Ammonium transport in the colonic crypt cell line, T84: Role for ...

Page 1 of 45
Articles in PresS. Am J Physiol Gastrointest Liver Physiol (November 21, 2007). doi:10.1152/ajpgi.00251.2006
Ammonium transport in the colonic crypt cell line, T84:
Role for Rhesus Glycoproteins and NKCC1.
Roger T. Worrell 1,2,* , Lisa Merk 1 , and Jeffrey B. Matthews 3
*To whom correspondence should be addressed.
1 Department of Surgery
2 Department of Molecular and Cellular Physiology
University of Cincinnati
Cincinnati, OH 45219
3 Department of Surgery
University of Chicago
Chicago, IL 60637
e-mail: Roger.Worrell@uc.edu
-1-
Copyright © 2007 by the American Physiological Society.

ABSTRACT
Although colonic lumen NH4 + levels are high, 15-44 mM normal range in humans, relatively few
studies have addressed the transport mechanisms for NH4 + . More extensive studies have elucidated the
transport of NH4 + in the kidney collecting duct which involves a number of transporter processes also
present in the distal colon. Similar to NH4 + secretion in the renal collecting duct, we show that the distal
colon secretory model, T84 cell line, has the capacity to secrete NH4 + and maintain an apical to
basolateral NH4 + gradient. NH4 + transport in the secretory direction was supported by basolateral NH4 +
loading on NKCC1, Na + /K + -ATPase, and the NH4 + transporter, RhBG. NH4 + was transported on
NKCC1 in T84 cells nearly as well as K + as determined by bumetanide-sensitive 86 Rb-uptake. 86 Rb-
uptake and ouabain-sensitive current measurement indicated that NH4 + is transported by Na + /K + -ATPase
in these cells to an equal extent as K + . T84 cells expressed mRNA for the basolateral NH4 + transporter
RhBG and the apical NH4 + transporter RhCG. Net NH4 + transport in the secretory direction determined
by 14 C-methylammonium uptake and flux occurred in T84 cells suggesting functional Rh G protein
activity. The occurrence of NH4 + transport in the secretory direction within a colonic crypt cell model
likely serves to minimize net absorption of NH4 + due to surface cell NH4 + absorption. These findings
suggest that we rethink the current limited understanding of NH4 + handling by the distal colon as being
due solely to passive absorption.
-2-
Page 2 of 45

Page 3 of 45
INTRODUCTION
The observation that portal vein ammonium (NH3 + NH4 + ) concentration (~350 µM) is
substantially higher than systemic levels (~45 µM) is prima facie evidence that NH4 + production and/or
absorption occurs in the gastrointestinal tract (7),(41). In particular, the colon is an ammonium-rich
organ due to bacterial fermentation of non-absorbed dietary nutrients in the luminal compartment,
leading to concentrations typically around 14-20 mM but as high as 100 mM (41). It is well accepted
that the colonic mucosa absorbs ammonium, that is, that the direction of net colonic movement of
NH3/NH4 + (Jnet, representing the difference between mucosal-to-serosal and serosal-to-mucosal fluxes,
Jms-Jsm) is in the absorptive direction. However, the extent to which the colonic mucosa can generate a
significant secretory flux of NH3/NH4 + (i.e., a non-zero Jsm) against the larger absorptive vector Jms is
unknown. Moreover, the possibility that transepithelial secretion and absorption of NH3/NH4 + might
occur in different cell types (as it does for Na + and Cl - ), has not been addressed previously. Yet it is
intuitively appealing to consider that a subset of colonic epithelial cells might actively extrude NH4 + so
as to temper the otherwise unopposed interstitial accumulation of this toxic substance. Indeed, there are
a number of examples in nature where epithelia faced with a high external NH4 + concentration are able
to actively excrete NH4 + against an uphill gradient (38), (40), (43), (47).
While there are some data that address absorptive NH3/NH4 + flux (Jms), the cell type and pathways
remain incompletely defined. It is controversial whether absorption occurs by the primary movement of
NH3 or NH4 + . Early studies supported a NH3 diffusion model, based on the pH sensitivity of ammonium
movement (3), (4), (55) however, this does not appear to be the case for ammonium movement across
mammalian ileum (28),(29). Recent studies indicate that colonic crypts, gastric glands, and renal cells
have a low apical NH3 permeability (2), (18),(42), (44). Entry of NH4 + in the absorptive direction has
-3-

een postulated to occur via apical Ba ++ -sensitive K + channels in the surface epithelium (10), (21) or
perhaps via aquaporin-1 (33).
In contrast, there is almost no information concerning NH4 + secretory flux (Jsm) in intestine. NH4 +
secretion in other epithelia occurs via its transport on known K + transporters, due to the similar hydrated
radius of K + and NH4 + . In most models, the basolateral loading step for NH4 + uses the K + site on
Na + /K + -ATPase and/or the Na + -K + -2Cl - cotransporter NKCC1. Apical ammonium exit pathways vary
from system to system. Passive diffusion of NH3 + across the apical membrane in combination with H +
secretion by H + -ATPase results in an ‘ion trapping’ mechanism of secretion in fresh water fish gill (51)
and possibly in mammalian inner medullar collecting duct (IMCD) (45). In contrast, in the case of salt
water fish gill (51) and the desert locust, Schistocerca gregaria, rectum (43), apical secretion of NH4 +
occurs by replacing H + on an apical Na + /H + -exchanger (NHE). In the giant mudskipper,
Periophalmodon schlosseri, gill both “ion trapping” and NHE are used to maintain NH4 + gradients up to
100 mM (37), (38). In the green crab, Carcinus maenas, NH4 + transport across the apical membrane
occurs by first vesicular “ion trapping” of NH4 + and then microtubule dependent vesicular release (47),
(40). An alternative model for mammalian IMCD involves NH4 + exit on the H + site of colonic-type
H + /K + -ATPase, with K + recycling occurring on ROMK1 K + channel (30). A common feature of the
above systems is physiologic exposure to a significant [NH4 + ] (20 to 100 mM). Human colonic epithelia
exposure is within this elevated range (41). Apical NHEs and colonic-type H + /K + -ATPase are present in
the apical membrane of colonic epithelia (22). Likewise Na + /K + -ATPase and NKCC1 are present. Given
a similar environment and that many of the same basolateral and apical membrane transport pathways
are present in colonic cells circumstantially suggests the colon may indeed actively secrete ammonia as
do these other tissues.
-4-
Page 4 of 45

Page 5 of 45
Perhaps one of the most significant recent discoveries involving NH3/NH4 + permeability is that
certain mammalian non-erythroid cells express members of the SLC42 solute carrier family (14),
(32),(48). The SLC42 family is comprised of the human Rhesus-associated glycoproteins (RhG), which
are homologous to the yeast Mep family of proteins (15). These proteins transport both ammonia as well
as methylammonium. It is notable that the Mep transporters can concentrate methylammonium by
approximately 1000 fold (9),(39). Not surprisingly, RhGs are found predominately in tissues that are
exposed to elevated NH4 + levels such as liver, kidney and stomach (24),(27),(48),(49),(50). RhGs have
been detected in the gut, including proximal colon (13). Interestingly, two of the family members show
polarized expression; RhBG is expressed in the basolateral membrane and RhCG is apically expressed
(48). Thus each is poised to be a potential player in the vectorial transport of NH3/NH4 + (32). The actual
mode of NH3/NH4 + transport by the SLC42 family is not clear. Transport has been shown to occur in an
electrogenic manner (31), (34), as electroneutral transport by acting as an NH4 + /H + exchanger (11), (12),
(25), (26) and as an NH3 ‘gas channel’ (17),(20), (23). Part of the confusion may derive from the results
showing that the affinity for NH4 + is affected by NH3 (1). Regardless, the functional significance of
RhG proteins in gut has not yet been elucidated.
As a first step in understanding the possible contribution of an NH3/NH4 + secretory vector (Jsm)
to ammonium handling by the colonic mucosa, we used the colonic cell line T84 as a model of crypt
enterocytes to define the relative contributions of NKCC1 and RhGs in basolateral uptake and
transepithelial movement of NH3/NH4 + . Our data suggest that colonic transport of ammonium includes
a secretory vector that is non-zero and may significantly limit net mucosal absorption and, by extension,
systemic accumulation.
-5-

