3 - Academic Journals

African Journal of
Biotechnology
Volume 10 Number 59 3 October, 2011
ISSN 1684-5315

ABOUT AJB
The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic
Journals.
African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded
on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial
microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic
engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and
to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.
Submission of Manuscript
Submit manuscripts as e-mail attachment to the Editorial Office at: ajb@acadjournals.org. A manuscript
number will be mailed to the corresponding author shortly after submission.
The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments.
Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be
given the last name of the first author.

Editors
George Nkem Ude, Ph.D
Plant Breeder & Molecular Biologist
Department of Natural Sciences
Crawford Building, Rm 003A
Bowie State University
14000 Jericho Park Road
Bowie, MD 20715, USA
N. John Tonukari, Ph.D
Department of Biochemistry
Delta State University
PMB 1
Abraka, Nigeria
Prof. Dr. AE Aboulata
Plant Path. Res. Inst., ARC, POBox 12619, Giza,
Egypt
30 D, El-Karama St., Alf Maskan, P.O. Box 1567,
Ain Shams, Cairo,
Egypt
Dr. S.K Das
Department of Applied Chemistry
and Biotechnology, University of Fukui,
Japan
Prof. Okoh, A. I
Applied and Environmental Microbiology Research
Group (AEMREG),
Department of Biochemistry and Microbiology,
University of Fort Hare.
P/Bag X1314 Alice 5700,
South Africa
Dr. Ismail TURKOGLU
Department of Biology Education,
Education Faculty, Fırat University,
Elazığ,
Turkey
Prof T.K.Raja, PhD FRSC (UK)
Department of Biotechnology
PSG COLLEGE OF TECHNOLOGY (Autonomous)
(Affiliated to Anna University)
Coimbatore-641004, Tamilnadu,
INDIA.
Dr. George Edward Mamati
Horticulture Department,
Jomo Kenyatta University of Agriculture
and Technology,
P. O. Box 62000-00200,
Nairobi, Kenya.
Dr Helal Ragab Moussa
Bahnay, Al-bagour, Menoufia,
Egypt.
Dr VIPUL GOHEL
Flat No. 403, Alankar Apartment, Sector 56, Gurgaon-
122 002,
India.
Dr. Sang-Han Lee
Department of Food Science & Biotechnology,
Kyungpook National University
Daegu 702-701,
Korea.
Dr. Bhaskar Dutta
DoD Biotechnology High Performance Computing
Software Applications
Institute (BHSAI)
U.S. Army Medical Research and Materiel Command
2405 Whittier Drive
Frederick, MD 21702
Dr. Muhammad Akram
Faculty of Eastern Medicine and Surgery,
Hamdard Al-Majeed College of Eastern Medicine,
Hamdard University,
Karachi.
Dr. M.MURUGANANDAM
Departtment of Biotechnology
St. Michael College of Engineering & Technology,
Kalayarkoil,
India.
Dr. Gökhan Aydin
Suleyman Demirel University,
Atabey Vocational School,
Isparta-Türkiye,
Dr. Rajib Roychowdhury
Centre for Biotechnology (CBT),
Visva Bharati,
West-Bengal,
India.
Dr.YU JUNG KIM
Department of Chemistry and Biochemistry
California State University, San Bernardino
5500 University Parkway
San Bernardino, CA 92407

Editorial Board
Dr. Takuji Ohyama
Faculty of Agriculture, Niigata University
Dr. Mehdi Vasfi Marandi
University of Tehran
Dr. FÜgen DURLU-ÖZKAYA
Gazi Üniversity, Tourism Faculty, Dept. of
Gastronomy and Culinary Art
Dr. Reza Yari
Islamic Azad University, Boroujerd Branch
Dr. Zahra Tahmasebi Fard
Roudehen branche, Islamic Azad University
Dr. Tarnawski Sonia
University of Neuchâtel – Laboratory of
Microbiology
Dr. Albert Magrí
Giro Technological Centre
Dr. Ping ZHENG
Zhejiang University, Hangzhou,
China.
Prof. Pilar Morata
University of Malaga
Dr. Greg Spear
Rush University Medical Center
Dr. Mousavi Khaneghah
College of Applied Science and
Technology-Applied Food Science, Tehran,
Iran.
Prof. Pavel KALAC
University of South Bohemia,
Czech Republic.
Dr. Kürsat KORKMAZ
Ordu University, Faculty of Agriculture,
Department of Soil Science and Plant nutrition
Dr. Tugay AYAŞAN
Çukurova Agricultural Research Institute, PK:01321,
ADANA-TURKEY.
Dr. Shuyang Yu
Asistant research scientist, Department of
Microbiology, University of Iowa
Address: 51 newton road, 3-730B BSB
bldg.Tel:+319-335-7982, Iowa City, IA, 52246,
USA.
Dr. Binxing Li
E-mail: Binxing.Li@hsc.utah.edu
Dr Hsiu-Chi Cheng
National Cheng Kung University and Hospital.
Dr. Kgomotso P. Sibeko
University of Pretoria,
South Africa.
Dr. Jian Wu
Harbin medical university ,
China.

Electronic submission of manuscripts is strongly
encouraged, provided that the text, tables, and figures are
included in a single Microsoft Word file (preferably in Arial
font).
The cover letter should include the corresponding author's
full address and telephone/fax numbers and should be in
an e-mail message sent to the Editor, with the file, whose
name should begin with the first author's surname, as an
attachment.
Article Types
Three types of manuscripts may be submitted:
Regular articles: These should describe new and carefully
confirmed findings, and experimental procedures should
be given in sufficient detail for others to verify the work.
The length of a full paper should be the minimum required
to describe and interpret the work clearly.
Short Communications: A Short Communication is suitable
for recording the results of complete small investigations
or giving details of new models or hypotheses, innovative
methods, techniques or apparatus. The style of main
sections need not conform to that of full-length papers.
Short communications are 2 to 4 printed pages (about 6 to
12 manuscript pages) in length.
Minireview: Submissions of mini-reviews and perspectives
covering topics of current interest are welcome and
encouraged. Mini-reviews should be concise and no longer
than 4-6 printed pages (about 12 to 18 manuscript pages).
Mini-reviews are also peer-reviewed.
Review Process
Instructions for Author
All manuscripts are reviewed by an editor and members of
the Editorial Board or qualified outside reviewers. Authors
cannot nominate reviewers. Only reviewers randomly
selected from our database with specialization in the
subject area will be contacted to evaluate the manuscripts.
The process will be blind review.
Decisions will be made as rapidly as possible, and the
journal strives to return reviewers’ comments to authors as
fast as possible. The editorial board will re-review
manuscripts that are accepted pending revision. It is the
goal of the AJB to publish manuscripts within weeks after
submission.
Regular articles
All portions of the manuscript must be typed doublespaced
and all pages numbered starting from the title
page.
The Title should be a brief phrase describing the
contents of the paper. The Title Page should include the
authors' full names and affiliations, the name of the
corresponding author along with phone, fax and E-mail
information. Present addresses of authors should
appear as a footnote.
The Abstract should be informative and completely selfexplanatory,
briefly present the topic, state the scope of
the experiments, indicate significant data, and point out
major findings and conclusions. The Abstract should be
100 to 200 words in length.. Complete sentences, active
verbs, and the third person should be used, and the
abstract should be written in the past tense. Standard
nomenclature should be used and abbreviations should
be avoided. No literature should be cited.
Following the abstract, about 3 to 10 key words that will
provide indexing references should be listed.
A list of non-standard Abbreviations should be added.
In general, non-standard abbreviations should be used
only when the full term is very long and used often.
Each abbreviation should be spelled out and introduced
in parentheses the first time it is used in the text. Only
recommended SI units should be used. Authors should
use the solidus presentation (mg/ml). Standard
abbreviations (such as ATP and DNA) need not be
defined.
The Introduction should provide a clear statement of
the problem, the relevant literature on the subject, and
the proposed approach or solution. It should be
understandable to colleagues from a broad range of
scientific disciplines.
Materials and methods should be complete enough
to allow experiments to be reproduced. However, only
truly new procedures should be described in detail;
previously published procedures should be cited, and
important modifications of published procedures should
be mentioned briefly. Capitalize trade names and
include the manufacturer's name and address.
Subheadings should be used. Methods in general use
need not be described in detail.

Results should be presented with clarity and precision.
The results should be written in the past tense when
describing findings in the authors' experiments.
Previously published findings should be written in the
present tense. Results should be explained, but largely
without referring to the literature. Discussion,
speculation and detailed interpretation of data should
not be included in the Results but should be put into the
Discussion section.
The Discussion should interpret the findings in view of
the results obtained in this and in past studies on this
topic. State the conclusions in a few sentences at the end
of the paper. The Results and Discussion sections can
include subheadings, and when appropriate, both
sections can be combined.
The Acknowledgments of people, grants, funds, etc
should be brief.
Tables should be kept to a minimum and be designed to
be as simple as possible. Tables are to be typed doublespaced
throughout, including headings and footnotes.
Each table should be on a separate page, numbered
consecutively in Arabic numerals and supplied with a
heading and a legend. Tables should be self-explanatory
without reference to the text. The details of the methods
used in the experiments should preferably be described
in the legend instead of in the text. The same data should
not be presented in both table and graph form or
repeated in the text.
Figure legends should be typed in numerical order on a
separate sheet. Graphics should be prepared using
applications capable of generating high resolution GIF,
TIFF, JPEG or Powerpoint before pasting in the Microsoft
Word manuscript file. Tables should be prepared in
Microsoft Word. Use Arabic numerals to designate
figures and upper case letters for their parts (Figure 1).
Begin each legend with a title and include sufficient
description so that the figure is understandable without
reading the text of the manuscript. Information given in
legends should not be repeated in the text.
References: In the text, a reference identified by means
of an author‘s name should be followed by the date of
the reference in parentheses. When there are more than
two authors, only the first author‘s name should be
mentioned, followed by ’et al‘. In the event that an
author cited has had two or more works published during
the same year, the reference, both in the text and in the
reference list, should be identified by a lower case letter
like ’a‘ and ’b‘ after the date to distinguish the works.
Examples:
Smith (2000), Blake et al. (2003), (Kelebeni, 1983),
(Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b;
Gold, 1993,1995), (Kumasi et al., 2001)
References should be listed at the end of the paper in
alphabetical order. Articles in preparation or articles
submitted for publication, unpublished observations,
personal communications, etc. should not be included
in the reference list but should only be mentioned in
the article text (e.g., A. Kingori, University of Nairobi,
Kenya, personal communication). Journal names are
abbreviated according to Chemical Abstracts. Authors
are fully responsible for the accuracy of the references.
Examples:
Diaz E, Prieto MA (2000). Bacterial promoters triggering
biodegradation of aromatic pollutants. Curr. Opin.
Biotech. 11: 467-475.
Dorn E, Knackmuss HJ (1978). Chemical structure and
biodegradability of halogenated aromatic compounds.
Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown
Pseudomonad. Biochem. J. 174:
73-84.
Pitter P, Chudoba J (1990). Biodegradability of Organic
Substances in
the Aquatic Environment. CRC press, Boca Raton,
Florida, USA.
Alexander M (1965). Biodegradation: Problems of
Molecular Recalcitrance
and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80.
Boder ET, Wittrup KD (1997). Yeast surface display for
screening combinatorial polypeptide libraries. Nat.
Biotechnol. 15: 537-553.
Short Communications
Short Communications are limited to a maximum of
two figures and one table. They should present a
complete study that is more limited in scope than is
found in full-length papers. The items of manuscript
preparation listed above apply to Short
Communications with the following differences: (1)
Abstracts are limited to 100 words; (2) instead of a
separate Materials and Methods section, experimental
procedures may be incorporated into Figure Legends
and Table footnotes; (3) Results and Discussion should
be combined into a single section.
Proofs and Reprints: Electronic proofs will be sent (email
attachment) to the corresponding author as a PDF
file. Page proofs are considered to be the final version
of the manuscript. With the exception of typographical
or minor clerical errors, no changes will be made in the
manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of
Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the
handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that
the editorial office waive some of the handling fee under special circumstances.
Copyright: © 2012, Academic Journals.
All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use
but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary
bibliographic citation, including author attribution, date and article title.
Submission of a manuscript implies: that the work described has not been published before (except in the form of an
abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if
and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the
publisher.
Disclaimer of Warranties
In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any
kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not
advised of the possibility of damage, and on any theory of liability.
This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not
limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement.
Descriptions of, or references to, products or publications does not imply endorsement of that product or publication.
While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements
appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and
advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no
warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or
information in this publication or of any other publication to which it may be linked.

.
African Journal of Biotechnology
Table of Contents: Volume 10 Number 59 3 October, 2011
International Journal of Medicine and Medical Sciences
ences
Research Articles
GENETICS AND MOLECULAR BIOLOGY
ARTICLES
Molecular cloning and characterization of a chitinase gene
up-regulated in longan buds during flowering reversion 12504
Dongli Xie, Wenyu Liang, Xiangxi Xiao, Xiao Liu, Lihan Chen and Wei Chen
Study on combining ability, heterosis and genetic
parameters of yield traits in rice 12512
Mehdi Mirarab, Asadollah Ahmadikhah and and Mohamad Hadi Pahlavani
Assessment of biodiversity based on morphological characteristics
and RAPD markers among genotypes of wild rose species 12520
Atif Riaz, Mansoor Hameed, Azeem Iqbal Khan,
Adnan Younis and Faisal Saeed Awan
Genetic relationships among alfalfa gemplasms resistant to common
leaf spot and selected Chinese cultivars assessed by sequence-related
amplified polymorphism (SARP) markers 12527
Qinghua Yuan, Jianming Gao, Zhi Gui, Yu Wang, Shuang Wang,
Ximan Zhao, Buxian Xia and Xiang-lin Li
PLANT AND AGRICULTURAL TECHNOLOGY
Microspore derived embryo formation and doubled haploid
plant production in broccoli (Brassica oleracea L. var italica)
according to nutritional and environmental conditions 12535
Haeyoung Na, Guiyoung Hwang, Jung-Ho Kwak, Moo Koung
Yoon and Changhoo Chun
Role and significance of total phenols during rooting of
Protea cynaroides L. Cuttings 12542
Wu, H. C. and du Toit, E. S.

Table of Contents: Volume 10 Number 59 3 October, 2011
ences
Number 51 7 september, 2011
ences
ences
ences
ARTICLES
Effect of environmental conditions on the genotypic difference
in nitrogen use efficiency in maize 12547
Cai Hong-Guang, Gao Qiang, Mi Guo-Hua and Chen Fan-Jun
Variability of characteristics in new experimental hybrids of
early cabbage (Brassica oleracea var. capitata L.) 12555
Cervenski Janko, Gvozdanovic-Varga Jelica, Glogovac
Svetlana and Dragin Sasa
Evaluation of genetic diversity in self-incompatible broccoli
DH lines assessed by SRAP markers 12561
Huifang Yu, Zhenqing Zhao, Xiaoguang Sheng,
Jiansheng Wang and Honghui Gu
Growth and nutrient uptake responses of ‘Seolhyang’
strawberry to various ratios of ammonium to nitrate
nitrogen in nutrient solution culture using inert media 12567
An Feng, Kong Lingxue, Gong Lidan, Wang Zhenhui and Lin Weifu
Yield and fiber quality properties of cotton
(Gossypium hirsutum L.) under water stress
and non-stress conditions 12575
Cetin Karademir, Emine Karademir, Remzi Ekinci
and Kudret Berekatoğlu
Modelling of seed yield and its components in tall fescue
(Festuca arundinacea) based on a large sample 12584
Quanzhen Wang, Tianming Hu, Jian Cui, Xianguo Wang,
He Zhou, Jianguo Han and Tiejun Zhang

Table of Contents: Volume 10 Number 59 3 October, 2011
ences
ences
ences
ARTICLES
Response of fed dung composted with rock phosphate on
yield and phosphorus and nitrogen uptake of maize crop 12595
Sharif, M., Matiullah, K., Tanvir, B., Shah, A. H. and Wahid, F.
Seed viability, germination and seedling growth of canola
(Brassica napus L.) as influenced by chemical mutagens 12602
S. N. Emrani, A. Arzani and G. Saeidi
T-DNA integration patterns in transgenic maize lines
mediated by Agrobacterium tumefaciens 12614
Lin Yang, Feng-Ling Fu, Zhi-Yong Zhang, Shu-Feng Zhou,
Yue-Hui She and Wan-Chen Li
Ecological features of Tricholoma anatolicum in Turkey 12626
Guanghua Yang, Yucai He, Zhiqiang Cai, Xiyue Zhao,
Liqun Wang, and Li Wang
Effect of plant growth promoting rhizobacteria on root
morphology of Safflower (Carthamus tinctorius L.) 12639
Asia Nosheen, Asghari Bano, Faizan Ullah, Uzma Farooq,
Humaira Yasmin and Ishtiaq Hussain
High-efficiency regeneration of peanut (Arachis hypogaea L.)
plants from leaf discs 12650
Lili Geng, Lihong Niu, Changlong Shu, Fuping Song,
Dafang Huang and Jie Zhang
ENVIRONMENTAL BIOTECHNOLOGY
A pilot study on the isolation and biochemical characterization
of Pseudomonas from chemical intensive rice ecosystem 12653
Prakash Nathan, Xavier Rathinam, Marimuthu Kasi, Zuraida
Abdul Rahman and Sreeramanan Subramaniam

Table of Contents: Volume 10 Number 59 3 October, 2011
ences
ences
ARTICLES
Microbial degradation of textile industrial effluents 12657
Shanooba Palamthodi, Dhiraj Patil2 and Yatin Patil
FOOD TECHNOLOGY
ences
Yield and storability of green fruits from hot pepper
cultivars (Capsicum spp.) 12662
Awole, S., Woldetsadik, K. and Workneh, T. S.
Effects of different cooking methods on the consumer
acceptability of chevon 12671
Nomasonto M. Xazela, Voster Muchenje and Upenyu Marume
Biot number - lag factor (Bi-G) correlation for tunnel
drying of baby food 12676
Tomislav Jurendid and Branko Tripalo
MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY
Optimization of the technology of extracting water-soluble
polysaccharides from Morus alba L. Leaves 12684
Zhonghai Tang, Shiyin Guo, Liqun Rao, Jingping Qin, Xiaona Xu and Yizeng Liang
Intracellular expression of human calcitonin (hCT) gene in the
methylotrophic yeast, Pichia pastoris 12691
Ali Salehzadeh, Hamideh Ofoghi, Farzin Roohvand, Mohammad
Reza Aghasadeghi and Kazem Parivar
Effect of sodium hypochlorite on the shear bond strength of
fifth- and seventh-generation adhesives to coronal dentin 12697
Mohammad Esmaeel Ebrahimi Chaharom, Mehdi Abed Kahnamoii,
Soodabeh Kimyai and Mohammadreza Hajirahiminejad Moghaddam
Biological study of the effect of licorice roots extract on serum lipid
profile, liver enzymes and kidney function tests in albino mice 12702
Maysoon Mohammad Najeeb Mohammad Saleem, Arieg Abdul Whab
Mohammad, Jazaer Abdulla Al-Tameemi and Ghassan Mohammad Sulaiman

\
\
Table of Contents: Volume 10 Number 59 3 October, 2011
ences
ences
ARTICLES
Assessment of immune response and safety of two
recombinant hepatitis B vaccines in healthy infants in India 12707
Ashok, G., Rajendran, P., Jayam, S., Karthika, R., Kanthesh,
B. M., Vikram, Reddy, E., and Kulkarni, P. S.
ences
ENTOMOLOGY
Differential expression of cytochrome P450 genes in a
laboratory selected Anopheles arabiensis colony 12711
Givemore Munhenga and Lizette L. Koekemoer
FISHERY SCIENCE
Predominant lactic acid bacteria isolated from the intestines
of silver carp in low water temperature 12722
Farzad Ghiasi
BIOTECHNIQUES
Effects of banana wilt disease on soil nematode community
structure and diversity 12729
Shuang Zhong, Yingdui He, Huicai Zeng, Yiwei Mo, ZhaoXi Zhou,
XiaoPing Zang and Zhiqiang Jin
Effect of interaction of 6-benzyl aminopurine (BA) and sucrose
for efficient microtuberization of two elite potato
(Solanum tuberosum L.) cultivars, Desiree and Cardinal 12738
Aafia Aslam, Aamir Ali, Naima Huma Naveed, Asif Saleem and Javed Iqbal
Meiothermus sp. SK3-2: A potential source for the production of
trehalose from maltose 12745
Kian Mau Goh, Charles Voon, Yen Yen Chai and Rosli Md. Illias
Synthesis and application of polyethylene glycol/
vinyltriethoxy silane (PEG/VTES) copolymers 12754
Yin-Chun Chao, Shuenn-Kung Su, Ya-Wun Lin, Wan-Ting
Hsu and Kuo-Shien Huang
APPLIED BIOCHEMISTRY
ANIMAL SCIENCE
ences

Table of Contents: Volume 10 Number 59 3 October, 2011
ences
ences
ARTICLES
Fraud identification in fishmeal using polymerase
chain reaction (PCR) 12762
Abbas Doosti, Pejman Abbasi and Sadegh Ghorbani-Dalini
ences
ANIMAL SCIENCE
Purification and characterization of a phytase from Mitsuokella
jalaludinii, a bovine rumen bacterium 12766
G. Q. Lan, N. Abdullah, S. Jalaludin and Y. W. Ho
Effect of different levels and particle sizes of perlite on carcass
characteristics and tibia ash of broiler chicks 12777
Hamid Reza Ebadi Azar, Kambiz Nazer Adl, Yahya Ebrahim Nezhad
and Mohammad Moghaddam
BIOTECHNIQUES
ences
The effect of butyric acid glycerides on performance and some
bone parameters of broiler chickens 12782
Mehrdad Irani, Shahabodin Gharahveysi,
Mona Zamani and Reza Rahmatian
Construction of a mammalian cell expression vector pAcGFP-FasL
and its expression in bovine follicular granulosa cells 12789
RunJun Yang , Meng Huang, JunYa Li , ZhiHui Zhao, ShangZhong Xu

African Journal of Biotechnology Vol. 10(59), pp. 12504-12511, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.2669
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Molecular cloning and characterization of a chitinase
gene up-regulated in longan buds during flowering
reversion
Dongli Xie 1,2 , Wenyu Liang 2,3 , Xiangxi Xiao 4 , Xiao Liu 2 , Lihan Chen 2 and Wei Chen 1,2 *
1 Key Laboratory of Ministry of Education for Genetics, Breeding and Multiple Utilization of Corps, Fujian Agriculture and
Forestry University, Fuzhou 350002, People’s Republic of China.
2 College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, People’s Republic of China.
3 School of Life Sciences, Ningxia University, Yinchuan 750021, People’s Republic of China.
4 Fujian Academy of Forestry Sciences, Fuzhou 350012, People’s Republic of China.
Accepted 1 September, 2011
A cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique was used for differential
screening of genes expressed in longan (Dimocarpus longan Lour.) flower buds undergoing normal
development versus flowering reversion. One cDNA fragment up-regulated during flowering reversion
was further cloned by rapid amplification of cDNA ends (RACE) technology. This cDNA consists of 961
nucleotides and encodes an open reading frame (ORF) of 227-amino acid residues. The nucleotides and
deduced amino acid sequence were both identical against published chitinases from other species and
hence this cDNA was designated as DLchi (GenBank accession No. GU177464). It has a signal peptide
and glycoside hydrolase’s domain. The estimated molecular weight was 24.77 kD and the isoelectric
point was 5.17. This protein might be grouped as a new member of class II chitinase based on the
sequences available and hypothesis discussed. DLchi might be involved in the flower bud abscission
observed in longan flowering reversion.
Key words: Longan, flowering reversion, chitinase gene, cloning, sequence analysis.
INTRODUCTION
Longan (Dimocarpus longan Lour.), a tree with edible
fruit, is distributed widely in tropical and subtropical
regions. When longan flowering reversion occurs, flower
buds cease normal development and instead form floral
spikes with leaves. The floral spikes gradually shed,
which result in decrease in longan fruit productivity (Chen
et al., 2009).
Recently, some researchers have shown that chitinase
may be involved in abscission of leaves, buds, floral
*Corresponding author. E-mail: weichen909@hotmail.com. Tel:
+86-0591-83718915. Fax: +86-0591-83847208.
Abbreviation: cDNA-AFLP, cDNA-amplified fragment length
polymorphism; RT-PCR, reverse transcriptase PCR; RACE,
rapid amplification of cDNA ends; EDTA,
ethylenediaminetertracetic acid; DEPC, diethyl pyrocarbonate;
ORF, open reading frame.
organs, etc (Patterson, 2001). For example, Campillo and
Lewis (1992) reported that basic chitinases accumulated
to high levels in abscission zones and they serologically
identified a related 33 kD protein in bean anthers and
pistils during flower abscission. Coupe et al. (1997)
screened two chitinases, Chia1 and Chia4, which were
up-regulated in the leaflet abscission zone of Sambucus
nigra. Four different chitinase transcripts were also
identified during abscission of citrus leaves and apple
fruits (Agusti et al., 2008; Zhou et al., 2008). Two
chitinase genes were up-regulated in the abscission zone
at 2 h after flower removal and remained highly
expressed during 14 h, while in the non-abscission zone,
their observed increase of expression was only transient
and peaked at 2 h after flower removal and the class II
chitinase was suggested as abscission zone specific
gene (Meir et al., 2010). In addition, a wound-inducible
class I acidic chitinase gene, win6, was reported in young
undamaged poplar leaves, while a sharp increase,

predominantly in pollen, coincided with anther
dehiscence in flowers (Clarke et al., 1994). An
unexpected abundance (23%) of chitinase genes was
found in the libraries of senescing petals of wallflower
(Erysimum linifolium) (Price et al., 2008). Evidently,
abscission involves the dissolving of cell walls or cell
separation, so that dehiscence and senescence are
similar processes involving cell wall disruption through
the action of chitinases (Roberts et al., 2002; Lewis et al.,
2006).
We identified a chitinase fragment that is up-regulated
during flowering reversion of longan buds with cDNA-
AFLP technique. Semi-quantitative reverse transcriptase
PCR (RT-PCR) was used for further validation of these
results. We proposed that this chitinase may be involved
in longan flower bud abscission. To study its function in
detail, we cloned the complete DLchi cDNA sequence
from the screened gene using the rapid amplification of
cDNA ends (RACE) method and characterized the
sequence by a bioinformatics program.
MATERIALS AND METHODS
A ‘Longyou’ cultivar of longan (D. longan Lour.) growing in the
orchard of the Putian Research Institute of Agricultural Sciences,
Fujian Province, China was used in this study. Samples of both
normal and reversion flowering buds were collected every week
from March 01 to April 05, 2008. Most of the buds were immediately
immersed in liquid N2 and then stored at -80°C for later analysis.
Total RNA extraction from flower buds
1 g sample of longan flower bud tissue was ground into a fine
powder in a pre-cooled pestle and mortar under liquid N2. The
powder was transferred into a centrifuge tube containing pre-heated
(65°C) TB buffer (150 mM Tris Base), 575 mM H3BO3, 50 mM
ethylenediaminetertracetic acid (EDTA) (pH 8.0), 0.5 M NaCl, 4%
SDS), β-mercaptoethanol, 100% ethanol and potassium acetate
(KAc) (5 M, pH 4.8) and mixed on a vortex mixer. An equal volume
of chloroform : isoamyl alcohol (24:1) mixture was then added to
extract the RNA. This procedure was repeated three times. The
upper aqueous phases were pooled and then successively
precipitated with 400 μl 9 M LiCl and 1 ml 100% ethanol at -20°C.
After centrifuging, the precipitate was washed twice with 70%
ethanol and dried at room temperature. The total RNA was resuspended
in diethyl pyrocarbonate (DEPC)-treated water and
stored at -80°C. The RNA purity and integrity were checked by
ensuring that absorbance ratios (A260/280) were between 1.8 and
2.0 and by agarose gel electrophoresis (1%).
cDNA-AFLP analysis
cDNA-AFLP was performed with normal and reversion flowering
buds as described by Bachem et al. (1998). The double-stranded
cDNA was synthesized using the SMART TM PCR cDNA Synthesis
Kit (Clontech, USA). A 200 ng sample of each ds-cDNA was
digested with EcoRI and MseI enzymes and ligated to
corresponding adapters. The sequences of the adapter were as
follows: EcoRI up-stream adapter: 5'-CTCGTAGACTGCGTACC-3',
EcoRI down-stream adapter: 5'-AATTGGTACGCAGTCTAC-3';
MseI upstream adapter: 5'-GACGATGAGTCCTGAG-3', MseI down-
Xie et al. 12505
stream adapter: 5'-TACTCAGGACTCAT-3'. Pre-amplification and
selective amplification were performed according to the protocol
provided with the AFLP Kit (Dingguo, China). The primer
sequences for pre-amplification were as follows: up-stream primer:
5'-GACTGCGTACCAATTCA-3'; downstream primer: 5'-GATGAGT
CCTGAGTAAC-3', selective primers: up-stream: 5'-GACTGCGTA
CCAATTCAAC-3'; down-stream: 5'-GATGAGTCCTGAGTAACAG-
3'. PCR products were identified on a 6% polyacrylamide gel run at
70 W run until the bromophenol blue reached the bottom of the gel.
Bands were then displayed by silver staining.
Cloning and sequence analysis of full-length DLchi cDNA
The target DNA fragment separated into polymorphic bands was
cut and re-amplified with the same primer combinations as those
used for selective amplification. After checking the amplified DNAs
by 1.2% (w/v) agarose gel electrophoresis, these were cloned into a
pMD18-T vector (Takara, China) and sequenced using the
universal M13 and RVm-14 primers.
The flanking 5' and 3'-regions were obtained using the rapid
amplifications of cDNA ends (SMART TM RACE cDNA Amplification
Kit, Clontech). A pair of gene-specific primers was designed based
on the sequence of the fragment screened by cDNA-AFLP. The
forward primer was 5'-CTATTCGGAAGATCAATGGTGCTG-3' and
the reverse primer was 5’-GAACCACAAGGCCGT
CTTGAAGGCGATGG-3'. The open reading frame (ORF) was
detected by DNAstar software. A similar sequence to the cDNA and
its putative amino acid sequence were verified by database
searching at the National Center for Biotechnology Information
server using the BLAST algorithm. Multiple alignments and a
phylogenetic tree were constructed using DNAMAN 2.0 software.
Amino acid sequence analysis was conducted with tools available
at the Expert Protein Analysis System (ExPASy).
Semi-quantitative RT-PCR analysis
2 μg sample of total RNA was used for RT-PCR with the
ReverAid TM First Strand cDNA Synthesis Kit (Fermentas,
Germany), according to the manufacturer’s instructions. Genespecific
primers were as follows: forward primer: 5'-
ATGGCCATGTTCAACTT-3' and reverse primer: 5'-
TCAACAGGACAGATTCTC-3'. DLchi was amplified by 94°C for 2
min, 30 cycles of 94°C for 30 s, 44°C for 30 s and 72°C for 1 min.
The longan actin gene (accession No. EU340557) was used as
internal standard to normalize the amount of templates. The
forward primer was 5'-TGAGGGATGCTAAGATGG-3' and the
reverse primer was 5'-ATGAGTTGCCTGATGGAC-3'. All RT-PCR
expression assays were performed and analyzed at least three
times in independent experiments. Analysis of expression in the gel
bands was performed using the Band leader software.
RESULTS
Isolation and molecular characterization of the DLchi
gene
The cDNAs that were differentially expressed in normal
and reversing flower buds were identified with cDNA-
AFLP. One chitinase cDNA fragment was found and its
up-regulation during flowering reversion was confirmed
by RT-PCR (Figure 1). The full-length cDNA was
completed by assembling the known partial fragment, 3'
and 5' end sequences and was submitted to GenBank

12506 Afr. J. Biotechnol.
Figure 1. Isolation of a differentially expressed fragment of DLchi from
reversion flower buds. A, Detection of DLchi expression using cDNA-AFLP
technique from corresponding buds; M, 100 bp marker; N, normal flower
buds; R, reversion flower buds. The arrow indicates the band corresponding
to DLchi; B, semi-quantitative RT-PCR products were analyzed by agarose
gel electrophoresis; C, relative expression profile of DLchi by Band leader
software analysis. Actin was used as a standard.
(accession No. GU177464).
Comparison of the sequence with NCBI nucleotide (nt)
databases revealed a close identity with the complete
mRNA of several chitinases. Hence, this clone was
named DLchi (D. longan chitinase). The known partial
fragment covers 381 nt from position 367 to 626 in the full
length, while the upstream 367 nt were the result of 5'
RACE and the downstream 626 nt were the result of 3'
RACE. The complete nucleotide sequence covers 961 bp
with an open reading frame (ORF) of 684 bp, capable of
encoding 227-amino-acid residues. An ATG initiation
codon was found in 59 nt (5'-UTR) downstream of the 5'start
and a TGA stop codon is present in 219 nt (3'-UTR)
upstream of the 3'-end. The 3'-UTR contain one AATAA
motif, representing putative polyadenylation signals and
21bp polyadenylation (Figure 2). The first Met is probably
the real translation initiation site since it is embedded
within a sequence that conforms to the consensus for the
optimal context of eukaryotic translation initiation, as
defined by the motif GCC (G or A) CCAUGG (Kozak,
1991). The two most important positions in this motif- the
purine at position -3 and the last G at position +4- were
conserved.
The DLchi protein had a calculated molecular mass of
24.77 kD and isoelectric point (pI) of 5.17. The protein is
hydrophilic with a grand average hydropathicity (GRAVY)
value of -0.127. The N-terminal 25 amino acids exhibited
the characteristics of a signal peptide with a highly
hydrophobic core and the characteristic amino acid
composition near the cleavage site (Von Heijne, 1983),
with the most likely cleavage site been between S25 and
Q26. This protein showed no transmembrane signal in
TMHMM analysis suggesting that it is secreted into the
cytoplasm. Pfam analysis revealed that the DLchi protein
has the catalytic domain of the family 19 chitinases,
placing it as a member of the family 19 glycosyl
hydrolases. Two chitinase family 19 signatures were
found at Cys48 to Gly70
(CAGKSFYTRDGFLSAANSYAEFG) and I161 to M171
(IAFKTALWFWM). A conserved motif (NYNYG), essential
to hydrolytic activity (Verburg et al., 1993), was found in
the catalytic domain at position Asn134 to Gly138. Scanning
the PROSITE database also revealed a potential N-linked
glycosylation site (NLSC) at the C terminal region (Asn224
to Cys227), and one possible protein kinase C phosphorylation
site [Ser77 to Arg79 (SKR)], four possible
casein kinase II phosphorylation sites [Ser65 to Glu68
(SYAE), Ser73 to Asp76 (SADD), Ser77 to Glu80 (SKRE),
Ser220 to Glu223 (SPGE)], four possible N-myristoylation
sites [Gly70 to Asp75 (GSGSAD), Gly141 to Phe146
(GQAIGF), Gly191 to Gly196 (GAVECG), Gly218 to
Glu223(GVSPGE)], and one possible ATP/GTP-binding

Figure 2. The full-length cDNA and deduced amino acid sequence of DLchi. The grey base indicates
the cDNA fragment from cDNA-AFLP. The start codon (ATG) is underlined and an asterisk represents a
termination codon. The 59 bp 5'-UTR leader sequence and the polyadenylation signal are underlined
with - - - and_ _ _, respectively. The 684 bp open reading frame (from 60 to 743 bp as shown in capital
letters) encodes a 227-amino acid DLchi precursor with a signal peptide of 25 amino acids. The arrow
indicates the cleavage site of signal peptide between S25 and Q26.
site motif A (P-loop) [Ala45 to Ser52 (AADCAGKS)]. These
structural features suggest that this protein might have
substrate affinity and enzyme activity similar to those of
other plant chitinases.
Comparison of DLchi putative amino acid sequence
and phylogenetic analysis
Comparison with NCBI protein databases showed that
DLchi had a different identity to a number of other plant
Xie et al. 12507
chitinases, including that of Citrus sinensis 1 (74%),
Pyrus pyrifolia (71%), Galega orientalis (69%), Medicago
sativa (67%), Vitis vinifera (68%), Arabidopsis thaliana
(67%), Zea mays (65%), and Phaseolus vulgaris (63%),
which (except for C. sinensis chitinase) are all of class IV
chitinases. The identical region was mainly localized in
the catalytic domain (Figure 3). Despite similar sequence
correspondence in the catalytic region, DLchi differs from
class IV chitinases by its absence of an N-terminal
cysteine-rich domain. Hence, DLchi is probably a class II
chitinase. Four kinds of class II chitinases were chosen

12508 Afr. J. Biotechnol.
Figure 3. Alignment of amino acid sequences of DLchi with representatives of plant
chitinases of class I, II and IV. Class I: St, S. tuberosum (AF153195.1), Gh, G. hirsutum
(AF034566.1); Class II: Cs1, C. sinensis 1 (AF090336.1), Fa, F. ananassa (EF593027.1),
Hv, H. vulgare (AJ276226.1), Cs2, C. sinensis 2 (Z70032.1), Os, O. sativa ( L40336.1);
Class IV: Pp, P. pyrifolia (FJ589786.1), Go, G. orientalis (AY253984.1), Ms, M. sativa
(FJ487629.1), Vv, V. vinifera (U97521.1), At, A. thaliana (Y14590.1), Zm, Z. mays
(EU724261.1), Pv, P. vulgaris (X57187.1). The structural domain differences are
indicated. The first box represents the chitin-binding domain (cysteine-rich domain); the
second box is a typical Chitinase family 19 signature 1, (C-x (4,5)-F-Y-[ST]-x (3)-[FY]-
[LIVMF]-x-A-x (3)-[YF]-x (2)-F-[GSA]); the third box represents a chitinase family 19
signature 2, ([LIVM]-[GSA]-F-x-[STAG] (2)-[LIVMFY]-W-[FY]-W-[LIVM]).

Figure 4. Phylogenetic tree of amino acid sequences of DLchi and chitinases from
other species. The numbers on the branches represented bootstrap support for 1000
replicates; the phylogenetic tree was computed using standard parameters.
for further comparison, but we found lower identities with
DLchi in class II chitinases from Fragaria ananassa
(40%), Hordeum vulgare (39%), Citrus sinensis 2 (38%),
and Oryza sativa (36%). Three deletions in catalytic
domain were in accordance with the difference between
class I and class IV chitinases. Two class I chitinases,
from Solanum tuberosum (37%) and Gossypium hirsutum
(38%), were also examined. Phylogenetic analysis
(Figure 4) showed that chitinase from longan was most
closely clustered with one class II (C. sinensis 1)
chitinase. They formed the first clade, with another cluster
including S. tuberosum, G. hirsutum, F. ananassa, H.
vulgare, C. sinensis, O. sativa. DLchi was distantly
Xie et al. 12509
related to class IV chitinases from P. pyrifolia, G.
orientalis, M. sativa, A. thaliana, P. vulgaris, V. vinifera,
and Z. mays. This suggests that DLchi might be closer to
class II chitinases from the viewpoint of evolution.
DISCUSSION
We performed cDNA-AFLP to identify genes that were
differentially expressed during flowering reversion. The
results show that three potential genes were involved in
flower reversion, namely, NIMA related protein kinases
(Nek1), endo-1,4-beta-D-glucanase precursor and

12510 Afr. J. Biotechnol.
chitinase (data not shown). Nek1mRNA is thought to be
involved in cell cycle with an accumulation of Nek1
mRNA at the G1/S transition and throughout the G2-to-M
progression (Cloutier et al., 2005). Nek1 downexpression
in flower reversion may interfere with normal
mitosis in flower buds. There is also no doubt that endo-
1,4-beta-D-glucanase up-regulated expression plays an
important role in cell wall separation in plant development
(Xie et al., 2011). However, chitinase is usually suggested
to be pathogenesis-related protein and exert more antifungal
activity (Iqbal et al., 2011). The underlying role in
plant development is not very clear. Therefore, we paid
more attention on chitinase in this study.
The expression of the DLchi cDNA fragment was upregulated
in reversion buds. Analysis of amino acid
sequences indicated similarity with class I, II, IV chitinases of
other plant species. However, DLchi shared higher identities
with class IV, at 63 to 76% similarity, than it did with class I,
at 37 to 38%, or class II, at 36 to 40% (except for C. sinensis
1, which had a 76% similarity). Although class I, II and IV
chitinases are all members of the family 19 glycosyl
hydrolases and the sequences in the catalytic regions are
highly conserved, they differ in their structural elements.
Class I chitinases consist of a chitin-binding domain (CBD)
and a catalytic domain (Cat), linked by a variable hinge
domain (VHD); class II chitinases are structurally
homologous to Cat domain of class I, but lack CBD; class
IV chitinases show sequence similarity to class I, but they
are smaller due to four deletions (Collinge et al., 1993).
When compared with class I, II, and IV enzymes in terms
of sequence, DLchi also has more similarity with class IV
in structure, exhibiting three deletions in the Cat domain.
However, some researchers believe that acid class II
chitinase and class IV chitinase genes might have both
evolved from class I chitinase genes (Wiweger et al.,
2003). This model was also consistent with our
phylogenetic tree results. Taken together, we suggestthat
DLchi encodes a class II chitinase with the following
features: (1) lack of an N-terminal cysteine-rich CBD and
VHD, (2) an acidic isoelectric point and (3) a closer
cluster to class II chitinase. The class II chitinase seems
to be more basically associated with plant development
and morphogenesis, especially in flower formation and
leaf abscission (Delos Reyes et al., 2001; Meir et al.,
2010).
Proscan analysis predicted that DLchi would possess
many post-translational modification sites, including an Nlinked
glycosylation site, a protein kinase C
phosphorylation site, a casein kinase II phosphorylation
site, N-myristoylation sites, and an ATP/GTP-binding site
motif A (P-loop). Although, the significance and exact
mechanism of these motifs are not yet clear, they might
be involved in signal transduction. As one strong
candidate substrate for chitinase, plant arabinogalactan
proteins (AGPs) (Showalter, 2001) could be hydrolyzed to
generate an oligosaccharide fragment signal molecule
that could regulate plant growth and development (Pilling
and Höfte, 2003). Chitinase-treated AGPs were able to
rescue the temperature-sensitive embryonic development
in the carrot tsl1 mutant cell line (Van Hengel et al.,
2001). Kim et al (2000) isolated a chitinase-related
receptor-like kinase in tobacco and suggested that it
might transduce a signal by binding oligosaccharides.
These reports raise the possibility that chitinase may
influence some physiological process in abscission
process by some types of signal transduction mechanism
(Stenvik, 2006). The oligosaccharide would then be
ligated to a receptor for further transduction of the signal
for special physiological process, but its detailed
mechanism still needs further investigation. We anticipate
further plant transformation in the model Arabidopsis in
the coming years based on our analysis.
ACKNOWLEDGEMENTS
This work was supported by the National Natural Science
Grant of China (Award no. 30571293) and the Ph.D.
Programs Foundation of the Ministry of Education of
China (Award no. 200803890009).
REFERENCES
Agustí J, Merelo P, Cercós M, Tadeo FR, Talón M (2008). Ethyleneinduced
differential gene expression during abscission of citrus
leaves. J. Exp. Bot. 59(10): 2717-2733.
Bachem CWB, Oomen RJF, Visser RGF (1998). Transcript imaging
with cDNA-AFLP: A step by step protocol. Plant Mol. Biol. Rep. 16(2):
157-173.
Campillo E, Lewis LN (1992). Occurrence of 9.5 cellulase and other
hydrolases in flower reproductive organs undergoing major cell wall
disruption. Plant Physiol. 99(3): 1015-1020.
Campillo E, Lewis LN (1992). Occurrence of 9.5 cellulase and other
hydrolases in flower reproductive organs undergoing major cell wall
disruption. Plant Physiol. 99(3): 1015-1020.
Clarke HRGM, Davis JM, Wilbert SM, Bradshaw Jrhd, Gordon MP
(1994). Wound induced and developmental activation of a poplar tree
chitinase gene promoter in transgenic tobacco. Plant Mol. Biol. 25(5):
799-815.
Cloutier M, Vigneault F, Lachance D, Séguin A (2005). Characterization
of a poplar NIMA-related kinase PNek1 and its potential role in
meristematic activity. FEBS Lett. 579(21): 4659-4665.
Collinge DB, Kragh KM, Mikkelsen JD, Nielsen KK, Rasmussen U, Vad
K (1993). Plant chitinases. Plant J. 3(1): 31-40.
Coupe SA, Taylor JE, Roberts JA (1997). Temporal and spatial
expression of mRNAs encoding pathogenesis-related proteins during
ethylene-promoted leaflet abscission in Sambucus nigra. Plant Cell.
Environ. 20(12): 1517-1524.
Delos Reyes BG, Taliaferro CM, Anderson MP, Melcher U, McMaugh S
(2001). Induced expression of the class II chitinase gene during cold
acclimation and dehydration of bermudagrass (Cynodon sp.). Theor.
Appl. Genet. 103(2): 297-306.
Iqbal MM, Zafar Y, Nazir F, Ali S, Iqbal J, Asif MA, Omer Rashid O, Ali
GM (2011). Over expression of bacterial chitinase gene in Pakistani
peanut (Arachis hypogaea L.) cultivar GOLDEN. Afr. J. Biotechnol.
10(31): 5838-5844.
Kim YS, Lee JH, Yoon GM, Cho HS, Park SW, Suh MC, Choi D, Ha HJ,
Liu JR, Pai HS (2000). CHRK1, a chitinase-related receptor-like
kinase in tobacco. Plant Physiol. 123(3): 905-915.
Kozak M (1991). Structural features in eukaryotic mRNAs that modulate
the initiation of translation. J. Biol. Chem. 266(30): 19867-19870.
Lewis MW, Leslie ME, Liljegren SJ (2006). Plant separation: 50 ways to
leave your mother. Curr. Opin. Plant Biol. 9(1): 59-65.
Meir S, Philosoph-Hadas S, Sundaresan S, Vijay-Selvaraj KS, Burd S,

Ophir R, Kochanek B, Reid MS, Jiang CZ, Lers A (2010). Microarray
analysis of the abscission-related transcriptome in the tomato flower
abscission zone in response to auxin depletion. Plant Physiol. 154(4):
1929-1956.
Patterson SE (2001). Cutting Loose. Abscission and Dehiscence in
Arabidopsis. Plant Physiol. 126(2): 494-500.
Pilling E, Höfte H (2003). Feedback from the wall. Curr. Opin. Plant Biol.
6(6): 611-616.
Price AM, Orellana DFA, Salleh FM, Stevens R, Acock R, Buchanan-
Wollaston V, Stead AD, Rogers HJ (2008). A comparison of leaf and
petal senescence in wall flower reveals common and distinct patterns
of gene expression and physiology. Plant Physiol. 147(4): 1898-1912.
Roberts JA, Elliott KA, Gonzales-Carranza ZH (2002). Abscission,
dehiscence, and other cell separation processes. Ann. Rev. Plant
Biol. 53: 131-158.
Showalter AM (2001). Arabinogalactan-proteins: structure, expression
and function. Cell Mol. Life Sci. 58(10): 1399-1417.
Stenvik GE, Butenko MA, Urbanowicz BR, Rose JKC, Aalen RB (2006).
Overexpression of inflorescence deficient in abscission activates cell
separation in vestigial abscission zones in arabidopsis. Plant Cell.
18(6): 1467-1476.
Van Hengel AJ, Tadesse Z, Immerzeel P, Schols H, Van Kammen A,
De Vries SC (2001). N-acetylglucosamine and glucosamine
containing arabinogalactan proteins control somatic embryogenesis.
Plant Physiol. 125(4): 1880-1890.
Verburg JG, Rangwala SH, Samac, DA, Luckow VA, Huynh QK (1993).
Examination of the role of tyrosine-174 in the catalytic mechanism of
the Arabidopsis thaliana chitinase: Comparison of variant chitinases
generated by site directed mutagenesis and expressed in insect cells
using baculovirus vectors. Arch. Biochem. Biophys. 300(1): 223-230.
Xie et al. 12511
Von Heijne G (1983). Pattern of amino acids near signal sequence
cleavage sites. Eur. J. Biochem. 133(1): 17-21.
Wiweger M, Farbos I, Ingouff M, Lagercrantz U, Von Arnold S (2003).
Expression of Chia4-Pa chitinase genes during somatic and zygotic
embryo development in Norway spruce (Picea abies): similarities and
differences between gymmosperm and angiiosperm class IV
chitinases. J. Exp. Bot. 54(393): 2691-2699.
Xie XJ, Huang JJ, Gao HH, Guo GQ (2011). Expression patterns of two
Arabidopsis endo-β-1, 4-glucanase genes (At3g43860, At4g39000) in
reproductive development. Mol. Biol. 45(3): 458-465.
Zhou CJ, Lakso AN, Robinson TL, Gan SS (2008). Isolation and
characterization of genes associated with shade induced apple
abscission. Mol. Gene. Geno, 280(1): 83-92.

