BARLEY GENETICS NEWSLETTER - GrainGenes

More documents

Recommendations

Info

Barley Genetics Newsletter (2008) 38:4-6 Table 1. Average dry matter yield (g plot -1 ) of inoculated vs. uninoculated (control) Virden, CDC Earl and RILs treated with VAM. Source Control Inoculated Standard Error Significance Response CDC Earl 399.1 435.5 16.1 ** Increase Virden 516.5 469.4 27.3 * Decrease RILs 450.1 436.7 19.0 ns Decrease Average 455.2 447.2 Std. Error 34.0 11.1 CV 7.5 2.5 Table 2. Average grain yield (g plot -1 ) of inoculated vs. uninoculated (control) Virden, CDC Earl and RILs treated with VAM. Source Control Inoculated Standard Error Significance Response CDC Earl 128.2 140.8 6.1 ** Increase Virden 97.8 97.6 8.5 ns No change RILs 117.4 119.6 4.3 ns Increase Average 114.5 119.3 Std. Error 8.9 12.5 CV 7.8 10.5 Acknowledgements The author is grateful to Dr. R.B. Irvine for suggesting the topic and to Dr. R. Mohr for providing the plot land. References Bagyaraj, D.J. 1991. Ecology of vesicular-arbuscular mycchorizae. In: Handbook of Applied Mycology: Soil and Plants (Eds. D.K. Arola, R. Rai, K.G. Mukerjii and G.R. Knudsen) pp. 3-34. Marcel Dekker, New York, USA. Boyetchko, S.M. and J.P. Tewari. 1995. Susceptibility of barley cultivars to vesicular-arbuscular mycorrhizal fungi. Can. J. Plant Sci. 75(1): 269-275. Jensen, A. 1982. Influence of four vescicular-arbuscular micorrhyzal fungi on nutrient uptake and growth in barley. New Phytol. 90: 45-50. Jensen, A. 1984. Response of barley, pea and maize to inoculation with different vesiculararbuscular mycchorizal fungi in irradiated soil. Plant and Soil 78(3): 315-323. SAS Institute. 1988. SAS user’s guide: Statistics. Version 6.04 ed., SAS Inst., Cary, NC. 6
Barley Genetics Newsletter (2008) 38:7-9 A vrs1 mutant in CIho 4196 to facilitate breeding of 6-rowed cultivars with Fusarium Head Blight resistance. Christine Boyd 1 , Richard Horsley 2 , and Andris Kleinhofs 1 1 Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420 2 Department of Plant Sciences, North Dakota State University, Fargo, ND 58105-5051 Development of commercial 6-rowed Fusarium Head Blight (FHB) cultivars has been difficult due to the close linkage of the 2-rowed (Vrs1) trait to a major FHB resistance QTL on chromosome 2H bin10 (Horsley et al. 2006; Mesfin et al. 2003). We have initiated a mutation program with the FHB resistant 2-rowed line CIho4196 to convert it to a 6-rowed (vrs1) phenotype and to correct other undesirable traits such as tall stature and late ripening (Boyd et al. 2007). We have now confirmed a vrs1 mutant in CIho 4196 background. This mutant should facilitate breeding for 6-rowed Fusarium Head Blight (FHB) resistant cultivars since it is closely linked with the chromosome 2H bin10 FHB resistance. The mutant designated G07-014 was isolated in a gamma irradiated CIho 4196 M2 population (proposed gene and allele designation vrs1.u). The mutant phenotype was confirmed in Pullman, WA summer 2008 and genotype confirmed sequencing. Sequence analysis revealed that the mutant vrs1 gene has a 9 nucleotide (nt) deletion compared with the wild-type CIho 4196 Vrs1 gene (Fig. 1). (750) g07-014 Vrs1 (287) CIho4196 Vrs1 (750) Consensus (750) 750 760 770 780 790 800 810 825 ACCCCAAGAAGCGGCGGCTCACCGACGAG---------ATTCTGGAGCTGAGCTTCCGGGAGGACCGCAAGCTGGA ACCCCAAGAAGCGGCGGCTCACCGACGAGCAGGCCGAGATTCTGGAGCTGAGCTTCCGGGAGGACCGCAAGCTGGA ACCCCAAGAAGCGGCGGCTCACCGACGAG ATTCTGGAGCTGAGCTTCCGGGAGGACCGCAAGCTGGA Fig.1 Comparison of the CIho 4196 Vrs1 and gene sequence with the mutant G07-014 gene sequence. Since the 9 nt deletion does not result in a frameshift, we wondered why the protein is inactivated. It turned out that the deletion is at the beginning of the homeodomain of exon II, a critical region of the gene (Fig. 2). Hox 1 Exon I Exon II Splicing product of Vrs1 CI 1-4 7 669 bp Exon III Fig. 2. CIho 4196 Vrs1 cDNA structure. The approximate location of the 9 nt deletion is boxed. The homeodomain region is underlined. 7
Page 1 and 2: Barley Genetics Newsletter Volume 3
Page 3 and 4: INSTRUCTIONS FOR CONTRIBUTORS TO VO
Page 5 and 6: INSTRUCTIONS FOR CONTRIBUTORS TO VO
Page 7 and 8: at RVAU as a lecturer, as well as c
Page 9 and 10: Barley Genetics Newsletter (2008) 3
Page 13: Barley Genetics Newsletter (2008) 3
Page 51 and 52: Table 1. contin. GSHO number Barley
Page 65 and 66:
Barley Genetics Newsletter (2008) 1
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Page 95 and 96:
show all

BARLEY GENETICS NEWSLETTER - GrainGenes

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?