliferationassociated 

2G4, 38kDa). Atlas Genet Cytogenet Oncol 

Haematol. 2012; 16(2):129-132. 





Review 


PRDM1 (PR domain containing 1, with ZNF 

domain) 

Wayne Tam 

Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY, 

USA (WT) 


Online updated version : http://AtlasGeneticsOncology.org/Genes/PRDM1ID41831ch6q21.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PRDM1ID41831ch6q21.txt 



Identity 

Other names: BLIMP-1, BLIMP1, PRDI-BF1 

HGNC (Hugo): PRDM1 


DNA/RNA 

Description 

The gene encompasses 23,6 kb DNA in humans, 

from 106534195 to 106557814 (hg19-Feb, 2009) in 

the long arm of chromosome 6. It encodes 7 exons. 

The open reading frame spans all 7 exons. 

Figure 1. 

Transcription 

The mRNAs encoded by PRDM1 have two 

transcript isoforms, PRDM1alpha and PRDM1beta, 

which are 5164 and 4675 bp long, respectively. The 

shorter isoform is generated by usage of the 

alternative promoter located in intron 3 and 

contains a different 5' untranslated region. It lacks 

the 5' inframe portion of the coding region present 

in PRDM1alpha. A deletion exon 6 (exon 7 in 

mice) variant has also been described (Schmidt et 

al., 2008). 

Pseudogene 

None. 


PRDM1 (PR domain containing 1, with ZNF domain) Tam W 

Protein 

Description 

PRDM1alpha is the larger isoform and contains 825 

amino acids, with a predicted molecular weight of 

92 kD. It has a PR domain at the N-terminal portion 

(86-207 aa) of the protein, which is related to the 

SET domain (SM00317, SMART) found in many 

histone methyltransferases. In contrast to bona fide 

SET-domain proteins, the PR domain in PRDM1 

does not possess intrinsic histone methyltransferase 

activity. Five C2H2-type zinc fingers (SM00355, 

SMART), which represent the DNA binding 

domain, are present at the C-terminal portion of the 

protein (575-707 aa). The middle part of PRDM1 

(about 300-400 aa) is rich in proline and serine. 

PRDM1beta lacks the N-terminal 101 amino acids 

of the PRDM1alpha, and has a truncated PR 

domain. PRDM1beta has been shown to be 

functionally impaired in its transcriptional 

repression activity (Gyory et al., 2003). The 

proximal 3 zinc fingers in PRDM1/Blimp-1 delta 

exon 6 variant are disrupted (Schmidt et al., 2008). 

This protein variant has auto-regulatory potential 

through negative regulation of PRDM1/Blimp-1 

expression and functions. 

Expression 

PRDM1/Blimp-1 is expressed in several tissues and 

organs, including hematopoietic tissues, skin, 

central nervous system, testis and gut. Within the 

hematopoietic system, PRDM1/Blimp-1 is 

expressed in plasma cells, B cells, T cells, natural 

killer cells, monocytes, granulocytes and dendritic 

cells. In the B cell population, PRDM1/Blimp-1 

starts to be expressed when they are committed to 

undergo terminal differentiation (Cattoretti et al., 

2005). Consistent with its expression in normal 

lymphoid cells, PRDM1 is also expressed in 100% 

of multiple myeloma, and in various frequency in B 

and T lymphomas (Garcia et al., 2006; D'Costa et 

al., 2009). PRDM1/Blimp-1 expression is regulated 

by a number of transcription activators and 

repressors (Martins and Calame, 2008). 

MicroRNAs have also been implicated in the downregulation 

of PRDM1 in both normal germinal 

center B cells (Malumbres et al., 2009; Zhang et al., 

2009; Gururajan et al., 2010) and in neoplastic 

lymphoid cells (Nie et al., 2008; Nie et al., 2010). 

Among PRDM1 isoforms, PRDM1alpha is the 

Figure 2. 

most abundantly expressed, although relative 

abundance between PRDM1alpha and PRDM1beta 

may vary between cell types (Garcia et al., 2006). 

PRDM1/Blimp-1 delta 6 isoform is preferentially 

expressed in resting B cells (Schmidt et al., 2008). 

Localisation 

Nuclear. 

Function 

Mechanisms of action 

PRDM1/Blimp-1 is a transcription repressor that 

binds to specific DNA sequences through its zinc 

fingers, and functions as a scaffold for recruiting 

co-repressors that catalyze histone modifications. It 

has no known intrinsic histone methyltransferase 

activity. PRDM1/blimp-1 has been shown to 

mediate transcriptional silencing via interactions 

with H3 lysine methyltransferase G9a (Gyory et al., 

2004), histone deacetylases HDAC1 and HDAC2 

(Yu et al., 2000), and H3 lysine demethylase LSD1 

(Su et al., 2009). PRDM1 can also tether Groucho 

family of transcription factors to mediate repression 

of gene transcription (Ren et al., 1999). Interaction 

of PRDM1/Blimp-1 with these co-repressors is 

mediated through the proline/serine rich domain 

and/or the zinc fingers. PRDM1 exerts its biological 

functions by repressing expressions of various 

target genes, which can be cell-type specific. For 

example, PRDM1/Blimp-1 mediates cell-cycle 

arrest in B cells by repressing c-myc, and in CD4 

positive helper T cells by inhibiting expressions of 

IL-2 and Fos, an IL-2 activator (Martins and 

Calame, 2008). 

Biologic functions 

PRDM1 was originally identified as a novel 

repressor of human beta-interferon gene expression 

called PRDI-BF1 (positive regulatory domain I 

binding factor 1) (Keller and Maniatis, 1991). Later 

Blimp-1 (B lymphocyte-induced maturation 

protein), which represents the murine homolog of 

PRDI-BF1(Huang, 1994), was discovered as a 

protein the enforced expression of which was 

sufficient to drive plasma cell differentiation of a 

mouse lymphoma cell line with an activated B cell 

phenotype (Turner et al., 1994). Studies since then 

have revealed a role of PRDM1/Blimp-1 in 

multiple cell types. 

PRDM1/Blimp-1 is the master regulator of plasma 

cell differentiation, critical for the generation of 

immunoglobulin-secreting plasma cells and 



maintenance of long-lived plasma cells (Shapiro- 

Shelef et al., 2003; Shapiro-Shelef et al., 2005; 

Martins and Calame, 2008). It mediates terminal B 

cell differentiation by extinguishing gene programs 

related to B cell signaling and proliferation (Shaffer 

et al., 2002), and allowing induction of XBP1 

which coordinates phenotypic changes, including 

expansion of endoplasmic reticulum and increased 

protein synthesis, that define the plasma cell 

phenotype (Shaffer et al., 2004). 

PRDM1/Blimp-1 is also required for T cell 

homeostasis (Kallies et al., 2006; Martins et al., 

2006; Calame, 2010). It attenuates proliferation and 

survival of CD4 positive helper T cells by 

repressing IL-2-dependent activation; inhibits Th1 

differentiation by down-regulating IFNgamma, 

Tbx21 and BCL6; and antagonizes BCL6dependent 

follicular T cell differentiation. 

PRDM1/Blimp-1 also plays critical role in the 

differentiation of CD8-positive T cells. 

Besides its critical functions in B and T cells, 

PRDM1/Blimp-1 promotes differentiation of 

macrophages (Chang et al., 2000). It is also 

important for homeostatic development of dendritic 

cells as well as dendritic cell maturation (Chan et 

al., 2009). PRDM1/Blimp-1 negatively regulates 

NK cell activation by suppressing effector cytokine 

production (Smith et al., 2010). 

In the non-hematopoietic cell types, 

PRDM1/Blimp-1 plays an important role in the 

terminal differentiation of keratinocytes 

(Magnusdottir et al., 2007) and sebaceous cells 

(Sellheyer and Krahl, 2010). It also regulates 

postnatal reprogramming of intestinal enterocytes 

(Harper et al., 2011). 

Furthermore, PRDM1/Blimp-1 is required in 

embryonic developmental cell fate specification and 

organ morphogenesis, as demonstrated by mouse 

and zebrafish model systems (Bikoff et al., 2009). 

Blimp-1 specifies cell fate of primordial germ cells 

(Vincent et al., 2005), neural crests and neuron 

progenitors (Roy and Ng, 2004), and also muscle 

fiber identity (Baxendale et al., 2004; Hofsten et al., 

2008). Blimp-1 is also critical for the normal 

development of the cardiovascular system, 

forelimbs and vibrissae (Robertson et al., 2007). 

Homology 

PRDM1 is conserved in chimpanzee, dog, cow, 

mouse, rat, chicken and zebrafish. 

Mutations 

Somatic 

Somatic mutations have been identified in diffuse 

large B cell lymphomas (DLBCL) at a frequency of 

about 8 to 23% (Tam et al., 2006; Pasqualucci et 

al., 2006; Mandelbaum et al., 2010). One group did 

not detect mutations in 82 cases of DLBCLs in the 

Chinese population, suggesting geographic 

differences in PRDM1 mutations in DLBCL (Liu et 

al., 2007). PRDM1 mutations are exclusively 

detected in about 24 to 35% of the activated B 

cell(ABC)/non-germinal center B cell (non-GCB) 

subtype of DLBCL, and have not been identified in 

GCB-like DLBCL. In addition, about 20% of 

primary DLBCL of the central nervous system, a 

subtype of DLBCL, harbor PRDM1 mutations 

(Courts et al., 2008). PRDM1 mutation was also 

found in one case of primary effusion lymphoma 

out of 2 cases analyzed (Tate et al., 2007). The 

types of somatic mutations seen in PRDM1 include 

splice site mutations, frameshift insertion/deletion 

and less frequently, nonsense and missense 

mutations. The vast majority of these mutations 

result in inactivating truncations lacking one or 

more of the critical domains including PR, proline 

rich region, and the zinc fingers. Missense 

mutations have been demonstrated to affect 

PRDM1 functions (Mandelbaum et al., 2010). Most 

of the somatic mutations (about 90%) are 

associated with inactivation of the other allele by 

deletion, consistent with biallelic inactivation 

characteristic of a tumor suppressor gene. 

Mutations in acute leukemias and solid tumors have 

been not identified (Hangaishi and Kurokawa, 

2010). 

Implicated in 

Diffuse large B cell lymphomas 

Prognosis 

Diffuse large B cell lymphoma (DLBCL) with 

partial plasmablastic differentiation, as indicated by 

PRDM1 expression, has a worse overall and failure 

free survival compared to conventional DLBLC 

without PRDM1 expression, suggesting that 

PRDM1 may be useful as a prognostic marker in 

DLBCL (Montes-Moreno et al., 2010). 

Expression of PRDM1beta has been implicated as a 

poor prognostic marker in DBLCL treated with 

CHOP (but not R-CHOP) and in T cell lymphomas. 

Resistance to chemotherapeutic agents mediated by 

PRDM1beta has been proposed as a potential 

mechanism (Liu et al., 2007; Zhao et al., 2008). 

Oncogenesis 

Inactivation or down-regulation of PRDM1 appears 

to be an important event in the pathogenesis of 

DLBCLs of the ABC/non-GCB subtype. In about 

50% of DLBCLs of this subtype, PRDM1 is 

inactivated by truncating or missense mutations, 

biallele gene deletions or transcription repression 

by a constitutively active, translocated BCL6 

(Mandelbaum et al., 2010). In non-GCB/ABC-like 

DLBCL without these genetic lesions, 

asynchronous PRDM1 mRNA and protein 

expressions have been observed, suggesting a posttranscriptional 

down-regulation (Mandelbaum et 

al., 2010; Nie et al., 2010). MicroRNAs have been 

postulated as a potential mechanism of downregulation 

(Nie et al., 2010). All these findings are 



consistent with a tumor suppressor role of PRDM1 

in DLBCL. In addition, PRDM1/Blimp-1 has been 

directly demonstrated in mouse models to function 

as a tumor suppressor gene (Calado et al., 2010; 

Mandelbaum et al., 2010). Mice lacking 

PRDM1/Blimp-1 are predisposed to develop 

lymphoproliferative disorders resembling human 

ABC-like DLBCL. One of these mouse models also 

demonstrated a cooperative pathogenic effect 

between PRDM1 inactivation and constitutive NFkB 

activation. These findings suggest that PRDM1 

inactivation contributes to the pathogenesis of 

ABC-like DLBCL by inhibiting terminal B cell 

differentiation induced by constitutive canonical 

NF-kB activation characteristically present in this 

lymphoma type. 

Natural killer cell neoplasms 

Oncogenesis 

PRDM1 is frequently (about 40%) deleted as part 

of a minimal deleted region in aggressive natural 

killer (NK) cell neoplasms such as extranodal NK/T 

cell lymphomas, nasal type, and aggressive NK cell 

leukemias (Iqbal et al., 2009; Karube et al., 2011). 

This deletion is generally associated with a downregulation 

of PRDM1 expression, associated with 

focal hypermethylation of the 5' region of the other 

PRDM1 allele. Enforced expression of PRDM1 in 

NK lymphoma cell lines results in cell cycle arrest 

and apoptosis (Karube et al., 2011). Inactivating 

nonsense mutations have also been found in two 

NK cell lines and one clinical NK neoplasm (Iqbal 

et al., 2009; Karube et al., 2011). These findings 

indicate a tumor suppressor role of PRDM1 in NK 

cell neoplasms. 

Radiation-therapy induced second 

malignant neoplasms 

Prognosis 

Pediatric Hodgkin lymphoma patients treated by 

radiation are at risk of developing second 

malignancies later in life. Two SNP variants were 

identified at 6q21 (intergenic between ATG5 and 

PRDM1) in a genome wide association study that 

are associated with increased risk of second 

neoplasms for pediatric patients with Hodgkin 

lymphoma who received radiation therapy. These 

variants correlate with decreased basal PRDM1 

expression and reduced PRDM1 induction after 

radiation therapy, implicating PRDM1 in the 

etiology of radiation-therapy induced second 

malignancies (Best et al., 2011). 

Plasma cell myeloma 

Oncogenesis 

PRDM1 is consistently expressed in plasma cell 

myeloma. A plasmacytoma transgenic mouse 

model demonstrates that PRDM1/Blimp-1 is not a 

tumor suppressor gene in myeloma. Instead, it 

appears to be a limiting factor in plasma cell 

transformation (D'Costa et al., 2009). Reducing 

PRDM1/Blimp-1 dosage decreases incidence of 

plasmacytoma in mice but does not cause reduction 

of normal plasma cells in nontransgenic mice. Loss 

of PRDM1/Blimp-1 eliminates plasmacytoma 

development. 

References 

Keller AD, Maniatis T. Identification and characterization of 

a novel repressor of beta-interferon gene expression. 

Genes Dev. 1991 May;5(5):868-79 

Huang S. Blimp-1 is the murine homolog of the human 

transcriptional repressor PRDI-BF1. Cell. 1994 Jul 

15;78(1):9 

Turner CA Jr, Mack DH, Davis MM. Blimp-1, a novel zinc 

finger-containing protein that can drive the maturation of B 

lymphocytes into immunoglobulin-secreting cells. Cell. 

1994 Apr 22;77(2):297-306 

Ren B, Chee KJ, Kim TH, Maniatis T. PRDI-BF1/Blimp-1 

repression is mediated by corepressors of the Groucho 

family of proteins. Genes Dev. 1999 Jan 1;13(1):125-37 

Chang DH, Angelin-Duclos C, Calame K. BLIMP-1: trigger 

for differentiation of myeloid lineage. Nat Immunol. 2000 

Aug;1(2):169-76 

Yu J, Angelin-Duclos C, Greenwood J, Liao J, Calame K. 

Transcriptional repression by blimp-1 (PRDI-BF1) involves 

recruitment of histone deacetylase. Mol Cell Biol. 2000 

Apr;20(7):2592-603 

Shaffer AL, Lin KI, Kuo TC, Yu X, Hurt EM, Rosenwald A, 

Giltnane JM, Yang L, Zhao H, Calame K, Staudt LM. 

Blimp-1 orchestrates plasma cell differentiation by 

extinguishing the mature B cell gene expression program. 

Immunity. 2002 Jul;17(1):51-62 

Györy I, Fejér G, Ghosh N, Seto E, Wright KL. 

Identification of a functionally impaired positive regulatory 

domain I binding factor 1 transcription repressor in 

myeloma cell lines. J Immunol. 2003 Mar 15;170(6):3125- 

33 

Shapiro-Shelef M, Lin KI, McHeyzer-Williams LJ, Liao J, 

McHeyzer-Williams MG, Calame K. Blimp-1 is required for 

the formation of immunoglobulin secreting plasma cells 

and pre-plasma memory B cells. Immunity. 2003 

Oct;19(4):607-20 

Baxendale S, Davison C, Muxworthy C, Wolff C, Ingham 

PW, Roy S. The B-cell maturation factor Blimp-1 specifies 

vertebrate slow-twitch muscle fiber identity in response to 

Hedgehog signaling. Nat Genet. 2004 Jan;36(1):88-93 

Gyory I, Wu J, Fejér G, Seto E, Wright KL. PRDI-BF1 

recruits the histone H3 methyltransferase G9a in 

transcriptional silencing. Nat Immunol. 2004 Mar;5(3):299- 

308 

Roy S, Ng T. Blimp-1 specifies neural crest and sensory 

neuron progenitors in the zebrafish embryo. Curr Biol. 

2004 Oct 5;14(19):1772-7 

Shaffer AL, Shapiro-Shelef M, Iwakoshi NN, Lee AH, Qian 

SB, Zhao H, Yu X, Yang L, Tan BK, Rosenwald A, Hurt 

EM, Petroulakis E, Sonenberg N, Yewdell JW, Calame K, 

Glimcher LH, Staudt LM. XBP1, downstream of Blimp-1, 

expands the secretory apparatus and other organelles, 

and increases protein synthesis in plasma cell 

differentiation. Immunity. 2004 Jul;21(1):81-93 

Cattoretti G, Angelin-Duclos C, Shaknovich R, Zhou H, 

Wang D, Alobeid B. PRDM1/Blimp-1 is expressed in 

human B-lymphocytes committed to the plasma cell 

lineage. J Pathol. 2005 May;206(1):76-86 



Shapiro-Shelef M, Lin KI, Savitsky D, Liao J, Calame K. 

Blimp-1 is required for maintenance of long-lived plasma 

cells in the bone marrow. J Exp Med. 2005 Dec 

5;202(11):1471-6 

Vincent SD, Dunn NR, Sciammas R, Shapiro-Shalef M, 

Davis MM, Calame K, Bikoff EK, Robertson EJ. The zinc 

finger transcriptional repressor Blimp1/Prdm1 is 

dispensable for early axis formation but is required for 

specification of primordial germ cells in the mouse. 

Development. 2005 Mar;132(6):1315-25 

Garcia JF, Roncador G, García JF, Sánz AI, Maestre L, 

Lucas E, Montes-Moreno S, Fernandez Victoria R, 

Martinez-Torrecuadrara JL, Marafioti T, Mason DY, Piris 

MA. PRDM1/BLIMP-1 expression in multiple B and T-cell 

lymphoma. Haematologica. 2006 Apr;91(4):467-74 

Kallies A, Hawkins ED, Belz GT, Metcalf D, Hommel M, 

Corcoran LM, Hodgkin PD, Nutt SL. Transcriptional 

repressor Blimp-1 is essential for T cell homeostasis and 

self-tolerance. Nat Immunol. 2006 May;7(5):466-74 

Martins GA, Cimmino L, Shapiro-Shelef M, Szabolcs M, 

Herron A, Magnusdottir E, Calame K. Transcriptional 

repressor Blimp-1 regulates T cell homeostasis and 

function. Nat Immunol. 2006 May;7(5):457-65 

Pasqualucci L, Compagno M, Houldsworth J, Monti S, 

Grunn A, Nandula SV, Aster JC, Murty VV, Shipp MA, 

Dalla-Favera R. Inactivation of the PRDM1/BLIMP1 gene 

in diffuse large B cell lymphoma. J Exp Med. 2006 Feb 

20;203(2):311-7 

Tam W, Gomez M, Chadburn A, Lee JW, Chan WC, 

Knowles DM. Mutational analysis of PRDM1 indicates a 

tumor-suppressor role in diffuse large B-cell lymphomas. 

Blood. 2006 May 15;107(10):4090-100 

Liu YY, Leboeuf C, Shi JY, Li JM, Wang L, Shen Y, Garcia 

JF, Shen ZX, Chen Z, Janin A, Chen SJ, Zhao WL. 

Rituximab plus CHOP (R-CHOP) overcomes PRDM1associated 

resistance to chemotherapy in patients with 

diffuse large B-cell lymphoma. Blood. 2007 Jul 

1;110(1):339-44 

Magnúsdóttir E, Kalachikov S, Mizukoshi K, Savitsky D, 

Ishida-Yamamoto A, Panteleyev AA, Calame K. Epidermal 

terminal differentiation depends on B lymphocyte-induced 

maturation protein-1. Proc Natl Acad Sci U S A. 2007 Sep 

18;104(38):14988-93 

Robertson EJ, Charatsi I, Joyner CJ, Koonce CH, Morgan 

M, Islam A, Paterson C, Lejsek E, Arnold SJ, Kallies A, 

Nutt SL, Bikoff EK. Blimp1 regulates development of the 

posterior forelimb, caudal pharyngeal arches, heart and 

sensory vibrissae in mice. Development. 2007 

Dec;134(24):4335-45 

Tate G, Hirayama-Ohashi Y, Kishimoto K, Mitsuya T. 

Novel BLIMP1/PRDM1 gene mutations in B-cell 

lymphoma. Cancer Genet Cytogenet. 2007 Jan 

15;172(2):151-3 

Courts C, Montesinos-Rongen M, Brunn A, Bug S, Siemer 

D, Hans V, Blümcke I, Klapper W, Schaller C, Wiestler OD, 

Küppers R, Siebert R, Deckert M. Recurrent inactivation of 

the PRDM1 gene in primary central nervous system 

lymphoma. J Neuropathol Exp Neurol. 2008 Jul;67(7):720- 

7 

Martins G, Calame K. Regulation and functions of Blimp-1 

in T and B lymphocytes. Annu Rev Immunol. 2008;26:133- 

69 

Nie K, Gomez M, Landgraf P, Garcia JF, Liu Y, Tan LH, 

Chadburn A, Tuschl T, Knowles DM, Tam W. MicroRNAmediated 

down-regulation of PRDM1/Blimp-1 in 

Hodgkin/Reed-Sternberg cells: a potential pathogenetic 

lesion in Hodgkin lymphomas. Am J Pathol. 2008 

Jul;173(1):242-52 

Schmidt D, Nayak A, Schumann JE, Schimpl A, Berberich 

I, Berberich-Siebelt F. Blimp-1Deltaexon7: a naturally 

occurring Blimp-1 deletion mutant with auto-regulatory 

potential. Exp Cell Res. 2008 Dec 10;314(20):3614-27 

von Hofsten J, Elworthy S, Gilchrist MJ, Smith JC, Wardle 

FC, Ingham PW. Prdm1- and Sox6-mediated 

transcriptional repression specifies muscle fibre type in the 

zebrafish embryo. EMBO Rep. 2008 Jul;9(7):683-9 

Zhao WL, Liu YY, Zhang QL, Wang L, Leboeuf C, Zhang 

YW, Ma J, Garcia JF, Song YP, Li JM, Shen ZX, Chen Z, 

Janin A, Chen SJ. PRDM1 is involved in chemoresistance 

of T-cell lymphoma and down-regulated by the proteasome 

inhibitor. Blood. 2008 Apr 1;111(7):3867-71 

Bikoff EK, Morgan MA, Robertson EJ. An expanding job 

description for Blimp-1/PRDM1. Curr Opin Genet Dev. 

2009 Aug;19(4):379-85 

Chan YH, Chiang MF, Tsai YC, Su ST, Chen MH, Hou 

MS, Lin KI. Absence of the transcriptional repressor Blimp- 

1 in hematopoietic lineages reveals its role in dendritic cell 

homeostatic development and function. J Immunol. 2009 

Dec 1;183(11):7039-46 

D'Costa K, Emslie D, Metcalf D, Smyth GK, Karnowski A, 

Kallies A, Nutt SL, Corcoran LM. Blimp1 is limiting for 

transformation in a mouse plasmacytoma model. Blood. 

2009 Jun 4;113(23):5911-9 

Iqbal J, Kucuk C, Deleeuw RJ, Srivastava G, Tam W, 

Geng H, Klinkebiel D, Christman JK, Patel K, Cao K, Shen 

L, Dybkaer K, Tsui IF, Ali H, Shimizu N, Au WY, Lam WL, 

Chan WC. Genomic analyses reveal global functional 

alterations that promote tumor growth and novel tumor 

suppressor genes in natural killer-cell malignancies. 

Leukemia. 2009 Jun;23(6):1139-51 

Malumbres R, Sarosiek KA, Cubedo E, Ruiz JW, Jiang X, 

Gascoyne RD, Tibshirani R, Lossos IS. Differentiation 

stage-specific expression of microRNAs in B lymphocytes 

and diffuse large B-cell lymphomas. Blood. 2009 Apr 

16;113(16):3754-64 

Su ST, Ying HY, Chiu YK, Lin FR, Chen MY, Lin KI. 

Involvement of histone demethylase LSD1 in Blimp-1mediated 

gene repression during plasma cell 

differentiation. Mol Cell Biol. 2009 Mar;29(6):1421-31 

Zhang J, Jima DD, Jacobs C, Fischer R, Gottwein E, 

Huang G, Lugar PL, Lagoo AS, Rizzieri DA, Friedman DR, 

Weinberg JB, Lipsky PE, Dave SS. Patterns of microRNA 

expression characterize stages of human B-cell 

differentiation. Blood. 2009 May 7;113(19):4586-94 

Calado DP, Zhang B, Srinivasan L, Sasaki Y, Seagal J, 

Unitt C, Rodig S, Kutok J, Tarakhovsky A, Schmidt- 

Supprian M, Rajewsky K. Constitutive canonical NF-κB 

activation cooperates with disruption of BLIMP1 in the 

pathogenesis of activated B cell-like diffuse large cell 

lymphoma. Cancer Cell. 2010 Dec 14;18(6):580-9 

Calame K. Blimp-1's maiden flight. J Immunol. 2010 Jul 

1;185(1):3-4 

Gururajan M, Haga CL, Das S, Leu CM, Hodson D, Josson 

S, Turner M, Cooper MD. MicroRNA 125b inhibition of B 

cell differentiation in germinal centers. Int Immunol. 2010 

Jul;22(7):583-92 

Hangaishi A, Kurokawa M. Blimp-1 is a tumor suppressor 

gene in lymphoid malignancies. Int J Hematol. 2010 

Jan;91(1):46-53 

Mandelbaum J, Bhagat G, Tang H, Mo T, Brahmachary M, 

Shen Q, Chadburn A, Rajewsky K, Tarakhovsky A, 

Pasqualucci L, Dalla-Favera R. BLIMP1 is a tumor 



suppressor gene frequently disrupted in activated B celllike 

diffuse large B cell lymphoma. Cancer Cell. 2010 Dec 

14;18(6):568-79 

Montes-Moreno S, Gonzalez-Medina AR, Rodriguez-Pinilla 

SM, Maestre L, Sanchez-Verde L, Roncador G, Mollejo M, 

García JF, Menarguez J, Montalbán C, Ruiz-Marcellan 

MC, Conde E, Piris MA. Aggressive large B-cell lymphoma 

with plasma cell differentiation: immunohistochemical 

characterization of plasmablastic lymphoma and diffuse 

large B-cell lymphoma with partial plasmablastic 

phenotype. Haematologica. 2010 Aug;95(8):1342-9 

Nie K, Zhang T, Allawi H, Gomez M, Liu Y, Chadburn A, 

Wang YL, Knowles DM, Tam W. Epigenetic downregulation 

of the tumor suppressor gene PRDM1/Blimp-1 

in diffuse large B cell lymphomas: a potential role of the 

microRNA let-7. Am J Pathol. 2010 Sep;177(3):1470-9 

Sellheyer K, Krahl D. Blimp-1: a marker of terminal 

differentiation but not of sebocytic progenitor cells. J Cutan 

Pathol. 2010 Mar;37(3):362-70 

Smith MA, Maurin M, Cho HI, Becknell B, Freud AG, Yu J, 

Wei S, Djeu J, Celis E, Caligiuri MA, Wright KL. 

PRDM1/Blimp-1 controls effector cytokine production in 

human NK cells. J Immunol. 2010 Nov 15;185(10):6058-67 

Best T, Li D, Skol AD, Kirchhoff T, Jackson SA, Yasui Y, 

Bhatia S, Strong LC, Domchek SM, Nathanson KL, 

Olopade OI, Huang RS, Mack TM, Conti DV, Offit K, 

Cozen W, Robison LL, Onel K. Variants at 6q21 implicate 

PRDM1 in the etiology of therapy-induced second 

malignancies after Hodgkin's lymphoma. Nat Med. 2011 

Jul 24;17(8):941-3 

Harper J, Mould A, Andrews RM, Bikoff EK, Robertson EJ. 

The transcriptional repressor Blimp1/Prdm1 regulates 

postnatal reprogramming of intestinal enterocytes. Proc 

Natl Acad Sci U S A. 2011 Jun 28;108(26):10585-90 

Karube K, Nakagawa M, Tsuzuki S, Takeuchi I, Honma K, 

Nakashima Y, Shimizu N, Ko YH, Morishima Y, Ohshima 

K, Nakamura S, Seto M. Identification of FOXO3 and 

PRDM1 as tumor-suppressor gene candidates in NK-cell 

neoplasms by genomic and functional analyses. Blood. 

2011 Sep 22;118(12):3195-204 


Tam W. PRDM1 (PR domain containing 1, with ZNF 

domain). Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):133-138. 





Mini Review 

del(11)(q23q23) MLL/ARHGEF12 



Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, 

France (JLH) 


Online updated version : http://AtlasGeneticsOncology.org/Anomalies/del11q23q23ID1420.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI del11q23q23ID1420.txt 



Clinics and pathology 

Disease 

Acute myeloid leukemia (AML) 

Epidemiology 

Two cases so far: a 38-year-old male patient with a 

history of occupational exposure to herbicides and a 

M4-AML, and a 77-year-old female patient with a 

M5a-AML (Kourlas et al., 2000; Shih el al., 2006). 

Evolution 

The M4-AML patient underwent complete 

remission, but died 6 months later from an 

unrelated cause. 

Cytogenetics 

Cytogenetics morphological 

The del(11)(q23q23) has been missed by 

cytogenetic analysis; both cases were hyperploid 

with +8 and other abnormalities. 

Genes involved and 

proteins 

MLL 

Location 

11q23.3 

Protein 

A major transcript of 14982 bp produces a 3969 

amino acids protein from 36 of the 37 exons. 

Contains from N-term to C-term a binding site for 

MEN1, 3 AT hooks (binds to the minor grove of 

DNA); 2 speckled nuclear localisation signals; 2 

repression domains RD1 and RD2: RD1 or CXXC: 

cystein methyl transferase, binds CpG rich DNA, 

has a transcriptional repression activity; RD2 

recruits histone desacetylases HDAC1 and 

HDAC2; 3 plant homeodomains (cystein rich zinc 

finger domains, with homodimerization properties), 

1 bromodomain (may bind acetylated histones), and 

1 plant homeodomain; these domains may be 

involved in protein-protein interaction; a FYRN and 

a FRYC domain; a transactivation domain which 

binds CBP; may acetylates H3 and H4 in the HOX 

area; a SET domain: methyltransferase; methylates 

H3, including histones in the HOX area for 

allowing chromatin to be open to transcription. 

MLL is cleaved by taspase 1 into 2 proteins before 

entering the nucleus: a p300/320 N-term protein 

called MLL-N, and a p180 C-term protein, called 

MLL-C. The FYRN and a FRYC domains of native 

MLL associate MLL-N and MLL-C in a stable 

complex; they form a multiprotein complex with 

transcription factor TFIID. General transcription 

factor; maintains HOX genes expression in 

undifferentiated cells. Major regulator of 

hematopoiesis and embryonic development; role in 

cell cycle regulation. 

ARHGEF12 

Location 

11q23.3 

Protein 

Better known as LARG, ARHGEF12 contains a 

PDZ (postsynaptic density protein, Drosophila disc 

large tumor suppressor, and zonula occludens-1 

protein) domain, which localize ARHGEF12 to the 

membrane, a regulator of G protein signalling-like 

domain (RGSL or RH), which binds to activated 

heterotrimeric G protein alpha12/13 subunits, a Dbl 

homology (DH) domain, responsible for exchange 


del(11)(q23q23) MLL/ARHGEF12 Huret JL 

activity, and a pleckstrin homology (PH) domain, 

involved in the regulation of the process. 

Regulatory protein involved in the GDP/GTP 

exchange reaction of the Rho proteins; activates a 

Rho-GTPase-dependent signaling pathway; 

activated by FYN. 