African Journal of Biotechnology Vol. 10(59), pp. 12512-12519, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.501
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Study on combining ability, heterosis and genetic
parameters of yield traits in rice
Mehdi Mirarab, Asadollah Ahmadikhah* and and Mohamad Hadi Pahlavani
Department of Plant Breeding and Biotechnology, Gorgan University of Agricultural Sciences and Natural Resources,
Gorgan, Iran.
Accepted 19 August, 2011
A study was conducted on heterosis, combining ability and genetic parameters of yield and yield
components in rice. Five lines were crossed with two testers in line × tester manner to produce ten F1
hybrids. Results show that general combining ability (GCA) effect was only significant for total number
of kernels per panicle, number of filled kernels and grain yield per plant, and specific combining ability
(SCA) effect was significant for yield and all of its studied components (except for 100-kernel weight).
Lines IR42 and Pouya showed a significant GCA for grain yield in opposite direction (20.9 and -13.7
g/plant, respectively). The two lines also showed highest significant GCA for number of filled kernels
(22.7 and 23.3, respectively). In the total number of kernels, lines IR8 and IR42 and tester Usen showed
the highest significant GCA (34.79, 27.97 and 12.56). In tiller number, only line IR36 and tester IR68897
had the highest significant GCA (3.51 and 0.84). Combination of IR68897×IR8 showed highest
significant SCA for grain yield (9.7 g/plant), while in the case of number of filled kernels and tiller
number, combinations IR68897×IR8 and Usen/IR36 showed a significant positive SCA (18.9 and 2.1,
respectively), indicating that hybridization can be a choice for improving hybrids with better quantity of
these traits. The highest general heritability ( h ) was obtained for tiller number (96.1%), indicating
2
b
slight effects of the environment on the trait, while for other traits, a mild general heritability (~70%) was
obtained, indicating considerable effect of environment on phenotypic expression of most yield traits. A
low specific heritability ( h ) was obtained for all traits (18.2 to 26.3%), indicating that non-additive
2
n
effects play an important role in genetic control of yield traits. Therefore, it seems that hybridization
must be a choice for utilizing the putative heterosis in special crosses, and such a condition was
observed for tiller number and grain yield in combinations of IR42×IR68897 and IR42×Usen.
Key words: Rice, line × tester, combining ability, heritability, heterosis.
INTRODUCTION
Rice is one of the most important crop plants in the world
and is the main nutritional staple food for approximately
40% of the world’s population. Therefore, increasing its
productivity is of high importance in breeding programs.
Reduced plant height, moderate tillering, large and
compact panicles, increased kernel number per panicle,
increased thousand kernel weight and higher yield are
the most important rice characters to be improved in
breeding programs (Mackill and Lei, 1997; Miller et al.,
*Corresponding author. E-mail: ahmadikhaha@gmail.com.
1993; Nemoto et al., 1995; Paterson et al., 2005; Wayne
and Dilday, 2003). Since some rice hybrids show
heterosis, it subsequently result to production yields
which is 15 to 30% higher than inbred varieties (Yuan,
1994; Fujimura et al., 1996), and finding a better cross
combination is of high importance. Line × tester analysis
is used to evaluate the general and specific combining
ability of various lines and to estimate gene effects and it
is useful in deciding the relative ability of female and male
lines to produce desirable hybrid combinations
(Kempthorne, 1957). It also provides information on
genetic components and enables the breeders to choose
appropriate breeding methods for hybrid variety or

Table 1. Analysis of variance (ANOVA) of yield traits in line × tester experiment.
SOV d.f
Tiller
number
Number of
total kernel
Mean square
Number of
filled kernel
100-kernel
weight (g)
Mirarab et al. 12513
Yield
(g/plant)
Replication 2 0.093 32.72 4.53 0.0007 0.79435
Genotype 16 122.5** 4686** 1796.84** 0.285** 532.506**
Parents 6 232.4** 5065** 1051.64** 0.618** 368.957**
Parents vs. crosses 1 392.9** 0.826 4044.61** 0.03 1045.42**
Crosses 9 19.18** 4955** 2043.89** 0.092* 584.549**
Lines 4 28.67 8434 3447.73 0.084 983.009
Testers 1 21.17 4735 1059.69 0.259 370.868
Lines x Testers 4 9.189** 1530* 886.10** 0.058 239.508*
Error 32 1.639 563.3 210.21 0.031 63.6824
Mean 22.6 187.5 125.0 2.86 46.5
C.V(%) 5.7 12.7 11.6 6.2 17.2
* and ** Indicate significance at 5 and 1% level of probability, respectively.
cultivar development programs.
The nature and magnitude of gene action involved in
expression of quantitative traits is important for
successful development of crop varieties (Pradhan et al.,
2006). Several workers reported the predominance of
dominant gene action for a majority of the yield traits
(Peng and Virmani, 1999, Ramalingan et al., 1993,
Satyanarayana et al., 2000; Kumar et al., 2004), while
Vijay Kumar et al. (1994) reported the predominance of
additive gene action. Preponderance of non-additive
gene action in the expression of yield and yield-related
traits was reported by Pradhan et al. (2006), Ganeshan et
al. (1997), Ramalingam et al. (1997), Ganesan and
Rangaswamy (1998) and Thirumeni et al. (2000).
Wu et al. (1986) reported a low specific heritability for
tiller number and grain yield. Ahmadikhah (2008)
reported highest specific heritability (~42%) for 1000kernel
weight and obtained a low specific heritability
(~26%) for grain yield. Swati and Ramesh (2004)
reported high heritability for grain yield and moderate
heritability for flag leaf area and plant height. Saleem et
al. (2008) noted high specific heritability and high genetic
advance in response to selection in next generation for all
the studied traits. Marilia et al. (2001) stated that specific
combining ability (SCA) effects of hybrids alone had
limited power for parental selection in breeding programs,
and must be used in combination with other parameters
such as hybrid means and GCA of the respective
parents. The hybrid combinations with high mean
performance, desirable SCA estimates and involving at
least one of the parents with high GCA would likely
enhance the concentration of favorable alleles
(Gnanasekaran et al., 2006; Kenga et al., 2004;
Manivannan and Ganesan, 2001; Thirumeni et al., 2000).
The objectives of this research were to study the
important genetic parameters and estimate the GCA and
SCA for yield and its components in rice.
MATERIALS AND METHODS
Two testers and five lines were grown, and at flowering stage, they
were crossed with each other in a line × tester manner to produce
10 F1 hybrids in 2009. The five lines were Pouya (L1), IR42 (L2),
IR36 (L3), IR8 (L4) and Neda-A/IR36 (L5), and the two testers were
Usen (T1) and IR68897 (T2). F1s together with parental lines and
testers were grown in the second year in a randomized complete
blocks design with three replications. Four-week seedlings were
transplanted in each experimental plot with 25 × 25 cm spacing.
Yield and yield-related traits (viz. tiller number, total number of
kernels per panicle, number of filled kernels per panicle and 100kernel
weight) were recorded at suitable times. Genotype means
were used for the analysis of variance as described by Singh and
Chaudhary, (1985). Line × tester analysis was conducted as
described for by Kempthorne (1957). Combining ability analysis
was also performed according to Singh and Chaudhary (1985).
Mid-parent based heterosis (MP) and better-parent based heterosis
(BP) were estimated as outlined by Falconar and Mackey (1996).
General combing ability (GCA) and specific combing ability (SCA)
values were estimated as described for by Kempthorne (1957).
Some important genetic parameters such as additive variance, nonadditive
variance, degree of dominance (d), broad-sense heritability
2
2
( h b ) and narrow-sense heritability ( h n ) were also estimated
according to Falconar and Mackey (1996).
RESULTS AND DISCUSSION
Analysis of variance (ANOVA)
Analysis of variance showed that effects of genotype,
parents and crosses were significant for all the studied
traits (Table 1). However, effects of lines and testers
were not significant. The non-significance of the mean
squares due to lines and testers indicates the prevalence
of non-additive variance (Singh and Kumar, 2004). Line ×
tester effect was significant for all studied traits, except
for 100-kernel weight. Therefore, line × tester analysis
was done only for tiller number, number of total kernels,

12514 Afr. J. Biotechnol.
Tiller number
30
25
20
15
10
5
0
a
L3T1
a
L2
b
b
L1T2
L3T2
ab
ab
L4
L1
c
c
L5
bc
L2T1
L2T2
cd
cd
L4T2
bc
bc
L4T2
L1T1
L5T2
Tiller number
bc
L1T2
cd
de
L2T1
c
L2T2
L1T1
cd
T2
de
de
T1
L4T1
de
de
L5
L3T2
ef
f
L1
e
T1
L3
ef
L3
f
L5T1
fg
L3T1
g
L4
fg
L4T1
g
T2
g
L5T1
h
L2
g
L5T2
250
200
150
100
50
0
a
a
ab
abc
abcd
abcd
abcd
abcd
L4T1
L5
L2T1
L2
Number of total kernels per panicle
100-kenel weight (g)
Figure 1. Mean performance Number of lines, of filled testers kernels and their per hybrids paniclefor
different yield traits in the study. Means with common letters have no significant difference at 5% level of
probability.
4
180
Number of filled kernel per panicle
number of filled
160
kernels and plant yield. Significant
mean square 140 of parents vs. crosses for tiller
number, number of filled kernels and yield
indicated that 120 crosses differed from the parents
significantly; therefore, it is inferred that variations
in the cases
100
of the earlier mentioned traits were
transmitted to 80progeny
(Saleem et al., 2010).
Mean performance of studied genotypes are
shown in Figure 60 1. Among parents, in the case of
tiller number, lines L5 and L2 showed highest and
lowest values, 40 respectively (24.7 and 15.3
tillers/plant). 20For
total number of kernels per
panicle, again line L5 showed the highest value
(229.1 kernels) 0 and line L3 showed the lowest
value (148.5 kernels). In the case of filled kernels
per panicle, line L2 showed the highest value (168
filled kernels) and line L3 showed the lowest value
(104.3 filled kernels). For 100-kernel weight, line
L4 showed the highest value (3.54 g) and tester 80
t)
70
60
a
3.5
T2 showed the lowest value (2.2 g). Finally, in the
case of yield per plant, line L4 showed 3 the highest
yield (77.5 g/plant) and tester T2 showed the
lowest value (34.4 g). Among 2.5 hybrids,
combination L3T1 showed the highest value for
tiller number (29.1 tillers/plant) and L5T1 2 showed
the lowest value (20.7 tillers/plant). For total
number of kernels per panicle, combination 1.5 L4T1
showed the highest value (232 kernels/panicle)
and L3T2 showed the lowest value 1 (124.3
kernels/panicle). In the case of filled kernels per
panicle, hybrid L2T1 showed the 0.5 highest value
(144.5 filled kernels) and L5T2 showed the lowest
value (83.4 filled kernels). For 100-kernel 0 weight,
hybrid L1T2 showed the highest value (3.1 g) and
L5T1 showed the lowest Yield value (g/plant) (2.49 g). Finally, in
the case of yield, hybrids L2T2 and L4T1 showed
the highest and the lowest yield per plant,
respectively (68.2 and 24 g/plant) (Figure 1).
ab
bc
cd
cde
de
Number of total kernel per panicle
100-kernel weight (g)
a
L4
L1
b
bc
bc
bc
bcd
cde
cde
L1T2
L4T2
L4T1
L5T2
T1
L4T2
L5T1
L2T2
L2T2
L1T1
bcd
cd
Heterosis study
L1T2
L1T1
de
L4
ef
efg
cde
cde
cde
cde
L2
L3T2
L3T1
T2
L3
T1
de
L1
fgh
L3
gh
L3T1
e
e
L5
L2T1
h
h
In tiller number, the highest significant MP-based
heterosis was estimated for L3T1 and L2T2 (7.8
and 7.7, respectively), and the highest significant
BP-based heterosis was estimated for L3T2 and
L3T1 (7.9 and 7.3, respectively) (Table 2). In total
number of kernels, the highest significant MPbased
heterosis was estimated for L4T1 and L2T1
(59.7 and 36.2, respectively), and the highest
significant BP-based heterosis was estimated for
L4T1 (46.8). For filled kernels per panicle, no
hybrid showed positive significant MP and BPbased
heterosis. For 100-kernel weight, the
highest significant MP-based heterosis was
estimated for L1T2 and L5T2 (0.62 and 0.52 g,
respectively) and the highest significant BP-based
heterosis was estimated for the same hybrids
(0.35 and 0.26 g, respectively). In the case of
L5T2
f
L5T1
L3T2
g
T2

Number of filled kernel per panicle
5
0
180
160
140
120
100
80
60
40
20
L3T1
0
Figure 1. Contd.
a
L2
L1T2
L3T2
ab
ab
L4
L1
L5
L2T2
L4T2
L5T2
L2T1
L1T1
Number of filled kernels per panicle
bc
L2T1
bc
bc
L4T2
L1T1
bc
L1T2
c
L2T2
Yield (g/plant)
cd
T2
T1
L4T1
de
de
L5
80
70
60
50
40
30
20
10
0
L3T2
L1
a
L4
e
T1
L3
ab
L2T2
ef
L3
L5T1
fg
L3T1
bc
cd
L2T1
L4
L3
fg
L4T1
T2
g
L5T1
cde
cde
L4T2
L2
g
L1
L5T2
def
T1
Yield (g/plant)
def
L5
ef
f
L3T2
Numbe
100-kernel weight (g)
L2
50
4
3.5
3
2.5
2
1.5
1
0.5
0
fg
L5T1
0
a
L4
fgh
L3T1
L4T1
L5
L2T1
L2
L1
b
bc
bc
bc
bcd
cde
cde
L1T2
ghi
ghi
T2
L4T2
L5T2
L4T1
hi
L1T2
L5T2
i
i
L1T1
T1
L4T2
L5T1
L2T2
L2T2
100-kenel weight (g)
L4T1
L1T1
L1T2
L1T1
cde
cde
cde
cde
L2
L3T2
L4
L3T1
T2
L3
Mirarab et al. 12515
T1
de
L1
L3
L3T1
e
e
L5
L2T1
L5T2
f
L5T1
L3T2
g
T2

12516 Afr. J. Biotechnol.
Table 2. Values of mid-parent (MP) and better parent (BP) heterosis for yield and its components.
Parameter
Tiller number Total kernel
Number of filled
kernel
100-kernel weight
(g)
Yield (g/plant)
MP BP MP BP MP BP MP BP MP BP
L1T1 1.3 1.0 9.9 -16.2 8.1 -11.5 0.03 -0.07 -22.8** -25.1**
L1T2 6.8** 5.5** 11.7 -10.6 -2.7 -13.3 0.62** 0.35** -13.7** -23.1**
L2T1 4.7** 1.5* 36.2* 7.3 3.3 -23.4** -0.21* -0.25* 13.23** 10.8*
L2T2 7.7** 6.0** 13.2 -12.1 -13.6 -31.4** 0.35** 0.01 29.03** 24.3**
L3T1 7.8** 7.3** -17.6 -23.1 -15.8 -20.9* -0.02 -0.08 -12.8** -16.2**
L3T2 6.8** 7.9** -26.7 -24.2 -1.8 12.2 0.36** 0.06 0.49 -10.0*
L4T1 1.5 3.0** 59.7** 46.8** -42.8** -64.0** -0.25* -0.55** -35.04** -49.5**
L4T2 5.3** 5.3** 35.4* 26.2 -2.2 -14.3 0.14 -0.53** -1.45 -23.0**
L5T1 -2.5** -4.1** 14.9 -19.9 -28.9** -30.2** -0.35** -0.24* -6.58 -6.4
L5T2 2.0* -1.07 -68.0** -99.1** -41.2** -33.5** 0.52** 0.26* -7.66 -14.6**
S.E 0.739 13.7 8.37 0.102 4.607
* and ** indicate significance at 5 and 1% level of probability, respectively.
Table 3. Analysis of combining ability effects of yield traits in the experiment.
S.O.V
Tiller number
Total number of
kernel
Mean square
Number of filled
kernels
GCA 0.46 158.1** 53.44** 15.92**
SCA 2.52** 322.2** 225.30** 58.61**
Error 0.331 6.13 3.744 2.06
2
� GCA
2
SCA
Yield
/ � 0.183 0.491 0.237 0.272
* and ** indicate significance at 5 and 1% level of probability, respectively.
yield, the highest significant MP-based heterosis was
estimated for L2T2 and L2T1 (29 and 13.2 g/plant,
respectively), and thr highest significant BP-based
heterosis was estimated for the same hybrids (24.3 and
10.8 g/plant, respectively).
GCA and SCA values
Analysis of combining ability effects is shown in Table 3.
GCA effect was significant for total number of kernels,
number of filled kernels and yield per plant, and SCA
effect was significant for all mentioned traits. This shows
the contribution of both additive and non-additive effects
in genetic control of total number of kernels, number of
filled kernels and yield per plant, and highly
preponderance of non-additive effects in control of tiller
number.
2
GCA
2
SCA
� / � ratio in all cases was less than
0.5, showing that non-additive effects are preponderant in
the control of all studied traits. Importance of non-additive
gene action in the expression of yield-related traits was
reported by Pradhan et al. (2006) who stated that
2
GCA
2
SCA
� / � ratio was less than unity. Similar results
were also reported by Ganesan et al. (1997),
Ramalingam et al. (1997), Ganesan and Rangaswamy
(1998) and Thirumeni et al. (2000).
GCA values of parents are shown in Table 4. As
shown, in tiller number, only line L3 (IR36) and tester T2
had highest significant GCA (3.51 and 0.84, respectively);
that is, these two parents were better general combiners
for tiller number. In contrast, lines L5 and L4 and tester
T1 had significant negative GCA; that is, the use of these
parents in breeding programs reduces tiller number.
Lines L4 and L2 and tester T1 showed the highest
significant GCA for total number of kernels per panicle
(34.8, 27.97 and 12.6, respectively), while line L3 and
tester T2 showed the highest significant negative GCA for
the trait (-56.6 and -12.6, respectively). These results
indicate that two lines, L4 and L2, and tester T1 are good
general combiners for improving total number of kernels
per panicle and the use of these parents in breeding
programs increases the trait value. In the case of number
of filled kernels per panicle, lines L1 and L2 showed the
highest significant GCA (23.3 and 22.7, respectively),
indicating that these lines are good general combiners for
improving the trait value. In yield performance, only line
L2 showed the highest significant GCA (20.9 g/plant).

Table 4. Estimated GCA values of parents for yield traits in the experiment.
Mirarab et al. 12517
Parents Tiller number Total number of kernel Number of filled kernel Yield (g/plant)
Lines
L1 0.393 11.2 23.31** -13.71**
L2 -0.357 27.97** 22.66** 20.94**
L3 3.51** -56.6** -12.9* -0.512
L4 -1.44** 34.79** -0.29 -1.604
L5 -2.107** -17.4 -32.8** -5.112
S.E (gi) 0.523 9.69 5.919 3.258
Testers
T1 -0.84* 12.56* -5.94 -3.516
T2 0.84* -12.56* 5.943 3.516
S.E(gi) 0.331 6.13 3.744 2.06
* and ** ndicate significance at 5 and 1% level of probability, respectively.
Table 5. Estimated SCA values in different hybrid combinations fof yield traits.
Combination Tiller number Total number of kernel Number of filled kernel Yield (g/plant)
L1T1 -1.16 -15.33 6.9 2.52
L1T2 1.16 15.33 -6.9 -2.52
L2T1 0.09 -2.9 9.9 -0.83
L2T2 -0.09 2.9 -9.9 0.83
L3T1 2.057** -6.5 -5.5 0.42
L3T2 -2.057** 6.5 5.5 -0.42
L4T1 -0.327 -2.28 -18.9* -9.72*
L4T2 0.327 2.28 18.9* 9.72*
L5T1 -0.66 27.0 7.6 7.61
L5T2 0.66 -27.0 -7.6 -7.61
S.E(sca) 0.739 13.7 8.37 4.61
* and ** indicate significance at 5 and 1% level of probability, respectively.
Since the other two traits (total number of kernels and
number of filled kernels) also showed significant GCA in
this line, it can be concluded that these traits are most
important yield components in this line. SCA values of the
hybrids are shown in Table 5. As shown, in the case of
tiller number, only L3T1 and L3T2 showed significant
SCA at 1% level in opposite directions (2.06 and -2.06,
respectively). In the case of number of filled kernels,
combinations L4T1 and L4T2 showed significant SCA at
5% level in opposite directions (-18.9 and 18.9, respectively)
and in the case of yield, combinations L4T1 and
L4T2 showed significant SCA at 5% level in opposite
directions (-9.7 and 9.7 g/plant, respectively). The SCA
values of these hybrids were high enough, so
hybridization can be a choice for improving hybrids with
higher yield. In the case of total number of kernels, no
significant SCA was observed. However, Marilia et al.
(2001) noted that SCA effects of hybrids alone had
limited power for parental selection in breeding programs,
such as hybrid means and GCA of the respective
parents.
Genetic parameters
Important estimated genetic parameters are shown in
Table 6. Additive and non-additive variances were
significant for all studied traits. However, non-additive
effects played more important role as confirmed by value
of degree of dominance (d). This parameter in all cases
was estimated to be >1, indicating that over-dominance is
preponderant in controlling the studied traits. Several
workers also reported the predominance of dominant
gene action for a majority of the yield traits (Peng and
Virmani, 1999; Ramalingan et al., 1993; Satyanarayana
et al., 2000; Kumar et al., 2004), while Vijay Kumar et al.
(1994) reported the predominance of additive gene and
must be used in combination with other parameters
action. Preponderance of non-additive gene action in the
expression of yield and yield-related traits, was also

12518 Afr. J. Biotechnol.
Table 6. Genetic parameters estimated for yield traits.
Parameter Tiller number Total number of kernel Number of filled kernels Yield (g/plant)
δ 2 A 0.922** 316.1** 106.9** 31.85**
S.E(δ 2 A) 0.331 6.13 3.74 2.06
δ 2 D 2.517** 322.2** 225.3** 58.61**
S.E(δ 2 D) 0.739 13.7 8.37 4.61
δ 2 P 41.93 1937.6 739.1 219.96
δ 2 G 40.29 1374.3 528.9 156.27
δ 2 E 1.639 563.27 210.2 63.68
d 2.336 1.43 2.05 1.92
2
h (%)
b
96.1 70.9 71.6 71.0
2
h (%) n
18.2 26.3 19.7 20.7
* and ** indicate significance at 5 and 1% level of probability, respectively.
reported by Pradhan et al. (2006), Ganesan et al. (1997),
Ramalingam et al. (1997), Ganesan and Rangaswamy
(1998) and Thirumeni et al. (2000).
The highest general heritability ( h ) was obtained for
tiller number (96.1%), indicating slight effects of
environment on the trait. However, a mild h (~71%)
was obtained for the remaining traits, indicating that the
environment had relatively large effects on these traits
(Pradhan et al., 2006; Saleem et al., 2010). In all cases, a
2
n
low specific heritability ( h ) was obtained (18.2 to
26.3%), although the highest specific heritability was
calculated for total number of kernels (26.3%), again
indicating that non-additive effects play an important role
in controlling the traits. Ahmadikhah (2008) also reported
a low specific heritability for yield-related traits and Wu et
al. (1986) reported a low specific heritability for tiller
number and grain yield. Therefore, it seems that
hybridization must be a choice for utilizing the putative
heterosis in special crosses.
Abbreviations
ANOVA, Analysis of variance; S.E., standard error; GCA,
general combining ability; SCA, specific combining ability;
2
MP, mid-parent; BP, better parent; � , additive
variance;
variance;
variance;
2
b
2
� , dominance variance;
D
2
P
2
b
� , phenotypic variance;
h , general heritability;
heritability; d, degree of dominance.
REFERENCES
2
E
A
2
b
2
� , genotypic
G
� , environmental
2
h n , specific
Ahmadikhah A (2008). Estimation of heritability and heterosis of some
agronomic traits and combining ability of rice lines using line × tester
method. Elect. J. Crop Prod. 1(2): 15-33.
Falconar DS, Mackey TFC (1996). Introduction to quantitative genetics
(Fourth Edition), Longman Essex, U.K., 532 pp.
Fujimura T, Akagi H, Oka M, Nakamura A, Sawada R (1996).
Establishment of a rice protoplast culture and application of an
asymmetric protoplast fusion technique to hybrid rice breeding. Plant
Tissue Cult. Lett. 13: 243-247.
Ganesan KN, Rangasamy M (1998). Combining ability studies in rice
hybrids involving wild abortive (WA) and Oryza perennis sources of
CMS lines. Oryza, 35(2): 113-116.
Ganesan K, Manual WW, Vivekanandan P, Pillai MA (1997). Combining
ability, heterosis and inbreeding depression for quantitative traits in
rice. Oryza, 34: 13-18.
Gnanasekaran M, Vivekanandan P, Muthuramu S (2006). Combining
ability and heterosis for yield and grain quality in two line rice (Oryza
sativa L.) hybrids. Ind. J. Genet. 66(1): 6-9.
Kempthorne O (1957). An introduction to genetic statistics. John Wiley
and Sons Inc., New York, p. 231.
Kenga R, Albani SO, SC Gupta (2004). Combining ability studies in
tropical sorghum [Sorghum bicolor L. (Meonch)]. Field Crop Res. 88:
251-260.
Kumar A, Singh NK, Chaudhory VK (2004). Line × tester analysis for
grain yield and related characters in rice. Madras Agric. J. 91(4-6):
211-214.
Mackill DJ, Lei XM (1997). Genetic variation for traits related to
temperate adaptation of rice cultivars. Crop Sci. 37: 1340-1346.
Manivannan N, Ganesan J (2001). Line × tester analysis over
environments in sesame. Ind. J. Agric. Res. 35(4): 225-258.
Marilia CF, Servio TC, VatterOR, Clibas V, Siu TM (2001). Combining
ability for nodulation in common bean (Phaseolus vulgaris L.)
genotype from Andean and middle American gene pools. Euph. 118:
265-270.
Miller BC, Foin TC, Hill JE (1993). CARICE: a rice model for scheduling
and evaluating management actions. Agron. J. 85: 938-947.
Nemoto K, Morita S, Baba T (1995). Shoot and root development in rice
related to the phyllochron. Crop Sci. 35: 24-29.
Paterson AH, Freeling M, Sasaki T (2005). Grains of knowledge:
genomics of model cereals. Genome Res. 15: 1643-1650.
Peng JY, Virmani SS (1999). Combining ability for yield and four related
traits in relation to breeding in rice. Oryza, 37: 1-10.
Pradhan SK, Bose LK, Meher J (2006). Studies on gene action and
combining ability analysis in basmati rice. J. Centr. Eur. Agric. 7(2):
267-272.
Ramalingam J, Nadarajan N, Vanniyarajan C, Rangasamy P (1997).
Combining ability studies involving CMS lines in rice. Oryza, 34: 4-7.
Ramalingan J, Virekanaudan P, Vamiarajan C (1993). Combining ability
analysis in lowland early rice. Crop Res. 6: 220-233.
Saleem MY, Mirza JI, Haq MA (2010). Combining ability analysis for

yield and related traits in Basmati rice (Oryza sativa ). Pak. J. Bot.
42(1): 627-637.
Saleem MY, Mirza JI, Haq MA (2008). Heritability, genetic advance and
heterosis in line × tester crosses of basmati rice. J. Agric. Res. 46(1):
15-27.
Satyanarayana PV, Reddy MSS, Kumar I, Madhuri J (2000). Combining
ability studies on yield and yield components in rice. Oryza, 57: 22-
25.
Singh RK, Chaudhary BD (1985). Biometrical Methods in Quantitative
Genetic analysis. Kalyani Publ., Ludhiana, New Delhi, p. 342.
Singh NK, Kumar A (2004). Combining ability analysis to identify
suitable parents for heterotic rice hybrid breeding. Int. Rice Res.
Newslett. 29(1): 21-22.
Swati PG, Ramesh BR (2004). The nature and divergence in relation to
yield traits in rice germplasm. Annals Agric. Res. 25(4): 598-602.
Thirumeni S, Subramanian M, Paramasivam K (2000). Combining
ability and gene action in rice. Trop. Agric. Res. 12: 375-385.
Mirarab et al. 12519
Vijay Kumar SB, Kulkarni RS, Murty N (1994). Line × tester analysis for
combining ability in ratooned F1 rice. Oryza, 31: 8-11.
Wayne SC, Dilday RH (2003). Rice: Origin, History, Technology, and
Production. Wiley Series in Crop Science, John Wiley & Sons, Inc. p.
324.
Wu ST, Hsu TH, Theeng FS (1986). Effect of selection on hybrid rice
populations in the first crop season and at different locations. II.
Corelations and heritability values for agronomic characters in the F2.
J. Agric. Forest. 34(2): 77-88.
Yuan LP (1994). Increasing yield potential in rice by exploitation of
heterosis. In: Virmanni SS (ed) Hybrid rice technology. New
developments and future prospects. IRRI, Manila, Philippines, p. 1-6.

African Journal of Biotechnology Vol. 10(59), pp. 12520-12526, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.866
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Assessment of biodiversity based on morphological
characteristics and RAPD markers among genotypes of
wild rose species
Atif Riaz 1,2 *, Mansoor Hameed 3 , Azeem Iqbal Khan 4 , Adnan Younis 1 and Faisal Saeed Awan 4
1 Institute of Horticultural Sciences, University of Agriculture, Faisalabad, Pakistan.
2 Plant Breeding Institute, Faculty of Food and Agriculture, University of Sydney, Australia.
3 Department of Botany, University of Agriculture, Faisalabad, Pakistan.
4 Centre of Agricultural Biochemistry and Biotechnology (CABB), University of Agriculture Faisalabad, Pakistan.
Accepted 1 July, 2011
Conservation and utilization of the native plant resources is essential for long term sustainability
of biodiversity. Wild native resources are adapted to specific and diverse environmental conditions
and therefore, these adaptive features can be introduced into modern cultivars either through
conventional breeding or advanced molecular genetic techniques. Understanding the genetic make
up of the wildly growing plant species and of target desirable genes is a prerequisite for this
purpose. Five wild rose (Rosa L.) genotypes were collected from different locations in northern
hilly areas of Pakistan for this study. Different morphological characteristics and PCR based random
amplified polymorphic DNA (RAPD) technique was used to find out the diversity and relationship among the
genotypes. On morphological basis, Rosa webbiana collected from Muree and Nathia gali showed
maximum (83%) similarity, whereas on DNA pattern basis, Rosa brunonii collected from Bansra gali
and Sunny bank showed maximum (72%) similarity, while R. webbiana showed maximum diversity
among all the species.
Key words: Genetic diversity, morphological differences, random amplified polymorphic DNA (RAPD), Rosa.
INTRODUCTION
Rose has been cultivated for the last 5000 years during
ancient civilization of China, Western Asia and Northern
Africa (Gudin, 2000), which facilitated its diversification.
After selection and breeding for thousand
years, especially after the first hybrid, tea roses were
bred, rose became one of the most economically
important ornamental crops. Many wild species of
roses are endemic to Pakistan (Landrein et al.,
2009), especially in the northern areas, which if
improved through conventional breeding or advanced
molecular techniques, can have great economic value for
the people of the area, where farmers have small land
holdings of less than 1 hectare and rely on conventional
agriculture for making a living.
*Corresponding author. E-mail: atiff23@gmail.com. Tel: +61-
410191553.
Biodiversity itself provides the basis for all life on earth,
where land clearing and degradation are the one of the
biggest threats to it. This vegetation clearing destroys
fragments or modifies the habitats, and such activities
contribute to further loss of biodiversity through
accelerated land and water degradation (Anonymous,
2004). Loss of the specie or gene will result in reduced
adaptive capacity (Savage, 2010). Conserving biodiversity,
therefore, relies heavily on the protection of
native vegetation in any area across the world, including
areas strongly impacted by human activities (Hance,
2007).
Indo-Pak subcontinent has always been site of
attraction for the whole world regarding its natural flora
and diverse wild roses growing there are adaptable to
several environmental stresses, which grow in cool
temperate to hot arid regions. Native flora is expected to
be adapted to diverse environmental stresses like
disease, salinity, temperature, drought, nutrients, etc.

and conservation of such plants require a broad understanding
of biological diversity.
The genus Rosa L. belongs to the subfamily
Rosoideae of family Rosaceae (Simpson and Ogorzaly,
2001) and comprises more than hundred botanical (wild)
species (Crespel and Mouchotte, 2003). From many of
the wild species, the large number of cultivated
varieties and hybrids has been developed. Since many
species are highly variable and hybridize easily, the
classification of Rosa is sometimes difficult, and the wild
type of some modern forms is not always known. On the
other hand, incorporation of stress resistant genes into
modern cultivars, both by using conventional breeding
programs or modern molecular/genetic techniques, can
be extremely useful in improving modern cultivars,
because if species are more diverse genetically, there
will be more possibilities of DNA encoding in it (Savage,
2010) and this will ultimately increase economic
resources of the country.
To incorporate required attributes, it is essential to
find out the genetic make up of these wildly growing
plant species and their relationship with each other.
Previously, some studies based on herbarium
collections have been carried out for identification and
classification of the wild roses growing in Pakistan in
which morphological characters were considered for the
identification and measuring of diversity (Maryum, 2000).
However, genetic diversity of plants based on
morphological traits is difficult to measure in natural
populations because these traits are influenced by
environmental factors to a large degree. To overcome
this problem, PCR based molecular techniques have
been used for genetic diversity estimations in many
plants species (Debener et al., 2000a; Métais et al.,
2000; Bredemeijer et al., 2002; Heckenberger et al.,
2002; Allnutt et al., 2003; Awamleh et al., 2009; Mujaju,
2010; Panagal et al., 2010). Out of the various PCRbased
multiple-loci marker techniques, RAPD, AFLP
(Wim et al., 2008), microsatellite and SSR, are increasingly
being used in this type of research. Among
these, RAPD was largely used for fingerprinting and to
estimate genetic relatedness in germplasm collections
(Ebrahimi et al., 2009; Hasnaoui et al., 2010). In this
particular study however, both morphological techniques
and RAPDs were used to investigate genetic
diversity in wildly growing roses collected from northern
areas of Pakistan.
MATERIALS AND METHODS
Endemic wild roses were collected based on morphological
differences from five different sites in the northern hilly areas of
Pakistan including Muree foothills, Sunny bank, Ayyubia, Nathia
gali and Bansra gali (Table 1). Sampling was conducted by
transect method, where 10 permanent quadrants (5 m 2 each)
were laid along the straight transect line, each separated by 20 m.
The data were recorded during summer and winter seasons of the
year. Morphological features of flowers, leaves, branches and
Riaz et al. 12521
fruits were recorded. Stem cuttings of wild genotypes were
collected for future genetic studies in end June to early July, while
fruits were collected in September. Cuttings of rose genotypes
were wrapped in wet cloth, and brought down to Faisalabad and
were grown in a mixture of soil and sand media in greenhouse
of Rose Experimental Area, Institute of Horticultural Sciences,
University of Agriculture, Faisalabad, where temperature was
maintained at 26°C.
Morphological studies
Plant samples of five genotypes collected for morphological
studies were brought down to University of Agriculture, Faisalabad
(U.A.F.) and identified by comparing with plants in the herbarium
collection at Department of Botany, U.A.F. Data were recorded on
the selected traits. Plant height was measured onsite from the
base above soil surface to the tip of the branch and average of five
longest branches was recorded, whereas five fully developed
leaves from middle to bottom regions of plants were collected
from the current year's growth. Total leaf length (cm) was measured
from the apex to the base of the leaf along with leaflet length and
leaflet number, while leaf colour was determined by comparing it
with colour chart. Other leaf features including stipule shape,
petiole pubescence, leaf hairiness, leaflet shape and leaflet
margin were examined as per description given in Plant Form, An
Illustrated Guide to Flowering Plant Morphology (Bell and Bryan,
1991). Twig hairiness and prickle shapes were also studied on
branches. Flowers were collected from each plant in blooming
period and flower colour, inflorescence type, calyx shape and
corolla shape were recorded. Fruits (rose hips) were also
collected and fruit shape and fruit length were measured,
while fruit colour was examined by comparing it with colour chart.
DNA extraction for genetic studies
Three-week old leaves were collected from cuttings grown from all
five genotypes and directly frozen in liquid nitrogen. DNA was
extracted using the Qiagen DNeasy ® Plant DNA extraction Kit
(Qiagen Ltd., Crawley, U.K.) according to the protocol (James et al.,
2000; Griffin et al., 2002). Extracted DNA was run on 1% agarose
gel electrophoresis for 15 min to observe quality of DNA. DNA
samples which gave smear results were rejected and re-extracted.
RAPD analysis
Polymerase chain reaction (PCR) conditions were optimized for
rose DNA to obtain reproducible amplification with RAPD. PCR
conditions were optimized with respect to rose DNA
concentration, primers, number of thermal cycles, denaturing,
annealing and extension temperatures, Taq DNA polymerase
concentration and MgCl2 concentration in PCR. The final volume
of the PCR reaction mixture was 25 µl containing 15 ng/ul
DNA, lU/ul Taq polymerase (FERMENTAS INC USA), 2.5 mM
dNTPs (FERMENTAS INC USA), decamer primer (Genelink
Inc. USA); 3 mM of MgCl2, 10X buffer. The DNA amplification was
carried out in a thermal cycler (Eppendorf AG No. 5333 00839,
Germany) with 40 cycles of 94°C for 1 min, 35°C for 1 min and
72°C for 2 min, followed by a final incubation at 72°C for 10
min. A total of 54 random 10 base pair RAPD primers were
obtained from Genelink Inc. (USA), out of which 27 were
selected which yielded consistent amplification.
The RAPD fragments were analyzed by electrophoresis in 1.5%
agarose gels stained with ethidium bromide (l0 ng/l00 ml of agarose
solution) in 1X TBE buffer, 5 µl samples were loaded in each well,

12522 Afr. J. Biotechnol.
Table 1. Geographical distribution of collected rose genotypes.
S/N Rose genotype Geographical region Elevation (m) latitude longitude
1 R.webbiana Nathia gali 2,501 34° 06' 35" N 73° 28' 08" E
2 R.webbiana Murree 2,133 33° 54' 00" N 73° 24' 00" E
3 R.brunonii Sunny bank 2,210 33° 38' 56" N 73° 13' 72" E
4 R.brunonii Ayyubia 2,718 34° 03' 08" N 73° 35' 92" E
5 R.brunonii Bansra gali 2,228 33° 90' 41" N 73° 36' 74" E
Table 2. Correlations between sites of rose collections for soil organic matter (%).
Correlation
R. brunonii
(Ayyubia)
R. webbiana
(Murree)
R. brunonii
(Bansra gali)
R. brunonii
(Sunny bank)
R. webbiana (Murree) 0.97 (0.02)*
R. brunonii (Bansra gali) 0.98 (0.02)* 1.00 (0.00)**
R. brunonii (Sunny bank) 0.99 (0.01) 0.99 (0.01)** 0.99 (0.01)**
R. webbiana (Nathia gali) 0.95 (0.04)* 1.00 (0.00)** 1.00 (0.00)** 0.97 (0.02)*
Figures in parentheses show P-value; * = P < 0.05; * = P< 0.01.
along with 5 µl of 1 KB DNA ladder mix (BDH Chemicals, U.K.) in
each end and run for l.5 h at 150 V. Bands obtained on gel
were measured by comparing PCR product with DNA ladder
mix. These reactions were repeated for three times and only
consistent and bright DNA bands were counted as present (1) or
absent (0). The ambiguous and light DNA bands were rejected in
this study.
Data analysis
Morphological data were analyzed by using multivariate technique
“Cluster Analysis” with the help of statistical software Minitab
(version 13.1) (State College PA, USA). Data was standardized by
using the Z score. Similarities were measured by using Euclidean
distance. The analysis was done at 50% similarity by using
hierarchical clustering to obtain complete linkage clusting dendrogram
(Affifi and Clark, 1996; Hair et al., 2005). Tuky’s T method
(Zar, 2003) was used for pairwise comparison among rose
genotypes whereas, genetic similarities among all pairs of rose
genotypes were calculated and analyzed using Popgen software
(ver 1.44) (Cambridge, UK). This similarity matrix was analyzed
and clustered with UPGMA (unweighted pair group methods using
arithmetic averages) algorithm to determine the genetic
relationships among rose genotypes.
Soil analysis
Composite soil samples were collected from the rhizosphere of the
selected plants at each site, from where the experimental material
was collected. Soil samples were collected at four points per
selected site from top s oil, 0 to 15 cm, 15 to 30 cm and 30 to
45cm depth, and composite sample were prepared for each depth.
RESULTS
Soil analysis distribution of rose genotypes
Analysis of soil samples collected from the five rose plant
collection sites showed that, the soils are predominantly
sandy loam in texture and well drained throughout the
entire root zone, with pH ranging from 6.23 to 7.5. The
relationship between soil characteristics and rose
genotypes was studied by determining the correlation
coefficient among the sites. The correlation between
any two sites for pH, ranging from -0.92 to 0.85 was
statistically non-significant, while there was highly
significant correlation between Sunny bank and Nathia
gali (sites growing different species) at ECe. It was
observed that all sites had significant/highly significant
correlation for organic matter, indicating that this
character was not species specific (Table 2). Soil, silt,
clay and CaCO3 contents showed a non-significant correlation
between the sites irrespective of Rosa
species growing there but there was strong negative
correlation (-0.95) between Bansra gali (Rosa brunonii)
and Murree (Rosa webbiana) at soil silt percentage. Soil
sand percentage also showed overall non-significant
effect, although it was found to be the same on some
sites and the only perfect positively significant
correlation was observed between Nathia gali (Rosa
webbiana) and Ayyubia (Rosa brunonii).
Morphological studies
Based on morphological characters, it was found that
five plant genotypes collected from different locations
belonged to two different species (R. webbiana and R.
brunonii) and these species belonged to sections
Cinnamonae and Synstylae, respectively. Diversity among
genotypes, based on morphological features, using
complete linkage method can be seen in the dendrogram
(Figure 1) and Table 3 shows that at 50% similarity level,

Figure 1. Complete linkage Euclidean distances dendrogram for similarities among rose genotypes based on
morphological features.
Table 3. Euclidean distances for similarities among rose genotypes based on morphological features.
Rose genotype
R. webbiana
(Nathia gali)
R. webbiana
(Murree)
R. brunonii
(Sunny bank)
R. brunonii
(Ayyubia)
Riaz et al. 12523
R. brunonii
(Bansra gali)
R. webbiana (Nathia gali) **** 1.7 9.22 9.43 10.8
R. webbiana (Murree) **** 9.17 9.38 11.5
R. brunonii (Sunny bank) **** 2 8
R. brunonii (Ayyubia) **** 8.2
R. brunonii (Bansra gali) ****
there are two clusters. One of the clusters contains three
genotypes of R. brunonii collected from Sunny bank,
Ayyubia and Bansra gali, while the other cluster contains
two genotypes of R. webbiana collected from Nathia gali
and Muree. It is further noted that plants of R. webbiana
collected from Nathia gali and Muree showed
maximum similarity (83%) among all rose genotypes,
while R. brunonii collected from Sunny bank and
Ayyubia showed 80% similarity level.
RAPD analysis
List and sequences of RAPD primers are shown in Table
4. The genetic relationships among five rose genotypes
based on RAPD can be seen in the dendrogram (Figure
2 and Table 5), using Nei and Li's (1979) similarity
coefficient, where dendrogram clusters the genotypes
mainly into two groups. To divide these genotypes into
groups, 50% similarity (0.5 similarity coefficient) was
taken as the cut off point. Dendrogram shows that R.
brunonii collected from Bansra gali and Sunny bank
showed maximum similarity (72%) among all collections
followed by similarity index of 71% between the
same species collected from Ayyubia and Bansra gali,
and Ayyubia and Sunny bank (70%), respectively.
Overall, R. webbiana particularly those collected from
Murree, showed maximum diversity with all rose
genotypes included in this study, which showed similar
trend of least similarity (62%) with R. brunonii collected
from Bansra gali and Sunny bank and even with R.
webbiana itself collected from Nathia gali. R. webbiana
collected from Nathia gali exhibited more similarity
ranging from 63 to 65% with R. brunonii collected from
various locations rather than the same species (R.
webbiana).
DISCUSSION
Soil analysis distribution of rose genotypes
Soils collected from all selected sights are generally
rich in organic matter which is much higher than the
major soil series of Pakistan. These sites had non
saline calcareous soils with high pH. However, there
was always an acidic horizon in the root zone at all
sites. Apparently, there was no consistent relationship
between soil components and presence of these species
growing in those sites.

