BIBLIOGRAPHY1. American Type Culture Collection(http://www.atcc.org/)2. Agricultural Research Service CultureCollection, USDA(http://nrrl.ncaur.usda.gov/)3. Arx von, J.A. 1981. The Genera of FungiSporulating in Pure Culture. 3 rd ed. J. Cramer,Vaduz, Germany.4. Beneke, E.S. and Rogers, A.L. 1996.Medical Mycology and Human Mycoses.Star Publishing Company.5. Barnett, H.L. and Hunter, B.B. 1987.Illustrated Genera of Imperfect Fungi. 4 th ed.Macmillan Publishing Co. New York.6. Barnett, J.A., Payne, R.W., Yarrow, D. 2000.Yeasts: Characteristics and Identification.3 rd ed. Cambridge University Press, UK.7. Barron, G.L. 1968. The Genera ofHyphomycetes from Soil. Williams andWilkins Co.8. Carmichael, J.W., Kendrick, W.B., Conners,I.L., Sigler, L. 1980. Genera ofHyphomycetes. University of Alberta Press,Edmonton.9. The Centraalbureau voor Schimmelcultures(CBS) Fungal Biodiversiry Centre(http://www.cbs.knaw.nl/About/)10. De Hoog, G.S., Guarro, J., Gene, J., andFigueras, M.J. 2009. Atlas of Clinical Fungi.3 rd ed (CD-ROM version). Centraalbureauvoor Schimmelcultures, Utrecht, TheNetherlands.11. Domsch, K.H., Gams, W., Anderson, T.H.1980. Compendium of Soil Fungi, Vols. 1and 2. Academic Press. New York.12. Ellis, M.B. 1971. DematiaceousHyphomycetes. Commonwealth MycologicalInstitute, Kew, Surrey, England.13. Ellis, M.B. 1976. More DematiaceousHyphomycetes. Commonwealth MycologicalInstitute, Kew, Surrey, England.14. Fisher, F. and Cook, N.B. 1998.Fundamentals of Diagnostic Mycology. W.B.Saunders Company, Philadelphia.15. Folds, J.D., Hamilton, R.G., and Detrick, B.2006. Manual of Molecular and ClinicalLaboratory Immunology. 6 th ed. ASM Press,Washington, D.C.16. Gilman, J.C. 1957. A Manual of Soil Fungi.2 nd ed. Iowa State University Press, Ames,Iowa. Davis Company, Philadelphia.17. Hamlin, R. 1990. Illustrated Genera ofAscomycetes. APS press. The AmericanPhytopathological Society. St. Paul.Minnesota.18. Japan Collection of Microorganisms(http://www.jcm.riken.go.jp/)19. Kendrick, W.B., Carmichael, J.W. 1973.Hyphomycetes. In Ainsworth GC SparrowFK, Sussman AS. (eds). The Fungi. Vol.IVA. Academic Press, New York, 323-509.20. Kern, M.E. and Blevins, K.S. 1997. MedicalMycology – A Self-Instructional Text. 2 nd ed.F.A. Davis, Philadelphia.21. Kiffer, E. and Morelet, M. 1999. TheDeuteromycetes – Mitosporic Fungi,Classification and Generic Keys. SciencePublishers Inc. U.S.A.22. Klich, M.A. 2002. Identification of commonAspergillus species. 1 st ed. Centraalbureauvoor Schimmelcultures, Utrecht, TheNetherlands.23. Kurtzman, C.P. and Fell, J.W. 1998. TheYeasts, a taxonomic study. 4 th ed. Elsevier,New York, NY.24. Kwon-Chung, K.J., Bennett, J.E. 1992.Medical Mycology. Lea & Febiger,Philadelphia.25. Larone, D.H. 2002. Medically ImportantFungi – A Guide to Identification. 4 th ed,ASM Press, Washington, D.C.26. McGinnis, M.R. 1980. Laboratory Handbookof Medical Mycology. Academic Press, NewYork.27. Murray, P.R., Baron, E.J., Pfaller, M.A.,Tenover, F.C., Yolken, R.H. 2010. Manual ofClinical Microbiology. 10 th ed. ASM Press,Washington, D.C.58
28. New York State Department of HealthMycology Proficiency Testing ProgramYeasts/Molds Master List and Instructions.<strong>January</strong> <strong>2011</strong>.29. Raper, K.B. and Fennell, D.I. 1973. TheGenus Aspergillus. Robert E. KriegerPublishing Company, Huntington, NewYork.30. Rebell, G. and Taplin, D. 1972.Dermatophytes - Their Recognition andIdentification. University of Miami Press,Coral Gables, FL.31. Rippon, J.W. 1988. Medical Mycology – ThePathogenic Fungi and the PathogenicActinomycetes. W.B. Saunders Company,Philadelphia.32. St-Germain, G. and Summerbell, R. <strong>2011</strong>.Identifying Fungi – A Clinical LaboratoryHandbook. 2 nd Edition. Star PublishingCompany, Belmont, CA.33. Sutton, D.A., Fothergill, A.W., and Rinaldi,M.G. 1998. Guide to Clinically SignificantFungi. Williams and Wilkins, A WaverlyCompany, Baltimore.34. The United Kingdom National CultureCollection UKNCC(http://www.ukncc.co.uk/html/Databases/search.asp)35. University of Alberta MicrofungusCollection(http://www.devonian2.ualberta.ca/uamh/)59
- Page 2 and 3:
Dr. Vishnu Chaturvedi, DirectorDr.
- Page 4 and 5:
Schedule of 2011 Mycology PT Mailou
- Page 6:
Mycology - GeneralANSWER KEY AND LA
- Page 9 and 10: MOLD DESCRIPTIONSM-1 Exophiala spp.
- Page 11 and 12: D1/D2 domain sequence analysis. FEM
- Page 13 and 14: M-2 Aspergillus versicolorSource: S
- Page 15: prospective multicenter surveillanc
- Page 18 and 19: M-3 Chaetomium spp.Source: FootLabo
- Page 20 and 21: 5. Valinsky, L., Della Vedova, G.,
- Page 22 and 23: M-4 Trichophton rubrumSource: Nail
- Page 24 and 25: 3. Cetinkaya, Z., Kiraz, N., Karaca
- Page 26 and 27: M-5 Paecilomyces spp.Source: Scalp
- Page 28 and 29: A. B.Figure 9. (A) Seven-day-old, y
- Page 30 and 31: Query 61 CCACTTACACCTGTGAACTGTTCTAC
- Page 32 and 33: Figure 11. Seven-day-old, white to
- Page 34 and 35: 201 250ATCTCTTGGC TCTCGCATCG ATGAAG
- Page 36 and 37: Figure 13. Seven-day-old, mucoid, s
- Page 38 and 39: Query 121 GAGCGAACTCCTATTCACTTATAAA
- Page 40 and 41: Y-4 Rhodotorula minutaSource: Sputu
- Page 42 and 43: Figure 17. Seven-day-old, soft, smo
- Page 44 and 45: Query 61 CCCTCACCTCTGTGAACTGTGGACCT
- Page 46 and 47: Figure 19. Five-day-old, white crea
- Page 48 and 49: Summary:Table 3. Laboratory Perform
- Page 50 and 51: Table 5. Antifungal Susceptibility
- Page 52 and 53: determination of broth dilution min
- Page 54 and 55: Table 6. Summary of quantitative as
- Page 56 and 57: Summary of Molecular Tests SurveyDu
- Page 60: Copyright © 2011 Wadsworth CenterN
Change language