Result of the chromosomal 

anomaly 

Hybrid gene 

Description 

5' MLL - 3' ARHGEF12 

Fusion protein 

Description 

Joins amino acid 1362 from MLL to amino acid 

309 from ARHGEF12. The fusion protein 

comprises the Ala/Gly/Ser-rich region, poly-Gly 

stretch, three AT hooks domains, poly-Pro 

stretches, and Zinc finger CXXC-type domain from 

MLL fused to the RGSL, DH, PH domains of 

ARHGEF12. 

References 

Kourlas PJ, Strout MP, Becknell B, Veronese ML, Croce 

CM, Theil KS, Krahe R, Ruutu T, Knuutila S, Bloomfield 

CD, Caligiuri MA. Identification of a gene at 11q23 

encoding a guanine nucleotide exchange factor: evidence 

for its fusion with MLL in acute myeloid leukemia. Proc Natl 

Acad Sci U S A. 2000 Feb 29;97(5):2145-50 

Shih LY, Liang DC, Fu JF, Wu JH, Wang PN, Lin TL, Dunn 

P, Kuo MC, Tang TC, Lin TH, Lai CL. Characterization of 

fusion partner genes in 114 patients with de novo acute 

myeloid leukemia and MLL rearrangement. Leukemia. 

2006 Feb;20(2):218-23 


Huret JL. del(11)(q23q23) MLL/ARHGEF12. Atlas Genet 






Mini Review 

t(3;11)(q21;q23) 




France (JLH) 


Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0311q21q23ID1407.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0311q21q23ID1407.txt 




Disease 

Acute leukemia 

Epidemiology 

Only two cases of acute leukemia to date (2 female 

patients); in one case, the phenotype was described: 

it was a case of biphenotypic acute leukemia 

(BAL), a B-ALL expressing CD13 (Hanson et al., 

1993). 

Clinics 

No data. 


Cytogenetics morphological 

A complex karyotype was found in both cases. In 

one case, a t(9;22)(q34;q11) was also present. 


proteins 

Note 

The genes involved in the translocation were 

determined in one case (Meyer et al., 2005). 

EEFSEC 

Protein 

EEFSEC, often called SELB, is the elongation 

factor for delivery of selenocysteinyl-tRNA to the 

ribosome. Selenocysteine (Sec) is found in the 

active sites of enzymes, most of which are involved 

in redox reactions (Paleskava et al., 2010). 

MLL 

Location 

11q23 

Protein 

A major transcript of 14982 bp produces a 3969 

amino acids protein from 36 of the 37 exons. 

Contains from N-term to C-term a binding site for 

MEN1, 3 AT hooks (binds to the minor grove of 

DNA); 2 speckled nuclear localisation signals; 2 

repression domains RD1 and RD2: RD1 or CXXC: 

cystein methyl transferase, binds CpG rich DNA, 

has a transcriptional repression activity; RD2 

recruits histone desacetylases HDAC1 and 

HDAC2; 3 plant homeodomains (cystein rich zinc 

finger domains, with homodimerization properties), 

1 bromodomain (may bind acetylated histones), and 

1 plant homeodomain; these domains may be 

involved in protein-protein interaction; a FYRN and 

a FRYC domain; a transactivation domain which 

binds CBP; may acetylates H3 and H4 in the HOX 

area; a SET domain: methyltransferase; methylates 

H3, including histones in the HOX area for 

allowing chromatin to be open to transcription. 

MLL is cleaved by taspase 1 into 2 proteins before 

entering the nucleus: a p300/320 N-term protein 

called MLL-N, and a p180 C-term protein, called 

MLL-C. The FYRN and a FRYC domains of native 

MLL associate MLL-N and MLL-C in a stable 

complex; they form a multiprotein complex with 

transcription factor TFIID. General transcription 

factor; maintains HOX genes expression in 

undifferentiated cells. Major regulator of 

hematopoiesis and embryonic development; role in 

cell cycle regulation. 


t(3;11)(q21;q23) Huret JL 

Result of the chromosomal 

anomaly 

Hybrid gene 

Description 

Fusion between MLL intron 9 and EEFSEC intron 

1, but with no maintenance of an open reading 

frame. This translocation seems to create 

nonfunctional fusion genes. 

References 

Hanson CA, Abaza M, Sheldon S, Ross CW, Schnitzer B, 

Stoolman LM.. Acute biphenotypic leukaemia: 

immunophenotypic and cytogenetic analysis. Br J 

Haematol. 1993 May;84(1):49-60. 

Meyer C, Schneider B, Reichel M, Angermueller S, Strehl 

S, Schnittger S, Schoch C, Jansen MW, van Dongen JJ, 

Pieters R, Haas OA, Dingermann T, Klingebiel T, 

Marschalek R.. Diagnostic tool for the identification of MLL 

rearrangements including unknown partner genes. Proc 

Natl Acad Sci U S A. 2005 Jan 11;102(2):449-54. Epub 

2004 Dec 30. 

Paleskava A, Konevega AL, Rodnina MV.. 

Thermodynamic and kinetic framework of selenocysteyltRNASec 

recognition by elongation factor SelB. J Biol 

Chem. 2010 Jan 29;285(5):3014-20. Epub 2009 Nov 23. 


Huret JL. t(3;11)(q21;q23). Atlas Genet Cytogenet Oncol 

Haematol. 2012; 16(2):141-142. 




Solid Tumour Section 

Review 


Head and Neck: Squamous cell carcinoma: an 

overview 

Audrey Rousseau, Cécile Badoual 

Universite d'Angers, Departement de Pathologie Cellulaire et Tissulaire, CHU Angers, 4 rue Larrey, 

49100 Angers, France (AR), Universite Rene Descartes Paris 5, Service d'Anatomie Pathologique, 

Hopital Europeen Georges Pompidou, 20 rue Leblanc, 75015 Paris, France (CB) 


Online updated version : http://AtlasGeneticsOncology.org/Tumors/HeadNeckSCCID5090.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI HeadNeckSCCID5090.txt 



Identity 

Note 

Head and neck squamous cell carcinoma (HNSCC) 

develops from the mucosal linings of the upper 

aerodigestive tract, comprising 1) the nasal cavity 

and paranasal sinuses, 2) the nasopharynx, 3) the 

hypopharynx, larynx, and trachea, and 4) the oral 

cavity and oropharynx. Squamous cell carcinoma 

(SCC) is the most frequent malignant tumor of the 

head and neck region. HNSCC is the sixth leading 

cancer by incidence worldwide. There are 500000 

new cases a year worldwide. Two thirds occur in 

industrialized nations. HNSCC usually develops in 

males in the 6 th and 7 th decade. It is caused by 

tobacco and alcohol consumption and infection 

with high-risk types of human papillomavirus 

(HPV). SCC often develops from preexisting 

dysplastic lesions. The five-year survival rate of 

patients with HNSCC is about 40-50%. 

Classification 

SCC can occur either in 1) the nasal cavity and 

paranasal sinuses, 2) the nasopharynx, 3) the 

hypopharynx, larynx, and trachea, or 4) the oral 

cavity and oropharynx. The 2005 World Health 

Organization (WHO) classification of Head and 

Neck Tumors (Barnes et al., 2005) distinguishes 

different types of SCC: 

- Conventional 

- Verrucous 

- Basaloid 

- Papillary 

- Spindle cell (sarcomatoid) 

- Acantholytic 

- Adenosquamous 

- Cuniculatum 

Each variant can arise in any one of the 4 above 

mentioned head and neck regions, except for the 

cuniculatum type which only develops from the 

oral mucosa. 

SCC can be well-, moderately- or poorlydifferentiated, 

and either keratinizing or nonkeratinizing. 

Most cases are moderately to poorlydifferentiated. 

Precursor lesions (dysplasia) can be (arbitrarily) 

separated into mild, moderate, or severe (carcinoma 

in situ) (see below). 


Etiology 

The most important risk factors for developing 

HNSCC are tobacco smoking and alcohol 

consumption, which have a synergistic effect. 

Smoking habits that increase the risk of developing 

HNSCC are smoking black tobacco (compared to 

blond tobacco), smoking at a young age, long 

duration, high number of cigarettes per day, and 

deep smoke inhalation (Benhamou et al., 1992). 

Avoiding cigarettes and alcohol could prevent 

about 90% of HNSCCs, especially laryngeal and 

hypopharyngeal tumors. Tobacco chewing is a 

major cause of oral and oropharyngeal SCC in the 

Indian subcontinent, parts of South-East Asia, 

China and Taiwan, especially when consumed in 

betel quids containing areca nut (Znaor et al., 

2003). In India, chewing accounts for nearly 50% 


Head and Neck: Squamous cell carcinoma: an overview Rousseau A, Badoual C 

of oral and oropharyngeal tumors in men and over 

90% in women (Barnes et al., 2005). Significant 

risk increases of developing HNSCC have also 

been reported among non-drinking smokers and, to 

a lesser extent, non-smoking heavy drinkers. Heavy 

consumption of all types of alcoholic beverages 

(wine, beer, hard liquors) confers an increased risk 

(La Vecchia et al., 1999). Conversely, protective 

effects of diets rich in fresh fruits and vegetables 

have been described (Pelucchi et al., 2003). 

Some occupational exposures may be associated 

with a higher risk of developing HNSCC, especially 

of the larynx: polycyclic aromatic hydrocarbons, 

metal dust, cement dust, varnish, lacquer, etc... 

Significant associations were also found with 

ionizing radiation, diesel exhausts, sulphuric acid 

mists, and mustard gas (Barnes et al., 2005). 

The incidence of HNSCC in specific sites has been 

slowly declining during the past decade, due to a 

decrease in the prevalence of the more traditional 

risk factors, most notably smoking. However, in the 

Western World, HNSCCs, notably of the oral 

cavity and oropharynx, are becoming more 

prevalent, which may be related to an increase in 

oral and oropharyngeal HPV infections (Leeman et 

al., 2011). Indeed, recent studies have shown that 

infection with high-risk types of HPV (e.g. HPV-16 

and -18) is responsible for a subgroup of HNSCCs. 

HPV-positive tumors represent a different 

clinicopathological and molecular entity compared 

to HPV-negative cases (see below). HPV infection 

is now recognized as one of the primary causes of 

oropharyngeal SCC (especially SCC of the tonsils 

and the base of the tongue). In the USA, about 40- 

80% of oropharyngeal cancers are caused by HPV, 

whereas in Europe the proportion varies from 

around 90% in Sweden to less than 20% in 

communities with the highest tobacco use (Marur et 

al., 2010). Patients tend to be younger, with no 

prior history of tobacco and/or heavy alcohol 

consumption. There is evidence that HPV-positive 

HNSCC is a sexually transmitted disease. A strong 

association between sexual behavior (oral sex) and 

risk of oropharyngeal cancer as well as HPV-16positive 

HNSCC has been demonstrated (Smith et 

al., 2004; Gillison et al., 2008). 

Finally, certain inherited disorders, such as Fanconi 

anemia or Bloom syndrome, predispose to HNSCC 

(Kutler et al., 2003; Barnes et al., 2005). 

Epidemiology 

SCC is the most frequent malignant tumor of the 

head and neck region. HNSCC represents the sixth 

leading cancer by incidence and there are 500000 

new cases a year worldwide (Kamangar et al., 

2006). Two thirds occur in industrialized nations. 

Most HNSCCs arise in the hypopharynx, larynx, 

and trachea, and in the oral cavity and oropharynx. 

The majority of laryngeal SCCs originate from the 

supraglottic and glottic regions. Tracheal SCCs are 

rare compared to laryngeal ones. The most common 

oropharyngeal site of involvement is the base of the 

tongue. Within the oral cavity, most tumors arise 

from the floor of the mouth, the ventrolateral 

tongue or the soft palate complex. 

HNSCCs occur most frequently in the sixth and 

seventh decades. They typically develop in men 

though women are more and more affected because 

of increased prevalence of smoking over the last 

two decades (Barnes et al., 2005). For laryngeal, 

hypopharyngeal and tracheal SCCs, the incidence 

in men is high in Southern and Central Europe, 

some parts of South America, and among Blacks in 

the United States. The lowest rates are recorded in 

South-East Asia and Central Africa. The disease is 

slightly more common in urban than in rural areas. 

For oral and oropharyngeal SCCs, the disease 

usually affects adults in the 5 th and 6 th decades of 

life. Extremely elevated rates are observed in 

France, parts of Switzerland, Northern Italy, Central 

and Eastern Europe, and parts of Latin America. 

Rates are high among both men and women 

throughout South Asia. In the US, incidence rates 

are two-fold higher in Blacks compared to Whites 

(Barnes et al., 2005). 

Clinics 

Clinical features of HNSCC depend on the 

localization of the tumor. 

Nasal and paranasal sinuses 

Patients with SCC arising in the nasal or paranasal 

sinuses may complain of nasal fullness, stuffiness, 

or obstruction, but also of epistaxis, rhinorrhea, 

pain, paraesthesia, swelling of the nose and cheek 

or of a palatal bulge. Some may present with a 

persistent or non-healing nasal sore or ulcer, a nasal 

mass, or in advanced cases, proptosis, diplopia, or 

lacrimation (Barnes et al., 2005; Thompson, 2006). 

Nasopharynx 

Most patients with nasopharyngeal carcinoma 

present with painless enlargement of upper cervical 

lymph nodes. Nasal symptoms, particularly bloodstained 

post-nasal drip are reported in half the 

cases. Serous otitis media following Eustachian 

tube obstruction is also common. Headaches and 

cranial nerve involvement indicate more advanced 

disease. However, 10% of the patients are 

asymptomatic (Barnes et al., 2005; Thompson, 

2006). 

Hypopharynx, larynx, and trachea 

Hypopharyngeal and supraglottic tumors may be 

responsible of dysphagia, change in quality of 

voice, foreign body sensation in the throat, 

haemoptysis, and odynophagia. Glottic SCC most 

commonly presents with hoarseness (Fig. 1). In 

case of subglottic tumor, dyspnea and stridor are 

frequent clinical features. SCC arising in the 

trachea may cause dyspnea, wheezing or stridor, 

acute respiratory failure, cough, haemoptysis, and 

hoarseness (Barnes et al., 2005; Thompson, 2006). 



Figure 1: Endoscopy. Exophytic and ulcerative SCC of the left vocal cord. Figure 2: Large exophytic and ulcerative SCC of the 

left amygdala. Fig. 1-2 were kindly provided by Dr S. Hans (Georges Pompidou European Hospital, Paris, France). 

Oral cavity and oropharynx 

Most patients display at the time of diagnosis signs 

and symptoms of locally advanced disease. Clinical 

features vary according to the exact site of the 

lesion. The most common presenting features are 

ulceration, pain, referred pain to the ear, difficulty 

with speaking, opening the mouth or chewing, 

difficulty and pain with swallowing, bleeding, 

weight loss, and neck swelling (Fig. 2). Cancer of 

the buccal mucosa may present as an ulcer with 

indurated raised margins or as an exophytic growth. 

SCC of the floor of the mouth may arise as a red or 

ulcerated lesion or as a papillary growth. Cancer of 

the gingiva usually presents as an 

ulceroproliferative growth. Cancer of the tongue 

may appear as an ulcer infiltrating deeply and 

reducing the mobility of the tongue. SCC of the 

base of the tongue usually presents at a locally 

advanced stage as an ulcerated, painful, indurated 

growth. Cancer of the hard palate often presents as 

a papillary or exophytic growth rather than a flat or 

ulcerated lesion. Cancer of soft palate and uvula 

often appears as an ulcerative lesion with raised 

margins or as a fungating mass. Occasionally, 

patients harbor enlarged cervical lymph nodes with 

no identifiable oral or oropharyngeal lesion. In very 

advanced disease, patients may present an 

ulceroproliferative lesion with areas of necrosis and 

extension to surrounding structures, such bone, 

muscle and skin (Barnes et al., 2005; Thompson, 

2006). 

Pathology 

Precursor lesions 

The 2005 WHO classification of precursor lesions 

(Barnes et al., 2005) is as follows: 

- Squamous cell hyperplasia 

Hyperplasia describes increased cell numbers. This 

may be in the spinous layer (acanthosis) and/or in 

the basal/parabasal cell layers (progenitor 

compartment), termed basal cell hyperplasia. The 

architecture shows regular stratification without 

cellular atypia. 

- Mild dysplasia (Squamous Intraepithelial 

Neoplasia (SIN) 1) 

- Moderate dysplasia (SIN 2) 

- Severe dysplasia (SIN 3) 

- Carcinoma in situ (SIN 3) 

The Ljubljana classification of squamous 

intraepithelial lesions has also been proposed (see 

below) (Barnes et al., 2005). 

2005 

WHO 


Squamous 

cell 

hyperplasia 

Mild 

dysplasia 

Moderate 

dysplasia 

Severe 

dysplasia 

Carcinoma in 

situ 

Squamous 

Intraepithelial 

Neoplasia 

(SIN) 

SIN 1 

SIN 2 

SIN 3 

Ljubljana 


Squamous 

Intraepithelial 

Lesions (SIL) 

Squamous cell 

(simple) 

hyperplasia 

Basal/Parabasal 

cell hyperplasia 

Atypical 

hyperplasia 

Atypical 

hyperplasia 

SIN 3 Carcinoma in situ 

Invasive HNSCCs arise in most cases from 

preneoplastic lesions grouped under the term 

"dysplasia". Dysplastic lesions present with an 

increased likelihood of progressing to SCC. The 

altered epithelium displays architectural and 

cytological changes that range from mild to severe 

(see below). Precursor lesions are mostly seen in 

the adult population and affect men more often than 

women. They are strongly associated with tobacco 

smoking and alcohol consumption, and especially a 

combination of the two. The duration of smoking, 

the type of tobacco and the practice of deep 

inhalation play a role in the development of 

precursor lesions. Other etiological factors have 

been reported such as industrial pollution, specific 



occupational exposures, and nutritional deficiency. 

Mean age of patients with first diagnosis of 

precursor lesions is 48-56.5 years. Rarely, 

malignant transformation may develop from 

morphologically normal epithelium (Barnes et al., 

2005; Thompson, 2006). 

The clinical picture of precursor lesions depends on 

the location and severity of the disease. In case of 

dysplastic lesions of the hypopharynx, larynx or 

trachea, patients may present with fluctuating 

hoarseness, sore throat, and/or chronic cough of a 

few months' duration. However, some individuals 

may be asymptomatic. 

Endoscopically, the lesions may be discrete or 

diffuse, smooth or irregular, flat or exophytic. 

Precursor lesions may present as a small flat patch 

or as a large warty plaque. The surface may be 

brown to red (erythroplakia) or present with 

circumscribed whitish plaques (leukoplakia). White 

patches may be ulcerated. Leukoplakia, in contrast 

to erythroplakia, tends to be well demarcated and 

seems to have a lower risk of malignant 

transformation. The lesions are commonly diffuse, 

with a thickened appearance. However, in a 

minority of cases, patchy atrophy may be present. 

In the larynx, the precursor lesions appear mainly 

along the anterior true vocal cords. Two thirds of 

vocal cord lesions are bilateral. Occasionally, 

precursor lesions may present macroscopically as 

normal mucosa (Barnes et al., 2005; Thompson, 

2006). 

Microscopically, dysplasia is defined as 

architectural and cytological changes of the 

epithelium, without evidence of invasion. The 

diagnostic features of dysplasia are not uniformly 

accepted or interpreted. In dysplastic lesions, the 

epithelium presents with irregular stratification, loss 

of polarity of basal cells, drop-shaped rete ridges, 

increased number of mitotic figures, abnormal 

superficial mitoses, premature keratinization in 

single cells (dyskeratosis) and keratin pearls within 

rete pegs. Cytological changes include abnormal 

variation in nuclear or cell size and shape, increased 

nuclear to cytoplasmic ratio, increased nuclear size, 

atypical mitotic figures, increased number and size 

of nucleoli, and hyperchromasia. The spectrum of 

dysplasia is divided for practical reasons into mild, 

moderate and severe. In mild dysplasia, 

architectural disturbances and cytological atypia are 

limited to the lower third of the epithelium. In 

moderate dysplasia, architectural and cytological 

changes extend into the middle third of the 

epithelium. Up-grading from moderate to severe 

dysplasia may be considered when there is marked 

cytological atypia. Severe dysplasia displays greater 

than two thirds altered epithelium. Carcinoma in 

situ presents with full thickness or almost full 

thickness architectural abnormalities accompanied 

by cytological atypia (Fig.3). Superficial and 

atypical mitotic figures are commonly seen. By 

definition, invasion has not yet occurred. 

Differential diagnosis of dysplastic lesions includes 

reactive or regenerative squamous epithelium 

(Barnes et al., 2005; Thompson, 2006). 

Conventional type squamous cell carcinoma 

SCC is characterized by squamous differentiation 

(often seen as keratinization, sometimes with 

keratin pearl formation) and invasive growth with 

disruption of the basement membrane. Extension 

into the underlying tissue is often accompanied by a 

desmoplastic stromal reaction and a dense 

inflammatory infiltrate, mainly comprised of 

lymphocytes and plasma cells. Angiolymphatic and 

perineural invasion may be seen. SCC is graded 

into well-, moderately-, and poorly-differentiated. 

Well-differentiated SCC closely resembles normal 

squamous mucosa whereas moderatelydifferentiated 

SCC displays nuclear pleomorphism, 

mitoses (including atypical forms), and usually less 

keratinization (Fig. 4-6). In poorly-differentiated 

SCC, immature cells predominate, with numerous 

typical and atypical mitoses, minimal 

keratinization, and sometimes necrosis. Most SCCs 

are moderately-differentiated (Barnes et al., 2005; 

Thompson, 2006). 

HNSCCs express epithelial markers such as 

cytokeratins. In well-differentiated tumors, no 

additional stains are usually needed. In poorlydifferentiated 

lesions, immunohistochemistry may 

be useful. HNSCCs are immunopositive for 

cytokeratin cocktails, AE1/AE3 and pancytokeratin. 

CK5/CK6 and p63 are also excellent markers to 

detect squamous differentiation (Dabbs, 2006). 

Verrucous carcinoma 

Verrucous carcinoma (VC) is a non-metastasizing 

variant of well-differentiated SCC characterized by 

an exophytic, warty, slowly-growing tumor with 

pushing rather than infiltrative margins (Barnes et 

al., 2005). The larynx is the second most common 

site of VC in the head and neck region after the oral 

cavity. The gross appearance is of a broad-based, 

exophytic, warty, firm to hard, white mass. 

Microscopically, the thickened, club-shaped, 

projections are lined by well-differentiated 

squamous epithelium devoid of the malignant 

features commonly seen in SCC. Mitotic figures are 

rare and not atypical. The advancing margins are 

usually broad with a pushing appearance. A dense 

inflammatory response is often present in the 

underlying tissue. There is abundant surface 

keratosis ("church-spire" keratosis) (Fig. 7). 

Differential diagnosis includes verrucous 

hyperplasia and very well-differentiated SCC. 

Distinguishing these entities from verrucous 

carcinoma can be delicate. Analysis of a sample of 

sufficient size which has been accurately oriented is 

necessary before rendering a definitive diagnosis. 

The separation of verrucous hyperplasia from 

verrucous carcinoma is often difficult, requiring 

clinical-pathological confrontation. Pure VC does 



not metastasize and has an excellent prognosis. 

However, hybrid VC (displaying a conventional 

SCC component) has the potential to metastasize 

and should be managed as similarly staged SCC 


Basaloid squamous cell carcinoma 

Basaloid squamous cell carcinoma is a high-grade 

variant of SCC composed of both basaloid and 

squamous components (Barnes et al., 2005). It is an 

aggressive, rapidly growing tumor characterized by 

an advanced stage at the time of diagnosis (cervical 

lymph node metastases) and a poor prognosis. The 

basaloid component is comprised of small packed 

cells displaying hyperchromatic nuclei without 

nucleoli, and scant cytoplasm. The tumor grows in 

a solid pattern with a lobular configuration, and 

sometimes a prominent peripheral palisading. 

Comedo-type necrosis is frequently seen (Fig. 8). 

Small cystic spaces containing PAS- and Alcian 

Blue-positive material and stromal hyalinization 

may be noticed. BSCC is always associated with a 

SCC component, usually located superficially. The 

SCC component may also present as focal 

squamous differentiation within the basaloid 

lobules. The junction between the two components 

may be abrupt. The differential diagnosis includes 

neuroendocrine carcinoma, adenoid cystic 

carcinoma, and adenosquamous carcinoma. BSCC 

requires aggressive multimodality treatment, 

including radical surgery (including neck 

dissection), radiotherapy, and chemotherapy 

(especially for metastatic disease). Survival rate is 

only 40% (Thompson, 2006). 

Papillary squamous cell carcinoma 

Papillary squamous cell carcinoma (PSCC) is a 

distinct variant of SCC characterized by an 

exophytic, papillary growth, and a favorable 

prognosis. PSCC presents as a soft, friable, 

polypoid, exophytic, papillary tumor. It frequently 

arises from a thin stalk, but broad-based lesions 

have also been described. The tumor is 

characterized by a predominant papillary growth 

pattern. By definition, the lesion must demonstrate 

a dominant (> 70%) exophytic or papillary 

architectural growth pattern with unequivocal 

cytological evidence of malignancy. The papillary 

pattern consists of multiple, thin, delicate, fingerlike 

papillary projections. These papillae have thin 

fibrovascular cores covered by neoplastic, 

immature basaloid cells or more pleomorphic cells. 

Commonly, there is minimal keratosis. Foci of 

necrosis and hemorrhage are common. Invasion 

may be difficult to define, especially in superficial 

biopsies. Stroma invasion consists of a single or 

multiple nests of tumor cells with dense 

lymphoplasmacytic inflammation at the tumorstroma 

interface. Differential diagnosis includes 

squamous papilloma, verrucous carcinoma, and 

exophytic SCC. Though squamous papilloma and 

verrucous carcinoma share similar architectural 

features with PSCC, the latter is easily recognized 

by atypia of the squamous epithelium. Patients with 

PSCC tend to have a better prognosis compared to 

those with site- and stage-matched conventional 

SCC. This is probably related to limited invasion in 

PSCC. Approximately, one third of patients 

develop recurrence, frequently more than once 


Spindle cell carcinoma 

Spindle cell carcinoma is a biphasic tumor 

composed of a squamous cell carcinoma, either in 

situ and/or invasive, and a malignant spindle cell 

component with a mesenchymal appearance, but of 

epithelial origin (Barnes et al., 2005). Spindle cell 

carcinoma most often occurs in males. It usually 

exhibits a polypoid appearance with a mean size of 

2 cm. The surface is frequently ulcerated. The 

spindle cell component usually forms the bulk of 

the tumor. It can be arranged in a diverse array of 

appearances, including storiform, interlacing 

bundles or fascicles, and herringbone. The two 

components can abut directly against one another 

with areas of blending and continuity between 

them. Hypocellular areas with dense collagen 

deposition can be seen. Pleomorphism is often mild 

to moderate, without a severe degree of anaplasia. 

The tumor cells are plump fusiform cells, although 

they can be rounded and epithelioid. Rarely, 

metaplastic or frankly neoplastic cartilage or bone 

can be seen. Resemblance to fibrosarcoma or 

malignant fibrous histiocytoma is most common. 

Evidence for squamous epithelial derivation can be 

seen as either in situ carcinoma or as invasive SCC. 

The SCC component is usually minor to 

inconspicuous with the sarcomatoid part 

dominating. Carcinoma in situ can be obscured by 

extensive ulceration. Infiltrating SCC may be focal, 

requiring multiple sections for demonstration. 

Sometimes, only spindle cells are present; in such 

cases, SPCC can be mistaken for a true sarcoma. 

Metastases usually contain SCC alone or both SCC 

and the spindle cell component, and rarely, only the 

spindle cell component. SPCC can also be confused 

with reactive or benign spindle cell proliferation 

(such as nodular fasciitis), inflammatory 

myofibroblastic sarcoma, low-grade 

myofibroblastic sarcoma, and myoepithelial 

carcinoma. There is mounting molecular evidence 

that SPCC is a monoclonal epithelial neoplasm with 

a divergent (mesenchymal) differentiation, rather 

than a collision tumor. This is the one SCC variant 

in which immunohistochemistry may be of value. 

The individual neoplastic spindle cells react 

variably with keratin (AE1/AE3), EMA, and CK18, 

even though only 70% of cases will yield any 

epithelial immunoreactivity. A nonreactive or 

negative result should not dissuade the pathologist 

from the diagnosis, especially in the right setting. 

Spindle cell carcinoma metastasizes to the regional 

lymph nodes in up to 25% of cases, but distant 



dissemination is less common (5-15%). The 

reported 5-year survival rate is between 65% and 

95% (Barnes et al., 2005; Thompson, 2006). 

Acantholytic squamous cell carcinoma 

This is an uncommon histopathologic variant of 

squamous cell carcinoma, characterized by 

acantholysis of the tumor cells, creating 

pseudolumina and false appearance of glandular 

differentiation. No special etiologic factor has been 

discovered for the mucosal acantholytic SCC. It is 

most frequent in sun-exposed areas of the head and 

neck. The tumor is composed of SCC, but with foci 

of acantholysis in tumor nests, creating the 

appearance of glandular differentiation. The 

pseudolumina usually contain acantholytic and 

dyskeratotic cells, or cellular debris, but they may 

be empty. They are more frequent in the deeper 

portions of the tumor. There is no evidence of true 

glandular differentiation or mucin production. The 

SCC component predominates, and is usually 

moderately-differentiated. The stroma is usually 

desmoplastic, with a lymphoplasmacytic response. 

The acantholysis may also form anastomosing 

spaces and channels mimicking angiosarcoma. 

Acantholytic SCC must be differentiated from 

adenosquamous carcinoma, adenoid cystic 

carcinoma, and mucoepidermoid carcinoma. 

Prognosis is similar to that of SCC. However, some 

reports suggest a more aggressive behavior (Barnes 

et al., 2005; Thompson, 2006). 

Adenosquamous carcinoma 

This rare aggressive neoplasm originates from the 

surface epithelium and is characterized by both 

squamous cell carcinoma and true adenocarcinoma. 

The larynx is the most frequent site of occurrence. 

Most patients (65%) present with lymph node 

metastases. Adenosquamous carcinoma occurs 

throughout the upper aerodigestive tract, often as an 

indurated submucosal nodule usually less than 1 cm 

in diameter. It can present as an exophytic or 

polypoid mass, or as poorly defined mucosal 

induration, frequently with ulceration. The main 

feature is both true adenocarcinoma and SCC. The 

two components occur in close proximity, but they 

tend to be distinct and separate, not intermingled as 

in mucoepidermoid carcinoma. The SCC 

component can present either as in situ or as an 

invasive SCC. The adenocarcinomatous component 

tends to occur in the deeper parts of the tumor. It 

consists of tubular structures that give rise to 

"glands within glands". The adenocarcinoma 

component can be tubular, alveolar, and glandular, 

although mucus-cell differentiation is not essential 

for the diagnosis. Mucin production is typically 

present, either intraluminal or intracellular, and can 

appear as signet ring cells. There is typically a 

sparse inflammatory cell infiltrate at the tumorstroma 

interface. Differential diagnosis includes 

mucoepidermoid carcinoma, acantholytic SCC, and 

SCC invading seromucinous glands, and 

necrotizing sialometaplasia. The most important 

differential diagnosis is from mucoepidermoid 

carcinoma as adenosquamous carcinoma has a 

poorer prognosis. Aggressive surgery with neck 

dissection yields an approximately 55% 2-year 

survival rate (Barnes et al., 2005; Thompson, 

2006). 

Carcinoma cuniculatum is a rare variant of oral 

cancer displaying similarities with lesions more 

commonly described in the foot in which the tumor 

infiltrates deeply into the bone. There is 

proliferation of stratified squamous epithelium in 

broad processes with keratin cores and keratinfilled 

crypts which seem to burrow into bone tissue, 

but lack obvious cytological features of 

malignancy. Clinical-pathological correlation is 

often needed to make the diagnosis (Barnes et al., 

2005). 

Nasopharyngeal carcinoma and lymphoepithelial 

carcinoma are rare entities distinct from 

conventional squamous cell carcinomas. 

Lymphoepithelial carcinoma (LEC) may develop in 

the nasal cavity and paranasal sinuses, the 

hypopharynx, larynx and trachea, and in the oral 

cavity and oropharynx. It is a poorly differentiated 

squamous cell carcinoma or histologically 

undifferentiated carcinoma accompanied by a 

prominent reactive lymphoplasmacytic infiltrate, 

morphologically similar to nasopharyngeal 

carcinoma. Most sinonasal LECs are associated 

with Epstein-Barr virus (EBV) infection (Barnes et 

al., 2005). 