MATERIALS AND METHODS
Cell culture:
T84 cells (8) obtained from Jim McRoberts (UCLA) were grown to confluence at pH 7.4 in 162
cm 2 flasks with DMEM-Hams’s: F-12, 1:1 mix supplemented with 6% fetal bovine serum, 15 mM
HEPES, 14 mM NaHCO3, 170 µM Penicillin G, and 69 µM Streptomycin sulfate. Amphotericin B was
not included in the media to avoid potential complications due to its ionophoretic activity. Cells were
maintained in culture with weekly passage by trypsinization in Ca ++ and Mg ++ free phosphate buffered
saline at a split ratio of 1:2. Cells for experimentation were plated on un-coated 12 or 24 mm Costar
Transwell (0.4 µm pore size) inserts at a seeding density of 4-5 x 10 5 cells/cm 2 and cultured 8-14 days
with feeding in the above media 3 times per week. Cell monolayers were determined to be of acceptable
use when the trans-epithelial resistance reached >1200 cm 2 as measured by EVOM (see below). All
experiments were performed at 37 o C.
Epithelial monolayer integrity:
The quality of high resistance monolayer formation was monitored using an EVOM (World Precision
Instruments) as described previously (52),(54). The T84 cell line used in these experiments typically had
a transepithelial resistance of > 2000 cm 2 . Both trans-epithelial potential (mV) and trans-epithelial
resistance (K ) were measured with this instrument. Transepithelial Current (ITR) was calculated by
Ohm’s law and expressed as µ /cm 2 . EVOM measurements proved consistent and reliable for detecting
changes in trans-epithelial voltage, resistance, and current (52),(53),(54). Moreover, measurements in
the open-circuit mode represent the normal condition (e.g., not short circuited) of native epithelia.
-6-
Page 6 of 45

Page 7 of 45
Real Time RT-PCR of RhBG and RhCG:
Total RNA was extracted from T84 cells with TRIzol Reagent (Invitrogen) according to the
manufacturer’s instructions. Reverse transcription was performed using 50ug/ml oligo(dT) 20 primer
using Superscript Reverse Transcriptase (Invitrogen) according to the manufacturer’s instructions.
Amplification reactions were performed with 1 x SybrGreen PCR master mix (Applied Biosystems) or
with a gene specific fluorescent labeled probe, gene specific primers and 200 ng sample cDNA in a 50
ul final volume. Real-Time PCR was performed on a DNA Engine Opticon 2 detector (DYAD).
Thermal conditions (50 o C for 2 min, 40 cycles of 95 o C for 15 sec, and 60 o C for 1 min) were used for all
primer sets. Emitted fluorescence was measured during the annealing/extension phase; amplification
plots were generated using the Opticon Monitor Analysis software. Standard curves were generated for
each primer set (Table 1) using a known concentration of plasmid DNA; the amount of mRNA was then
extrapolated and normalized to GAPDH for comparison.
Plasmids were made by obtaining a portion of the gene by performing PCR on cDNA from T84
cells that were positive for the gene. The PCR product was then cloned into a TA cloning vector. Real
time PCR was performed to confirm the plasmid contained the insert. A standard curve was then
generated from known concentrations of plasmid DNA for each primer set. Well behaved standard
curves for each primer set were obtained, r 2 P 0.993.
Table 1. Primer sets used for PCR.
Plasmid Primers to create Plasmid (5’-3’) Primers for Real Time PCR (5’-3’)
Human RhBG For – GACGGCCCTCAACACATACT For – GCCTGGAGAGTGTGTTTCCA
Rev – AAAAGGAGCGTGTCCTCTCA Rev - GAGCTGATGCATGGCCTGTGA
Human RhCG For – CACCCTCTTCCTGTGGATGT For – GCATTCCTGGCATCATAGGC
Rev – GAACTTCTGCAGCCAGAACC Rev - CCATAGACTTCAAGGCTGGCG
Human GAPDH For – GAAGGTGAAGGTCGGAGTC
Rev –GAAGATGGTGATGGGATTTC
Same
-7-

14 C-methylammonium Uptake and Flux:
T84 cell monolayers were grown on 1 cm 2 transwell inserts. Uptake and Flux measurements
were carried out in the following base solution (in mM): 135 NaCl, 3 KCl, 0.5 CaCl2, 2 MgCl2, 10 Na-
HEPES at a pH of 7.4. Apical media volume was 0.5 ml and basolateral media volume 1 ml. For apical
uptake and Jab MA studies, apical volume was reduced to 250 µl to conserve 14 C-MA tracer. Cells were
incubated in cold MA for 5-10 min prior to uptake/flux initiation. Use of tracers which are transported as
well as diffusible through the cell membrane (exist in both charge and uncharged form) present a unique
situation to classical ion tracer experiments. It is noteworthy that the “steady-state condition” may not be
obtained during this incubation time, thus uptake and flux measurements may represent an overestimate
of “true” values. However, experiments shown are comparable to those published by Handlogten, et.al.
(11, 12) and thus support the functional presence of RhGs in T84 cells. Long term measurements were
carried out in culture media with cells kept in the tissue culture incubator between time points. Under
these conditions “steady state” does exist. Short and long term fluxes are consistent thus supporting the
physiologic relevance of the methods used. For consistency with initial studies and those involving
NKCC1 mediated NH4 + transport, study of ammonium transport by RhGs was done under conditions of
active cAMP-dependent Cl - secretion (stimulated by basolateral 10 µM forskolin, 5 min). As
subsequently demonstrated by data in figure 8A & B, RhG function is not altered by forskolin. When
bumetanide or ouabain was used drugs were applied 5 min prior to initiation of uptake and flux.
Apical-to-basolateral flux (Jab) and basolateral-to-apical flux (Jba) are used to indicate absorptive
(Jms) and secretory (Jsm) vector (direction) of flux as would occur in intact colon. Jnet is used to indicate
the combined effect of each vector, i.e., Jba – Jab (When plotted together, Jab is assigned a negative
-8-
Page 8 of 45

Page 9 of 45
value). 14 C-methylammonium (1 µCi/ml or 0.5 µCi/ml for the long term uptake and flux) was used.
Radioactivity in an aliquot of initial loading media was determined to establish specific activity for each
experiment. At the end of the flux period (typically 2 min) the entire volume of trans-media was
collected and radioactivity determined to calculate trans-epithelial flux. Uptake was ended by
sequentially dunking inserts into 3 reservoirs of > 500 ml ice cold 0.1M MgCl2 , 10 mM Tris-Cl pH 7.4.
Inserts were then cut from the supports and placed in scintillation vials with scintillation cocktail to
determine total cellular radioactivity. For uptake calculations the radioactivity of the cellular fraction
and trans-media fraction were combined. Previously we determined correcting for protein content by
protein measurements on individual inserts did not lead to a significant decrease in variability and were
thus omitted to simplify the assay (54), data is expressed per unit area of the epithelial monolayer.
Ammonium Assay
Ammonium determination was accomplished using a spectrophotometric ammonium assay kit
(Megazyme, Co. Wicklow, Ireland) based on the enzymatic conversion of NADPH to NADP in the
presence of 2-oxoglutarate and glutamate dehydrogenase. The assay has a variability between duplicate
measurements of 1-2 µM NH4 + (0.005-0.010 abs units) with a linear range of ~10 µM to 5.5 mM NH4 + .
Media from experiments was sampled (0.1 mL) and immediately placed on ice, when necessary samples
were frozen at -20 o C until the time of the assay. Unknown samples with anticipated [NH4 + ] > 5 mM
were diluted accordingly to achieve an assay [NH4 + ] approximating 2.5 mM. Data are presented either
as actual NH4 + movement (nmoles/min/cm 2 ) or as accumulated NH4 + (mM) for longer term experiments.
As for 14C-MA uptake and flux, drugs were applied 5 min prior to initiation of the flux (exposure to
NH4 + ).
-9-

Reagents: Forskolin was obtained from Calbiochem, FBS and PenStrep were from Gibco BRL, all
other chemicals were of the highest grade obtainable from Sigma, InVitrogen, or Stratagene.
Significance Tests: Data are presented as Mean ± SEM. Significance was estimated using the Student
T-test and two-way ANOVA when indicated, with a p value of less than 0.05 indicating a significant
difference.
-10-
Page 10 of 45