12524 Afr. J. Biotechnol.
Table 4. List and sequences of RAPD primers.
S/N Primer name Sequence
Amplified
band/primer
Polymorphic
band/primer
Percentage of
polymorphic band (%)
1. GLA-01 CAGGCCCTTC 6 3 50
2. GLA-04 CAATCGCCGT 11 8 72.72
3. GLA-12 GACCGCTTGT 9 7 77.78
4. GLA-15 AGGTGACCGT 4 4 100
5. GLA-16 AGCCAGCGAA 7 7 100
6. GLA-18 AGGTGACCGT 12 9 75
7. GLA-19 CAAACGTCGG 8 8 100
8. GLA-20 GTTGCGATCC 11 9 81.81
9. GLB-01 GTTTCGCTCC 9 9 100
10. GLB-05 TGGGGGACTC 7 6 85.71
11. GLB-11 GTAGACCCGT 10 8 80
12. GLB-16 TTTGCCCGGA 9 9 100
13. GLB-19 ACCCCCGAAG 9 8 88.89
14. GLC-01 TTCGAGCCAG 8 7 87.5
15. GLC-03 GTGAGGCGTC 10 9 90
16. GLC-04 CCGCATCTAC 9 9 100
17. GLC-05 GATGACCGCC 7 7 100
18. GLC-06 TGTCTGGGTG 7 5 71.42
19. GLC-07 AAAGCTGCGG 8 8 100
20. GLC-08 GACGGATCAG 9 6 66.67
21. GLC-11 AAAGCTGCGG 10 8 80
22. GLD-10 GGTCTACACC 10 9 90
23. GLD-13 TGAGCGGACA 6 6 100
24. GLD-14 CTTCCCCAAG 12 9 75
25. GLD-15 GGTCTACACC 2 2 100
26. GLD-20 GGGACCTCTC 9 8 88.89
27. GLF-17 AACCCGGGAA 10 9 90
Morphological studies
Morphological data have long served as major sources of
information for inferring phylogenetic relationships among
taxa and despite the emphasis on generating large molecular
datasets that is currently seen in phylogenetics,
morphological data remain both relevant and readily
employed (Seth et al., 2010). Therefore, in this study, on
the basis of 19 morphological characteristics, it can be
suggested that genotypes of the species collected from
different ecological environments did not exhibit much
difference. However, the slight difference observed may
be as a result of variations in environment that influenced
characteristics like leaf length, plant height and fruit
length. Some taxonomically important diagnostic
features related to stem, leaves and inflorescence may
be the consequence of adaptation to diverse environmental
conditions, therefore, hunting native germplasm
of Rosa and selection of promising genotypes can
be immensely important for incorporating desirable
characteristics in the future breeding efforts (Kazankaya
et al., 2005). There were also considerable variations in
leaves and shoots characteristics, fruit colour, hairiness,
size and shape among the species and also within the
accessions. Since most of these characteristics are used
in the classification of Rosa genotypes, ecotypic variations
in wild roses can effectively be identified and
used in breeding research of modern cultivars
(Kazankaya et al., 2005). Similar variations have
been reported by several researchers in wild roses
from different regions e.g., Kazankaya et al. (2005) in
native genotypes of R. canina and Ercisli (2005) in
Rosa spp. from Turkey, and Kiani et al. (2007) and
Tabaei-Aghdaei et al. (2007) in R. damascene from Iran.
RAPD analysis
With the advent of polymerase chain reaction and
modern molecular approaches to phylogenetics, DNA
has become a major source for phylogenetic inference
(Seth et al., 2010) and considering morphological data
less important than DNA sequence data in phylogenetic
studies is common (Endress 2002). Results based on

Figure 2. UPGMA dendrogram illustrating the genetic
relationship among Rosa species based on Nei and Li’s (1979)
similarities at 197 RAPD bands.
Table 5. Nei and Li’s similarity matrix index of five rose genotypes obtained from RAPD analysis.
Rose genotype
R. webbiana
(Nathia gali)
R. webbiana
(Murree)
R. brunonii
(Sunny bank)
R. brunonii
(Ayyubia)
Riaz et al. 12525
R. brunonii
(Bansra gali)
R. webbiana (Nathia gali) **** 0.7232 0.7143 0.6339 0.6250
R. webbiana (Murree) **** 0.7054 0.6429 0.6250
R. brunonii (Sunny bank) **** 0.6518 0,6339
R. brunonii (Ayyubia) **** 0.6250
R. brunonii (Bansra gali) ****
morphological descriptions seem contradictory to the
results based on RAPD, where genotypes of R.
webbiana particularly collected from Nathia gali were
found close to each other morphologically but genetically
these are closer to R. brunonii. Morphological characters
differ substantially from DNA sequence characters in their
complexity and their frequency of evolutionary change
(Harald et al., 2009). However, RAPD has been proved
to be a useful genetic marker in taxonomic and
genetic diversity studies (Kiani et al., 2007). These
kinds of molecular/genetic markers can also be used to
verify the origin of vegetatively propagated rose
plants of doubtful origin (Debener et al., 2000b; Byrne
et al., 2007). Data obtained from this study will be an
excellent source for the genome mapping studies.
The unique bands in each of these species will also be
used for SCAR markers development (Sadia et al., 2007)
(unpublished data).
Conclusions
It can be concluded that along with environmentally
influenced characters, there were certain differences
among genotypes which are related to the changes in
genetic makeup of individuals, though similarity on the
basis of morphological characteristics was more as
compared to DNA based information. This diversity may be
because of chance of hybridization among various wild
species, which gives the opportunity to use these
species together for further breeding program.
This can also be a very useful tool in rose crop
improvement, which can help to generate rose varieties,
more resistant to biotic and abiotic stresses. Apparently,
there was no relationship between the soils characteristics
and presence of a particular Rosa species in a
site.
ACKNOWLEDGEMENTS
We thank the Common Wealth Commission for the
financial support. We also acknowledge Professor Dr.
John Gorham and Dr. Katherine A. Steel for providing
the scientific and technical support. Special thanks to
Dr. Phill Holington for reviewing this article.

12526 Afr. J. Biotechnol.
REFERENCES
Affifi A, Clark VA (1996). Computer-aided multivariate analysis, 3rd edn.
Chapman and Hall, London.
Allnutt TR, Newton AC, Premoli A, Lara A (2003). Genetic variation in
the threatened South American conifer Pilgerodendron uviferum
(Cupressaceae), detected using RAPD markers. Biol. Conserv. (114):
245-253.
Anonymous (2004). Biodiversity, It’s every one’s business. Department
of Environment and conversation (NSW), Australia.
http://www.environment.nsw.gov.au/resources/nature/landholderNote
s12Biodiversity.pdf (accessed on 27-08-2010).
Awamleh HD, Hassawi HM, Brake M (2009). Molecular characterization
of pomegranate Punica granatum L. landraces grown in Jordan using
amplified fragment length polymorphism markers. Biotechnology, (8):
316-322.
Bell AD, Bryan A (1991). Plant Form: An Illustrated Guide to
Flowering Plant Morphol. Oxford Univ. Press, Oxford.
Bredemeijer GMM, Cooke RJ, Ganal MW , Peters R, Isaac P
(2002). Construction and testing of a microsatellite database
containing more than 500 tomato varieties. Theor. Appl. Genet. (97):
584-590.
Byrne DH, Rajapakse S, Zhang L, Zamir D (2007). Adventures in
roseland: from applied rose breeding to rose genomics In Plant
Ani. Genomes XV Conference, San Diego, C.A.
Crespel L, Mouchotte J (2003). Methods of cross breeding. In
Encyclopedia of Rose Science (Eds A. Roberts, T. Debener & S.
Gudin). Oxford: Elsevier Science, pp. 30-33.
Debener T, Janakiram T, Mattiesch L (2000b). Sports and seedlings
of rose varieties analysed with molecular markers. Plant Breed. (119):
71-74.
Debener T, Kaufmann H, Dohm A (2000a). Roses as a model for
genome analysis in woody ornamentals. In Plant & Animal
Genome VIII Conference, San Diego. C.A.
Ebrahimi R, Zamani Z, Kashi A (2009). Genetic diversity evaluation of
wild Persian shallot (Allium hirtifolium Boiss.) using morphological
and RAPD markers. Sci. Hortic. (119): 345-351.
Endress PK (2002). Morphology and angiosperm systematics in the
molecular era. Bot. Rev. (Lancaster) (68): 545-570.
Ercisli S (2005). Rose (Rosa spp.) Germplasm resources of Turkey.
Genet. Resour. Crop Evol. (52): 787-795.
Griffin DW, Kellogg CA, Peak KK, Shinn EA (2002). A rapid and
efficient assay for extracting DNA from fungi. Appl. Microbiol. 34 (3):
210-214.
Gudin S (2000). Rose: genetics and breeding. Plant Breed. Rev. (17):
59-189.
Hair JF, Anderson RE, Tatham RL, Black WG (2005). Multivariate Data
Analysis. 5th ed. Pearson education, Singapore.
Hance J (2007). Large-scale agriculture compromises forest's ability to
recover http://news.mongabay.com/2007/1119interview_chazdon.html
(accessed on 12-8-2010).
Harald S, Alan RS, Kathleen MP (2009). Is Morphology Really at Odds
with Molecules in Estimating Fern Phylogeny Syst. Bot. 34(3): 455-
475.
Hasnaoui N, Mars M, Chibani J, Trifi M (2010). Molecular
Polymorphisms in Tunisian Pomegranate (Punica granatum L.) as
Revealed by RAPD Fingerprints. Diversity, (2): 107-114.
Heckenberger M, Bonn M, Ziegle JS, Joe KL, Hauser JD, Hutton M,
Melchinger AE (2002). Variation of DNA fingerprints among
accessions within maize inbred lines and implications for identification
of essentially derived varieties. Genetic and technical sources of
variation in SSR data. Mol. Breed. (10): 181-191.
James AS, Sue M, Hemeida AA (2000). The use of AFLP techniques
for DNA fingerprinting in plants. App. Infor. Beckman, California, USA.
Kazankaya A, Turkoglu N, Yilmaz VI, Balta MF (2005). Pomological
description of Rosa canina selections from Eastern Anatolia, Turkey.
Int. J. Bot. (1):100-102.
Kiani M, Zamani Z, Khalighi A, Fatahi R, Byrne DH (2007). Wide
genetic diversity of Damask rose germplasm in Iran as revealed
by RAPD analysis. In Plant Animal. Genomes XV Conference,
San Diego, CA.
Landrein S, Dorosova K, Osborni J (2009). Rosaceae (I)-Potentilleae &
Roseae. In Flora of Pakistan (Eds Ali SI, Qaiser M) University of
Karachi, Pakistan and Missouri Botanical Press. St. Louis, Missouri,
USA.
Maryum MK (2000). Taxonomic studies of genus Rosa from
Pakistan. Dissertation, Quaid-e-Azam University, Islamabad,
Pakistan.
Metais I, Aubry C, Hamon B, Jalouzot R, Peltier D (2000).
Description and analysis of genetic diversity between commercial
bean lines (Phaseolus vulgaris L.). Theor. Appl. Genet. (101): 1207-
1214.
Mujaju C, Sehic J, Werlemark G, Garkava-gustavsson L, Fatih M,
Nybom H (2010). Genetic diversity in watermelon (Citrullus lanatus)
landraces from Zimbabwe revealed by RAPD and SSR markers.
Hereditas, 147(4): 142-153.
Nei M, Li W (1979). Mathematical model for studying genetic variation
in terms of restriction endonucleous. Proc. Natl. Acad Sci. (76): 5269-
5273.
Panagal M, John BTMM, Kumar RA, Ahmed ABA (2010). RAPDanalysis
of genetic variation of four important rice varieties using two
OPR primers. ARPN J. Agric. Biol. Sci. 5(4): 12-15.
Savage C (2010). Biodiversity What is biodiversity? The Biodiversity
issue. http://www.canadiangeographic.ca/magazine/jun10/what-isbiodiversity.asp
(accessed 9-09-2010).
Seth MB, Jennifer MZ, Kylea AB, Clare HS, Bradley WS, Marc AB
(2010). Are molecular data supplanting morphological data in
modern phylogenetic studies Syst. Entomol. (35): 2-5.
Simpson BB, Ogorzaly MC (2001). Economic botany. 3rd ed. McGraw-
Hill, New York.
Tabaei-aghdaei SR, Babaei A, Khui MK, Jaimand K, Rezaee MB,
Assareh MH, Naghavi MR (2007). Morphological and oil content
variations amongst Damask rose (Rosa damascena Mill.) landraces
from different regions of Iran. Sci. Hort. (113): 44-48.
Wim JMK, Volker WET, Katrien DC, Johan VH, Jan DR, Gerda JHS,
Dirk V, Ben V, Christiane MR, Bert M, Gun W, Hilde N, Thomas D,
Marcus L, Marinus JMS (2008). AFLP markers as a tool to
reconstruct complex relationships: A case study in Rosa (Rosaceae)
Am. J. Bot. (95): 353-366.
Zar RH (2003). Biostistical analysis 4th ed. Pearson edu. Inc.

African Journal of Biotechnology Vol. 10(59), pp. 12527-12534, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.901
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Genetic relationships among alfalfa gemplasms
resistant to common leaf spot and selected Chinese
cultivars assessed by sequence-related amplified
polymorphism (SARP) markers
Qinghua Yuan 1 , Jianming Gao 2 , Zhi Gui 2 , Yu Wang 1 , Shuang Wang 2 , Ximan Zhao 2 , Buxian
Xia 2 and Xiang-lin Li 1*
1 Institute Animal Science, Chinese Academy of Agricultural Science, Beijing, 100193, P. R. China.
2 The Key Laboratory of Crop Genetics and Breeding, Department of Agronomy, Tianjin Agricultural University, Tianjin
300384, P. R. China.
Accepted 18 August, 2011
Genetic relationships among 26 alfalfa cultivars, of which, 12 were of high resistance to common leaf
spot (CLS), were assessed using sequence-related amplified polymorphism (SRAP) markers. 34 SRAP
primer combinations were selected for fingerprinting of these cultivars and a total of 281 bands were
observed, among which 115 were polymorphic (40.93%). Based on molecular data, 26 cultivars were
classified into 5 groups. Group I included 12 Chinese cultivars, most of which had a low CLS resistance
and were planted in cold and/or drought region in China, while 10 of 11 cultivars with a high CLS
resistance were put in group II or group IV respectively. Furthermore, the clustering pattern was, on the
whole, consistent with their CLS resistance or geographic origins. In addition, there was a low genetic
diversity among alfalfa cultivars from China. In conclusion, SRAP markers may serve as a quick tool to
analyze the genetic relationships and genetic diversity among alfalfa cultivars in conjunction with DNAbulking
method. The information produced by this study on the genetic relationships and genetic
diversity among 26 cultivars could be useful to select parents in a CLS resistance breeding program of
alfalfa.
Key words: Lucerne, SRAP, Medicago sativa, common leaf spot, genetic relationships
NTRODUCTION
Alfalfa (Medicago sativa) is the most important forage
species globally in temperate climates (Barnes et al.,
1988) and the most important forage legume in China.
The mainly cultivated alfalfa belongs to two sub-species
of this species, M. sativa subssp. sativa and M. sativa
subssp.× varia, and is the autotetraploid that is naturally
outcrossing, and thus is susceptible to inbreeding
depression. So, the great majority of alfalfa cultivars are
synthetic populations that have been developed from
successive generations of random mating of selected
*Corresponding author. E-mail: lxl@caas.net.cn. Tel: +86-10-
62815750.
clones and their progeny. The complex genetic nature of
alfalfa makes breeding for improved yield very difficult.
A foliar disease called common leaf spot (CLS), is one
of the most serious diseases occurring on alfalfa throughout
the world. It is caused by the fungus Pseudopeziza
medicaginis (Lib.) Sacc. CLS usually not only causes
substantial yield losses but also affects forage quality by
reducing carbohydrate and protein content (Mainer and
Leath,1978; Morgan and Parbery, 1980; Hwang et al.,
2006), with reduced protein levels generally having the
greatest negative impact on feed value. Yuan and Zhang
(2000) evaluated the CLS resistance in 250 alfalfa
populations representing an extensive geographic origin
and found that few of cultivars from China were of high
resistance to CLS. It is an effective method which

12528 Afr. J. Biotechnol.
improves the resistance to CLS of Chinese cultivars
using cultivars with high resistance to CLS identified by
Yuan and Zhang (2000) as breeding parents. However,
efficient use of these gemplasm requires accurate
characterization of genetic variation within and among
populations. Molecular-marker-based genetic diversity
assessments of alfalafa cultivars offers a promising
approach to desigh more effective strategies to use these
gemplasms.
An interesting modified marker technology termed as
sequence-related amplified polymorphism (SRAP) (Li and
Quiros, 2001) was similar to random amplified polymorphic
DNA (RAPD), but it was a preferential random
amplification of coding regions in genome. SRAP had
been applied extensively in genetic linkage map
construction (Li and Quiros, 2001; Yeboah et al., 2007),
genetic diversity analysis (Ferriol et al., 2003; Zhao et al.,
2009; Yang et al., 2010), and comparative genetics (Li et
al., 2003) of different species. In the genetic diversity
analysis, the information derived from SRAP marker was
more concordant to the agronomic and morphological
variability and to the evolutionary history of the
morphotypes than that from other molecular markers
(Ferriol et al., 2003). Recently, SRAP had been also
applied in estimating genetic relationships among alfalfa
germplasm and selected cultivars (Vandemark et al.,
2006).
The objective of this experiment was to use SRAP
markers to estimate genetic relationships among 14
selected alfalfa cultivars (landraces or developed
varieties) from China and 12 cultivars with high
resistance to CLS originated from other countries in the
world. In addition, some of DNA fragments found
polymorphic were sequenced and analyzed in order to
determine the nature of the amplified fragments using
SRAP markers and provide sequence information for
developing of gene markers of alfalfa.
MATERIALS AND METHODS
Genetic materials
14 selected alfalfa cultivars from China, 11 cultivars with high
resistance to CLS originated from other countries in the world
(Table 1) and 1 famous cultivar, “Rambler”, with medium resistance
to CLS originated from Canada were used in this study (Yuan and
Zhang, 2000). In cultivars from China, 4 belonged to synthetic
varieties including “Gannong No.3”, “Zhongmu No. 1”, “Gongnong
No. 1” and “Xinmu No. 2” while all other were landraces. The
resistant cultivars mostly come from America and Canada, and only
2 originated from England and New Zealand respectively.
DNA isolation
DNA was extracted from the bulked trifoliate leaf tissues of 30
seedlings from each cultivar using the CTAB (cetyltrimethylammonium
bromide) procedure of Doyle and Doyle (1990). Finally,
the quality and quantity of DNA were analyzed by running 1%
agarose gel electrophoresis containing λ-DNA standards.
SRAP assay
All SRAP reactions were performed in 20 µl volume containing 20
ng DNA, 200 µM each dNTP, 1.5 mM MgCl2, 1 unit Taq DNA
Polymerase (Takara, Japan) and 0.25 µM of both forward and
reverse primers. Amplification was carried out in an Eppendorf
Mastercycler Gradient Thermocycler with the PCR program of Li
and Quiros (2001). PCR products were resolved by electrophoresis
on 2% agarose gel with ethidium bromide and photographed in
SYNGENE Automated Gel Documentation System.
Sequencing of SRAP fragments and sequence analyzing
To order to get good sequencing results, part cultivar/primer pairs
were separated on 4% denaturing polyacrylamide gels and silver
stained. Some of the amplified fragments using SRAP markers
were recovered from the dried acrylamide gel and re-amplified. The
fragments were then ligated into the pBS-T vector and the
recombinant plasmids were transformed into Escherichia coli,
DH5α. 3 Transformants with insert each recovered fragments were
sequenced at Shanghai Sangon Co. Ltd. Sequence similarity
searches were performed at GeneBank database
(http://www.ncbi.nlm.nih.gov) and Medicago truncatula Database
(http://www.jcvi.org/), with the program BLASTN or BLASTX.
Data analysis
SRAP bands behave as dominant markers, and the band profiles of
each primer pair were manually scored for the presence (1),
absence (0) or missing (-1) of co-migrating fragments for all
cultivars. Only fragments which had a molecular weight ranged from
100 bp to 2000 bp and were of medium or high intensity were
considered for data analysis. Polymorphism information content
(PIC) provide an estimate of the discriminatory power of a marker
and the PIC for each SRAP primer pairs was determined as
described by Smith et al. (1997). Pair-wise genetic distances
among the studied cultivars were calculated using Jaccard’s
genetic dissimilarity coefficient, estimated as dij = c / (a+b+c),
where, dij is the measure of distance between sample i and j, a is
the number of fragments present in i and absent in j, and b is the
number of fragments present in j and absent in i, c is the number of
shared present fragments by i and j. The resulting pairwise
dissimilarity matrix was employed to construct a dendrogram by the
unweighted pair group method with arithmetic mean (UPGMA)
using SAS9.0. The 0/1 matrix is available to readers upon request.
RESULTS
SRAP analysis
The selected primers were based on previous reports of
Li and Quiros (2001), Budak et al. (2004) and Vandemark
et al. (2006). There were 224 sets of primer combinations
that were combined by 16 forward primers and 14
reverse primers (Table 2). Based on preliminary test, 34
sets of primer combinations, which steadily produced
well-defined and scorable amplification products, showed
polymorphisms in all 26 cultivars (Table 3). Figure 1 was
the amplification profile of primer combination F14/R9
and it produced the most bands and the most
polymorphic bands in 34 primer combinations. A total of
281 bands were observed, among which 115 were

Table 1. the alfalfa materials in this study and their CLS resistance.
Yuan et al. 12529
Assay number Cultivar Species 1 Gerplasm No. 2 Origin Seed source 3 CLS Reistance 4 SRAP group
1 Baoding Ms 0130 Hebei, China B MR I
2 Gannong No.3 Ms -- Gansu, China C -- I
3 Longdong Ms -- Gansu, China C -- I
4 Xinjiangdaye Ms 2712 Xinjiang, China C MR III
5 Yongji Ms 0456 Shanxi, China B HS I
6 Zhongmu No. 1 Ms 2758 Beijin, China B -- I
7 Changwu Ms 0208 Shănxi, China B MS I
8 Gongnong No. 1 Ms 128 Jilin, China B MS I
9 Qianxian Ms 0060 Shănxi, China B MR I
10 Yanggao Ms 0133 Shanxi, China B MS I
11 Zihua Ms 1149 Heilongjiang China B MS I
12 Aohan Ms 2761 Neimenggu, China B MR I
13 Xinmu No. 2 Ms 2715 Xinjiang, China B -- I
14 Weinan Ms 0932 Shănxi, China B MS II
15 Rambler Mv 72-10 Canada B MR III
16 Victoria Ms -- Canada A HR IV
17 PG sutter Ms 88-44 America B HR IV
18 Oranga Ms 84-759 New Zealand B HR IV
19 Glacier Mv 83-228 Canada B HR V
20 America(1) Ms 2325 America B HR II
21 America Ms 0064 America B HR II
22 Spredor No. 2 Ms 85-77 America B HR IV
23 Superstan Ms 83-130 America B HR II
24 Valor Ms 83-241 Canada B HR II
25 England(3) Ms 1872 England B HR II
26 WL202 G3057 Mv 83-128 Canada B HR II
1 Ms, Medicago sativa subssp. sativa; Mv, Medicago sativa subssp. x varia. 2 collection code of Institute of Animal Science, Chinese Academy of Agricultural Science. 3 A, Beijing Clover Group; B,
Institute of Animal Science, Chinese Academy of Agricultural Science; C, Pratacultural College of Gansu Agricultural University. 4 Yuan and Zhang (2000); HR, high resistance; MR, Medium
resistance; MS, Medium susceptibility; HS, High susceptibility.
polymorphic (40.93%), ranging between 1 and 8
per primer combination, with an average of 3.4
bands per primer combination. The size of scored
bands ranged from 100 to 2000 bp. The mean of
the PIC value over the 34 combinations averaged
1.12, ranging from 0.35 for F8/R10 to 3.36 for
F14/R9. In order to assess the reproducibility of
the band profiles, two PCR amplifications each
primer combination were carried out for the cultivar
“Weinan”. The results show that 98.93% of
the scorable bands were reproducible across two
PCR replicates, indicating the SRAP assay was of
high reproducibility between PCR replicates.
Genetic relationships
Pairwise comparison was made between all the

12530 Afr. J. Biotechnol.
Table 2. The primer sequences of SRAP used in this experiment.
Primer Type Sequence (5΄-3΄)
cultivars included in this study. Genetic dissimilarity
coefficient (dij) calculated from SRAP data varied from
0.300 between “Aohan” and “Yanggao”, to 0.678 between
“Rambler” and “Weinan”, with a mean of 0.525. The
mean of dij of 14 Chinese cultivars (susceptibility group),
the mean of dij of 12 forage cultivars (resistance group)
and the mean of dij among the cultivars of these two
groups were 0.477, 0.532 and 0.548 respectively.
A dendrogram based on the dissimilarity coefficients of
the 26 cultivars was constructed (Figure 2). According to
the data of “Cluster History” of SAS (data not shown),
when 5 groups became 4 groups in course of joining,
both SPRSQ (semipartial R-square) value (from 0.045 to
0.107) and PST2 (pseudo t2) value (from 1.4 to 3.4) had
a relatively great increase while the reverse was the fact
for RSQ (R-square) value (from 0.327 to 0.220).
Moreover, PSF (pseudo F) value for 5 groups was a local
maximum (2.6). Therefore, it was appropriate that 26
cultivars were separated into 5 groups (Figure 2). Among
them, group I included 12 of 14 Chinese cultivars most of
F1 Forward TGAGTCCAAACCGGATA
F2 Forward TGAGTCCAAACCGGAGC
F3 Forward TGAGTCCAAACCGGAAT
F4 Forward TGAGTCCAAACCGGACC
F5 Forward TGAGTCCAAACCGGAAG
F6 Forward TGAGTCCAAACCGGACA
F7 Forward TGAGTCCAAACCGGACG
F8 Forward TGAGTCCAAACCGGACT
F9 Forward TGAGTCCAAACCGGAGG
F10 Forward TGAGTCCAAACCGGAAA
F11 Forward GTAGCACAAGCCGGAGC
F12 Forward GTAGCACAAGCCGGACC
F13 Forward CGAATCTTAGCCGGATA
F14 Forward CGAATCTTAGCCGGAGC
F15 Forward CGAATCTTAGCCGGCAC
F16 Forward CGAATCTTAGCCGGAAT
R1 Reverse GACTGCGTACGAATTAAT
R2 Reverse GACTGCGTACGAATTTGC
R3 Reverse GACTGCGTACGAATTGAC
R4 Reverse GACTGCGTACGAATTAAC
R5 Reverse GACTGCGTACGAATTGCA
R6 Reverse GACTGCGTACGAATTCAA
R7 Reverse GACTGCGTACGAATTCAC
R8 Reverse GACTGCGTACGAATTCAT
R9 Reverse GACTGCGTACGAATTCTA
R10 Reverse GACTGCGTACGAATTGTC
R11 Reverse CGCACGTCCGTAATTAAC
R12 Reverse CGCACGTCCGTAATTCCA
R13 Reverse CGTAGCGCGTCAATTATG
R14 Reverse CGTAGCGCGTCAATTAAC
which had a low CLS resistance and were planted in cold
and/or drought region in China. 10 of 11 cultivars with a
high CLS resistance were put in group II and group IV
respectively. Group II included the cultivars adapted to
humid environment, for example, “WL202 G3057” which
was planted in Canada irrigation soil and “Weinan” which
came from humid Guanzhong regions of Shănxi in China.
Furthermore, the cultivars in Group IV were more coldresistance
and/or drought-enduring than Group II, for
example, “Victory” which adapted to the environmental
conditions of northern America.
Sequence analysis of SRAP fragments
In order to determine the nature of the amplified fragments
using SRAP markers, 9 randomly selected polymorphic
fragments, obtained with different primer
combinations, were sequenced and the GC content of 8
(89%) of them was over 35% (Table 4). The results of

Table 3. SRAP primer combinations used in this study and their polymorphism information.
Primer pair NF 1 NPF 2 PFP 3 PIC 4
F1/R5 10 5 0.500 1.06
F1/R14 6 2 0.333 0.70
F2/R1 11 1 0.091 0.48
F2/R11 12 3 0.250 1.33
F2/R13 8 6 0.750 1.68
F3/R6 9 5 0.556 1.30
F3/R8 7 3 0.429 1.23
F3/R9 10 5 0.500 1.57
F3/R12 9 4 0.444 1.07
F3/R14 10 2 0.200 0.75
F4/R12 8 3 0.375 0.85
F5/R11 6 4 0.667 1.17
F6/R3 6 2 0.333 0.67
F7/R2 6 2 0.333 0.84
F7/R9 7 4 0.571 1.58
F8/R4 9 5 0.556 1.56
F8/R10 7 2 0.286 0.35
F9/R4 9 2 0.222 0.64
F9/R9 10 3 0.300 0.68
F11/R3 7 3 0.429 0.99
F11/R7 9 3 0.333 1.37
F11/R11 6 3 0.500 1.07
F13/R9 10 2 0.200 0.86
F14/R3 7 3 0.429 1.32
F14/R5 8 3 0.375 1.38
F14/R9 14 8 0.571 3.36
F14/R11 6 4 0.667 1.24
F14/R13 8 5 0.625 1.04
F15/R1 7 2 0.286 0.63
F16/R3 7 2 0.286 0.54
F16/R7 9 4 0.444 1.24
F16/R8 8 3 0.375 1.11
F16/R9 9 5 0.556 1.87
F16/R13 6 2 0.333 0.63
1 NF, Number of fragments. 2 NPF, Number of Polymorphic fragments. 3 PFP, Polymorphic fragments percent. 4 PIC,
polymorphism information content.
BLAST search showed that all of the sequenced
fragments shared significant similarity to CDS (coding
sequences) or gene sequences stored in the Genbank
database and Medicago truncatula Database. Furthermore,
two fragments, 13-090 and 16-092, showed a high
similarity with Polynucleotide transferase of M. truncatula
and Receptor protein kinase CLAVATA1 precursor of
Ricinus communis respectively. The DNA sequence
information of sequenced SRAP fragments is available to
readers upon request.
DISCUSSION
Alfalfa cultivars are genetically heterogeneous and
Yuan et al. 12531
commercial cultivars of alfalfa seed are composed of
thousands of plants of different genotypes. Popularly,
genetic distance estimates among alfalfa cultivars were
carried out by evaluation of individual genotypes within
cultivars (Pupilli et al., 2000; Zaccardelli et al., 2003;
Flajoulot et al., 2005). However, the studies of Yu and
Pauls (1993), Segovia-Lerma et al. (2003) and
Vandemark et al. (2006) indicated that the hierarchical
patterns of diversity among alfalfa cultivars by using bulk
DNA templates were associated with their geographic,
subspecific, and intersubspecific hybrid origins. Although,
some allelic information was likely lost as a result of DNA
bulking from a population perspective, the DNA-bulking
method permits sampling of a greater number of

12532 Afr. J. Biotechnol.
Figure 1. Fingerprint patterns generated using SRAP primer pair F14R9 from the genomic DNA of the 26 alfalfa cultivars. M, DNA
molecular weight standard; Codes of lanes corresponding to that of the 26 alfalfa cultivars in Table 1.
Figure 2. UPGMA dendrogram of 26 alfalfa cultivars based on SRAP markers.
individuals in heterogeneous populations. This approach
may more accurately reflect a population’s general
genetic composition compared with evaluation of fewer
individual genotypes. It also permits greater population
number to be evaluated with comparable resources. This
study used DNA-bulking method in conjunction with

Table 4. Sequence analysis of 9 of SRAP polymorphic fragments isolated from acrylamide gels.
Marker name Primer pair Size (bp) GC (%) BLAST N/X (database) Score (bit) Accession number
03-080 F3R8 485 41.7 BLASTN (refseq_ma) 46.4 gi|NM_001159170
Yuan et al. 12533
07-020 F7R2 910 45.9 BLASTN (Mt3.0 CDS) 67.3 IMGA|Medtr2g005010
07-092 F7R9 613 41.8 BLASTN (Mt3.0 CDS) 103.0 IMGA|Medtr2g005010
11-030 F11R3 455 36.9 BLASTN (refseq_ma) 69.8 gi|NM_001061890
13-090 F13R9 901 41.1 BLASTX (nr) 228.0 gi|ABN08587
14-092 F14R9 133 48.9 BLASTN (refseq_ma) 37.4 gi|XM_002284796
16-091 F16R9 242 48.4 BLASTN (Mt3.0 CDS) 97.9 IMGA|Medtr5g047120
16-092 F16R9 491 35.2
BLASTX (nr)
BLASTN (Mt3.0 CDS)
237.0
356.8
gi|XP_002297907
IMGA|Medtr5g097160
16-093 F16R9 245 33.1 BLASTN (refseq_ma) 37.4 gi|XM_002262976
SRAP to estimate genetic relationships among the
studied alfalfa cultivars, and showed a similar result to
that of the studies of Yu and Pauls (1993), Segovia-
Lerma et al. (2003) and Vandemark et al. (2006). In
general, the distances among these cultivars and their
clustering pattern were consistent with their CLS
resistance or geographic origins. For example, both
cultivar pairs “Longdong”/ “Yongji” and “Yanggao” and
“Aohan” showed low genetic distance, and this was
accordant with resembling environment between their
origin regions. Moreover, the UPGMA dendrogram,
basically, separated between cultivars with a high CLS
resistance and cultivars with a low CLS resistance, and
distinguished between Chinese cultivars and cultivars
from other countries in the world.
In this study, 12 Chinese cultivars, were classified as a
group (Figure 1, group I) and they had a mean distance
of 0.455, which was obviously lower than that of other 14
cultivars (0.542), indicating that there was possibly a low
genetic diversity among alfalfa cultivars. The main reason
for it was that all of these 12 Chinese cultivars came from
cold and/or drought regions in north China. Therefore,
introducing CLS resistance genes into new varieties and
improving genetic diversity should be two important goals
in breeding in these regions. Remarkably, 4 cultivars
included in group IV not only had a high CLS resistance,
but were cold-resistance and/or drought-enduring. Using
these cultivars as one of breeding parents could both
make easy selecting of ideal plants, which adapt to cold
and/or drought environment and have a high CLS
resistance, and increase genetic diversity.
The sequenced fragments not only had a high GC
content, but also shared significant similarity to reported
CDS or gene sequences. This finding confirms that a
large proportion of the bands generated by SRAPs
include exons in ORFs, which are expected to be evenly
distributed along all chromosomes, and agreed with the
results reported in previous studies with other species (Li
and Quiros, 2001; Ferriol et al., 2003). ORFs may be
involved in the agronomic and morphological traits, and
thus the information derived from SRAP markers was
more concordant to the agronomic and morphological
variability. Ulteriorly, this also was made sure by the fact
that the information on genetic relationships among 26
alfalfa germplasms produced by this study was well
consistent with their CLS resistance or geographic
origins. Since the mainly cultivated alfalfa was an
autotetraploid, co-dominant markers would be more
useful than dominant ones. The nucleotide sequences of
SRAP markers sequenced in this study could be use to
develop co-dominant markers targeting a gene.
In conclusion, the genetic relationships and genetic
diversity information derived from SRAP markers were
more concordant to the agronomic and morphological
variability than other molecular markers such as amplified
fragment length polymorphism (AFLP) and RAPD.
Furthermore, SRAP markers may serve as a quick tool to
analyze the genetic relationships and genetic diversity
among alfalfa cultivars in conjunction with DNA-bulking
method. The information of the genetic relationships and
genetic diversity among CLS resistance alfalfa germplasms
and Chinese cultivars would be useful to select
parents in a CLS resistance breeding program of alfalfa.
In addition, the molecular tools developed in this study
can be applied for characterizing other germplasm collections
of alfalfa.

12534 Afr. J. Biotechnol.
ACKNOWLEDGEMENTS
This study was financially supported by a grant from
National Nature Science Fund (NO. 30972140) and the
National Science and Technology support Project (No.
2011BAD17B01).
REFERENCES
Barnes DK, Goplen BP, Baylor JE (1988). Highlights in the USA and
Canada. In: Hanson AA, Barnes DK, Hill RR (eds) Alfalfa and Alfalfa
Improvement. American Society of Agronomy Press, Madison, USA,
pp. 1-24.
Budak H, Shearman RC, Parmaksiz I, Gaussoin RE, Riordan TP,
Dweikat I (2004). Molecular characterization of Buffalograss
germplasm using sequence-related amplified polymorphism markers.
Theor. Appl. Genet., 108: 328-334.
Doyle JF, Doyle JL (1990). A rapid DNA isolation procedure for small
quantities of fresh leaf tissue. Focus, 12: 13-15.
Ferriol M, Picó B, Nuez F (2003). Genetic diversity of a germplasm
collection of Cucurbita pepo using SRAP and AFLP marker. Theor.
Appl. Genet. 107: 271-282.
Flajoulot S, Ronfort J, Baudouin P, Barre P, Huguet T, Huyghe C, Julier
B (2005). Genetic diversity among alfalfa (Medicago sativa) cultivars
coming from a breeding program, using SSR markers. Theor. Appl.
Genet. 111: 1420-1429.
Hwang SF, Wang HP, Gossen BD, Chang KF, Turnbull GD, Howard RJ
(2006). Impact of foliar diseases on photosynthesis, protein content
and seed yield of alfalfa and efficacy of fungicide application. Eur. J.
Plant Pathol. 115: 389-399.
Li G, Gao M, Yang B, Quiros CF (2003). Gene for gene alignment
between the Brassica and Arabidopsis genomes by direct
transcriptome mapping. Theor. Appl. Genet. 107: 168-180.
Li G, Quiros CF (2001). Sequence-related amplified polymorphism
(SRAP), a new marker system based on a simple PCR reaction: its
application to mapping and gene tagging in Brassica. Theor. Appl.
Genet. 103: 455-461.
Mainer A, Leath KT (1978). Foliar diseases alter carbohydrate and
protein levels in leaves of alfalfa and orchardgrass. Phytopathology,
68: 1252-1255.
Morgan WC, Parbery DG (1980). Depressed fodder quality and
increased oestrogenic activity of lucerne infected with Pseudopeziza
medicaginis. Aust. J. Agric. Res. 31: 1103-1110.
Pupilli F, Labombarda P, Scotti C, Arcioni S (2000). RFLP analysis
allows for the identification of alfalfa ecotypes. Plant Breed. 119: 271-
276.
Segovia-Lerma A, Cantrell RG, Conway JM, Ray IM (2003). AFLPbased
assessment of genetic diversity among nine alfalfa
germplasmas using bulk DNA templates. Genome, 46: 51-58.
Smith JSC, Chin ECL, ShuH, Smith OS, Wall SJ, Senior ML, Mitchell
SE, Kresovich S, Ziegle J (1997). An evaluation of the utility of SSR
loci as molecular markers in maize (Zea mays L.): comparisons with
data from RFLPs and pedigree.Theor. Appl. Genet. 95: 163-173.
Sun Z, Wang Z, Tu J, Zhang J, Yu F, McVetty PB E, Li G (2007). An
ultradense genetic recombination map for Brassica napus, consisting
of 13551 SRAP markers. Theor. Appl. Genet. 114: 1305-1317.
Vandemark GJ, Ariss JJ, Bauchan GA, Larsen RC, Hughes TJ (2006).
Estimating genetic relationships among historical sources of alfalfa
germplasm and selected cultivars with sequence related amplified
polymorphisms. Euphytica, 152: 9-16.
Yang P, Liu XJ, Liu XC, Yang WY, Feng ZY (2010). Diversity analysis of
the developed qingke (hulless barley) cultivars representing different
growing regions of the Qinghai-Tibet Plateau in China using
sequence-related amplified polymorphism (SRAP) markers. Afr. J.
Biotechnol. 9(50): 8530-8538.
Yeboah MA, Chen XH, Feng CR, Liang GH, Gu MH (2007). A genetic
linkage map of cucumber (Cucumis sativus L) combining SRAP and
ISSR markers. Afr. J. Biotechnol. 6(24): 2784-2791.
Yu K, Pauls KP (1993). Rapid estimation of genetic relatedness among
heterogeneous populations of alfalfa by random amplification of
bulked genomic DNA samples. Theor. Appl. Genet. 86: 788-794.
Yuan Q, Zhang W (2000). Screening for resistance to common leaf spot
in alfalfa germplasms. Acta Pratacul Turae Sinica. 12: 52-58.
Zaccardelli M, Gnocchi S, Carelli M, Scotti C (2003). Variation among
and within Italian alfalfa ecotypes by means of bio-agronomic
characters and amplified fragment length polymorphism analyses.
Plant Breed. 122: 61-65.
Zhao WG, Fang RJ, Pan YL, Yang YH, Chung JW, Chung IM, Park YJ
(2009). Analysis of genetic relationships of mulberry (Morus L.)
germplasm using sequence-related amplified polymorphism (SRAP)
markers. Afr. J. Biotechnol. 8(11): 2604-2610.