Nasopharyngeal carcinoma (NPC) is a carcinoma 

arising in the nasopharynx that shows light 

microscopic or ultrastructural evidence of 

squamous differentiation. It encompasses squamous 

cell carcinoma, non-keratinizing carcinoma 

(differentiated or undifferentiated), and basaloid 

squamous cell carcinoma. Keratinizing squamous 

cell carcinoma of the nasopharynx is 

morphologically similar to keratinizing squamous 

cell carcinomas occurring in other head and neck 

sites. NPC incidence is considerably higher in 

Chinese, Southeast Asians, North Africans, and 

native people from the Arctic region. There is a 

near constant association of NPC with EBV, 

suggesting an oncogenic role of the virus. NPC 

harbors a highly malignant behavior with extensive 

loco-regional infiltration, early lymphatic spread, 

and hematogenous dissemination (Barnes et al., 

2005). 

Histogenesis 

SCC originates from the squamous mucosa or from 

ciliated respiratory epithelium that has undergone 

squamous metaplasia (Barnes et al., 2005). 



Figure 3: Carcinoma in situ. Full thickness architectural abnormalities and cytological atypia Hematoxylin and eosin staining 

(original magnification x200). Figure 4: Invasive SCC. Invasive growth with disruption of the basement membrane and extension 

into the underlying tissue. Hematoxylin and eosin staining (original magnification Fig. 4A: x20, Fig. 4B: x100). Figure 5: Invasive 

SCC. Mitoses (at 9 o' clock) and nuclear atypia. Hematoxylin and eosin staining (original magnification x400). Figure 6: Invasive 

SCC. Focal keratinization (left hand side). Hematoxylin and eosin staining (original magnification x400). Figure 7: Verrucous 

carcinoma. Thickened, club-shaped, projections of well-differentiated squamous epithelium and abundant surface keratosis 

("church-spire" keratosis). Hematoxylin and eosin staining (original magnification x20). Figure 8: Basaloid SCC. Solid pattern of 

growth and central comedo-type necrosis. Hematoxylin and eosin staining (original magnification x100). Figure 9: p16 

immunostaining in basaloid SCC (original magnification x200). 





Malignant transformation of the mucosal lining is a 

genetic process resulting from accumulation of 

multiple genetic alterations that dictates the 

frequency and pace of progression to invasive 

carcinoma. LOH studies indicate that the earliest 

alterations appear to target specific genes located on 

chromosomes 3p, 9p21 (CDKN2A), and 17p13 

(TP53). Alterations that tend to occur in association 

with higher grades of dysplasia and SCC include 

cyclin D1 amplification, PTEN inactivation, and 

LOH at 13q21, 14q32, 6p, 8, 4q27, and 10q23 

(Barnes et al., 2005). 

There are no individual markers that reliably predict 

malignant transformation of dysplastic lesions. 

Ploidy studies of dysplastic leukoplakias showed 

that the great majority of aneuploid lesions 

developed SCC in the follow-up period, by contrast 

with 60% of tetraploid lesions and only about 3% 

of diploid lesions (Sudbo et al., 2001). Similar 

studies on erythroplakias confirmed the higher 

predictive potential of aneuploidy in identifying 

cases which progressed to SCC (Sudbo et al., 

2002). 

Invasive squamous cell carcinoma 

HNSCC is a heterogeneous disease, comprising at 

least two distinct genetic subclasses: tumors that are 

caused by infection with high-risk types of HPV, 

and those that do not contain HPV. Approximately 

20% of HNSCCs contain transcriptionally active 

HPV whereas 60% harbor a TP53 mutation. In the 

remaining 20%, other genes encoding proteins in 

the p53 pathway may be targeted or these tumors 

may undergo p53-independent malignant 

progression. 

- HPV-negative squamous cell carcinoma 

Tobacco and alcohol-induced HNSCCs are 

characterized by TP53 mutation. The excess of G to 

T transversions and the codons more frequently 

affected were attributed to the carcinogenic effect 

of tobacco smoking (Barnes et al., 2005). Other 

genes are involved in the pathogenesis of HPVnegative 

tumors. CCND1, which encodes cyclin 

D1, is amplified or gained in more than 80% of 

HPV-negative HNSCCs. CDKN2A (encoding p16) 

can be inactivated by mutation, homozygous 

deletion, or promoter hypermethylation (Barnes et 

al., 2005). 

EGFR (Epidermal Growth Factor Receptor) is 

overexpressed in most HNSCCs (Hama et al., 

2009). The EGFR is a receptor tyrosine kinase 

belonging to the erbB family of cell surface 

receptors. Once phosphorylated, it can signal 

through MAPK, Akt, ERK, and Jak/STAT 

pathways. These pathways are related to cellular 

proliferation, apoptosis, invasion, angiogenesis, and 

metastasis. Dysfunction of the receptor and its 

associated pathways occurs in 80-90% of HNSCCs 

(Kalyankrishna et al., 2006). Mutations and 

amplifications of EGFR have been reported, albeit 

at relatively low frequencies. EGFR amplification 

has been detected in 10-30% of cases (Temam et 

al., 2007; Sheu et al., 2009). Even though few 

activating mutations have been found, the mutant 

form EGFRvIII has been detected in 42% of 

HNSCCs (Sok et al., 2006). Interestingly, it has 

been shown that microscopically normal mucosa 

adjacent to invasive SCC displayed a high degree of 

overexpression and that the upregulation of EGFR 

occurs in the transition from dysplasia to cancer 

(Grandis et al., 1993; Shin et al., 1994). Elevated 

levels of EGFR expression have been associated to 

a poor clinical outcome (Chung et al., 2004; 

Temam et al., 2007). High copy number 

amplification has also been shown to portend a 

dismal prognosis in HNSCCs (Chung et al., 2006). 

However, overexpression of EGFR may be a 

biomarker for an improved response to therapy and 

could serve as a predictive marker (Bentzen et al., 

2005). The EGFR pathway can be targeted through 

the use of specific tyrosine kinase inhibitors (TKIs), 

monoclonal antibodies blocking receptor 

dimerization, and anti-sense oligodeoxynucleotides 

or siRNA blocking mRNA expression (Glazer et 

al., 2009). 

Both mutations and gene amplifications of MET 

have been described in HNSCCs. MET, the 

receptor for Hepatocyte Growth Factor (HGF) is a 

tyrosine kinase encoded by MET on chromosome 

7q31. It activates the AKT and Ras pathways and 

influences growth, motility and angiogenesis in 

HNSCCs (Leeman et al., 2011). 

Finally, the PI3K-PTEN-AKT pathway is 

frequently activated in HNSCCs (Leeman et al., 

2011). 

- HPV-induced squamous cell carcinoma 

HPVs are DNA viruses that show a tropism for 

squamous epithelium. HPV is a strictly 

epitheliotropic, circular double-stranded DNA 

virus. There are more than 100 subtypes of HPV, 

some of which are involved in cervical 

carcinogenesis and have been designated as highrisk 

HPVs (e.g. HPV-16 and -18) (zur Hausen, 

2002; Moody et al., 2010). HPV-positive HNSCCs 

present with distinct molecular profiles compared to 

HPV-negative tumors whereas they harbor 

similarities with HPV-positive cervical SCCs. Most 

HPV-induced HNSCCs are caused by one subtype, 

HPV-16. HPV infection is an early, and probably 

initiating, oncogenic event in HNSCCs. High-risk 

oncogenic HPV subtypes have been shown to be 

capable of transforming oral epithelial cells through 

the viral oncoproteins E6 and E7. The E6 protein 

induces degradation of p53 through ubiquitinmediated 

proteolysis, leading to substantial loss of 

p53 activity. The usual function of p53 is to arrest 

cells in G1 or induce apoptosis to allow host DNA 

to be repaired. E6-expressing cells are not capable 



of this p53-mediated response to DNA damage and, 

hence, are susceptible to genomic instability. The 

E7 protein binds and inactivates the retinoblastoma 

tumor suppressor gene product pRB, causing the 

cell to enter S-phase, leading to cell cycle 

disruption. This functional inactivation of pRB also 

results in a reciprocal overexpression of p16 

protein. By immunohistochemistry, most HPVpositive 

HNSCCs show p16 overexpression (Marur 

et al., 2010) (Fig. 9). The combination of low 

EGFR and high p16 expression has been shown to 

highly correlate with better clinical outcome 

compared with high EGFR expression and low 

HPV titer or high EGFR and low p16 expression 

(Kumar et al., 2008). P16 expression in 

oropharyngeal SCCs has also been associated with 

longer survival times regardless of HPV status 

(Lewis et al., 2010). 

The best method for HPV detection is still 

controversial. PCR-based detection of HPV E6 

oncogene expression in frozen samples is generally 

regarded as the gold standard but in situ 

hybridization is also commonly used. P16 

immunohistochemistry could serve as a potential 

surrogate marker (Marur et al., 2010). 

As mentioned above, HPV-positive HNSCCs are 

typically TP53 wild-type. There also seems to be an 

inverse relationship between EGFR expression and 

HPV status. 

Prognosis 


Some precursor lesions are self-limiting and 

reversible (particularly if apparent etiologic factors 

are removed), others persist and some progress to 

SCC. The likelihood of malignant change directly 

relates to the severity of dysplasia. However, it is 

clear that malignancy can develop from any grade 

of dysplasia or even from morphologically normal 

epithelium. Dysplastic lesions classified as 

moderate to severe have an 11% rate of malignant 

transformation. Diagnosis of precursor lesions 

implies a need for close follow-up and complete 

excision. Patients with carcinoma in situ require 

more extensive management (Thompson, 2006). 

Dysplastic lesions are frequently found in the 

surgical margins of invasive SCC, meaning such 

lesions can remain in the patient. These unresected 

fields act as an important source of local 

recurrences and second primary tumors that often 

occur in patients treated for HNSCC. 

Invasive squamous cell carcinoma 

The prognosis for patients with HNSCC is 

determined by the stage at presentation, established 

based on the extent of the tumor, as well as the 

presence of lymph-node metastases and distant 

metastases. About one third of patients presents 

with early-stage disease, whereas two thirds present 

with advanced cancer with lymph node metastases 

(Jemal et al., 2007). Early-stage tumors are treated 

with surgery or radiotherapy and have a favorable 

prognosis. The standard of care for advanced 

tumors is surgery combined with adjuvant radiation 

therapy and/or chemotherapy. Survival outcomes 

are poor (40-50% five-year survival rates) and the 

treatment is uniformly morbid. Organ-preservation 

protocols, with combined chemotherapy/radiation 

therapy and surgery for salvage, are increasingly 

performed. These protocols are particularly 

effective for young patients with a good 

performance status presenting with moderatelyadvanced 

laryngeal or pharyngeal SCC. Several 

characteristics of patients with HNSCC have been 

linked to favorable prognosis, including nonsmoker, 

minimum exposure to alcohol, good 

performance status, and absence of co-morbid 

disorders (Marur et al., 2010). Thirty-five to 55% of 

patients with advanced-stage HNSCC remain 

disease-free 3 years after standard treatment. 

However, locoregional recurrence develops in 30% 

to 40% of patients and distant metastases occur in 

20% to 30% of HNSCCs (Forastiere et al., 2003). 

Locoregional recurrences often require a 

combination of surgery, radiation therapy, and/or 

chemotherapy, and metastatic disease is treated 

with chemotherapy. 

Recently, the use of targeted drugs has entered the 

field. Cetuximab is one of the most well studied 

monoclonal antibodies directed against EGFR. 

Binding of the antibody to EGFR prevents 

activation of the receptor by endogenous ligands. 

An overall survival benefit and an increased 

duration of locoregional control have been observed 

in advanced HNSCCs treated with a combination of 

radiation therapy and cetuximab, compared to 

radiation therapy alone (Bonner et al., 2006). 

It has been demonstrated that the presence and type 

of TP53 mutation is also of prognostic relevance. 

Several studies have shown a correlation between 

p53 mutation and lower response rates to 

chemotherapy and shorter overall survival times 

(Erber et al., 1998; Cabelguenne et al., 2000; 

Temam et al., 2000; Poeta et al., 2007). 

On the whole, survival has not markedly improved 

in recent decades because patients still frequently 

develop locoregional recurrences, distant 

metastases, and second primary tumors. Primary 

prevention could be achieved by cessation of 

smoking and reduction of alcohol consumption. 

Patients with HPV-positive HNSCC tend to be 

younger and have a lower tobacco and alcohol 

consumption. They often present at a late stage with 

large metastatic cervical lymph nodes. 

Histopathologically, the tumor is often moderately 

to poorly-differentiated with basaloid features 

(Gillison et al., 2000). However, HPV-positive 

HNSCCs are associated with a more favorable 

clinical outcome regardless of treatment modalities, 

and this may be related to immune surveillance to 

viral antigens (Leemans et al., 2011). Prognosis is 



better not only for patients treated with radiation 

therapy or concomitant chemotherapy/radiation 

therapy but also for patients treated with surgery 

alone (Lassen et al., 2009; Fischer et al., 2010). In 

patients with oropharyngeal SCC treated with 

surgery, the 5-year survival rates for p16-negative 

and p16-positive patients were 26.8% and 57.1%, 

respectively (Lassen et al., 2009). In another study, 

patients with HPV-positive oropharyngeal SCC had 

a 58% reduction in the risk of death (Ang et al., 

2010). The better prognosis associated with HPVstatus 

has also been observed in high-grade 

basaloid SCCs of the oropharynx (Thariat et al., 

2010). Most studies confirm that HPV is one of the 

most important independent prognostic factors in 

HNSCC. However, only the rate of locoregional 

recurrence, but not that of distant disease, is 

diminished in patients with HPV-positive SCC. 

Increased sensitivity to chemotherapy and 

radiotherapy in HPV-positive oropharyngeal cancer 

may be related to absence of exposure to tobacco 

and presence of functional p53 protein. Increased 

survival of patients with HPV-positive SCC may be 

in part attributable to absence of dysplastic fields 

related to tobacco and alcohol exposure. So, HPVstatus 

of HNSCC is a prognostic factor for 

progression-free and overall survival and might also 

be a predictive factor. Use of HPV vaccines against 

infection and therapeutic vaccines in the adjuvant 

setting for locoregional recurrence and distant 

disease should be assessed in this form of HNSCC. 

References 

Benhamou CA, Laraqui N, Touhami M, Chekkoury A, 

Benchakroun Y, Samlali R, Kahlain A. [Tobacco and 

cancer of the larynx: a prospective survey of 58 patients]. 

Rev Laryngol Otol Rhinol (Bord). 1992;113(4):285-8 

Grandis JR, Tweardy DJ. Elevated levels of transforming 

growth factor alpha and epidermal growth factor receptor 

messenger RNA are early markers of carcinogenesis in 

head and neck cancer. Cancer Res. 1993 Aug 

1;53(15):3579-84 

Shin DM, Ro JY, Hong WK, Hittelman WN. Dysregulation 

of epidermal growth factor receptor expression in 

premalignant lesions during head and neck tumorigenesis. 

Cancer Res. 1994 Jun 15;54(12):3153-9 

Erber R, Conradt C, Homann N, Enders C, Finckh M, Dietz 

A, Weidauer H, Bosch FX. TP53 DNA contact mutations 

are selectively associated with allelic loss and have a 

strong clinical impact in head and neck cancer. Oncogene. 

1998 Apr 2;16(13):1671-9 

La Vecchia C, Franceschi S, Favero A, Talamini R, Negri 

E. Alcohol intake and cancer of the upper digestive tract. 

Pattern of risk in Italy is different from that in Denmark. 

BMJ. 1999 May 8;318(7193):1289-90; author reply 1291 

Cabelguenne A, Blons H, de Waziers I, Carnot F, Houllier 

AM, Soussi T, Brasnu D, Beaune P, Laccourreye O, 

Laurent-Puig P. p53 alterations predict tumor response to 

neoadjuvant chemotherapy in head and neck squamous 

cell carcinoma: a prospective series. J Clin Oncol. 2000 

Apr;18(7):1465-73 

Gillison ML, Koch WM, Capone RB, Spafford M, Westra 

WH, Wu L, Zahurak ML, Daniel RW, Viglione M, Symer 

DE, Shah KV, Sidransky D. Evidence for a causal 

association between human papillomavirus and a subset 

of head and neck cancers. J Natl Cancer Inst. 2000 May 

3;92(9):709-20 

Temam S, Flahault A, Périé S, Monceaux G, Coulet F, 

Callard P, Bernaudin JF, St Guily JL, Fouret P. p53 gene 

status as a predictor of tumor response to induction 

chemotherapy of patients with locoregionally advanced 

squamous cell carcinomas of the head and neck. J Clin 

Oncol. 2000 Jan;18(2):385-94 

Sudbø J, Bryne M, Johannessen AC, Kildal W, Danielsen 

HE, Reith A. Comparison of histological grading and largescale 

genomic status (DNA ploidy) as prognostic tools in 

oral dysplasia. J Pathol. 2001 Jul;194(3):303-10 

Sudbø J, Kildal W, Johannessen AC, Koppang HS, Sudbø 

A, Danielsen HE, Risberg B, Reith A. Gross genomic 

aberrations in precancers: clinical implications of a longterm 

follow-up study in oral erythroplakias. J Clin Oncol. 

2002 Jan 15;20(2):456-62 

zur Hausen H. Papillomaviruses and cancer: from basic 

studies to clinical application. Nat Rev Cancer. 2002 

May;2(5):342-50 

Forastiere AA, Goepfert H, Maor M, Pajak TF, Weber R, 

Morrison W, Glisson B, Trotti A, Ridge JA, Chao C, Peters 

G, Lee DJ, Leaf A, Ensley J, Cooper J. Concurrent 

chemotherapy and radiotherapy for organ preservation in 

advanced laryngeal cancer. N Engl J Med. 2003 Nov 

27;349(22):2091-8 

Kutler DI, Auerbach AD, Satagopan J, Giampietro PF, 

Batish SD, Huvos AG, Goberdhan A, Shah JP, Singh B. 

High incidence of head and neck squamous cell carcinoma 

in patients with Fanconi anemia. Arch Otolaryngol Head 

Neck Surg. 2003 Jan;129(1):106-12 

Pelucchi C, Talamini R, Levi F, Bosetti C, La Vecchia C, 

Negri E, Parpinel M, Franceschi S. Fibre intake and 

laryngeal cancer risk. Ann Oncol. 2003 Jan;14(1):162-7 

Znaor A, Brennan P, Gajalakshmi V, Mathew A, Shanta V, 

Varghese C, Boffetta P. Independent and combined effects 

of tobacco smoking, chewing and alcohol drinking on the 

risk of oral, pharyngeal and esophageal cancers in Indian 

men. Int J Cancer. 2003 Jul 10;105(5):681-6 

Chung CH, Parker JS, Karaca G, Wu J, Funkhouser WK, 

Moore D, Butterfoss D, Xiang D, Zanation A, Yin X, 

Shockley WW, Weissler MC, Dressler LG, Shores CG, 

Yarbrough WG, Perou CM. Molecular classification of 

head and neck squamous cell carcinomas using patterns 

of gene expression. Cancer Cell. 2004 May;5(5):489-500 

Smith EM, Ritchie JM, Summersgill KF, Klussmann JP, 

Lee JH, Wang D, Haugen TH, Turek LP. Age, sexual 

behavior and human papillomavirus infection in oral cavity 

and oropharyngeal cancers. Int J Cancer. 2004 Feb 

20;108(5):766-72 

Barnes L, Eveson JW, Reichart P, Sidransky D.. Pathology 

and Genetics of Head and Neck Tumours. World Health 

Organization Classification of Tumours. IARC Press, Lyon. 

2005. 

Bentzen SM, Atasoy BM, Daley FM, Dische S, Richman 

PI, Saunders MI, Trott KR, Wilson GD.. Epidermal growth 

factor receptor expression in pretreatment biopsies from 

head and neck squamous cell carcinoma as a predictive 

factor for a benefit from accelerated radiation therapy in a 

randomized controlled trial. J Clin Oncol. 2005 Aug 

20;23(24):5560-7. 

Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, 

Cohen RB, Jones CU, Sur R, Raben D, Jassem J, Ove R, 

Kies MS, Baselga J, Youssoufian H, Amellal N, Rowinsky 

EK, Ang KK.. Radiotherapy plus cetuximab for squamous- 



cell carcinoma of the head and neck. N Engl J Med. 2006 

Feb 9;354(6):567-78. 

Chung CH, Ely K, McGavran L, Varella-Garcia M, Parker 

J, Parker N, Jarrett C, Carter J, Murphy BA, Netterville J, 

Burkey BB, Sinard R, Cmelak A, Levy S, Yarbrough WG, 

Slebos RJ, Hirsch FR.. Increased epidermal growth factor 

receptor gene copy number is associated with poor 

prognosis in head and neck squamous cell carcinomas. J 

Clin Oncol. 2006 Sep 1;24(25):4170-6. 

Dabbs D.. Diagnostic immunohistochemistry. Churchill 

Livingstone Elsevier, Philadelphia. 2006. 

Kalyankrishna S, Grandis JR.. Epidermal growth factor 

receptor biology in head and neck cancer. J Clin Oncol. 

2006 Jun 10;24(17):2666-72. (REVIEW) 

Kamangar F, Dores GM, Anderson WF.. Patterns of 

cancer incidence, mortality, and prevalence across five 

continents: defining priorities to reduce cancer disparities 

in different geographic regions of the world. J Clin Oncol. 

2006 May 10;24(14):2137-50. 

Sok JC, Coppelli FM, Thomas SM, Lango MN, Xi S, Hunt 

JL, Freilino ML, Graner MW, Wikstrand CJ, Bigner DD, 

Gooding WE, Furnari FB, Grandis JR.. Mutant epidermal 

growth factor receptor (EGFRvIII) contributes to head and 

neck cancer growth and resistance to EGFR targeting. Clin 

Cancer Res. 2006 Sep 1;12(17):5064-73. 

Thompson LDR.. Head and Neck Pathology. Foundations 

in Diagnostic Pathology Series. Churchill Livingstone, 

Elsevier, Philadelphia. 2006. 

Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ.. 

Cancer statistics, 2007. CA Cancer J Clin. 2007 Jan- 

Feb;57(1):43-66. 

Poeta ML, Manola J, Goldwasser MA, Forastiere A, Benoit 

N, Califano JA, Ridge JA, Goodwin J, Kenady D, Saunders 

J, Westra W, Sidransky D, Koch WM.. TP53 mutations and 

survival in squamous-cell carcinoma of the head and neck. 

N Engl J Med. 2007 Dec 20;357(25):2552-61. 

Temam S, Kawaguchi H, El-Naggar AK, Jelinek J, Tang H, 

Liu DD, Lang W, Issa JP, Lee JJ, Mao L.. Epidermal 

growth factor receptor copy number alterations correlate 

with poor clinical outcome in patients with head and neck 

squamous cancer. J Clin Oncol. 2007 Jun 1;25(16):2164- 

70. 

Gillison ML, D'Souza G, Westra W, Sugar E, Xiao W, 

Begum S, Viscidi R.. Distinct risk factor profiles for human 

papillomavirus type 16-positive and human papillomavirus 

type 16-negative head and neck cancers. J Natl Cancer 

Inst. 2008 Mar 19;100(6):407-20. Epub 2008 Mar 11. 

Kumar B, Cordell KG, Lee JS, Worden FP, Prince ME, 

Tran HH, Wolf GT, Urba SG, Chepeha DB, Teknos TN, 

Eisbruch A, Tsien CI, Taylor JM, D'Silva NJ, Yang K, 

Kurnit DM, Bauer JA, Bradford CR, Carey TE.. EGFR, p16, 

HPV Titer, Bcl-xL and p53, sex, and smoking as indicators 

of response to therapy and survival in oropharyngeal 

cancer. J Clin Oncol. 2008 Jul 1;26(19):3128-37. Epub 

2008 May 12. 

Glazer CA, Chang SS, Ha PK, Califano JA.. Applying the 

molecular biology and epigenetics of head and neck 

cancer in everyday clinical practice. Oral Oncol. 2009 Apr- 

May;45(4-5):440-6. Epub 2008 Jul 31. (REVIEW) 

Hama T, Yuza Y, Saito Y, O-uchi J, Kondo S, Okabe M, 

Yamada H, Kato T, Moriyama H, Kurihara S, Urashima M.. 

Prognostic significance of epidermal growth factor receptor 

phosphorylation and mutation in head and neck squamous 

cell carcinoma. Oncologist. 2009 Sep;14(9):900-8. Epub 

2009 Sep 2. 

Lassen P, Eriksen JG, Hamilton-Dutoit S, Tramm T, Alsner 

J, Overgaard J.. Effect of HPV-associated p16INK4A 

expression on response to radiotherapy and survival in 

squamous cell carcinoma of the head and neck. J Clin 

Oncol. 2009 Apr 20;27(12):1992-8. Epub 2009 Mar 16. 

Sheu JJ, Hua CH, Wan L, Lin YJ, Lai MT, Tseng HC, 

Jinawath N, Tsai MH, Chang NW, Lin CF, Lin CC, Hsieh 

LJ, Wang TL, Shih IeM, Tsai FJ.. Functional genomic 

analysis identified epidermal growth factor receptor 

activation as the most common genetic event in oral 

squamous cell carcinoma. Cancer Res. 2009 Mar 

15;69(6):2568-76. Epub 2009 Mar 10. 

Ang KK, Harris J, Wheeler R, Weber R, Rosenthal DI, 

Nguyen-Tan PF, Westra WH, Chung CH, Jordan RC, Lu 

C, Kim H, Axelrod R, Silverman CC, Redmond KP, Gillison 

ML.. Human papillomavirus and survival of patients with 

oropharyngeal cancer. N Engl J Med. 2010 Jul 

1;363(1):24-35. Epub 2010 Jun 7. 

Fischer CA, Zlobec I, Green E, Probst S, Storck C, Lugli A, 

Tornillo L, Wolfensberger M, Terracciano LM.. Is the 

improved prognosis of p16 positive oropharyngeal 

squamous cell carcinoma dependent of the treatment 

modality? Int J Cancer. 2010 Mar 1;126(5):1256-62. 

Lewis JS Jr, Thorstad WL, Chernock RD, Haughey BH, 

Yip JH, Zhang Q, El-Mofty SK.. p16 positive oropharyngeal 

squamous cell carcinoma:an entity with a favorable 

prognosis regardless of tumor HPV status. Am J Surg 

Pathol. 2010 Aug;34(8):1088-96. 

Marur S, D'Souza G, Westra WH, Forastiere AA.. HPVassociated 

head and neck cancer: a virus-related cancer 

epidemic. Lancet Oncol. 2010 Aug;11(8):781-9. Epub 2010 

May 5. (REVIEW) 

Moody CA, Laimins LA.. Human papillomavirus 

oncoproteins: pathways to transformation. Nat Rev 

Cancer. 2010 Aug;10(8):550-60. Epub 2010 Jul 1. 

(REVIEW) 

Thariat J, Badoual C, Faure C, Butori C, Marcy PY, Righini 

CA.. Basaloid squamous cell carcinoma of the head and 

neck: role of HPV and implication in treatment and 

prognosis. J Clin Pathol. 2010 Oct;63(10):857-66. 

(REVIEW) 

Leemans CR, Braakhuis BJ, Brakenhoff RH.. The 

molecular biology of head and neck cancer. Nat Rev 

Cancer. 2011 Jan;11(1):9-22. Epub 2010 Dec 16. 

(REVIEW) 


Rousseau A, Badoual C. Head and Neck: Squamous cell 

carcinoma: an overview. Atlas Genet Cytogenet Oncol 

Haematol. 2012; 16(2):143-153. 




Cancer Prone Disease Section 

Short Communication 

Rombo syndrome 




France (JLH) 


Online updated version : http://AtlasGeneticsOncology.org/Kprones/RomboID10169.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI RomboID10169.txt 



Identity 

Inheritance 

Rare disorder, with less than 10 cases described, 

with a probable autosomal dominant transmission, 

as suggested by the family tree of four generations 

in the princeps report (Michaëlsson et al., 1981). 

Clinics 

Phenotype and clinics 

Skin changes appear at the age of 6-10 years, with 

cyanotic redness, acral erythema, thin implantation 

of hair and absent eyelashes (hypotrichosis). 

Atrophoderma vermiculatum (severe skin atrophy) 

of the face and sun-exposed areas, telangiectasia 

and milia-like papules develop in adulthood. 

Histology of the skin shows highly irregular 

distribution of elastin in the upper dermis, with 

areas without elastin and others with clumps of 

elastin, vascular proliferation and lymphocytes 

infiltration (Michaëlsson et al., 1981; Van Steensel 

et al., 2001). 

Differential Diagnosis 

Resembles Bazex-Dupré-Christol syndrome, which 

is a X-linked dominant disease. 

Neoplastic risk 

Basal cell carcinomas are a frequent complication. 


proteins 

Note 

The gene involved in this rare disease is unknown. 

References 

Michaëlsson G, Olsson E, Westermark P. The Rombo 

syndrome: a familial disorder with vermiculate 

atrophoderma, milia, hypotrichosis, trichoepitheliomas, 

basal cell carcinomas and peripheral vasodilation with 

cyanosis. Acta Derm Venereol. 1981;61(6):497-503 

van Steensel MA, Jaspers NG, Steijlen PM. A case of 

Rombo syndrome. Br J Dermatol. 2001 Jun;144(6):1215-8 


Huret JL. Rombo syndrome. Atlas Genet Cytogenet Oncol 

Haematol. 2012; 16(2):154. 






Cohesins and cohesin-regulators: Role in 

Chromosome Segregation/Repair and Potential 

in Tumorigenesis 

José L Barbero 

Cell Proliferation and Development Program, Chromosome Dynamics in Meiosis Laboratory, Centro 

de Investigaciones Biologicas (CSIC), Ramiro de Maeztu 9, E-28040 Madrid, Spain (JLB) 


Online updated version : http://AtlasGeneticsOncology.org/Deep/CohesinsID20100.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CohesinsID20100.txt 



Running title: Cohesins and tumorigenesis 

Keywords. Aneuploidy, cancer, cell cycle control, chromosome segregation, chromosome stability, cohesin, 

cohesin-regulators, DNA-repair, sister chromatid cohesion, tumorigenesis. 

Summary 

Cohesin is the name of a multifunctional protein complex, which was initially discovered and characterized by 

its role in maintain cohered sister chromatids during chromosome segregation in cell division. However, in the 

last years a large number of studies and results have evidenced the implication of cohesin complexes in different 

crucial processes in cell life such as DNA replication, control of gene expression, heterochromatin formation, 

and DNA-repair. The canonical cohesin complex consists in four subunits named SMC1, SMC3 (Structural 

Maintenance of Chromosomes) and SCC1, SCC3 (Sister Chromatid Cohesion). Two last subunits have also 

denominated RAD21 for SCC1 and STAG for SCC3 in mammals. These four subunits, named also cohesin 

individually, are able to form a ring-like structure (figure 1A), which could modulate different local chromatin 

conformations depending on the interactions with diverse cohesin-interacting proteins, which have been 

designated as cohesin cofactors and/or cohesin-regulators. 

Chromosomal instability is one of the hallmarks of cancer, generating chromosomic aberrations including 

aneuploidy, loss of heterozygosity, chromosomal translocations etc. Mutations in genes encoding for proteins 

that control cell cycle are potential candidates in the generation of genome instability. Thus, cohesins and 

cohesin-regulators, which are key players in chromosome segregation and in DNA-damage repair, are obviously 

aspirant molecules for this research. 

Basic concepts of cohesins in 

chromosome segregation and 

DNA-damage repair 

Chromosome miss-segregation and aneuploidy are 

frequently observed in most of cancer cells. Perhaps 

the two cellular mechanisms more critical for 

chromosomal stability in which cohesins are 

involved are chromosome segregation during cell 

division and DNA-damage repair, therefore, in this 

paper, I will center on the cohesins and cohesininteracting 

proteins involved in these two cellular 

important processes and their links with tumor 

formation and development. 

Although the multiple roles of cohesins remodeling 

chromatin structure have been extensively and 

detailed revised in the last time (for two example 

reviews see Barbero, 2009 and Nasmyth and 

Haering, 2009), following, I describe here briefly 

the most relevant concepts of cohesin dynamic in 

order to understand their potential involvement in 

tumorigenesis. 