Page 11 of 45
RESULTS
T84 cells express ammonium transporters RhBG and RhCG: The presence of ammonium transporters,
RhBG and RhCG, along the gastrointestinal tract have been shown by Handlogen, et.al. (13). Each
isoform was determined to be present in mouse ileum and proximal colon. Although the authors
concluded that expression was predominantly in the surface epithelium of proximal colon, their study
did not include distal colon. Thus we sought to determine the presence of RhBG and RhCG mRNA in a
human secretory cell line of colonic crypt origin (T84). Using specific human primers, and Real-Time
RT-PCR, mRNA for both RhBG and RhCG were readily detected in T84 cells, thus suggesting the
expression of these transporters within secretory cells characteristic of colonic crypt cells (Figure 1).
Quantitative analysis of Real-Time RT-PCR showed approximately equal expression of RhBG and
RhCG in T84 cells, ratio of RhBG/RhCG = 1.10±0.15 (N=8).
RhBG (typically basolateral) and RhCG (typically apical) (48) are known to transport
methylammonium, thus they can be functionally assayed using 14 C-methyl ammonium (MA) uptake and
flux. Figure 2 supports the functional presence of each transporter in T84 cells. Apical side 14 C-MA
uptake was significantly less than that of basolateral side uptake, 139±5 verses 390±16 pmoles/min/cm 2
MA respectively (Figure 2A). NH4 + competitively reduces the magnitude of RhG protein mediated MA
transport (11,12). Indeed, 14 C-MA uptake was found to be reduced in the presence of 10 mM NH4 + .
Inclusion of 10 mM NH4 + reduced apical 14 C-MA uptake ~36% to 25±1 pmoles/min/cm 2 MA.
Basolateral 14 C-MA uptake was reduced ~44% to 217±16 pmoles/min/cm 2 MA by 10 mM NH4 + . These
data together indicate the functional presence of RhG proteins at both the apical and basolateral
membrane of polarized T84 monolayers. In addition the data suggests that basolateral loading of NH4 +
exceeds apical loading (presumably by RhBG and RhCG respectively, although this has not been
-11-

directly determined in T84 cells). Transepithelial flux with symmetrical 1 mM cold MA reveals a net
secretory direction of flux in T84 cells (Figure 2B). The apical-to-basolateral flux (Jab) of MA was -
134±7 pmoles/min/cm 2 MA whereas the basolateral-to-apical flux (Jba) was 241±7 pmoles/min/cm 2 MA
resulting in a calculated net flux (Jnet) of 106±14 pmoles/min/cm 2 MA. Inclusion of 10 mM NH4 +
reduced Jab by ~22% to -104±6 pmoles/min/cm 2 MA, Jba by 31% to 167±6 pmoles/min/cm 2 MA, and Jnet
by ~41% to 63±12 pmoles/min/cm 2 MA.
To determine if net secretion occurs over a longer time period under culture conditions, long
term flux experiments were carried out with T84 cell monolayers over a 60 min period in complete
culture media. Results are qualitatively similar to short term (2 min flux period). Calculated rates
(Figure 2C) were 257±11 pmoles/min/cm 2 MA for basolateral and 107±5 pmoles/min/cm 2 MA for
apical uptake. Jba was 113±8 and Jab -44±3 pmoles/min/cm 2 MA resulting in a secretory direction flux
(Jnet) of 69±7 pmoles/min/cm 2 (Figure 2D). The lower values for long term flux rates may be due to the
different bathing conditions (culture media verses minimal media) or possibility could represent the
effect of closer to “steady state” intracellular [MA] in the long term experiments. Nonetheless,
qualitatively the data in whole support an appreciable secretory direction flux due to RhG activity.
Specificity of 14 C-MA as a tracer for RhG mediated uptake and flux. 14 C-MA is known to be
transported by the RhGs. However, it is uncertain the degree to which MA may also be transported by
NKCC1 (as defined by bumetanide-sensitivity). We therefore examined the effect of bumetanide on 14 C-
MA uptake and flux. Figure 3A shows the dose response relation for basolateral MA uptake (5 min) in
T84 cell monolayers in the absence and presence of 100 µM bumetanide. Bumetanide produced a small
decrease in MA uptake which was apparent at greater concentrations of cold MA. We also observed
-12-
Page 12 of 45

Page 13 of 45
(consistent with results of Handlogten, et.al., (12)) that as [MA] increases there develops in parallel a
non-saturable component of MA uptake, representing linear diffusive entry, particularly at
concentrations above approximately 5 mM MA. To determine the time course of MA uptake and flux as
well as the sampling rate at which RhG activity could be more accurately accessed, 3 mM [MA] was
used. This concentration was chosen to provide an extra “safety” margin in sampling times. The time
course of MA uptake (Figure 3B) and transcellular flux (Figure 3C) indicate little effect of bumetanide
on MA uptake or flux at time points less than ~3 min. However at longer time points (> 5min) a more
significant bumetanide-sensitive component for MA uptake is revealed. Since these data were obtained
at 3 mM MA, use of 1 mM MA in combination with a 2 min sample period is more than adequate to
access ‘specific’ RhG function. Transepithelial flux of MA is less sensitive to bumetanide treatment,
even at extended flux durations. There was no discernable K + competition (by Dixon plot with 1 and 3
mM MA and 0-10 mM K + ) for the total (Figure 3D) as well as bumetanide-sensitive (Figure 3E)
component of MA uptake as would be expected if MA were carried on the K + site of NKCC1 or the
pump , suggesting that this small effect of bumetanide on MA uptake is indirect. The greater impact of
bumetanide at longer time periods and a slightly greater effect on uptake verses transepithelial flux are
supportive of an indirect effect as well.
Increasing extracellular pH has been shown to increase MA uptake in mIMCD-3 cells (12).
Figure 4A demonstrates a similar increase in MA uptake with increased basolateral extracellular pH and
a decrease with basolateral extracellular acidification. Total MA uptake increased by ~3 fold from
1349±49 pmoles/min/cm 2 to 4379±242 pmoles/min/cm 2 on increasing pHo to 9.0, whereas MA uptake
decreased by ~77% to 315±16 pmoles/min/cm 2 at pHo 5.5. Transcellular flux of MA (Figure 4B) in the
secretory direction also increased with an increase in basolateral pHo. A pHo increase from 7.4 to 9.0
-13-

increased secretory direction MA flux ~3.6 fold from 148±3 to 534±24 pmoles/min/cm 2 . Acidifying pHo
to 5.5 produced an ~54% decrease in MA uptake (68±11 pmoles/min/cm 2 ). Change in basolateral
extracellular pH did not produce any significant increase in a bumetanide-sensitive component of MA
uptake, which further supports lack of MA transport on NKCC1 and Na + /K + -ATPase.
Change in apical extracellular pH had a similar effect on apical MA uptake and absorptive
direction flux (Figure 4C). Total apical MA uptake increased by ~4 fold from 211±9 pmoles/min/cm 2 to
890±26 pmoles/min/cm 2 on increasing apical pHo to 9.0, whereas MA uptake decreased by ~23% to
162±6 pmoles/min/cm 2 at pHo 5.5. Transcellular flux of MA in the absorptive direction also increased
with an increase in apical pHo. An apical pHo increase from 7.4 to 9.0 increased MA Jab ~8 fold from
54±3 to 437±15 pmoles/min/cm 2 . Acidifying pHo to 5.5 produced an ~54% decrease in MA uptake
(25±2 pmoles/min/cm 2 ). These data combined demonstrate that apical media (luminal) alkalization has a
more significant effect on MA absorption than does basolateral alkalization on MA secretion (~8 fold
verses ~3.6 fold increase).
It has been established that NH4 + will compete with MA uptake on Rh G proteins (11), (12).
Thus, we used a transepithelial NH4 + gradient to ascertain the degree to which basolateral MA (and thus
NH4 + ) loading and secretory direction NH4 + transport could occur. The rationale is that apical solution
NH4 + might retard the exit of MA across the apical membrane (presumably RhCG) or if apical NH4 +
were to enter and remain in the cell at significant levels a trans effect on basolateral transport
(presumably RhBG) might be revealed. In this case 14 C-MA is being used as a tracer for NH4 + transport
to determine if NH4 + secretion can occur against a substantial gradient. A caveat is that MA will only
sample a subset of the available secretory mechanisms since it is not transported by NKCC1 or to our
-14-
Page 14 of 45