African Journal of Biotechnology Vol. 10(59), pp. 12535-12541, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1287
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Microspore derived embryo formation and doubled
haploid plant production in broccoli (Brassica oleracea
L. var italica) according to nutritional and
environmental conditions
Haeyoung Na 1 , Guiyoung Hwang 1 , Jung-Ho Kwak 1 , Moo Koung Yoon 1 and Changhoo Chun 2,3 *
1 National Institute of Horticultural and Herbal Science, Suwon 440-706, Korea.
2 Department of Horticultural Science, Seoul National University, Seoul 151-921, Korea.
3 Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea.
Accepted 17 June, 2011
In cell culture, the maintenance of proper growing conditions is a key approach for improving the
formation of embryos, and is useful in the production of doubled haploid (DH) plants. Optimal
nutritional and environmental conditions for the microspore culture of Brassica oleracea L. var italica
were determined in order to reduce time and effort in breeding. The optimal conditions for microspore
embryo formation differed depending on genotype. Microspore-derived embryos (MDE) formation was
influenced by the strength of the NLN medium, the microelement and sugar concentration, and the heat
shock temperature and period. The 0.5XNLN liquid medium was the most favorable for MDE formation.
The most efficient formation of MDE was observed in the 0.5X NLN liquid medium, without the addition
of microelements. When 13 or 15% sucrose was added to the 0.5X NLN liquid medium, the amount of
normal MDE formation increased. The optimum heat shock temperature and period for MDE formation
was 32.5°C and 24 h, respectively. A polyploidy test indicated that 30% of the microspore derived plants
were diploid throughout the embryogenesis process.
Key words: Embryogenesis, heat shock, microelements, NLN medium, polyploidy test.
INTRODUCTION
Broccoli is considered as a major vegetable, having high
nutritional value with various functional materials such as
selenium, sulforaphane, indol-3-carbinol and folic acid. It
is also a well-known antioxidant food. The microspore
culture of Brassica plants is a very valuable tool for
genetic manipulation via haploid breeding; however, the
production of homozygous lines through bud pollination is
time consuming and labor intensive. Microspore culture is
an efficient technology for the production of homozygous
lines when producing F1 hybrids of modern cultivars,
leading to an increase in selection efficiency for desirable
genetic recombinants (Dias, 1999). Microspore derived
plants provide a rapid means of obtaining homozygous
and homogeneous lines of agriculturally important plants
*Corresponding author. E-mail: changhoo@snu.ac.kr.
(Dias, 2001).
Microspore culture has been used to produce haploid
and doubled haploid plants in the genus Brassica (Keller
and Armstrong, 1979; Lichter, 1989). These plants can be
utilized in varietal development, mutant selection, and
biochemical and genetic engineering studies (Swanson
and Erickson, 1989; Swanson et al., 1988; Taylor et al.,
1993). The doubled haploid parental lines can enhance
and accelerate plant breeding programs by saving labor
and time. These lines have already been developed using
anther culture (Farnham, 1998), and they have been
introduced into breeding schemes. Successful microspore
culture in different broccoli genotypes has been
described by Duijs et al. (1992) and Takahata and Keller
(1991).
One problem with the practical application of microspore
culture, reported by different authors (Dias, 1999;
Duijs et al., 1992), is the very low embryo yield in many

12536 Afr. J. Biotechnol.
Figure 1. Flower bud removed sepals of Brassica
oleracea L.var italica for microspore derived
embryo culture. The stigma is longer than the
length of the floral leaf.
broccoli genotypes. There has always been an attempt to
adapt and improve the current microspore culture
protocols to make this technique available for haploid
breeding. There are a few published reports on microspore
embryogenesis in broccoli, but improvement in the
microspore culture protocols is required. Several factors
influencing microspore embryogenesis are donor plant
conditions, genotype, developmental stage, media
constituents and culture conditions. The objective of this
paper was to study nutritional, chemical and physical
factors affecting microspore derived embryo (MDE)
formation in broccoli, and to also verify the polyploidy of
microspore-derived plantlets.
MATERIALS AND METHODS
Gene source K005262 provided by the National Agrobiodiversity
Center, located at Suwon Korea was used for donor plants. The
donor plants were grown using plastic pots (50 x 29 cm) in a
greenhouse under a 16 h photoperiod with 400 µmol m -2 -1 -
s
photosynthetic photon flux density (PPFD). Later, they were
vernalized in a cold room maintained at 4±1°C under a 16 h
photoperiod with 400 µmol m -2 s -1 PPFD for eight weeks. After floral
differentiation and the start of generative development, plants were
transferred to a greenhouse at 25°C under a 16 h photoperiod with
400 µmol m -2 s -1 PPFD.
Microspore isolation
Flower buds having a shorter floral leaf length as compared to the
length of the stigma were chosen. The buds of this stage contained
anthers at the late uninucleate stage of microspore development,
and their size was 2 to 4 mm (Figure 1). The buds were wrapped in
gauze and surface sterilized in 1% sodium hypochlorite for 15 min
on the shaker at 70 rpm, and then rinsed three times for 3 minutes
each, using sterile water. The buds were gently macerated with 2 ml
of B5-13 medium (Gamborg et al., 1968), and ground using a
mortar. They were filtered through a 45 µm metal mesh screen, and
collected in a 50 ml centrifuge tube. The microspore suspension
was washed three times with 10 ml of B5-13 medium by
centrifuging at 1,000 rpm for 3 min. Then, the supernatant was
removed and pelleted microspores were re-suspended at a density
of 40,000 microspores to 1 ml of NLN liquid medium (Lichter, 1982).
The number of microspores was estimated using a hemacytometer.
The last microspore suspension was re-suspended in NLN liquid
medium with 13% sucrose. We dispensed 2.5 ml of the microspore
suspension into a 60 x 15 mm sterile Petri-dish that was
subsequently sealed with parafilm. All culture media was adjusted
to pH 5.8 using NaOH or HCl and filter-sterilized using a 25 µm low
protein binding membrane filter (Corning, USA). After a 24h heat
shock treatment and 14day incubation in darkness, all microspores
were placed on a shaker at 60 rpm and 25°C under a 16 h
photoperiod with 50 µmol m -2 s -1 PPFD (cool, white fluorescent
lamps) for 2 weeks.
Microspore treatments
Microspores were incubated in the dark at 32.5°C during the 24 h
heat shock treatment, and then transferred to 25°C in the dark. After
15 days, the Petri-dishes were placed on a shaker and agitated at
60 rpm with a 16 h photoperiod at 25°C. The embryo number was
scored four weeks after microspore isolation (Figure 2A).
Microspores were cultured with various NLN liquid medium
strengths (0.25X, 0.5X, 1.0X, 2.0X and 4.0X) to investigate the
effect of NLN on MDE induction. To investigate the effects of sugar
concentration on embryonic induction, microspores were cultured in
0.5X NLN liquid medium containing 0, 3, 5, 10, 13, 15 and 20%
sucrose. Microspores were cultured at four different heat shock
temperatures of 25, 32.5, 37 and 42°C for 24h in order to determine
the optimal temperature for MDE formation. The heat shock period
was also varied at 0, 24, 48 and 72 h at 32.5°C. After 30 days of
culture, the number of embryos in each Petri-dish was counted. The
experiment was conducted with ten replications. Embryo yields
were calculated as the average of ten Petri-dishes.
Germination of microspore derived embryos
For the conversion of microspore embryos into plantlets, the fully
developed dicotyledonous embryos and torpedo embryos were
picked up and transferred directly to MS medium containing 3%
sucrose and 8% agar (Figure 2A and B). All microspore embryos
were incubated at 25 ± 1°C under a 16 h photoperiod with 50 mol
m -2 s -1 PPFD (cool, white fluorescent lamps) for 4 weeks. These
were transferred ex vitro (Figure 2C).
Ploidy analysis using flow cytometry
The nuclear DNA content of the leaves of microspore-derived
plantletswasmeasured with a flow cytometer (Cytoflow PA,Partec
GmbH, Germany) using the protocol described by Mishiba et al.
(2000). Seedling leaves of K005262 (2n = 2x = 18) were used as a
standard. Young leaves (0.3-0.5 cm2) from microspore-derived
plantlets and seedlings were analyzed for their nuclear DNA
content. Fresh tissues were individually chopped with a sharp razor
blade to less than 1 mm in a 6 cm glass petri-dish containing

A B C
2 mm
Na et al. 12537
Figure 2. Microspore derived embryo of Brassica oleracea L. var italica . A, Cotyledonary microspore embryo formation after 4
weeks in culture on 0.5 X NLN medium containing 150 g L -1 sucrose; B, microspore derived plantlet formation after 4 weeks on
conversion medium (0.5X MS medium containing 30 g L -1 sucrose, 0.8% agar); C, acclimatized microspore derived plants in the
greenhouse 4 weeks after transfer from in vitro culture.
400 µl of extracting buffer (Solution A inthe CyStain UV Precise P
Kit, Partec, Germany). After chopping, 1,600ml of the 4, 6diamidino-2-phenylindol
(DAPI) staining buffer (Solution B of the kit)
wasadded. The suspension was filtered through a 30 µm nylon
mesh (CellTricsTM, Partec, Germany). For each sample, 2,500-
5,000 nuclei were analyzed using a flow cytometer equipped with a
HBO-100 mercury lamp.
Statistical analysis
Statistical analysis was done to evaluate significant differences
among microspore-derived embryos formation and various
nutritional and environmental conditions. One way ANOVA was
used to assess differences of microspore-derived embryos
formation in NLN liquid medium strength, microelement strength of
NLN medium, sucrose concentration, heat shock temperature and
heat shock temperature period. ANOVA were carried out using
statistical analysis systems software SAS 9.2 (SAS Institute., Cary,
NC, USA). Means were separated using Duncan’s multiple range
tests at the 0.05 significance level.
RESULTS AND DISCUSSION
The MDE formation was 6.2 and 6.8 in the 0.25X and
1.0X NLN liquid medium, respectively; however, the
difference was not significant. The 0.5X NLN liquid
medium had the highest embryo formation, with 8.4. The
MDE formation in the 2.0X and 4.0X NLN liquid medium
was low (Figure 3). The high concentrations of macro and
micro nutrient were not effective for MDE formation.
Therefore, reducing the concentration of major salt to one
and half in the NLN liquid medium seems to increase
embryogenesis frequency in broccoli microspore culture.
The nutritional requirements for induction and production
of embryos vary widely from species to species. One of
the most important media components influencing
embryogenesis is basal salt. For MDE formation in
broccoli, most experiments use the standard NLN-13
media. In this study, 0.5X NLN liquid medium proved to
be significantly better than the other media strengths.
Sato et al. (1989) obtained similar results in Brassica
campestris ssp. Pekinensis, and the same result was
reported in somatic embryo formation of
Pimpinellbrachycarpa (Na and Chun, 2009). A reduction
in the concentrations of some of the macronutrients in
NLN-13, mainly NO3, may be useful for promoting
embryogenesis. Higher concentrations of macronutrients
may be inhibitory to the induction of embryogenesis, as
well as to embryo growth (Na and Chun, 2009). The
addition of various amounts of micronutrients to the 0.5X
NLN liquid medium was less effective than adding no
micronutrients at all. The media to which micronutrients
were not added had the highest formation rate in MDE
(Figure 4) and also in rooted MDE (data not shown). This
finding differed from results for Chinese cabbage, which
showed an increase in MDE formation after the addition
of micronutrients to 0.5X NLN medium (data not shown).
One of the most important medium components influencing
the induction of embryogenesis is sucrose. The
MDE formation was 72 and 69 in the 13 and 15%
sucrose concentrations, respectively. The difference in
MDE formation between the two concentrations was not
significant, but the MDE formation in the 15% sucrose
concentration was the highest. A sucrose concentration
less than 10% decreased the embryo formation rate

12538 Afr. J. Biotechnol.
Number of microspore derived embryo formation
Num ber of m icrospore derived em bryo formation
10
8
6
4
2
0
a
a
a
X0.25 X0.5 X1.0 X2.0 X4.0
Medium concentration
Figure 3. Microspore derived embryo yields (number of embryos/petri-dish) of Brassica
oleracea L.var italica of microspore
10
8
6
4
2
0
a
b b
X 0 X 0.25 X 0.5 X 1.0 X 2.0
Micro elements concentration
Figure 4. Microspore derived embryo yields (number of embryos/Petri-dish) of Brassica
oleracea L.var italica of microspore culture medium (0.5X NLN) with various microelement
strength of NLN liquid medium. Data was collected 30 days after culture. Each value is the
average obtained from ten replications. Columns with the same letters are not significantly
different by Duncan’s multiple range tests at P < 0.05.
b
b
b
b

Num ber of microspore derived em bryo form ation
100
80
60
40
20
0
c
c
b
0 50 100 130 150 200
a
Sucrose (g L -1 )
Figure 5. Microspore derived embryo yields (number of embryos/Petri-dish) of Brassica oleracea
L.var italica of microspore cultures treated with various concentration of sucrose. Data was
collected 30 days after culture. Each value is the average obtained from ten replications. Columns
with the same letter are not significantly different by Duncan’s multiple range tests at P < 0.05.
remarkably, and there was no microspore formation in the
5% sucrose concentration (Figures 5 and 6). Ferrie et al.
(1999) found that 13% sucrose had a higher embryo yield
as compared to 10%. However, previous studies showed
that a high level of sucrose is required for initial
microspore survival and division, but a lower level is
important for the continuation of microspore division
(Dunwell and Thurling, 1985). Additional research on the
different effects of applied sucrose concentration
according to MDE formation phase is required.
Microspore embryogenesis is induced by the heat
shock stress treatment. In B. napus, the most efficient
induction is obtained by increasing the culture temperature
to 32°C for a minimum of 8 h (Custers et al., 1994;
Pechan et al., 1991). Binarova et al. (1997) reported that
DNA synthesis was initiated in both generative and
vegetative nuclei by the application of heat stress treatment.
MDE formation at the heat shock temperatures of
25 and 32.5°C in broccoli was 4.5 and 7.5, respectively;
however, it was merely 0.5 at 37°C, and none at 42.5°C
(Figure 7). The optimum heat shock temperature for MDE
formation was 32.5°C. The MDE formation at a heat
shock temperature of 32.5°C was counted at heat shock
times of 0, 24, 48 and 72 h. At 0, 48 and 72 h, MDE
a
b
Na et al. 12539
formation was 1.6, 1.7 and 0.9, respectively. The highest
MDE formation was 8.9 at the heat shock time of 24 h
(Figure 8). Duijs et al. (1992) established a standard
protocol for microspore culture using a pre-treatment (48
h at 30°C). MDE formation was significantly increased in
many broccoli genotypes after incubating at the heat
shock temperature of 32.5°C for 1 day, as compared to
the standard incubation (Duijs et al., 1992).
The results of the polyploidy test for microspore-derived
plantlets produced from the earlier experiments showed
that the mean percentages of haploid, diploid, tetraploid,
haploid + diploid, and diploid + tetraploid nuclei were 52,
30, 2, 8 and 8%, respectively, indicating the existence of
endopolyploid cells in the microspore-derived plantlet,
which are considered to be mixoploid. These results were
consistent with the research of Chen et al. (2009), who
obtained various mixoploidy plants from the protocormlike
body of Phalaenopsis.
This study described a methodology for achieving a
high frequency of microspore embryo formation by
controlling nutritional factors. Moreover, the efficient
microspore culture protocols developed in this study
could be useful in the production of a homozygous line
used to produce F1 hybrids.

12540 Afr. J. Biotechnol.
Figure 6. Morphology of microspore derived embryo formed from microspores cultured in an NLN liquid media with
various concentrations of sucrose. A, 0; B, 50; C, 100; D, 130; E, 150; F, 200 g L-1.
Number of microspore derived embryo formation
10
8
6
4
2
0
b
a
25 32.5 37 37 42.5 42.5
Temperature ( o Temperature (°C) C)
Figure 7. Microspore derived embryo yields (number of embryos/Petri-dish) of
Brassica oleracea L.var italica of microspore cultures treated with various heat shock
temperature for 24 h. Data was collected 30 days after culture. Each value is the
average obtained from ten replications. Columns with the same letter are not
significantly different by Duncan’s multiple range tests at P < 0.05.
c
d

REFERENCES
Number of microspore derived embryo formation
10
8
6
4
2
0
b
a
0 hr 24 hr 48 hr 72 hr
72
Heat shock time (hour)
Figure 8. Microspore derived embryo yield (number of embryos/Petri-dish) of Brassica
oleracea L.var italica of microspore cultures treated with various heat shock time at
32.5°C. Data was collected 30 days after culture. Each value is the average obtained
from ten replications. Columns with the same letter are not significantly different by
Duncan’s multiple range tests at P < 0.05.
Chen WH, Tang CY, Kao YL (2009) Ploidy doubling by in vitro culture of
excised protocorms or protocorm-like bodies in Phalaenopsis
species. Plant Cell Tissue Org. Cult. 98: 229-238.
Custers JBM, Cordewener JHG, Nöllen Y, Dons JJM, Van Lookeren
Campagne MM (1994). Temperature controls both gametophytic and
sporophytic development in microspore cultures of Brassica napus.
Plant Cell Rep., 13: 267-271.
Dias JCD (1999). Effect of activated charcoal on Broccoli microspore
culture embryogenesis. Euphytica, 108: 65-69.
Dias JCD (2001). Effect of incubation temperature regimes and culture
medium on broccoli microspore culture embryogenesis. Euphytica,
119: 389-394.
Duijs JG, Voorrips RE, Visser DL, Custers JBM (1992). Microspore
culture is successful in most crop types of Brassica oleracea L.
Euphytica, 60: 45-55.
Dunwell JM, Thurling N (1985). Role of sucrose in microspore embryo
production in Brassica napus ssp. oleifera. J. Exp. Bot. 36: 1478-
1491.
Farnham MW (1998). Doubled-haploid broccoli production using anther
culture: effect of anther source and seed set characteristics of
derived lines. J. Am. Hort. Sci. 123: 73-77.
Ferrie AMR, Taylor DC, MacKenzie SL, Keller WA (1999). Microspore
embryogenesis of high sn-2 erucic acid Brassica oleracea
germplasm. Plant Cell Tissue Org. Cult. 57: 79-84.
Gamborg OL, Miller RA, Ojima K (1968). Nutrient requirements of
suspension cultures of soybean root cells. Exp. Cell Res., 50: 151-
158.
Keller WA, Armstrong KC (1979). Stimulation of embryogenesis and
haploid production in Brassica campestris anther cultures by elevated
temperature treatments. Theor. Appl. Genet. 55: 65-67.
Lichter R (1982) Induction of haploid plants from isolated pollen of
Brassica napus. Z. Pflanzenphysiol. 105:427-434.
Lichter R (1989). Efficient yield of embryoids by culture of isolated
microspores of different Brassicaceae species. Plant Breed., 103:
b
b
Na et al. 12541
119-123.
Mishiba K, Ando T, Mii M, Watanabe H, Kokubun H, Hashimoto G,
Marchesi E (2000). Nuclear DNA content as an index character
discriminating taxa in the genus Petunia sensu Jussieu (Solanaceae).
Ann. Bot. 85 665-673.
Na HY, Chun C (2009) Nutritional, chemical and physical factor
affecting somatic embryo formation and germination in Pimpinella
brachycarpa. Kor. J. Hort. Sci. Technol. 27: 280-286.
Sato T, Nishio T, Hirai M (1989) Plant regeneration from isolated
microspore cultures of Chinese cabbage (Brassica campestris ssp.
pekinensis). Plant Cell Rep., 8: 486-488.
Swanson EB, Erickson LR (1989) Haploid transformation in Brassica
napus using an octopine-producing strain of Agrobacterium
tumefaciens. Theor. Appl. Genet. 78: 831-835
Swanson EB, Coumans MP, Brown GL, Patel JD, Beversdorf WD
(1988). The characterization of herbicide tolerant plants in Brassica
napus L. after in vitro selection of microspores and protoplasts. Plant
Cell Rep. 7: 83-87.
Takahata Y, Keller WA (1991) High frequency embryogenesis and plant
regeneration in isolated microspore culture of Brassica oleracea L.
Plant Sci. 74: 235-242.
Taylor DC, Ferrie AMR, Keller WA, Giblin EM, Pass EW, MacKenzie SL
(1993). Bioassembly of acyl lipids in microspore derived embryos of
Brassica campestris L. Plant Cell Rep. 12: 375-384.

African Journal of Biotechnology Vol. 10(59), pp. 12542-12546, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1836
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Role and significance of total phenols during rooting of
Protea cynaroides L. cuttings
Wu, H. C. 1 * and du Toit, E. S. 2
1 Department of Natural Biotechnology, College of Science and Technology, Nanhua University, No. 55, Section 1,
Nanhua Road., Dalin Township, Chiayi 62248, Taiwan.
2 Department of Plant Production and Soil Science, Faculty of Natural and Agricultural Sciences, University of Pretoria,
Pretoria, 0002, South Africa.
Accepted 23 May, 2011
Phenolic compounds, which are known to regulate root formation, are found abundantly in difficult-toroot
Protea cynaroides stem cuttings. In this study, analysis of total phenol content was carried out on
blanched and unblanched cuttings to observe its fluctuation throughout the entire rooting period (120
days) and establish its relationship with root formation. Results showed that blanching significantly
increased the total phenol content in the basal ends of the cuttings. The high total phenol content was
associated with significantly higher rooting percentage and increased the number of roots formed.
Blanching reduced the time needed for the cuttings to root sufficiently to be transplanted to the field by
30 days. Analyses of different parts of cuttings throughout the entire rooting period showed continuous
increase in total phenols at the basal end, while decrease in total phenols was observed in the leaves.
Keywords: Etiolation, king protea, phenolic compounds, Proteaceae, root formation
INTRODUCTION
Protea cynaroides L. (King Protea) is an important cut
flower in the floriculture industry. At present, the
production areas are expanding in Europe, with new
plantations being established in Portugal and Spain
(Leonardt, 2008). P. cynaroides plants show great
variation in nature with many different sizes, colours and
flowering times (Vogts, 1982). Due to the genetic
variability of seeds, vegetative propagation is the
preferred method used by growers to obtain and maintain
genetic uniformity in the commercial production of P.
cynaroides cut flowers. However, P. cynaroides is a
woody plant, which typically has a poor physiological
capacity for adventitious root formation and is notoriously
known as a difficult-to-root ornamental plant. Using
conventional vegetative propagation methods, P.
cynaroides cuttings usually take six months to root with
low rooting percentage. The application of commercially
*Corresponding author. E-mail: hcwu@mail.nhu.edu.tw. Tel:
+886 5 272 1001 Ext. 5441. Fax: +886 5 242 7195.
Abbreviations: ELISA, Enzyme-linked immunosorbent assay;
IAA, indole-3-acetic acid.
available rooting hormones does not improve its rooting.
It is known that, starch content is important during root
formation. The analysis of starch accumulation in P.
cynaroides cuttings during rooting has been conducted
(Wu et al., 2006). Results showed that an increase in the
accumulation of starch in stem cuttings improved root
formation. Furthermore, 3,4-dihydroxybenzoic acid was
found in P. cynaroides stems and shown to stimulate root
formation in micropropagated explants (Wu et al., 2007).
Plants of the Proteaceae family are known to contain
large amounts of phenolic compounds, however,
currently, no study has been done on the role of total
phenol content in P. cynaroides stem cuttings during root
formation. The aim of this study was to analyze
fluctuations in total phenol concentration of different parts
of blanched and unblanched P. cynaroides stem cuttings
throughout the entire rooting process and to establish
their relationship with root formation.
MATERIALS AND METHODS
P. cynaroides stem cuttings that were used in this study were
collected from mother plants grown in an open field in the summer
rainfall region (Gauteng) of South Africa. Terminal semi-hardwood
stems (15 cm in length) of the current year’s growth, which were

Table 1. Rooting percentage, mean root dry mass and mean number of roots according to root length
categories of P. cynaroides cuttings after 90 days in the mist bed.
Parameter Control Blanched
1 Rooting % 60 b 100 a
2 Mean root dry mass (mg) 96.7 16.5 b 159.8 17.9 a
2 Mean number of roots categorized by root length
Group 1 (1 - 10 mm) 6.6 2.6 b 11.6 3.4 a
Group 2 (11 - 20 mm) 4.8 2.2 b 10.8 2.8 a
Group 3 (21 - 30 mm) 5.8 3.6 b 11.6 0.5 a
Group 4 (31 - 40 mm) 4.0 0.7 a 4.2 1.1 a
Group 5 (41 - 50 mm) 4.4 2.3 b 9.6 3.8 a
Group 6 ( >51 mm) 3.0 1.4 b 5.8 2.5 a
1 Different letters in the same row indicate significant differences at P ≤ 0.05 based on chi-square; 2 different letters in
the same row indicate significant differences at P < 0.001, based on Tukey’s studentized test.
either blanched for 30 days or untreated (control) were used as
cuttings. The blanching treatment applied to the stems was done
according to Wu et al. (2006). The rooting medium consisted of a
peat moss and polystyrene ball (1:1 v:v) mixture. The cuttings were
rooted under intermittent mist, which irrigated every 20 min for 1
min. The air temperature of the mist bed, which was constructed
inside a white polyethylene structure, was maintained at 26°C±2,
with no bottom heating.
The determination of total soluble phenols was carried out on
samples prepared from stem cuttings taken after 0, 60, 90 and 120
days in the mist bed. The roots were removed from the cuttings,
dried and weighed. Each cutting was then separated into four parts,
which consisted of the basal end (20 mm), the middle and top ends
(equally divided from the remainder of each cutting) and the leaves.
After each part was freeze-dried and ground into fine powder, 0.05
g samples were weighed into separate test tubes. The procedure
for the extraction and quantification of total phenolic compounds
was adapted from Fourie (2004). The solvent used was
methanol:acetone:water (7:7:1). One millilitre of the solvent was
added to 0.05 g of powdered sample. It was then placed in an
ultrasound waterbath for 3 min and then centrifuged (Kubota ® 2010
centrifuge) for 30 s. The extraction procedure was repeated twice.
The concentration of phenolic compounds was determined using
the Folin-Ciocalteu reagent (Bray and Thorpe, 1954). A 96-well
enzyme-linked immunosorbent assay (ELISA) plate was used for
the reaction mixture. A dilution series (10 to 1000 μg/ml methanol)
was used to prepare standard curves for ferulic acid and gallic acid
for the quantification of phenolic content. The reaction mixture
comprised of 175 μl distilled water + 5 μl standard or extract sample
+ 25 μl Folin-Ciocalteu reagent + 50 μl 20% (v/v) Na2CO3. The
samples were then incubated at 40°C for 30 min. Afterwards, the
absorbance was read at 690 nm using an ELISA reader (Multiskan
ascent V1.24354-50973). The phenolic concentration was
expressed as gallic acid equivalents per gram dry sample material.
A completely randomized design was used. A total of eighty
cuttings were used for each treatment. For total phenol content
analyses, twenty cuttings were randomly collected in each
treatment at 0, 60, 90 and 120 days after planting. To determine
root growth parameters at day 90, roots of the twenty cuttings
collected after 90 days were used to measure rooting percentage,
mean root dry mass and mean number of roots. Where appropriate,
chi-square analysis and Tukey’s studentized range test were
applied to compare treatment means. All statistical analyses were
done using the Statistical Analysis System (SAS) program (SAS
Institute Inc., 1996).
RESULTS AND DISCUSSION
Wu and du Toit 12543
After 90 days, a significantly higher rooting percentage
was observed in blanched cuttings (100%) than those
that were unblanched (60%) (Table 1). In addition, the
amounts of roots formed in blanched cuttings were
significantly higher than in unblanched cuttings, as
indicated by the mean root dry mass. Similar findings
were reported by Howard et al. (1985), Sun and Bassuk
(1991) and Wu et al. (2006). Furthermore, in terms of root
length, blanched cuttings formed significantly more roots
in all root length groups except Group 4 (31 to 40 mm),
confirming that, blanching significantly improved
formation and elongation of roots (Table 1). Figure 1
illustrates the changes of total phenol content in the
different parts of the unblanched and blanched cuttings
during a rooting period of 120 days. At the basal end of
the cuttings (Figure 1a), where rooting took place, the
total phenol content of both the control and blanched
treatments increased steadily throughout the propagation
period. However, the total phenol content of the blanched
cuttings (42.09 mg/g) was already significantly higher
than the control (23.68 mg/g) on day 0, when phenolic
analysis was done immediately after the blanching
treatment was completed, which clearly showed that,
blanching caused an increase in the accumulation of total
phenols in stems (Figure 1a). This is contrary to many
study results, which often reported that phenolic
compound concentrations are reduced by etiolation
treatments (George, 1996; Goupy et al., 1990; Sharma et
al., 1995; Sharma and Singh, 2002).
Furthermore, the increase in the total phenol content
throughout the entire propagation period correlated with
the rooting of the cuttings, as shown by the increase of
mean root dry mass in Figure 1a. The total phenol
content of the basal end of blanched cuttings was at its
highest level (84.15 mg/g) on day 90, which is at the
same time when considerable rooting had taken place. In

12544 Afr. J. Biotechnol.
(A) Basal end (C) Top end
(B) Middle (D) Leaves
Total Phenols (mg.g-1)
Total Phenols (mg.g-1)
100
90
80
70
60
50
40
30
20
10
0
100
80
60
40
20
0
Figure 1.
*
0 60 90 120
*
*
Days After Planting
Control Blanched
Control (Root mass) Blanched (Root mass)
*
0 60 90 120
*
Days After Planting
Control Blanched
*
ns
*
250
200
150
100
50
0
Mean Root Dry Mass
(mg)
Total Phenols (mg.g-1)
Total Phenols (mg.g-1)
120
100
80
60
40
20
0
160
140
120
100
80
60
40
20
0
ns
ns
0 60 90 120
ns
Days After Planting
Control Blanched
0 60 90 120
Days After Planting
Control Blanched
Figure 1. Fluctuations of total phenol content in different parts of P. cynaroides cuttings during a rooting period of 120 days. Means tested for significance at the
same time period within each plant part based on Tukey’s studentized test. *: significant (P < 0.05); ns: not significant.
ns
ns
ns
ns
ns

fact, the blanched cuttings had rooted sufficiently to be
transplanted to the field after 90 days. Large amounts of
rooting in untreated cuttings were only observed after 120
days when the phenol content reached its highest level
(78.42 mg/g), which incidentally was similar to the levels
obtained in blanched cuttings on day 90. This is in
contrast with other studies, which showed that improvements
in root formation are due to reductions of total
phenols in etiolated plants (Sharma et al., 1995; Sivaci et
al., 2007), while high total phenol content is generally
associated with inhibition of root formation in woody
plants (Curir et al., 1993). In the few cases (mostly in
woody species) where etiolation treatments increased
total phenol concentrations and stimulated rooting, such
as those reported by Druart et al. (1982) and Gautam and
Chauhan (1990), it has been hypothesized that, phenolic
compounds protect the endogenous natural-occurring
auxin - indole-3-acetic acid (IAA) from destruction by the
enzyme IAA oxidase (Donoho et al., 1962; Fadl et al.,
1979) or act as precursors to lignin formation for
structural support (Haissig, 1986).
Regarding the changes of total phenol content in the
basal end and the leaves of cuttings, a positive
correlation was also evident. The highest amounts of total
phenols in the entire cutting were found in the leaves,
confirming that phenolic compounds are synthesized in
the chloroplasts and transported to the vacuole for
storage (Jähne et al., 1993; Mosjidis et al., 1989; Mueller
and Beckman, 1974; Weissenböck et al., 1986). The total
phenol content in the leaves of blanched cuttings
decreased from its peak of 141.81 mg/g on day 60 to
118.64 mg/g on day 90 (Figure 1d), while at the same
time period, the total phenol content in the basal end
increased from 66.07 to 84.15 mg/g (Figure 1a). In
relation to root formation during the same period, the
mean root dry mass increased from 15.6 (day 60) to
159.8 mg (day 90) for blanched cuttings (Figure 1a). The
fluctuations of total phenol concentrations in the leaves
and basal ends of the unblanched cuttings during rooting
were similar. Of particular importance is that, the results
showed when the total phenol concentration was
between 66.07 and 84.15 mg/g (day 60 to 90) in the
basal end of blanched cuttings, large amounts of root
formation took place. Considerable rooting also took
place at a similar total phenol concentration range (60.84
to 78.42 mg/g) for the unblanched cuttings from day 90 to
120 (Figure 1a). This suggests that a minimum of 60.84
mg/g total phenols may be required to stimulate the
formation of large amounts of roots in P. cynaroides
cuttings. This finding is of practical significance to
growers since it raises the possibility of inducing early
rooting by applying phenolic compounds exogenously on
the basal ends of cuttings to increase its endogenous
phenol concentration or by using Brotomax ® , which has
been reported to increase total phenol concentrations in
stems and leaves (Del Rio et al., 2003). The amounts of
total phenols found in the top part of the cuttings in the
unblanched and blanched treatments were very similar
Wu and du Toit 12545
(Figure 1c). However, in the middle part of the cutting
(Figure 1b), the total phenol content of the blanched
cuttings was significantly higher than the control, which
may be partly due to an increase in the accumulation of
phenols in this area caused by the etiolation effect in the
basal end below it.
In conclusion, by analyzing the total phenol content of
P. cynaroides cuttings from when the plant materials
were collected until they were well rooted, the
relationship between total phenol content and root
formation was established. In addition, through the
phenolic analysis of different parts of the cuttings, a
positive correlation among blanching, total phenol content
and rooting was found. In contrast to many etiolation
studies, blanching increased the total phenol content in
P. cynaroides stems, particularly in the basal ends. The
results of this study have contributed new knowledge
regarding the role of total phenols during root formation in
P. cynaroides cuttings.
ACKNOWLEDGEMENT
The authors are grateful to Dr. Gordon Bredenkamp for
providing the plant materials and the use of his
propagation facility.
REFERENCES
Bray HG, Thorpe WV (1954). Analysis of phenolic compounds of
interest in metabolism. Methods Biochem. Anal. 1: 27-52.
Curir P, Sulis S, Mariani F, Van Sumere CF, Marchesini A, Dolci M
(1993). Influence of endogenous phenols on rootability of
Chamaelaucium uncinatum Schauer stem cuttings. Sci. Hortic., 55:
303-314.
Del Río JA, Báidez AG, Botía JM, Ortuño A (2003). Enhancement of
phenolic compounds in olive plants (Olea europea L.) and their
influence on resistance against Phytophthora sp. Food Chem., 83:
75-78.
Donoho CWA, Mitchell AE, Sell HN (1962). Enzymatic destruction of C 14
labelled indoleacetic acid and naphthaleneacetic acid by developing
apple and peach seeds. Proc. Am. Soc. Hortic. Sci., 80: 43-49.
Druart P, Keevers C, Boxus P, Gaspar T (1982). In vitro promotion of
root formation by apple shoots through darkness effect on
endogenous phenols and peroxidases. Z. Pflanzenphysiol., 108: 429-
436.
Fadl MS, El-Deen AS, El-Mahady MA (1979). Physiological and
chemical factors controlling adventitious root initiation in carob
(Ceratonia siliqua) stem cuttings. Egypt. J. Hortic., 6(1): 55-68.
Fourie A (2004). Biochemical mechanisms for tolerance of citrus
rootstocks against Phytophthora nicotianae. MSc Thesis. University
of Pretoria, South Africa.
Gautam DR, Chauhan JS (1990). A physiological analysis of rooting in
cuttings of juvenile walnut (Juglans regia L.). Acta Hortic., 284: 33-44.
George EF (1996). Plant propagation by tissue culture. Part 2: In
Practice, 2 nd Ed. Exegetics Ltd. Edington, Wilts. BA13 4QG, England.
Goupy PM, Varoquaux PJA, Nicolas JJ, Macheixo JJ (1990).
Identification and localization of hydroxycinnarnoyl and flavanol
derivatives from endive (Cichoriumendivia L. cv. Geante Maraichere)
leaves. J. Agric. Food Chem., 38: 2116-2121.
Haissig BE (1986). Metabolic processes in adventitious rooting of
cuttings. In: Jackson, M. B. (Ed.) New Root Formation of Plants.
Martinus Nijhoff Publishers, Boston: 141-190.
Howard BH, Harrison-Murray RS, Arjal SB (1985). Responses of apple

12546 Afr. J. Biotechnol.
summer cuttings to severity of stockplant pruning and to stem
blanching. J. Hortic. Sci., 60(2): 145-152.
Jähne A, Fritzen C, Weissenböck G (1993). Chalcone synthase and
flavonoid products in primary-leaf tissues of rye and maize. Planta
189: 39-46.
Leonardt K (2008). Regional grower reports. Protea Newsletter
International 1(1): 8-12.
Mosjidis CO’H, Peterson CM, Mosjidis JA (1989). Developmental
differences in the location of polyphenols and condensed tannins in
leaves and stems of Sericea lespedeza, Lespedeza cuneata. Ann.
Bot., 65(4): 355-360.
Mueller WC, Beckman CH (1974). Ultrastructure of the phenol-storing
cells in the roots of banana. Physiol. Plant Pathol., 4: 187-190.
SAS Institute Inc. (1996). The SAS system for Windows. SAS Institute
Inc. SAS Campus drive, Cary, North Carolina, USA.
Sharma HC, Sharma RR, Goswami AM (1995). Effect of etiolation on
polyphenol oxidase activity in shoots of grape and its subsequent in
vitro survival. Indian J. Hortic., 52(2): 104-107.
Sharma RR, Singh SK (2002). Etiolation reduces phenolic content and
polyphenol oxidase activity at the pre-culture stage and in-vitro
exudation of phenols from mango explants. Trop. Agric., 79(2): 94-
99.
Sivaci A, Sokmen M, Gunes T (2007). Biochemical changes in green
and etiolated stems of MM106 apple rootstock. Asian J. Plant Sci.,
6(5): 839-843.
Sun W-Q, Bassuk NL (1991). Stem banding enhances rooting and
subsequent growth of M.9 and MM.106 apple rootstock cuttings.
HortScience 26(11): 1368-1370.
Vogts M (1982). South Africa’s Proteaceae. Know them and grow them.
C. Struik, Cape Town: 91-92.
Weissenböck G, Hedrich R, Sachs G (1986). Secondary phenolic
products in isolated guard cell, epidermal cell and mesophyll cell
protoplasts from pea (Pisum sativum L.) leaves: distribution and
determination. Protoplasma 134: 141-148.
Wu HC, du Toit ES, Reinhardt CF (2006). Etiolation aids rooting of
Protea cynaroides cuttings. S. Afr. J. Plant Soil 23(4): 315-316.
Wu HC, du Toit ES, Reinhardt CF, Rimando AM, Van Der Kooy F,
Meyer JJM (2007). The phenolic, 3,4-dihydroxybenzoic acid, is an
endogenous regulator of rooting in Protea cynaroides. Plant Growth
Regul., 52: 207-215.

African Journal of Biotechnology Vol. 10(59), pp. 12547-12554, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1906
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effect of environmental conditions on the genotypic
difference in nitrogen use efficiency in maize
Cai Hong-Guang 1,2# , Gao Qiang 3# , Mi Guo-Hua 1 and Chen Fan-Jun 1 *
1 Key Lab of Plant Nutrition, MOA, Department of Plant Nutrition, China Agricultural University, Beijing, 100193, China.
2 Research Center of Agricultural Environment and Resources, Jilin Academy of Agricultural Sciences,
3 Jilin Agricultural University, Changchun; 130118, China. Changchun 130033, China
Accepted 31 January, 2011
Selection for nitrogen (N) efficient cultivars is typically conducted under favorable field conditions with
only difference in soil N availability. However, in practical field conditions, variation in soil types and/or
seasonal weather conditions may have a strong influence on plant growth and therefore, N use
efficiency. In the present study, a set of 3 genotypes (JD209, JD180 and SM25) were compared for their
response to N inputs in two locations with different soil types in 2004 and 2005. It was found that maize
yield in Xin-Li-Cheng with black soils was significantly higher than that in Qian-an with light chernozem
soil. At the same location, maize yield in 2005 was higher than in 2004 because there was more rainfall
in 2005. With sufficient N supplies (150 to 300 kg/ha), no difference in yield potential was observed
among the 3 hybrids under the favorable soil and weather conditions. Nevertheless, genotypic
difference in maize yield in response to N inputs was observed under varied soil types and rainfall
conditions. N-efficient JD209 only showed low-N tolerance under unfavorable soil (light chernozem) and
water shortage condition (in 2004). It is concluded that, identification of N-efficient cultivars should be
conducted under multiple environments.
Key words: Maize, N efficiency, soil, precipitation.
INTRODUCTION
Maize (Zea mays L.) is widely distributed from the subhumid
to semi-arid area in northeastern China Plain.
Nitrogen is the major limiting mineral nutrient in maize
production. Breeding for N-efficient cultivars, which can
achieve a relative high yield at low N input, is considered
a promising way to deal with the problem (Bolaños and
Edmeades, 1993). Selection for N-efficient cultivars is
typically conducted under favorable field conditions with
only difference in soil N availability. However, in practical
field conditions, variation in soil types and/or seasonal
*Corresponding author: caucfj@cau.edu.cn. Tel: 86 10
62734454. Fax: 86 10 62731016.
#Both authors contributed equally to the work.
weather conditions may have a strong influence on soil N
dynamics and plant growth and therefore, N uptake and
its subsequent utilization in plants. As a result, the
response of a genotype to N inputs may be quite different
under different soil and/or weather conditions (Shumway,
1992). A N-efficient genotype selected under favorable
soil and weather conditions may not have superior
performance in an adverse condition and vice versa. It is
not clear if the adaptability to environment variation play
an important role in efficient use of N fertilizer. Research
in CIMMYT suggested that there is close relationship
between low-N and drought tolerance (Bänziger et al.,
2000). In the present study, the relationship between Nefficiency
and environmental adaptability was further
investigated by using 3 maize genotypes grown in two
locations with different soil types in two years. The results
suggest that the N-efficient trait of a genotype is closely
related to its adaptability to soil characters and water
supplies.

12548 Afr. J. Biotechnol.
Table 1. The major chemical characteristics of the soils.
Experimental
location
pH
(1:2.5)
Organic
matter (g/kg)
Total nitrogen
(g/kg)
Olsen-P
(mg/kg)
NH4COOH-
K (mg/kg)
NH4 - N
(0-30cm) mg/kg
NO3 - N
(0-30cm) mg/kg
Xin-Li-Cheng 5.73 28.5 1.84 19.6 139.1 10.1 7.96
Qian-an 8.02 22.2 1.66 18.8 117.8 4.4 10.2
MATERIALS AND METHODS
Locations
Table 2. Rates of N application in Xin-Li-Cheng and Qian-an in 2004 and 2005.
Experimental
location
Rate of N fertilizer (kg N /ha)
2004 2005
N0 N1 N2 N0 N1 N2
Xin-Li-Cheng 0 190 300 0 150 200
Qian-an 0 190 300 0 190 300
Maize Zea may L. was grown in 2004 and 2005 in two locations of
Jilin province of China, Xin-Li-Cheng and Qian-an, respectively. Xin-
Li-Cheng is located in the central Northeast Plain of China with a
semi-humid weather. During the growing season from April through
September, the precipitation was 410.1 and 642.5 mm in 2004 and
2005, respectively. Qian-an is located about 200 km northwest of
Xin-Li-Cheng. It has a semi-arid weather (Zhang et al., 2002; An,
2002). The precipitation from April through September was 316 and
543 mm, respectively. So rainfall in 2004 was less than in 2005 at
both locations. In Xin-Li-Chen, the soil type is a black soil with good
nutrient buffer capacity (Wang and Liu, 1997). It has a pH of 5.73
(Table 1). In Qian-an, the soil types is a light chernozem which is
much sandy in comparison to the black soil in Xin-Li-Cheng. The pH
value is high (pH = 8.02) (Agricultural Planning Department of Qianan,
1984). Both of the locations have been grown continuously for
maize.
Genotypes and N treatments
Maize hybrids SM25, JD209 and JD180 were chosen according to
their differential response to soil fertility in a previous study (Wu et
al., 2001). The experiment was a split-plot design with N treatments
as the main plot and genotypes as the sub-plot. Nitrogen fertilizer
rates were shown in Table 2. Each treatment was repeated 3 times,
resulting in a total of 72 plots. The plot size was 60 (in Xin-Li-
Cheng) and 80 m 2 (in Qian-an), respectively. Plots were thinned at
the seedling stage to a final stand of 60 000 plants ha -1 . No
irrigation was applied. Phosphorus (P2O5 69 kg ha -1 ) and potassium
(K2O, 50 kg ha -1 ) was applied as basal fertilizer before sowing.
Thirty kg ha-1 of the N fertilizer (as urea) was applied as basal
fertilizer and the rest was applied at 9 leaf stage. Maize was sown
in late April and harvested in early October in 2004 and 2005. The
plot for each genotype and N treatment was fixed in the two years.
In Xin-Li-Cheng in 2004, root samples were taken at anthesis stage
by excavation method. A soil column surrounding a plant, with
surface area of 0.25 m (1/2 distance between rows) × 0.17 m (1/2
distance between plants in a row), was excavated to a depth of 60
cm below the soil surface. The soil column containing the roots was
washed by using a mesh sieve. All the plants from each plot were
sampled for yield determination. Five plants from each plot were
sampled for determining N content in plants. Nitrogen utilization
efficiency (NUtE) was calculated as the grain yield divided by P
accumulated in aboveground biomass at maturity. Data were
statistically analyzed using SAS program and Microsoft excel.
RESULTS
Variance analysis
In general, there was a significant difference in maize
yield and N accumulation among genotypes, N treatments,
as well as between the two locations (Table 3).
Across genotypes, N treatments and the two sites, grain
yield was not different between 2004 and 2005. Except
for year x N treatment, the interactions between any 2,
among any 3 and 4 experimental factors were significant
for grain and N accumulation, suggesting the special
combination of genotype, location, weather (year), as well
as N application play an important role in both N accumulation
and grain yield. Nitrogen utilization efficiency
(NUtE) was significantly affected by years and N
treatments and their interaction with sites, but was not
different among genotypes.
Yield variation across soil types
At zero-N (N0) treatment, maize yield and N accumulation
in Qian-an were higher than in Xin-Li-Chen (Figure
1), reflecting that basic NO3 - -N content in the soil of Qianan
was higher (Table 1). Nevertheless, yield and N
accumulation response to N application were stronger in
Xin-Li-Cheng than that in Qian-an. This may result from
two reasons. One reason is that soil structure in Xin-Li-
Chen was better. It is a black soil which is loamy with
higher organic matter content and the soil pH was
suitable for plant growth (pH = 5.73) (Table 1). While in
Qian-an, the soil is a light Chernozem soil, which is much
sandy with lower organic matter and its pH value is
suboptimal (pH = 8.02) (Table 1). The second reason is

Hong-Guang et al. 12549
Table 3. Variance analysis of yield, N accumulations and N utilization efficiency of maize hybrids at different experimental areas.
Parameters
Yield N accumulation N utilization efficiency
Df Mean
square
F
value
Pr > F
Mean
square
F
value
Pr > F Mean
square
F
value
Pr > F
R (repeat) 2 614987 3.03 0.055 21.1 0.13 0.8825 54.1 0.87 0.4235
A (year) 1 3008 0.01 0.9035 11205 66.7

12550 Afr. J. Biotechnol.
A: Xin-Li-Cheng
Grain yield (kg/ha)
grain yield (kg /ha)
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
B: Qian-an
Grain yield (kg/ha)
grain yield (kg/ ha)
7000
6000
5000
4000
3000
2000
1000
0
N0 N1 N2
N treatments
SM25
JD209
JD180
N0 N1 N2
N treatments
SM25
JD209
JD180
Figure 2. Genotypic difference in maize yield and N accumulation in Xin-Li-Cheng (A) in Qian-an (B). Bars indicate
the value of LSD0.05.
in 2004, but not in 2005 (Figures 3 and 4). In both sites,
JD209 got higher yield at N0 and N1 treatments than the
other two genotypes in 2004. At N2 treatment, the yield of
JD209 was higher than the other two genotypes in Qianan
and was similar to that of SM25 in Xin-Li-Cheng. In
general, JD209 accumulated more N at N0 treatment
than the other two genotypes. JD180 got the lowest yield
at N1 and N2 treatments in Qian-an in both years. These
data suggest that precipitation may have a strong effect
on the response of maize genotypes to N application.
JD209 is adaptive to either N stress, drought or soil
constraints. Therefore, it got higher yield across years, N
N accumulations (kg /ha)
N accumulations (kg/ ha)
180
160
140
120
100
80
60
40
20
0
140
120
100
80
60
40
20
0
N0 N1 N2
N treatments
input and locations. SM25 seems adaptive to drought and
constraints, but not low N stress. Therefore, it performed
well at N1 and N2 treatments in 2004 only. JD180 was
the least tolerant cultivar which yield was most
susceptible to low N, water and soil constraints.
Root size of different genotypes
SM25
JD209
JD180
N0 N1 N2
N treatments
SM25
JD209
JD180
Root characters are a fundamental factor in adaptation to
various abiotic stresses. To understand the mechanism
for the genotypic difference of yield variation in different

2004
Grain yield (kg/ha)
grain yield (kg /ha)
2005
Grain yield (kg/ha)
grain yield (kg /ha)
10000
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
10000
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
N0 N1 N2
N treatments
SM25
JD209
JD180
N0 N1 N2
N treatments
SM25
JD209
JD180
Hong-Guang et al. 12551
Figure 3. Genotypic difference in maize yield and N accumulation in 2004 and in 2005 in Xin-Li-Cheng. Bars
indicate the value of LSD0.05.
environments, the root size of the 3 three genotypes was
investigated in Xin-Li-Chen in 2004. It was shown that the
root size of JD209, as shown by the root dry weight at
silking stage, was much larger than that of the other two
genotypes, especially at the optimum N application (N2)
treatment (Figure 5). Root size was reduced both at N0
and N2 in JD209 and SM25, suggesting that both N
deficiency stress and overdose of N input had a negative
effect on root growth. The root size of JD180 was small,
but seemed not sensitive to variation in N applies. Across
the N and genotype treatments, there is a significant
N accumulations (kg/ ha)
N accumulations (kg/ ha)
250
200
150
100
50
0
140
120
100
80
60
40
20
0
N0 N1 N2
N treatments
positive correlation between root dry weight and grain
yield (r = 0.7507, P < 0.01).
Nitrogen utilization efficiency
SM25
JD209
JD180
N0 N1 N2
N treatments
SM25
JD209
JD180
Nitrogen utilization efficiency (NUtE) is not significantly
different among genotypes and sites (Table 3). As
expected, there was significant difference in NUtE among
N treatments (Table 3), with higher NUtE at low-N
conditions (Table 4). In addition, NUtE in 2004 was