Cohesin complexes preserve sister chromatid 

cohesion during cell division in mitosis and meiosis 

by binding along the arm and centromeres of 


Cohesins and cohesin-regulators: Role in Chromosome 

Segregation/Repair and Potential in Tumorigenesis 

chromosomes. For this function, cohesin needs to 

the action of other proteins; among the best 

characterized of these cofactors are the followings: 

the adherin complex formed by SCC2 and SCC4 

proteins is required for the loading of cohesin 

complexes to chromosomes; the cohesion 

establishment/maintenance proteins Eco1 

acetyltransferase in yeast and the mammalian 

homologues ESCO1 and ESCO2, which, by 

acetylation of the SMC3 subunit of cohesin 

complex, stabilizes the binding of cohesin to 

chromatin; PDS5A and B (Precocious Dissociation 

of Sister), WAPL (Wings Apart-Like) and 

SORORIN are proteins involved in the maintenance 

of cohesion through their interaction with cohesin 

complex subunits and/or with other cohesinregulators 

(figures 1B and 2A); Shugoshin ("the 

Barbero JL 

guardian of the spirit" in Japanese) protein family 

SGO1 and SGO2, which are essentially implicated 

in the protection of sister chromatid cohesion at the 

centromeric regions and, finally, the cohesion 

removal proteins PLK1 (Polo Like Kinase 1), 

Aurora B and securin/separase complex (figure 

2A). The two first molecules are protein-kinases 

that phosphorylate cohesin, essentially STAG 

subunit, triggering the removal of arm cohesins. 

Separase is a specific protease, which is inhibited 

by its cofactor securin; activation of the anaphase 

promoting complex/cyclosome (APC/C) leads to 

ubiquitination and degradation of securin, allowing 

cleavage of SCC1/RAD21 from centromeric 

cohesin complexes by separase and triggering the 

onset of anaphase. 

Figure 1. Cohesin complex and cohesin-regulators. A. Ring model of cohesin complex formed by four subunits SMC1, 

SMC3, RAD21/SCC1 and STAG/SCC3. Subunits SMC1, SMC3 and RAD21 conform the ring-like structure. STAG protein 

interacts with RAD21 to complete the cohesin complex. B. Examples of cohesin-regulators. PDS5 and WAPL form a protein 

complex, which is associated to the cohesin complex by STAG interaction. Sororin is other cohesin-regulator that is also involved 

in the control of cohesin ring dynamic. 

Figure 2. Scheme of cohesin metabolism during chromosome segregation and DNA-damage repair. A. Dynamic of 

cohesin complex in chromosome segregation indicating the characterized cohesin-regulators involved in cohesin loading to 

chromosomes, sister chromatid cohesion establishment and maintenance, and cohesion dissolution during cell division. B. 

Involvement of cohesin complexes during DNA-damage repair. Cohesin are recruited to double strand break (DSB) areas to 

facilitate the repair process. Some cohesin-regulators, such us Scc2/Scc4 loading complex and Eco1 cohesion establishment 

factor are also required for new cohesin loading in these chromosome damaged regions. See text for more details. 




All these cohesin-regulators were firstly 

characterized studying its function in sister 

chromatid cohesion, but shortly after has been 

found evidence of its involvement in DNA repair 

and other cohesin tasks. The initial result on the 

participation of cohesins in theses mechanisms was 

already reported before cohesins were known to 

mediate sister chromatid cohesion; the Scc1 

ortholog from Schizosaccharomyces pombe was 

first identified as a protein whose mutation causes 

sensitivity to radiation because damaged DNA 

cannot be properly repaired and, thus, called Rad21 

(Radiation-sensitivity) (Birkenbihl and Subramani, 

1992). Following experiments, essentially in 

budding yeast, showed that cohesin mutants are 

defective in repair damaged DNA and provided 

evidence that DNA repair depends on the function 

of cohesin to mediate sister chromatid cohesion. In 

addition, studies of Rad21-depleted chicken cells 

have shown that vertebrate cohesin also functions 

in both segregation and repair (Sonoda et al., 2001). 

This cohesin requirement could be explained 

because DNA double strand breaks (DSB) are 

preferentially repaired by recombination between 

sister chromatids and the cohesion between them 

would facilitate this process. In this sense, cohesin 

complexes are recruited to sites of DSB to 

contribute to DNA repair of these damaged regions 

of chromosomes (figure 2B). This cohesin 

recruitment also required: from Eco1/ESCO 

acetyltransferase (Heidinger-Pauli et al., 2009) and 

from a functional SCC2/SCC4 adherin complex 

(Ström et al., 2004). In addition to machinery of 

chromosome cohesion, another specific DNAdamage 

repair proteins are necessary for the 

cohesin localization to DSB sites (figure 2B). A 

component of the DNA-damage sensing complex 

MRX (Mre11/Rad50/Xsr2) is required for cohesin 

assembly around the DSB. Phosphorylation of 

histone H2AX by Mec1/Tel1 generates what is 

known as gH2AX. Yeast strains expressing a nonphosphorylatable 

H2AX fail to recruit cohesin, thus 

suggesting that gH2AX may act as a signal for 

cohesin assembly (Unal et al., 2004). Interestingly, 

some modifications by phosphorylation of SMC1 

and SMC3 cohesin subunits are carried out by 

specific kinases following IR and UV damage. 

Mutations in SMC1 or SMC3 that prevent 

phosphorylation result in abrogated DNA-damage 

responses (Kitagawa et al., 2004). 

Although, currently the participation of other 

chromosome cohesion cohesin-regulators in DNA 

repair is poorly understood, probably future 

research will incorporate also some of these 

molecules to control of DNA repair mechanisms 

(figure 2B). 

Barbero JL 

Cohesins: chromosome 

segregation, DNA-damage repair 

and cancer 

Obviously, the multiple roles of cohesins (figure 3) 

make it difficult to determine how their lack of 

function contributes to the generation and 

development of tumors and probably in many cases, 

were involved several processes. In this review, I 

focus on the two functions of cohesins most clearly 

related to genome stability, chromosome 

segregation and DNA-damage repair, and on the 

currently available data and results linking 

mutations on cohesin and cohesin-regulators genes 

and tumorogenesis. 

Figure 3. Cohesin functions. Scheme of the main cell life 

processes in which cohesins have been functionally 

characterized. The two cohesin tasks in red are the 

principal focus of this review. 

Cohesin complex subunits 

RAD21 cohesin subunit has long been linked with 

cancer chemotherapy; inhibition of RAD21 

expression by RNA interference in human breast 

cancer cells enhanced the cytotoxicity of etoposide 

and bleomycin in these cells (Atienza et al., 2005). 

In agreement with this result, Xu et al. (2011) 

reported that overexpression of RAD21 gives 

resistance to chemotherapy in high-grade luminal, 

basal and HER2 breast cancers. Mice lacking 

Rad21 gene function present early embryonal 

lethality, but heterozygous Rad21 +/- animals were 

obtained by breeding. Rad21 +/- mice were viable 

and developed to apparently normal adulthood 

without morphological defects. However, Rad21 +/- 

mice have enhanced sensitivity to whole body 

irradiation, indicating that Rad21 gene dosage is 

critical for ionizing radiation (IR) response (Xu et 

al., 2010). 

The study of 11 somatic mutations in 132 human 

colorectal cancers identified 6 of them mapping to 3 

cohesin, SMC1a, SMC3 and STAG3, genes and 4 to 

a cohesin-regulator SCC2 gene (Barber et al., 

2008). 




Chromosomal instability is a characteristic of 

colorectal cancer cells, resulting in chromosome 

gain or loss. It is possible to argue that abnormal 

cohesin pathway activity leads to chromosome 

missegregation and chromosome instability. This 

hypothesis is supported by the observation that 

colorectal cancer cells exhibit up to 100-fold higher 

rates of missegregation than normal cells. In 

addition, using a microcell mediated chromosome 

transfer and expression microarray analysis, 

Notaridou et al. (2011) identified the cohesin 

subunit STAG3 gene as one of the nine genes 

associated with functional suppression of 

tumorogenicity in ovarian cancer cell lines and as a 

candidate gene associated with risk and 

development of epithelial ovarian cancer. Kalejs et 

al. (2006) found aberrant expression of meioticspecific 

genes, including the meiotic specific 

cohesin genes REC8 and STAG3 in a lymphoma 

cell model. 

The other two members of the STAG cohesin 

family (STAG1 and STAG2) have been also 

implicated in cancer. The most frequent cause of 

familial clear cell renal cell carcinoma (RCC) is 

von Hippel-Lindau disease and the VHL tumor 

suppressor gene (TSG) is inactivated in most 

sporadic clear cell RCC. To identify candidate 

genes for renal tumorigenesis, Foster et al. (2007) 

characterized a translocation, t(3;6)(q22;q16.1) 

associated with multicentric RCC without evidence 

of VHL target gene dysregulation. The gene 

encoding for the human cohesin subunit STAG1 

map within close proximity to the breakpoints and 

thus it is a candidate gene involved in RCC. In 

array studies searching for genome alterations in a 

series of 167 malignant myeloid diseases, Rocquain 

et al. (2010) found recurrent deletions of RAD21 

and STAG2 genes, suggesting that cohesin 

components are new players in leukemogenesis. 

Chromosomal translocations are also frequently 

found in different cancer cells. The results studying 

a novel non-TCR chromosome translocations 

t(3;11)(q25;p13) and t(X;11)(q25;p13) activating 

LMO2 by juxtaposition with MBNL1 and STAG2 

are consistent with LMO2 upregulation via capture 

of MBNL1 or STAG2 regulatory elements effected 

by t(3;11) or t(X;11), respectively (Chen et al., 

2011). With the aim to identify genomic alterations, 

associated with exposure to radiation, Hess et al. 

(2011) used array comparative genomic 

hybridization to analyze a main (n=52) and a 

validation cohort (n=28) of PTC from patients aged 



al., 2011), linking again lost of chromosome 

cohesion with genomic instability. 

WAPL was also identified as an oncogene in uterine 

cervical cancer and it is induced by human 

papillomavirus (HPV) E6 and E7 oncoproteins. 

WAPL overexpression induces apparition of 

multinucleated cells and increases the number of 

chromatid breaks in the cell, contributing to 

molecular mechanisms of tumor progression from 

HPV-infected cells to cervical carcinoma 

(Ohbayashi et al., 2007). Later, these authors 

reported that human WAPL gene encodes a large 

number of spliced variants and that the expression 

patterns of these variants could have diagnostic 

potential for cervical lesions (Oikawa et al., 2008). 

Sororin, also known as cell division cycle 

associated 5 (CDCA5) protein, has been recently 

identified as an up-regulated gene in mostly lung 

cancers using a cDNA array containing 27648 

genes or expressed sequence tags (Nguyen et al., 

2010). Sororin is phosphorylated by extracellular 

signal-regulated kinase (ERK) at Ser79 and Ser209 

in vivo. The suppression of sororin expression by 

siRNAs or the inhibition of the interaction between 

sororin and ERK inhibited the growth of lung 

cancer cells indicating a functional role of 

activation of CDCA5/sororin in lung cell cancer 

proliferation. 

To investigate the putative role of the centromere 

cohesion guardian shugoshin 1 (SGO1) in human 

colorectal cancer, Iwaizumi et al. (2009) performed 

SGO1 knockdown using shRNA expression vector. 

Human SGO1 knockdown cells proliferated slowly 

and presented marked of chromosomal instability 

(CIN) in the form of aneuploidy. Other 

characteristics of these transfected cells were 

increased centrosome amplification, the presence of 

binucleated cells, and mitotic catastrophes. The 

results of this study showed that SGO1 downregulation 

leads CIN in human colorectal cancer 

cells and it could be a molecule involved in the CIN 

pathway found in colorectal cancer progression. 

Cohesin-regulators: cohesion 

dissolution 

The complex separase and its inhibitor securin are 

responsible for the total dissolution of sister 

chromatid cohesion in anaphase. Mammalian 

securin gene was originally identified in 1997 and 

characterized as pituitary tumor-transforming gene 

(Pttg1), which encodes the PTTG protein, from rat 

pituitary tumor cells (Pei and Melmed, 1997). 

PTTG/securin is highly expressed in various tumors 

and it can induce human cellular transformation. 

PTTG/securin is associated with more aggressive 

tumor behavior and has been identified as one of 17 

key signature genes associated with metastatic 

disease (Ramaswamy et al., 2003). In addition, a 

PTTG binding factor (PBF) was identified through 

its interaction with PTTG and it was characterized 

Barbero JL 

as a proto-oncogene that is upregulated in several 

cancers (Smith et al., 2010). PTTG1/securin is also 

overexpressed in hepatocellular carcinoma. Chronic 

infection with hepatitis B virus (HBV) is the main 

causal factor for hepatocellular carcinoma and the 

viral protein HBx plays an essential role in the 

pathogenesis of hepatic tumors. To investigate the 

putative correlation between the abnormal 

expression of PTTG1 and the tumorigenic 

mechanism of HBx, Molina-Jiménez et al. (2010) 

analyzed the PTTG1 expression in biopsies from 

patients chronically infected with HBV in different 

disease stages and from HBx transgenic mouse 

model. These authors found that HBx viral protein 

promotes an accumulation of PTTG1 by inhibition 

of PTTG1 ubiquitination and degradation. The 

molecular mechanism/s by which HBx carried out 

this inhibition is currently under research. 

Separase is the endopeptidase that cleaves RAD21 

cohesin subunit during to metaphase/anaphase 

transition causing the removal of cohesins and the 

separation of sister chromatids. Overexpression of 

separase induces premature separation of 

chromatids, lagging chromosomes, and anaphase 

bridges. In a mouse mammary transplant model, 

induction of separase expression in the transplanted 

FSK3 cells for 3-4 weeks results in the formation of 

aneuploid tumors in the mammary gland (Zhang et 

al., 2008). In a later report, Meyer et al. (2009) 

showed that separase is significantly overexpressed 

in osteosarcoma, breast, and prostate tumor 

specimens. There is a strong correlation of tumor 

status with the localization of separase into the 

nucleus throughout all stages of the cell cycle. In 

addition, overexpression of separase transcript 

strongly correlates with high incidence of relapse, 

metastasis, and lower 5-year overall survival rate in 

breast and prostate cancer patients, suggesting that 

separase is an oncogene. 

Polo-like kinase 1 (PLK1) and Aurora B are two 

protein-kinases that have as substrates cohesins and 

other proteins involved in chromosome segregation. 

PlK1 is overexpressed in various human cancers, 

and this is mostly associated with poor prognosis 

(Strebhardt and Ullrich, 2006). The first data to 

associate PLK1 with neoplastic growth were 

generated by studies showing that PLK1 

concentrations are also increased in primary cancer 

tissues (Holtrich et al., 1994). This prompted a 

number of studies that subsequently demonstrated 

that PLK1 is overexpressed in a broad spectrum of 

human tumors compared with normal controls. 

Furthermore, some reports have indicated that 

PLK1 expression is a reliable marker for 

identifying a high risk of metastasis (Dai et al., 

2000). More recently, Ito el al. (2010) described the 

post-transcriptional regulation of Plk1 expression 

by RNA interference mediates by miR-593* and 

Plk1 downregulation in EC cells decreases cell 




proliferation in vitro via G2/M cell cycle arrest, and 

drastically suppresses tumor formation in vivo. 

Aurora B kinase is involved in different key 

functions during chromosome segregation to 

preserve genomic stability. Examples of these 

functions are: sister chromatid cohesion, 

chromosome condensation, mitotic spindle 

assembly, syntelic chromosome attachments and 

spindle assembly checkpoint (for a review see 

Vader and Lens, 2008). Aurora B is overexpressed 

in cancer cells, and an increased level of Aurora B 

correlates with advanced stages of colorectal 

cancer. Overexpression of Aurora B results in 

multi-nucleation and polyploidy in human cells 

(Tatsuka et al., 1998) and, additionally, it has been 

reported that Aurora B overexpression induces 

chromosomes lagging in metaphase, chromosome 

segregation error, and errors in cytokinesis, and 

thus suggesting a direct link between Aurora B and 

carcinogenesis (Ota et al., 2002). These findings 

and the crucial roles of Aurora B and PLK1 in 

chromosome dynamics during cell cycle have led to 

consider these two kinases as important targets for 

cancer therapy (de Cárcer et al., 2007; Strebhardt, 

2010; Libertini et al., 2010). 

Concluding remarks 

Cohesin complex, initially characterized as a ring 

protein complex that maintains sister chromatids 

together during chromosome segregation, is now 

considered a real architect of chromatin structure 

during essential dynamic DNA processes. In many 

cases, these processes are designed to safeguard the 

stability of genetic material and its proper 

distribution to the daughter cells. Thus, it is not 

surprising that when there are errors/problems in 

the cohesin complex metabolism related with this 

guardian function, one of the likely results was the 

formation of a tumor. Although this review focuses 

essentially on the role of cohesins in chromosome 

segregation and DNA-damage repair and their 

connection with tumorigenesis, other functions of 

cohesins are also possibly related with the 

development of human tumors. In this sense, 

recently Baysal et al. 2011, described that germ line 

mutations in SDHD, a mitochondrial complex II 

(succinate dehydrogenase) subunit gene at 

chromosome band 11q23, cause highly penetrant 

paraganglioma tumors when transmitted through 

fathers. In contrast, maternal transmission rarely, if 

ever, leads to tumor development. They observed 

that hypermethylated adrenal tissues show 

increased binding of the chromatin-looping factor 

cohesin relative to the hypomethylated tissues, 

suggesting that this differential allelic interaction 

may result in maternal downregulation of SDHD 

and the parent-of-origin dependent tumor 

susceptibility. 

In recent years, an increasing number of scientific 

works showed that cohesin functions are mediated 

by the action of other proteins. These molecules can 

Barbero JL 

be subdivided into two kind of cohesin-interacting 

proteins: those that regulate different aspects of the 

cohesin metabolism and necessary for several 

functions (such as SCC2/SCC4, Eco1/ESCO) and 

those that contribute to one cohesin specific role by 

a spatial-temporal interaction with cohesin complex 

(such as CCCTC-binding factor (CTCF) and 

MEDIATOR in the control of gene expression 

(Wendt et al., 2008; Kagey et al., 2010)). In 

addition, post-translational modifications, such as 

acetylation and phosphorylation, in specific 

residues of cohesin subunits are also required for 

specific cohesin functions, suggesting the putative 

existence of a cohesin code similarly to well 

established histone code. 

All these findings point to the initial denomination 

of cohesin is currently very limited and therefore 

some authors are beginning to use other terms, such 

us chromatin-looping factor (Baysal et al., 2011) 

or, from my point of view, more convenient 

chromosome architectins, which, by interaction 

with specific regulator proteins, model precise 

tridimensional structures at local regions of 

chromosomes to perform different and specific 

functions depending on the spatial-temporal 

requirements of cell life. The future research on the 

molecular mechanisms of both, the cohesininteracting 

proteins and the specific cohesin posttranslational 

modifications, and on the alterations in 

the cohesin network during pathological conditions 

is crucial in determining the relationships between 

this interesting ring protein complex and the 

formation/development of tumors in humans. 

Acknowledgments 

We thank Dr. Adela Calvente for her help in the 

figure design and critical comments. We apologize 

to all colleagues whose important contributions 

have not been referenced due to space restrictions. 

This work was supported by the Spanish Ministerio 

de Ciencia e Innovación (grant BFU2009- 

08975/BMC) and CSIC (grant PIE-201120E020). 

References 

Birkenbihl RP, Subramani S. Cloning and characterization 

of rad21 an essential gene of Schizosaccharomyces 

pombe involved in DNA double-strand-break repair. 

Nucleic Acids Res. 1992 Dec 25;20(24):6605-11 

Holtrich U, Wolf G, Bräuninger A, Karn T, Böhme B, 

Rübsamen-Waigmann H, Strebhardt K. Induction and 

down-regulation of PLK, a human serine/threonine kinase 

expressed in proliferating cells and tumors. Proc Natl Acad 

Sci U S A. 1994 Mar 1;91(5):1736-40 

Pei L, Melmed S. Isolation and characterization of a 

pituitary tumor-transforming gene (PTTG). Mol Endocrinol. 

1997 Apr;11(4):433-41 

Tatsuka M, Katayama H, Ota T, Tanaka T, Odashima S, 

Suzuki F, Terada Y. Multinuclearity and increased ploidy 

caused by overexpression of the aurora- and Ipl1-like 

midbody-associated protein mitotic kinase in human 

cancer cells. Cancer Res. 1998 Nov 1;58(21):4811-6 




Dai W, Li Y, Ouyang B, Pan H, Reissmann P, Li J, Wiest J, 

Stambrook P, Gluckman JL, Noffsinger A, Bejarano P. 

PRK, a cell cycle gene localized to 8p21, is downregulated 

in head and neck cancer. Genes Chromosomes Cancer. 

2000 Mar;27(3):332-6 

Pezzi N, Prieto I, Kremer L, Pérez Jurado LA, Valero C, 

Del Mazo J, Martínez-A C, Barbero JL. STAG3, a novel 

gene encoding a protein involved in meiotic chromosome 

pairing and location of STAG3-related genes flanking the 

Williams-Beuren syndrome deletion. FASEB J. 2000 

Mar;14(3):581-92 

Sonoda E, Matsusaka T, Morrison C, Vagnarelli P, Hoshi 

O, Ushiki T, Nojima K, Fukagawa T, Waizenegger IC, 

Peters JM, Earnshaw WC, Takeda S. Scc1/Rad21/Mcd1 is 

required for sister chromatid cohesion and kinetochore 

function in vertebrate cells. Dev Cell. 2001 Dec;1(6):759- 

70 

Ota T, Suto S, Katayama H, Han ZB, Suzuki F, Maeda M, 

Tanino M, Terada Y, Tatsuka M. Increased mitotic 

phosphorylation of histone H3 attributable to AIM-1/Aurora- 

B overexpression contributes to chromosome number 

instability. Cancer Res. 2002 Sep 15;62(18):5168-77 

Ramaswamy S, Ross KN, Lander ES, Golub TR. A 

molecular signature of metastasis in primary solid tumors. 

Nat Genet. 2003 Jan;33(1):49-54 

Kitagawa R, Bakkenist CJ, McKinnon PJ, Kastan MB. 

Phosphorylation of SMC1 is a critical downstream event in 

the ATM-NBS1-BRCA1 pathway. Genes Dev. 2004 Jun 

15;18(12):1423-38 

Ström L, Lindroos HB, Shirahige K, Sjögren C. 

Postreplicative recruitment of cohesin to double-strand 

breaks is required for DNA repair. Mol Cell. 2004 Dec 

22;16(6):1003-15 

Unal E, Arbel-Eden A, Sattler U, Shroff R, Lichten M, 

Haber JE, Koshland D. DNA damage response pathway 

uses histone modification to assemble a double-strand 

break-specific cohesin domain. Mol Cell. 2004 Dec 

22;16(6):991-1002 

Atienza JM, Roth RB, Rosette C, Smylie KJ, Kammerer S, 

Rehbock J, Ekblom J, Denissenko MF. Suppression of 

RAD21 gene expression decreases cell growth and 

enhances cytotoxicity of etoposide and bleomycin in 

human breast cancer cells. Mol Cancer Ther. 2005 

Mar;4(3):361-8 

Kalejs M, Ivanov A, Plakhins G, Cragg MS, Emzinsh D, 

Illidge TM, Erenpreisa J. Upregulation of meiosis-specific 

genes in lymphoma cell lines following genotoxic insult and 

induction of mitotic catastrophe. BMC Cancer. 2006 Jan 

9;6:6 

Strebhardt K, Ullrich A. Targeting polo-like kinase 1 for 

cancer therapy. Nat Rev Cancer. 2006 Apr;6(4):321-30 

de Cárcer G, Pérez de Castro I, Malumbres M. Targeting 

cell cycle kinases for cancer therapy. Curr Med Chem. 

2007;14(9):969-85 

Foster RE, Abdulrahman M, Morris MR, Prigmore E, 

Gribble S, Ng B, Gentle D, Ready S, Weston PM, 

Wiesener MS, Kishida T, Yao M, Davison V, Barbero JL, 

Chu C, Carter NP, Latif F, Maher ER. Characterization of a 

3;6 translocation associated with renal cell carcinoma. 

Genes Chromosomes Cancer. 2007 Apr;46(4):311-7 

Ohbayashi T, Oikawa K, Yamada K, Nishida-Umehara C, 

Matsuda Y, Satoh H, Mukai H, Mukai K, Kuroda M. 

Unscheduled overexpression of human WAPL promotes 

chromosomal instability. Biochem Biophys Res Commun. 

2007 May 11;356(3):699-704 

Barbero JL 

Ryu B, Kim DS, Deluca AM, Alani RM. Comprehensive 

expression profiling of tumor cell lines identifies molecular 

signatures of melanoma progression. PLoS One. 2007 Jul 

4;2(7):e594 

Barber TD, McManus K, Yuen KW, Reis M, Parmigiani G, 

Shen D, Barrett I, Nouhi Y, Spencer F, Markowitz S, 

Velculescu VE, Kinzler KW, Vogelstein B, Lengauer C, 

Hieter P. Chromatid cohesion defects may underlie 

chromosome instability in human colorectal cancers. Proc 

Natl Acad Sci U S A. 2008 Mar 4;105(9):3443-8 

Oikawa K, Akiyoshi A, Tanaka M, Takanashi M, Nishi H, 

Isaka K, Kiseki H, Idei T, Tsukahara Y, Hashimura N, 

Mukai K, Kuroda M. Expression of various types of 

alternatively spliced WAPL transcripts in human cervical 

epithelia. Gene. 2008 Oct 15;423(1):57-62 

Vader G, Lens SM. The Aurora kinase family in cell 

division and cancer. Biochim Biophys Acta. 2008 

Sep;1786(1):60-72 

Wendt KS, Yoshida K, Itoh T, Bando M, Koch B, 

Schirghuber E, Tsutsumi S, Nagae G, Ishihara K, Mishiro 

T, Yahata K, Imamoto F, Aburatani H, Nakao M, Imamoto 

N, Maeshima K, Shirahige K, Peters JM. Cohesin 

mediates transcriptional insulation by CCCTC-binding 

factor. Nature. 2008 Feb 14;451(7180):796-801 

Yamamoto F, Yamamoto M. Identification of genes that 

exhibit changes in expression on the 8p chromosomal arm 

by the Systematic Multiplex RT-PCR (SM RT-PCR) and 

DNA microarray hybridization methods. Gene Expr. 

2008;14(4):217-27 

Zhang N, Ge G, Meyer R, Sethi S, Basu D, Pradhan S, 

Zhao YJ, Li XN, Cai WW, El-Naggar AK, 

Baladandayuthapani V, Kittrell FS, Rao PH, Medina D, Pati 

D. Overexpression of Separase induces aneuploidy and 

mammary tumorigenesis. Proc Natl Acad Sci U S A. 2008 

Sep 2;105(35):13033-8 

Barbero JL. Cohesins: chromatin architects in 

chromosome segregation, control of gene expression and 

much more. Cell Mol Life Sci. 2009 Jul;66(13):2025-35 

Heidinger-Pauli JM, Unal E, Koshland D. Distinct targets of 

the Eco1 acetyltransferase modulate cohesion in S phase 

and in response to DNA damage. Mol Cell. 2009 May 

15;34(3):311-21 

Iwaizumi M, Shinmura K, Mori H, Yamada H, Suzuki M, 

Kitayama Y, Igarashi H, Nakamura T, Suzuki H, Watanabe 

Y, Hishida A, Ikuma M, Sugimura H. Human Sgo1 

downregulation leads to chromosomal instability in 

colorectal cancer. Gut. 2009 Feb;58(2):249-60 

Meyer R, Fofanov V, Panigrahi A, Merchant F, Zhang N, 

Pati D. Overexpression and mislocalization of the 

chromosomal segregation protein separase in multiple 

human cancers. Clin Cancer Res. 2009 Apr 15;15(8):2703- 

10 

Nasmyth K, Haering CH. Cohesin: its roles and 

mechanisms. Annu Rev Genet. 2009;43:525-58 

Denes V, Pilichowska M, Makarovskiy A, Carpinito G, 

Geck P. Loss of a cohesin-linked suppressor APRIN 

(Pds5b) disrupts stem cell programs in embryonal 

carcinoma: an emerging cohesin role in tumor 

suppression. Oncogene. 2010 Jun 10;29(23):3446-52 

Ito T, Sato F, Kan T, Cheng Y, David S, Agarwal R, Paun 

BC, Jin Z, Olaru AV, Hamilton JP, Selaru FM, Yang J, 

Matsumura N, Shimizu K, Abraham JM, Shimada Y, Mori 

Y, Meltzer SJ. Polo-like kinase 1 regulates cell proliferation 

and is targeted by miR-593* in esophageal cancer. Int J 

Cancer. 2010 Dec 17; 




Kagey MH, Newman JJ, Bilodeau S, Zhan Y, Orlando DA, 

van Berkum NL, Ebmeier CC, Goossens J, Rahl PB, 

Levine SS, Taatjes DJ, Dekker J, Young RA. Mediator and 

cohesin connect gene expression and chromatin 

architecture. Nature. 2010 Sep 23;467(7314):430-5 

Libertini S, Abagnale A, Passaro C, Botta G, Portella G. 

Aurora A and B kinases--targets of novel anticancer drugs. 

Recent Pat Anticancer Drug Discov. 2010 Nov;5(3):219-41 

Molina-Jiménez F, Benedicto I, Murata M, Martín-Vílchez 

S, Seki T, Antonio Pintor-Toro J, Tortolero M, Moreno- 

Otero R, Okazaki K, Koike K, Barbero JL, Matsuzaki K, 

Majano PL, López-Cabrera M. Expression of pituitary 

tumor-transforming gene 1 (PTTG1)/securin in hepatitis B 

virus (HBV)-associated liver diseases: evidence for an 

HBV X protein-mediated inhibition of PTTG1 ubiquitination 

and degradation. Hepatology. 2010 Mar;51(3):777-87 

Nguyen MH, Koinuma J, Ueda K, Ito T, Tsuchiya E, 

Nakamura Y, Daigo Y. Phosphorylation and activation of 

cell division cycle associated 5 by mitogen-activated 

protein kinase play a crucial role in human lung 

carcinogenesis. Cancer Res. 2010 Jul 1;70(13):5337-47 

Rocquain J, Gelsi-Boyer V, Adélaïde J, Murati A, 

Carbuccia N, Vey N, Birnbaum D, Mozziconacci MJ, 

Chaffanet M. Alteration of cohesin genes in myeloid 

diseases. Am J Hematol. 2010 Sep;85(9):717-9 

Smith VE, Franklyn JA, McCabe CJ. Pituitary tumortransforming 

gene and its binding factor in endocrine 

cancer. Expert Rev Mol Med. 2010 Dec 3;12:e38 

Strebhardt K. Multifaceted polo-like kinases: drug targets 

and antitargets for cancer therapy. Nat Rev Drug Discov. 

2010 Aug;9(8):643-60 

Xu H, Balakrishnan K, Malaterre J, Beasley M, Yan Y, 

Essers J, Appeldoorn E, Tomaszewski JM, Vazquez M, 

Verschoor S, Lavin MF, Bertoncello I, Ramsay RG, McKay 

MJ. Rad21-cohesin haploinsufficiency impedes DNA repair 

and enhances gastrointestinal radiosensitivity in mice. 

PLoS One. 2010 Aug 12;5(8):e12112 

Baysal BE, McKay SE, Kim YJ, Zhang Z, Alila L, Willett- 

Brozick JE, Pacak K, Kim TH, Shadel GS. Genomic 

imprinting at a boundary element flanking the SDHD locus. 

Hum Mol Genet. 2011 Nov 15;20(22):4452-61 

Chen S, Nagel S, Schneider B, Kaufmann M, Meyer C, 

Zaborski M, Kees UR, Drexler HG, MacLeod RA. Novel 

non-TCR chromosome translocations t(3;11)(q25;p13) and 

t(X;11)(q25;p13) activating LMO2 by juxtaposition with 

MBNL1 and STAG2. Leukemia. 2011 Oct;25(10):1632-5 

Barbero JL 

Hagemann C, Weigelin B, Schommer S, Schulze M, Al- 

Jomah N, Anacker J, Gerngras S, Kühnel S, Kessler AF, 

Polat B, Ernestus RI, Patel R, Vince GH. The cohesininteracting 

protein, precocious dissociation of sisters 

5A/sister chromatid cohesion protein 112, is up-regulated 

in human astrocytic tumors. Int J Mol Med. 2011 

Jan;27(1):39-51 

Hess J, Thomas G, Braselmann H, Bauer V, Bogdanova T, 

Wienberg J, Zitzelsberger H, Unger K. Gain of 

chromosome band 7q11 in papillary thyroid carcinomas of 

young patients is associated with exposure to low-dose 

irradiation. Proc Natl Acad Sci U S A. 2011 Jun 

7;108(23):9595-600 

Notaridou M, Quaye L, Dafou D, Jones C, Song H, Høgdall 

E, Kjaer SK, Christensen L, Høgdall C, Blaakaer J, 

McGuire V, Wu AH, Van Den Berg DJ, Pike MC, Gentry- 

Maharaj A, Wozniak E, Sher T, Jacobs IJ, Tyrer J, 

Schildkraut JM, Moorman PG, Iversen ES, Jakubowska A, 

Mędrek K, Lubiński J, Ness RB, Moysich KB, Lurie G, 

Wilkens LR, Carney ME, Wang-Gohrke S, Doherty JA, 

Rossing MA, Beckmann MW, Thiel FC, Ekici AB, Chen X, 

Beesley J, Gronwald J, Fasching PA, Chang-Claude J, 

Goodman MT, Chenevix-Trench G, Berchuck A, Pearce 

CL, Whittemore AS, Menon U, Pharoah PD, Gayther SA, 

Ramus SJ. Common alleles in candidate susceptibility 

genes associated with risk and development of epithelial 

ovarian cancer. Int J Cancer. 2011 May 1;128(9):2063-74 

Solomon DA, Kim T, Diaz-Martinez LA, Fair J, Elkahloun 

AG, Harris BT, Toretsky JA, Rosenberg SA, Shukla N, 

Ladanyi M, Samuels Y, James CD, Yu H, Kim JS, 

Waldman T. Mutational inactivation of STAG2 causes 

aneuploidy in human cancer. Science. 2011 Aug 

19;333(6045):1039-43 

Xu H, Yan M, Patra J, Natrajan R, Yan Y, Swagemakers S, 

Tomaszewski JM, Verschoor S, Millar EK, van der Spek P, 

Reis-Filho JS, Ramsay RG, O'Toole SA, McNeil CM, 

Sutherland RL, McKay MJ, Fox SB. Enhanced RAD21 

cohesin expression confers poor prognosis and resistance 

to chemotherapy in high grade luminal, basal and HER2 

breast cancers. Breast Cancer Res. 2011 Jan 21;13(1):R9 


Barbero JL. Cohesins and cohesin-regulators: Role in 

Chromosome Segregation/Repair and Potential in 

Tumorigenesis. Atlas Genet Cytogenet Oncol Haematol. 