Page 15 of 45
knowledge by other known K + /NH4 + transporters. Initial experiments with 1 mM MA and 2 min uptake
showed an ~50% decrease in basolateral MA uptake from 1514±41 to 773±29 pmoles/min/cm 2 with the
inclusion of 20 mM basolateral NH4 + (thus confirming effective NH4 + competition) whereas inclusion of
20 mM NH4 + on the apical side produced no significant decrease in basolateral MA uptake (1578±33
pmoles/min/cm 2 ). Figure 5 shows that apical NH4 + concentrations as high as 100 mM have no effect on
either basolateral MA loading or on the secretory direction flux of MA. These data indirectly indicate
that NH4 + transport in the secretory direction driven by basolateral RhG (presumably RhBG) can occur
against a significant NH4 + gradient, one within the physiological range of luminal [NH4 + ].
Transepithelial transport of NH4 + in T84 cells. Although 14 C-MA uptake and flux is a useful tool
to investigate the contribution of the Rh G proteins to secretory direction movement of NH4 + , it does
not allow one to determine the contribution of Na + /K + -ATPase or NKCC1 to NH4 + secretion.
Unfortunately, there is no convenient radioisotope to directly measure NH4 + transport. We have
previously shown that NH4 + competes with K + on Na + /K + -ATPase as well as NKCC1 in T84 cells and
that both transporters will transport (load) NH4 + into T84 cells (54) and thus may contribute to NH4 +
secretion.
Initial studies were designed to determine the relative magnitude of NH4 + flux in T84 cell
monolayers under asymmetric conditions and were performed in the presence of forskolin to maximize
NKCC1 activity. Unidirectional flux of NH4 + was determined by the inclusion of 10 mM NH4 + on one
side of the cell monolayer and sampling the trans-side media. NH4 + flux in the secretory direction (Jba)
exceeded flux in the absorptive direction (Jab) (Figure 6) resulting in a calculated secretory direction for
the net movement of NH4 + . Flux rates were -6.7±1.9 for Jab, 38.3±8.1 for Jba and 30.8±7.8
-15-

nmoles/min/cm 2 NH4 + for the calculated net flux. These data add further support to the MA uptake and
flux experiments indicating that T84 cells are capable of net NH4 + secretion.
In order to determine if transepithelial potential (apical negative due to Cl - secretion with
forskolin stimulation) affected NH4 + secretion flux studies were performed in an Ussing chamber system
(4 ml symmetrical volume) either under open-circuit or short-circuit (VTE = 0 mV) conditions.
Asymmetric 0:10 mM NH4 + gradients were established and 0.1 ml trans-side bathing media sampled at
10 min intervals for 60 min. Calculated secretory rate for the initial 10 min period was not significantly
different between open-circuit and short-circuit mode (29±6 and 24±2 nmoles/min/cm 2 respectively).
Similarly secretory rate did not differ over the full 60 min period between open-circuit and short-circuit
modes (30±3 and 26±2 nmoles/min/cm 2 respectively). These data indicate that transepithelial NH4 +
movement is electroneutral (supportive of electroneutral movement on RhG’s as well as NKCC1). With
current techniques it is difficult to distinguish between paracellular NH4 + movement and cellular
membrane NH3 movement, although the Isc experiments suggest little contribution of paracellular NH4 +
movement to the overall transepithelial flux.
To determine the degree to which NKCC1 and Na + /K + -ATPase contribute to the secretory
direction flux, cells were treated with basolateral bumetanide or ouabain for 5 min prior to the flux
period. Both bumetanide and ouabain decreased Jba NH4 + flux (Figure 7A). Bumetanide decreased the
unidirectional secretory direction NH4 + flux by ~44% from 73±10 to 40±5 nmoles/min/cm 2 while pump
inhibition reduced NH4 + transport by ~33% to 48±6 nmoles/min/cm 2 suggesting that NKCC1 and to
some extent pump activity contribute to the secretory flux of NH4 + . In a separate experiment the effect
of basolateral bumetanide on the unidirectional absorptive flux of NH4 + was assessed. Whereas
-16-
Page 16 of 45

Page 17 of 45
inhibition of NKCC1 caused a decrease in secretory direction NH4 + flux, absorptive NH4 + flux was
enhanced by NKCC1 inhibition. Jab for NH4 + was increased ~2 fold from -1.6±0.2 in control to -3.2±0.5
nmoles/min/cm 2 in bumetanide treated cells. These data suggest that NKCC1 may play a key role in
scavenging NH4 + traversing the cell from the lumen thus limiting NH4 + absorption. To further lend
support for NKCC1 limiting NH4 + absorption, an additional experiment was designed under gradient
conditions with NH4 + initially present on both sides of the monolayer (Figure 7B.) Depicted is the
change in basolateral media NH4 + concentration in cells exposed to 10 mM apical NH4 + and 3 mM
basolateral NH4 + in the absence and presence of basolateral bumetanide. Under control conditions there
was no significant increase in basolateral NH4 + (which would represent net absorption) or rather the
monolayer is capable of preventing diffusive NH3 entry at the apical membrane from being delivered to
the basolateral medium. However in the presence of basolateral bumetanide, basolateral NH4 + levels
increase by 0.42±0.02 mM (14%) in 10 mins and by 0.55±0.04 mM (18%) by 20 min. The diminished
increase in basolateral NH4 + with time suggest the possibility that other mechanisms of limiting
absorptive NH4 + flux are acting in a compensatory manner.
cAMP-stimulates ammonium but not MA transport. Because cAMP activates transepithelial Cl -
secretion and NKCC1 in T84 cells, we examined the effect of forskolin on MA uptake and flux. Our
previous studies demonstrated that basolateral ammonium dampens cAMP-mediated Cl - secretion in
T84 cells (16), (35),(54). Since little is known regarding the regulation of Rh G ammonium transport,
uptake and flux measurements were determined in unstimulated T84 cells. As shown in Figure 8A &
8B, forskolin stimulation did not significantly alter MA transport. Basolateral MA uptake was
3394±255 pmoles/cm 2 /min under control conditions and 3024±214 pmoles/cm 2 /min in the presence of
forskolin. Basolateral to apical flux was 312±89 pmoles/cm 2 /min for control and 260±21
-17-

pmoles/cm 2 /min in the presence of forskolin. Apical MA uptake was 1535±109 pmoles/cm 2 /min under
control conditions and 1503±125 pmoles/cm 2 /min with forskolin. Under control conditions apical to
basolateral MA flux was 157±40 pmoles/cm 2 /min and 187±8 pmoles/cm 2 /min with forskolin. In contrast
to the lack of effect of cAMP stimulation on MA transport, secretory direction NH4 + flux was increased
~24% in the presence of forskolin (Figure 8C). Basolateral to apical NH4 + flux was 17±1
nmoles/min/cm 2 under control conditions and increased to 21±2 nmoles/min/cm 2 with forskolin.
cAMP-stimulation of NH4 + movement in the secretory direction is consistent our previous data (54) and
supportive of NKCC1 participation in basolateral NH4 + loading (see below). Consistent with NKCC1
activity limiting the transepithelial absorptive vector, forskolin stimulation results in decreased NH4 + Jab
flux (Figure 8D). Jab for NH4 + was 5.8±0.5 nmoles/min/cm 2 under control condition and decreased ~
44% to 3.3±0.8 nmoles/min/cm 2 with forskolin stimulation. As with other classic secretory or
absorptive processes the magnitude variability in NH4 + flux across experiments may in part relate to
variability in the magnitude of forskolin response in T84 cells between cell platings and passages.
However, despite the magnitude variability the relative effect is consistent across different groups.
T84 monolayers maintain an applied ammonium gradient. The ability of T84 cells to maintain
basolateral [NH4 + ] when exposed to a high apical to basolateral NH4 + gradient is shown in Figure 9.
Cell monolayers were exposed to various initial apical [NH4 + ] ranging from 0 to 30 mM while
basolateral [NH4 + ] was initially 3.11±0.08 mM. Over a period of 30 min cells in the control group (no
added NH4 + ) did not produce significant amounts of NH4 + . During the initial 10 min, basolateral media
[NH4 + ] decreased in all groups. However at apical NH4 + concentrations in excess of 10 mM, basolateral
NH4 + increased by the 20 min time point. Basolateral [NH4 + ] continued to decrease when the initial
apical [NH4 + ] was at or below that of basolateral NH4 + and was relatively unchanged with an initial 10
-18-
Page 18 of 45

Page 19 of 45
mM apical to 3 mM basolateral gradient. Thus, despite increased apical membrane permeability to NH3,
T84 cells can maintain at least a 10:3 NH4 + gradient, indicating an ability to transport NH4 + in the
secretory direction to minimize back diffusion of NH3.
The passive diffusion of NH3 from the apical media into and across T84 cells is supported by
data obtained at differing apical pHo. Figure 10 shows the basolateral media NH4 + concentration in
cells exposed to 10 mM apical NH4 + at apical media pH of 5.5, 7.4, and 9.0. Initial basolateral media
[NH4 + ] was 2.88±0.02 mM. At an apical media pH of 5.5 and 7.4, basolateral [NH4 + ] decreased to
2.69±0.03 and 2.78±0.01 mM in the first 10 min then rose to levels not significantly different than the
starting values. However with an apical media pH of 9.0, at which more NH3 is present, basolateral
[NH4 + ] increased to 3.00±0.05 mM in 10 min and to 3.45±0.09 by 20 min.
The ability of T84 cells to actively minimize net NH4 + absorption when exposed to an apical to
basolateral NH4 + gradient for an extended period was further tested with cells in culture medium. Cell
monolayers were maintained in complete culture medium on the basolateral side with a measured value
of 4.06±0.03 mM NH4 + and serum free culture media containing 20 mM NH4 + at pH 6.0 on the apical
side. Apical pH 6.0 was used instead of pH 5.5 due to the buffering capacity of culture media. As shown
in Figure 11, basolateral [NH4 + ] decreased to 2.51±0.03 mM by 10 min with only a slight increase
(2.66±0.04 mM) at 60 min.
-19-