12552 Afr. J. Biotechnol.
Figure 4. Genotypic difference in maize yield and N accumulation in Qian-an in 2004 and in 2005. Bars indicate
the value of LSD0.05.
significantly lower than that in 2005 (Table 4), suggesting
that NUtE was much affected by weather conditions. Low
NUtE in 2004 might be closely related to the less rainfall.
DISCUSSION
2004
Grain yield kg/ha) Grain yield kg/ha)
grain yield (kg /ha)
grain yield (kg /ha)
2005
7000
6000
5000
4000
3000
2000
1000
0
7000
6000
5000
4000
3000
2000
1000
0
N0 N1 N2
N treatments
SM25
JD209
JD180
N0 N1 N2
N treatments
SM25
JD209
JD180
Using N-efficient genotypes has been suggested as one
of the ways to increase N fertilizer use efficiency in crops.
In theoretical research, evaluation of genotypes for N
N accumulations(kg /ha)
N accumulations(kg /ha)
140
120
100
80
60
40
20
0
140
120
100
80
60
40
20
0
N0 N1 N2
N treatments
SM25
JD209
JD180
N0 N1 N2
N treatments
SM25
JD209
JD180
efficiency was generally conducted under uniform experimental
conditions where only N supply is a variant. In
field conditions, however, there are strong interactions
between N availability and other environmental constraints,
such as soil characters, water supply etc. In this
case, the efficiency for a genotype to use N fertilizer,
which is largely determined by final grain yield, is unlikely
to be only determined by its ability to take up N from the
soil and subsequently utilize N efficiently in plant for grain
production. In CIMMYT, breeding for drought and low-N

Figure 5. Root size of 3 maize genotypes in response to
N inputs. Roots were sampled at anthesis stage in Xin-Li-
Cheng, in 2004. Bars indicate the value of LSD0.05.
Hong-Guang et al. 12553
Table 4. Genotypic difference in N utilization efficiency of 4 maize hybrids grown in Xin-Li-Cheng and Qian-an in 2004 and
2005.
Experimental
location
Genotype
Rate of N fertilizer (kg N /ha)
2004 2005
N0 N1 N2 N0 N1 N2
Xin-Li-Cheng SM25 49.7 41.5 41.8 61.7 59.5 60.7
JD209 41.0 51.0 38.4 63.6 62.8 62.9
JD180 64.5 49.2 40.3 66.0 62.6 60.7
Qian-an SM25 61.2 50.6 60.1 58.9 52.3 52.0
JD209 60.6 52.6 54.6 59.4 48.4 55.3
JD180 45.0 46.6 51.6 55.6 57.4 50.6
Yearly effect
Average 50.0 58.4
3.0
LSD0.05
Root dry weight (kg /ha)
3000
2500
2000
1500
1000
500
tolerance is closely related (Bänziger et al., 2000). In the
present study, a strong genotype x environment
interaction was shown in controlling grain yield formation
in response to N supplies. In comparison to 2005, the
genotypic difference in response to N supplies was more
significant in 2004 when the water supply was less
(Figure 4). JD209 got higher yield at zero-N treatment
(N0) than the other two genotypes. However, in 2005 no
difference was found between the 3 genotypes. Although,
JD209 had a high ability to accumulate N at N0 treatment
(Figure 3 and 4), genotypic difference in yield could not
be fully explained by N uptake. For example, JD180
accumulated the same amount of N as JD209 at N0
treatment in Qian-an in 2004, but the yield of JD180 was
0
SM25 JD209 JD180
N treatments
N0
N190
N300
much lower than that of JD209 (Figure 4). Therefore, the
low-N tolerance character of JD209 is likely related to its
ability in drought tolerance. It was found that, both soil
water deficit and soil nitrate deficiency can induce
stomatal closure and cause reductions in leaf growth
rates in plants (McDonald and Davies, 1996). Wilkinson
et al. (2004) found that nitrate signaling in soil had an
effect on stomata and leaf growth through its interactions
with soil drying, abscisic acid (ABA) and xylem sap pH in
maize. This provides physiological evidence in explaining
why low-N tolerance is closely related to drought
tolerance in maize and can be selected simultaneously
(Bänziger et al., 2000). In addition, genotypic difference
was more profound under light chernozem soil conditions

12554 Afr. J. Biotechnol.
(Figure 2) possibly because the soil was more sandy
(Agricultural Programming Department of Qian’an
country, 1984) and therefore, the possibility of N leaching
is higher. Without water shortage, the yield advantage of
JD209 was only shown under light chernozem soil
conditions in Qian-an (Figure 2), suggesting that low-N
tolerance in JD209 is also related to its ability to adapt to
adverse soil conditions.
The yield stability of JD209 at varied soil and climate
conditions in the present study may be explained by its
large root system (Figure 6). Under field conditions, many
studies highlight the essential role of root traits in N
acquisition (Mackay and Barber, 1986; Wiesler and Horst,
1994), though there are different opinions (Robinson and
Rorison, 1983; Robinson et al., 1991). To deal with a midseason
drought, Matthews et al. (1990) also suggested
that a more intensive root growth and hence, the
extraction of soil moisture from deeper layers is crucial.
Water shortage and low-N limitation may happen at the
same or different growth stage in field conditions.
Therefore, a genotype with a large root system can be an
insurance for yield formation at varied and hardly
expected, environmental conditions.
In conclusion, environmental conditions like soil types
and weather conditions have a strong effect on the
genotypic difference in maize yield in response to N input.
Identification of N-efficient cultivars should be conducted
under multiple environments. Selection under favorable
soil conditions with only difference in N supply may not
result in the genotypes that would perform well under a
variety of climate and/or soil conditions. Selection for
drought tolerance may simultaneously improve Nefficiency.
ACKNOWLEDGEMENTS
This study was supported financially by the Ministry of
Science and Technology ‘973’ program (2011CB100305,
2009CB118601, 2007CB109302), the National Science
Foundation of China (No.31172015, No.30821003),
Special Fund for Agriculture Profession (201103003), and
Chinese University Scientific Fund (2011JS163).
REFERENCES
Agricultural Planning Department of Qian’an County (1984). Soils of
Qian’an country of Jilin province.
An G, Sun L, Lian Y, Shen BZ (2002). The Climatic Changes Analysis of
Qian’an in the last 40 years. Climatic Environ. Res. 7: 370-376.
Bänziger M, Edmeades GO, Beck D, Bellon M (2000). Breeding for
Drought and Nitrogen Stress Tolerance in Maize: From Theory to
Practice. Mexico, D.F: CIMMYT.
Bolaños J, Edmeades GO (1993). Cycles of selection for drought
tolerance in lowland tropical maize. I. Responses in grain yield,
biomass, and radiation utilization. Field Crops Res. 31: 233-252.
Mackay AD, Barber SA (1986). Effect of nitrogen on root growth of two
corn genotypes in the field. Agron. J. 78: 699-703.
McDonald AJS, Davies WJ (1996). Keeping in touch: responses of the
whole plant to deficits in water and nitrogen supply. Adv. Bot. Res. 22:
229-300.
Matthews RB, Azam-Ali SN, Peacock JM (1990). Response of four
sorghum lines to mid-season drought. I. Growth, water use and yield.
Field Crops Res. 25: 279-296.
Robinson D, Rorison IH (1983). Relationships between root morphology
and nitrogen availability in a recent theoretical model describing
nitrogen uptake from soil. Plant Cell Environ. 6: 641–647.
Robinson D, Linehan DJ, Caul S (1991). What limits nitrate uptake from
soil. Plant Cell Environ. 14: 77-851.
Shumway CR (1992). Planting date and moisture effects on yield,
quality and alkaline-processing characteristics of food-grade maize.
Crop Sci. 5: 1265-1269.
Wang JG, Liu HX (1997). Study on nutrient-supply capacity of black soil
and its change. Acta Pedologica Sinica. 34: 295-301.
Wu W, Wang XF, Zhang K (2001). A new approach for high-efficiency
agricultural research that break through the traditional models,
Classification of fertilizer requirement of Maize and quantified
application of fertilizer according to the grades. Rev. China Agric. Sci.
Technol. 4: 38-42.
Wiesler F, Horst WJ (1994). Root growth and nitrate utilization of maize
cultivars under field conditions. Plant Soil, 163: 267-277.
Wilkinson S, Bacon MA, Davies WJ (2004). Nitrate signalling to stomata
and growing leaves: interactions with soil drying, ABA, and xylem sap
pH in maize. J. Exp. Bot. 58: 1705–1716.
Zhang YF, Jia NX, Liu Y, Wang XP (2002). Favorable factors of maize
production, limited factors and partition of ecological regions in Jilin
province. Agric. Technol. 22: 13-15.

African Journal of Biotechnology Vol. 10(59), pp. 12555-12560, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.337
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Variability of characteristics in new experimental
hybrids of early cabbage (Brassica oleracea var.
capitata L.)
Cervenski Janko 1 , Gvozdanovic-Varga Jelica 1 , Glogovac Svetlana 1 and Dragin Sasa 2
1 Institute of Field and Vegetable Crops, Department for Vegetable Crops, Maksim Gorki St. 30, 21000 Novi Sad, Serbia.
2 Institute of Field and Vegetable Crops, Maksim Gorki St. 30, 21000 Novi Sad, Serbia.
Accepted 26 August, 2011
Early hybrids take a significant share of the Serbian fresh vegetables market; however, all early hybrids
are foreign. New domestic experimental hybrids of early cabbage have been analyzed and results are
presented in this paper. In order to get a better insight in the variability among the tested hybrids, we
have analyzed them for 14 characteristics by the principal component analysis (PCA) method. This
paper deals with four principal components that explain 87.2% of the total variance. Out of the 14 traits
analyzed, only seven traits had the highest communality with the first principal component and these
were plant height, rosette diameter, the weight of the whole plant, head weight, the usable part of the
head, head height and head diameter. All characteristics were positively correlated with the first
principal component. Cabbage characteristics that constitute the first principal component are in fact
the main objectives in programs of breeding early maturing cabbage. These characteristics explained
45.3% of the variability of the tested hybrids. If value of any of these seven characteristics is increased,
the values of the other six characteristics increased proportionally. The results of this work have
therefore contributed to a better understanding of the clustering of variability of the studied
characteristics. These characteristics directly impact the formation of market value of new hybrids, and
make them recognizable on the market.
Key words: Cabbage, head weight, principal component analysis, useful portion.
INTRODUCTION
Several experimental early cabbage hybrids have been
developed at Institute of Field and Vegetable Crops, Novi
Sad, in recent years. The objective was to develop
cabbage hybrids for production in early spring. These
hybrids are light green, sweet taste and intended for fresh
consumption. It is known that heterosis is applicable in
the development of early cabbage hybrids. Early maturity,
head forming and their correlations have been investigated
by Tanaka and Niikura, (2006). They concluded
that head shape, size and density must go together with
the earliness of head formation to answer market
demand. In Serbia, cabbage is grown at about 21,000 ha
*Corresponding author. E-mail: anko.cervenski@ifvcns.ns.ac.rs.
Tel: ++381 21 4898 356. Fax: ++381 21 4898 355.
(http://faostat.fao.org). This acreage includes both
hybrids and varieties, early, mid-season or late, for the
fresh market, pickling or long storage. Early cabbage
hybrids play an important role in the early vegetables
production. They are also an important cash crop.
However, foreign hybrids are exclusively grown in the
country since no competitive domestic hybrids have been
developed so far (Cervenski et al., 2006, 2011).
Principal component analysis (PCA) is a method of
data reduction that transforms the original variables into a
limited number of uncorrelated new variables. The
techniques is thus a useful device for representing a set
of variables by a much smaller set of composite variables
that account for much of the variance among the set of
original variables. It allows visualization of the differences
among the individuals, identification of possible groups
and relationships among individuals and variables

12556 Afr. J. Biotechnol.
(Rakonjac et al., 2010). Results obtained from such
analyses are very important for developing and recommending
best cultivar for production in a specific area, as
a selection criteria for further genetic improvements and
can enable objective estimation of experimental
genotypes, hence, developing best possible varieties for
official testing by national registration authorities
(Marjanović-Jeromela et al., 2008).
The objective of this study was to analyze the structure
of principal components of variability of characteristics of
experimental early cabbage hybrids in order to assess
the contribution of individual characteristics to the total
variability, and to establish similarities and differences
among the studied hybrids. Such analysis would help us
decide which of the experimental hybrids to register in the
Varietal Commission.
MATERIALS AND METHODS
The latest cycle of cabbage breeding at the Institute produced a set
of cabbage lines, some of which were used to develop experimental
lines suitable for fresh consumption after early field or greenhouse
production. It included eight early cabbage hybrids intended for
fresh consumption. The selected material was crossed in the
course of 2005 and 2006. Regardless of the fact that the hybrids
belonged to the same maturity group, it was our intention to see if
there exist differences in the variability of characteristics of the
hybrids, to show the structure of the variability and to group the
characteristics possessing the highest level of variability.
Experimental site and data collection
Experiments were established at the experiment field Rimski
Šancevi in the Institute of Field and Vegetable Crops, Novi Sad.
Experimental materials were planted manually in well prepared soil
in the half of April. A randomized block design with five replications
was used in the trial, with space between rows 60 cm and between
plants in row 50 cm. Conventional cultural practics were applied
during growing season. The area has a continental semiarid to
semihumid climate, a mean annual air temperature of 11.0°C, an
annual precipitation sum of 617 mm and an uneven distribution of
precipitation. The experiment was established in a loamy soil with
pH 7.0, organic matter content of 2.82%, N-NO3 of 10.7 ppm, P2O5
of 30.8 ppm and K2O of 26.6 ppm. The previous crop was winter
wheat, whose straw was baled and removed after harvest.
The analyses involved a total of fourteen characteristics during
two year period (2007 to 2008), which were measured and
described as: plant height (PH) in cm, rosette diameter (RD) in cm,
number of rosette leaves (NRL), total plant weight (TPW) in g, head
weight (HW) in g, weight of useful part of the head (WUPH) in g,
outer stem length (OSL) in cm, inner stem length (ISL) in cm, head
height (HH) in cm, head diameter (HD) in cm, total plant to head
weight ratio (PHR), head index (HI), inner stem length to head
height ratio (ISHHR) in %, useful part of the head to head weight
ratio (UPHR) in %.
Statistical analysis
In order to determine the contribution of individual characteristics of
the total variability, the analysis of principal components was
applied, or more precisely the varimax rotation method from the
group of multivariate analyses. The statistical package “Statistica”
9.1 (Statsoft, Inc., 2011) was used. The same method was used to
analyze the divergence and similarity of the tested cabbage
hybrids. The choice of principal components was based on the
percent of explained variability calculated by the scree test. To
determine which of the four principal components (PC) accounted
for the greatest amount of variation, the Eigenvalues of the four
PCs were compared for each trait.
RESULTS AND DISCUSSION
The principal components analysis places focus on the
variability of the first principal component. The first
principal component explains as much as possible, the
variability of all traits, while the second principal
component independent of the first, explains the highest
variability of what remains after the first component is
subtracted, etc. As the first two principal components
explained 60.0% of the total variability, which was not
high enough, we applied the quadrimax rotation and the
percentage of explained variability increased slowly as
we increased the number of principal components taken
into consideration (Table 1).
Relations between characteristics of the tested
cabbage hybrids were analyzed based on the communality
(% share of the variance) of the four rotated
principal components. The sum communality of the four
principal components was 87.2%, that is most of the
variability of the characteristics was explained by them.
Our result is similar with Tucak et al. (2009). The
objectives of their research were to explore the extent
and pattern of phenotypic variability in the alfalfa
collections, to classify the germplasm into similar groups
and to identify the main traits contributing to the overall
variability. They found that the first four PCs contributed
89,02% of the entire variability among the populations
and cultivars.
The first principal component however explained 45.3%
of the variance. The first group of hybrid cabbage
characteristics that were defined by this component
included: plant height (PH),PC1 = 0.920; rosette diameter
(RD), PC1 = 0.717; total plant weight (TPW), PC1 =
0.956; head weight (HW), PC1 = 0.950; usable part of the
head (WUPH), PC1 = 0.952; head height (HH), PC1 =
0.950 and head diameter (HD), PC1 = 0.873. These
characteristics account for the largest part of divergence
and variability among the tested hybrids. Considering the
characteristics associated with the first principal component,
we concluded that large plants with greater
height and rosette diameter are bound to form plants with
greater weight, larger heads and a larger usable part of
the head. This conclusion was drawn on the basis of the
fact that some of the above characteristics were highly
positively correlated with the first principal component.
The following characteristics were highly correlated with
the second principal component: number of rosette

Table 1. Eigenvalues, proportion of total variability and correlation between the original variables and the
first four principal components (PCs).
Characteristic a PC1 PC2 PC3 PC4
PH
0.920 0.055 -0.135 -0.053
RD 0.717 0.291 0.228 -0.065
NRL 0.008 0.881 0.175 0.074
TPW 0.956 -0.031 0.253 0.089
HW 0.950 -0.025 0.251 -0.121
WUPH 0.952 0.020 0.245 -0.120
OSL -0.289 0.468 -0.621 0.001
ISL 0.005 -0.254 -0.930 0.067
HH 0.950 -0.164 0.155 0.003
HD 0.873 0.127 0.136 -0.421
PHR -0.284 0.016 -0.152 0.873
HI 0.291 -0.587 0.192 0.564
ISHHR -0.381 -0.131 -0.892 0.065
UPHR 0.447 0.705 0.144 -0.163
Eigenvalue 6.341 2.052 2.458 1.342
% Var. 45.3 14.7 17.6 9.6
% Cum. 45.3 60.0 77.6 87.2
a For explanation of character symbols, see materials and method, under experimental data collection.
leaves (NRL)(PC2 = 0.881), head index (HI)(PC2 = -
0.587) and the usable part of the head to head weight
ratio (UPHR)(PC2 = 0.705).
More also, the third principal component explained
17.6% of the variance and it included the outer stem
length (OSL)(PC3 = -0.621), the internal stem length
(ISL)(PC3 = -0.930) and the inner stem length to head
height ratio (ISHHR)(PC3 = -0.892). These characteristics
were negatively correlated with this principal
component. The fourth principal component explained
9.6% of the total variance. Total plant weight to head
weight ratio (PHR) was highly correlated with the fourth
principal component (PC4 = 0.873). That characteristic
was dominant in this component, contributing to hybrids'
differentiation with about 9% of the total variability (Table
1). Based on the size of the obtained results, only the
characteristics associated with the first two principal
components are presented (Table 2).
The number of principal components to be included in
the analysis was determined by the significance test of
characteristic roots. For this purpose, we chose a graphic
representation of the values of the characteristic roots
according to their ordinal numbers. This diagram is called
the scree test, and it was proposed by Cattell (1966)
(Figure 1). Using this test, we selected principal components
whose values of characteristic roots were above
the unity. When the variance of the principal component
is less than unity, the characteristic root too is less than
one, which means that this component explains less than
the originally observed characteristic. Eliminating from
Janko et al. 12557
the system all components having the characteristic roots
less than one is a way to choose for observation, a
requisite number of principal components. In some
instances it is necessary to choose the number of
principal components that is required to explain satisfactorily
the variability percentage of a set (Kovacevic,
1994).
PCA is a multivariate analytical method, which is used
to downsize the dimensions of a data set, while
maximally retaining its variability. All of it aimed at faciletating
the presentation of data and the understanding of
data structure and relationships among variables used.
The method of principal component focuses on the
variability of the first few principal components. The first
principal component explains as much as possible, the
variability of all traits, while the second principal
component, independent of the first, explains the greatest
part of the variance that remains after the first and so on.
For this study, we selected four components that
explained 87.1% of the total variance. We analyzed
fourteen traits, but only seven traits had the highest communality
with the first principal component: plant height,
rosette diameter, whole plant weight, head weight, usable
part of the head, head height and head diameter. All
these characteristics were positively correlated with the
first principal component and they explained 45.3% of the
variability of the tested hybrids. If value of any of these
seven characteristics is increased, the values of the other
six characteristics increase proportionally. Tanaka and
Niikura, (2003) analyzed the characteristics of early

12558 Afr. J. Biotechnol.
Table 2. Characteristics of early cabbage hybrids associated with the first two principal components.
Hybrids/Year a PH b
RD NRL TPW HW WUPH HH HW HI UPHR
H1 - 2007 23.9 58,8 14 2371.0 1750.0 1461.7 16.2 17.5 0.9 83.1
H3 - 2007 24.2 67,7 11 3215.3 2347.7 1938.3 17.7 18.7 0.9 81.6
H4 - 2007 22.8 65,7 12 3296.7 2500.0 2022.3 18.3 18.8 1.0 80.8
H7 - 2007 23.5 62,6 12 2594.7 1933.3 1601.3 16.4 18.4 0.9 82.6
H10 - 2007 23.0 63,9 14 2716.0 1968.7 1686.7 16.6 17.9 0.9 85.5
H11 - 2007 24.9 79,9 13 3861.3 2877.3 2363.7 17.9 20.4 0.9 82.5
H14 - 2007 25.0 73,9 12 3112.7 2406.0 2036.3 17.7 20.0 0.9 84.5
H17 - 2007 27.0 74,5 12 4888.7 3854.3 3276.3 20.5 21.6 1.0 85.1
H1 - 2008 24.4 70,8 12 3302.4 1827.0 1486.0 17.0 16.7 1.0 81.2
H3 - 2008 24.7 76,4 14 3657.3 2705.7 2290.7 18.4 19.8 0.9 84.6
H4 - 2008 23.9 74,9 13 3637.0 2730.0 2245.7 18.7 19.1 1.0 82.1
H7 - 2008 25.4 79,8 15 4354.3 3303.3 2806.0 19.2 21.2 0.9 84.8
H10 - 2008 22.7 74,7 15 3036.0 2186.3 1865.0 16.9 18.1 0.9 85.3
H11 - 2008 25.8 88,7 14 4198.0 3097.3 2620.3 18.6 21.2 0.9 84.6
H14 - 2008 26.1 83,9 13 3467.7 2594.8 2182.7 17.7 21.0 0.8 84.3
H17 - 2008 27.7 82,4 13 5202.0 4087.7 3506.3 21.2 21.9 1.0 85.8
a Hybrid title and test year; b For explanation of character symbols, see experimetal data collection under materials and method.
Figure 1. Scree test of the principal components for the tested characteristics of cabbage hybrids.

hybrids and grouped them on the basis of the PCA.
These authors also obtained 4 major groups which
shared the variance in the following way: PC1 - 52.3,
PC2 - 13.0, PC3 - 9.1 and PC4 - 7.0% of the total
variance, and their cumulative variance amounted to
81.4%. Our results also show a group of four principal
components, with similar percentages of variance. The
highest percentage of variance is also in the first group,
as in the case of the above authors, and the cumulative
variance of 87.2% again shows high similarity. After
rotation, a selected group of principal components
retained some part of communality of the original
variables observed in communality of a single original
variable and the participation of variance explained by
selected principal components, but the values for some of
the main components change. Orthogonal rotation
facilitates the interpretation of principal components and it
clarifies the relationships among the original variables.
A closer look at the first principal component reveals
that this component contains the characteristics that form
the yield of early maturing hybrids. Our results are in
agreement with those of Vasic et al. (2008), who named
the first principal component the yield component.
Cabbage characteristics that constitute the first principal
component are in fact the main objectives in programs of
breeding early maturing cabbage. When engaged in
breeding, it is difficult to bring a decision and select a
hybrid only on the basis of the data discussed in this
paper. To obtain a satisfactory head weight, in addition to
the prevailing agro ecological conditions and agronomic
practices used, choice of a hybrid or cultivar suitable for a
particular area is of great importance. Correct choice of
hybrid or cultivar allows the genes that control head
weight to be fully expressed, thus minimizing the effects
of limiting environmental factors (Červenski et al., 2007).
Multivariate analysis is a very useful method because it
reveals the relationships and correlation among variables
studies. This type of analysis applied to studies of
germplasm collection allows a better understanding of the
structure of the collection, identification of more relevant
variables, detection of the relationships among
accession, as well as identification of possible groups
(Martines-Calvo et al., 2008). Rotation of principal
components makes it easier to see the location of each
studied characteristic within the system of principal
components. Mutual relationships between individual
characteristics remain unchanged, but changes take
place in their correlations with the principal components,
their proportion in certain principal components and their
load factor. Some characteristics become more firmly
attached to one of the principal components, and less
firmly attached to others. In that way, we maximize the
variance or the proportion of a set of principal
components and individual characteristics that comprise
them within the total variability.
The analysis of genetic divergence therefore plays an
Janko et al. 12559
important role in breeding programs for determining new
sources of variability that could be included in a desired
plant model (Gvozdanovic-Varga et al., 2002). For a
successful breeding program, genetic diversity and
variability play a vital role. Population genetic diversity is
a prerequisite for an effective plant–breeding program. It
is a useful and essential tool for parents’ choice in
hybridization to develop high yield potential cultivars and
to meet the diversified goals of plant breeding (Arslanoglu
et al., 2011).
Conclusion
The results of this work have contributed to a better
understanding of the clustering of variability of the studied
characteristics. Positive traits for breeding were found in
all clusters. The characteristics that take a significant role
in the formation of variability of the first principal
component are in fact the characteristics considered by
breeders to be of greatest importance in breeding
programs. These characteristics directly impact the
formation of market value of new hybrids, and make them
recognizable on the market. When cabbage is
concerned, this applies in the first place to head weight
and the weight of the usable part of the head. Therefore,
when choosing hybrids for a market, care should be
taken to 1) correctly interpret the statistical data derived
from the available experimental results and 2) to carefully
consider the available range of environmental factors
(growing conditions). The latest cycle of cabbage
breeding at the Institute produced a set of cabbage lines,
some of which were used to develop experimental lines
suitable for fresh consumption after early field or
greenhouse production. This effort has produced the
experimental hybrid H17, which in terms of quality, is
capable of competing with the cabbage cultivars currently
present on the Serbian market. The hybrid takes up to 65
days to mature from transplanting, its head is light green
and its flavor is sweet and pleasant.
REFERENCES
Arslanoglu F, Aytac S,Karaca Oner E (2011). Morphological
characterization of the local potato (Solanum tuberosum L.)
genotypes collected from the Eastern Black Sea region of Turkey.
Afr. J. Biotechnol. 10(6): 922-932.
Cattell RB (1966). The scree test for the number of factors. J. Multiv.
Behav. Res. 1: 245-276.
Cervenski J, Gvozdenovic DJ, Gvozdanovic-Varga J, Nikolic Z, Balaz F
(2006). Survey of cabbage experimental hybrids (Brassica oleracea
var. capitata L.). Plant Breed. Seed Prod. 12(12): 101-105.
Cervenski J, Gvozdenovic Dj, Gvozdanovic-Varga J, Bugarski D (2007).
Identification od desirable Genotypes in white cabbage (Brassica
oleracea var. capitata L.). Acta Horticult. 729: 61-66.
Cervenski J, Gvozdanovic-Varga J, Glogovac S (2011). Domestic
cabbage (Brassica oleracea var. capitata L.) populations from
Serbian province of Vojvodina. Afr. J. Biotechnol. 10(27): 5281-5285.
Gvozdanovic-Varga J, Vasic M, Cervenski J (2002). Variability of

12560 Afr. J. Biotechnol.
characteristics of garlic (Allium sativum L.) ecotypes. Acta Horticult.
579: 171-176.
Kovacic JZ (1994). Multivarijaciona analiza. Univerzitet u Beogradu,
Ekonomski fakultet in Serbian language. p. 283.
Martinez-Calvo J, Gisbert AD, Alamar MC, Hernandorena R, Romero C
Llacer G, Badenes ML (2008). Study of a germplasm collection of
loquat (Eriobotrya japonica Lindl.) by multivariate analysis. Gene.
Res. Crop Evol. 55(5): 695-703.
Marjanović-Jeromela A, Marinković R, Mijić A, Jankulovska M, Zdunić
Z, Nagl N (2008). Oil yield stability of winter rapeseed (Brassica
napus L.) Geno. Agric. Conspectus Sci. 73(4): 217-220.
Rakonjac V, Fotiric AM, Nikolic D, Milatovic D, Čolić S (2010).
Morphological characterization of Oblačinska sour cherry by
multivariate analysis. Sci. Horticult.125: 679-684.
Statsoft Inc (2011). Statistica (data analysis software system), Tulsa,
OK. 9: 1.
Tanaka N, Niikura S (2003). Characterization of early maturing F1
hybrid varieties in cabbage (Brassica oleracea L.). Breed.Sci. 53:
325-333.
Tanaka N, Niikura S (2006). Genetic analysis of the developmental
characteristics related to the earlines of head formation in cabbage
(Brassica oleracea L.) Breed. Sci. 56: 147-153.
Tucak M, Popovic S, Cupic T, Šimic G, Gantner R, Meglic V (2009).
Evaluation of Alfaalfa germplasm collection by multivariate analysis
based on phenotypic traits. Rom. Agric. Res. 26: 47-52.
Vasic M, Gvozdanovic-Varga J, Cervenski J (2008). Divergence in the
dry bean collection by principal component analysis (PCA).
www.faostat.fao.org Genetics, 40(1): 23-30.

African Journal of Biotechnology Vol. 10(59), pp. 12561-12566, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.822
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Evaluation of genetic diversity in self-incompatible
broccoli DH lines assessed by SRAP markers
Huifang Yu, Zhenqing Zhao, Xiaoguang Sheng, Jiansheng Wang and Honghui Gu*
Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, 198 ShiQiao Road, Hangzhou, Zhejiang Province
310021, China.
Accepted 19 August, 2011
In this article, we investigated self-compatibility index (SCI) in broccoli double haploid (DH) lines, and
the relationship and genetic diversity of 15 self-incompatible (SI) broccoli DH lines were analyzed by
sequence related amplified polymorphism (SRAP). 11 primer combinations selected from 88 primer
pairs revealed a total number of 129 unambiguous bands, 61 of which were polymorphic with a
polymorphism frequency of 47.3%. Analyzed by NTSYS software, the genetic similarity coefficient of the
15 broccoli resources ranged from 0.76 to 0.98. Based on the coefficient value of 0.79, these broccoli
DH lines were clustered into three multiple-member groups by unweighted pair group method with
arithmetic mean (UPGMA) analysis, which provided molecular reference for parent selection in broccoli
breeding.
Key words: Brassica oleracea L. var. italica, self-compatibility index, double haploid, genetic diversity,
sequence related amplified polymorphism (SRAP).
INTRODUCTION.
Broccoli (Brassica oleracea L. var. italica) is a traditional
European crop, and now has become widespread in
Asian in recent decades (Branca, 2008). In broccoli, F1
hybrids have advantages especially in uniform maturity,
high total yield, better curd/head quality, and resistance
to diseases and unfavourable weather conditions
(Branca, 2008). For producing hybrid seeds of cabbage,
cauliflower, broccoli, Brussels sprout and kale, a selfincompatibility
(SI) character is utilized which is controlled
by the S-locus (King, 2003). For establishing the
homozygous SI parental lines, it usually needs years to
*Corresponding author. E-mail: gu2199@yahoo.com.cn. Tel:
+86-571-86417316.
Abbreviations: SCI, Self-compatibility index; DH, double
haploid; SRAP, sequence related amplified polymorphism;
UPGMA, unweighted pair group method with arithmetic mean;
SI, self-incompatible; SSI, sporophytic self-incompatibility; SRK,
S receptor kinase; SP11/SCR, small cysteine-rich secreted
protein; DNA, deoxyribonucleic acid; CTAB, cetyl
trimethylammonium bromide; PCR, polymerase chain reaction;
SC, self-compatible; ORPs, open reading frames; AFLP,
amplified fragment length polymorphism.
get inbred line, survey and choose for several
generations. Microspores culture could fleetly get
homozygous lines-double haploid) (DH) lines and
surveying self-compatibility indexes (SCI) of DH lines
could quicken the getting of homozygous SI lines.
Broccoli belongs to Brassicaceae. In the Brassicaceae, a
conserved sporophytic self-incompatibility (SSI) system is
present, and detailed genetic studies have resulted in the
identification of highly polymorphic S genes that confer
this trait.
The SSI system has been best characterized in the
genus Brassica, and is primarily controlled by a receptor–
ligand system encoded in two tightly linked and multiallelic
genes: the S receptor kinase (SRK), and the small
cysteine-rich secreted protein, SP11/SCR (Samuel et al.,
2008). SRK is the sole determinant of specificity in the
stigma, and encodes a membrane-associated receptor
protein kinase with extracellular, transmembrane and
cytoplasmic kinase domains (Takasaki et al., 2000; Silva
et al., 2001). SP11/SCR is the male determinant of Slocus
specificity in the pollen side and encodes a lowmolecular
weight cysteine-rich protein which specifically
expresses in the anther tissues (Shiba et al., 2001). The
co-evolved SRK and SP11/SCR alleles constitute
different S-haplotypes, and ‘self’ pollen rejection occurs

12562 Afr. J. Biotechnol.
Table 1. SRAP primers.
Primer Sequences (5’-3’) Primer Sequences (5’-3’)
me1 TGAGTCCAAACCGGATA em1 GACTGCGTACGAATTAAT
me2 TGAGTCCAAACCGGAGC em2 GACTGCGTACGAATTTGC
me3 TGAGTCCAAACCGGAAT em3 GACTGCGTACGAATTGAC
me4 TGAGTCCAAACCGGACC em4 GACTGCGTACGAATTTGA
me5 TGAGTCCAAACCGGAAG em5 GACTGCGTACGAATTAAC
me6 TGAGTCCAAACCGGTAA em6 GACTGCGTACGAATTGCA
me7 TGAGTCCAAACCGGTCC em7 GACTGCGTACGAATTCAA
me8 TGAGTCCAAACCGGTGC em8 GACTGCGTACGAATTCTG
when the S-haplotype of the pollen parent matches the
pistil S-haplotype (Boyes and Nasrallah, 1993).
Although the interactions between SRK and SP11/
SCR has been well mapped out, still there are several
questions to be solved, such as how temperature and
humidity have impact on the SI, and how to overcome SI
during reproduction of SI plants. Research on broccoli SI
is seldom. In this article, we investigated SCI in broccoli
DH lines, and evaluated genetic diversity of SI materials
in broccoli by sequence related amplified polymorphism
(SRAP).
MATERIALS AND METHODS
DH lines were planted in conservatory in 2008 autumn and SCI
were determined in the next year spring when plants flowered.
Determination of self-compatibility index
Before buds anthesis, florets were protected from other pollens
pollinated by bags. When most buds of the florets flowered, the
bags were wiped off and flowers were pollinated with the pollen of
the same plant and they were protected from other pollens for
about 1 week after pollination. In every DH lines, 50 flowers were
pollinated in early flower (in March). All other flowers or florets were
discarded and the indication of plant name was written on a tag.
SCI was determined again when plants were in the final-phase
flower (in April).
DNA extraction
According to the result of determination of SCI, tender leaves of low
SCI plants were taken for genomic deoxyribonucleic acid (DNA)
isolation according to a cetyl trimethylammonium bromide (CTAB)
procedure (Li and Quiros, 2001).
SRAP analysis
em9 GACTGCGTACGAATTCGA
em10 GACTGCGTACGAATTCAG
em11 GACTGCGTACGAATTCCA
In this assay, exceptional SRAP primers (me6-me8, em7-em11)
were designed except those mentioned in Li and Quiros’ paper. All
the primers were commercially synthesized (Sangon biological
engineering technology and service Co. LTD., Shanghai). A total of
88 different combinations were employed using eight forward
primers and 11 reverse primers (Table 1). Polymerase chain
reaction (PCR) amplification was according to the procedure of Li
and Quiros (2001).
Scoring and data analysis
The PCR products from SRAP analyses were scored qualitatively
for presence or absence of bands. Only clear and apparently
unambiguous bands were scored for SRAP. Genetic similarities
between the SI DH lines were measured by the Dice similarity
coefficient based on the proportion of shared alleles using ‘simqual’
sub-program of software NTSYS-PC version 1.8 (Exeter Software,
Setauket, NY, U.S.A.) software package (Rohlf, 1993). The
resultant distance matrix data was used to construct dendrograms
by using the un-weighted pair-group method with an arithmetic
average (UPGMA) subprogram of NTSYS-PC (Rohlf, 1993).
RESULTS
Self-compatibility indexes of broccoli DH lines tested
SCI of 124 broccoli DH lines were determined (Table 2).
Self-compatible (SC) broccoli DH lines existed, but most
of the broccoli DH lines were SI. Out of 124 broccoli DH
lines, SCI of 15 lines were greater than 1, that is selfcompatible,
and 105 lines SI. b08266, b08267, b08268,
b08269, four broccoli DH lines’ SCI s were different
hugely in the two SCIs tests. Out of 105 invariable
(Tables 2 and 3).

Table 2. SCI test of broccoli DH plants (2009).
DH line SCI 1 SCI2 DH lines SCI 1 SCI 2 DH lines SCI 1 SCI 2
2151-3 4.153 4.363 2214-8 1.206 1.206 b08247 0.26 0.568
2201 0.063 0.121 2220-3 0 0.962 b08248 0.137 0.238
2201D1 6.463 6.982 2236-2 0 0 b08249 0 -
2201D2 0.933 0.821 2237-1 0 - b08250 0 0.368
2203-1 0 0.325 2237-2 0.085 0 b08251 0.767 1.021
2204T 1.737 1.679 2239T 0 0.093 b08252 0.891 0.982
2205T 0.050 0.078 2241-3 0.024 0.368 b08253 0.071 0.282
2206-16 0 0.314 2242D1 0 0.326 b08254 0 0.291
2208-4 0 0.193 2243-5 0.172 0.031 b08256 1.686 1.922
2208-5 0 0.128 2244 0 0.561 b08257 0 0.016
2209-1 0.026 0.185 2245T2 0.046 0.096 b08258 0.902 1.215
2209-3 0.281 0.389 2246T 0 0.069 b08259 0.163 0.238
2209-4 0.023 0.153 2246T1 0.067 0.093 b08260 1.233 1.036
2209-8 0.022 0.182 2249T15 0.884 - b08261 0.102 0.625
2209-13 0 0.073 2249-7 0.419 0.327 b08262 0 0.021
2209-16 0.545 0.328 2249-8 0.053 0.517 b08263 0.291 0.395
2209-17 0.039 0.187 2249-9 0.5 0.980 b08264 0.455 0.827
2209-18 0 0.165 2249C2 0.082 0.098 b08265 0.469 0.768
2209-19 0 0.132 2253-6 0.022 0.089 b08266 0 7.333
2209-21 0.105 0.795 2256T - 2.048 b08267 0.021 3.846
2209-22
0 0.251 b08225 0 0 b08268 0 4.657
2209-26 0 0.194 b08227 0.351 0.533 b08269 0 7.062
2209-29 0.073 0.186 b08228 0.017 0.328 b08270 0.111 -
2209-30 1.509 1.752 b08229 - 0 b08271 0 0.322
2209-39 0.070 0.210 b08230 0 0.315 b08272 0.226 0.879
2209C4 0.585 0.671 b08231 0.186 0.685 b08273 2.125 2.675
2209T35 0 0 b08232 0 0.216 b08274 2.061 2.786
2209T36 0 0.055 b08233 0 - b08275 0.309 0.785
2209T37 0 0.925 b08234 0 0.158 b08276 0.948 1.258
2209T50 0.030 0.710 b08235 0 - b08277 0 0.051
2209D1 0.041 0.561 b08236 0 0.212 b08278 0 0.098
2209D2 0 0.398 b08237 0 0.125 b08279 1.804 1.672
2209D3 0.015 0.258 b08238 0.3 0.131 b08280 0 0.091
2209T1 0 0.026 b08239 0.049 0.145 b08281 0.069 0.162
2209T2 0 0.237 b08240 0.021 0.533 b08282 0.036 0.215
2209T3 0 0.094 b08241 0 0.516 b08284 0 0.319
2209T4 0 0.400 b08242 0.059 0.256 b08285 3.092 3.846
2214-1 0.870 0.658 b08243 0 0.312 b08286 0.266 0.266
2214-2 0.647 0.763 b08244 0.683 0.735 b08287 0.042 0.089
2214-3 1.146 1.753 b08245 0 - b08292 0.16 0.343
2214-5 0.018 0.087 b08246 0 0.257 b08302 0.016 0.108
2214-7 0.175 0.352
SCI 1, Self-compatibility index in early flower (in March); SCI 2, self-compatibility index in final-phase flower (in April).
Yu et al. 12564

12564 Afr. J. Biotechnol.
Table 3. Source of self-incompatible broccoli DH lines.
Number Name Donor/generation Origin (country)
01 2209-13 Li lv/ F4 Japan
02 2209T1 Li lv / F4 Japan
03 2209T37 Li lv / F4 Japan
04 2214-5 No. 19 / F3 China Taiwan
05 2246T No.172 / F1 Japan
06 2246T1 No.172 / F1 Japan
07 2249C2 No.116 / F1 Japan
08 b08287 Sheng lv/ F1 Japan
09 2253-6 No.10/ F1 Netherland
10 2237-2 Lv xiong 90 / F1 Japan
11 b08225 Man tuo lv/ F1 Netherland
12 2245T2 No.59/ F3 Unknown
13 2239T No.219/ F2 Unknown
14 b08257 No.64/ F1 Unknown
15 2236-2 No.64/ F1 Unknown
SRAP analysis of 15 broccoli strongly selfincompatible
DH lines
SRAP analysis revealed a large number of distinct,
scorable fragments per primer pair and in total, 129
bands, both polymorphic and monomorphic were
obtained using the 11 primer combinations in 15 broccoli
strongly SI DH lines (Tables 3 and 4). The number of
amplified fragments varied from eight to 17, with an
average of 11.7±3.07 bands (electromorphs) per primer
combination. Overall size of PCR amplified fragments
using five primer sets ranged from 50 to 700 bp. Out of
129 bands, 61 bands were polymorphic and thus, the
polymorphism percentage averaged to 47.3% across the
15 DH lines. Maximum number of polymorphic bands
was obtained for em1-me1 (AAT-ATA) primer combination.
Genetic diversity analysis
The results obtained by the Dice coefficient show that the
genetic similarity varied from 0.76 between DH line
2209T1 and 2249C2 (from varieties of different Japanese
company) to 0.98 between DH line 2209T1 and 2209T37
(both from the same variety). No region-specific markers
were found. The UPGMA analysis clustered 15 broccolis
SI DH lines into three main large groups; cluster A
comprising 10 DH lines, cluster B comprising three DH
lines and cluster C comprising two DH lines from different
country (Figure 1). The clustering of the DH lines based
on genetic similarity did not in general reflect their
geographic region of origin. Cluster A included three
subgroups. Subgroup 1 comprised 2209-13, 2209-T1 and
2209T37; all from one variety of a Japanese company.
Subgroup 2 comprised 2246T1, 2237-2, 2236-2, 2245T2,
2214-5 and 2253-6; the former two lines were both from
Japan, mid two lines were of unknown origin, and the
latter 2 lines were from China, Taiwan and Netherland
respectively. The two unknown origin lines 2236-2 and
2245T2 had high genetic similarity with 2246T1 from
Japan. Subgroup 3 only had 1 line (2246T) which had the
same origin as 2246T1 in subgroup 2.
Cluster B comprised 2239T, b08257 and 2249C2; the
former two lines had high genetic similarity (0.88) but
were from two different varieties which both had unknown
origin, and the last line was from Japan.
DISCUSSION
The result of SCI test revealed that most of the broccoli
DH lines were SI, and a few were SC, which is consistent
with the opinion of Branca (2008). Out of 124 broccoli DH
lines, four DH lines’ SCI were distinctly different and the
other DH lines’ SCI were not obviously different in the two
SCIs tests, which demonstrated that the SI of some
broccoli plants was affected by the environment such as
temperature and humidity.
Broccoli’s origin is Europe, and was introduced in
China in the 1980s. In China, broccoli varieties in
production are almost from foreign country such as
Japan, Netherland and France. Broccoli resource is lean
in China, so it is important to collect broccoli resource in
order to research broccoli and breeding. During collection
of broccoli resource, some broccoli materials were
unknown. SRAP was developed by Li and Quiros (2001),
which is aimed for the amplification of open reading
frames (ORFs). The polymorphism fundamentally

Table 4. Data on SRAP fragments and polymorphism obtained using 11 primer combinations in 15 broccoli DH lines.
Primer combination
Total number of
band
Number of
polymorphic
band
Number of monomorphic
band
Yu et al. 12565
Polymorphism
(%)
e1m1 14 10 4 71.4
e1m2 8 7 1 87.5
e1m3 11 8 2 72.7
e2m1 17 6 11 35.3
e2m4 9 7 2 77.8
e2m5 9 1 8 11.1
e3m5 11 4 7 36.4
e3m6 16 4 12 25
e8m8 14 3 11 21.4
e9m8 11 5 6 45.5
e10m8 9 6 3 66.7
Total 129 61 68
Mean 11.7±3.07 5.5±2.50 6.2± 3.92 47.3
Figure 1. Dendrogram of the 15 broccoli self-incompatible DH lines based on SRAP bands using UPGMA cluster
analysis.
originates from the variation of the length of introns,
promoters and spacers, both among individuals and
among species. In genetic diversity analysis, the
information given by SRAP markers was more
concordant to the morphological variability and to the
evolutionary history of the morphotypes than that of the

12566 Afr. J. Biotechnol.
amplified fragment length polymorphism (AFLP) markers
(Ferriol et al., 2003). In the SRAP analysis, the number of
amplified fragments varied from 8 to17, with an average
of 11.7±3.07 bands per primer combination, and the
polymorphism percentage averaged to 47.3% across all
the varieties. SRAP analysis was successful in detecting
genetic diversity and relationships between the broccoli
SI DH lines. A low level of genetic diversity was found in
the broccoli SI germplasm. In cluster analysis, 2209-13,
2209T1 and 2209T37, which were from Li lv F4 inbred
line, were highly similar (genetic similarity greater than
0.95). 2246T and 2246T1 from the same variety F1 were
less similar, and were clustered into two different groups.
That is to say, genetic background of donor decides
genetic relationship among donor’s DH lines; the more
miscellaneous genetic background of donor is, the more
complex genetic relationship among donor’s DH lines
are. Contrarily, the more simplex genetic background of
donor is, the lower genetic diversity among the donor’s
DH lines.
REFERENCES
Boyes DC, Nasrallah JB (1993). Physical linkage of the SLG and SRK
genes at the self-incompatibility locus of Brassica oleracea. Mol. Gen.
Genet. 236: 369-373.
Branca F(2008). Cauliflower and broccoli. In: J. Prohens and F. Nuez
(eds.), Vegetables I: Asteraceae, Brassicaceae, Chenopodiacea,.
Cucurbitace., Springer, New York. pp. 151-186.
Ferriol M, Picó B, Nuez F (2003). Genetic diversity of a germplasm
collection of Cucurbita pepo using SRAP and AFLP markers. Theor.
Appl. Genet. 107: 271-282.
King GJ (2003). Using molecular allelic variation to understand
domestication processes and conserve diversity in Brassica crops.
Acta Hortic. 598: 181-186.
Li G, Quiros CF (2001). Sequence-related amplified polymorphism
(SRAP), a new marker system based on a simple PCR reaction: its
application to mapping and gene tagging in Brassica. Theor. Appl.
Genet. 103: 455-461.
Rohlf FJ (1993). NTSYS-PC: Numerical taxonomy and multivariate
analysis system. Version 1.8, Exeter Software, Setauket, New York.
Samuel MA, Yee D, Haasen KE, Goring DR (2008). ‘Self’ pollen
rejection through the intersection of two cellular pathways in the
Brassicaceae: Self-incompatibility and the Compatible pollen
response. In “Self-Incompatibility in Flowering Plants – Evolution,
Diversity, and Mechanisms”, edited by V. Franklin-Tong, Springer-
Verlag Berlin Heidelberg. pp. 173-191.
Shiba H, Takayama S, Iwano M, Shimosato H, Funato M, Nakagawa T,
Che FS, Suzuki G, Watanabe M, Hinata K, Isogai A (2001). A pollen
coat protein, SP11 /SCR, determines the pollen S-specificity in the
self-incompatibility of Brassica species. Plant Physiol. 125(4): 2095 -
2103.
Silva NF, Stone SL, Christie LN, Sulaman W, Nazarian KP, Burentt LA,
Arnoldo MA, Rothstein SJ, Goring DR (2001). Expression of the S
receptor kinase in self-compatible Brassica napus cv. Westar leads to
the allele-specific rejection of self-incompatible Brassica napus
pollen. Mol. Genet. Genomics, 265: 552 - 559.
Takasaki T, Hatakeyama K, Suzuki G, Watanabe M, Isogai A, Hinata K
(2000). The S receptor kinase determines self-incompatibility in
Brassica stigma. Nature, 403: 913-916.