2012; 16(2):155-162. 






Mechanisms and regulation of autophagy in 

mammalian cells 

Maryam Mehrpour, Joëlle Botti, Patrice Codogno 

INSERM U984, Faculty of Pharmacy, University Paris-Sud 11, 92296 Chatenay-Malabry Cedex, 

France (MM, JB, PC) 


Online updated version : http://AtlasGeneticsOncology.org/Deep/AutophagyID20102.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI AutophagyID20102.txt 



Introduction 

Cell homeostasis depends on the balance between 

the production and destruction of macromolecules 

and organelles. There are two major systems in 

eukaryotic cells that degrade cellular components: 

the ubiquitin proteasome system (UPS) and the 

lysosome. The UPS only degrades proteins, mainly 

short-lived proteins that have to be tagged by 

ubiquitin to be recognized by the proteasome 

(Ciechanover et al., 2000). The lysosomal system is 

responsible for degrading macromolecules, 

including proteins, and for the turnover of 

organelles by autophagy (Mizushima et al., 2008). 

Recent evidence demonstrates that cross-talk and 

cooperation exist between the UPS and autophagy 

(Korolchuk et al., 2009; Lamark and Johansen, 

2009; Nedelsky et al., 2008). The term "autophagy" 

was coined by Christian de Duve soon after his 

discovery of lysosomes (see reference Klionsky, 

2007 for an historical view of autophagy). The 

seminal discovery of ATG (AuTophaGy) genes, 

originally in yeast and subsequently in multicellular 

organisms, has provided an important breakthrough 

in the understanding of macroautophagy and of its 

functions in physiology and diseases (Klionsky et 

al., 2003; Nakatogawa et al., 2009). However the 

term "autophagy" also embraces microautophagy 

and chaperone-mediated autophagy (Klionsky, 

2007) that we will briefly describe here. In contrast 

to macroautophagy, which starts with the formation 

of a vacuole, known as the autophagosome, that 

sequesters cytoplasmic components, 

microautophagy consists of the direct uptake of 

fractions of the cytoplasm by the lysosomal 

membrane. Macro- and microautophagy are 

conserved from yeast to humans. These processes 

were originally described as bulk degradation 

mechanisms. However, selective forms of 

macroautophagy and microautophagy target 

organelles (mitophagy, pexophagy, ribophagy, 

ERphagy, piecemeal microautophagy of the 

nucleus), protein aggregates (aggrephagy), lipid 

droplets (lipophagy), glycogen and microorganisms 

that invade the intracellular milieu (xenophagy) 

(Beau et al., 2008; Kraft et al., 2009; van der Vaart 

et al., 2008). Microautophagy is dependent on GTP 

hydrolysis and on calcium (Uttenweiler and Mayer, 

2008). However the molecular regulation of 

microautophagy remains to be unraveled. Bulk 

microautophagy does not seem to be dependent on 

Atg proteins, whereas selective forms of 

microautophagy require different sets of Atg 

proteins (Beau et al., 2008; Kraft et al., 2009; van 

der Vaart et al., 2008). Chaperone-mediated 

autophagy (CMA) is a selective form of autophagy 

that has so far only been described in mammalian 

cells (Cuervo, 2009). Substrates for CMA contain a 

KFERQ-related motif in their amino acid sequence. 

This motif is recognized by the cytosolic 

constitutive chaperone hsc70 (heat shock cognate of 

the Hsp70 family). This recognition allows the 

lysosomal delivery of CMA substrates to occur. 

The lysosomal membrane protein, LAMP-2A, 

serves as a receptor in the translocation of unfolded 

polypeptides across the lysosomal membrane. 

KFERQ-like motifs are found mainly in cytosolic 

proteins, and it is estimated that about 30% of 

cytosolic proteins contain this motif. CMA 

performs several general functions, such as the 

elimination of oxidazed proteins and the removal of 

misfolded proteins, and also provides amino acids 


Mechanisms and regulation of autophagy in mammalian cells Mehrpour M, et al. 

during prolonged periods of starvation. It is 

interesting to note that cross-talk occurs between 

macroautophagy and CMA during starvation 

(Kaushik et al., 2008; Massey et al., 2006). When 

CMA is stimulated, macroautophagy is first 

induced and then declines. The molecular basis for 

this switch remains to be identified. Prevention of 

the age-related decline of CMA is beneficial for the 

homeostasis of organs and function (Zhang and 

Cuervo, 2008). This observation is indicative of the 

potential importance of CMA and macroautophagy, 

as we discuss below, as possible anti-aging 

mechanisms. CMA is also involved in more 

specific functions, such as antigen presentation by 

MHC class II molecules, neurone survival, and 

kidney growth (Cuervo, 2009). 

Molecular and cellular aspects of 

macroautophagy 

Autophagosome formation. Autophagy is initiated 

by the formation of a double membrane-bound 

vacuole known as the autophagosome. The size of 

this vacuole can range from 300 to 900 nm. 

Autophagosomes are non-degradative vacuoles that 

sequester cytoplasmic material. The boundary 

membrane arises from a single membrane, known 

as the phagophore or isolation membrane (reviewed 

in Yang and Klionsky, 2010) (Figure 1). Once 

completed, autophagosomes receive inputs from the 

endocytic pathway, and thus acquire acidic and 

degradative capacities. These acidic and 

degradative vacuoles form single-membrane 

compartments known as amphisomes (reviewed in 

Yang and Klionsky, 2010). The last stage of 

autophagy is the fusion of the amphisomes with 

lysosomes to degrade their autophagic cargoes and 

to recycle nutrients (to meet the metabolic demand) 

and membranes (to permit ongoing lysosomal 

function). Whereas the mobility of autophagic 

vacuoles is dependent on microtubules, fusion 

events between autophagic vacuoles and lysosomes 

seem to be independent of cytoskeletal elements. A 

long-standing question regarding autophagy was to 

identify the origin of the phagophore and to 

decipher the molecular basis of the biogenesis of 

autophagosomes. The discovery of ATG genes in 

yeast was a major milestone in our understanding of 

autophagy (Nakatogawa et al., 2009). More than 15 

Atg proteins, plus class III PI3K or hVps34, are 

required to construct the autophagosome. These 

Atg proteins are hierarchically recruited at the PAS 

(Nakatogawa et al., 2009). The formation of the 

autophagosome is a multistep process that includes 

the biogenesis of the isolation membrane, followed 

by its elongation and closure. The process also 

requires the shuttling of Atg9, the only 

transmembrane Atg, between a peripheral site and 

the isolation membrane (Nakatogawa et al., 2009) 

(Figure 2). 

Figure 1. Schematic view of the autophagic pathway. Autophagy is initiated by the nucleation of an isolation membrane or 

phagophore. Several different membrane pools contribute to the formation of the phagophore. This membrane then elongates 

and closes on itself to form an autophagosome. In most cases, once the autophagosome has been formed it receives input from 

the endocytic pathway (early and late endosomes and multivesicular bodies-MVB). These steps are collectively termed 

maturation. The amphisomes that result from the fusion of autophagosomes with late endosomes/MVB are acidic and hydrolytic 

vacuoles. 



Figure 2. Regulation of autophagy and its relationship with signaling molecules and apoptotic mediators. In the 

presence of amino acids, growth factors and energy, the mTOR complex 1 (mTORC1) represses autophagy by inhibiting the 

kinase activity of ULK1. In contrast, in the absence of amino acids and growth factors, or in response to an increase in the 

AMP/ATP ratio (via activation of AMPK), mTORC1 is inhibited and autophagy is initiated by the ULK1 complex. In this complex, 

Atg13 and FIP200 are substrates for ULK1 kinase activity. We do not know whether ULK1 has any other substrates. During 

starvation, c-JUN N-terminal kinase 1 (JNK1) is activated. By phosphorylating Bcl-2, JNK1abolishes its inhibitory effect on the 

activity of the Beclin 1:hVps34:Atg14 complex. The phosphorylation of Beclin 1 by Death-associated protein kinase (DAPK) also 

triggers the dissociation of Bcl-2 from Beclin 1. Not shown in the Figure, BH3-containing proteins can dissociate the Beclin 1:Bcl- 

2 interaction by competing with the Beclin 1 BH3 domain independently of the modification of the phosphorylation status of the 

proteins in the complex. The activity of the Beclin 1:hVps34:Atg14 complex is important for the nucleation of the autophagosomal 

membrane. The functional relationship between the ULK1:Atg13:FIP200 (initiation) and Beclin 1:hVps34:Atg14 (nucleation) 

complexes remains to be determined. Production of PtdIns3P by hVps34 in the Beclin 1:hVps34:Atg14 complex allows the 

recruitment of WIPI-1 and Atg2 to occur. The expansion and closure of the autophagosomal membrane are dependent on the 

Atg12 and LC3 conjugation systems. The Atg12-Atg5 conjugate associated with Atg16 contributes to the stimulation of the 

conjugation of LC3-I to phosphatidylethanolamine (PE) to generate LC3-II. Expansion of the autophagosomal membrane is 

probably dependent on the supply of lipids by Atg9 that cycles between a peripheral pool and the growing isolation membrane or 

phagophore. The anti-apoptotic protein FLIP inhibits autophagy by interacting with Atg3. In this Figure, protein kinases with 

substrates in the autophagic machinery are boxed in rectangles. Mediators of apoptosis are boxed in orange. These mediators 

regulate autophagy at the nucleation step (Bcl-2 and DAPK) and at the expansion/closure step (FLIP). 

Recently strong arguments have been advanced for 

the role of the endoplasmic reticulum (ER) in the 

initiation of autophagy (Axe et al., 2008; Hayashi- 

Nishino et al., 2009; Ylä-Anttila et al., 2009). The 

ULK1 complex (a complex composed of ULK1: 

the mammalian ortholog of yeast Atg1, FIP200: the 

mammalian ortholog of the yeast Atg13, Atg17, 

Atg101), and the PI3K complex (a complex 

composed of Beclin 1: the mammalian ortholog of 

yeast Atg6, Atg14, hVps34, hVps15 and AMBRA 

1) congregate at the PAS to initiate autophagy in 

response to nutrient starvation. The kinase activity 

of ULK1 is controlled by the kinase mTOR in the 

mTORC1 complex sensitive to rapamycin 

(Hosokawa et al., 2009). The protein Atg14 plays a 

key role in the ER targeting of the PI3K complex. 

How the ULK1 and PI3K complexes are 

coordinately regulated remains to be elucidated. 

The production of PtdIns3P by hVps34 recruits 

WIPI-1/2 (Atg18) and DFPC1, which are both 

PtdIns3P binding proteins. DFCP1 is located at the 

Golgi in resting cells, but in response to autophagy 

stimulation it is recruited to an ER structure known 

as the omegasome (Axe et al., 2008). The 

omegasome serves as a PAS to accommodate the 

two ubiquitin-like conjugation systems (Atg12- 

Atg5, Atg16 and LC3-II, the 

phosphatidylethanolamine containing LC3, the 

mammalian ortholog of the yeast Atg8) that act 

sequentially to elongate the phagophore membrane 

and thus form the autophagosome (Nakatogawa et 

al., 2009). More recently it has been suggested that 

the mitochondrial outer membrane may be another 

source of the isolation membrane (Hailey et al., 

2010). According to this scenario, the 

mitochondria-ER contact site provides the growing 

phagophore with lipids. The plasma membrane, 

through Atg16L1 decorated vesicles derived from 

coated pits, is also a source of membrane for the 

phagophore (Ravikumar et al., 2010a). Finally, 



Golgi apparatus and post-Golgi compartments 

containing Atg9 also contribute to the formation of 

the autophagosome membrane (Mari et al., 2010; 

Ohashi and Munro, 2010). Whatever the origin of 

the membrane, Atg proteins are retrieved from the 

autophagosome membrane after closure, with the 

exception of a fraction of LC3-II, which is 

transported into the lysosomal compartment (Yang 

and Klionsky, 2010). Following on from this 

discovery, several methods based on the analysis of 

the LC3 protein have been developed to monitor 

autophagy (Mizushima et al., 2010). 

The role of LC3 and of other members of the 

mammalian Atg8 family (GABARAPs) remains to 

be fully elucidated. However, a recent study shows 

that LC3s and GABARAPs are involved in 

different steps of autophagosome biogenesis 

(Weidberg et al., 2010). LC3s mediate the 

elongation of the autophagic membrane, and 

GABARAPs mediate a downstream event probably 

associated with the closure of the autophagosome 

membrane. Atg8 proteins induce membrane fusion, 

which is involved in autophagy (Nakatogawa et al., 

2007; Weidberg et al., 2011a). However, the 

biogenesis of autophagosomes has also been shown 

to involve SNAREs in yeast and mammalian cells 

(Moreau et al., 2011; Nair et al., 2011). Atg8 

proteins can also serve as a scaffold for recruiting 

proteins that may regulate events upstream and 

downstream of the formation of autophagosomes 

(Garcia-Marcos et al., 2011; Itoh et al., 2011; 

Mauvezin et al., 2010). Moreover, LC3 contributes 

to the selectivity shown by autophagy towards 

different cell structures, protein aggregates and 

microorganisms via the recognition of an LIR (LC3 

Interacting Region) on target proteins such as P62 

and NBR1 (Noda et al., 2008; Kraft et al., 2009; 

Weidberg et al., 2011b). 

After their formation, autophagosomes can merge 

with endocytic compartments (early and late 

endosomes, multivesicular bodies can merge with 

autophagosomes) before fusing with the lysosomal 

compartment (Liou et al., 1997; Razi et al., 2009; 

Stromhaug and Seglen, 1993). The term 

"amphisome" (from the Greek roots, amphi: both 

and soma: body) has been coined by Per O. Seglen 

(reviewed in Fengsrud et al., 2004) for the vacuole 

that results from the fusion of an autophagosome 

with an endosome. The late stage of autophagy 

depends on molecules that regulate the maturation 

of autophagosomes, including their fusion with 

endosomes and lysosomes, as well as on the 

acidification of the autophagic compartments, and 

the recycling of metabolites from the lysosomal 

compartment (Figure 1). These steps are of a 

fundamental importance for the flux (defined here 

as extending from the cargo sequestration step to 

that of its lysosomal degradation) of material 

through the autophagic pathway (Codogno and 

Meijer, 2005). Any blockade in the maturation of 

autophagosomes, fusion with the lysosomal 

compartment or impairment of the lysosomal 

function or biogenesis would result in an 

accumulation of autophagosomes that would 

inevitably slowdown or interrupt the autophagic 

flux (Eskelinen, 2005; Rubinsztein et al., 2009). 

Maturation and degradation of 

autophagosomes 

Rubicon and UVRAG. Rubicon and UVRAG (UV 

irradiation resistance associated gene) are two 

Beclin 1-binding proteins that regulate the 

maturation of autophagosomes and endocytic 

trafficking (Liang et al., 2006; Matsunaga et al., 

2009; Zhong et al., 2009). These findings suggest 

that the Beclin 1: hVps34: UVRAG: Rubicon 

complex down-regulates these trafficking events, 

whereas the Beclin 1: hVps34: UVRAG complex 

upregulates the maturation of autophagosomes and 

the endocytic trafficking (Matsunaga et al., 2009; 

Zhong et al., 2009). Therefore, Beclin 1 regulates 

both the formation of autophagosomes (via its 

interaction with Atg14L) and the maturation of 

autophagosomes (via its interaction with UVRAG 

and Rubicon). 

Rab proteins. Colombo and co-workers (Gutierrez 

et al., 2004), and Eskelinen and co-workers (Jager 

et al., 2004) have shown that Rab7 is required for 

autophagosome maturation. Autophagosome 

maturation is dependent on interactions with class 

C Vps proteins and UVRAG (Liang et al., 2008). 

This function of UVRAG is independent of its 

interaction with Beclin 1, and stimulates Rab7 

GTPase activity and the fusion of autophagosomes 

with late endosomes/lysosomes. Interestingly, 

Rab11 is required for the fusion of autophagosomes 

and multivesicular bodies (MVB) during starvationinduced 

autophagy in the erythroleukemic cell line 

K562 (Fader et al., 2008). These findings suggest 

that specific membrane-bound compartment fusion 

processes during the maturation of autophagosomes 

engage different sets of Rab proteins, and possibly 

associated cohort proteins. Other Rab proteins such 

as Rab22 and Rab24 have subcellular locations 

compatible with a role in autophagy (Egami et al., 

2005; Mesa et al., 2001; Olkkonen et al., 1993). 

ESCRT and Hrs. The endosomal sorting complex 

required for transport (ESCRT) mediates the 

biogenesis of MVB and the sorting of proteins in 

the endocytic pathway (Raiborg and Stenmark, 

2009). It has recently been demonstrated that the 

multisubunit complex ESCRT III is needed for 

autophagosomes to fuse with MVB and lysosomes 

to generate amphisomes and autolysosomes, 

respectively (Filimonenko et al., 2007; Lee et al., 

2007; Rusten et al., 2007). ESCRT III dysfunction 

associated with the autophagic pathway may have 

important implications in neurodegenerative 

diseases (such as frontotemporal dementia and 

amyotrophic lateral sclerosis) (Filimonenko et al., 

2007; Lee et al., 2007). The Hrs protein (hepatocyte 



growth factor-regulated tyrosine kinase substrate) 

plays a major role in endosomal sorting upstream of 

ESCRT complexes (Raiborg and Stenmark, 2009). 

Hrs contains a FYVE domain that binds specifically 

to PtdIns3P, and facilitates the maturation of 

autophagosomes (Tamai et al., 2007). This raises 

the intriguing possibility that PtdIns3P may be 

required for the formation of the autophagosome 

and its maturation. However, the role of ESCRT 

proteins in autophagy remains to be elucidated. It is 

impossible to rule out the possibility that these 

proteins could be involved in the closing of 

autophagosomes (reviewed in Rusten and 

Stenmark, 2009). 

SNAREs. Soluble N-ethylmaleimide-sensitive 

factor attachment protein receptors (SNAREs) are 

basic elements in intracellular membrane fusion 

(Gurkan et al., 2007; Rothman and Wieland, 1996). 

In yeast the vacuolar t-SNAREs Vam3 (Darsow et 

al., 1997) and Vti1 (Ishihara et al., 2001), are 

needed for complete fusion to occur between the 

autophagosome and the vacuole (the name given to 

the lysosome in yeast) in S. cerevisiae. The 

mammalian homologue of Vt1, Vti1b, may be 

involved in a late stage of autophagy, because the 

maturation of autophagic vacuoles is delayed in 

hepatocytes isolated from mice in which Vti1b has 

been deleted (Atlashkin et al., 2003). More recently, 

Colombo and colleagues (Fader et al., 2009) have 

reported that VAMP3 and VAMP7, two v- 

SNAREs, control the fusion between 

autophagosomes and MVB and fusion of 

amphisomes with lysosomes, respectively. 

Endo/lysosomal membrane proteins. LAMPs 

(Lysosomal associated membrane proteins) are a 

family of heavily-glycosylated, endo/lysosomal 

transmembrane proteins (Eskelinen et al., 2003). 

Autophagic degradation has been shown to be 

impaired in hepatocytes isolated from LAMP-2 

deficient mice (Tanaka et al., 2000). However, no 

defect in autophagy was observed in LAMP-2 

deficient mouse fibroblasts (Eskelinen et al., 2004). 

A blockade in the later stage of autophagy only 

occurs in fibroblasts that are deficient for both 

LAMP-1 and LAMP-2. The differences in the 

autophagic activity observed between hepatocytes 

and fibroblasts may be responsible for the cell typespecific 

effects of LAMP-1 and LAMP-2 depletion 

(Eskelinen, 2005). 

DRAM (Damage-regulated autophagy modulator) 

encodes a 238-amino acid protein which is 

conserved through evolution, but has no ortholog in 

yeast (Crighton et al., 2006). DRAM is a direct 

target of p53. The protein is a multispanning 

transmembrane protein present in the lysosome. 

DRAM may regulate late stages of autophagy, but 

surprisingly it also controls the formation of 

autophagosomes (Crighton et al., 2006). This 

suggests the possibility of a new paradigm in which 

feedback signals from the lysosomes control the 

early stages of autophagy. 

Microtubules. The destabilization of microtubules 

by either vinblastin (Høyvik et al., 1991) or 

nocodazole (Aplin et al., 1992) blocks the 

maturation of autophagosomes, whereas their 

stabilization by taxol increases the fusion between 

autophagic vacuoles and lysosomes (Yu and 

Marzella, 1986). More recent findings have 

confirmed the role of microtubules in the fusion 

with the acidic compartment (Jahreiss et al., 2008; 

Kochl et al., 2006; Webb et al., 2004). 

Autophagosomes move bidirectionally along 

microtubules. Their centripetal movement is 

dependent on the dynein motor (Kimura et al., 

2008; Ravikumar et al., 2005). Two types of fusion 

have been documented (Jahreiss et al., 2008): 1. 

Complete fusion of the autophagosome with the 

lysosome, 2. Transfer of material from the 

autophagosome to the lysosomal compartment 

following a kiss-and-run fusion process in which 

two separate vesicles are maintained. However, 

fusion with lysosomes can be microtubuleindependent 

during starvation-induced autophagy 

when autophagosomes are formed in the vicinity of 

lysosomes (Fass et al., 2006). 

Acidification and degradation 

ATPases. Vacuolar ATPases (v-ATPase) are 

ubiquitous, multi-subunit proteins located in the 

acidic compartment (Forgac, 2007). Inhibition of 

the activity of v-ATPase by bafilomycin A1 or 

concanamycin A blocks the lysosomal pumping of 

H+ and consequently inhibits lysosomal enzymes, 

which are active at low pH. It has been proposed 

that bafilomycin A1 blocks the late stages of 

autophagy by interfering with the fusion of 

autophagosomes with endosomes and lysosomes 

(Yamamoto et al., 1998) or preventing the 

lysosomal degradation of sequestered material 

(Fass et al., 2006; Mousavi et al., 2001). Overall, 

the resulting effect of the inhibition of v-ATPase is 

to interrupt the autophagic flux as determined by 

the lysosomal inhibition of autophagic cargo. 

Interestingly it has recently been demonstrated that 

a deficiency of vacuolar H+-ATPase homolog 

(VMA21), a chaperone that binds to the c" subunit 

of the v-ATPase in the ER and which is responsible 

for X-linked myopathy with excessive autophagy 

(XMEA), causes an accumulation of autophagic 

vacuoles and interrupts autophagy flux in striated 

muscle cells (Ramachandran et al., 2009). 

ATPases associated with various cellular activity 

proteins (AAA ATPases) are a family of proteins 

broadly engaged in intracellular membrane fusion 

(White and Lauring, 2007). N-ethylmaleimide 

sensitive factor (NSF) is an AAA ATPase, which 

binds to SNARE complexes and utilizes ATP 

hydrolysis to disassemble them, thus facilitating 

SNARE recycling. In yeast mutants lacking sec18 

(the yeast homolog of NSF), autophagosomes are 



formed, but dot not fuse with the vacuole (Ishihara 

et al., 2001). However, we do not know whether the 

ATPase activity of NSF plays a role in the later 

stages of autophagy in mammalian cells. 

Nevertheless the activity of NSF is attenuated 

during starvation, which provides a possible 

explanation for the slow fusion between 

autophagosomes and lysosomes observed when 

autophagy is induced by starvation (Fass et al., 

2006). Suppressor of K+ transport growth defect 1 

(SKD1-Vps4), another AAA ATPase protein, is 

required for the maturation of autophagosomes 

(Nara et al., 2002) in mammalian cells. Vps4 

controls the assembly of ESCRT complexes on the 

multivesicular membrane, and is involved in 

autophagosome maturation (Rusten et al., 2007) in 

Drosophila, and autophagosome fusion with the 

vacuole in yeast (Shirahama et al., 1997). 

Degradation and lysosomal efflux. By virtue of 

lysosomal degradation autophagy contributes to 

regulating the metabolism of carbohydrates, lipids 

and proteins (Kotoulas et al., 2006; Kovsan et al., 

2009; Mortimore and Pösö, 1987). Like 

acidification defects in the endo/lysosomal 

compartment, defects in the transport or the 

expression of lysosomal enzymes induce a blockade 

of autophagy, which is characterized by an 

accumulation of autophagic vacuoles (Koike et al., 

2005; Yogalingam and Pendergast, 2008). The final 

stage of autophagy is the efflux of metabolites 

generated by the lysosomal degradation of 

macromolecules into the cytosol (reviewed in 

Lloyd, 1996). Atg22 has recently been identified as 

a permease that recycles amino acids from the 

vacuole in S. cerevisiae (Yang et al., 2006). 

Cytoplasmic and nuclear 

regulation of mammalian 

autophagy 

Several recent reviews have been dedicated to the 

regulation of autophagy by signaling pathways 

(Codogno and Meijer, 2005; He and Klionsky, 

2009; Meijer and Codogno, 2009). In this section 

we would like to focus on signaling pathways with 

identified targets in the molecular machinery of 

autophagosome formation. We will also discuss the 

role of signaling pathways and transcription factors 

in the regulation of the expression of genes 

involved in controlling autophagy. 

Cytoplasmic regulation 

mTORC1 and mTORC2. Many signals, including 

growth factors, amino acids, glucose, and energy 

status, are integrated by the kinase mTOR (Kim et 

al., 2002). The induction of autophagy by the 

inhibition of TOR under conditions of starvation is 

conserved from yeast to mammals (Blommaart et 

al., 1995; Noda and Ohsumi, 1998). The mTOR 

pathway involves two functional complexes: 

mTORC1 and mTORC2. Both these complexes are 

involved in the regulation of autophagy (Fig. 2). 

mTORC1, the rapamycin-sensitive mTOR complex 

1, contains the mTOR catalytic subunit, raptor 

(regulatory associated protein of mTOR, a protein 

that acts as a scaffold for the mTOR-mediated 

phosphorylation of mTOR substrates), GbL and 

PRAS40 (proline-rich Akt substrate of 40 kDa). 

The binding of FKBP12 to mTOR inhibits the 

mTOR-raptor interaction, suggesting a mechanism 

for rapamycin-specific inhibition of mTOR 

signaling (Oshiro et al., 2004). This mTOR-raptor 

interaction, and its regulation by nutrients and/or 

rapamycin are dependent on GbL (Kim et al., 

2003). A major unanswered question about the 

stimulation of autophagy during starvation is how 

amino acids signal to mTOR (Meijer and 

Dubbelhuis, 2004). It has been suggested that 

hVps34 may have a role in the amino acid signaling 

to mTORC1 (Byfield et al., 2005; Nobukuni et al., 

2005). Thus it appears that hVps34 acts both as a 

down-regulator of autophagy (acting as an amino 

acid sensor) and as an up-regulator (because it is a 

component of Beclin 1 complexes) of autophagy. 

However, recent observations in Drosophila and 

mammalian cells suggest that Rag GTPases (Rasrelated 

small GTPases) activate TORC1 in response 

to amino acids by promoting its redistribution to a 

specific subcellular compartment, which contains 

the TORC1 activator Rheb (Ras homolog enriched 

in brain, a GTP-binding protein) (Kim et al., 2008a; 

Sancak et al., 2008). Moreover, the rate-limiting 

factor that enables essential amino acids to inhibit 

mTORC1 has been identified as L-glutamine 

(Nicklin et al., 2009). L-glutamine uptake is 

regulated by solute carrier family 1, member 5 

(SLC1A5). Loss of SLC1A5 function activates 

autophagy, and inhibits cell growth. Thus, Lglutamine 

sensitivity is attributable to 

SLC7A5/SLC3A2, a bidirectional transporter that 

regulates the simultaneous efflux of L-glutamine 

out of cells and the transportation of Lleucine/essential 

amino acids into cells (Nicklin et 

al., 2009). 

The other mTOR complex, mTORC2, which is less 

sensitive to rapamycin, includes mTOR, rictor 

(rapamycin-insensitive companion of mTOR), GbL, 

SIN1 (SAPK-interacting protein 1) and PROTOR 

(protein observed with rictor) (Sarbassov et al., 

2006). The mTORC2 complex phosphorylates the 

Ser 473 of Akt/PKB, thereby contributing to the 

activation of this important cell-survival kinase 

(Sarbassov et al., 2006). Phosphorylated Akt/PKB 

down-regulates the activity of the transcriptional 

factor Forkhead Box O3 (FoxO3). Interestingly, 

FoxO3 has been shown to stimulate autophagy in 

muscle cells by increasing the transcription of 

several genes involved in autophagy (see below) 

(Mammucari et al., 2007). 

Signaling segments acting upstream of mTORC1 

and mTORC2 that regulate autophagy have been 



discussed in recent reviews that the reader can 

consult for more information (Codogno and Meijer, 

2005; Meijer and Codogno, 2009). 

mTORC1 substrates and the regulation of 

autophagy. As discussed above,ULK1, Atg13 and 

FIP200 form a stable complex that signals to the 

autophagic machinery downstream of mTORC1. 

Importantly, mTORC1 is incorporated into the 

ULK1:Atg13:FIP200 complex via ULK1 in a 

nutrient-dependent manner. mTOR phosphorylates 

both ULK1 and Atg13. Under starvation conditions 

or in response to rapamycin treatment, mTORC1 

dissociates from the ULK1 complex, resulting in 

the activation of ULK1. Activated ULK1 

autophosphorylates, and also phosphorylates both 

Atg13 and FIP200 to initiate autophagy (Hosokawa 

et al., 2009). The location of phosphorylation sites, 

as well as the role played by other members of the 

ULK family, ULK2 and ULK3, remain to be 

determined. Once activated, mTORC1 favors cell 

growth by promoting translation via the 

phosphorylation of 70 kDa, polypeptide 1 

ribosomal protein S6 kinase-1 (p70S6K), and 

phosphorylation of the inhibitor of translation 

initiation, 4E-BP1. Interestingly, Neufeld and 

coworkers showed that p70S6K is up-regulated 

during starvation-induced autophagy in the 

Drosophila fat body (Scott et al., 2004). 

Mammalian cells probably have a regulatory 

feedback pathway involving S6K that regulates 

autophagy (Klionsky et al., 2005). p70S6K is 

known to phosphorylate and inhibit IRS1 

downstream of the insulin receptor (reviewed in 

Meijer and Codogno, 2009). This loop could 

provide a way to regulate the activity of mTORC1 

during starvation-induced autophagy. 

AMP-activated kinase (AMPK). Apart of being a 

sensor, mTOR can also sense changes in the 

cellular energy via AMPK. Activation of AMPK 

inhibits mTOR-dependent signaling, by interfering 

the activity of the GTPase Rheb, and protein 

synthesis (Meijer and Codogno, 2004). This is 

consistent with the switch off of ATP-dependent 

processes (Hardie, 2004) during period of energy 

crisis. In starved cells when AMP/ATP ratio 

increases, the binding of AMP to AMPK favors its 

activation by the AMPK kinase LKB1 (Corradetti 

et al., 2004; Shaw et al., 2004). Moreover, 

Ca 2+ /calmodulin-dependent kinase kinase b 

(CaMKK-b) has been identified to be an AMPK 

kinase (Hawley et al., 2005; Woods et al., 2005). 