DISCUSSION
Excess systemic NH4 + levels can lead to hyperammonemia associated encephalopathy which can be
life threatening. Although, the kidney is responsible for carrying out the bulk of body NH4 + homeostasis,
the possibility exists that some level of body NH4 + control can be accomplished via changes in colonic
function. Our data demonstrate that 1) T84 cells express mRNA for two known NH4 + transporters RhBG
and RhCG and display transport characteristics consistent with functional RhG proteins, 2)
transepithelial MA flux in T84 cells is greater in the secretory than absorptive direction, 3)
transepithelial transport of NH4 + in T84 cells is greater the secretory than absorptive direction and is
sensitive to cAMP stimulation and to inhibitors of NKCC1 and Na + /K + -ATPase, and, 4) T84 cells, are
able to maintain an apical to basolateral NH4 + gradient despite having a greater apical membrane NH3
permeability than native colonic crypts (2),(16),(18),(42),(44). Taken together, these data provide
evidence that model colonic crypt epithelia secrete NH4 + by a mechanism that involves both K +
transport and novel RhG protein mediated pathways. The long standing premise, based on greater
[NH4 + ] in portal vein verses systemic circulation has been that NH4 + absorption occurs along the length
of the intestine. No consideration has been given for an opposing NH4 + secretory vector, which is
surprising considering that secretory epithelia in the intestine share similar transport mechanisms with
renal and gill epithelium which do effect NH4 + secretion. If confirmed in natural tissue, these findings
indicate that active secretion by colonic crypts could oppose the larger absorptive NH4 + vector to limit
net NH4 + delivery to the portal circulation.
RhBG and RhCG isoforms of the Rhesus glycoprotein family have been identified along the GI
tract in mouse (13). Although limited RhBG and RhCG expression was observed in the upper portion of
proximal colon crypts compared to surface cells in mouse tissue, both isoforms are present in T84 cells
-20-
Page 20 of 45

Page 21 of 45
(human), which otherwise functionally resemble cells of crypt origin. Whether expression patterns of
RhBG and RhCG differ along the length of the colon or along the entire crypt surface axis in mouse or
human tissue remains to be determined as does distribution among the various cell types present within
the colonic crypt. MA uptake in to T84 cells was observed from the basolateral side thus suggesting the
functional presence of RhBG. MA uptake was partially inhibited by the addition of basolateral NH4 + ,
suggestive of RhBG function similar to reported results for RhBG in renal mIMCD-3 cells (12). In
mIMCD-3 cells basolateral methyl ammonium transport exhibits both diffusive and carrier-mediated
components with the diffusive component becoming predominant at [MA] exceeding 10 mM. The dose
response relation for MA uptake observed in T84 cells shows similar properties with an almost linear
relation between 5 and 15 mM MA. Handlogten, et.al. (12) reported that MA uptake via RhBG in
mIMCD-3 cells is not affected by the NKCC1 inhibitor bumetanide. In their study, excess NH4 + was
used to distinguish between trasporter-mediated and diffusive entry of MA. Since T84 cells have
abundant NKCC1 activity (which as discussed below is capable of NH4 + transport) such a maneuver
becomes somewhat problematic, therefore we operationally defined transporter-uptake by performing
assays at < 5 mM MA and < 3 min uptake periods). Consistent with RhBG in mIMCD-3 cells,
transporter-mediated uptake of MA (e.g., at < 5mM MA & < 3 min uptake periods) is insensitive to
bumetanide. With increased concentration of MA as well as with increased uptake times (at a greater
fraction of diffusive MA entry) total MA uptake showed some sensitivity to bumetanide. This could be
due to an indirect effect bumetanide itself on diffusive MA entry or alternatively an indirect effect of
NKCC1 inhibition on diffusive MA entry. The later possibility is perhaps more likely given the
abundant capacity for NKCC1 activity in T84 cells. It should be noted however that bumetanide had
little impact on the transepithelial flux of MA, perhaps due to the apical exit of MA being rate limiting
(suggested by less apical MA uptake verses basolateral MA uptake).
-21-

Uptake of MA by either RhBG or RhCG expressed in Xenopus oocytes has been shown to be
stimulated by extracellular alkalosis (26), similarly RhCG activity in mIMCD-3 cells is enhanced by
extracellular alkalinization (11). Both RhBG and RhCG have been identified in mouse intestine,
showing basolateral and apical immunostaining respectively (48). In mIMCD-3 cells, functional
distinction between RhBG and RhCG is primarily based on basal activity, pH sensitivity, and relative
affinity (11). In T84 cells, both basolateral MA uptake (RhBG) and basolateral to apical flux of MA is
enhanced by elevated basolateral pH and inhibited by basolateral solution acidification.
MA uptake into T84 cells was also observed from the apical side, thus supporting the functional
presence of an RhG protein, likely RhCG. Uptake was partially inhibited by the addition of apical
NH4 + . Although conditions were not optimized for maximal competitive inhibition (since apical NH4 +
will change pHi (16, 54) the data are suggestive of RhG activity as reported results for RhCG in renal
mIMCD-3 cells (11). Apical MA uptake in T84 cells with changes in apical solution pH are consistent
with published data for RhCG (11),(26) thus supporting the functional presence of apical RhCG in T84
cells.
The notion that NH4 + secretion can be driven by NKCC and Na + /K + -ATPase with an opposing
apical exit pathway is supported by work in renal cells (19), (46). In fact, Kinne, et.al. estimated that it
is energetically possible for NKCC and Na + /K + -ATPase under physiologic conditions to generate a
[NH4 + ]i/[NH4 + ]o ratio of approximately 2000! As previously reported, NH4 + can be effectively
transported on the K + site of Na + /K + -ATPase and NKCC1 in T84 cells (54). Since similar loading
pathways are used by various NH4 + secretory epithelia, it was logical to examine whether T84
monolayers demonstrate transepithelial ammonium transport. Indeed, we demonstrated a role for
-22-
Page 22 of 45

Page 23 of 45
NKCC1 and perhaps Na + /K + -ATPase in transepithelial secretory flux of NH4 + . Basolateral bumetanide
as well as ouabain significantly decreased the movement of basolateral NH4 + to the apical compartment.
Although it is difficult to assess the degree to which ouabain might indirectly affect NKCC1 activity (by
altering the Na + gradient), these data support the involvement of additional pathways for basolateral
NH4 + loading (such as RhBG) as described above since bumetanide or ouabain resulted in only an ~40%
or ~33% reduction in NH4 + flux. In our study, bumetanide had little effect on transepithelial MA
transport. It should be noted as well that Handlogten, et.al. (12) showed minimal MA uptake on Na + /K + -
ATPase or NKCC1 in mIMCD-3 cells. Our data support a role for NKCC1 in retarding the movement of
NH4 + from the apical compartment to the basolateral compartment, perhaps acting as an NH3/NH4 +
scavenger by rapidly internalizing NH4 + present in the basolateral vicinity of the crypt compartment.
Ammonium was transported by both Na + /K + -ATPase, NKCC1 (as has been described for other
epithelial transport models of ammonium secretion (30, 38, 40, 43, 45, 47) ) as well as RhBG and
RhCG. Under asymmetric flux conditions at pH 7.4, both MA and NH4 + transepithelial fluxes were
greater in the secretory compared to absorptive direction. Whereas MA uptake and flux (RhBG/RhCG
mediated) were unaffected by forskolin, NH4 + flux was stimulated by cAMP, presumably due to
increased NKCC1 activity. In vivo, luminal pH is more acidic (~ pH 5.5 in humans); this would further
favor net secretion under physiological pH conditions because relative luminal acidity favors luminal
NH4 + over NH3 and thus minimizes passive back-diffusion of NH3 through the apical membrane. The
redundancy in mechanisms for basolateral ammonium loading in both kidney and intestine suggests the
importance of maintaining ammonium secretory capacity. Indeed, predicted distal tubular acidosis or
hyperammonemia was absent in Rhbg KO mice (5),(6).
-23-