African Journal of Biotechnology Vol. 10(59), pp. 12567-12574, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1104
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Growth and nutrient uptake responses of ‘Seolhyang’
strawberry to various ratios of ammonium to nitrate
nitrogen in nutrient solution culture using inert media
Jong Myung Choi 1 *, Ahmed Latigui 2 and Chiwon W. Lee 3
1 Department of Horticulture, Chungnam National University, Daejeon 305-765, Korea.
2 Faculty of Agronomical and Veterinary Science, University of IBN Khaldoun, Tiaret, Algeria.
3 Department of Plant Sciences, North Dakota State University, Fargo, ND 58108, USA.
Accepted 21 July, 2011
The effect of the variation of NH4 + :NO3 − ratios (meq/l: 0:100, 40:60, 50:50, 65:35 and 100:0) in the nutrient
solution on strawberry (Fragaria × ananassa var Seolhyang) growth was evaluated. A mixture of large
particle size (2 to 5 mm) and small particle size (smaller than 1 mm) of perlite was used as growing
substrate and the nutrient solutions were applied once a week to the root substrate. The growth
responses were determined 120 days after transplanting. The use of NO3 − as the sole source of nitrogen
in the nutrient solution resulted in the highest vegetative growth among the treatments tested. On the
contrary, the exclusive use of NH4 + in the nutrient solution suppressed plant growth severely. The initial
symptoms of ammonium toxicity appeared on the lower leaves, with the curling down of the old leaves.
The margins turned brown and finally died. The introduction of the two nitrogen forms as the treatment
ratio 60:40 (NH4
+ :NO3
− ) resulted in the optimal growth performance and nutrient uptake of this variety.
The rate K/Ca+Mg=0.57, which was close to the best rate 0.67, allowed the optimal uptake of all
nutrients. The data of the growth characteristics, nutrient content and electrical conductivity (EC) and
pH were subjected to a polynomial regression analysis. The results show a high correlation between
these data and the variation of NH4 + :NO3 − ratios. The values of the fresh and dry weight and N content of
above-ground plant tissue to this variation were linear, with R 2 coefficients of 0.95***, 0.94**, and 0.71*.
The changes in the NO3 − concentration in the petiole sap, EC and pH of the root substrate were
quadratic, with a coefficients of R 2 = 0.99***, 0.98***, and 0.73*.
Key words: Growth characteristics, NH4 + : NO3 − ratios, nutrient content, strawberry.
INTRODUCTION
Since the breeding of the ‘Seolhyang’ strawberry
(Fragaria × ananassa Duch.) by crossing the Akihime (M)
and the Read Pearl (F) (Kim et al., 2004) varieties in
Korea, the cultivation area of this variety has grown rapidly.
The area covered by the new variety is estimated to
be more than 60% of the total strawberry cultivation area
(6,800 ha) in Korea (unpublished data). The strong points
of this variety are vigorous growth habits and very high
*Corresponding author. E-mail: choi1324@cnu.ac.kr. Tel: +82-
42-821-5736.
productivity.
The ‘Seolhyang’ strawberry has unique nutrient uptake
characteristics compared to the other varieties. Regarding
soil cultivation in a green house, the pH in the root
rhizosphere drops to 4.6 for this variety, whereas in other
varieties it is maintained at around 6, when analyzed 5
weeks after transplanting (unpublished data). This situation
can be improved by adjusting the NH4 + :NO3 − ratios of
the total N supplied through nutrient solution; this ratio
can serve as the main tool to balance the total cation-toanion
uptake ratio and maintain the pH within the desired
range (Babiker et al., 2004; Paz and Ramos, 2004).
The form of the N source has been shown to influence

12568 Afr. J. Biotechnol.
the growth, yield, fruit quality, and chemical composition
of the plant tissue in strawberries and other plants
(Kotsiras et al., 2002; Tabatabaei et al., 2006), as crops
are very sensitive to various ratios of NH4 + : NO3 − in the
nutrient solution (Sonneveld, 2002). According to Guo et
al. (2002) and Bruck and Guo (2006), different NH4 + :NO3 −
ratios can affect the rate of plant growth as well as the
biomass allocation. Inappropriate levels result in
phytotoxicity and impair the product quality and quantity
(Tabatabei et al., 2007; Ingestad, 2006). When NH4 + is
the sole N source, plants can develop symptoms of
toxicity and root growth can be severely impaired (Lasa et
al., 2001). Moreover, according to Britto and Kronzucker,
(2002), the NH4 + as the unique source of N usually has
deleterious effects on plant growth and can result in
toxicity symptoms in many plants. In contrast, plant root
−
growth is only slightly affected when NO3 is the sole N
source (Ruan et al., 2007). Because the NH4 + :NO3 − ratios
during fertilization affect the rhizosphere pH and nutrient
uptake as mentioned above, the best ratios of the two
nitrogen sources should be determined for the cultivation
of the ‘Seolhyang’ strawberry. This ratio can differ
depending on the physiological stage in a single variety
(Marschner, 1995). However, strawberries have several
overlapping stages in a single floral stalk for a periodical
distribution of physiological stages (Choi and Latigui,
2008; Risser and Navatel 1997). This makes the
determination of the best ratios to meet all physiological
stages difficult.
For this purpose, and to improve strawberry fertilization,
we compared solutions containing two sources of
+ −
nitrogen, NH4 and NO3 , under the proportions of 40:60,
50:50, 65:35, 100:0 and 0:100, respectively. Britto and
Kronzucker (2002) showed that the contribution of both
ammonium and nitrate to culture medium improves the
strength and reduces leaf chlorosis. Marschner (1995)
showed that 80% NO3 − and 20% NH4 + ensures in most
cases, the best possible balance.
The objective of this study was to determine the effect
of several ratios of NH4 + :NO3 − in the nutrient solutions on
the growth and development of the ‘Seolhyang’ strawberry
in growth stage prior to flowering. Then, according
to the results, we improve these solutions for better
absorption of all nutrients through the introduction of a
new ionic equilibrium value.
MATERIALS AND METHODS
Treatment solutions
Hoagland solution (Hoagland and Arnon, 1950) was modified in order
to make three treatment solutions containing different NH4 + to NO3 −
ratios: 40:60, 50:50 and 65:35 (Table 1). The ionic balances of
macro cations (K + , Ca 2+ and Mg 2+ ) were similar according to the
ratio K + / (Ca 2+ + Mg 2+ ) = 0.57. Treatments with 0:100 and 100:0 as
the ratios for NH4 + :NO3 − were used to determine the impact of the
two exclusive nitrogen forms on toxicity development and plant
growth. H2PO4 − was used instead of HPO4 2− in the 0:100 treatments
(Table 1) to adjust ionic balance of macro cations because KH2PO4
contains less K compared to K2HPO4. This treatment solution was
composed of 6 meq/l of K (Table 1), which is the highest
concentration among all treatments tested.
The increase of SO4 2− (Table 1) from 2 to 7 meq/l was due to the
use of (NH4)2SO4 to increase the concentration of NH4 + required for
the 100:0 treatment. The variation from 6 to 8 meq/l in Cl − concentration
for the 40:60, 50:50 and 63:35 treatments was due to the
use of KCl instead of KNO3 and KSO4. The variations in the ratio of
K/N from 0.21 to 0.60 and the sum of ion value from 13 to 21 meq/l
were necessary due to the quantitative variations of the total
nitrogen in the treatment solutions.
The five treatment solutions contained equal amount of six micronutrients
(mg/l): MnCl2·4H2O, 1.81; H3BO3, 2.86; ZnSO4·7H2O, 0.22;
CuSO4·5H2O, 0.08; H2MoO4·H2O, 0.09; and Na2FeEDTA, 0.79. The
pH levels of all solutions were adjusted to 6.0. There were four
replicates for each treatment with 2 plants per replicate.
Plants and experimental design
The experiments were carried out in the controlled environment of a
glasshouse, located in Daejeon (36° 20' N, 127° 26' E), Korea. The
mean day and night temperatures inside the glasshouse were 24
and 15°C, respectively, during the experimental period. The relative
humidity was 60 to 70% and the average photoperiod was 15 h with
a photosynthetic photon flux density of 330 to 370 µmol/m 2 /s 1 .
Plug-grown ‘Seolhyang’ strawberry seedlings at the three trueleaf
stage were planted into plastic pots with an internal diameter of
15 cm and a volume of 1600 ml of a 1:1 mixture of coarse (2 to 5
mm) and fine (smaller than 1 mm in diameter) perlite.
The plants were irrigated with distilled water for the first 45 days
after planting to decrease the tissue nutrient levels and the older
leaves were removed, leaving only 3 newly formed leaves per plant
as the baseline measure. The plants were then fertilized with the
NH4 + /NO3 − treatment solutions once a week. Between the weekly
applications of the fertilizer solution, the plants were irrigated with
distilled water. During each fertilization or irrigation, the leaching
percentage was controlled at 30 to 40% to avoid salt accumulation
in the root media (Muñoz et al., 2008).
The crop growth as influenced by the treatment solutions was
checked 120 days after planting, by measuring the number of
leaves, leaf length and width, petiole length, crown diameter, and
fresh and dry weights. The procedure to determine the crop growth
followed the methods described by Choi et al. (2000).
Petioles of fully grown young leaves were also collected, 120
days after planting, and cut into 1 mm long segments for analysis.
Samples were put into vial, with distilled water (1:10, w/w). Vials
were occasionally shaken for 30 min by hand to allow the
electrolytes to leak out from the petiole sections. After filtering with a
Whatman No. 2 filter paper, the solutions were used for NO3 − -N
analysis following the procedures of Cataldo et al. (1975).
Statistical analysis
Data from the growth measurements, tissue analyses, soil solution
pH and electrical conductivity (EC) were subjected to a randomized
complete block analysis of variance. The treatment means were
separated via a LSD test. Data were also subjected to a polynomial
regression analysis using the CoStat program (CoHort Software
version 6.3, Monterey, CA).

Choi et al. 12569
Table 1. Composition of the nutrient solutions used to check for the effect of NH4:NO3 ratios on the growth and nutrient uptake of the
‘Seolhyang’ strawberry z .
NH4:NO3 ratio
NH4 +
(meq/l)
NO3 -
(meq/l)
K +
(meq/l)
Ca 2+
(meq/l)
Mg 2+
(meq/l)
SO4 2-
(meq/l)
HPO4
(meq/l)
H2PO4 -
(meq/l)
Cl -
(meq/l)
0:100 0 10 6 5 2 2 0 1 0
40:60 4 6 4 5 2 2 1 0 6
50:50 7.5 7.5 4 5 2 2 1 0 8
65:35 7.5 4 4 5 2 5.5 1 0 8
100:0 11.5 0 2.5 5 2 7 1 0 13
z Micronutrients (mg/l solution): MnCl2·4 H2O, 1.81; H3BO3, 2.86; ZnSO4·7H2O, 0.22; CuSO4·5H2O, 0.08; H2MoO4·H2O, 0.09; and Na2
FeEDTA, 0.79.
RESULTS AND DISCUSSION
Effect on growth characteristics
Except for the leaf numbers, all growth characteristics of
the ‘Seolhyang’ strawberry, 120 days after planting were
significantly influenced by various NH4 + :NO3 − ratios in the
nutrient solution (Table 2 and Figure 3). However, no
significant differences in the number of leaves were
noticed in all treatments. Nevertheless, the unique
+ +
contributions of the 11.5 meq/l of NH4 in 100:0 (NH4 :
NO3 − ) treatment (Table 2) resulted in a decrease of the
leaf length, leaf width, and petiole length. In contrast, the
crown diameter was significantly larger in this treatment.
Fresh and dry weights were also the lowest in 100:0
+ −
(NH4 : NO3 ) treatment. These results are in agreement
with those of Fallovo et al. (2009), who found that the
exclusive use of NH4 reduced the fresh and dry mass of
the shoot by 70 and 50%, respectively. The edges
(Figure 1) of the young leaves became dull green, wilted
and curled backwards, and the older leaves were desiccated
and scorched while the petioles remained green.
Claussen and Lenz (1999) and Rothstein and Cregg
(2005) argued that the accumulation of NH4 + in the leaves
can cause uncoupling of the electron transport due to
photophosphorylation in the chloroplasts, resulting in a
decreased of the photosynthetic rate. Chaillou et al.
(1986) showed that a strict ammonium diet leads to the
falling of rhizosphere pH due to the root excretion of H +
ions. At low external pH, net excretion of protons is
impaired and cytosolic pH may also fall, explaining the
relationship between growth retardation and pH decline in
ammonium fed plants (Marschner, 1995). These results
show that NH4 + has unique contributions that are
negative for crop growth.
−
In contrast, when NO3 was the sole source of N
+ −
(0:100, NH4 : NO3 ), the treatment (Table 2) resulted in
an increase in the leaf width and petiole length and also
resulted in the highest fresh and dry weights. The growth
in terms of dry weight decreased lineally as the NH4
ratios in nutrient solution were elevated (Figure 2). These
results are supported by another study of Choi et al.
(2008). However, Sasseville and Mills (1979) found that a
lower weight of 8.6 g per plant was obtained with a ratio
of 0:100. The NO3 − -N concentration in the petiole sap is
also greater with the 0:100 treatments with lineally
+ −
decreasing tendency as the ratios of NH4 :NO3 in the
nutrient solution were elevated. But the no trend was
+
observed in NH4 -N concentration.
In addition, it is evident, that the contribution of NO3 −
(0:100) resulted in the largest leaf development (Figure 1)
compared to those in other treatments. As it can be
verified in the same figure, a ratio of 40% NH4 + and 60%
−
of NO3 resulted in balanced growth of the leaves as well
as the largest leaf area (Table 2). This ratio promotes the
development of fruit as well as runners because sole
-
source of NO3 in fertilizer solution results in vegetative
growth as indicated by Sharma et al. (2006). According to
+ −
Marschner (1995), adjusting the NH4 :NO3 ratio of the
total N supplied can serve as the main tool to balance the
total cation-to-anion uptake ratio, appearing to be
beneficial to the plant (Sonneveld, 2002).
When a ratio of 40% of NH4 and 60% of NO3 − was
used, it resulted in an increased of the leaf length, leaf
width, petiole length (Table 2), and leading to the highest
fresh weight. Compared to other treatments, 40:60
(NH4 + :NO3 − ) resulted in the best growth performance of
this variety.
Effect on the nutrient content
Except for the Mn and total N contents (Table 3), the
analysis of variance showed highly significant effects of
various NH4 + :NO3 − ratios on the nutrient content based on
the dry weight of the above-ground tissue. It was also
verified that the ratios of 35:65 and 100:0 (NH4
+ −
:NO3 )
resulted in the higher percentage of T-N than 0:100
treatment. These are different to the results of Tabatabei
et al. (2006) who found that the highest tissue content of
+ −
T-N was observed at 25:75 and 50:50 (NH4 : NO3 ) in a
strawberry solution.

12570 Afr. J. Biotechnol.
Table 2. Influence of various NH4 to NO3 ratios in the nutrient solution on the growth characteristics of ‘Seolhyang’ strawberry, 120 days after transplanting.
NH4:NO3
ratio
Number of leaves
(per plant)
Leaf length
(cm)
Leaf width
(cm)
Petiole length
(cm)
Crown diameter
(cm)
Fresh weight
(g/plant)
Dry weight
(g/plant)
0:100 28.5 az 7.48 ab 5.43 a 12.50 a 1.08 b 16.7 a 4.51 a
40:60 26.0 a 7.98 a 5.38 a 11.60 a 0.98 b 15.9 a 3.62 b
50:50 24.5 a 7.53 ab 5.38 a 11.13 a 0.97 b 13.8 ab 3.30 bc
65:35 28.0 a 6.70 bc 4.90 ab 9.08 b 1.09 b 11.1 bc 2.55 cd
100:0 23.5 a 6.11 c 4.20 b 8.23 b 1.28 a 8.6 c 2.12 d
Linear NS * * ** * *** ***
Quadratic NS NS * ** *** *** ***
z Mean separation by Duncan’s multiple range test at P ≤ 0.05. Values followed by the same letter within columns are not significantly different.
NS,*,**,***Non-significant or significant at P ≤ 0.05, 0.01 and 0.001, respectively.
Table 3. Influence of various NH4 to NO3 ratios in the fertilizer solution on the nutrient content based on the dry weight of the above-ground tissue of ‘Seolhyang’ strawberry, 120 days
after transplanting.
NH4:NO3 Ratio T-N (%) P (%) K (%) Ca (%) Mg (%) Na (%) Fe (mg/kg) Mn (mg/kg) Zn (mg/kg) Cu (mg/kg)
0:100 1.32 bz 0.66 b 2.69 a 1.87 a 0.71 a 0.07 b 205.2 b 105.2 a 48.4 b 12.1 b
40:60 1.45 ab 0.75 a 2.13 b 1.37 c 0.65 ab 0.07 b 302.0 a 93.8 ab 60.7 b 14.4 ab
50:50 1.46 ab 0.75 a 2.35 b 1.33 c 0.63 ab 0.07 b 291. 7 a 81.1 b 46.1 b 14.4 ab
35:65 1.59 a 0.75 a 2.39 b 1.39 c 0.55 c 0.08 b 285.1 a 96.5 a 73.6 b 16.3 a
100:0 1.54 a 0.73 a 1.75 c 1.59 b 0.59 bc 0.14 a 301.9 a 94.6 ab 184.4 a 13.9 ab
Linear ** NS ** NS ** ** * NS ** NS
Quadratic ** * * *** ** *** * NS ** *
z Mean separation by Duncan’s multiple range test at P ≤ 0.05. Values followed by the same letter within columns are not significantly different.
NS ,*,**,***Non-significant or significant at P ≤ 0.05, 0.01 and 0.001, respectively.
+ −
The response to the varied NH4 :NO3 ratios on
the N content of above-ground tissue (Figure 2)
was linear, as expressed as y=1.3546+0.0023x
(R 2 −
=0.7193***). The NO3 concentration in the petiole
sap (Figure 4) had a determination coefficient
of R 2 = 0.99***. The judgment of nutritional status
of crops through the NO3-N concentrations in
petiole sap is an easier way than those conventional
method in which total nitrogen contents of
above ground tissue is analysed. But there are no
comparable data related to NO3-N concentrations
in petiole sap. In case of T-N in above ground
tissue, Sharma et al. (2006) showed that a 3.5%
of T-N (in dry weight basis) is necessary to obtain
a normal fruit. According to their findings,
additional nitrogen is needed in the solution for all
the treatments of our research.
The lowest tissue phosphorus content was
obtained when the rate was 0:100, this result
being significantly lower than the ones for all the
other treatments. The greatest contents were
0.75% for 40:60, 50:50 and 65:35 and 0.73% for
100:0, these results were not significantly different
though (Table 3). Results obtained for P in this
experiment are supported by the ones of Abbes et
al. (1995) and Leikam et al. (1983), who worked
+
with Allium cepa. The presence of NH4 in the

Figure 1. Differences in crop growth (upper) and ammonium toxicity (lower) of the
‘Seolhyang’ strawberry at 120 days after transplanting as influenced by various NH4:NO3 in
the fertilizer solution.
Figure 2. Influence of various NH4 to NO3 ratios in the fertilizer solutions on changes in
the dry weight and N content of above-ground part of the ‘Seolhyang’ strawberry, 120
days after transplanting.
Choi et al. 12571

12572 Afr. J. Biotechnol.
Figure 3. Influence of various NH4 to NO3 ratios in fertilizer solutions on fresh weight of aboveground
plant tissue, NO3-N and NH4-N concentrations in the petiole sap of the ‘Seolhyang’
strawberry, 120 days after transplanting. The curve in the NH4-N concentration was not significant
as regards linear or quadratic fitting.
Figure 4. Effect of various NH4 to NO3 ratios in fertilizer solutions on changes in pH and
EC of the soil solutions of root media, 120 days after transplanting of the ‘Seolhyang’
strawberry.

solution resulted in the highest phosphorus content,
based on the dry weight of above-ground tissue.
However, the ratio of 0:100 resulted in the highest
tissue K content (Table 3). Values for 40:60, 50.50 and
65.35 were, respectively 2.13, 2.35 and 2.37%, these
results being significantly lower than the ones for the ratio
0:100. The ratio 100:0 showed the lowest content.
The ratio 0:100 resulted in the highest Ca 2+ content
(Table 3). This value was followed by the one obtained for
ratio 100:0, the lowest contents being obtained with
40:60, 50.50 and 65:35, with rates of 1.37, 1.33 and
1.39%, respectively; nevertheless, all these values were
significantly lower than the ones for 0:100. The highest
rate of Mg 2+ , 0.71%, was obtained with 0:100, followed by
the ones for 40:60 and 50:50, respectively, with values of
0.65 and 0.63%, respectively. The lowest content of
0.55% was obtained with the ratio 65:35, but this value
was statistically lower than all the others. In addition, the
− +
presence of NO3 alone or mixed with NH4 gave the
largest contents of K + , Ca 2+ and Mg 2+ . Alan (1989) and
Kotsiras et al. (2002) showed that the presence of a high
+
concentration of NH4 in a nutrient solution induced a
decrease of these elements in the tissue contents, while
−
NO3 had the opposite effect.
No sodium fertilizer was used in the experiment.
However, the presence of Na was detected in all treatments.
The highest rate of 0.14% was obtained with the
ratio of 100:0. This was clearly due to the high storage
capacity of this strawberry variety during the 120 day
experimental period. Earlier, the plants had been in a
nursery, with all of the elements they needed.
Regarding the micronutrients, it can be noted that the
lowest and significantly different Fe content was obtained
with 0:100, in contrast to the ratios 40:60, 50:50, 65:35
and 100:0, where no significant differences were noted.
The highest contents of Zn and Cu were obtained with
the ratios 100:0 and 65:35, respectively.
Effect on EC and pH
Electrical conductivity (EC) (Figure 4) increases from 1.2
dS/m with 0:100 to 2.0 dS/m with 100:0. This is why the
elevation of NH4 ratios in nutrient solution requires the
increase in concentration of counter ion such as SO4 -2 in
(NH4)2SO4 (Table 1) and the solution EC for 100:0 was
higher than those of 0:100 treatment (NH4 + :NO3 - ) when
crops were irrigated. However, this range has no negative
effect on the growth of strawberries. According to Skiredj
(2005), the standard parameter for EC is between 1.5
and 2.5 dS/m, which is in accordance with the results
obtained in this study.
+
The pH decreased as NH4 ratios in the fertilizer
solution were elevated ranging between 5 and 6. This
reduction is caused by the release of H + when plant roots
absorb NH4 + (Marschner 1995). Nonetheless, the ratio of
Choi et al. 12573
0:100 resulted in a relatively high pH 7, due to the
consumption of NO3, despite the addition of 0.8 meq/l
HNO3 (d = 1.33, 38° B), which had reduced the initial pH
of 6 to 5.5 (Figure 4), a condition necessary for the
uptake of all micronutrients. According to Latigui (1992),
this reduction may decrease the concentration of HCO3 −
presented in the nutrient solutions, as it increases the
root rhizosphere pH during crop cultivation. According to
Marschner (1995) adjusting the NO3 − :NH4 + ratio from the
total N maintains the pH within the desired range.
Conclusion
According to the plant growth results obtained in this
study, we conclude that the NH4 + : NO3 − ratio of 40:60 is
relatively less stringent (Latigui, 1992). However, this
required some corrections. Initially, it was composed of
(meq/l): 4 K + , 5 Ca 2+ , 2 Mg 2+ , 4 NH4 + , 6 NO3 − , 10 (NH4 + +
− 2− 2− −
NO3 ), 2 SO4 , 1 HPO4 , and 6 Cl with the characterristics
of pH 6, EC=1.460 dS·m -1 , K/ (Ca +Mg) = 0.57 and
∑cations = ∑anions = 15 meq/l. For this composition, we
used the fertilizers KNO3, K2HPO4, KCl, Ca(NO3)2,
MgSO4 and NH4Cl. To improve this solution based on the
results and literature findings, we have to reduce the
concentration of NH4 + from 4 to 3.55 meq/l using the
NH4NO3 fertilizer instead of NH4Cl. This arrangement
also allowed us to reduce the concentration of Cl − , which
unnecessarily increased the salinity of the substrate.
Other changes in the levels of K + and Ca 2+ allowed
K + /(Ca 2+ + Mg 2+ ) to be equal to 0.72, which is ideal as
regards the ionic balance at this stage of development for
2−
strawberries. The mono and biphosphate HPO4 and
H2PO4 − have the same roles but vary in proportion
according to the pH in a normal substrate. The use of
H2PO4 − would be more beneficial, as this ion predominates
in acidic substrates such as that in the solution
NH4 + : NO3 − at a ratio of 40:60 with a pH of approximately
5.5, which is necessary to avoid any precipitation of
elements.
Depending on the results of this study, the new
developed solution consisted of (meq/l): 5.15 K + , 5.15
Ca 2+ , 2 Mg 2+ , 3.55 NH4 + , 0.8 H + , 10.65 NO3 − , 14.20
(NH4 + + NO3 − ), 2 SO4 2− , 2 HPO4 2− , 2 Cl − with the
characteristics pH 5.5, EC =1.620 dS/m, K/ (Ca +Mg)
=0.72, ∑cations = ∑anions=16.65 meq/l. Therefore, after
the results obtained, the solution was optimized as (in
meq/l): 1.5 KNO3, 2 K2HPO4, 2 KCl, 5.5 Ca(NO3)2, 2
MgSO4, 3.55 NH4NO3 and 0.8 HNO3 (d=1.33, 33°B) and
(in µM/l): 20 B, 0.5 Cu, 20 Fe, 10 Mn, 0.5 Mo, 4 Zn.
+ −
The exclusive use of NH4 or NO3 in the solution is not
recommended as an optimal plant requirement.
ACKNOWLEDGEMENT
This work was carried out with the support of

12574 Afr. J. Biotechnol.
"Cooperative Research Program for Agriculture Science
and Technology Development (Project
No. PJ0066752010 )" Rural Development Administration.
REFERENCES
Abbes C, Parent LE, Karam A, Isfan D (1995). Effect of NH4 + −
:NO3 ratios
on growth and nitrogen uptake by onions. Plant Soil, 171: 289-296.
Alan C (1989). The effect of nitrogen nutrition on growth, chemical
composition and response of cucumber Cucumis sativius L. to
nitrogen forms in solution culture. J. Hortic. Sci., 64: 467–474.
Babiker AA, Mohamed H, Terao K, Ohta K (2004). Assessment of
groundwater contamination by nitrate leaching from intensive
vegetable cultivation using geographical information system. Environ.
Intl. 29: 1009-1017.
Britto DT, Kronzucker HJ (2002). NH4 + toxicity in higher plants: a critical
review. Plant Physiol. 159:567–584.
Bruck H, Guo SW (2006). Influence of N form on growth and
photosynthesis of Phaseolus vulgaris L. Plant Nutr. Soil Sci., 169:
849–856.
Cataldo DA, Haren M, Shrader LE, Young VL (1975). Rapid colorimetric
determination of nitrate in plant tissue by nitration salicylic acid.
Commun. Soil Sci. Plant Anal., 6: p. 71.
Chaillou S, Morot-Gaudry JF, Salsac L, Lesaint C, Jolivet E (1986).
− +
Compared effects of NO3 and NH4 on growth and metabolism of
French bean. Physiol. Vég,. 24: 679-687.
Choi JM, Jeong SK, Cha KH, Chung HJ, Seo KS (2000). Deficiency
symptom, growth characteristics, and nutrient uptake of ‘Nyoho’
strawberry as affected by controlled nitrogen concentration in fertilizer
solution. J. Kor. Soc. Hortic. Sci., 41: 339-344.
+ −
Choi JM, Jeong SK, Ko KD (2008). Influence of NH4 :NO3 ratios in
fertigation solution on appearance of ammonium toxicity, growth and
nutrient uptake of 'Maehyang' strawberry (Fragaria x ananassa
Buch.). Kor. J. Hortic. Sci. Technol., 26: 223-229.
Choi JM, Latigui A (2008). Effect of various Mg concentrations on the
quantity of chlorophyll of 4 varieties of strawberry (Fragaria ananassa
D) cultivated in inert media. J. Agron., 7: 244-25.
Claussen W, Lenz F (1999). Effect of ammonium or nitrate nutrition on
net photosynthesis, growth, and activity of the enzymes reductase
and glutamine synthetase in blueberry, raspberry and strawberry.
Plant Soil, 208: 95–102.
Fallovo C, Colla G, Schreiner M, Krumbein A, Schwarz D (2009). Effect
of nitrogen form and radiation on growth and mineral concentration of
two Brassica species. Sci. Hortic., 123: 170-177.
Guo S, Bruck H, Sattelmacher B (2002). Effects of supplied nitrogen
form on growth and water uptake of French bean (Phaseolus vulgaris
L.) plants. Plant Soil, 239: 267–275.
Hoagland DR, Arnon DI (1950). The water culture method for growing
plants without soil. Univ. Calif. Agri. Exp. Sta. Circular 347.
Ingenbleek Y (2006). The nutritional relationship linking sulfur to
nitrogen in living organisms. J. Nutr. 136: 1641-1651.
Ingestad T (2006). Nitrogen and cation nutrition of three ecologically
different plant species. Physiol. Plant, 38: 29–34.
Kim TI, Jang WS, Choi JH, Nam MH, Kim WS, Lee SS (2004). Breeding
of ‘Maehang’ strawberry for culture. Kor. J. Hort. Sci. Technol., 22:
434-437.
Kotsiras C, Olympios M, Drosopoulos J, Passam HC (2002). Effect of
nitrogen form and concentration on the distribution of ions within
cucumber fruit. J. Am. Soc. Hortic. Sci., 95: 175–183.
Lasa B, Frechilla S, Lamsfus C, Aparicio-Tejo PM (2001). The sensitivity
to ammonium nutrition is related to nitrogen accumulation. Sci.
Hortic., 91: 143–152.
Latigui A (1992). Effect of different fertilizations of the eggplant and
tomatoes grown in inert media on the biotic potential of Macrosiphum
euphorbiae PhD Diss., Univ. Aix Marseille III, France.
Leikam DF, Murphy LS, Kissel DE, Whitney DA, Mserh HC (1983).
Effect of nitrogen and phosphorus application and nitrogen source in
winter wheat grand yield and leaf tissue phosphorus. Soil. Sci. Soc.
Am. J. ,47: 530-535.
Marschner H (1995). Mineral nutrition of higher plants. 2nd ed.
Academic Press Inc. San Diego, CA.
Muñoz P, Antón A, Paranjpe A, Ariño J, Montero JI (2008). High
decrease in nitrate leaching by lower N input without reducing
greenhouse tomato yield. Agron. Sustainb. Dev., 28: 489-495.
Paz D, Ramos C (2004). Simulation of nitrate leaching for different
nitrogen fertilization rates in a region of Valencia (Spain) using a GIA.
Gleams System Agric. Ecosyst. Environ. 103: 59-73.
Risser G, Navatel JC (1997). Monographie: la fraise plants et varieties.
CTIFL France p. 103.
Rothstein DE, Cregg BM (2005). Effects of nitrogen form on nutrient
uptake and physiology of Fraser fir (Abies fraseri). For. Ecol.
Manage., 219: 69–80.
Ruan JY, Gerendas J, Hardter R, Sattelmacher B (2007). Effect of
nitrogen form and root-zone pH on growth and nitrogen uptake of tea
(Camellia sinensis) plants. Ann. Bot. 99: 301–310.
Sasseville DN, Mills HA (1979). N form and concentration: effect on N
absorption, growth, and total N accumulation with southern peas. J.
Am. Soc. Hortic. Sci., 104:586–591.
Sharma V, Patel B, Krichna H (2006). Relationship between light, fruit
and leaf mineral content with albinism incidence in strawberry
(Fragaria x ananassa Duch.) Sci. Hortic., 109: 66-70.
Skiredj A (2005). Fertigation of vegetable crops: General and calculation
of nutrient solutions. Dept. of Hort./IAV Hassan II/Rabat-Morocco.
Sonneveld C (2002). Composition of nutrient solutions. In: Savvas D,
Passam HC (eds). Hydroponic production of vegetables and
ornamentals. Embryo Publications, Athens, Greece, pp. 179–210.
Tabatabaei SJ, Fatemi L, Fallahi E (2006). Effect of ammonium: nitrate
ratio on yield, calcium concentration, and photosynthesis rate in
strawberry, J. Plant Nutr., 29: 1273–1285.
Tabatabei SJ, Yusefi M, Hajiloo J (2007). Effect of shading and
− +
NO3 :NH4 ratio on the yield, quality and N metabolism in strawberry
Sci. Hortic., 116: 264-272.
Vessey JK, Henry LT, Chaillou S, Raper CD (1990). Root-zone acidity
affects relative uptake of nitrate and ammonium from mixed nitrogen
sources. J. Plant Nutr., 13: 95- 116.

African Journal of Biotechnology Vol. 10(59), pp. 12575-12583, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1118
ISSN 1684-5315 © 2011 Academic Journals
Full Length Research Paper
Yield and fiber quality properties of cotton (Gossypium
hirsutum L.) under water stress and non-stress
conditions
Cetin Karademir*, Emine Karademir, Remzi Ekinci and Kudret Berekatoğlu
Southeastern Anatolia Agricultural Research Institute, 21110, Diyarbakir, Turkey.
Accepted 13 July, 2011
The primary objective of this study was to determine the effect of water stress and non-stress
conditions on cotton yield and fiber quality properties. A two-year field study was carried out at the
Southeastern Anatolia Agricultural Research Institute (SAARI), in 2009 and 2010, with the aim of
evaluating 12 cotton genotypes for yield and fiber quality properties under irrigated and water stress
conditions. The experiment was laid out as a randomized split block design (RSBD) with four
replications. Significant differences were observed among genotypes and water treatments for seed
cotton yield, fiber yield, ginning percentage and all fiber quality properties except fiber uniformity. Yield
differences among genotypes under water stress and non-stress conditions were higher during the first
season. In both years, SER-18 and Stoneville 468 cotton genotypes produced higher yield under water
stress conditions, while Stoneville 468 produced higher yield under well-irrigated conditions. The
results during the two years indicated that seed cotton yield decreased (48.04%) and fiber yield
decreased (49.41%), due to water stress. Ginning percentage and fiber quality properties were also
negatively affected by water stress treatment. Fiber length, fiber strength, fiber fineness and fiber
elongation were decreased, while fiber uniformity was not affected by water stress treatment.
Key words: Cotton, yield, fiber quality properties, water stress, non-stress.
INTRODUCTION
Water stress is the most important factor limiting crop
productivity and adversely affects fruit production, square
and boll shedding, lint yield and fiber quality properties in
cotton (El-Zik and Thaxton, 1989). As the global climate
changes continue, water shortage and drought have
become an increasingly serious constraint limiting crop
production worldwide.
The demand for drought tolerant genotypes will be
exacerbated as water resources and the funds to access
them become more limited (Longenberger et al., 2006).
Previous studies revealed that 2 to 4°C increase in
temperature and the expected 30% decrease in precipitation
may adversely affect crop productivity and
water availability by the year 2050 (Ben-Asher et al.,
2007). Thus, screening cotton varieties for resistance to
*Corresponding author. E-mail: cetin_karademir@hotmail.com.
drought stress conditions and improving cotton tolerance
to this stress conditions will mitigate negative consequences
of this adversity. Cotton is normally not
classified as a drought tolerant crop as some other plants
species such as sorghum which is cultivated in areas
normally too hot and dry to grow other crops (Poehlman,
1986). Nevertheless, cotton has mechanisms that make it
well adapted to semi-arid regions (Malik et al., 2006). An
understanding of the response of cultivars to water
deficits is also important to model cotton growth and
estimate irrigation needs (Pace et al., 1999). Previous
studies reported variation in drought resistance among
and within species (Penna et al., 1998). Cotton lint yield
is generally reduced because of reduced boll production,
primarily because of fewer flowers and also because of
increased boll abortions when the stress is extreme and
when it occurs during reproductive growth (Grimes and
Yamada, 1982; McMichael and Hesketh, 1982; Turner et
al., 1986; Gerik et al., 1996; Pettigrew, 2004a; Pettigrew,
2004b). Cook and El-Zik (1992) revealed significant

12576 Afr. J. Biotechnol.
differences between genotypes for seedling and firstbloom
plant measurements, with Tamcot CD3H and TX-
CABUCS-2-1-83 having higher levels of seedling vigor,
more rapid root system establishment and lower root-toshoot
ratio. Similar results were also reported by Başal et
al. (2005), who suggested that root parameters, initial
water content (IWC) and excised leaf water loss (ELWL),
can be used as a reliable selection criteria for drought
tolerance. In addition, earlier researchers reported that
root growth is an important and reliable indicator of the
response of drought tolerant varieties and therefore this
character could be used at seedling stage; at plant
maturity, roots and its characteristics are complex to
measure, and screening method is destructive, thus
making their use limited in breeding programs (Igbal et
al., 2010). Bölek (2007) found Tamcot Sphinx,
CUBQHGRPIS-1-92 and CUBQHGRPIH-1-92 cotton
genotypes more tolerant to mid-season water stress than
the other genotypes and that decline in boll retention was
positively associated with a 39% reduction in yield in the
water stressed treatment.
The primary objective of this study was to investigate
the differential response to yield, fiber quality properties
of selected drought tolerant lines and some commercial
cotton varieties when grown under water stress and nonstressed
conditions.
MATERIALS AND METHODS
The experiment was carried out at the Southeastern Anatolia
Agricultural Research Institute’s experimental area during 2009 and
2010 growing seasons in Diyarbakir, Turkey. In this study, 12 cotton
genotypes were observed in terms of yield and fiber quality
properties under water stress and non-stress conditions. Eight
advanced cotton lines (BMR-25, SMR-15, TMR-26, BST-1, SER-21,
SST-8, CMR-24 and SER-18) developed for tolerance to drought
stress, and four commercial cotton varieties (Stoneville 468, BA
119, GW-Teks and Şahin 2000) were used as plant materials.
The experiment was carried out under field conditions as a
randomized split block design (RSBD) with two blocks, one was
well watered and to the other, water stress was applied, with four
replications in each block. Genotypes were randomized within each
of the main blocks and replications. Each sub plot consisted of four
rows of 12 m in length, between and within the row spacing were
0.70 and 0.20 m, respectively. Between the main plots, 4.2 m space
was left to avoid edge interference between the treatments.
Seeds of these cotton genotypes were planted with combined
cotton drilling machine on 6th May, 2009 and on 7th May, 2010 and
all plots were treated with 20-20-0 composite fertilizer to provide 70
kg N ha -1 and 70 kg P2O5 ha -1 . Just before flowering, 70 kg N ha -1
were applied as ammonium nitrate as an additional N dose.
Herbicides were used twice in both years. In both years, insect
were monitored throughout the experiment and no insect control
was necessary during these growing season. Plants were grown
under recommended cultural practices for commercial production;
the experiment was thinned and hoed three times by hand and two
times with a machine.
Experimental plots were irrigated by drip irrigation method. Water
treatments consisted of two regimes, one was watered and the
other was water-stressed. Throughout the growing season, 378 mm
water was given in water stress treatment and 756 mm water was
given in non-stress treatment in 2009 and 2010. In the stress
application, plants were subjected to water stress from flowering
stage to 10% boll opening period. The meteorological data of the
experimental site during the study period is presented in Figures 1
and 2.
The sowing time is usually from the end of the April to mid May. It
can be seen that the precipitation were inadequate during the two
years of experiments when compared with long term precipitation at
the sowing time. On the contrary, two years precipitation was higher
than that of the long term experiment at the harvesting time (Figure
1). In the second year of the experiment, both maximum
temperatures and mean temperatures were higher than that of
previous year and long term period (Figure 2).
Plots were harvested twice by hand and the obtained seed cotton
from the four rows of the plots were weighed and calculated for
seed cotton yield and fiber yield. The first harvest was done on 13th
October, 2009 and 7th October, 2010 and the second harvest was
done on 10th November, 2009 and 9th November, 2010. After the
harvest, seed cotton samples were ginned on a mini-laboratory
roller-gin for lint quality. Fiber quality properties were determined by
high volume instrument (HVI Spectrum). Statistical analysis were
performed using JMP 5.0.1 statistical software
(http://www.jmp.com) and the means were grouped with LSD(0.05)
test.
RESULTS AND DISCUSSION
The analysis of variance of the investigated characteristics
and the obtained findings from the cotton genotypes
are presented in Tables 1 to 5. Significant differences
were obtained among genotypes and treatments for seed
cotton yield, fiber yield, ginning percentage and all fiber
technological properties, except fiber uniformity. The
effect of year was significant for seed cotton yield, fiber
yield, ginning percentage, fiber length and fiber
elongation. Year x treatment interaction was significant
for seed cotton yield, fiber yield, ginning percentage, fiber
length, fiber strength, fiber elongation and fiber uniformity.
Year x genotype and year x treatment x genotype
interactions were non-significant for all the measured
traits. Treatment x genotype interaction was significant
for fiber strength (Table 1).
Seed cotton yield and fiber yield were consistently
affected by water treatment. The results of the combined
analysis over two years indicated that water stress
treatment had negative effect on seed cotton yield and
fiber yield. Seed cotton yield decreased by 48.04%, and
fiber yield by 49.41%, due to water stress on the average.
Among the genotypes, highest seed cotton yield was
obtained from SER-18, Stoneville 468 and SST-8 in
water stress conditions. Stoneville 468 also had the
highest yield under well watered conditions (Table 2 and
Figure 3). This indicates drought tolerance of these genotypes
(SER-18, Stoneville 468 and SST-8) as compared
to others. These genotypes also maintained higher fiber
yield under stress conditions. In addition, the response to
the two water treatment was similar among genotypes,
indicating the lack of a significant genotype x treatment
interaction. Year differences were significant at 0.01
probability level for seed cotton yield and fiber yield,
because there were variability between two years in

45,00
45.00
40,00
40.00
35,00
35.00
30,00
30.00
25,00
25.00
20,00
20.00
15,00
15.00
10,00
10.00
5.00
5,00
0,00
0.00
80.00 80,00
70.00 70,00
60.00 60,00
50.00 50,00
40.00 40,00
30.00 30,00
20.00 20,00
10.00 10,00
10.00 0,00
March
April
May
June
July
August
September
October
2009 Precipitation
2010 Precipitation
Long Term Precipitation
November
Figure 1. Average precipitation levels (mm) of 2009, 2010 and long term.
March
April
May
June
July
Aug ust
Sep tember
O ctobe r
2009 Average Temperature 2010 Average Temperature
Long Year Average Temperature 2009 Maximum Temperature
Karademir et al. 12577
November
2010 Maximum Temperature Long Year Maximum Temperature
Figure 2. Monthly average and maximum temperature of 2009, 2010 and long term.

