Permanent Genetic Resources Note Thirty-one short red fox (Vulpes ...

More documents

Recommendations

Info

Molecular Ecology ResourcesPage 6 of 11112113Ichikawa Y, Takahashi S, Tsumagari M, et al (2002) Identification and characterization of 40dinucleotide microsatellites in the dog genome. Animal Genetics, 3, 400-402.114115Kaplinski L, Andreson R, Puurand T, Remm M (2005) MultiPLX: automatic grouping andevaluation of PCR primers. Bioinformatics, 21, 1701-1702.116117Karolchik D, Baertsch R, Diekhans M, et al (2003) The UCSC Genome Browser Database.Nucleic Acids Research, 31,51-54.118119Ostrander EA, Sprague GF, Rine J (1993) Identification and Characterization of dinucleotiderepeat (CA)n markers for genetic mapping in dog. Genomics, 16, 207-213.120121122Sacks B, Louie S (2008) Using the dog genome to find single nucleotide polymorphisms in redfoxes and other distantly related members of the Canidae. Molecular Ecology Resources,8, 35-49.123124125Sacks BN, Statham MJ, Perrine JD, Wisely SM, Aubry KA (in press) North American montanered foxes: expansion, fragmentation, and the origin of the Sacramento Valley red fox.Conservation Genetics126127Wandeler P, Funk SM (2005) Short microsatellite DNA markers for the red fox (Vulpes vulpes).Molecular Ecology, 6, 98-100.128129130Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004) MICRO-CHECKER: softwarefor identifying and correcting genotyping errors in microsatellite data. MolecularEcology Notes, 4, 535-538.
Page 7 of 11Molecular Ecology ResourcesTable 1. Characterization of 31 red fox microsatellite loci and one sex marker, indicating whether primers necessitated redesigning(N), fluorescent dye, multiplex set (M), and screening of 31 red foxes for number of alleles (NA), size range,expected heterozygosity (He), observed heterozygosity (Ho), and polymorphic information content (PIC).Locus aRepeatmotifHe Ho PICPrimer sequence Dye M NA Size(bp) brangeAHT121 (CA) 22 F-TATTGCGAATGTCACTGCTT VIC 5 9 85-111 0.82 0.81 0.77R-ATAGATACACTCTCTCTCCGAHT133 (CA) 23 F-AGCCCTGAGTTTGCTACATTT (N) PET 2 5 154-168 0.65 0.46 0.59R-GCAGGAAGAGGTGCAATCTCAHT137 (CA) 21 F-TACAGAGCTCTTAACTGGGTCC VIC 4 8 123-149 0.76 0.6 0.71R-CCTTGCAAAGTGTCATTGCTAHTh171 (CA) 13 F-AGGTGCAGAGCACTCACTCA PET 3 5 155-167 0.70 0.64 0.62R-CCTCAAACCCAGGTGAAGC (N)C01.424 (GT) 11 F-AGCCTAGCTTACTGCCCTGG (N) PET 1 4 179-185 0.69 0.77 0.63C04.140 (GA) 3(GT) 19R-TCCTTTGGTTTTTAGCAGGGF-CAGAGGTGGCATAGGGTGAT NED 1 8 139-161 0.83 0.83 0.79R-TCGAAGCCCAGAGAATGACTC08.618 (GT) 18 F-CAACCCAGGGTGGAAGC 6-FAM 2 7 190-202 0.83 0.48* 0.78R-GCCCAGAATCCATTGAGAAA (N)CPH2 (GT) 19 F- TTCTGTTGTTATTGGCACCA (N) NED 2 8 93-111 0.79 0.71 0.74R-TTCTTGAGAACAGTGTCCTTCGCPH3 (TC) 17 F-CAGGTTCAAATGATGTTTTAAG (N) NED 4 7 158-174 0.74 0.56 0.69
Page 1: Page 1 of 11Molecular Ecology Resou
Page 4 and 5: Molecular Ecology ResourcesPage 4 o
Page 8 and 9: Molecular Ecology ResourcesPage 8 o
Page 10 and 11: Molecular Ecology ResourcesPage 10

Permanent Genetic Resources Note Thirty-one short red fox (Vulpes ...

Create successful ePaper yourself

Delete template?

Save as template?