An important caveat to our study is the observation that native colonic crypt cells of certain
mammals appear to exhibit low apical permeability to ammonia (NH3) (2),(18), (42), (44). In contrast,
the apical membrane of T84 cells has a more readily apparent NH3 permeability (16). It should be noted
that the higher apical NH3 permeability in T84 cells would impair their ability to secrete NH4 + against a
concentration gradient and thus might underestimate the ability of intact crypts to secrete NH4 + or
maintain a large luminal to serosal NH4 + gradient. Moreover, it is unknown whether cultured crypt
epithelial lines differ in general from native crypts with respect to apical ammonium permeability;
certainly, there may be considerable species, segmental, or cellular heterogeneity.
Several models for NH4 + secretion in other tissues (see introduction) include “ion trapping” of NH4 +
at the luminal surface. In particular, colonic H + -K + -ATPase along with an apical K + channel have been
shown to be important participants for mammalian IMCD (30). Although, it is well established that
native colonic mucosa contains both c-H + /K + -ATPase and a ROMK1 like apical K + channel (22), both
appear to be absent from the T84 cell line (36). The lack of these two apical transporters (cH + /K + -
ATPase and K + channel) in T84 cells thus also limit their ability to secrete NH4 + against a concentration
gradient or maintain a large luminal to serosal NH4 + gradient.
Due to the nature of the ammonium assay (signal to noise) and the NH3 permeability of T84 apical
membrane, it is difficult to measure NH4 + transport against a sizeable apical [NH4 + ]. An alternative
approach would be the use of the stable non-radioactive isotope of N ( 15 N) in tracer fluxes, although it is
questionable whether this approach would enhance accuracy of transepithelial flux assays. As an indirect
alternative, we determined secretory MA flux against an apical-to-basolateral NH4 + gradient (Figure 5).
The rationale is that NH4 + is transported by RhBG and RhCG to a greater extent than is MA, thus NH4 +
-24-
Page 24 of 45

Page 25 of 45
acts competitively against MA transport on RhGs (Figure 2 and (12)). We found that 20 mM cis NH4 +
inhibits uptake of MA by about half. Thus, it is reasonable that trans NH4 + , if “sensed” by the secretory
machinery, should also inhibit the transepithelial flux of MA. However, secretory direction MA flux was
not significantly altered by the trans addition of up to 100 mM NH4 + . This observation suggests that
NH4 + secretion (in this case estimated by 14 C-MA tracer) can occur against a physiologically relevant
apical-to-basolateral NH4 + gradient. These results underestimate the secretory capacity since MA is not
transported by NKCC1 or Na + /K + -ATPase whereas NH4 + would be loaded into the cell by these
transporters. T84 cells were also capable of maintaining an apical-to-basolateral NH4 + gradient (Figures
9 and 11). The initial loss of basolateral compartment NH4 + may represent a combination of cellular
NH4 + sequestering and/or metabolism, however this does not negate the fact that T84 cells can maintain
an appreciable apical-to-basolateral gradient.
Taken together, our data suggest that ammonium transport in the secretory direction can occur in
T84 model crypt epithelia and that Rh G proteins, NKCC1, and to some extent Na + /K + -ATPase
participate in basolateral loading of NH4 + into the cell. We speculate that a secretory mechanism may be
present in natural colonic mucosa in order to counter ammonium absorptive pathways and thus limit the
amount of NH4 + reaching the portal circulation. Further elucidation of the mechanisms involved in
colonic NH4 + transport and regulation may be useful in developing new targets for more effective
therapeutic treatment of hyperammonemia.
-25-

Acknowledgments
We thank Corryn A. Morris for her administrative assistance on this project. This work was
supported by NIDDK DK051630 to JBM and by the Epithelial Pathobiology Group.
-26-
Page 26 of 45

Page 27 of 45
REFERENCES
1. Bakouh N, Benjelloun F, Hulin P, Brouillard F, Edelman A, Cherif-Zahar B, and Planelles
G. NH3 is involved in the NH4+ transport induced by the functional expression of the human Rh C
glycoprotein. J Biol Chem 279: 15975-15983, 2004.
2. Boron WF, Waisbren SJ, Modlin IM, and Geibel JP. Unique permeability barrier of the
apical surface of parietal and chief cells in isolated perfused gastric glands. J Exp Biol 196: 347-360,
1994.
3. Bown RL, Sladen GE, Clark ML, and Dawson AM. The production and transport of ammonia
in the human colon. Gut 12: 863, 1971.
4. Castell DO and Moore EW. Ammonia absorption from the human colon. The role of nonionic
diffusion. Gastroenterology 60: 33-42, 1971.
5. Chambrey R, Goossens D, Bourgeois S, Picard N, Bloch-Faure M, Leviel F, Geoffroy V,
Cambillau M, Colin Y, Paillard M, Houillier P, Cartron JP, and Eladari D. Genetic ablation of
Rhbg in the mouse does not impair renal ammonium excretion. Am J Physiol Renal Physiol 289: F1281-
1290, 2005.
6. Chambrey R, Goossens D, Quentin F, and Eladari D. Rh glycoproteins in epithelial cells:
lessons from rat and mice studies. Transfus Clin Biol 13: 154-158, 2006.
7. Clemmesen JO, Kondrup J, and Ott P. Splanchnic and leg exchange of amino acids and
ammonia in acute liver failure. Gastroenterology 118: 1131-1139, 2000.
8. Dharmsathaphorn K, McRoberts JA, Mandel KG, Tisdale LD, and Masui H. A human
colonic tumor cell line that maintains vectorial electrolyte transport. Am J Physiol 246: G204-208, 1984.
9. Dubois E and Grenson M. Methylamine/ammonia uptake systems in saocharomyces cerevisiae:
multiplicity and regulation. Mol Gen Genet 175: 67-76, 1979.
10. Hall MC, Koch MO, and McDougal WS. Mechanism of ammonium transport by intestinal
segments following urinary diversion: evidence for ionized NH4+ transport via K(+)-pathways. J Urol
148: 453-457, 1992.
11. Handlogten ME, Hong SP, Westhoff CM, and Weiner ID. Apical ammonia transport by the
mouse inner medullary collecting duct cell (mIMCD-3). Am J Physiol Renal Physiol 289: F347-358,
2005.
12. Handlogten ME, Hong SP, Westhoff CM, and Weiner ID. Basolateral ammonium transport
by the mouse inner medullary collecting duct cell (mIMCD-3). Am J Physiol Renal Physiol 287: F628-
638, 2004.
13. Handlogten ME, Hong SP, Zhang L, Vander AW, Steinbaum ML, Campbell-Thompson M,
and Weiner ID. Expression of the ammonia transporter proteins Rh B glycoprotein and Rh C
glycoprotein in the intestinal tract. Am J Physiol Gastrointest Liver Physiol 288: G1036-1047, 2005.
14. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, and Bruford EA. The ABCs of
solute carriers: physiological, pathological and therapeutic implications of human membrane transport
proteinsIntroduction. Pflugers Arch 447: 465-468, 2004.
15. Heitman J and Agre P. A new face of the Rhesus antigen. Nat Genet 26: 258-259, 2000.
16. Hrnjez BJ, Song JC, Prasad M, Mayol JM, and Matthews JB. Ammonia blockade of
intestinal epithelial K+ conductance. Am J Physiol 277: G521-532, 1999.
17. Khademi S, O'Connell J, 3rd, Remis J, Robles-Colmenares Y, Miercke LJ, and Stroud
RM. Mechanism of ammonia transport by Amt/MEP/Rh: structure of AmtB at 1.35 A. Science 305:
1587-1594, 2004.
-27-