12578 Afr. J. Biotechnol.
Table 1. The analysis of variance of the investigated characteristics.
Source df Seed cotton
yield
(kg ha -1 )
Fiber
yield
(kg ha -1 )
Ginning
percentage
(%)
Fiber length
(mm)
Fiber
fineness
(mic.)
Fiber
strength
(g tex -1 )
Fiber
elongation
(%)
Fiber
uniformity
(%)
Year 1 665.81** 464.22** 40.39** 8.64* 1.01 0.37 20.92** 0.39
Replication (year) 6 5.93* 5.53* 0.71 0.49 1.88 0.61 1.08 0.43
W. Treatment 1 2076.15** 1845.82** 11.89* 14.14** 27.91** 16.43** 66.41** 3.27
Year x W. treatment 1 701.67** 645.03** 15.30** 12.27* 3.89 10.17* 24.97** 7.94*
Replication x W. treatment [Year] and random 6 1.03 1.26 4.56** 2.64* 2.37* 3.72** 1.04 1.21
Genotype 11 3.48** 8.14** 46.02** 7.30** 4.45** 13.81** 9.55** 1.25
Year x genotype 11 0.98 1.06 0.92 1.35 1.02 1.06 0.65 0.74
W. Treatment x genotype 11 0.81 1.23 0.63 0.96 1.00 2.07* 0.76 1.60
Year x W. treatment x genotype 11 0.64 0.96 1.03 1.61 0.47 0.85 0.64 0.92
* and **Significant at the 0.05 and 0.01 probability level, respectively.
Table 2. Average values of seed cotton and fiber yields of cotton genotypes and statistical groups of each year and over the two years.
Seed cotton yield (kg ha
Genotype
-1 ) Fiber yield (kg ha -1 )
2009 2010 2009-2010
2009 2010 2009-2010
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
Average
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
Average
BMR-25 1940 4755 2076 2764 2008 3760 2884 cd 746 1937 865 1143 806 1540 1173 d
SMR -15 1986 4898 1835 2968 1910 3933 2922 cd 722 1908 728 1141 725 1525 1125 d
TMR-26 2087 5076 2003 2840 2045 3958 3001 bc 782 2014 812 1152 797 1583 1190 d
BST-1 2006 5017 1962 2622 1984 3819 2902 cd 762 1992 806 1068 784 1530 1157 d
SER-21 2053 5045 1945 2780 1999 3913 2956 cd 795 2047 807 1144 801 1596 1198 cd
SST-8 2145 4992 2064 2815 2104 3904 3004 bc 818 1982 826 1142 822 1562 1192 cd
CMR-24 2056 4767 1935 2542 1996 3655 2825 cd 780 1942 790 1060 785 1501 1143 d
SER-18 2258 4979 2307 3147 2282 4063 3173 ab 875 1974 946 1288 911 1631 1271 bc
STV 468 2099 5213 2418 3246 2259 4230 3244 a 868 2261 1081 1439 974 1850 1412 a
BA 119 1899 5111 2184 2834 2041 3972 3007 bc 784 2197 968 1269 876 1733 1305 b
GW-TEKS 1597 4972 1849 2724 1723 3848 2786 d 650 2093 793 1164 721 1629 1175 d
ŞAHĐN 2000 2093 5115 1980 2733 2036 3924 2980 b-d 801 2088 807 1088 804 1588 1196 cd
Mean 2018 4995 2047 2835 2032 b 3915 a 782 2036 853 1175 817 b 1606 a
Year (Y) 3507 a 2441 b 1409 a 1014 b

Table 2 Contd.
CV (%) 9.44 9.32
LSD (0.05)
Genotype (G) 195.73** 78.74**
Treatment (T) 100.79** 44.77**
Y x T 142.54** 63.31**
Y x G ns ns
T x G ns ns
Y x T x G ns ns
* and **Significant at the 0.05 and 0.01 probability level, respectively.
Table 3. Average values of ginning percentage (%) and fiber length (mm) of cotton genotypes and statistical groups of each year and over the two years.
Karademir et al. 12579
Ginning percentage (%) Fiber length (mm)
Genotype
2009 2010 2009-2010
2009 2010 2009-2010
Stress
Non
stress
Average
Average
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
BMR-25 38.43 40.74 41.69 41.42 40.06 41.08 40.57 c 26.16 27.27 26.78 26.56 26.47 26.92 26.69 fg
SMR -15 36.31 38.97 39.70 38.48 38.01 38.73 38.37 f 27.64 28.75 27.01 27.82 27.33 28.28 27.81 ab
TMR-26 37.25 39.71 40.50 40.58 38.88 40.15 39.51 e 27.16 27.43 26.17 26.28 26.66 26.85 26.76 e-g
BST-1 37.98 39.73 41.15 40.78 39.55 40.25 39.91 de 27.22 27.72 27.00 26.83 27.11 27.27 27.19 c-f
SER-21 38.66 40.62 41.55 41.19 40.10 40.90 40.50 cd 26.80 28.18 27.01 27.09 26.90 27.64 27.27 b-e
SST-8 38.15 39.71 40.04 40.57 39.09 40.14 39.62 e 26.89 29.28 27.60 26.29 27.25 27.78 27.51 a-d
CMR-24 37.98 40.76 40.77 41.78 39.37 41.27 40.32 cd 26.73 27.86 26.42 27.05 26.57 27.46 27.01 d-f
SER-18 38.61 39.64 40.99 40.98 39.80 40.31 40.05 c-e 27.63 28.52 26.97 27.31 27.30 27.92 27.61 a-c
STV 468 41.24 43.38 44.68 44.35 42.96 43.87 43.41 a 26.72 28.23 26.77 26.58 26.74 27.41 27.08 c-f
BA 119 41.20 43.02 44.32 44.75 42.76 43.89 43.32 a 25.21 27.52 26.14 26.10 25.68 26.81 26.24 g
GW-TEKS 40.64 42.12 42.89 42.77 41.77 42.44 42.10 b 26.46 28.94 27.89 28.52 27.17 28.73 27.95 a
ŞAHĐN 2000 38.04 40.86 40.76 39.83 39.40 40.34 39.87 de 27.63 28.88 27.77 27.66 27.70 28.27 27.96 a
Mean 38.71 40.77 41.59 41.46 40.15 b 41.11 a 26.85 28.21 26.96 27.01 26.71 b 27.61 a
Year (Y) 39.74 b 41.52 a 27.53 a 26.98 b
CV (%)
LSD (0.05)
2.21 2.89
Genotype (G) 0.63** 0.55**
Treatment (T) 0.68* 0.43**

12580 Afr. J. Biotechnol.
Table 3 Contd.
Y x T 0.95** 0.63*
Y x G ns ns
T x G ns ns
Y x T x G ns ns
*and ** Significant at the 0.05 and 0.01 probability level, respectively.
Table 4. Average values of fiber fineness (mic.) and fiber strength (g tex -1 ) of cotton genotypes and statistical groups of each year and over the two years.
Fiber fineness (micronaire) Fiber strength (g tex
Genotype
-1 )
2009 2010 2009-2010
2009 2010 2009-2010
Stress
Non
stress
Average
Average
Stress
Non
stress Stress
Non
Stress
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
BMR-25 4.00 4.59 4.14 4.62 4.07 4.61 4.34 a-d 24.80 28.30 27.62 27.10 26.21 27.70 26.95 de
SMR -15 4.18 4.67 4.35 4.49 4.26 4.58 4.42 ab 26.87 31.95 26.85 30.20 26.86 31.07 28.96 b
TMR-26 3.95 4.42 4.02 4.47 3.99 4.44 4.22 cd 23.92 29.92 26.90 26.80 25.41 28.36 26.88 de
BST-1 4.25 4.68 4.23 4.72 4.24 4.70 4.47 a 26.37 29.62 28.87 29.32 27.62 29.47 28.55 bc
SER-21 4.17 4.46 4.33 4.53 4.23 4.50 4.37 a-c 25.05 30.05 26.77 27.97 25.91 29.01 27.46 c-e
SST-8 3.99 4.43 4.04 4.24 4.01 4.33 4.17 c-e 27.82 30.15 26.25 27.70 27.03 28.92 27.98 b-d
CMR-24 3.86 4.37 4.27 4.52 4.07 4.44 4.25 b-d 24.12 28.47 26.35 27.52 25.23 28.00 26.61 e
SER-18 4.00 4.48 4.28 4.30 4.14 4.39 4.27 a-d 27.25 28.82 27.32 27.60 27.28 28.21 27.75 c-e
STV 468 4.21 4.44 4.23 4.16 4.22 4.30 4.26 b-d 28.77 29.02 28.97 27.70 28.87 28.36 28.61 bc
BA 119 3.86 4.17 4.26 4.32 4.06 4.25 4.15 d-f 26.82 30.50 27.60 27.35 27.21 28.92 28.06 b-d
GW-TEKS 3.38 4.28 3.97 4.21 3.67 4.25 3.96 f 30.00 34.85 32.70 32.45 31.35 33.65 32.50 a
ŞAHĐN 2000 3.82 4.33 3.89 3.98 3.85 4.15 4.00 ef 25.95 27.97 26.45 25.95 26.20 26.96 26.58 e
Mean 3.97 4.44 4.16 4.38 4.07 a 4.41 b 26.48 b 29.97 a 27.72 b 28.13 b 27.10 b 29.05 a
Year (Y) 4.21 4.27 28.22 27.93
CV (%)
LSD (0.05)
6.83 6.12
Genotype (G) 0.19** 1.20**
Treatment (T) 0.14** 1.17**
Y x T ns 1.65*
Y x G ns ns
T x G ns 1.69*
Y x T x G ns ns
* and **Significant at the 0.05 and 0.01 probability level, respectively.

Table 5. Average values of fiber elongation (%) and fiber uniformity (%) of cotton genotypes and statistical groups of each year and over the two years.
Karademir et al. 12581
Fiber elongation (%) Fiber uniformity (%)
Genotype
2009 2010 2009-2010
2009 2010 2009-2010
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
Average
Stress
Non
stress
Stress
Non
stress
Stress
Non
stress
Average
BMR-25 5.20 6.25 5.37 5.67 5.28 5.96 5.62 b 80.82 83.82 82.57 82.12 81.70 82.97 82.33
SMR -15 5.35 5.67 5.47 5.45 5.41 5.56 5.48 bc 81.97 85.10 83.05 82.77 82.51 83.93 83.22
TMR-26 5.27 5.95 5.10 5.65 5.18 5.80 5.49 bc 79.52 84.52 82.40 83.20 80.96 83.86 82.41
BST-1 5.10 5.65 5.17 5.40 5.13 5.52 5.33 cd 81.10 84.27 83.20 84.40 81.15 84.33 83.24
SER-21 5.02 5.65 5.02 5.17 5.02 5.41 5.21 d 81.32 83.52 81.30 83.92 81.31 83.72 82.51
SST-8 5.12 5.97 5.50 5.22 5.31 5.60 5.45 b-d 81.55 83.55 82.17 82.07 81.86 82.81 82.33
CMR-24 5.05 5.77 5.25 5.50 5.15 5.63 5.39 b-d 81.67 83.92 81.55 82.80 81.61 83.36 82.48
SER-18 5.42 6.27 5.22 5.50 5.32 5.88 5.60 b 82.47 83.62 83.40 82.57 82.93 83.10 83.01
STV 468 5.92 6.67 5.82 5.90 5.87 6.28 6.08 a 81.75 82.87 83.55 70.82 82.65 76.85 79.75
BA 119 5.95 6.50 5.80 6.15 5.87 6.32 6.10 a 81.52 83.80 83.12 82.75 82.32 83.27 82.80
GW-TEKS 5.52 6.02 5.37 5.40 5.45 5.71 5.58 bc 81.92 86.32 83.22 85.00 82.57 85.66 84.11
ŞAHĐN 2000 5.55 6.65 5.65 5.80 5.60 6.22 5.91 a 81.17 83.87 82.57 82.62 81.87 83.25 82.56
Mean 5.37 c 6.08 a 5.39 bc 5.56 b 5.38 b 5.82 a 81.40 b 84.10 a 82.67 a b 82.08ab 82.03 83.09
Year (Y) 5.73 a 5.48 b 82.75 82.38
CV (%)
LSD (0.05)
6.42 4.43
Genotype (G) 0.23** ns
Treatment (T) 0.12** ns
Y x T 0.17** 2.00*
Y x G ns ns
T x G ns ns
Y x T x G ns ns
* and ** : significant at the 0.05 and 0.01 probability level, respectively.
terms of climatic factors. For treatment, first year’s
yield differences were higher than that of the
second year. It is estimated that these differences
may be as a result of year differences due to
higher temperature that occurred during the
second year of the experiment.
These seed cotton yield and fiber yield
reductions are similar to those reported (El-Fouly
et al., 1971; Marur, 1991; Cook and El-Zik, 1993;
Rajamani, 1994; Pettigrew, 2004b; Bölek, 2007;
Alishah and Ahmadikhah, 2009). Some
researchers revealed that water stress at different
growing stage reduced cotton yield, with the
greatest effect at the flowering and fruiting stages
(Luz et al., 1997).
Significant differences were obtained between
treatments and genotypes for ginning percentage.
Ginning percentage was generally decreased in

12582 Afr. J. Biotechnol.
5000.00
4500.00
4000.00
3500.00
3000.00
2500.00
2000.00
1500.00
1000.00
500.00
0.00
BMR-25 SMR -15 TMR-26 BST-1 SER-21 SST-8 CMR-24 SER-18 STV 468BA 119 TEKS ŞAHIN
2000
Figure 3. Seed cotton yield (kg ha -1 ) of genotypes under water stress and non stress conditions.
response to water stress treatment. Under water stress
conditions, average of genotypes for ginning percentage
was 40.15%, and under non-stress conditions, it was
41.11%. Non stressed plots ginned out were 2.39%
higher than the plots subjected to water stress treatments.
The genotypes ginning percentage ranged from
38.37 to 43.41%. Ginning percentage was highest for
Stoneville 468 (43.41%) and BA 119 (43.32%) with
respect to both treatments (Table 3). Same results
relating to ginning percentage was reported by Osborne
and Banks (2006).
Mahmood et al. (2006) also reported that water deficits
had remarkable decreasing effect on ginning out turn.
These findings were similar to earlier researchers’ report.
Genotype, year, treatment and year x treatment
interactions were significant for fiber length. The plots in
non stress conditions produced 0.9 mm longer fiber than
the stress plots. As seen in Table 3, fiber length in water
stress treatment was 26.71 mm, but non stress treatment
was 27.61 mm. Genotypic differences were also found to
be significant. Fiber length was highest for Şahin 2000,
GW-Teks and SMR-15, and lowest for BA 119 genotype.
Fiber length was also affected by year differences. Fiber
length was 1.99% lower in 2010 than in 2009. As
mentioned earlier, high temperatures occurred during the
2010 cotton growing season and may affect fiber length
development. The lack of interaction between genotype x
treatment, indicate similar response of cotton genotypes
to different water treatment. Fiber length is a desirable
character for textile industry and spinning technology,
and premium is paid for this trait (Table 3). Some
researchers revealed that water stress had adverse effect
on fiber length (Marur, 1991; Pettigrew, 2004b; Osborne
and Banks, 2006; Mahmood et al., 2006); but some of the
researchers revealed that water treatment had no
Stress
Non-stress
significant effect on fiber length (Luz et al., 1997). These
contradictory results may be as a result of variety and
year differences.
Water stress had a significant (p

eported by Osborne and Banks (2006). However,
Pettigrew (2004b) revealed that fiber quality response to
irrigation was inconsistent throughout the duration of the
experiment and irrigation had no effect on fiber strength.
Year, treatment, year x treatment and genotype was
significant at p

African Journal of Biotechnology Vol. 10(59), pp. 12584-12594, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1220
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Modelling of seed yield and its components in tall
fescue (Festuca arundinacea) based on a large sample
Quanzhen Wang 1 *, Tianming Hu 1 , Jian Cui 2 , Xianguo Wang 3 , He Zhou 3 , Jianguo Han 3 and
Tiejun Zhang 4
1 Department of Grassland Science, College of Animal Science and Technology, Northwest A and F University, Yangling
712100, Shaanxi, China.
2 Department of Plant Science, College of Life Science, Northwest A F University, Yangling 712100, Shaanxi, China.
3 Institute of Grassland Science, College of Animal Science and Technology, China Agricultural University, Beijing
100094, China.
4 Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, China.
Accepted 29 August, 2011
Tall fescue (Festuca arundinacea Schreb.) is a primary cool-season grass species that is widely used as
a cold-season forage and turfgrass throughout the temperate regions of the world. The key seed yield
components, namely fertile tillers m -2 (Y1), spikelets fertile tiller -1 (Y2), florets spikelet -1 (Y3), seed
number spikelet -1 (Y4), seed weight (Y5), and the seed yield (Z) of tall fescue were determined in field
experiments from 2003 to 2005. The experiments produced a large sample for analysis. The correlations
among Y1 to Y5 and their direct and indirect effects on Z were investigated. All of the direct effects of the
Y1, Y3, Y4 and Y5 components on the seed yield were significantly positive. However, the effect of Y2 was
not significant. In decreasing order, the contributions of the five components to seed yield are Y1 >Y4
>Y3 >Y5 >Y2. Y4 and Y5 were not significantly correlated with Z. However, the components Y1, Y2 and Y3
were positively correlated with Z in all the three experimental years and the intercorrelations among the
components Y1, Y2 and Y3 were significant. Ridge regression analysis was used to derive a steady
algorithmic model that related Z to the five components; Y1 to Y5. This model can estimate Z precisely
from the values of these components. Furthermore, an approach based on the exponents of the
algorithmic model could be applied to the selection for high seed yield via direct selection for large Y2,
Y3 and Y5 values in a breeding program for tall fescue.
Key words. Modelling, seed yield, components, tall fescue, path and ridge analyses, large sample.
INTRODUCTION
Tall fescue (Festuca arundinacea Schreb.) is a primary
and important cool-season forage grass species. It is
grown for livestock production throughout the temperate
regions of the world (Majidi et al., 2009). Because the
grass thrives on impoverished soils in pastoral
environments (under simultaneously occurring multiple
stresses) (Belesky et al., 2010), tall fescue plays a
significant role in soil conservation in arid and semi-arid
regions. Tall fescue is also widely used as a cold-season
turfgrass in residential and commercial landscapes. For
turf-type tall fescue, previous research has focussed
*Corresponding E-mail: wangquanzhen191@163.com.
mainly on cultivation. The purpose of this previous
research was to identify heat- and drought-tolerant
selections that can produce a higher-quality turf. Specific
research topics in this area have included the effects of
organic fertilisers on greening quality, shoot, root growth,
etc. (Cheng et al., 2010) and the genetic mechanism of
brown patch resistance in tall fescue (Bokmeyer et al.,
2009). Tall fescue also has the potential to serve as a
sink for industrial pollutants, as reported in a study of lead
uptake by the roots of turfgrass tall fescue (Qu et al.,
2003).
Nevertheless, little research has been conducted
regarding the algorithms of seed yield and its key
components in grasses. This information is crucial to
meet the demands of commercial propagation. Seed

yield, a quantitative character, is largely influenced by the
environment and thus has a low heritability (Bliss et al.,
1973; Boelt and Gislum, 2010; Wang et al., 2010).
Therefore, the response to direct selection for seed yield
may be unpredictable unless environmental variation is
well controlled. Thus, there is a need to examine the
mathematical relationships among various characters.
The investigation of such relationships involving seed
yield and yield components, interior yield components,
and a certain amount of interdependence is especially
important. To date, although some research has focused
on the seed yield and the yield components of tall fescue
(Young et al., 1998a, b), no information is available on the
algorithmic relationships between these characters.
Path analysis has been widely used by plant breeders
to assist in identifying the traits that are useful as
selection criteria in improving crop yield (Akinyele and
Osekita, 2006; Bicer, 2009; Ceyhan, et al. 2008; Karasu,
et al. 2009; Kaya, et al. 2010; Kokten et al., 2009;
Mensah et al., 2007). However, morphological characters
(that is, Y1 to Y5) influencing seed yield (Z), are often
highly intercorrelated. This situation leads to multicollinearity
when the intercorrelated variables are
regressed against yield in a multiple-regression equation
(Wang et al. 2011). For such situations, the estimation of
regression coefficients through ridge regression was
developed by Hoerl and Kennard (1970 a, b) to
ameliorate problems of multicollinearity. These problems
may result in the inflation of the absolute value of the
regression coefficients and may also produce incorrect
signs for the regression coefficients resulting from these
intercorrelated variables.
The objective of this study was to examine the
mathematical relationships between seed yield and its
components by using a path analysis and ridge regression
modelling approach to forecast the seed yield in
seed production. This approach offers a reference
algorithm suitable for quantitative genetics and breeding
in tall fescue and can stimulate further investigations of
seed yield and its components in grasses.
MATERIALS AND METHODS
A multifactor, orthogonal design involving various field experimental
management conditions (Hedayat et al., 1999) was used in this
study. The seed yield components considered in this study, were
fertile tillers m -2 (Y1), spikelets fertile tiller -1 (Y2), florets spikelet -1
(Y3), seed number spikelet -1 (Y4) and seed weight (Y5) (Canode,
1980; Fairey and Hampton, 1997).The following theoretical
formulas describe the relationships between the seed yield
components and seed yield (or seed yield potential).
Seed yield: ZSY = Y1·Y2· Y4· Y5
If one floret contents one seed embryo for grasses, then
Seed yield potential: ZSYP = Y1·Y2· Y3· Y5
Research location and field conditions
A field experiment was conducted from 2003 to 2005 at the China
Wang et al. 12585
Agricultural University Grassland Research Station located at
Yinger village of Shangba Commune, in Jiuquan, Gansu province,
northwestern China (latitude 39°37′ N, longitude 98°30′ E; elevation
1480 m). The initial soil at the site is Mot-Cal-Orthic Aridisols,
classified as Xeric Haplocalcids in the USDA soil classification (Soil-
Survey-Staff, 1996). The plots used in this experiment had been
planted with ‘alfalfa’ (Medicago sativa L.) during the previous
season.
The 0.6 ha experimental site was tilled using a chisel plough in
the fall and a disk harrow in the spring for seedbed preparation.
‘Fawn’ tall fescue was planted on 23 April, 2002 at a planting depth
of 2.5 cm and at a seeding rate of 15 kg ha -1 . The rows were 0.45 m
apart and were planted in a south to north direction. Fertiliser was
initially applied in a 6 cm-deep band and 5 cm to the side of the
seed furrow at a rate of 104 kg hm −2 N and 63 kg hm −2 P2O5. There
was no seed yield in autumn of 2002. This research trial was
conducted during the next three years (2003 to 2005), using five
groups (A to E) of designed field management regimes (X1-6) that
were repeated yearly.
Experimental design
For the simulation of various growing conditions, the experiment
used five groups (A to E) of multifactor, orthogonal experimentaldesigned
field block designs with six experimental factors, including
the time of fertilisation (X1), the quantity of irrigation (X2), the
amount of N applied (X3), the amount of P2O5 applied (X4), the
seeding density (X5) and the amount of plant growth regulator
sprayed (X6) (Hedayat et al., 1999; Lattin et al., 2003; Yandell,
1997).
Groups A and B each consisted of a 2-D-optimum design (a 2-Doptimum
matrix applied with six plots) and arranged experimental
factors X3 and X4 with different levels, respectively. Group A
included three replicates [3 × 6 = 18 plots (treatments), stochastic
arrangement]. Group B had one replicate (6 plots, stochastic
arrangement; not used in 2003). The design of groups C, D and E
was based on an application of compound matrices. Group C was
arranged according to a Quinque-factor orthogonal design (factors:
X1 to X5, one repeat: 36 plots, stochastic arrangement).
Group D involved Bin-factor orthogonal contract plots (factors: X2,
X3 + X4, one repeat: 22 plots, stochastic arrangement). Group E
consisted of a Tri-factor orthogonal rotary design (factors: X1, X3
and X6, one repeat: 23 plots, stochastic arrangement). Six
additional plots to which no treatment was applied were included as
controls from 2003 through 2005. Therefore, a total of 111
experimental field plots (treatments) divided into the five groups
defined above, plus the control, were arranged via designs of
orthogonal arrays (Hedayat et al., 1999).
Each of the individual plot areas was 28 m 2 (that is, 4 × 7 m) with
1.5 m spacing between the adjacent plots. These orthogonal
experiments were conducted yearly and repeated under various
field management conditions for the controlled growing
environments involving X1 to X6.
Data collection
To avoid marginal effects from anthesis to seed harvest in the
experimental years of 2003, 2004 and 2005, 1 m was left at the
edge of the plots. Data on the seed-yield components and the seed
yields of each plot were collected in the following manner. Ten
samples of a 1 m long row were randomly selected in each plot to
count the number of fertile tillers. The resulting counts were then
converted [divided by 0.45 (row space)] and expressed in units of
fertile tillers m -2 (Y1). From each plot, 30 to 51 fertile tillers, 27 to 30
spikelets and 24 to 30 spikelets were randomly selected for
measuring the values of spikelets fertile tillers -1 (Y2), florets spikelet -1

Year
12586 Afr. J. Biotechnol.
Table 1. The sample size of Y1-Y5 and Z for each field experimental plot of Festuca arundinacea Schreb.
Sample
size
of plots (N)
Fertile tillers
m -2 Y1
Spikelets
fertile
tillers -1 Y2
Sample size of each plot (n)
Florets
spikelet -1
Y3
Seed
numbers
spikelet -1 Y4
Seed
weight
† Y5
Seed yield
Z
Number (m -2 ) Number Number Number mg kg ha -1
2003 105 10 51 27 24 10 4
Total sample size (n) ‡ 1050 5355 2835 2520 1050 420
2004 111 10 30 30 30 10 4
Total sample size (n) 1110 3330 3330 3330 1110 444
2005 111 10 30 30 30 10 4
Total sample size (n) 1110 3330 3330 3330 1110 444
Three years totally (n) 3270 12015 9495 9180 3270 1308
†: Y1 to Y5 and Z are stand for fertile tillers m -2 , spikelets fertile tillers -1 , florets spikelet -1 ,seed numbers spikelet -1 , seed weight (mg) and seed
yield (kg ha-1), respectively. ‡: F-values are presented along with statistical differences; * P

Table 2. The Pearson correlation coefficients of Y1-Y5 and Z of Festuca arundinacea Schreb. for the three years †† .
Wang et al. 12587
Seed yield component Y1 † Y2 ‡ Y3 § Y4 Y5 # Z (seed yield)
Y1 1.0000 0.2201*** 0.3067*** -0.2195*** -0.1070 0.7668***
Y2 1.0000 0.3555*** -0.2569*** 0.0070 0.4917***
Y3 1.0000 0.2568*** 0.0885 0.6023***
Y4 1.0000 0.2826*** -0.1099*
Y5 1.0000 0.0032
†, Fertile tillers m -2 ; ‡, spikelets fertile tillers -1 ; §, florets spikelet -1 ; , seed numbers spikelet -1 ; # seed weight (mg); ††, F-values are presented
along with statistical differences; * P Y5 >Y2. This order is the same as that found by
considering the total of the direct effects.
Ridge regression models of Z with Y1 to Y5
The results of the Duncan multiple range tests conducted
in SAS for Z and its components (Y1 to Y5) in the three
years are presented in Table 4. Z and the components Y1
to Y4 all differed significantly in the three years of the
study (P

12588 Afr. J. Biotechnol.
Table 3. Path analysis showing direct and indirect effects of Y1-Y5 on Z for Festuca arundinacea Schreb. ‡
Parameter
year
Indirect effect via §
→Y1 † →Z →Y2→Z →Y3→Z →Y4→Z →Y5→Z
Y1 2003 0.4427*** 0.0001 -0.0970 -0.0389 -0.0111
2004 0.6172*** 0.0112 0.0361 0.0485 0.0016
2005 0.6616*** 0.0003 0.0229 0.0309 -0.0374
Y2 2003 0.0361 0.0013 0.0220 0.0334 0.0498
2004 0.1717 0.0404 0.0332 0.0310 0.0002
2005 0.0480 0.0039 0.0182 0.0365 0.0172
Y3 2003 -0.1838 0.0001 0.2336 0.1525 0.0509
2004 0.1377 0.0083 0.1617 0.1437 0.0030
2005 0.0850 0.0004 0.1780* 0.1872 0.0028
Y4 2003 -0.0873 0.0002 0.1808 0.1970 0.0537
2004 0.1510 0.0063 0.1172 0.1983* 0.0033
2005 0.0752 0.0005 0.1228 0.2713** 0.0013
Y5 2003 -0.0276 0.0003 0.0666 0.0594 0.1785
2004 0.1981 0.0015 0.0968 0.1310 0.0050
2005 -0.1151 0.0003 0.0023 0.0016 0.2152**
Total direct effect 1.7215 0.0456 0.5733 0.6666 0.4077
Total effect 2.2141 0.0751 1.1952 1.4834 0.5430
†, Y1 to Y5 and Z are stand for fertile tillers m -2 , spikelets fertile tillers -1 , florets spikelet -1 ,seed numbers spikelet -1 , seed
weight (mg) and seed yield (kg ha -1 ), respectively; ‡, F-values are presented along with statistical differences; * P

an exponential function as follows:
Figure 1. Ridge traces of the standard partial regression coefficients for the
increasing values of k for the five yield components of tall fescue in Jiuquan,
Gansu province, China, for the years 2003, 2004 and 2005. Y1 to Y5 and Z denote
fertile tillers m -2 , spikelets fertile tillers -1 , florets spikelet -1 ,seed numbers spikelet -1 ,
seed weight (mg) and seed yield (kg ha -1 ), respectively.
Z = e -1.6 ·Y1 0.42 ·Y2 0.98 ·Y3 0.89 ·Y4 0.07 ·Y5 0.59 (10).
Formula (10) was used to estimate the seed yield of all
the 327 samples. These estimates were denoted by
Zestimated. The observed seed yields were denoted by
Zactual.
A general linear regression model was used to compare
the values of Z actual with the values of Z estimated. An analysis of
Wang et al. 12589
variance was used to assess the dependent variable Z actual
and the parameter estimates of Z estimated (Tables 7 and 8).
The linear regression model is graphed in Figure 2.
The regression model obtained in this analysis is as
follows:
Zactual = -106.49+1.17·Zestimated (N = 327, F = 1036.95,
Pr

12590 Afr. J. Biotechnol.
Figure 2. Scatterplot used to fit the regression of the actual seed yield on the
estimated seed yield for the combined three years. Zest was estimated by the
model Z=e -1.6 Y1 0.42 Y2 0.98 Y3 0.89 Y4 0.07 Y5 0.59 for tall fescue.
Table 5. Analysis of variance for the dependent variable of Zactual with the five seed yield components of a total of 327
samples.
Source DF Sum of squares Mean square F value Pr > F
Model 5 96.4791 19.2952 237.55

Table 7. Analysis of variance for the dependent variable Zactual with the estimated seed yield.
Source DF Sum of squares Mean square F value Pr > F
Model 1 120601166 120601166 1036.95 |t|
Intercept 1 -106.49 39.1487 2.74 0.0065
Zestimated 1 1.1722 0.0291 32.21 |t|
Intercept 1 -0.0019 42.1125 -0.00 1.0000
Zestimated 1 1.0000 0.03105 32.20

12592 Afr. J. Biotechnol.
in grasses (Fairey and Hampton, 1997; Hampton and
Fairey, 1998; Boelt and Gislum, 2010). This finding
implies that Y2 is the component that should first be
considered if high seed yield in grasses is the goal of the
breeding program.
Nevertheless, Y1 was the most important and effective
component associated with Z, as shown by its
significantly (P
Y5 (0.59) Y1 (0.42) > Y4 (0.07), whereas the contributions
of the same variables exhibited the rank order Y1 (2.22) >
Y4 (1.48) > Y3 (1.20) > Y5 (0.54) > Y2 (0.08) (Table 3).
Although, these two sets of calculated values were
computed from the same database, the ridge analysis
values analytically combined the effects of all the Ys,
especially the effects of aging and climate, to address the
variation in Z for the three years, whereas the path
analysis included the separate analytic effects of the
individual three years. The former analysis is mathema-
tically more generic than the latter (Lawless and Wang,
1976; Chatterjee and Price, 1977; Gregory, 1978; Lattin
et al., 2003). Obviously, in the present trial, the genetic
controls were more generic than the environmental
controls for Y1 to Y5. Therefore, we tentatively propose
that Y2, Y3 and Y5 were orderly more genetic and less
environmental control than Y1 and Y4 and vice versa.
These considerations might suggest that improvement of
Y1 and Y4 should be the primary focus of breeding
programs aimed at improving the seed production of tall
fescue. This suggestion is consistent with previous
literature on the topic (Young et al., 1989c).
The intercorrelation among Y1 to Y5 and Z
In a study conducted in Corvallis, Oregon (United States),
Young (1998c) found that the Zs of all four experimental
tall fescue cultivars tested (including Fawn), were closely
correlated with Y1×Y2 ×Y4 .We found that Z was
significantly positively correlated both with Y1 and Y2 but
negatively correlated with Y4. Neither Y1, Y2 nor Y3 were
significantly correlated with Y5 (Table 2), but it was
negatively correlated with Y4 over the entire three years
(Table 2). Variation may be the reason for this apparent
discrepancy (Jafari et al., 2006). Our result in this
experiment appears to be in theoretical accordance with
current biological theory. Except for the correlation of Y3
with Y4 and Y1 and the correlation of Y3 and Y4 with Z, the
significant correlations were variable. This result was
probably a consequence of the effects of aging of the
plant and the climate of the individual year. The
management regimes were repeated each year in the
experiment and therefore would not have produced this
result (Fairey and Hampton, 1997; Hampton and Fairey,
1998). The results of this study further emphasises that
as the plants aged during the successive experimental
years, Y1, Y2 and Y3 decreased significantly, whereas Y4
and Y5 increased. This finding agrees with the results of
previous research (Fairey and Lefkovitch, 1999). This
result also implies that Y4 and Y5 should and could be
effectively improved if the values of Y1, Y2 and Y3 are
lower than normal. The justification for this argument is
that Y1 through Y5 represented successive phenological
periods in the production cycle of the grass seed.
Significantly varying coefficients of ridge regressions
The coefficients of the ridge regression models for the
individual years were variable and ranged from 1.064 to
462.909. The main apparent causes of this variation were
co-effects of the aging of the plants, variable climatic
conditions and variation among the designs for the
experimental management of the fields. These causes
added to the effects of high intercorrelation among the
components and led to multicollinearity in the regression

analysis that linked Y1 to Y5 with Z. For this very reason,
the data from all three years were summed, logtransformed
and subjected to ridge regression analysis to
reveal the essential algorithmic relations underlying the
data (Hoerl and Kennard, 1970; Hoerl et al., 1975;
Bradley et al., 1977; Chatterjee and Price, 1977; Lattin et
al., 2003; Gao et al., 2005).
Conclusions
Ridge regression analysis of a large sample produced by
an orthogonal experimental design yielded the following
algorithmic model:
0.42 0.98 0.89 0.07 0.59
Z =-106.49+0.24·Y1 ·Y2 ·Y3 ·Y4 ·Y5 .
The study found that Z can be accurately estimated from
Y1, Y2, Y3, Y4 and Y5. The combined direct effects of Y1,
Y3, Y4 and Y5 with regard to Z were positive. Y2
represented an exception to this pattern of positive
relationships. Of the components examined, Y1 exhibited
the largest contribution to Z. In rank order, the
contributions of the five key components to Z were as
follows: Y1 >Y4 >Y3 >Y5 >Y2. The components Y1, Y2 and
Y3 were positively correlated with Z, whereas Y4 exhibited
a weakly negative correlation. The intercorrelations of the
components Y1, Y2 and Y3 were significant. Y1, the major
component, exhibited the most important and substantial
effect of any of the five components on grass seed
production. However, in view of the values of the
exponents of the algorithmic model, it appears that
selection for high seed yield through direct selection for
large Y2, Y3 and Y5 values would be more effective than
selection on Y4 and Y1 in a breeding program involving
this grass.
Future studies may consider the climate (such as
rainfall and temperature) in the seed production stage
and different site locations to facilitate the determination
and testing of models of seed yield as a function of seed
yield components in grasses.
ACKNOWLEDGEMENTS
The National Science and Technology Pillar Program of
China (2011BAD17B05), The National Basic Research
and Development Program (973 project, 2007CB106805)
and 948 Research Project (No.202099) Ministry of
Agriculture of P R China, funded this work. We are
grateful to Dr Luo Shuhang, Dr Liu Fuyuan, and Dr
Zhongyong, presidents of the Daye International Interest
Co. Ltd., and to our skilled technical assistants, Zhang
Bing, Yan Xuehua, Han Juhoung, Zhang Xijun, Wang
Shouguo and Zhang Guoqi, animal husbandry engineers
of the Daye Institute of Forage and Grass Products in
Jiuquan, and Gansu Branch of Chengdu Daye Interna-
Wang et al. 12593
tional Interest Co. Ltd. for their assistance in this
research.
REFERENCES
Akinyele BO, Osekita OS (2006). Correlation and path coefficient
analyses of seed yield attributes in okra (Abelmoschus esculentus
(L.) Moench). Afr. J. Biotechnol. 5: 1330-1336.
Barrios C, Armando L, Berone G, Tomas A (2010). Seed yield
components and yield per plant in populations of Panicum coloratum
L. var. makarikariensis Goossens, Proc. Int. Herbage Seed Conf.
Dallas TX. p. 7.
Belesky DP, Ruckle JM, Halvorson JJ (2010). Carbon isotope
discrimination as an index of tall fescue endophyte association
response to light availability and defoliation. DOI:
10.1016/j.envexpbot.2009.09.009. Environ. Exp. Bot. 67: 515-521.
Bicer BT (2009). The effect of seed size on yield and yield components
of chickpea and lentil. Afr. J. Biotechn. 8: 1482-1487.
Bliss FA, Barker LN, Hall TC (1973). Genetic and environmental
variation of seed yield, yield components, and seed protein quantity
and quality of cowpea. Crop Sci. 13: 656-660.
Boelt B, Gislum R (2010). Seed yield components and their potential
interaction in grasses to what extend does seed weight influence
yield?, Proc. Int. Herbage Seed Conf. Dallas, TX. 7: 109-112.
Bradley SP, Hax AC, Magnanti TL (1977). Applied mathematical
programming. Addison- Wesley Pub. Company Inc. CA.
Canode CL (1980). Grass seed production in the intermountain Pacific
Northwest, USA. p. in P.D. Hebblethwaite. Seed production. Proc.
Easter School Agric. Sci. Univ. Nottingham. Butterworths, London,
28: 189-202.
Ceyhan E, Avci MA, Karadas S (2008). Line X tester analysis in pea
(Pisum sativum L.): Identification of superior parents for seed yield
and its components. Afr. J. Biotechnol. 7: 2810-2817.
Chatterjee S, Price B (1977). Regression analysis by example. John
Wiley & Sons, Inc, New York.
Cheng Z, Salminen SO, Grewal PS (2010). Effect of organic fertilisers
on the greening quality, shoot and root growth, and shoot nutrient and
alkaloid contents of turf-type endophytic tall fescue, Festuca
arundinacea. Annal. Appl. Biolog. 156: 25-37.
Crook S (2001). Visual FoxPro Client-Server Handbook. Redware
Research Ltd., Hove, England.
Deleuran LC, Gislum R, Boelt B (2009). Cultivar and row distance
interactions in perennial ryegrass. Acta Agriculturae Scandinavica
Section DOI: 10.1080/09064710802176642. B-Soil. Plant Sci. 59:
335-341.
Fairey DT, Hampton JG (1997). Forage seed production. CAB
Internatonal. Wallingford, Oxon. OX10 8DE, UK.
Gao S, Li Y, Jin H (2005). Application of ridge regression models in
economic increasing factors analysis. Statist. Decision Making, 5:
142-144.
Gregory S (1978). Statistical methods and the geographer. Fourth
Edition ed. Longman Group Limited London. Printed in Great Britain
by Richard Clay (The Chaucer Press) Ltd., London.
Hampton JG, Fairey DT (1998). Components of seed yield in grasses
and legumes. Forage seed production, Temperate species. 1: 45-69.
Hedayat AS, Sloane NJA, Stufken J (1999). Orthogonal arrays: Theory
and applications. Published by Springer-Verlag New York.
Hoerl AE, Kennard RW (1970a). Ridge regression: biased estimation for
non orthogonal problem. Technometrics. 12: 55-67.
Hoerl AE, Kennard RW (1970b). Ridge regression: Applications to non
orthogonal problems. Technometrics, 12: 69-82.
Hoerl AE, Kennard RW, Kent FB (1975). Ridge regression: some
simulations. Commun. stat. 4: 105-123.
Jafari AA, Setavarz H, Alizadeh MA (2006). Genetic variation for and
correlations among seed yield and seed components in tall fescue. J.
New Seeds, 8(4): 47-65
Jafari AA, Seyedmohammadi AR, Abdi N (2007). Study of variation for
seed yield and seed components in 31 genotypes of Agropyron
desertorum through factor analysis. Iranian J. Rangelands and
Forests Plant Breed. Gene Res. 15(21): 1220- 1221.

12594 Afr. J. Biotechnol.
Karasu A, Oz M, Goksoy AT, Turan ZM (2009). Genotype by
environment interactions, stability, and heritability of seed yield and
certain agronomical traits in soybean [Glycine max (L.) Merr.]. Afr. J.
Biotechnol. 8: 580-590.
Kaya M, Sanli A, Tonguc M (2010) Effect of sowing dates and seed
treatments on yield, some yield parameters and protein content of
chickpea (Cicer arietinum L.). Afr. J. Biotechnol. 9: 3833-3839.
Kokten K, Toklu F, Atis I, Hatipoglu R (2009) Effects of seeding rate on
forage yield and quality of vetch (Vicia sativa L.) triticale (Triticosecale
Wittm.) mixtures under east mediterranean rainfed conditions. Afr. J.
Biotechnol. 8: 5367-5372.
Lattin JM, Carroll JD, Green PE (2003). Analyzing multivariate data.
Brooks/Cole, an imprint of Thomson Learning, Pacific Grove, CA:
Duxbury.
Lawless JF, Wang P (1976). A simulation study of ridge and other
regression estimators. Commun. Stat. Ser. A. 5: 307-323.
Ma C, Han J, Sun J, Zhang Q,Lu G (2004). Effects of nitrogen fertilizer
on seed yields and yield components of Zoysia japonica established
by seeding and transplant. Agric. Sci. China. 3: 553-560.
Marquardt D, Snee R (1975). Ridge regression in practics. Am. Statist.
29: 3-14.
Mensah JK, Obadoni BO, Akomeah PA, Ikhajiagbe B, Ajibolu J (2007).
The effects of sodium azide and colchicine treatments on
morphological and yield traits of sesame seed (Sesame indicum L.).
Afr. J. Biotechnol. 6: 534-538
Newell GJ, Lee B (1981). Ridge regression: an alternative to multiple
linear regression for highly correlated data [in food technology]. J.
Food Sci. USA. 46: 968-969.
Qu RL, Li D, Du R, Qu R (2003). Lead uptake by roots of four turfgrass
species in hydroponic cultures. Hort. Sci. 38: 623-626.
SAS-Institute-Inc. (1988). SAS/STAT User's Guide. SAS Institute Inc.
Cary, NC.
Soil-Survey-Staff. (1996). Keys to soil taxonomy (7th. ed.). Natural
Resources Conservation Service, Washington, DC.
Sun T, Han J, Zhao S, Yue W (2005). Effects of fertilizer application on
seed yield and yield components of Psathyrostachys juncea.
Grassland of China. 27: 16-21.
Taghizadeh R, Jafari A, Choukan R, Asghari A (2008). Evaluation for
seed yield and seed components among accessions of crested
wheatgrass (Agropyron desertorum and Agropyron crustatum).
Multifunctional grasslands in a changing world, Volume II: XXI Int.
Grassland Congr. and VIII Int. Rangeland Congr., Hohhot, China, 29
June-5 July. p. 361.
Wang Q (2005). Coupling effects of water and fertilizer on seed yield
and the yield performance of six grasses species, Ph.D. diss. China
Agricult. Univ. Beijing.
Wang Q, Cui J, Zhou H, Wang X, Zhang T, Han J (2010). Path
coefficient and ridge regression analysis to improve seed yield of
Psathyrostachys juncea Nevski, Proc. 7th Int. Herbage Seed Conf.
Dallas TX. USA.
Wang Q, Zhang T, Cui J, Wang X, Zhou H, Han J, Gislum R (2011).
Path and Ridge Regression Analysis of Seed Yield and Seed Yield
Components of Russian Wildrye (Psathyrostachys juncea Nevski)
under Field Conditions. PLoS One. 6: 18-245.
Wu YQ, Taliaferro CM, Martin DL, Anderson JA, Anderson MP (2008).
Correlation analyses of seed yield and its components in
bermudagrass. Multifunctional grasslands in a changing world,
Volume II: XXI Int. Grassland Congr. and VIII Int. Rangeland Congr.,
Hohhot, China, 29 June-5 July. p. 562.
Yandell BS (1997). Practical data analysis for designed experiments.
Chapman & Hall, London.
Young WC, Youngberg HW, Silberstein TB (1998a). Management
studies on seed production of turf type tall fescue: I. Seed yield.
Agron. J. 90: 474-477.
Young WC, Youngberg HW, Silberstein TB (1998b). Management
studies on seed production of turf type tall fescue: II. Seed yield
components. Agron. J. 90: 478-483.

African Journal of Biotechnology Vol. 10(59), pp. 12595-12601, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1240
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Response of fed dung composted with rock phosphate
on yield and phosphorus and nitrogen uptake of maize
crop
Sharif, M. 1 *, Matiullah, K. 2 , Tanvir, B. 3 , Shah, A. H. 1 and Wahid, F. 1
1 Department of Soil and Environmental Sciences, Agricultural University, Peshawar, Pakistan.
2 Water Resources Research Institute, National Agricultural Research Center, Islamabad, Pakistan.
3 Department of Botany, Peshawar University, Peshawar, Pakistan.
Accepted 29 August, 2011
Two experiments were conducted to determine the extent of phosphate (P) solubility from rock
phosphate (RP) fed dung through composting with RP and to determine its effects on yield and P
uptake of maize crop. Different composts of RP fed dung and simple dung were prepared with and
without RP. Field experiment was conducted on silty clay loam soil at the research farm of Khyber
Pakhtunkhwa Agricultural University, Peshawar to study the effect of RP fed dung composted with RP
on the yield, yield components and P uptake of maize (Zea mays. L. Azam). The fertilizers, N, P and K,
were applied at the rate of 120- 90- 60 kg ha -1 , respectively in a randomized complete block design
(RCBD) with three replications. Compost and urea were used as a fertilizer source for N, compost and
single super phosphate (SSP) as a fertilizer source for P and sulphate of Potash (SOP) was used as a
fertilizer source for K. Application of the compost prepared from RP fed dung with RP, improved the
yield and yield components of maize crop. The maximum and significantly (P ≤ 0.05) increased grain
yield of 3264 kg ha -1 , total dry matter yield of 9634 kg ha -1 , stover yield of 7293 kg ha -1 , and thousand
grain weight (231 g) of maize crops were recorded in the treatment where full dose of the prepared
compost was applied with half dose of SSP, followed by the treatment of full recommended SSP. The
data of soil analysis showed increase in soil organic matter content and a decreasing trend in soil pH
values. Application of compost with SSP significantly (P ≤ 0.05) increased soil N and P concentration
and their uptake by the maize plants. Maximum net return of Rs. 24060 ha -1 with a value cost ratio (VCR)
of 3.0:1 was obtained by the application of full dose of compost with half SSP, followed by the treatment
of full dose of compost applied alone with a net return of Rs. 14555 ha -1 and VCR of 2.8 : 1. Results
suggest that application of the compost prepared from RP fed dung with RP is economical,
environment friendly and has the potential to improve maize yield, plants N and P uptake.
Key words: Maize, dung, rock phosphate, composts, yield, plants P uptake.
INTRODUCTION
Phosphorous is considered as the second macronutrient
after nitrogen, which is essential for plant growth. Plants
absorb P as primary orthophosphate (H2PO4 -1 ) or
secondary orthophosphate (HPO4 -2 ). Relative quantities
of these ions taken up by plants depend on soil pH. In
acidic soil, H2PO4 -1 dominates, while alkaline soils have
-2
abundance of HPO4 . The inorganic P is derived from the
*Corresponding author. E-mail: msharif645@yahoo.com.
weathering of rocks containing mineral apatite, while
organic P is derived from plants and animals’ residues.
The inorganic form of P is present in a variety of
combination with Fe, Al, Ca and Mg plus other elements.
The relative importance of each type in a soil will be
largely dependent on soil pH and amount of clay
(Chavarria, 1981). Quantification of N use efficiency
requires better understanding of soil N mineralization
during plants’ growth period. Ismaily et al. (2008)
reported that soil N content and its plant availability
increased with the application of organic manures.