The activity of AMPK is required to induce 

autophagy in response to starvation in mammalian 

cells (Meley et al., 2006) and in yeast (Wang et al., 

2001) in a TORC1-dependent manner. Moreover, 

induction autophagy is also dependent on the 

inhibition of mTORC1 by AMPK in non-starved 

cells in response to an increase in free cytosolic 

Ca 2+ (Høyer-Hansen et al., 2007). In this setting, the 

activation of AMPK and stimulation of autophagy 

are dependent on CaMKK-b. Induction of 

autophagy through the activation of AMPK is 

probably extended to other settings such as hypoxia 

(Degenhardt et al., 2006; Laderoute et al., 2006). 

AMPK is probably a general regulator of autophagy 

upstream of mTOR (Høyer-Hansen and Jaattela, 

2007; Meijer and Codogno, 2007). Another 

potential candidate of autophagy regulation 

downstream of AMPK is the Elongation factor-2 

kinase (eEF-2 kinase) that controls the rate of 

peptide elongation (Hait et al., 2006). Activation of 

eEF-2 kinase increases autophagy while slowing 

down protein translation (Wu et al., 2006). The 

activity of eEF-2 kinase is regulated by mTOR, 

S6K and AMPK (Browne et al., 2004; Browne and 

Proud, 2002). During periods of ATP depletion, 

AMPK is activated and eEF-2 kinase is 

phosphorylated (Browne et al., 2004) making a 

balance between inhibition of peptide elongation 

and induction of autophagy. How eEF-2 kinase 

impinges on the molecular machinery of autophagy 

remains to be investigated. Moreover, autophagy is 

activated by AMPK in a p53-dependent manner 

(Feng et al., 2005). But the cytoplasmic form of p53 

has been shown to have an inhibitory effect on 

autophagy (Tasdemir et al., 2008). 

Finally, AMPK also triggers the initiation of 

autophagosome formation by phosphorylating 

ULK1 (Egan et al., 2011; Kim et al., 2011) (Figure 

2). 

Beclin 1:hVps34 complexes. As discussed in the 

preceding sections, the trimer Beclin 

1:hVps34:hVps15 can interact with various 

different partners to control the formation and the 

maturation of autophagosomes. Recently, the antiapoptotic 

protein Bcl-2, and anti-apoptotic 

members of the Bcl-2 family such as Bcl-XL were 

shown to inhibit autophagy (Erlich et al., 2007; 

Maiuri et al., 2007; Pattingre et al., 2005). Bcl- 

2/Bcl-XL binds Beclin 1 through a BH3 domain that 

mediates the docking of the latter to the BH3binding 

groove. The constitutive Bcl-2/Bcl- 

XL:Beclin 1 interaction is disrupted by signals that 

promote autophagy. Importantly, c-Jun N-terminal 

kinase 1 (JNK-1) phosphorylates 3 amino acids in 

the N-terminal loop of Bcl-2 to trigger its release 

from Beclin 1 (Wei et al., 2008) in response to 

starvation or ceramide treatment (Pattingre et al., 

2009; Wei et al., 2008). In a reciprocal manner, the 

BH3 domain of Beclin 1 can be phosphorylated by 

death-associated protein kinase (DAPk), which has 

the effect of reducing its affinity for Bcl-XL 

(Zalckvar et al., 2009). A second mechanism that 

leads to the dissociation of the complex involves 

the competitive displacement of BH3-domain 

Beclin 1 from Bcl-2/Bcl-XL by other BH3containing 

proteins with proapoptotic properties 

such BH3-only member of the Bcl-2 family (BAD), 

the pro-apoptotic member of the Bcl-2 family, Bax- 

, and BH3-mimetics (Luo and Rubinsztein, 2010; 



Maiuri et al., 2007). The role of the hypoxiainducible 

BH3-only proteins BNIP3 and BNIP3L in 

the dissociation of the Beclin 1:Bcl-2 complex will 

be discussed in the next section. Overall these 

findings point to the central role of Beclin1:hVps34 

complexes in the cross-talk between autophagy and 

apoptosis. Interestingly, a recent study reports that 

the anti-apoptotic protein FLIP, which blocks the 

activation of caspase 8 downstream of death 

receptors, is also an anti-autophagy molecule by 

blocking the formation of LC3-II via its interaction 

with Atg3 (Lee et al., 2009) (Figure 2). 

Inositol 1,4,5-trisphosphate (IP3) receptor. 

Autophagy can also be induced via an mTORindependent 

pathway by lowering myo-inositol 

1,4,5-trisphosphate (IP3) levels (Sarkar et al., 2005). 

This effect can be achieved pharmacologically with 

drugs such as lithium or L-690 330, which disrupt 

the metabolism of inositol by inhibiting inositol 

monophosphatase (IMP). Rubinsztein and 

coworkers found that L-type Ca2+ channel 

antagonists, the K+ATP channel opener, and Gi 

signaling activators all induce autophagy (Williams 

et al., 2008). These drugs reveal a cyclical mTORindependent 

pathway regulating autophagy, in 

which cAMP regulates IP3 levels, influencing 

calpain activity, which completes the cycle by 

cleaving and activating Gs alpha, which regulates 

cAMP levels. These data also suggest that insults 

that elevate intracytosolic Ca2+ (such as 

excitotoxicity) inhibit autophagy, thus retarding the 

clearance of aggregate-prone proteins. Both genetic 

and pharmacological inhibition of the IP3 receptor 

(IP3R) strongly stimulate autophagy. Kroemer and 

coworkers have shown that the IP3R antagonist 

xestospongin B induces autophagy by disrupting a 

molecular complex formed between the IP3R and 

Beclin 1, an interaction that is regulated by Bcl-2 

(Vicencio et al., 2009). The IP3R is known to be 

located in the membranes of the ER as well as in 

ER-mitochondrial contact sites, and IP3R blockade 

triggers the autophagy of both ER and 

mitochondria, as observed in starvation-induced 

autophagy. ER stressors, such as tunicamycin and 

thapsigargin, also induce autophagy of the ER and, 

to a lesser extent, of mitochondria. Autophagy 

triggered by starvation or IP3R blockade is inhibited 

by Bcl-2, and Bcl-XL located at the ER, but not at 

the mitochondrial outer membrane (Pattingre et al., 

2005; Vicencio et al., 2009). In contrast, ER stressinduced 

autophagy is not inhibited by Bcl-2 or Bcl- 

XL. Autophagy promoted by IP3R inhibition cannot 

be attributed to a modulation of steady-state Ca2+ 

levels in the ER or in the cytosol (Vicencio et al., 

2009). 

Other cytoplasmic autophagy regulation 

mechanisms. The function of Atg proteins in 

autophagy can be regulated not only by proteinprotein 

interactions and phosphorylation, but also 

by oxidation, acetylation, and proteolytic cleavage. 

Elazar and colleagues (Scherz-Shouval et al., 2007) 

have reported that the oxidation of a cysteine 

residue near the catalytic site of Atg4A and Atg4B 

is required during starvation-induced autophagy. 

During starvation, the deacetylation of Atg5, Atg7, 

LC3 and Atg12 is important to stimulate autophagy. 

The acetylation is dependent on the activity of p300 

(Lee and Finkel, 2009), and the deacetylation is 

probably under the control of the histone 

deacetylase sirtuin 1 (Lee et al., 2008). Atg5, Atg7 

and Beclin 1 are substrates for calpains (Kim et al., 

2008b; Xia et al., 2010; Yousefi et al., 2006), and 

Atg4D and Beclin 1 are substrates for caspases 

(Betin and Lane, 2009; Cho et al., 2009; Luo and 

Rubinsztein, 2010). The cleavage of Beclin 1 by 

caspase 3, and that of Atg5 by calpain 1 inhibit 

autophagy (Luo and Rubinsztein, 2010; Xia et al., 

2010). The cleavage of Atg proteins by caspases 

and calpains has been proposed as a possible 

additional mechanism modulating autophagy. 

Interestingly, the truncated form of Atg5 generated 

by calpain 1 cleavage is translocated into the 

mitochondria and induces apoptosis (Yousefi et al., 

2006). 

Nuclear regulation of autophagy 

JNK/c-Jun. The sphingolipid ceramides have been 

shown to increase the expression of Beclin 1 in 

human cancer cell lines (Scarlatti et al., 2004). In 

cancer cell lines exposed to ceramide, Li et al. have 

observed activation of JNK and increased 

phosphorylation of c-Jun (Li et al., 2009). They 

also showed that c-Jun controls the transcription of 

Becn1 (we have adopted this nomenclature for the 

gene encoding Beclin 1), and the induction of 

autophagic cell death in response to ceramide. 

Activation of JNK, resulting in the upregulation of 

Beclin 1 expression, has also been reported in the 

autophagic cell death of human colon cancer cells 

induced by the stimulation of the human death 

receptor 5 (Park et al., 2009). 

NF-κB. The NF-κB transcription factor, which 

plays a plethoric role in inflammation, immunity 

and cancer (Karin, 2006), has also been implicated 

in regulating autophagy. A conserved NF-κB 

binding site has recently been unveiled in the 

promoter of the murine and human gene that 

encodes Beclin 1 (Copetti et al., 2009). The authors 

have shown that p65/RelA, a member of the NF-κB 

family, upregulates the expression of Beclin 1 and 

stimulates autophagy in several cellular systems. 

Autophagy stimulation has also been observed after 

the activation of NF-κB during the heat shock 

response (Nivon et al., 2009). However, in contrast 

to this stimulatory role of NF-κB in the regulation 

of autophagy, the inhibition of NF-κB favors 

TNFα-dependent and starvation-dependent 

autophagy (Djavaheri-Mergny et al., 2006; Fabre et 

al., 2007). Moreover, Schlottmann et al. reported 

that activation of NF-κB prevents autophagy in 



macrophages by downregulating the expression of 

Atg5 and Beclin 1 (Schlottmann et al., 2008). 

E2F1. E2F transcription factors are known to be 

involved in cellular proliferation, but also in DNA 

repair, differentiation and development (DeGregori 

and Johnson, 2006). E2F1 has been shown to bind 

to the promoter of Becn1, although an effect of 

E2F1 on Beclin 1 expression remains to be 

demonstrated (Weinmann et al., 2001). More 

recently, the activation of E2F1 has been shown to 

induce autophagy by upregulating the expression of 

the autophagy genes Map1lc3, Ulk1, Atg5 and 

Dram (we have adopted the nomenclature Map1lc3 

for the gene encoding LC3) (Polager et al., 2008). 

The E2F1-mediated induction of Map1lc3, Ulk1 

and Dram is direct (interaction with the promoter), 

whereas the up-regulation of the expression of Atg5 

is indirect. 

HIF-1. HIF-1 (hypoxia-inducible factor-1) is a 

transcription factor, which regulates the 

transcription of hundred of genes in response to 

hypoxia (Manalo et al., 2005). Recently Zhang et al 

have demonstrated that hypoxia-induced 

mitochondrial autophagy via HIF-1 mediated 

induction of Bnip3 (Zhang et al., 2008). In a similar 

way, Bellot et al. have shown that hypoxia-induced 

autophagy is mediated by HIF-1, which induces the 

expression of BNIP3 and BNIP3L (Bellot et al., 

2009). BNIP3 and BNIP3L play important roles in 

the induction of autophagy by disrupting the 

interaction of Beclin 1 with Bcl-2 via their BH3 

domain. HIF-1 could also regulate the expression of 

Beclin 1 and Atg5, probably indirectly although 

according to a recent report the silencing of HIF-1 

in cultured chondrocytes was associated with a 

reduced level of Beclin 1 (Bohensky et al., 2007). 

FoxO proteins. Three members of the FoxO family 

of transcription factors, FoxO1, FoxO3, and FoxO4 

are regulated by Akt phosphorylation in response to 

growth factor and insulin stimulation. FoxO 

proteins are phosphorylated by Akt, which renders 

them inactive in the presence of growth factors. 

When Akt is repressed, FoxO proteins are 

translocated into the nucleus, bind to DNA, and 

transactivate its target genes (Salih and Brunet, 

2008). Several studies of protein degradation during 

muscle atrophy show that FoxO3 can induce the 

expression of multiple autophagy genes, including 

Map1lc3, Atg12, Becn1, Atg4b, Ulk1, Pik3c3 (we 

have adopted the nomenclature Pik3c3 for the gene 

encoding hVps34), Bnip3/Bnip3l, and Gabarapl1 

(Mammucari et al., 2007; Zhao et al., 2007), and 

then upregulates autophagy. FoxO3 can bind 

directly to the promoter region of some of these 

genes, such as Map1lc3, Atg12, Gabarapl1 and 

Bnip3/Bnip3l. Expression of a constitutive form of 

FoxO3 induces autophagy in adult mouse skeletal 

muscle. Recently another member of the FoxO 

protein family, FoxO1, has been shown to regulate 

the expression of key autophagy genes, Pik3c3, 

Atg12, and Gabarapl1 in hepatocytes in an insulindependent 

manner (Liu et al., 2009). 

p53. p53 is a pivotal factor involved in regulating 

cell death and survival, and in regulating 

metabolism (Vousden and Prives, 2009). When p53 

is activated by cellular stress, p53 accumulates in 

the cell nucleus, where it transactivates several 

autophagy-modulating genes including Dram 

(damage-regulated autophagy modulator) and Tigar 

(TP53-induced glycolysis and apoptosis regulator). 

DRAM stimulates the accumulation of 

autophagosomes, probably by regulating 

autophagosome-lysosome fusion to generate 

autophagolysosomes (Crighton et al., 2006). 

TIGAR, through its fructose 2, 6-bisphosphatase 

function, can modulate the glycolytic pathway and 

indirectly contribute to the fall in the intracellular 

level of ROS (Bensaad et al., 2006). Recently, the 

same group showed that TIGAR can also modulate 

the intracellular ROS level in response to nutrient 

starvation or metabolic stress, and consequently 

inhibit autophagy via an mTOR-independent 

pathway (Bensaad et al., 2009). So, while DRAM 

and TIGAR are both transactivated by p53, DRAM 

promotes autophagy whereas TIGAR inhibits 

autophagy. The complexity of the autophagic 

response to p53 is further increased by the ability of 

cytoplasmic p53 to limit autophagy (Tasdemir et 

al., 2008). 

Transcription factor EB (TFEB). Recently the 

bHLH-leucine zipper transcription factor TFEB has 

been shown to control lysosomal biogenesis and 

function. TFEB is a master gene in the gene 

regulatory network CLEAR (CLEAR: Coordinated 

Lysosomal Enhancement And Regulation) that 

binds to CLEAR target sites in the promoter of 

lysosomal genes and increases lysosomal 

biogenesis (Sardiello et al., 2009). TFEB not only 

controls the expression of lysosomal proteins, it 

also regulates the autophagy transcription program 

during starvation (Settembre et al., 2011). TFEB is 

retained in the cytosol because it phosphorylates 

MAP kinase (ERK2). The reduction of TFEB 

phosphorylation during starvation triggers its 

nuclear transport where it activates a transcription 

program that activates the biogensesis of lysosomes 

and stimulates autophagy. TFEB has a broad range 

of activities, because it controls the activity of 

genes involved in various different steps of 

autophagy, including autophagosome formation 

(Map1lc3, Wipi), cargo recognition (Sqstm1,) and 

autophagosome fusion with the lysosomal 

compartment (Uvrag, Vps11, Vps18). The fact that 

autophagy and lysosomal formation are both 

coordinated by TFEB offers a possible therapeutic 

target that could be used to boost the autophagic 

pathway when appropriate. 

Other regulators of Atg genes expression. 

Recently the phosphorylation of eIF2α by PERK 

has been shown to be essential for the conversion of 



LC3-I to LC3-II during ER-stress induced by the 

polyQ72 or dysferlin L1341P mutant (Fujita et al., 

2007; Kouroku et al., 2007). In polyQ72 loaded 

mammalian cells, the phosphorylation of eIF2α 

upregulates the expression of Atg12 (Kouroku et 

al., 2007). During the unfolded protein response, 

triggered by hypoxia, the transcription factors 

ATF4 and CHOP, which are regulated by PERK, 

increase the expression Map1lc3b and Atg5, 

respectively (Rouschop et al., 2010). 

Glyceraldehyde-3-phosphate dehydrogenase 

(GAPDH), a multifunctional enzyme known to play 

a role in glycolysis as well as having other less 

well-understood roles such as transcriptional 

coactivation, has also been shown to upregulate the 

transcription of Atg12 to protect cells against 

caspase-independent cell death (Colell et al., 2007). 

Beclin 1 is one of the essential components 

involved in autophagosome formation, and its level 

usually increases during autophagy. For example, in 

HBV (hepatitis B virus)-infected hepatocytes, the 

HBV x protein increases autophagy by upregulating 

the expression of Beclin 1 (Tang et al., 2009). In 

human monocytes and human myeloid leukemia 

cells, vitamin D3 has been shown to induce 

autophagy by upregulating both Beclin 1 and Atg5 

(Wang et al., 2008; Yuk et al., 2009). The 

transcription factor implicated has not been 

identified, but it has been shown that in human 

monocytes the effect of Vitamin D3 is mediated via 

cathelicidin. 

Very recently, Zhu et al. (Zhu et al., 2009) observed 

for the first time the regulation of autophagy by 

miRNA. They showed that miR-30a targets Beclin 

1 mRNA, and down-regulates the expression of 

Beclin 1. 

Autophagy in physiology 

Autophagosome formation occurs at a basal rate in 

most cells and controls the quality of the cytoplasm 

by initiating the elimination of protein aggregates 

and of damaged organelles (Ravikumar et al., 

2010b) (Figure 3). This autophagy-dependent 

quality control is also important to limit the 

production of ROS. 

Stimulation of autophagy during periods of 

starvation is an evolutionarily-conserved response 

to stress in eukaryotes (Yang and Klionsky, 2010). 

Under starvation conditions, the degradation of 

proteins and lipids allows the cell to adapt its 

metabolism and meet its energy needs (Figure 3). 

Figure 3. Physiological and pathological roles of autophagy. The physiological role of basal autophagy is to clean the 

cytoplasm of damaged organelles and protein aggregates. This function is essential for cell fitness by limiting the accumulation of 

ROS. The stimulation of autophagy during periods of starvation plays a major role in many tissues, but with some exceptions, 

such as the brain, in providing nutrients for cell metabolism, for the biosynthesis of macromolecules, and to maintain the level of 

ATP. Autophagy is involved in an early stage of development (pre-implantation of the fertilized oocyte), and differentiation. 

Autophagy declines during aging, and the restoration of autophagy extends life span in various species. Autophagy contributes 

to both innate and adaptive immunity. Defective autophagy is observed in many human diseases, and its stimulation is beneficial 

in most cases. Autophagy plays a more complex role in cancer, because it can be a tumor suppressor mechanism, but can also 

become a cytoprotective mechanism in tumors, where it contributes to cell survival in a context of metabolic stress and in 

response to cancer treatments. 



The stimulation of autophagy plays a major role at 

birth to maintain energy levels in various tissues 

after the maternal nutrient supply via the placenta 

ceases (Kuma et al., 2004). Moreover, starvationinduced 

autophagy is cytoprotective by blocking 

the induction of apoptosis upstream of 

mitochondrial events (Boya et al., 2005). 

Autophagy is essential during development and 

differentiation. The pre-implantation period after 

oocyte fertilization is dependent on autophagic 

degradation of components of the oocyte cytoplasm 

(Tsukamoto et al., 2008). Autophagy remodeling of 

the cytoplasm is involved during the differentiation 

of erythrocytes, lymphocytes and adipocytes 

(Ravikumar et al., 2010b). Autophagy is crucial for 

the homeostasis of immune cells, and contributes to 

the regulation of self-tolerance (Nedjic et al., 2008). 

The pioneering work of Bergamini and colleagues 

in the field of autophagy (Yang and Klionsky, 

2010) suggested that its stimulation during calorie 

restriction may contribute to extending lifespan in 

the rat. Recent data have shown that the induction 

of autophagy increases longevity in a large panel of 

species (Eisenberg et al., 2009). The antiaging 

effect of autophagy probably depends, at least in 

part, on its quality control function that limits the 

accumulation of aggregation-prone protein and 

damaged mitochondria. Calorie restriction 

stimulates autophagy via the activation of the 

deacetylase sirtuin-1 (Morselli et al., 2010). Targets 

of sirtuin-1 include Atg proteins 5, 7 and 8. In 

several cell lines, deacetylation of these Atg 

proteins is necessary for autophagy to be stimulated 

by nutrient deprivation (Lee et al., 2008). It would 

be interesting to investigate whether this regulation 

of autophagy is conserved in tissues that 

preferentially use fatty acids as oxidizable 

substrates during starvation, where a high level of 

acetyl-CoA is to be expected. 

Autophagy and pathology 

As mentioned above, basal autophagy is important 

as a housekeeping process to prevent the deposition 

of aggregation-prone proteins in the cytoplasm 

(Figure 3). Several neurodegenerative diseases, 

including Huntington's, Alzheimer's and 

Parkinson's diseases, are characterized by the 

accumulation of such protein aggregates in the 

brain (Ravikumar et al., 2010b). As a protective 

measure, the stimulation of autophagy limits the 

accumulation of toxic products and protects 

neurons against degeneration. The important 

pathological role of autophagy in aggregation-prone 

protein disease is strengthened by a recent study 

showing that a drug that enhances autophagy 

promotes the degradation of mutant, aggregationprone 

α1-antitrypsin in the liver, and consequently 

reduces hepatic fibrosis (Hidvegi et al., 2010). 

Autophagy is involved in the clearance of 

aggregation-prone proteins in muscle diseases, 

including limb girdle muscular dystrophy type 2B, 

Miyoshi myopathy, and sporadic inclusion body 

myositis. Blockade of the autophagic pathway leads 

to the cardiomyopathy and myopathy of Danon 

disease (Ravikumar et al., 2010b). Autophagy is 

also involved in muscle atrophy but it is unclear 

whether autophagy has a beneficial effect by 

promoting survival during catabolic conditions, or a 

detrimental effect by causing atrophy. In the heart, 

basal autophagy is necessary to maintain cellular 

homeostasis and is upregulated in response to stress 

in hypertensive heart disease, heart failure, cardiac 

hypertrophy, and ischemia-reperfusion (Nakai et 

al., 2007). 

In the pancreas, autophagy is required to maintain 

the architecture and function of pancreatic β-cells 

(Ebato et al., 2008). Defective hepatic autophagy 

probably makes a major contribution to insulin 

resistance and to predisposition to type-2 diabetes 

and obesity (Yang et al., 2010). 

In infectious diseases, autophagy is involved in the 

elimination of intracellular pathogens (bacteria, 

viruses and parasites), and thus contributes to the 

innate immunity (Levine and Deretic, 2007; Virgin 

and Levine, 2009). Autophagy acts as an effector of 

Toll-like receptor (TLR) signaling. TLR ligands 

induce autophagy to promote the delivery of 

infecting pathogens to the lysosomes (Levine and 

Deretic, 2007). Autophagy contributes to adaptive 

immunity by generating antigenic peptides that are 

exposed on the cell surface in association with 

MHCAtg16L1 class II for presentation to CD4positive 

T cells, or by promoting the development 

and survival of B and T cells (Paludan et al., 2005; 

Pua et al., 2007). Recently polymorphisms of the 

genes that encode and IRGM, two autophagy genes 

essential for the elimination of intracellular 

pathogens, have been associated with Croh's 

disease, a chronic inflammatory bowel disease 

(Virgin and Levine, 2009). 

Cancer is frequently associated with defects in 

autophagy, but the role of autophagy in cancer is 

clearly complex, because autophagy is also required 

in the later stages of tumor progression to enable 

tumor cells to cope with metabolic stress (caused by 

limited supplies of oxygen and nutrients) (Levine, 

2007). The link between autophagy and cancer is 

further strengthened by the fact that several of the 

proteins involved in regulating autophagy are 

known to be tumor suppressor genes or 

oncoproteins (Morselli et al., 2009). Several of the 

functions of autophagy, such as the elimination of 

defective organelles, which reduces oxidative stress 

and prevents DNA damage, also contribute to its 

tumor suppressor role (Mathew et al., 2009; 

Mathew et al., 2007). Remarkably, autophagy 

facilitates effective glucose uptake and glycolytic 

flux in Ras-transformed cells (Lock et al., 2011). 

Moreover, the loss of autophagy in Rastransformed 

cells is associated with reduced oxygen 

consumption and lower levels of the tricarboxylic 



acid (TCA) intermediate (Guo et al., 2011). The 

high basal level of autophagy observed in tumors 

with Ras mutation is required for cancer cell 

survival (Yang et al., 2011). In these tumors, 

autophagy certainly constitutes an Achilles heel that 

could be used in the fight against cancer. More 

generally, inhibiting autophagy is a challenging 

concept; because in many tumors autophagy is a 

stress response to anti-cancer treatments (Kondo et 

al., 2005). 

References 

Yu QC, Marzella L. Modification of lysosomal proteolysis in 

mouse liver with taxol. Am J Pathol. 1986 Mar;122(3):553- 

61 

Mortimore GE, Pösö AR. Intracellular protein catabolism 

and its control during nutrient deprivation and supply. Annu 

Rev Nutr. 1987;7:539-64 

Høyvik H, Gordon PB, Berg TO, Strømhaug PE, Seglen 

PO. Inhibition of autophagic-lysosomal delivery and 

autophagic lactolysis by asparagine. J Cell Biol. 1991 

Jun;113(6):1305-12 

Aplin A, Jasionowski T, Tuttle DL, Lenk SE, Dunn WA Jr. 

Cytoskeletal elements are required for the formation and 

maturation of autophagic vacuoles. J Cell Physiol. 1992 

Sep;152(3):458-66 

Olkkonen VM, Dupree P, Killisch I, Lütcke A, Zerial M, 

Simons K. Molecular cloning and subcellular localization of 

three GTP-binding proteins of the rab subfamily. J Cell Sci. 

1993 Dec;106 ( Pt 4):1249-61 

Strømhaug PE, Seglen PO. Evidence for acidity of 

prelysosomal autophagic/endocytic vacuoles 

(amphisomes). Biochem J. 1993 Apr 1;291 ( Pt 1):115-21 

Blommaart EF, Luiken JJ, Blommaart PJ, van Woerkom 

GM, Meijer AJ. Phosphorylation of ribosomal protein S6 is 

inhibitory for autophagy in isolated rat hepatocytes. J Biol 

Chem. 1995 Feb 3;270(5):2320-6 

Lloyd JB. Metabolite efflux and influx across the lysosome 

membrane. Subcell Biochem. 1996;27:361-86 

Rothman JE, Wieland FT. Protein sorting by transport 

vesicles. Science. 1996 Apr 12;272(5259):227-34 

Darsow T, Rieder SE, Emr SD. A multispecificity syntaxin 

homologue, Vam3p, essential for autophagic and 

biosynthetic protein transport to the vacuole. J Cell Biol. 

1997 Aug 11;138(3):517-29 

Liou W, Geuze HJ, Geelen MJ, Slot JW. The autophagic 

and endocytic pathways converge at the nascent 

autophagic vacuoles. J Cell Biol. 1997 Jan 13;136(1):61- 

70 

Shirahama K, Noda T, Ohsumi Y. Mutational analysis of 

Csc1/Vps4p: involvement of endosome in regulation of 

autophagy in yeast. Cell Struct Funct. 1997 Oct;22(5):501- 

9 

Noda T, Ohsumi Y. Tor, a phosphatidylinositol kinase 

homologue, controls autophagy in yeast. J Biol Chem. 

1998 Feb 13;273(7):3963-6 

Yamamoto A, Tagawa Y, Yoshimori T, Moriyama Y, 

Masaki R, Tashiro Y. Bafilomycin A1 prevents maturation 

of autophagic vacuoles by inhibiting fusion between 

autophagosomes and lysosomes in rat hepatoma cell line, 

H-4-II-E cells. Cell Struct Funct. 1998 Feb;23(1):33-42 

Ciechanover A, Orian A, Schwartz AL. Ubiquitin-mediated 

proteolysis: biological regulation via destruction. 

Bioessays. 2000 May;22(5):442-51 

Tanaka Y, Guhde G, Suter A, Eskelinen EL, Hartmann D, 

Lüllmann-Rauch R, Janssen PM, Blanz J, von Figura K, 

Saftig P. Accumulation of autophagic vacuoles and 

cardiomyopathy in LAMP-2-deficient mice. Nature. 2000 

Aug 24;406(6798):902-6 

Ishihara N, Hamasaki M, Yokota S, Suzuki K, Kamada Y, 

Kihara A, Yoshimori T, Noda T, Ohsumi Y. 

Autophagosome requires specific early Sec proteins for its 

formation and NSF/SNARE for vacuolar fusion. Mol Biol 

Cell. 2001 Nov;12(11):3690-702 

Mesa R, Salomón C, Roggero M, Stahl PD, Mayorga LS. 

Rab22a affects the morphology and function of the 

endocytic pathway. J Cell Sci. 2001 Nov;114(Pt 22):4041-9 

Mousavi SA, Kjeken R, Berg TO, Seglen PO, Berg T, 

Brech A. Effects of inhibitors of the vacuolar proton pump 

on hepatic heterophagy and autophagy. Biochim Biophys 

Acta. 2001 Feb 9;1510(1-2):243-57 

Wang Z, Wilson WA, Fujino MA, Roach PJ. Antagonistic 

controls of autophagy and glycogen accumulation by 

Snf1p, the yeast homolog of AMP-activated protein kinase, 

and the cyclin-dependent kinase Pho85p. Mol Cell Biol. 

2001 Sep;21(17):5742-52 

Weinmann AS, Bartley SM, Zhang T, Zhang MQ, Farnham 

PJ. Use of chromatin immunoprecipitation to clone novel 

E2F target promoters. Mol Cell Biol. 2001 

Oct;21(20):6820-32 

Browne GJ, Proud CG. Regulation of peptide-chain 

elongation in mammalian cells. Eur J Biochem. 2002 

Nov;269(22):5360-8 

Kim DH, Sarbassov DD, Ali SM, King JE, Latek RR, 

Erdjument-Bromage H, Tempst P, Sabatini DM. mTOR 

interacts with raptor to form a nutrient-sensitive complex 

that signals to the cell growth machinery. Cell. 2002 Jul 

26;110(2):163-75 

Nara A, Mizushima N, Yamamoto A, Kabeya Y, Ohsumi Y, 

Yoshimori T. SKD1 AAA ATPase-dependent endosomal 

transport is involved in autolysosome formation. Cell Struct 

Funct. 2002 Feb;27(1):29-37 

Atlashkin V, Kreykenbohm V, Eskelinen EL, Wenzel D, 

Fayyazi A, Fischer von Mollard G. Deletion of the SNARE 

vti1b in mice results in the loss of a single SNARE partner, 

syntaxin 8. Mol Cell Biol. 2003 Aug;23(15):5198-207 

Eskelinen EL, Tanaka Y, Saftig P. At the acidic edge: 

emerging functions for lysosomal membrane proteins. 

Trends Cell Biol. 2003 Mar;13(3):137-45 

Kim DH, Sarbassov DD, Ali SM, Latek RR, Guntur KV, 

Erdjument-Bromage H, Tempst P, Sabatini DM. GbetaL, a 

positive regulator of the rapamycin-sensitive pathway 

required for the nutrient-sensitive interaction between 

raptor and mTOR. Mol Cell. 2003 Apr;11(4):895-904 

Klionsky DJ, Cregg JM, Dunn WA Jr, Emr SD, Sakai Y, 

Sandoval IV, Sibirny A, Subramani S, Thumm M, Veenhuis 

M, Ohsumi Y. A unified nomenclature for yeast autophagyrelated 

genes. Dev Cell. 2003 Oct;5(4):539-45 

Browne GJ, Finn SG, Proud CG. Stimulation of the AMPactivated 

protein kinase leads to activation of eukaryotic 

elongation factor 2 kinase and to its phosphorylation at a 

novel site, serine 398. J Biol Chem. 2004 Mar 

26;279(13):12220-31 

Corradetti MN, Inoki K, Bardeesy N, DePinho RA, Guan 

KL. Regulation of the TSC pathway by LKB1: evidence of 

a molecular link between tuberous sclerosis complex and 



Peutz-Jeghers syndrome. Genes Dev. 2004 Jul 

1;18(13):1533-8 

Eskelinen EL, Schmidt CK, Neu S, Willenborg M, Fuertes 

G, Salvador N, Tanaka Y, Lüllmann-Rauch R, Hartmann 

D, Heeren J, von Figura K, Knecht E, Saftig P. Disturbed 

cholesterol traffic but normal proteolytic function in LAMP- 

1/LAMP-2 double-deficient fibroblasts. Mol Biol Cell. 2004 

Jul;15(7):3132-45 

Fengsrud, M., Lunde Sneve, M., yverbye, A., and Seglen, 

P.O. Structural aspects of mammalian autophagy In 

Autophagy, D.J. Klionsky, ed. (Georgetown, TX, Landes 

Bioscience), 2004;11-25. 