18. Kikeri D, Sun A, Zeidel ML, and Hebert SC. Cell membranes impermeable to NH3. Nature
339: 478-480, 1989.
19. Kinne R, Kinne-Saffran E, Schutz H, and Scholermann B. Ammonium transport in
medullary thick ascending limb of rabbit kidney: involvement of the Na+,K+,Cl(-)-cotransporter. J
Membr Biol 94: 279-284, 1986.
20. Knepper MA and Agre P. Structural biology. The atomic architecture of a gas channel. Science
305: 1573-1574, 2004.
21. Koch MO and Hall MC. Mechanism of ammonium transport: inhibition by potassium and
barium. J Urol 148: 1285-1287, 1992.
22. Kunzelmann K and Mall M. Electrolyte transport in the mammalian colon: mechanisms and
implications for disease. Physiol Rev 82: 245-289, 2002.
23. Kustu S and Inwood W. Biological gas channels for NH3 and CO2: evidence that Rh (Rhesus)
proteins are CO2 channels. Transfus Clin Biol 13: 103-110, 2006.
24. Liu Z, Peng J, Mo R, Hui C, and Huang CH. Rh type B glycoprotein is a new member of the
Rh superfamily and a putative ammonia transporter in mammals. J Biol Chem 276: 1424-1433, 2001.
25. Ludewig U. Electroneutral ammonium transport by basolateral rhesus B glycoprotein. J Physiol
559: 751-759, 2004.
26. Mak DO, Dang B, Weiner ID, Foskett JK, and Westhoff CM. Characterization of ammonia
transport by the kidney Rh glycoproteins RhBG and RhCG. Am J Physiol Renal Physiol 290: F297-305,
2006.
27. Marini AM, Matassi G, Raynal V, Andre B, Cartron JP, and Cherif-Zahar B. The human
Rhesus-associated RhAG protein and a kidney homologue promote ammonium transport in yeast. Nat
Genet 26: 341-344, 2000.
28. Mossberg SM. Ammonia absorption in hamster ileum: effect of pH and total CO2 on transport
in everted sacs. Am J Physiol 213: 1327-1330, 1967.
29. Mossberg SM and Ross G. Ammonia movement in the small intestine: preferential transport by
the ileum. J Clin Invest 46: 490-498, 1967.
30. Nakamura S, Amlal H, Galla JH, and Soleimani M. NH4+ secretion in inner medullary
collecting duct in potassium deprivation: role of colonic H+-K+-ATPase. Kidney Int 56: 2160-2167,
1999.
31. Nakhoul NL, Dejong H, Abdulnour-Nakhoul SM, Boulpaep EL, Hering-Smith K, and
Hamm LL. Characteristics of renal Rhbg as an NH4(+) transporter. Am J Physiol Renal Physiol 288:
F170-181, 2005.
32. Nakhoul NL and Hamm LL. Non-erythroid Rh glycoproteins: a putative new family of
mammalian ammonium transporters. Pflugers Arch 447: 807-812, 2004.
33. Nakhoul NL, Hering-Smith KS, Abdulnour-Nakhoul SM, and Hamm LL. Transport of
NH(3)/NH in oocytes expressing aquaporin-1. Am J Physiol Renal Physiol 281: F255-263, 2001.
34. Nakhoul NL, Schmidt E, Abdulnour-Nakhoul SM, and Hamm LL. Electrogenic ammonium
transport by renal Rhbg. Transfus Clin Biol 13: 147-153, 2006.
35. Prasad M, Smith JA, Resnick A, Awtrey CS, Hrnjez BJ, and Matthews JB. Ammonia
inhibits cAMP-regulated intestinal Cl- transport. Asymmetric effects of apical and basolateral exposure
and implications for epithelial barrier function. J Clin Invest 96: 2142-2151, 1995.
36. Ramirez MA, Toriano R, Parisi M, and Malnic G. Control of cell pH in the T84 colon cell
line. J Membr Biol 177: 149-157, 2000.
37. Randall DJ and Tsui TK. Ammonia toxicity in fish. Mar Pollut Bull 45: 17-23, 2002.
-28-
Page 28 of 45

Page 29 of 45
38. Randall DJ, Wilson JM, Peng KW, Kok TW, Kuah SS, Chew SF, Lam TJ, and Ip YK. The
mudskipper, Periophthalmodon schlosseri, actively transports NH4+ against a concentration gradient.
Am J Physiol 277: R1562-1567, 1999.
39. Roon RJ, Even HL, Dunlop P, and Larimore FL. Methylamine and ammonia transport in
Saccharomyces cerevisiae. J Bacteriol 122: 502-509, 1975.
40. Santer R. Waste Disposal, Crab Style. J Exp Biol 205: i, 2002.
41. Silen W, Harper HA, Mawdsley DL, and Weirich WL. Effect of antibacterial agents on
ammonia production within the intestine. Proc Soc Exp Biol Med 88: 138-140, 1955.
42. Singh SK, Binder HJ, Geibel JP, and Boron WF. An apical permeability barrier to
NH3/NH4+ in isolated, perfused colonic crypts. Proc Natl Acad Sci U S A 92: 11573-11577, 1995.
43. Thomson RB, Thomson JM, and Phillips JE. NH4+ transport in acid-secreting insect
epithelium. Am J Physiol 254: R348-356, 1988.
44. Waisbren SJ, Geibel JP, Modlin IM, and Boron WF. Unusual permeability properties of
gastric gland cells. Nature 368: 332-335, 1994.
45. Wall SM. Mechanisms of NH4+ and NH3 transport during hypokalemia. . Acta Physiol Scand
179: 325-330, 2003.
46. Wall SM, Trinh HN, and Woodward KE. Heterogeneity of NH+4 transport in mouse inner
medullary collecting duct cells. Am J Physiol 269: F536-544, 1995.
47. Weihrauch D, Ziegler A, Siebers D, and Towle DW. Active ammonia excretion across the
gills of the green shore crab Carcinus maenas: participation of Na(+)/K(+)-ATPase, V-type H(+)-
ATPase and functional microtubules. J Exp Biol 205: 2765-2775, 2002.
48. Weiner ID. Expression of the non-erythroid Rh glycoproteins in mammalian tissues. Transfus
Clin Biol 13: 159-163, 2006.
49. Weiner ID, Miller RT, and Verlander JW. Localization of the ammonium transporters, Rh B
glycoprotein and Rh C glycoprotein, in the mouse liver. Gastroenterology 124: 1432-1440, 2003.
50. Weiner ID and Verlander JW. Renal and hepatic expression of the ammonium transporter
proteins, Rh B Glycoprotein and Rh C Glycoprotein. Acta Physiol Scand 179: 331-338, 2003.
51. Wilkie MP. Ammonia excretion and urea handling by fish gills: present understanding and
future research challenges. J Exp Zool 293: 284-301, 2002.
52. Worrell RT, Bao HF, Denson DD, and Eaton DC. Contrasting effects of cPLA2 on epithelial
Na+ transport. Am J Physiol Cell Physiol 281: C147-156, 2001.
53. Worrell RT, Best A, Crawford OR, Xu J, Soleimani M, and Matthews JB. Apical
ammonium inhibition of cAMP-stimulated secretion in T84 cells is bicarbonate dependent. Am J Physiol
Gastrointest Liver Physiol 289: G768-778, 2005.
54. Worrell RT, Oghene J, and Matthews JB. Ammonium effects on colonic Cl- secretion:
anomalous mole fraction behavior. Am J Physiol Gastrointest Liver Physiol 286: G14-22, 2004.
55. Wrong O. Nitrogen metabolism in the gut. Am J Clin Nutr 31: 1587-1593, 1978.
-29-

Figure Legends:
Figure 1. mRNA for the ammonium transporting Rh Glycoproteins is present in T84 cells. The end
products at PCR cycle completion of representative Real Time RT-PCR reactions (2 for each RhBG and
RhCG) are shown by PAGE gel electrophoresis. Quantitative analysis of Real-time RT-PCR reactions
yielded a ratio of RhBG/RhCG of 1.10±0.15 (N=8). Products of the predicted size (~70 bp) are
indicated by the arrows. Control RCR reactions did not reveal any product (not shown).
Figure 2. Functional determination of Rh Glycoprotein activity in T84 cells. In addition to NH4 + ,
methylammonium (MA) is transported by the Rh Glycoproteins, thus their activity can be assessed by
[ 14 C]-MA uptake and flux. A) Uptake of [ 14 C]-MA when applied to the apical or basolateral side of T84
cell monolayers. The magnitude of uptake is significantly greater when applied basolaterally. MA
uptake from either side is attenuated by the addition of NH4 + charateristic of Rh G activity. B)
Transepithelial flux of MA in T84 cells. Tracer [ 14 C]-MA was added to either the apical or basolateral
side to determine unidirectional flux in either direction. The combined results demonstrate net secretion
of MA. Transepithelial MA flux was attenuated by the addition of NH4 + characteristic of Rh G activity.
In A and B Symmetrical 1 mM ‘cold’ MA was used with 1 µCi/ml 14 C-MA applied to either the apical
or the basolateral side. Uptake and flux period was 2 min. C) Long term MA Uptake over a 60 min
period obtained in cells bathed in culture media and kept in tissue culture incubator. D) Long term MA
flux over a 60 min period for cells bathed in culture media and kept in tissue culture incubator. The
combined results are qualitatively similar to those in panel A & B. In C and D Symmetrical 1 mM ‘cold’
MA was used with 0.5 µCi/ml 14 C-MA applied to either the apical or the basolateral side. N=6 for all
groups. * P < 0.05.
-30-
Page 30 of 45

