Genetic Diversity of Aquilaria crassna - APAFRI-Asia Pacific ...

Genetic Diversity of Aquilaria crassna(Thymelaeaceae) in Thailand usingMicrosatellite Markers1,2Sudarat Buapech, 1 Suchitra Changtragoon, 2 Wichan Eiadthong1 Forest Genetic and Biotechnology Research Division, Forest and Plant ConservationResearch office, National Park, Wildlife and Plant Conservation Department, Thailand2 Department of Forest Biology, Faculty of Forestry Kasetsart University, Thailand

Aquilaria crassna or Agarwood• Family Thymelaeaceae•genus AquilariaDistributed from India, Burma,Indochina, SE China andwidespread in SE Asia

ThailandAquilaria crassna Pierre ex H. Lec.A. malaccensis Lamk.A. rugosa L.C. Kiet & KresslerA. hirta Ridl.A. subintegra Ding Hou.

USEtraditional medicineIncensePerfumeCosmeticsTea

Increasing demand andhigh price• seven Aquilaria species arecategorized as vulnerable• A. crassna recognized in IUCNred list as critically endangered

Houpooling,Mae Hong Son, ThailandAll species of Aquilariaand Gyrinops wereplaced on the AppendixII list of Convention onInternational Trade inEndangered Species ofWild Fauna and Flora(CITES) to improvecontrol of commercialagarwood tradePhu luang Wildlife Sanctuary,Loei, Thailand

Molecular markers• Biochemical markersIsozymeProduct of gene• DNA-based markersRAPDAFLPMicrosatellite (SSR)DNA

Microsatellite marker• SSR markerCore sequence 1-6 base• PCR based• Codominant• Highly quantityof information• High cost of development

ObjectivesThis study were to measure genetic variationand population genetic structure in naturalpopulations of A. crassna in Thailand and tosuggest guidelines for species conservation usingthe acquired genetic information

Materials and methods

Collection of the sample41 Khon Kaen (KKN)3122 Udon Thani(UDN)3 Phetchabun (PNB)5674 Chiang Mai (CMI)5 Prachinburi(PRI)6 Chanthaburi (CTI)7 Trat (TRT)20 samples per population

Extract DNALiquidnitrogenCTABCentrifugationIsopropanolPrecipitationCentrifugationThree timesCIAThree timesEthanolCentrifugationRNase

Genomic DNA of agarwoodM 1 2 3 4 5 6 7 8 9 10 11 MElectron(-)(M = 1 Kb ladder marker)(+)

Polymerase Chain Reaction• DNA (25 ng/l) 2 l• Primer F (10 M)0.5 l• Primer R (10 M)0.5 l• 10X PCR Buffer (15 mM MgCl 2 ) 1 l• dNTP (1 mM) 1 l• Taq DNA polymerase 0.1 l• Ultra pure water4.9 l• Total10 l

Polymerase Chain Reaction1.Pre-heat 94 ๐ C 3 min2. Denature 94 ๐ C 30 sAnnealing 50-64 ๐ C 30 sExtension 72 ๐ C 1 s28 cycles3. Final extension 72 ๐ C 5 min

Microsatellite loci and conditions of annealing temperatures(Tm), repeat pattern, allele size, for six polymorphicmicrosatellite loci in Aquilaria crassnaLocus Repeat motif Primer sequence(5'-3') Tm( o C)Expectedallelesize(bp)6pa18 (CA) 8 F: TGAGGCGTGAGTGAGATATTGATT 50 210R: CCTTCCTCTCTTCTTACCTCACCA10pa17 (CA) 12 F: CACACACTCTTATGGTCTACAGCTTR:TTCGCCATCTCATAATATTCTAATGTA16pa17 (CA) 19 F: AGTGAACAACTTGACTACGCTTGR:GCTGAACACAACAACATATCACCBMX1 (AG) 22 F: GTGAAGTGAGGAGACGCAGCCR:CAGAAACCCTACCCGAACAGBMX3 (AG) 20 F:CCAAGCCTCACAAGGATTGTCR:CCCTAAATGCGACGGTBMX7 (AG) 15 F:TCTTTTGTGAGGTAGGCCATT50 15656 15562 39764 36562 366R:CCTCTTCTCTTCCGCTTCCF, forward; R, reverse.

Polymerase chain reaction(PCR)ElectrophoresisNon-denaturing polyacrylamide gel- 6% polyacrylamide- EtBr- Real time laser scanning electrphoresis(Gelscan 3000)

Prachinburi population , primer 10pa17

DATA ANALYSIS• average number of alleles per locus ,A• the average effective number of alleleper locus, Ne• heterozygosityobserved heterozygosity, H oexpected heterozygosity, H eTFPGA v.1.3• genetic distance• an unweighted pair group method witharithmetic average (UPGMA)

Results and Discussion

Number of individuals in population (N), alleles per locus(Na), effective number of alleles (Ne), observed (Ho) andexpected heterozygosity (He) in Aquilaria crassnapopulations over all lociPopulation N Na Ne Ho HeKhon Kaen 20 2.83 2.03 0.4167 0.5060Udon Thani 20 2.83 2.54 0.5074 0.5028Phetchabun 20 3.17 2.06 0.5000 0.4573Chiang Mai 20 2.33 1.62 0.5083 0.3626Prachinburi 20 2.83 1.89 0.5333 0.4417Chanthaburi 20 2.50 2.03 0.5000 0.4607Trat 20 2.33 2.05 0.5000 0.4553Overall 20 2.69 2.03 0.4951 0.4552

Genetic distance between populations.POP KKN UDN PNB CMI PRI CTI TRTKKN *****UDN 0.1571 *****PNB 0.4342 0.4245 *****CMI 0.4361 0.4052 0.4588 *****PRI 0.2456 0.2686 0.4752 0.4343 *****CTI 0.2575 0.2767 0.4123 0.5658 0.2310 *****TRT 0.2897 0.2746 0.4599 0.5576 0.2867 0.1598 *****

Dendrogram

CBAAAA A

Conclusion and suggestion• average number of alleles per locus, A = 5.83• the average effective number of alleles per locus, Ne = 2.69• expected heterozygosity (H e )highest in Khon Kaen population = 0.5060lowest in Chiang Mai population = 0.3626• UPGMA tree separated the populations into three groups(A, B, and C)A = population from the Northeast and the EastB = population from the WestC = population from the North

Conclusion and suggestion• The genetic diversity and distance reflectedgeographic distribution• Future, should find private and unique alleles specific tothe Sub-region of Thailand, since the results shows thereflection of genetic variation and population distribution•Unique and private alleles for each pop and sub regionscan be use for illegal wood forensics in the future

Provides data on the genetic diversity of A. crassnaImprovementIn situEx situSustainable yield

THANK YOU• Department of National Park, Wildlifeand Plant Conservation, Bangkok ,Thailand• Graduate School, Kasetsart University,Bangkok , Thailand

THANK YOU FOR ATTENTION