Gutierrez MG, Munafo DB, Beron W, Colombo MI.. Rab7 

is required for the normal progression of the autophagic 

pathway in mammalian cells. J Cell Sci. 2004 Jun 1;117(Pt 

13):2687-97. Epub 2004 May 11. 

Hardie DG.. The AMP-activated protein kinase pathway-new 

players upstream and downstream. J Cell Sci. 2004 

Nov 1;117(Pt 23):5479-87. (REVIEW) 

Jager S, Bucci C, Tanida I, Ueno T, Kominami E, Saftig P, 

Eskelinen EL.. Role for Rab7 in maturation of late 

autophagic vacuoles. J Cell Sci. 2004 Sep 15;117(Pt 

20):4837-48. Epub 2004 Aug 31. 

Kuma A, Hatano M, Matsui M, Yamamoto A, Nakaya H, 

Yoshimori T, Ohsumi Y, Tokuhisa T, Mizushima N.. The 

role of autophagy during the early neonatal starvation 

period. Nature. 2004 Dec 23;432(7020):1032-6. Epub 

2004 Nov 3. 

Meijer AJ, Codogno P.. Regulation and role of autophagy 

in mammalian cells. Int J Biochem Cell Biol. 2004 

Dec;36(12):2445-62. (REVIEW) 

Meijer AJ, Dubbelhuis PF.. Amino acid signalling and the 

integration of metabolism. Biochem Biophys Res Commun. 

2004 Jan 9;313(2):397-403. (REVIEW) 

Oshiro N, Yoshino K, Hidayat S, Tokunaga C, Hara K, 

Eguchi S, Avruch J, Yonezawa K.. Dissociation of raptor 

from mTOR is a mechanism of rapamycin-induced 

inhibition of mTOR function. Genes Cells. 2004 

Apr;9(4):359-66. 

Scarlatti F, Bauvy C, Ventruti A, Sala G, Cluzeaud F, 

Vandewalle A, Ghidoni R, Codogno P.. Ceramidemediated 

macroautophagy involves inhibition of protein 

kinase B and up-regulation of beclin 1. J Biol Chem. 2004 

Apr 30;279(18):18384-91. Epub 2004 Feb 17. 

Scott RC, Schuldiner O, Neufeld TP.. Role and regulation 

of starvation-induced autophagy in the Drosophila fat body. 

Dev Cell. 2004 Aug;7(2):167-78. 

Shaw RJ, Bardeesy N, Manning BD, Lopez L, Kosmatka 

M, DePinho RA, Cantley LC.. The LKB1 tumor suppressor 

negatively regulates mTOR signaling. Cancer Cell. 2004 

Jul;6(1):91-9. 

Webb JL, Ravikumar B, Rubinsztein DC.. Microtubule 

disruption inhibits autophagosome-lysosome fusion: 

implications for studying the roles of aggresomes in 

polyglutamine diseases. Int J Biochem Cell Biol. 2004 

Dec;36(12):2541-50. 

Boya P, Gonzalez-Polo RA, Casares N, Perfettini JL, 

Dessen P, Larochette N, Metivier D, Meley D, Souquere S, 

Yoshimori T, Pierron G, Codogno P, Kroemer G.. nhibition 

of macroautophagy triggers apoptosis. Mol Cell Biol. 2005 

Feb;25(3):1025-40. 

Byfield MP, Murray JT, Backer JM.. hVps34 is a nutrientregulated 

lipid kinase required for activation of p70 S6 

kinase. J Biol Chem. 2005 Sep 23;280(38):33076-82. 

Epub 2005 Jul 27. 

Codogno P, Meijer AJ.. Autophagy and signaling: their role 

in cell survival and cell death. Cell Death Differ. 2005 

Nov;12 Suppl 2:1509-18. (REVIEW) 

Egami Y, Kiryu-Seo S, Yoshimori T, Kiyama H.. Induced 

expressions of Rab24 GTPase and LC3 in nerve-injured 

motor neurons. Biochem Biophys Res Commun. 2005 Dec 

2;337(4):1206-13. Epub 2005 Oct 6. 

Eskelinen EL.. Maturation of autophagic vacuoles in 

Mammalian cells. Autophagy. 2005 Apr;1(1):1-10. Epub 

2005 Apr 28. (REVIEW) 

Feng Z, Zhang H, Levine AJ, Jin S.. The coordinate 

regulation of the p53 and mTOR pathways in cells. Proc 

Natl Acad Sci U S A. 2005 Jun 7;102(23):8204-9. Epub 

2005 May 31. 

Hawley SA, Pan DA, Mustard KJ, Ross L, Bain J, Edelman 

AM, Frenguelli BG, Hardie DG.. Calmodulin-dependent 

protein kinase kinase-beta is an alternative upstream 

kinase for AMP-activated protein kinase. Cell Metab. 2005 

Jul;2(1):9-19. 

Klionsky DJ, Meijer AJ, Codogno P.. Autophagy and 

p70S6 kinase. Autophagy. 2005 Apr;1(1):59-60; discussion 

60-1. Epub 2005 Apr 5. 

Koike M, Shibata M, Waguri S, Yoshimura K, Tanida I, 

Kominami E, Gotow T, Peters C, von Figura K, Mizushima 

N, Saftig P, Uchiyama Y.. Participation of autophagy in 

storage of lysosomes in neurons from mouse models of 

neuronal ceroid-lipofuscinoses (Batten disease). Am J 

Pathol. 2005 Dec;167(6):1713-28. 

Kondo Y, Kanzawa T, Sawaya R, Kondo S.. The role of 

autophagy in cancer development and response to 

therapy. Nat Rev Cancer. 2005 Sep;5(9):726-34. 

(REVIEW) 

Manalo DJ, Rowan A, Lavoie T, Natarajan L, Kelly BD, Ye 

SQ, Garcia JG, Semenza GL.. Transcriptional regulation of 

vascular endothelial cell responses to hypoxia by HIF-1. 

Blood. 2005 Jan 15;105(2):659-69. Epub 2004 Sep 16. 

Nobukuni T, Joaquin M, Roccio M, Dann SG, Kim SY, 

Gulati P, Byfield MP, Backer JM, Natt F, Bos JL, 

Zwartkruis FJ, Thomas G.. Amino acids mediate 

mTOR/raptor signaling through activation of class 3 

phosphatidylinositol 3OH-kinase. Proc Natl Acad Sci U S 

A. 2005 Oct 4;102(40):14238-43. Epub 2005 Sep 21. 

Paludan C, Schmid D, Landthaler M, Vockerodt M, Kube 

D, Tuschl T, Munz C.. Endogenous MHC class II 

processing of a viral nuclear antigen after autophagy. 

Science. 2005 Jan 28;307(5709):593-6. Epub 2004 Dec 9. 

Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, 

Mizushima N, Packer M, Schneider MD, Levine B.. Bcl-2 

antiapoptotic proteins inhibit Beclin 1-dependent 

autophagy. Cell. 2005 Sep 23;122(6):927-39. 

Ravikumar B, Acevedo-Arozena A, Imarisio S, Berger Z, 

Vacher C, O'Kane CJ, Brown SD, Rubinsztein DC.. Dynein 

mutations impair autophagic clearance of aggregate-prone 

proteins. Nat Genet. 2005 Jul;37(7):771-6. Epub 2005 Jun 

26. 

Sarkar S, Floto RA, Berger Z, Imarisio S, Cordenier A, 

Pasco M, Cook LJ, Rubinsztein DC.. Lithium induces 

autophagy by inhibiting inositol monophosphatase. J Cell 

Biol. 2005 Sep 26;170(7):1101-11. 

Woods A, Dickerson K, Heath R, Hong SP, Momcilovic M, 

Johnstone SR, Carlson M, Carling D.. Ca2+/calmodulindependent 

protein kinase kinase-beta acts upstream of 

AMP-activated protein kinase in mammalian cells. Cell 

Metab. 2005 Jul;2(1):21-33. 

Bensaad K, Tsuruta A, Selak MA, Vidal MN, Nakano K, 

Bartrons R, Gottlieb E, Vousden KH.. TIGAR, a p53- 



inducible regulator of glycolysis and apoptosis. Cell. 2006 

Jul 14;126(1):107-20. 

Crighton D, Wilkinson S, O'Prey J, Syed N, Smith P, 

Harrison PR, Gasco M, Garrone O, Crook T, Ryan KM.. 

DRAM, a p53-induced modulator of autophagy, is critical 

for apoptosis. Cell. 2006 Jul 14;126(1):121-34. 

Degenhardt K, Mathew R, Beaudoin B, Bray K, Anderson 

D, Chen G, Mukherjee C, Shi Y, Gelinas C, Fan Y, Nelson 

DA, Jin S, White E.. Autophagy promotes tumor cell 

survival and restricts necrosis, inflammation, and 

tumorigenesis. Cancer Cell. 2006 Jul;10(1):51-64. 

DeGregori J, Johnson DG.. Distinct and Overlapping Roles 

for E2F Family Members in Transcription, Proliferation and 

Apoptosis. Curr Mol Med. 2006 Nov;6(7):739-48. 

(REVIEW) 

Djavaheri-Mergny M, Amelotti M, Mathieu J, Besan‡on F, 

Bauvy C, Souquere S, Pierron G, Codogno P.. NF-kappaB 

activation represses tumor necrosis factor-alpha-induced 

autophagy. J Biol Chem. 2006 Oct 13;281(41):30373-82. 

Epub 2006 Jul 20. 

Fass E, Shvets E, Degani I, Hirschberg K, Elazar Z.. 

Microtubules support production of starvation-induced 

autophagosomes but not their targeting and fusion with 

lysosomes. J Biol Chem. 2006 Nov 24;281(47):36303-16. 

Epub 2006 Sep 8. 

Hait WN, Wu H, Jin S, Yang JM.. Elongation factor-2 

kinase: its role in protein synthesis and autophagy. 

Autophagy. 2006 Oct-Dec;2(4):294-6. Epub 2006 Oct 3. 

Karin M.. Nuclear factor-kappaB in cancer development 

and progression. Nature. 2006 May 25;441(7092):431-6. 

(REVIEW) 

Kochl R, Hu XW, Chan EY, Tooze SA.. Microtubules 

facilitate autophagosome formation and fusion of 

autophagosomes with endosomes. Traffic. 2006 

Feb;7(2):129-45. 

Kotoulas OB, Kalamidas SA, Kondomerkos DJ.. Glycogen 

autophagy in glucose homeostasis. Pathol Res Pract. 

2006;202(9):631-8. Epub 2006 Jun 16. (REVIEW) 

Laderoute KR, Amin K, Calaoagan JM, Knapp M, Le T, 

Orduna J, Foretz M, Viollet B.. 5'-AMP-activated protein 

kinase (AMPK) is induced by low-oxygen and glucose 

deprivation conditions found in solid-tumor 

microenvironments. Mol Cell Biol. 2006 Jul;26(14):5336- 

47. 

Liang C, Feng P, Ku B, Dotan I, Canaani D, Oh BH, Jung 

JU.. Autophagic and tumour suppressor activity of a novel 

Beclin1-binding protein UVRAG. Nat Cell Biol. 2006 

Jul;8(7):688-99. Epub 2006 Jun 25. 

Massey AC, Kaushik S, Sovak G, Kiffin R, Cuervo AM.. 

Consequences of the selective blockage of chaperonemediated 

autophagy. Proc Natl Acad Sci U S A. 2006 Apr 

11;103(15):5805-10. Epub 2006 Apr 3. 

Meley D, Bauvy C, Houben-Weerts JH, Dubbelhuis PF, 

Helmond MT, Codogno P, Meijer AJ.. AMP-activated 

protein kinase and the regulation of autophagic proteolysis. 

J Biol Chem. 2006 Nov 17;281(46):34870-9. Epub 2006 

Sep 21. 

Sarbassov DD, Ali SM, Sengupta S, Sheen JH, Hsu PP, 

Bagley AF, Markhard AL, Sabatini DM.. Prolonged 

rapamycin treatment inhibits mTORC2 assembly and 

Akt/PKB. Mol Cell. 2006 Apr 21;22(2):159-68. Epub 2006 

Apr 6. 

Wu H, Yang JM, Jin S, Zhang H, Hait WN.. Elongation 

factor-2 kinase regulates autophagy in human 

glioblastoma cells. Cancer Res. 2006 Mar 15;66(6):3015- 

23. 

Yang Z, Huang J, Geng J, Nair U, Klionsky DJ.. Atg22 

recycles amino acids to link the degradative and recycling 

functions of autophagy. Mol Biol Cell. 2006 

Dec;17(12):5094-104. Epub 2006 Oct 4. 

Yousefi S, Perozzo R, Schmid I, Ziemiecki A, Schaffner T, 

Scapozza L, Brunner T, Simon HU.. Calpain-mediated 

cleavage of Atg5 switches autophagy to apoptosis. Nat 

Cell Biol. 2006 Oct;8(10):1124-32. Epub 2006 Sep 24. 

Bohensky J, Shapiro IM, Leshinsky S, Terkhorn SP, 

Adams CS, Srinivas V.. HIF-1 regulation of chondrocyte 

apoptosis: induction of the autophagic pathway. 

Autophagy. 2007 May-Jun;3(3):207-14. Epub 2007 May 

14. 

Colell A, Ricci JE, Tait S, Milasta S, Maurer U, Bouchier- 

Hayes L, Fitzgerald P, Guio-Carrion A, Waterhouse NJ, Li 

CW, Mari B, Barbry P, Newmeyer DD, Beere HM, Green 

DR.. GAPDH and autophagy preserve survival after 

apoptotic cytochrome c release in the absence of caspase 

activation. Cell. 2007 Jun 1;129(5):983-97. 

Erlich S, Mizrachy L, Segev O, Lindenboim L, Zmira O, 

Adi-Harel S, Hirsch JA, Stein R, Pinkas-Kramarski R.. 

Differential interactions between Beclin 1 and Bcl-2 family 

members. Autophagy. 2007 Nov-Dec;3(6):561-8. Epub 

2007 Jul 8. 

Fabre C, Carvalho G, Tasdemir E, Braun T, Ades L, 

Grosjean J, Boehrer S, Metivier D, Souquere S, Pierron G, 

Fenaux P, Kroemer G.. NF-kappaB inhibition sensitizes to 

starvation-induced cell death in high-risk myelodysplastic 

syndrome and acute myeloid leukemia. Oncogene. 2007 

Jun 14;26(28):4071-83. Epub 2007 Jan 8. 

Filimonenko M, Stuffers S, Raiborg C, Yamamoto A, 

Maler›d L, Fisher EM, Isaacs A, Brech A, Stenmark H, 

Simonsen A.. Functional multivesicular bodies are required 

for autophagic clearance of protein aggregates associated 

with neurodegenerative disease. J Cell Biol. 2007 Nov 

5;179(3):485-500. 

Forgac M.. Vacuolar ATPases: rotary proton pumps in 

physiology and pathophysiology. Nat Rev Mol Cell Biol. 

2007 Nov;8(11):917-29. (REVIEW) 

Fujita E, Kouroku Y, Isoai A, Kumagai H, Misutani A, 

Matsuda C, Hayashi YK, Momoi T.. Two endoplasmic 

reticulum-associated degradation (ERAD) systems for the 

novel variant of the mutant dysferlin: ubiquitin/proteasome 

ERAD(I) and autophagy/lysosome ERAD(II). Hum Mol 

Genet. 2007 Mar 15;16(6):618-29. Epub 2007 Mar 1. 

Gurkan C, Koulov AV, Balch WE.. An evolutionary 

perspective on eukaryotic membrane trafficking. Adv Exp 

Med Biol. 2007;607:73-83. (REVIEW) 

Hoyer-Hansen M, Bastholm L, Szyniarowski P, 

Campanella M, Szabadkai G, Farkas T, Bianchi K, 

Fehrenbacher N, Elling F, Rizzuto R, Mathiasen IS, 

Jaattela M.. Control of macroautophagy by calcium, 

calmodulin-dependent kinase kinase-beta, and Bcl-2. Mol 

Cell. 2007 Jan 26;25(2):193-205. 

Hoyer-Hansen M, Jaattela M.. AMP-activated protein 

kinase: a universal regulator of autophagy? Autophagy. 

2007 Jul-Aug;3(4):381-3. Epub 2007 Jul 5. 

Klionsky DJ.. Autophagy: from phenomenology to 

molecular understanding in less than a decade. Nat Rev 

Mol Cell Biol. 2007 Nov;8(11):931-7. (REVIEW) 

Kouroku Y, Fujita E, Tanida I, Ueno T, Isoai A, Kumagai H, 

Ogawa S, Kaufman RJ, Kominami E, Momoi T.. ER stress 

(PERK/eIF2alpha phosphorylation) mediates the 

polyglutamine-induced LC3 conversion, an essential step 

for autophagy formation. Cell Death Differ. 2007 

Feb;14(2):230-9. Epub 2006 Jun 23. 



Lee JA, Beigneux A, Ahmad ST, Young SG, Gao FB.. 

ESCRT-III dysfunction causes autophagosome 

accumulation and neurodegeneration. Curr Biol. 2007 Sep 

18;17(18):1561-7. Epub 2007 Aug 2. 

Levine B.. Cell biology: autophagy and cancer. Nature. 

2007 Apr 12;446(7137):745-7. 

Levine B, Deretic V.. Unveiling the roles of autophagy in 

innate and adaptive immunity. Nat Rev Immunol. 2007 

Oct;7(10):767-77. (REVIEW) 

Maiuri MC, Le Toumelin G, Criollo A, Rain JC, Gautier F, 

Juin P, Tasdemir E, Pierron G, Troulinaki K, Tavernarakis 

N, Hickman JA, Geneste O, Kroemer G.. Functional and 

physical interaction between Bcl-X(L) and a BH3-like 

domain in Beclin-1. EMBO J. 2007 May 16;26(10):2527- 

39. Epub 2007 Apr 19. 

Mammucari C, Milan G, Romanello V, Masiero E, Rudolf 

R, Del Piccolo P, Burden SJ, Di Lisi R, Sandri C, Zhao J, 

Goldberg AL, Schiaffino S, Sandri M.. FoxO3 controls 

autophagy in skeletal muscle in vivo. Cell Metab. 2007 

Dec;6(6):458-71. 

Mathew R, Kongara S, Beaudoin B, Karp CM, Bray K, 

Degenhardt K, Chen G, Jin S, White E.. Autophagy 

suppresses tumor progression by limiting chromosomal 

instability. Genes Dev. 2007 Jun 1;21(11):1367-81. Epub 

2007 May 17. 

Meijer AJ, Codogno P.. AMP-activated protein kinase and 

autophagy. Autophagy. 2007 May-Jun;3(3):238-40. Epub 

2007 May 14. 

Nakai A, Yamaguchi O, Takeda T, Higuchi Y, Hikoso S, 

Taniike M, Omiya S, Mizote I, Matsumura Y, Asahi M, 

Nishida K, Hori M, Mizushima N, Otsu K.. The role of 

autophagy in cardiomyocytes in the basal state and in 

response to hemodynamic stress. Nat Med. 2007 

May;13(5):619-24. Epub 2007 Apr 22. 

Nakatogawa H, Ichimura Y, Ohsumi Y.. Atg8, a ubiquitinlike 

protein required for autophagosome formation, 

mediates membrane tethering and hemifusion. Cell. 2007 

Jul 13;130(1):165-78. 

Pua HH, Dzhagalov I, Chuck M, Mizushima N, He YW.. A 

critical role for the autophagy gene Atg5 in T cell survival 

and proliferation. J Exp Med. 2007 Jan 22;204(1):25-31. 

Epub 2006 Dec 26. 

Rusten TE, Vaccari T, Lindmo K, Rodahl LM, Nezis IP, 

Sem-Jacobsen C, Wendler F, Vincent JP, Brech A, Bilder 

D, Stenmark H.. ESCRTs and Fab1 regulate distinct steps 

of autophagy. Curr Biol. 2007 Oct 23;17(20):1817-25. 

Epub 2007 Oct 11. 

Scherz-Shouval R, Shvets E, Fass E, Shorer H, Gil L, 

Elazar Z.. Reactive oxygen species are essential for 

autophagy and specifically regulate the activity of Atg4. 

EMBO J. 2007 Apr 4;26(7):1749-60. Epub 2007 Mar 8. 

Tamai K, Tanaka N, Nara A, Yamamoto A, Nakagawa I, 

Yoshimori T, Ueno Y, Shimosegawa T, Sugamura K.. Role 

of Hrs in maturation of autophagosomes in mammalian 

cells. Biochem Biophys Res Commun. 2007 Sep 

7;360(4):721-7. Epub 2007 Jul 5. 

White SR, Lauring B.. AAA+ ATPases: achieving diversity 

of function with conserved machinery. Traffic. 2007 

Dec;8(12):1657-67. Epub 2007 Sep 26. (REVIEW) 

Zhao J, Brault JJ, Schild A, Cao P, Sandri M, Schiaffino S, 

Lecker SH, Goldberg AL.. FoxO3 coordinately activates 

protein degradation by the autophagic/lysosomal and 

proteasomal pathways in atrophying muscle cells. Cell 

Metab. 2007 Dec;6(6):472-83. 

Axe EL, Walker SA, Manifava M, Chandra P, Roderick HL, 

Habermann A, Griffiths G, Ktistakis NT.. Autophagosome 

formation from membrane compartments enriched in 

phosphatidylinositol 3-phosphate and dynamically 

connected to the endoplasmic reticulum. J Cell Biol. 2008 

Aug 25;182(4):685-701. 

Beau I, Esclatine A, Codogno P.. Lost to translation: when 

autophagy targets mature ribosomes. Trends Cell Biol. 

2008 Jul;18(7):311-4. Epub 2008 May 27. (REVIEW) 

Ebato C, Uchida T, Arakawa M, Komatsu M, Ueno T, 

Komiya K, Azuma K, Hirose T, Tanaka K, Kominami E, 

Kawamori R, Fujitani Y, Watada H.. Autophagy is 

important in islet homeostasis and compensatory increase 

of beta cell mass in response to high-fat diet. Cell Metab. 

2008 Oct;8(4):325-32. 

Fader CM, Sanchez D, Furlan M, Colombo MI.. Induction 

of autophagy promotes fusion of multivesicular bodies with 

autophagic vacuoles in k562 cells. Traffic. 2008 

Feb;9(2):230-50. Epub 2007 Dec 7. 

Jahreiss L, Menzies FM, Rubinsztein DC.. The itinerary of 

autophagosomes: from peripheral formation to kiss-andrun 

fusion with lysosomes. Traffic. 2008 Apr;9(4):574-87. 

Epub 2008 Jan 7. 

Kaushik S, Massey AC, Mizushima N, Cuervo AM.. 

Constitutive activation of chaperone-mediated autophagy 

in cells with impaired macroautophagy. Mol Biol Cell. 2008 

May;19(5):2179-92. Epub 2008 Mar 12. 

Kim E, Goraksha-Hicks P, Li L, Neufeld TP, Guan KL.. 

Regulation of TORC1 by Rag GTPases in nutrient 

response. Nat Cell Biol. 2008a Aug;10(8):935-45. Epub 

2008 Jul 6. 

Kim JS, Nitta T, Mohuczy D, O'Malley KA, Moldawer LL, 

Dunn WA Jr, Behrns KE.. Impaired autophagy: A 

mechanism of mitochondrial dysfunction in anoxic rat 

hepatocytes. Hepatology. 2008b May;47(5):1725-36. 

Kimura S, Noda T, Yoshimori T.. Dynein-dependent 

movement of autophagosomes mediates efficient 

encounters with lysosomes. Cell Struct Funct. 

2008;33(1):109-22. Epub 2008 Apr 4. 

Lee IH, Cao L, Mostoslavsky R, Lombard DB, Liu J, Bruns 

NE, Tsokos M, Alt FW, Finkel T.. A role for the NADdependent 

deacetylase Sirt1 in the regulation of 

autophagy. Proc Natl Acad Sci U S A. 2008 Mar 

4;105(9):3374-9. Epub 2008 Feb 22. 

Liang C, Lee JS, Inn KS, Gack MU, Li Q, Roberts EA, 

Vergne I, Deretic V, Feng P, Akazawa C, Jung JU.. 

Beclin1-binding UVRAG targets the class C Vps complex 

to coordinate autophagosome maturation and endocytic 

trafficking. Nat Cell Biol. 2008 Jul;10(7):776-87. Epub 2008 

Jun 15. 

Mizushima N, Levine B, Cuervo AM, Klionsky DJ.. 

Autophagy fights disease through cellular self-digestion. 

Nature. 2008 Feb 28;451(7182):1069-75. (REVIEW) 

Nedelsky NB, Todd PK, Taylor JP.. Autophagy and the 

ubiquitin-proteasome system: collaborators in 

neuroprotection. Biochim Biophys Acta. 2008 

Dec;1782(12):691-9. Epub 2008 Oct 10. (REVIEW) 

Nedjic J, Aichinger M, Emmerich J, Mizushima N, Klein L.. 

Autophagy in thymic epithelium shapes the T-cell 

repertoire and is essential for tolerance. Nature. 2008 Sep 

18;455(7211):396-400. Epub 2008 Aug 13. 

Noda NN, Kumeta H, Nakatogawa H, Satoo K, Adachi W, 

Ishii J, Fujioka Y, Ohsumi Y, Inagaki F.. Structural basis of 

target recognition by Atg8/LC3 during selective autophagy. 

Genes Cells. 2008 Dec;13(12):1211-8. Epub 2008 Oct 22. 

Polager S, Ofir M, Ginsberg D.. E2F1 regulates autophagy 

and the transcription of autophagy genes. Oncogene. 2008 

Aug 14;27(35):4860-4. Epub 2008 Apr 14. 



Salih DA, Brunet A.. FoxO transcription factors in the 

maintenance of cellular homeostasis during aging. Curr 

Opin Cell Biol. 2008 Apr;20(2):126-36. Epub 2008 Apr 3. 

Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen 

CC, Bar-Peled L, Sabatini DM.. The Rag GTPases bind 

raptor and mediate amino acid signaling to mTORC1. 

Science. 2008 Jun 13;320(5882):1496-501. Epub 2008 

May 22. 

Schlottmann S, Buback F, Stahl B, Meierhenrich R, Walter 

P, Georgieff M, Senftleben U.. Prolonged classical NFkappaB 

activation prevents autophagy upon E. coli 

stimulation in vitro: a potential resolving mechanism of 

inflammation. Mediators Inflamm. 2008;2008:725854. 

Tasdemir E, Maiuri MC, Galluzzi L, Vitale I, Djavaheri- 

Mergny M, D'Amelio M, Criollo A, Morselli E, Zhu C, 

Harper F, Nannmark U, Samara C, Pinton P, Vicencio JM, 

Carnuccio R, Moll UM, Madeo F, Paterlini-Brechot P, 

Rizzuto R, Szabadkai G, Pierron G, Blomgren K, 

Tavernarakis N, Codogno P, Cecconi F, Kroemer G.. 

Regulation of autophagy by cytoplasmic p53. Nat Cell Biol. 

2008 Jun;10(6):676-87. Epub 2008 May 4. 

Tsukamoto S, Kuma A, Murakami M, Kishi C, Yamamoto 

A, Mizushima N.. Autophagy is essential for 

preimplantation development of mouse embryos. Science. 

2008 Jul 4;321(5885):117-20. 

Uttenweiler A, Mayer A.. Microautophagy in the yeast 

Saccharomyces cerevisiae. Methods Mol Biol. 

2008;445:245-59. 

van der Vaart A, Mari M, Reggiori F.. A picky eater: 

exploring the mechanisms of selective autophagy in 

human pathologies. Traffic. 2008 Mar;9(3):281-9. Epub 

2007 Nov 6. (REVIEW) 

Wang J, Lian H, Zhao Y, Kauss MA, Spindel S.. Vitamin 

D3 induces autophagy of human myeloid leukemia cells. J 

Biol Chem. 2008 Sep 12;283(37):25596-605. Epub 2008 

Jul 15. 

Wei Y, Pattingre S, Sinha S, Bassik M, Levine B.. JNK1mediated 

phosphorylation of Bcl-2 regulates starvationinduced 

autophagy. Mol Cell. 2008 Jun 20;30(6):678-88. 

Williams A, Sarkar S, Cuddon P, Ttofi EK, Saiki S, Siddiqi 

FH, Jahreiss L, Fleming A, Pask D, Goldsmith P, O'Kane 

CJ, Floto RA, Rubinsztein DC.. Novel targets for 

Huntington's disease in an mTOR-independent autophagy 

pathway. Nat Chem Biol. 2008 May;4(5):295-305. 

Yogalingam G, Pendergast AM.. Abl kinases regulate 

autophagy by promoting the trafficking and function of 

lysosomal components. J Biol Chem. 2008 Dec 

19;283(51):35941-53. Epub 2008 Oct 21. 

Zhang C, Cuervo AM.. Restoration of chaperone-mediated 

autophagy in aging liver improves cellular maintenance 

and hepatic function. Nat Med. 2008 Sep;14(9):959-65. 

Zhang H, Bosch-Marce M, Shimoda LA, Tan YS, Baek JH, 

Wesley JB, Gonzalez FJ, Semenza GL.. Mitochondrial 

autophagy is an HIF-1-dependent adaptive metabolic 

response to hypoxia. J Biol Chem. 2008 Apr 

18;283(16):10892-903. Epub 2008 Feb 15. 

Bellot G, Garcia-Medina R, Gounon P, Chiche J, Roux D, 

Pouyssegur J, Mazure NM.. Hypoxia-induced autophagy is 

mediated through hypoxia-inducible factor induction of 

BNIP3 and BNIP3L via their BH3 domains. Mol Cell Biol. 

2009 May;29(10):2570-81. Epub 2009 Mar 9. 

Bensaad K, Cheung EC, Vousden KH.. Modulation of 

intracellular ROS levels by TIGAR controls autophagy. 

EMBO J. 2009 Oct 7;28(19):3015-26. Epub 2009 Aug 27. 

Betin VM, Lane JD.. Caspase cleavage of Atg4D 

stimulates GABARAP-L1 processing and triggers 

mitochondrial targeting and apoptosis. J Cell Sci. 2009 Jul 

15;122(Pt 14):2554-66. Epub 2009 Jun 23. 

Cho DH, Jo YK, Hwang JJ, Lee YM, Roh SA, Kim JC.. 

Caspase-mediated cleavage of ATG6/Beclin-1 links 

apoptosis to autophagy in HeLa cells. Cancer Lett. 2009 

Feb 8;274(1):95-100. Epub 2008 Oct 7. 

Copetti T, Bertoli C, Dalla E, Demarchi F, Schneider C.. 

p65/RelA modulates BECN1 transcription and autophagy. 

Mol Cell Biol. 2009 May;29(10):2594-608. Epub 2009 Mar 

16. 

Eisenberg T, Knauer H, Schauer A, Buttner S, 

Ruckenstuhl C, Carmona-Gutierrez D, Ring J, Schroeder 

S, Magnes C, Antonacci L, Fussi H, Deszcz L, Hartl R, 

Schraml E, Criollo A, Megalou E, Weiskopf D, Laun P, 

Heeren G, Breitenbach M, Grubeck-Loebenstein B, Herker 

E, Fahrenkrog B, Frohlich KU, Sinner F, Tavernarakis N, 

Minois N, Kroemer G, Madeo F.. Induction of autophagy by 

spermidine promotes longevity. Nat Cell Biol. 2009 

Nov;11(11):1305-14. Epub 2009 Oct 4. 

Fader CM, Sanchez DG, Mestre MB, Colombo MI.. TI- 

VAMP/VAMP7 and VAMP3/cellubrevin: two v-SNARE 

proteins involved in specific steps of the 

autophagy/multivesicular body pathways. Biochim Biophys 

Acta. 2009 Dec;1793(12):1901-16. Epub 2009 Sep 23. 

Hayashi-Nishino M, Fujita N, Noda T, Yamaguchi A, 

Yoshimori T, Yamamoto A.. A subdomain of the 

endoplasmic reticulum forms a cradle for autophagosome 

formation. Nat Cell Biol. 2009 Dec;11(12):1433-7. Epub 

2009 Nov 8. 

He C, Klionsky DJ.. Regulation mechanisms and signaling 

pathways of autophagy. Annu Rev Genet. 2009;43:67-93. 

(REVIEW) 

Hosokawa N, Hara T, Kaizuka T, Kishi C, Takamura A, 

Miura Y, Iemura S, Natsume T, Takehana K, Yamada N, 

Guan JL, Oshiro N, Mizushima N.. Nutrient-dependent 

mTORC1 association with the ULK1-Atg13-FIP200 

complex required for autophagy. Mol Biol Cell. 2009 

Apr;20(7):1981-91. Epub 2009 Feb 11. 

Korolchuk VI, Mansilla A, Menzies FM, Rubinsztein DC.. 