Page 31 of 45
Figure 3. Methylammonium (MA) uptake and flux in T84 cells. A) Dose response for MA uptake in
the absence and presence of basolateral 100 µM bumetanide. Total (Y), Bumetanide-insensitive (Z),
and bumetanide-sensitive ([) uptakes are shown. Uptake period was 2 min. Uptake represents combined
uptake due to RhBG transporter activity and liner diffusive uptake (> 5 mM MA). B) Time course of
MA uptake with 3 mM symmetrical cold MA. Total (Y), Bumetanide-insensitive (Z), and bumetanide-
sensitive ([) uptakes are shown. A significant bumetanide-sensitive component of MA uptake is
observed only at uptake times exceeding 3-4 min. C) Time course of completed transepithelial MA flux
in the secretory direction. Total (Y), Bumetanide-insensitive (Z), and bumetanide-sensitive ([) fluxes
are shown. 3 mM symmetrical MA was used. A slight bumetanide-sensitive component of MA flux is
observed only at time points exceeding 5 min. N=4 for each data point. * P

presence of apical NH4 + . Apical NH4 + at concentrations up to 100 mM does not inhibit basolateral
uptake of MA or secretory direction flux of MA, suggesting that NH4 + uptake and transport via RhBG
can occur against a physiologically relevant NH4 + gradient. Uptake and flux time was 2 min, with 1 mM
symmetrical MA. Apical media pH was 5.5 and basolateral pH 7.4. Initial condition was 0 mM
basolateral NH4 + . N=4 for each data point, * indicates significant difference from the zero time point.
Figure 6. Net NH4 + flux in the secretory direction occurs in T84 cells. Unidirectional NH4 + fluxes in
forskolin-stimulated T84 cells under asymmetric NH4 + conditions. 10 mM NH4 + with 0 mM K + was
added to one side of the epithelium and the other side sampled at 5 min for NH4 + determination. The
combined results demonstrate a calculated net secretion (Jnet) of NH4 + . N=4 for each group.
Figure 7. Effect of basolateral bumetanide on NH4 + flux. A) Secretory direction flux (Jba) in the
presence of 100 µM basolateral bumetanide or 100 µM basolateral ouabain. A 5 min sample period was
used. B) Change in basolateral [NH4 + ] observed with an applied apical to basolateral NH4 + gradient of
10 mM apical to 3 mM basolateral. Data is shown for control (Y) and with 100 µM basolateral
bumetanide (Z). Inhibition of NKCC1 leads to a significant increase in basolateral [NH4 + ] suggesting
NKCC1 plays a key role in limiting an absorptive direction flux of NH4 + . Cells were pretreated with
basolateral drug for 5 min prior to initiating the NH4 + flux. N=4 for each group. * P < 0.05 verses
control.
Figure 8. cAMP effect on MA and NH4 + transport. A) Basolateral MA uptake and Jba flux in the
absence or presence of 10 µM foskolin. B) Apical MA uptake and Jab flux in the absence or presence of
10 µM forskolin. For A and B symmetrical 1 mM MA and a 2 min sample time were used.C) Jba flux of
-32-
Page 32 of 45

Page 33 of 45
NH4 + in the absence or presence of 10 µM forskolin. Initial condition was 0 mM apical and 10 mM
basolateral NH4 + . D) Jab flux of NH4 + in the absence or presence of 10 µM forskolin. Initial condition
was 10 mM apical and 0 mM basolateral NH4 + . For C and D a 5 min sample time was used. N=6 for
each bar. NS – no statistical significance and *- P < 0.05 for control verses forskolin treated groups.
Figure 9. Basolateral [NH4 + ] over time in the presence of varying apical to basolateral gradients of
NH4 + . Initial gradients were (Apical:Basolateral): Y- 0:0, Z- 0:3, [ – 3:3, \ - 10:3, ]- 20:3, and ^ -
30:3 mM NH4 + . Apical and basolateral pH was 7.4. N=4 for each data point.
Figure 10. Effect of apical pH on basolateral [NH4 + ] with an initial apical to basolateral 10:3 mM NH4 +
gradient. T84 cells can maintain a 10:3 NH4 + gradient at neutral (Y) and acidic (Z) apical pH but can
not overcome passive NH3 back flux at alkaline ([) apical pH. Basolateral ph was 7.4. N=4 for each data
point. * indicates significant difference from the respective time 0 point.
Figure 11. T84 cells are able to maintain an apical to basolateral NH4 + gradient of 20:~2.5 mM for at
least 60 min. Cells were kept in complete culture media at pH 7.2 on the basolateral side and serum free
culture media at pH 6.0 on the apical side (conditions which are more representative of in vivo
conditions). N=4 for each point, error bars are within the symbols.
-33-

marker
200 bp
100 bp
RhBG RhCG
Figure 1
Page 34 of 45

Page 35 of 45
A. B.
C.
MA uptake
(pmoles/min/cm 2 )
MA uptake
(pmoles/min/cm 2 )
400 +
No NH4 300
200
100
0
300
250
200
150
100
50
0
+
10 mM NH4 from apical from basolateral
from
apical
from
basolateral
MA flux
(pmoles/min/cm 2 )
D.
MA flux
(pmoles/min/cm 2 )
250
200
150
100
50
0
-50
125
100
75
50
25
0
-25
-50
+
No NH4 +
10 mM NH4 J ab
J ab
J ba
J ba
Figure 2
J net
J net
secretion
absorption
secretion
absorption

Basolateral MA uptake
(pmoles/cm 2 )
20000
15000
10000
5000
0
total
bumet-insensitive
bumet-sensitive
A.
Basolateral MA uptake
(pmoles/min/cm 2 )
min
6000
4000
2000
0
Total
0 2 4 6 8 10
Bumet-insensitive
Bumet-sensitive
0 2 4 6 8 10 12 14
MA (mM)
B. C.
*
*
Basolateral MA
(pmoles/cm 2 )
4000
3000
2000
1000
0
total
bumet-insensitive
bumet-sensitive
min
Figure 3
* *
0 2 4 6 8 10
Page 36 of 45

Page 37 of 45
Total MA Uptake
1 / (nM/cm 2 /min)
D. E.
1.0
0.8
0.6
0.4
0.2
0.0
-4 -2 0 2 4 6 8 10
K + mM
bumetanide-sensitive
MA Uptake
1 / (nM/cm 2 /min)
6
5
4
3
2
1
0
K + mM
Figure 3
(cont.)
-4 -2 0 2 4 6 8 10

A. B.
Basolateral MA uptake
(pmoles/min/cm 2 )
5000
4000
3000
2000
1000
0
Total
Bumetanide-insensitive
6 7 8 9
basolateral pH
C.
MA (pmoles/min/cm 2 )
1000
900
800
700
600
500
400
300
200
100
0
Apical Uptake
J ab
apical pH
MA Jba (pmoles/min/cm 2 )
600
500
400
300
200
100
0
Total
Bumetanide-insensitive
6 7 8 9
6 7 8 9
basolateral pH
Figure 4
Page 38 of 45

Page 39 of 45
MA (pmoles/min/cm 2 )
3000
2500
2000
1500
1000
500
0
*
*
Basolateral uptake
J ba
0 20 40 60 80 100
+
Apical NH4 (mM)
Figure 5

+
NH flux 4
(nmoles/min/cm 2 )
50
40
30
20
10
0
-10
-20
J ab
J ba
J net
Figure 6
Secretion
Absorption
Page 40 of 45

Page 41 of 45
+ Jba
NH 4
A. B.
(nmoles/min/cm 2 )
80
60
40
20
0
Control
+ bumetanide
+ ouabain
+
Basolateral NH4 ( mM)
0.6
0.4
0.2
0.0
Control
w/ bumet
min
Figure 7
0 5 10 15 20

A.
MA (pmoles/min/cm 2 )
C.
+ Jba
NH 4
3500
3000
2500
2000
1500
1000
500
0
(nmoles/min/cm 2 )
20
15
10
5
0
NS
Basolateral
Uptake
No FSK
10 µM FSK
NS
J ba
*
Control 10 µM FSK
+ Jab
B.
D.
NH 4
MA (pmoles/min/cm 2 )
(nmoles/min/cm 2 )
6
4
2
0
1500
1000
500
0
NS
Apical
Uptake
Figure 8
No FSK
10 µM FSK
NS
J ab
*
Control 10 µM FSK
Page 42 of 45

Page 43 of 45
+
Basolateral [NH4 ]
(mM)
3.5
3.0
2.5
2.0
0.0
0 5 10 15 20 25 30
min
Figure 9
A,B
0,0
0,3
3,3
10,3
20,3
30,3

+
Basal NH4 (mM)
3.6
3.4
3.2
3.0
2.8
2.6
Apical pH 5.5
Apical pH 7.4
Apical pH 9.0
*
0 5 10 15 20
min
Figure 10
*
Page 44 of 45

Page 45 of 45
+
Basolateral NH4 (mM)
4.5
4.0
3.5
3.0
2.5
2.0
0 10 20 30 40 50 60
Time (min)
Figure 11