Autophagy inhibition compromises degradation of 

ubiquitin-proteasome pathway substrates. Mol Cell. 2009 

Feb 27;33(4):517-27. 

Kraft C, Reggiori F, Peter M.. Selective types of autophagy 

in yeast. Biochim Biophys Acta. 2009 Sep;1793(9):1404- 

12. Epub 2009 Mar 2. (REVIEW) 

Lee IH, Finkel T.. Regulation of autophagy by the p300 

acetyltransferase. J Biol Chem. 2009 Mar 6;284(10):6322- 

8. Epub 2009 Jan 5. 

Lee JS, Li Q, Lee JY, Lee SH, Jeong JH, Lee HR, Chang 

H, Zhou FC, Gao SJ, Liang C, Jung JU.. FLIP-mediated 

autophagy regulation in cell death control. Nat Cell Biol. 

2009 Nov;11(11):1355-62. Epub 2009 Oct 18. 

Li DD, Wang LL, Deng R, Tang J, Shen Y, Guo JF, Wang 

Y, Xia LP, Feng GK, Liu QQ, Huang WL, Zeng YX, Zhu 

XF.. The pivotal role of c-Jun NH2-terminal kinasemediated 

Beclin 1 expression during anticancer agentsinduced 

autophagy in cancer cells. Oncogene. 2009 Feb 

12;28(6):886-98. Epub 2008 Dec 8. 

Liu HY, Han J, Cao SY, Hong T, Zhuo D, Shi J, Liu Z, Cao 

W.. Hepatic autophagy is suppressed in the presence of 

insulin resistance and hyperinsulinemia: inhibition of 

FoxO1-dependent expression of key autophagy genes by 

insulin. J Biol Chem. 2009 Nov 6;284(45):31484-92. Epub 

2009 Sep 16. 

Mathew R, Karp CM, Beaudoin B, Vuong N, Chen G, Chen 

HY, Bray K, Reddy A, Bhanot G, Gelinas C, Dipaola RS, 



Karantza-Wadsworth V, White E.. Autophagy suppresses 

tumorigenesis through elimination of p62. Cell. 2009 Jun 

12;137(6):1062-75. 

Matsunaga K, Saitoh T, Tabata K, Omori H, Satoh T, 

Kurotori N, Maejima I, Shirahama-Noda K, Ichimura T, 

Isobe T, Akira S, Noda T, Yoshimori T.. Two Beclin 1binding 

proteins, Atg14L and Rubicon, reciprocally 

regulate autophagy at different stages. Nat Cell Biol. 2009 

Apr;11(4):385-96. Epub 2009 Mar 8 

Meijer AJ, Codogno P.. Autophagy: regulation and role in 

disease. Crit Rev Clin Lab Sci. 2009;46(4):210-40. 

(REVIEW) 

Morselli E, Galluzzi L, Kepp O, Vicencio JM, Criollo A, 

Maiuri MC, Kroemer G.. Anti- and pro-tumor functions of 

autophagy. Biochim Biophys Acta. 2009 

Sep;1793(9):1524-32. Epub 2009 Jan 21. (REVIEW) 

Nakatogawa H, Suzuki K, Kamada Y, Ohsumi Y.. 

Dynamics and diversity in autophagy mechanisms: lessons 

from yeast. Nat Rev Mol Cell Biol. 2009 Jul;10(7):458-67. 

Epub 2009 Jun 3. (REVIEW) 

Nicklin P, Bergman P, Zhang B, Triantafellow E, Wang H, 

Nyfeler B, Yang H, Hild M, Kung C, Wilson C, Myer VE, 

MacKeigan JP, Porter JA, Wang YK, Cantley LC, Finan 

PM, Murphy LO.. Bidirectional transport of amino acids 

regulates mTOR and autophagy. Cell. 2009 Feb 

6;136(3):521-34. 

Nivon M, Richet E, Codogno P, Arrigo AP, Kretz-Remy C.. 

Autophagy activation by NFkappaB is essential for cell 

survival after heat shock. Autophagy. 2009 Aug;5(6):766- 

83. Epub 2009 Aug 20. 

Park KJ, Lee SH, Lee CH, Jang JY, Chung J, Kwon MH, 

Kim YS.. Upregulation of Beclin-1 expression and 

phosphorylation of Bcl-2 and p53 are involved in the JNKmediated 

autophagic cell death. Biochem Biophys Res 

Commun. 2009 May 15;382(4):726-9. Epub 2009 Mar 24. 

Pattingre S, Bauvy C, Carpentier S, Levade T, Levine B, 

Codogno P.. Role of JNK1-dependent Bcl-2 

phosphorylation in ceramide-induced macroautophagy. J 

Biol Chem. 2009 Jan 30;284(5):2719-28. Epub 2008 Nov 

23. 

Raiborg C, Stenmark H.. The ESCRT machinery in 

endosomal sorting of ubiquitylated membrane proteins. 

Nature. 2009 Mar 26;458(7237):445-52. (REVIEW) 

Ramachandran N, Munteanu I, Wang P, Aubourg P, 

Rilstone JJ, Israelian N, Naranian T, Paroutis P, Guo R, 

Ren ZP, Nishino I, Chabrol B, Pellissier JF, Minetti C, Udd 

B, Fardeau M, Tailor CS, Mahuran DJ, Kissel JT, Kalimo 

H, Levy N, Manolson MF, Ackerley CA, Minassian BA.. 

VMA21 deficiency causes an autophagic myopathy by 

compromising V-ATPase activity and lysosomal 

acidification. Cell. 2009 Apr 17;137(2):235-46. 

Razi M, Chan EY, Tooze SA.. Early endosomes and 

endosomal coatomer are required for autophagy. J Cell 

Biol. 2009 Apr 20;185(2):305-21. Epub 2009 Apr 13. 

Rubinsztein DC, Cuervo AM, Ravikumar B, Sarkar S, 

Korolchuk V, Kaushik S, Klionsky DJ.. In search of an 

"autophagomometer". Autophagy. 2009 Jul;5(5):585-9. 

Epub 2009 Jul 23. 

Rusten TE, Stenmark H.. How do ESCRT proteins control 

autophagy? J Cell Sci. 2009 Jul 1;122(Pt 13):2179-83. 

Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza 

M, Gennarino VA, Di Malta C, Donaudy F, Embrione V, 

Polishchuk RS, Banfi S, Parenti G, Cattaneo E, Ballabio 

A.. A gene network regulating lysosomal biogenesis and 

function. Science. 2009 Jul 24;325(5939):473-7. Epub 

2009 Jun 25. 

Tang H, Da L, Mao Y, Li Y, Li D, Xu Z, Li F, Wang Y, 

Tiollais P, Li T, Zhao M.. Hepatitis B virus X protein 

sensitizes cells to starvation-induced autophagy via upregulation 

of beclin 1 expression. Hepatology. 2009 

Jan;49(1):60-71. 

Vicencio JM, Ortiz C, Criollo A, Jones AW, Kepp O, 

Galluzzi L, Joza N, Vitale I, Morselli E, Tailler M, Castedo 

M, Maiuri MC, Molg¢ J, Szabadkai G, Lavandero S, 

Kroemer G.. The inositol 1,4,5-trisphosphate receptor 

regulates autophagy through its interaction with Beclin 1. 

Cell Death Differ. 2009 Jul;16(7):1006-17. Epub 2009 Mar 

27. 

Virgin HW, Levine B.. Autophagy genes in immunity. Nat 

Immunol. 2009 May;10(5):461-70. (REVIEW) 

Vousden KH, Prives C.. Blinded by the Light: The Growing 

Complexity of p53. Cell. 2009 May 1;137(3):413-31. 

(REVIEW) 

Yla-Anttila P, Vihinen H, Jokitalo E, Eskelinen EL.. 3D 

tomography reveals connections between the phagophore 

and endoplasmic reticulum. Autophagy. 2009 

Nov;5(8):1180-5. Epub 2009 Nov 8. 

Yuk JM, Shin DM, Lee HM, Yang CS, Jin HS, Kim KK, Lee 

ZW, Lee SH, Kim JM, Jo EK.. Vitamin D3 induces 

autophagy in human monocytes/macrophages via 

cathelicidin. Cell Host Microbe. 2009 Sep 17;6(3):231-43. 

Zalckvar E, Berissi H, Mizrachy L, Idelchuk Y, Koren I, 

Eisenstein M, Sabanay H, Pinkas-Kramarski R, Kimchi A.. 

DAP-kinase-mediated phosphorylation on the BH3 domain 

of beclin 1 promotes dissociation of beclin 1 from Bcl-XL 

and induction of autophagy. EMBO Rep. 2009 

Mar;10(3):285-92. Epub 2009 Jan 30. 

Zhong Y, Wang QJ, Li X, Yan Y, Backer JM, Chait BT, 

Heintz N, Yue Z.. Distinct regulation of autophagic activity 

by Atg14L and Rubicon associated with Beclin 1phosphatidylinositol-3-kinase 

complex. Nat Cell Biol. 2009 

Apr;11(4):468-76. Epub 2009 Mar 8. 

Zhu H, Wu H, Liu X, Li B, Chen Y, Ren X, Liu CG, Yang 

JM.. Regulation of autophagy by a beclin 1-targeted 

microRNA, miR-30a, in cancer cells. Autophagy. 2009 

Aug;5(6):816-23. Epub 2009 Aug 20. 

Hailey DW, Rambold AS, Satpute-Krishnan P, Mitra K, 

Sougrat R, Kim PK, Lippincott-Schwartz J.. Mitochondria 

supply membranes for autophagosome biogenesis during 

starvation. Cell. 2010 May 14;141(4):656-67. 

Hidvegi T, Ewing M, Hale P, Dippold C, Beckett C, Kemp 

C, Maurice N, Mukherjee A, Goldbach C, Watkins S, 

Michalopoulos G, Perlmutter DH.. An autophagyenhancing 

drug promotes degradation of mutant alpha1antitrypsin 

Z and reduces hepatic fibrosis. Science. 2010 

Jul 9;329(5988):229-32. Epub 2010 Jun 3. 

Kovsan J, Bashan N, Greenberg AS, Rudich A.. Potential 

role of autophagy in modulation of lipid metabolism. Am J 

Physiol Endocrinol Metab. 2010 Jan;298(1):E1-7. Epub 

2009 Nov 3. (REVIEW) 

Lamark T, Johansen T.. Autophagy: links with the 

proteasome. Curr Opin Cell Biol. 2010 Apr;22(2):192-8. 

Epub 2009 Dec 2. 

Luo S, Rubinsztein DC.. Apoptosis blocks Beclin 1dependent 

autophagosome synthesis: an effect rescued 

by Bcl-xL. Cell Death Differ. 2010 Feb;17(2):268-77. Epub 

2009 Aug 28. 

Mari M, Griffith J, Rieter E, Krishnappa L, Klionsky DJ, 

Reggiori F.. An Atg9-containing compartment that 

functions in the early steps of autophagosome biogenesis. 

J Cell Biol. 2010 Sep 20;190(6):1005-22. 



Mauvezin C, Orpinell M, Francis VA, Mansilla F, Duran J, 

Ribas V, Palac¡n M, Boya P, Teleman AA, Zorzano A.. The 

nuclear cofactor DOR regulates autophagy in mammalian 

and Drosophila cells. EMBO Rep. 2010 Jan;11(1):37-44. 

Epub 2009 Dec 4. 

Mizushima N, Yoshimori T, Levine B.. Methods in 

mammalian autophagy research. Cell. 2010 Feb 

5;140(3):313-26. 

Morselli E, Maiuri MC, Markaki M, Megalou E, Pasparaki 

A, Palikaras K, Criollo A, Galluzzi L, Malik SA, Vitale I, 

Michaud M, Madeo F, Tavernarakis N, Kroemer G.. The 

life span-prolonging effect of sirtuin-1 is mediated by 

autophagy. Autophagy. 2010 Jan;6(1):186-8. Epub 2010 

Jan 2. (REVIEW) 

Ohashi Y, Munro S.. Membrane delivery to the yeast 

autophagosome from the Golgi-endosomal system. Mol 

Biol Cell. 2010 Nov 15;21(22):3998-4008. Epub 2010 Sep 

22. 

Ravikumar B, Moreau K, Jahreiss L, Puri C, Rubinsztein 

DC.. Plasma membrane contributes to the formation of 

pre-autophagosomal structures. Nat Cell Biol. 2010a 

Aug;12(8):747-57. Epub 2010 Jul 18. 

Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia- 

Arencibia M, Green-Thompson ZW, Jimenez-Sanchez M, 

Korolchuk VI, Lichtenberg M, Luo S, Massey DC, Menzies 

FM, Moreau K, Narayanan U, Renna M, Siddiqi FH, 

Underwood BR, Winslow AR, Rubinsztein DC.. Regulation 

of mammalian autophagy in physiology and 

pathophysiology. Physiol Rev. 2010b Oct;90(4):1383-435. 

(REVIEW) 

Rouschop KM, van den Beucken T, Dubois L, Niessen H, 

Bussink J, Savelkouls K, Keulers T, Mujcic H, Landuyt W, 

Voncken JW, Lambin P, van der Kogel AJ, Koritzinsky M, 

Wouters BG.. The unfolded protein response protects 

human tumor cells during hypoxia through regulation of the 

autophagy genes MAP1LC3B and ATG5. J Clin Invest. 

2010 Jan 4;120(1):127-41. doi: 10.1172/JCI40027. Epub 

2009 Dec 14. 

Weidberg H, Shvets E, Shpilka T, Shimron F, Shinder V, 

Elazar Z.. LC3 and GATE-16/GABARAP subfamilies are 

both essential yet act differently in autophagosome 

biogenesis. EMBO J. 2010 Jun 2;29(11):1792-802. Epub 

2010 Apr 23. 

Xia HG, Zhang L, Chen G, Zhang T, Liu J, Jin M, Ma X, 

Ma D, Yuan J.. Control of basal autophagy by calpain1 

mediated cleavage of ATG5. Autophagy. 2010 

Jan;6(1):61-6. Epub 2010 Jan 13. 

Yang L, Li P, Fu S, Calay ES, Hotamisligil GS.. Defective 

hepatic autophagy in obesity promotes ER stress and 

causes insulin resistance. Cell Metab. 2010 Jun 

9;11(6):467-78. 

Yang Z, Klionsky DJ.. Eaten alive: a history of 

macroautophagy. Nat Cell Biol. 2010 Sep;12(9):814-22. 

(REVIEW) 

Egan DF, Shackelford DB, Mihaylova MM, Gelino S, 

Kohnz RA, Mair W, Vasquez DS, Joshi A, Gwinn DM, 

Taylor R, Asara JM, Fitzpatrick J, Dillin A, Viollet B, Kundu 

M, Hansen M, Shaw RJ.. Phosphorylation of ULK1 

(hATG1) by AMP-activated protein kinase connects energy 

sensing to mitophagy. Science. 2011 Jan 

28;331(6016):456-61. Epub 2010 Dec 23. 

Garcia-Marcos M, Ear J, Farquhar MG, Ghosh P.. A GDI 

(AGS3) and a GEF (GIV) regulate autophagy by balancing 

G protein activity and growth factor signals. Mol Biol Cell. 

2011 Mar 1;22(5):673-86. Epub 2011 Jan 5. 

Guo JY, Chen HY, Mathew R, Fan J, Strohecker AM, 

Karsli-Uzunbas G, Kamphorst JJ, Chen G, Lemons JM, 

Karantza V, Coller HA, Dipaola RS, Gelinas C, Rabinowitz 

JD, White E. Activated Ras requires autophagy to maintain 

oxidative metabolism and tumorigenesis. Genes Dev. 2011 

Mar 1;25(5):460-70. Epub 2011 Feb 11. 

Itoh T, Kanno E, Uemura T, Waguri S, Fukuda M.. OATL1, 

a novel autophagosome-resident Rab33B-GAP, regulates 

autophagosomal maturation. J Cell Biol. 2011 Mar 

7;192(5):839-53. 

Kim J, Kundu M, Viollet B, Guan KL.. AMPK and mTOR 

regulate autophagy through direct phosphorylation of Ulk1. 

Nat Cell Biol. 2011 Feb;13(2):132-41. Epub 2011 Jan 23. 

Lock R, Roy S, Kenific CM, Su JS, Salas E, Ronen SM, 

Debnath J.. Autophagy facilitates glycolysis during Rasmediated 

oncogenic transformation. Mol Biol Cell. 2011 

Jan 15;22(2):165-78. Epub 2010 Nov 30. 

Moreau K, Ravikumar B, Renna M, Puri C, Rubinsztein 

DC.. Autophagosome precursor maturation requires 

homotypic fusion. Cell. 2011 Jul 22;146(2):303-17. 

Nair U, Jotwani A, Geng J, Gammoh N, Richerson D, Yen 

WL, Griffith J, Nag S, Wang K, Moss T, Baba M, McNew 

JA, Jiang X, Reggiori F, Melia TJ, Klionsky DJ.. SNARE 

proteins are required for macroautophagy. Cell. 2011 Jul 

22;146(2):290-302. 

Settembre C, Di Malta C, Polito VA, Garcia Arencibia M, 

Vetrini F, Erdin S, Erdin SU, Huynh T, Medina D, Colella P, 

Sardiello M, Rubinsztein DC, Ballabio A.. TFEB links 

autophagy to lysosomal biogenesis. Science. 2011 Jun 

17;332(6036):1429-33. Epub 2011 May 26. 

Weidberg H, Shpilka T, Shvets E, Abada A, Shimron F, 

Elazar Z.. LC3 and GATE-16 N termini mediate membrane 

fusion processes required for autophagosome biogenesis. 

Dev Cell. 2011a Apr 19;20(4):444-54. 

Weidberg H, Shvets E, Elazar Z.. Biogenesis and cargo 

selectivity of autophagosomes. Annu Rev Biochem. 2011b 

Jun 7;80:125-56. 

Yang S, Wang X, Contino G, Liesa M, Sahin E, Ying H, 

Bause A, Li Y, Stommel JM, Dell'antonio G, Mautner J, 

Tonon G, Haigis M, Shirihai OS, Doglioni C, Bardeesy N, 

Kimmelman AC.. Pancreatic cancers require autophagy for 

tumor growth. Genes Dev. 2011 Apr 1;25(7):717-29. Epub 

2011 Mar 15. 


Mehrpour M, Botti J, Codogno P. Mechanisms and 

regulation of autophagy in mammalian cells. Atlas Genet 






Paper co-edited with the European LeukemiaNet 


A new case of t(5;14)(q31;q32) in a pediatric 

acute lymphoblastic leukemia presenting with 

hypereosinophilia 

Marta Gallego, Mariela Coccé, María Felice, Jorge Rossi, Silvia Eandi, Gabriela Sciuccati, 

Cristina Alonso 

Laboratorio de Citogenetica - Servicio de Genetica - Servicio de Inmunologia y Reumatologia - 

Servicio de Hemato-Oncologia, Hospital de Pediatria "Prof. Dr. J. P. Garrahan", Buenos Aires, 

Argentina (MG, MC, MF, JR, SE, GS, CA) 


Online updated version : http://AtlasGeneticsOncology.org/Reports/t514q31q32GallegoID100055.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t514q31q32GallegoID100055.txt 



Clinics 

Age and sex 

11 years old male patient. 

Previous history 

Preleukemia. The patient presented with a chronic 

eosinophilic leukemia 3 months before developing 

ALL. No previous malignancy. No inborn condition 

of note 

Organomegaly 

Hepatomegaly (4 cm from below costal rib), 

splenomegaly (3 cm from below costal rib), no 

enlarged lymph nodes , no central nervous system 

involvement. 

Blood 

WBC : 48 with 62% of eosinophils X 10 9 /l 

HB : 7.0g/dl 

Platelets : 79 X 10 9 /l 

Blasts : 15% 

Bone marrow : Normal cellularity was replaced by 

60% of lymphoblasts FAB L1 morphology%. 

Cyto-Pathology 


Immunophenotype 

Pre-B ALL (EGIL classification B III). 

The blasts expressed CD45, CD19, CD10, CD34, 

HLA-DR, cCD79a, cCD22, Tdt and cytoplasmic 

micro chain, partial CD20 and CD33 and were 

negative for CD2, CD7, CD13, CD15, CD117 and 

CD3. 

Diagnosis 

Acute lymphoblastic leukemia following a chronic 

eosinophilic leukemia. 

Survival 

Date of diagnosis: 03-2008 

Treatment: Chemotherapy for ALL (12-ALLIC 02 

protocol) 

Complete remission was obtained. 

Treatment related death : no 

Relapse : yes 

Phenotype at relapse 

During continuation phase hypereosinophilia was 

observed in peripheral blood, but low percentage of 

lymphoblasts was detected during 2-3 weeks before 

relapse. After this finding, the patient presented 

CNS infiltration by eosinophils (70% of WBC 

detected in CSF). He presented a bone marrow 

infiltration by dysplastic eosinophils and less than 

5% of lymphoblasts after 18 months from achieving 

CR and a hematological relapse was diagnosed. 

Status: Death 06-2010 

Survival: 21 months 


A new case of t(5;14)(q31;q32) in a pediatric acute 

lymphoblastic leukemia presenting with hypereosinophilia 

Karyotype 

Sample: Bone marrow 

Culture time: 24h 

Banding: G banding 

Results 

Karyotype at time of diagnosis of ALL: 

46,XY,t(5;14)(q31;q32)[4]/46,XY[12] 

Karyotype at Relapse 

46,XY,t(3;8)(p21;q24),t(5;14)(q31;q32)[2]/46,XY[ 

18] 

Other Molecular Studies 

Technics: 

RT-PCR non evaluable, due to control gene non 

amplifiable. 

Partial GTG banded karyotype showing t(5;14)(q31;q32). 

Comments 

To our knowledge nine cases (8M/1F) of ALL with 

eosinophilia and t(5;14)(q31;q32) have been 

reported in the literature. Five of them were 

described in childhood ALL. The prognosis of 

t(5;14)(q31;q32) seems to be very poor. Our patient 

relapsed and died 21 months after diagnoses. 

References 

Tono-oka T, Sato Y, Matsumoto T, Ueno N, Ohkawa M, 

Shikano T, Takeda T. Hypereosinophilic syndrome in 

acute lymphoblastic leukemia with a chromosome 

translocation [t(5q;14q)]. Med Pediatr Oncol. 

1984;12(1):33-7 

Gallego M, et al. 

Hogan TF, Koss W, Murgo AJ, Amato RS, Fontana JA, 

VanScoy FL. Acute lymphoblastic leukemia with 

chromosomal 5;14 translocation and hypereosinophilia: 

case report and literature review. J Clin Oncol. 1987 

Mar;5(3):382-90 

McConnell TS, Foucar K, Hardy WR, Saiki J. Three-way 

reciprocal chromosomal translocation in an acute 

lymphoblastic leukemia patient with hypereosinophilia 

syndrome. J Clin Oncol. 1987 Dec;5(12):2042-4 

Baumgarten E, Wegner RD, Fengler R, Ludwig WD, 

Schulte-Overberg U, Domeyer C, Schüürmann J, Henze 

G. Calla-positive acute leukaemia with t(5q;14q) 

translocation and hypereosinophilia--a unique entity? Acta 

Haematol. 1989;82(2):85-90 

Grimaldi JC, Meeker TC. The t(5;14) chromosomal 

translocation in a case of acute lymphocytic leukemia joins 

the interleukin-3 gene to the immunoglobulin heavy chain 

gene. Blood. 1989 Jun;73(8):2081-5 

Fishel RS, Farnen JP, Hanson CA, Silver SM, Emerson 

SG. Acute lymphoblastic leukemia with eosinophilia. 

Medicine (Baltimore). 1990 Jul;69(4):232-43 

Meeker TC, Hardy D, Willman C, Hogan T, Abrams J. 

Activation of the interleukin-3 gene by chromosome 

translocation in acute lymphocytic leukemia with 

eosinophilia. Blood. 1990 Jul 15;76(2):285-9 

Chen Z, Morgan R, Sandberg AA. Non-random 

involvement of chromosome 5 in ALL. Cancer Genet 

Cytogenet. 1992 Jul 1;61(1):106-7 

Heerema NA, Palmer CG, Weetman R, Bertolone S. 

Cytogenetic analysis in relapsed childhood acute 

lymphoblastic leukemia. Leukemia. 1992 Mar;6(3):185-92 

Knuutila S, Alitalo R, Ruutu T. Power of the MAC 

(morphology-antibody-chromosomes) method in 

distinguishing reactive and clonal cells: report of a patient 

with acute lymphatic leukemia, eosinophilia, and t(5;14). 

Genes Chromosomes Cancer. 1993 Dec;8(4):219-23 

Gmidène A, Sennana H, Elghezal H, Ziraoui S, Youssef 

YB, Elloumi M, Issaoui L, Harrabi I, Raynaud S, Saad A. 

Cytogenetic analysis of 298 newly diagnosed cases of 

acute lymphoblastic leukaemia in Tunisia. Hematol Oncol. 

2008 Jun;26(2):91-7 


Gallego M, Coccé M, Felice M, Rossi J, Eandi S, Sciuccati 

G, Alonso C. A new case of t(5;14)(q31;q32) in a pediatric 

acute lymphoblastic leukemia presenting with 

hypereosinophilia. Atlas Genet Cytogenet Oncol Haematol. 

2012; 16(2):181-182. 





Paper co-edited with the European LeukemiaNet 


Chromosomal translocation t(X;11)(q22;q23) 

involving the MLL gene 

Adriana Zamecnikova, Soad Al Bahar, Hassan A Al Jafar, Rames Pandita 

Kuwait Cancer Control Center, Dep of Hematology, Laboratory of Cancer Genetics, Kuwait (AZ, SA, 

RP), Dep of Hematology, Amiri Hospital, Kuwait (HAAJ) 


Online updated version : http://AtlasGeneticsOncology.org/Reports/tX11q22q23ZamecID100056.html 

Printable original version : http://documents.irevues.inist.fr/bitstream/DOI tX11q22q23ZamecID100056.txt 



Clinics 

Age and sex 

15 months old male patient. 

Previous history 

No preleukemia. No previous malignancy. No 

inborn condition of note. 

Organomegaly 

No hepatomegaly, no splenomegaly, no enlarged 

lymph nodes, no central nervous system 

involvement. 

Blood 

WBC : 50.2 (neutrophils 2%, lymphocytes 68%, 

probably blasts, monocytes 16%, atypical 

lymphocytes 14% undifferenciated cells) X 10 9 /l 

HB : 10.2g/dl 

Platelets : 191 X 10 9 /l 

Blasts : 14% 

Bone marrow : The bone marrow was 

hypercellular with more than 50% blasts that were 

positive for CD45, CD33, CD15, CD13, CD14 and 

HLA-DR. 

Cyto-Pathology 


Cytology: AML M4 

Immunophenotype: M4. CD13+,CD14+, CD15+, 

CD33+, CD45+, CD64+ and MPO. 

Diagnosis: Acute myelomonocytic leukemia. 

Survival 

Date of diagnosis: 02-2010 

Treatment: Chemotherapy (ADE) 

Complete remission was obtained. 

Treatment related death : no 

Relapse : no 

Status: Alive. Last follow up: 02-2011 

Survival: 12 months 

Karyotype 

Sample: BM 

Culture time: 24h 

Banding: G-band 

Karyotype at Relapse 

46,XY [5] / 46,Y,t(X;11)(q22;q23) [25] 

Other molecular cytogenetics technics 

Fluorescence in situ hybridization. 

Other molecular cytogenetics results 

MLL rearrangement was identified using the LSI 

MLL (11q23) Dual Color Break Apart 

Rearrangement probe (Abbott Molecular) revealing 

80% of cells with MLL rearrangement. The 

rearrangement was confirmed in metaphases 

demonstrating that the distal part of the MLL gene 

was juxtaposed to the der(X) chromosome. 


Chromosomal translocation t(X;11)(q22;q23) involving the 

MLL gene 

Zamecnikova A, et al. 

Top: partial karyotype of the patient. Bottom: fluorescence in situ studies were performed successively on G-banded slides 

prepared for chromosome analysis using a locus-specific, break-apart probe for MLL (green and red signals) and with 

centromeric X/Y probe (Vysis) (red and green signal). Hybridization on metaphase cells with the MLL probe detected one MLL 

signal on the normal chromosome 11 (red-green fusion signal) and signals on the der(11) (green signal) and the der(X), 

confirming MLL disruption. The red signal from MLL has moved to the derivative chromosome X, indicating that the breakpoint is 

in the 5' of the MLL gene. Arrows indicate derivative chromosomes, arrow heads are pointing to derivative chromosomes X and 

11. 

Comments 

A previously healthy, 15 months-old boy presented 

with fever, and chest infection was diagnosed with 

acute myeloid leukemia FAB M4 in February 2010. 

His biochemistry was significant for GGT (8 IU/L; 

normal 9-40) and LDH 350 (normal 90-225). 

Chromosomal studies performed at diagnosis 

revealed the karyotype 46,Y,t(X;11)(q22;q23) in 25 

out of 30 metaphases. Fluorescence in situ 

hybridization study showed rearrangement of the 

MLL gene in interphase and metaphase cells 

revealing that the break-apart 5'-MLL segment is 

translocated to the derivative X chromosome. The 

patient achieved a complete hematological 

remission with chemotherapy one month later. 

Chromosomal and FISH studies performed in April, 

June, August and December confirmed the 

complete cytogenetic response without 

rearrangment of the MLL gene. He remains disease 

free 1 year from diagnosis. Our case together with 

the few reported similar cases suggest that 

chromosomal band Xq22 is a recurring 11q23 

chromosomal partner in a subgroup of infant 

leukemia patients with AML. 

As the gene in Xq22 is yet unknown, it is therefore 

uncertain whether this translocation involve a new 

MLL partner. Due to the similar clinical features 

with patients with t(X;11)(q13;q23) involving the 

FOXO4/MLL genes, (such as occurrence in infants 

and young children diagnosed with acute 

myelomonocytic leukemia), the possibility of 

involvement of FOXO4 or FOXO related gene in 

our patient cannot be excluded. In addition as MLL 

rearrangements are frequently confirmed in cases 

with highly complex changes, complex and/or 

cryptic changes cannot be excluded. 

References 

Harrison CJ, Cuneo A, Clark R, Johansson B, Lafage- 

Pochitaloff M, Mugneret F, Moorman AV, Secker-Walker 

LM. Ten novel 11q23 chromosomal partner sites. 

European 11q23 Workshop participants. Leukemia. 1998 

May;12(5):811-22 

Ribeiro RC, Oliveira MS, Fairclough D, Hurwitz C, Mirro J, 

Behm FG, Head D, Silva ML, Raimondi SC, Crist WM. 

Acute megakaryoblastic leukemia in children and 

adolescents: a retrospective analysis of 24 cases. Leuk 

Lymphoma. 1993 Jul;10(4-5):299-306 

Soszynska K, Mucha B, Debski R, Skonieczka K, 

Duszenko E, Koltan A, Wysocki M, Haus O. The 

application of conventional cytogenetics, FISH, and RT- 

PCR to detect genetic changes in 70 children with ALL. 

Ann Hematol. 2008 Dec;87(12):991-1002 


Zamecnikova A, Al Bahar S, Al Jafar HA, Pandita R. 

Chromosomal translocation t(X;11)(q22;q23) involving the 

MLL gene. Atlas Genet Cytogenet Oncol Haematol. 2012; 

16(2):183-184. 





Instructions to Authors 

Manuscripts submitted to the Atlas must be submitted solely to the Atlas. 

Iconography is most welcome: there is no space restriction. 

The Atlas publishes "cards", "deep insights", "case reports", and "educational items". 

Cards are structured review articles. Detailed instructions for these structured reviews can be found at: 

http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, 

http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, 

http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, 

http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. 

According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" 

(between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by 

bibliographic databases. 

Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length 

restriction. 

Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in 

leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in 

at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, 

and 4- with iconography of chromosomes. 

It is mandatory to use the specific "Submission form for Case reports": 

see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. 

Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, 

German, Italian, and Spanish are welcome. 

Subscription: The Atlas is FREE! 

Corporate patronage, sponsorship and advertising 

Enquiries should be addressed to Editorial@AtlasGeneticsOncology.org. 

Rules, Copyright Notice and Disclaimer 

Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to 

editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members 

must disclose any potential conflict. 

Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If 

complete anonymity is difficult to achieve, informed consent should be obtained. 

Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the 

cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, 

nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further 

the content of their papers published in the Atlas, provided that the source is cited. 

Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general 

distribution. All rights are reserved. The information presented is protected under international conventions and under 

national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the 

Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with 

commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as 

the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver 

convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or 

otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions 

of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web 

site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, 

express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal 

liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever 

for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, 

and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to 

persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. 

See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical 

Publication - Updated October 2004": http://www.icmje.org. 

http://AtlasGeneticsOncology.org 

© ATLAS - ISSN 1768-3262



OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section - Atlas of Genetics and Cytogenetics

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?