12596 Afr. J. Biotechnol.
However, the potential of N mineralization of organic
residues and their impact on crop growth varied (Deenik
and Yost, 2008).
Organic materials have beneficial effects on soil fertility
and physical properties of soil. The physical properties of
soil play an important role in influencing the behaviors of
plant growth, thereby contributing to efficient crop
production. Farm yard manure (FYM) on an average
contains 0.5% N, 0.2% P2O5 and 0.5% K2O. Application
of organic materials to the soil reduces the dependence
on chemical fertilizers (Guar, 1990). The addition of
organic materials to the soil helps microorganisms to
produce polysaccharides and organic acids which
improve the soil structure and help in P solubilization
(Guar, 1994). The availability of P can be increased if
mixed with FYM and other organic materials. Organic
materials application to soil increase water holding
capacity, water infiltration rate, improve soil aeration,
conserve soil moisture, porosity and decrease soil bulk
density, thereby contributing to efficient crop production
(Castellanos and Munoz, 1985).
Composting is a biological process in which microorganisms
convert organic materials into a soil like
material called compost. During composting, microbes
utilize the carbon of organic matter as a source of energy
and for synthesis of new microbial cells. Optimum
conditions for decomposition of organic materials in
composting pile are oxygen (>5 %), moisture content (40
- 65 %), C/N ratio (< 30:1) and temperature (90 to 140°F).
However, the smaller the particle size, the faster it will be
turned into compost. Smaller particle sizes have a large
surface area that can be attacked by microbes readily.
Composting of manures and other organic materials with
rock phosphate (RP) has been shown to enhance the
solubility of P from RP (Mishra and Bangar, 1986; Singh
and Amberger, 1991) and is practiced widely as a lowinput
technology to improve the fertilizer value of
manures (Mahimairaja et al., 1995).
Maize (Zea mays. L.), along with wheat and rice, is one
of the world's leading grain crops. It is a source of food,
feed and fodder and it constitutes 6.4% of the grain
production. The grain of maize is a valuable source of
protein (10.4%), fats (4.5%), starches, vitamins and
minerals (71.8%). In spite of the high yielding potential of
maize, its yield per unit area is very low in Pakistan as
compared to advanced countries of the world. The area,
production and average yield in Pakistan is 1052.1
thousand ha, 3593.0 thousand tons and 3415 kg ha -1 ,
respectively, while in KPK province, the area, production
and average yield is 509.5 ha, 957.9 tons and 1880 kg
ha -1 , respectively (MINAFL, 2008, 2009).
Research investigations have been mainly focused on
the quality of composts (Liang et al., 1996) and on the
forms and availability of compost nitrogen N (Kuo, 1995
and Sanchez et al. 1997), and little has been done to
unravel the forms and availability of P. Keeping in view
the important role of organic materials in solubilizing P
from RP by creating a suitable environment in the
medium through releasing of organic acids, this experiment
was planned to determine the extent of P solubility
from RP fed FYM by composting with RP and then
determining its effects on the growth, yield and P uptake
of maize crop.
MATERIALS AND METHODS
Experiments were conducted to determine the extent of P solubility
from RP fed dung through composting with RP and then to
determine its effects on the yield and P and N uptake of maize crop.
Experiment 1: Composting RP fed dung with rock phosphate
Rock phosphate of Hazara area was mixed with animal feed at the
rate of 2% and fed to some selected animals. The dung collected
from these animals was composted with further RP using the ratio
of 2 : 1 (Dung : RP) according to the procedure as described by the
Food and Agriculture Organization (FAO) (1977). Mixture of
effective microorganism (EM) and molasses solution was sprayed
uniformly on these materials before dumping into pits. Thorough
mixing of the organic materials was done uniformly for the inputs’
contents. Reshuffling/mixing was carried out with an interval of 15
days. The heaps were covered with polythene sheet for maintaining
heat, while the moisture contents of the heap were frequently
observed. Data on organic C, total N, extractable P and pH were
recorded. Composts become ready for use when the temperature in
the pits drop to the temperature of the surrounding air, it smells
earthy not sour, putrid or like ammonia, it no longer heats up after
turned or watered, it looks like dark soil and does not have
identifiable food items, leaves or grass. However, the volume of the
well prepared compost becomes reduced. Composts so prepared
were applied to maize crop to determine its effects on the yield and
plants’ P uptake.
Experiment 2: Response of RP fed dung composted with RP
on maize crop
A field experiment on "Response of RP fed dung composted with
RP on the yield and P and N uptake of maize crop (Zea mays L,
Azam) was conducted at Agriculture Research Farm of KPK
Agriculture University, Peshawar in Kharif season during 2010.
Chemical fertilizers were applied at the rate of 120, 90 and 60 kg
ha -1 for N, P and K, respectively in the form of urea and compost for
N, SSP and compost for P and SOP for K on the basis of their
analysis. The experiment was done as a randomized complete
block design (RCBD) with three replications. There were seven
treatments with a plot size of 3 x 5 m 2 . The row to row distance was
75 cm and plant to plant distance was 50 cm with a seed rate of
120 kg ha -1 .
Soil and plant analysis
Composite soil samples at the depth of 0 to 20 cm were collected
from each treatment after crop harvests and analyzed by using
established standard procedures. Soil pH was determined by
McClean (1982), soil texture by Koehler (1984), soil organic matter
(SOM) by Nelson and Sommers (1982) and Ammonium
bicarbonate – diethylene triamine penta acetic acid (AB-DTPA) and
extractable P and K were determined by Soltanpour and Schwab
(1977). Total N concentrations in soil and plant samples were
determined by Kjeldhal method (Bremner and Mulvaney, 1996). Representative plant samples were collected from each treatment

and analyzed for phosphorous concentration by wet digestion
method (Walsh and Beaton, 1977). However, the parameters
recorded in this experiment were maize grain yield, total dry matter
yield, stover yield, thousand grains weight, soil and plants N and P
concentrations and their uptake by maize plants.
Statistical analysis
The data collected were analyzed statistically according to the
procedure given by Steel and Torrie (1980) using MStatC package,
while least significant difference (LSD) test was used for any
significant difference among the treatments.
RESULTS AND DISCUSSION
Composting experiment
The RP fed and unfed animals’ dung was composted with
and without RP and their properties were determined with
time (Table 1).
It is evident from Table 1 that with composting,
extractable P increased by 56% in RP fed dung without
RP and 110% with RP, while 107% increase was observed
in cases where simple dung was composted with
RP. Composting RP fed dung and simple dung with RP
increased P concentration to 96 and 91%, respectively
when compared with composting these materials without
RP. Total N increased by 6% in RP fed dung without RP
and by 23 and 22% in RP fed dung and simple dung with
RP, respectively, while it increased by 283 and 249% in
RP fed dung composted without RP. Organic carbon
decreased by 93, 113 and 85% in RP fed dung without
and with RP and in simple dung with RP, respectively
with composting. Slight reduction in pH values was noted
by composting RP fed dung and simple dung.
Crop experiment
A field experiment was conducted to study the response
of compost prepared from RP fed dung with RP on the
yield and yield components of maize (Zea mays. L.
Azam) at the research farm of Khyber Pakhtunkhwa
Agricultural University, Peshawar, during kharif season,
2010. The soil under study was silty clay loam in texture,
calcareous in nature (18% CaCO3) and alkaline in
reaction (pH 8.1), although it was low in organic matter
content (0.81%) and available phosphorus (3%).
Yield and yield components of maize crop
Data regarding maize grain yield, total dry matter yield,
stover yield and thousand grains weight are presented in
Table 2.
Grain yield
Maximum and significantly (P < 0.05) increased maize
Sharif et al. 12597
grains yield of 3264 kg ha -1 was recorded in the treatment
where full dose of compost was applied with half dose of
SSP followed by the treatment of half compost, half SSP
and full dose of SSP (Table 2). Ibrahim et al. (2008)
concluded that the application of organic fertilizers
increased the grain yield of maize significantly.
Total dry matter yield
Statistical analysis of the data indicated that compost
significantly (P ≤ 0.05) affected the total dry matter yield
of maize (Table 2). The maximum dry matter yield (9634
kg ha -1 ) was obtained in a treatment where full dose of
compost and half dose of recommended SSP were
applied, while the minimum (8517 kg ha -1 ) dry matter
yield was obtained in the treatment where no fertilizer
was applied. Khan et al. (1993) concluded that the total
dry matter yield increased significantly by the application
of organic fertilizers mixed with rock phosphate.
Stover yield
Maximum Stover yield of 7293 kg ha -1 was obtained
intreatments where full dose of compost and half dose of
SSP were applied (Table 2). This increase in Stover yield
was followed by the treatment of full SSP. However, the
lowest Stover yield of 6711 kg ha -1 was observed in the
treatment where no fertilizer was applied.
Thousand grains weight
The study’s data showed that the maximum thousand
grains weight of 231 g was obtained in the treatment
where a full dose of compost with half dose of SSP was
applied (Table 2), while the control treatment showed 166
g thousand grains weight as the minimum. Song et al.
(1998) found that a combination of organic and NPK
fertilizers had a significant effect on 1000 grains weight of
maize. However, the increasing order was seen as full
compost + half SSP > full SSP > half compost + half SSP
> full compost > N and K > half SSP > control.
Post harvest soil pH values, organic matter, total N
and extractable P contents
Data regarding post harvest soil pH values, organic
matter, total N and extractable P contents are presented
in Table 3. It was observed that application of the prepared
compost caused slight reduction in soil pH values.
Treatments, where full dose of compost was applied
alone and with half dose of SSP indicate pH values of
7.58 and 7.56, respectively. The decrease in soil pH
values was due to the release of H + ions during
mineralization process of organic and inorganic fertilizers.

12598 Afr. J. Biotechnol.
Table 1. Extractable phosphorus, total nitrogen, organic carbon concentrations and pH values of different organic
materials as affected by composting with RP.
Treatment
Extractable phosphorus
Concentrations (%)
Total nitrogen Organic carbon
pH value
Initial Final Initial Final Initial Final Initial Final
RP fed dung 0.73 1.143 (56) 1.105
1.175
(6.3)
45.3 41.9 8.30 8.27
Fed dung + RP 1.121 2.356 (110) 1.178 1.452 (23) 45.5 40.12 8.30 8.25
Simple dung + RP 1.119 2.321 (107) 1.145 1.403 (22) 45.8 39.1 8.30 8.25
Simple FYM - 0.639 - 1.065 - 43.65 - 8.29
Values in parenthesis show percent increase by composting organic materials without and with RP.
Table 2. Effect of the prepared compost on grain yield, total dry matter yield, stover yield and thousand grains weight of
maize.
Treatment
Grains yield
(kg ha -1 )
Total dry matter yield
(kg ha -1 )
Stover yield
(kg ha -1 )
Control 1806 a * 8517.1 c * 6711 b * 166 e *
N and K Fertilizers 2228 c 9054.0 b 6087 c 189 d
Half dose of SSP 2525 c 9520.8 ab 6725 b 183 d
Half Compost + Half SSP 2763 b 9342.1 ab 6639 b 208 c
Full dose of Compost 2871 b 9351.5 ab 6763 b 202 c
Full Compost + Half SSP 3264 a 9633.6 a 7293 a 231 a
Full SSP dose 2815 b 9488.1 ab 7012 ab 219 b
Mean with different letter(s) in the columns are significantly different at P ≤ 0.05.
Table 3. Effect of the prepared compost on post harvest soil pH, organic matter, and N and P contents.
1000 grains
weight (g)
Treatment Soil pH (1:5) SOM (%) Total N (mg kg -1 )
AB-DTPA extractable
P (mg kg -1 )
Control 7.90 0.95 1200 e * 1.62 bc *
N and K fertilizers 7.70 1.08 2100 d 1.35 c
Half SSP 7.74 1.55 2000 d 3.56 a
Half compost + Half SSP 7.72 1.65 3100 c 2.38 b
Full compost 7.58 1.79 4200 b 2.27 b
Full compost + half SSP 7.56 1.89 4900 a 4.02 a
Full SSP 7.58 1.72 4900 a 3.44 a
Mean with different letter(s) in the columns are significantly different at P ≤ 0.05.
As such, the use of different organic fertilizers caused a
reduction of soil pH values, which released H + from
fertilizers during the nitrification process (Akram, 1978).
The application of full dose of compost with half dose of
SSP showed the maximum (1.89%) soil organic matter
content, followed by the treatment of full compost when
applied alone (1.79%), while the lowest organic matter
content of 0.95% was found in the control treatment
(Table 3). Rabindra and Gowda (1986) reported that the
use of a careful combination of organic and inorganic
fertilizers increased the organic matter content, whereas
Subramanian and Kamarasswamy (1989) and Wang et
al. (2000) concluded that NPK plus organic manure
treatments increased the organic matter content of soil.
Total soil N content was maximum (4900 mg kg -1 ) in
the treatment where combination of a full dose of
compost and a half dose of SSP were applied, followed
by the treatment of a full dose of recommended SSP,
while the minimum nitrogen content of 1200 mg kg -1 was
noted in control treatment (Table 3). Esilab et al. (2000)
concluded that application of organic manures and NPK
increased maize yield and improved the soil nitrogen

Table 4. Effect of compost on plants N and P uptake.
Treatment Plant uptake N (kg ha -1 ) Plant uptake P (kg ha -1 )
Control 67.0 f * 6.57 c *
N and K Fertilizers 132.7 e 7.84 bc
Half dose of recommended SSP 159.2 c 15.27 ab
Half compost + Half SSP 175.6 b 17.25 ab
Full compost 144.6 d 17.63 ab
Full compost + half SSP 190.7 a 17.99 a
Full recommended dose of SSP 185.9 ab 17.87 ab
* Mean with different letter(s) in the columns is significantly different at P ≤ 0.05.
Table 5. Economic analysis of the applied fertilizers.
Treatments
Yield
(kg ha -1 )
Yield increase
(kg ha -1 )
Increased yield
value (Rs.ha -1 )
Cost of fertilizers
(Rs.ha -1 )
Sharif et al. 12599
Net return
(Rs.ha -1 )
VCR**
N and K 2228
Half SSP 2525 297 10395 4250 6145 2.4 :1
Half SSP + half compost 2763 535 18725 8225 10500 2.3 :1
Full compost 2871 643 22505 7950 14555 2.8 :1
Full compost + Half SSP 3264 1036 36260 12200 24060 3.0 :1
Full SSP 2815 587 20545 8500 12045 2.4 :1
Price of maize = Rs, 35 kg -1 ; Dung = Rs. 400 ton -1 ; RP = Rs. 4.50 kg -1 and SSP = Rs. 850 bag -1 ; *net return = value of increased yield - cost of
fertilizer; **VCR = value of increased yield / cost of fertilizer
concentration. In their study, maximum AB-DTPA extractable
P concentration in soil was (4.02 mg kg -1 ) observed
in treatment where full dose of compost and half dose of
SSP were applied with non-significant difference in SSP
treatment. Nonetheless, the minimum phosphorus content
(1.62 mg kg -1 ) was found in the control treatment (Table
3). Laskar et al. (1990) showed that the use of RP alone
and in combination with organic manures significantly
increased the total organic P content in soils.
Plants N and P uptake
Statistical data in Table 4 indicate that the maximum N
uptake of 190.7 kg ha -1 was recorded in the treatment
where full compost with half dose of recommended SSP
were applied followed by the treatment of recommended
SSP, while minimum nitrogen uptake of 67 kg ha -1 was
noted in the control where no fertilizer was applied.
Maximum P uptake of 17.99 kg ha -1 was observed in
treatments where a combination of full dose of compost
and half dose of SSP were applied followed by the
treatment of full dose of recommended SSP. Minimum
nitrogen uptake of 6.57 kg ha -1 was recorded in the
control where no fertilizer was applied. Erdal et al. (2000)
reported that N and P accumulation in plants were
increased by applying organic materials such as dung
with chemical fertilizers.
Economic analysis of fertilizers
Economic analysis of the applied fertilizer is shown in
Table 5. Maximum net return of Rs. 24060 ha -1 with value
cost ratio (VCR) of 3.0:1 was recorded by the application
of full compost with half SSP, followed by the treatment of
full dose of recommended SSP with net return of Rs.
14555 ha -1 and VCR of 2.8:1.
The soils of Pakistan are nutrient deficient, especially in
nitrogen and phosphorus. With the possible exception of
N, no other element has been as critical in plant growth
as P. Lack of this element is doubly serious since it may
prevent other nutrients from being acquired by the plants.
Phosphorus is known to be involved in a plethora of
functions in plant growth and metabolism.
Exploitation of soil natural resources and their
utilization, as an economical and environmentally friendly
source of fertilizer for increased crop production on
sustainable basis, plays key roles in the development of a
country like Pakistan.
Pakistan has RP deposits in Hazara division of Khyber
Pakhtunkhwa province. The reserves are wide spread in
the Kakul, Galdaman, Tarnawai and Lagerban villages
of District Abbottabad. The so far reported exploration

12600 Afr. J. Biotechnol.
exploration indicates that total reserves are about
35.7 million tonnes, out of which 14.7 million tonnes are
of proven quality and they contain 26 to 31% P2O5. The
remaining reserves of 21 million tonnes are of inferred
quality. The total proven quality reserves are 14.7 million
tonnes, while the inferred are 21 million tonnes. The
proven reserves at Tarnawai have a potential sustained
annual production of 60,000 tonnes for a period of 30
years. Van Kauwenbergh et al. (1991) stated that the
high cost of importing soluble P fertilizer is, therefore,
forcing many developing countries to increasingly turn to
the use of local RP resources to improve their agricultural
production.
Many researchers have proved that many microorganisms
in soil produce organic acids like carbonic
acids, acetic acids, citric acids, etc. These acids create
favorable environment for the enhancement of P solubility
from the applied RP. Kucey et al. (1989) has shown that
the microbial solubilization of soil phosphate in liquid
medium studies have often been due to excretion of
organic acids. The availability of P from RP can be
increased by several means. The RP is basically complex
of tri-calcium phosphates [Ca3 (PO4)2]3.CaCo3 insoluble in
water. Its soluble form is monocalcium phosphate [Ca
(H2PO4)2], which is generally called super phosphate (that
is, SSP, DSP and TSP). The solubility can be enhanced
by treatment with mineral acids, organic acids, a mixture
of organic materials, biological treatment, etc.
Biological solubilization of RP is more environmental
friendly and economical than acidulation. There is a need
therefore to develop the microbial process that will make
phosphorus available for plant use with minimum
pollution to the environment. Composting of manures and
other organic materials with RP has been shown to
enhance the solubility of P from RP (Mishra and Bangar,
1986; Singh and Amberger, 1991) and is practiced widely
as a low-input technology to improve the fertilizers value
of manures (Mahimairaja et al., 1995). Govi et al. (1996)
reported that the compost made from selected organic
waste was used alone and in mixture (25% of volume)
with a substrate from straw beeded horse manure. The
compost was found to be suitable for cultivation of crops
growth. Rajan et al. (1996) argued that RP has the
potential to improve soil fertility and increase agriculture
production as P fertilizer do, but the extent of suitability
varies with soil, crop, climatic condition and mineral
composition of RP. Gajdos (1992, 1997) prepared
different composts using a wide range of wastes like
sewage sludge, poultry manure, pig slurry, olive mill
wastewater, city refuse and the lignocellulosic wastes
cotton waste, maize straw and sweet sorghum bagass.
Their chemical and biological properties were studied at
four stages of the composting process; in the initial
mixture, at the thermophilic phase, at the end of the
active phase and after two months of maturation and the
maturation indexes, based mainly on humification of the
organic materials.
Conclusion
Phosphorus concentration increased by 56 and 110% in
RP fed dung composted without and with RP,
respectively and 107% in simple dung composted with
RP. Maize yield and yield components with plant N and P
uptake recorded by the application of full dose of
compost with half dose of SSP were higher or almost
similar to those observed in the treatment of full
recommended dose of SSP. The value cost ratio of 3.0
with maximum net return of Rs. 24060 ha -1 was obtained
by the application of full compost with half SSP, followed
by the treatment of full dose of compost with net return of
Rs. 14555 ha -1 and VCR of 2.8. The composting RP fed
dung and simple dung with RP has the potential to
enhance P solubility, which may be supplemented with
SSP to minimize dependence on the expensive chemical
fertilizers. Further research is suggested to prepare
composts of different organic materials with RP and
determine their direct and residual effect on various crops
in different agro ecological zones of Pakistan.
REFERENCES
Akram M (1978). Effect of organic and inorganic fertilizers applied to
maize crop. M.Sc (Hons) Thesis. Deptt. Soil. Sci. Univ. Agric.
Faisalabad, Pakistan.
Bremner JM, Mulvaney CS (1996). Nitrogen-total. In A. L. Page., R.H.
Miller., and D. R. Keeney (ed.). Methods of soil analysis. Part 2. 2 nd
ed. Agronomy. 9: 595-621.
Castellanos JZ, Munoz JA (1985). Soil physical properties and alfalfla
as affected by manure application to low infiltration clayed soil,
Proceeding of the Agricultural wastes. Chicago, Illinois. USA, pp. 16-
17.
Chavarria JM (1981). Hand book on phosphate fertilizers. ISMAN
Limited, 28 Rue Marbeuf 75008. Paris.
Deenik JL, Yost RS (2008). Nitrogen mineralization potential and
nutrient availability from five organic materials. Soil Sci., 173 (1): 54-
68.
Erdal I, Bozkurt MA, Cimrin KM, Karaca S, Salgam M (2000). Effects of
humic acid and phosphorus application on growth and phosphorus
uptake of corn plant (zea mays L.) grown on a calcareous soil. Turk
J. Agric. Forest. 24(6): 663-668.
Esilaba AO, Reda F, Ransom JK, Bayu W, Woldewahid G, Zemichael B
(2000). Integrated nutrients management strategies for soil fertility
improvement and Striga control in Northern Ethiopia. Afr. Crop. Sci.
J., 8(4): 403-410.
FAO (1977). Recycling of organic wastes in Agriculture. Soil Bull, 40.
FAO., Rome.
Gajdos R (1992). The use of organic waste materials as organic
fertilizers, recycling of plant nutrients. International symposium on
compost recycling of wastes. Athens Greece. (302): 325-331.
Gajdos R (1997). Product oriented composting from open to closed
bioconversion system. Acta University Agricultureae Sueciae Agrraia,
(68): 7-144.
Govi G, Sacchini G, Galli C, Sequi P, Papi T (1996). Compost from
selected organic wastes as a substitute for straw beeded horse
manure in Agaricus bioporus production. Sci. Composting Part 1:
439-446.
Guar AC (1990). Phosphatase Solublising Microorganisms as
Biofertilizers. Omega Scientific Piblishers. New Delhi India. p. 176.
Guar AC (1994). Bulky organic manures and crop residues. In: Tandon
HLS (ed.), Fertilizers, Organic Manures, Recyclable Wastes
Management, pp. 165-167.
Ibrahim M, Ahmad N, Khan A (1993). Use of pressmud as source of

phosphorus for crop production. Pak. J. Sci. Ind. Res., 36 (2-3): 110-
113.
Ibrahim M, Hassan A, Iqbal M, Valeem E.E (2008). Response of wheat
growth and yield to various levels of compost and organic manure.
Pak. J. Bot., 40(5): 2135-2141.
Ismaily AL, Said S, Walworth JL (2008). Effect of osmotic and matric
potentials on N mineralization in un amended and manure-amended
soils. Soil Sci., 173(3): 203-213.
Koehler FE, Moudre CD, Mcneal BL (1984). Laboratory manual for soil
fertility. Washington State University Pulman, USA.
Kucy RMN (1989). Increased P uptake by wheat & soyabean
application with RP inoculated with P solubilizing microorganisms.
Environ. Microbiol., 52: 2699-2703
Kuo SU (1995). Nitrogen and phosphorus availability in ground fish
waste and chitin-sludge cocomposts. Compost. Sci. Util. 3 (1995). pp.
19-29.
Laskar BK, Debnath NC, Basak RK (1990). Phosphorus availability and
transformation from Massoorie RP in acid soils. Environ. Ecol. 8: 612-
616.
Liang.BC, Gregorich EG, Schnitzer M, Schulten HR, Mathur GM (1960).
Effect of long-term application of fertilizers and manures on soil
properties and yield under cotton-wheat rotation in north-west
Rajasthan. J. Soc. Soil. Sci., 45: 288-292.
Mahimariraja S, Bolan NS, Hedley MJ (1995). Agronomic effectiveness
of poultry manure composts Commun. Soil Sci. Plant Anal., 26: 1843-
1861.
McCLean EO (1982). Soil pH and lime requirement. In Page AL, Miller
RD and Keeney DR (ed.) Methods of soil analysis part 2. 2 nd ed.
Argon. Madison. W. I. 9: 199-208.
Ministry of food, Agriculture and Livestock (MINFAL) (2009). Agricutural
Statistic of Pakistan, Govt. of Pakistan, Islamabad.
Mishra AA, Bangar KC (1986). Phosphate rock compositing:
transformation of phosphorus forms and mechanism of stabilization,
Biol. Agric., pp. 331-340.
Nelson DW, Sommer LE (1982). Total carbon, Organic carbon and
organic matter. In Page AL, Miller RH and Keeney DR (ed.) methods
of soil analysis part 2. 2 nd (ed.) Agron., 9: 574-577.
Sharif et al. 12601
Rabindra B, Gowda H (1986). Long range effect of fertilizers, lime and
manure on soil fertility and sugarcane yield on red sandy loam soil
(Udic Haplustalf). J. Indian Soc. Soil Sci., 34(1): 200-202.
Rajan SS, Watkinson JH, Sinclair AG. (1996). Phosphatic rock for direct
application to soils. Ad. Agron. Omega Scientific Piblishers, New
Delhi. 57: pp. 78-159; 176.
Sanchez R, Place KD, Buresh PM, Izac RJ (1997). Soil fertility
replenishment in Africa. In: Buresh, (e.d.), Replenishing soil fertility in
Africa". Soil Sci. Soc. of Amer. special publication No. 51. SSSA.
Madison. WI.
Singh CP, Amberger AA (1991). Solubilization and availability of
phosphorus during decomposition of rock phosphate enriched straw
and urine. Biol. Agric. Horticult., 7: 261-269.
Soltanpour PN, Schwab AP (1977). A new soil test for simultaneous
extraction of macro and micro nutrients in alkaline soils
communcation Soil. Sci. Plant Anal., 8: 195-207.
Steel RG, Toorie JH (1980). Principles and procedures of statistics. A
biometrical approach. McGraw-Hill, New York.
Subramanian NS, Kamarasswamy J (1989). Effect of continous
cropping and fertilization on chemical properties of soil. J. Ind. Soc.,
37: 17173.
Van K (1991). Overview of P deposits in East and Southern Africa. Pert.
Res., pp. 30127-30150. View Record in Scopus (19).
Walsh LM, Beaton JD (1977). Soil testing and plants analysis. Soil
Science America Inc. Madison. Wisconsin.
Wang XD, Zhang YP, Fan XL (2000). Effect of long term fertilization on
the properties of organic matter and humic acids. Scientia Agric.
Sincia, 33(2):75-81.

African Journal of Biotechnology Vol. 10(59), pp. 12602-12613, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.329
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Seed viability, germination and seedling growth of
canola (Brassica napus L.) as influenced by chemical
mutagens
S. N. Emrani*, A. Arzani and G. Saeidi
Department of Agronomy and Plant Breeding, College of Agriculture, Isfahan University of Technology, Isfahan-84156
83111, Iran.
Accepted 7 July, 2011
Mutation induction is considered as an effective way to enrich plant genetic variation, particularly for
traits with a very low level of genetic variation. The objectives of this study were to evaluate the effect
of different dosages of chemical mutagens on seed germination, seed viability and seedling growth
characteristics and to identify optimum treatment conditions for chemical mutagens based on the LD50
criterion in canola (Brassica napus L.). Two pretreatment conditions of soaking in distilled water and
non-soaking, different concentrations of chemical mutagens, and four treatment periods were
investigated. The effect of mutagen dosage on seed viability was also assessed using the tetrazolium
staining test. Results revealed the significant effects of mutagen dosages and treatment periods on
seed viability and seed germination as well as on seedling characteristics for all the mutagens tested.
Additionally, it was found that increased dosage and period in each treatment led to significant
reductions in seed viability for the tested mutagens. Pretreatment did not significantly influence most of
the studied characteristics. The 0.8% ethyl methanesulfonate (EMS) for 6 h, 12 mM N-nitroso-Nethylurea
(ENU) and 6 mM sodium azide for 8 h and 9 mM N-nitroso-N-methylurea (NMU) for 4 h were
considered as optimum treatment conditions.
Key words: Brassica napus, canola, chemical mutagen, germination, seed viability, seedling growth.
INTRODUCTION
Canola (Brassica napus L.) is one of the most important
sources of vegetable oils and protein-rich meals
worldwide. Canola ranks third in global production of
oilseed crops and fifth among economically important
crops following wheat, rice, maize, and cotton
(FAOSTAT, 2011). With 7% saturated fats, canola oil
contains the least amount of saturated fats among the
common edible oils. The polyunsaturated fats in canola
oil include the essential fatty acid α-linolenic acid (omega-
3) and linoleic acid (omega-6) which help reduce choles-
*Corresponding author. E-mail: nazgol_6532@yahoo.com Tel:
+98 311 391 3453. Fax: +98 311 391 2254.
Abbreviations: EMS; Ethyl methanesulfonate, ENU; N-nitroso-
N-ethylurea and NMU; N-nitroso-N-methylurea.
terol in the blood stream. Canola oil is also a good source
of vitamins E and K and plant sterols which may keep the
heart healthy (McDonald, 2011). Therefore, canola oil is
promoted as one of the healthiest vegetable oils for
human consumption.
Availability of genetic diversity and genetic variation is
the heart of any breeding program which plays a critical
role in developing well-adapted and improved varieties.
Mutation induction is an effective tool to enhance the
genetic variation available to plant breeders, particularly
for traits with a very low level of genetic variation
(Szarejko and Forster, 2007). The high frequency with
which certain radiations and chemicals can cause genes
to mutate made it feasible to perform genetic studies that
were not possible when only spontaneous mutations were
available. Consequently, much of our knowledge of
genetics of higher organisms is based upon works
utilizing induced mutations for analyzing gene function

(McCallum et al., 2000). To date, several welldocumented
examples of successful applications of
mutation breeding to oilseed crops have been reported in
the literature (Ahmad et al., 1991; Bacelis, 2001; Bhatia
et al., 1999; Ferrie et al., 2008; Fowler and Stefansson,
1972; Kott et al., 1996; MacDonald et al., 1991;
Newsholme et al., 1989; Osorio et al., 1995; Parry et al.,
2009; Rowland, 1991; Sala et al., 2008; Schnurbush et
al., 2000; Spasibionek, 2006; Swanson et al., 1989;
Velasco et al., 2008). Induced mutations have been used
mainly to generate variation that could rarely be found in
germplasm collections. Mutation techniques have been
applied to improve such traits as earliness, semi
dwarfness, lodging resistance, disease resistance, yield
and quality (Bhatia et al., 1999; Newsholme et al., 1989;
Osorio et al., 1995; Parry et al., 2009; Rowland, 1991;
Schnurbush et al., 2000).
About 3088 mutant varieties have been developed
according to FAO/IAEA mutant varieties database
(FAO/IAEA, 2011). To date, 198 mutant cultivars of
annual oilseed crops including soybean, sesame, canola,
sunflower and linseed have been released (FAO/IAEA,
2011). Soybean with 155 mutant cultivars possesses the
highest number of mutant cultivars, followed by sesame
with 24 and canola with 15 cultivars. In canola, oil
modification has been achieved by using seed and
microspore mutagenesis (Ferrie et al., 2008; MacDonald
et al., 1991; Velasco et al., 2008). In spring canola,
radiation treatment has been applied to the seeds of
“Regent” cultivar and M5 lines selected with increased
oleic acid contents varying from 63 to 79%. In winter
canola, chemical mutagenesis was used to isolate two
canola mutants of the cultivar “Winfield” with high oleic
acid content (Wong and Swanson, 1991). Mutation
breeding in canola has been also used to improve
herbicide resistance (Ahmad et al., 1991; Sala et al.,
2008; Swanson et al., 1988, 1989), disease resistance
(Ahmad et al., 1991; MacDonald et al., 1991; MacDonald
and Ingram, 1986; Newsholme et al., 1989), and lower
glucosinolate content (Barro et al., 2002; Kott, 1998; Kott
et al., 1996). Chemical and physical mutagens are
available for mutagenic treatment of crop plants.
Nevertheless, several chemical mutagens have been
applied of which ethyl methane sulfonate (EMS), Nnitroso-N-methylurea
(NMU), N-Nitroso, N-Ethylurea
(ENU) and sodium azide are the preferred agents in plant
mutation induction (Medrano et al., 1986; Szarejko and
Forster, 2007). Alkylating agents are the most important
chemical mutagens used in mutation breeding. They add
ethyl or methyl groups to bases in the nucleotide
structure, which leads to activating a silent gene,
silencing an active gene, or altering a particular gene
action (Snustad and Simmons, 2006). Chemical
mutagens have not only been used for forward genetic
screens but also used for reverse genetic screens. To
date, databases of many gene sequences of model plant
species are available, and the prediction of gene function
Emrani et al. 12603
on the basis of comparisons among genomes is feasible.
It is still necessary to validate those predictions, and the
‘reverse genetics’ that is based on the mutagenesis of the
target gene can been employed. Chemical mutagenesis
has a number of inherent attractions such as the ability to
use different mutagens, change mutagen doses and to
easily scale the size of the mutagenesis procedure.
Optimization of the mutation induction conditions in
each plant species plays a critical role in the successful
employment of the mutagenic events (Padma and Reddy,
1977). Breeders must be aware of the genetic structure
and responses of plant genotype to a mutagen because
frequency and type of induced mutation depends on plant
genotypic background, mutagen concentration and pre
and post-treatment conditions. Mutagen dosage,
temperature, pH, pre-treatment and post treatment
influence mutagen action, production of M1 plants, and
M1 viability. These factors vary from plant to plant and
from mutagen to mutagen (Fowler and Stefansson, 1972;
Kharkwal, 1998). Mutagen dosage is the most important
factor that affects mutation frequency. Hence, defining
the optimal dose of a chemical mutagen is one of the
most critical steps that have often been complicated by
limited knowledge of the effects of environmental
conditions and environment by mutagen interaction on
both mutagenic and toxic impacts on plant tissues.
Optimal dose can be defined as the dosage leading to
adequate genetic variation accompanied by the lowest
plant lethality (Snustad and Simmons, 2006). Mutagen
dose, treatment period and their interaction can be
considered as the main factors also influenced by
pretreatment, temperature, pH, and post-treatment (Hu
and Rutger, 1992). Lethal dose 50 (LD50) is generally
used as a criterion to define the optimum mutagenic
dose. Bacelis (2001) investigated the effects of different
concentrations of EMS, ENU and NMU on variability of
two flax varieties and reported 0.025% ENU, 0.012%
NMU and 0.3% EMS as their optimal doses. Patil et al.
(2011) also introduced 0.1 to 0.2% EMS concentrations
as optimum dosages to induce maximum variations in
soybean populations. Fowler and Stefansson (1972)
evaluated EMS for mutagenesis in rapeseed (B. napus
L.) and observed that increasing EMS concentration from
0 to 1.0% adversely affected germination percentage,
plant vigor and seed yield. Germination test is an
indication of the potential of a seed lot to emerge under
field conditions. On the other hand, tetrazolium test is a
timely and accurate test for determining seed viability
(AOSA, 2000; Karrfalt, 2011). Landho and Jorgensen
(1997) used the tetrazolium test for evaluating Brassica
wild species and hybrids and found stained seeds which
did not germinate after 2 to 3 days due to dormancy.
Therefore, application of both germination and
tetrazolium tests, rather than by either one alone,
provides complementary evidence of seed viability (Elias
et al., 2006).
When developing mutagenized populations for breeding

12604 Afr. J. Biotechnol.
purposes, forward or reverse genetic analyses,
ascertaining the optimum mutation frequency and thus
appropriate size of a desirable mutagenized population is
crucial. Mutagen treatment is usually applied in such a
manner that it produces sufficient lethality while allowing
sufficient fertility, so that a high frequency of induced
mutations may be recovered in mutagenized population.
The objective of this study was to determine the optimal
doses and treatment conditions for four chemical
mutagens (EMS, NMU, ENU and sodium azide) in canola
using seed germination and tetrazolium test.
MATERIALS AND METHODS
Seeds of spring canola cultivar "RGS003" were exposed to four
chemical mutagens obtained from Sigma-Aldrich (St. Louis,
Missouri, USA) which comprised of ethyl methane sulfonate (EMS,
Sigma M0880), N-nitroso-N-methylurea (NMU, Sigma, N4766), Nnitroso-N-ethylurea
(ENU, Sigma N8509), and sodium azide (NaN3,
Sigma S2002). A 4 × 2 × 4 × 4 factorial design with a completely
randomized design having five replications was used. Each
replication consisted of a 120 × 20 mm Petri-dish with 100 seeds.
Four mutagens, two levels of pre-treatment period including
soaking in distilled water for 3 h and non-soaking, four dosages of
each mutagen along with control and four treatment periods
comprised the experimental factors. Seeds were treated with EMS
concentrations of 0 (control), 0.4, 0.8, 1.2 and 1.6% (v/v) for 3, 6, 9
and 12 h periods. For NMU and ENU treatments, the treatments
included solutions of 0 (control), 3, 6, 9 and 12 mM for 2, 4, 6 and 8
h. And for sodium azide treatments, seeds were treated with 0
(control), 2, 4, 6 and 8 mM solutions for 2, 4, 6 and 8 h. After
mutagen treatments, seeds were rinsed for 30 min with running tap
water to completely remove mutagens.
One hundred seeds per treatment were placed on a filter paper in
sterilized Petri dishes containing 15 ml distilled water. The Petri
dishes were placed in an incubator with 12 h of darkness at the
constant temperature of 25±1°C. Germination counts were made
after 2, 4, 6 and 8 days of incubation. Seeds were considered
germinated when the radicle was at least 3 mm long. For
germination percentage, the number of seeds germinated on day 7
was considered. The germination rate index was determined by
( Ni / Di)
as described by Carlton et al. (1968), where Ni is
∑
the number of seeds germinated between two counting’s and Di
represents the day of counting. Seedling height and radicle length
were determined in centimetres as the mean of 10 seven day-old
seedlings per treatment.
Seed viability was tested using a standard tetrazolium test
(AOSA, 2000). To evaluate the effects of different chemical
mutagen dosages on seed viability, an experiment was conducted
using a factorial experiment (4×4×4) with a completely randomized
design replicated three times. Four mutagens, four dosages of each
mutagen and four treatment periods were the factors of the
experiment. For each treatment, 100 seeds were placed between
moist paper towels for 8 h. They were then incubated in 1% (w/v)
solution of 2,3,5-triphenol tetrazolium chloride for 24 h at 25 ±1°C.
Seeds with stained embryos were scored as viable.
Statistical analysis
The germination percentage data was transformed using arcsin√x
(Steel and Torrie, 1980) and then subjected to analysis of variance
(ANOVA). Data from seed germination test was analyzed as a 4 × 2
× 4 × 4 factorial experiment with a completely randomized design
(CRD), replicated five times. Data from the viability test were
analyzed as a 4 × 4 × 4 factorial experiment with a CRD replicated
three times. ANOVA was carried out using PROC GLM of SAS
(SAS Institute Inc, 2008). Mean comparisons were conducted using
the Fisher’s (protected) least significant difference (LSD) test.
Linear correlation coefficients (r) were also calculated between
pairs of traits.
RESULTS
The results of analyses of variance indicated that
mutagen, dosage and treatment period significantly
influenced canola-seed germination percentage, germination
rate index, radicle length and seedling height
(Table 1). Pre-treatment significantly affected only germination
rate and radicle. Among the first-order interactions,
mutagen × treatment period and dosage × treatment
period were significant for all the traits. For seedling
height, second and third-order interactions were significant.
All the main effects (mutagen, dosage, treatment
period) along with first and second-order interactions
were highly significant for seed viability (Table 2).
Ethyl methane sulfonate
Average germination percentage reduced with increasing
mutagen concentration and treatment period where
germination percentage was reduced from 92.7% in the
control to 7.9% in the treatment with 1.6% EMS (Table 3).
This trait was also reduced by increasing treatment
period from 3 to 12 h where the germination percentage
changed from 65.1% in non-presoaked seeds treated for
3 h to 9.25% in presoaked seeds treated for 12 h with
EMS. The treatment with 1.6% EMS acting similar to
those of 12 h treatment with different concentrations of
this mutagen almost blocked seed germination. The
highest germination rate index (37.9) belonged to the
presoaked control treatment and the least amount was
related to the 9 h treatment with 1.2% of EMS in of nonpresoaked
seeds (Table 4).
Seedling height and radicle length also decreased with
increasing EMS concentration and treatment period
(Tables 5 and 6). Pre-soaking did not significantly alter
seedling height and radicle length traits. In both pretreatment
conditions, treatment periods higher than 6 h
affected neither the germination rate nor the seedling
height of EMS-treated seeds. Non-presoaked seeds
performed superior than presoaked ones in most of the
treatments. Mean comparisons of seed viability for the
EMS treatment are presented in Table 7. Seed viability
varied between 0 for the treatment with 1.6% EMS for 12
h to 89.7% for the control. Means of germination percentage
just like seed viability grouped canola genotypes
into 9 different classes. The twelve hour treatment with
1.6% EMS induced the least amount of both germination
percentage and seed viability.

Emrani et al. 12605
Table 1. Analyses of variances for germination percentage, germination rate, radicle length and seedling height in canola
mutants.
Source of variation df
Germination
percentage
Mean square
Germination rate
index
Radicle
length
Seedling
height
Mutagen (M) 3 2.83** 2104.39** 716.42** 299.91**
Pre-treatment (P) 1 0.004 388.83** 2.81 0.01
Dosage (D) 4 1.79** 680.38** 54.82** 11.34**
Treatment period (T) 3 2.46** 2662.98** 120.69** 17.78**
M×P 3 0.01 160.81** 4.06* 0.91**
M×D 12 0.53** 439.44** 19.86** 1.72**
M×T 9 0.49** 248.99** 28.66** 2.72**
P×D 4 0.02 55.87* 1.30 0.79**
P×T 3 0.03 77.96** 9.90** 4.10**
D×T 9 0.04* 17.18 1.86 2.08**
M×P×D 12 0.03 40.32* 1.89 0.38*
M×P×T 9 0.02 16.30 5.23** 1.11**
M×D×T 27 0.05** 50.25** 4.01** 0.64**
P×D×T 9 0.04* 37.70 1.45 0.44*
M×P×D×T 27 0.02 17.31 1.53 0.79**
Residual 408 0.02 23.19 1.47 0.22
C.V. 17.87 30.41 23.76 16.67
* and ** significant at 0.05 and 0.01 of probability levels, respectively.
Table 2. Analysis of variance for seed viability in canola mutants.
Source of variation df Mean square
Mutagen (M) 3 0.59**
Dosage (D) 4 0.60**
Treatment period (T) 3 0.73**
M× D 12 0.08**
M×T 9 0.11**
D× T 9 0.05**
M× D×T 27 0.06**
Residual 136 0.01
C.V. 8.87
** Significant at P≤0.01.
N-Nitroso, N-ethyleurea
Increasing mutagen dosages decreased germination
percentage in a way that the presoaked control and the 8
h non-presoaked treatment with 12 mM ENU led to the
highest and the lowest amounts of germination
percentages, respectively (Table 3). Treatment of soaked
seeds with 6 mM ENU for 6 h yielded the lowest
germination rate among the treatments. On the other
hand, the 2 h treatment of non-presoaked seeds with 12
mM of this mutagen produced the highest germination
rate which was even greater than that of the control
(Table 4). Application of this treatment to non-presoaked
seeds also induced the lowest amount of radicle length
and seedling height.
The six hour presoaked seed treatment with 12 mM
ENU had the highest amount of radicle length with no
significant difference from the control treatment (Table 5).
Increasing ENU dosage reduced seedling height.
Presoaked seeds treated with 3 mM ENU for 8 h
produced the highest seedling height, which was even
higher than that of the control treatment (Table 6). Pretreatment
significantly affected germination rate and
seedling height of ENU-treated canola seeds. Germination
rate was reduced by soaking but pre-soaked
seeds had a higher seedling height except for the 2 h
treatment with this mutagen (Table 4). The highest seed
viability belonged to the control treatment, while the
seeds treated with 9 mM ENU for 8 h led to the highest
reduction in this trait (Table 7). This trait divided mutant
seeds to 13 different groups. Germination percentage
also showed high genetic variation and grouped
genotypes into 11 different classes.
N-Nitroso, N-methylurea
As expected, the increase of NMU concentration and
treatment period reduced germination percentage,
germination rate, radicle length and seedling height, but
the changes in germination rate were irregular for
different NMU concentrations. Control presoaked
treatment had the highest germination percentage and

12606 Afr. J. Biotechnol.
Table 3. Mean comparisons of germination percentage for dosages, pre-treatment and treatment period and their interactions in EMS, ENU, NMU and sodium
azide treated canola seeds.
EMS concentration
(%)
Soaking Non-soaking
3 h 6 h 9 h 12 h 3 h 6 h 9 h 12 h
Control 94 a 91.5 ab 92.75 a
0.4 84 a-c 81 a-c 56.25 c-f 37 e-g 91 ab 73a-d 55.25 c-f 38.5 e-g 64.5 b
0.8 83.75 a-c 44.75 d-f 0.75 h 0 h 63.25 b-e 34.75 fg 18.5 gh 0.75 h 30.81 c
1.2 63 b-e 15.5 gh 0.5 h 0 h 60 c-e 34fg 0.75 h 0 h 21.71 c
1.6 12.5 gh 0 h 0 h 0 h 46.25 d-f 4.25 h 0h 0 h 7.87 d
Total mean 60.81 a 35.31 b 14.37 cd 9.25 d 65.12 a 36.5 bc 18. 62b-d 9.81 d
ENU concentration
(mM)
Soaking Non-soaking
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Control 85.25 a 1 75.50 b 80.37 a
3 63.56 cd 60.03 c-f 57.81 c-h 50.17 g-n 57.38 c-i 61.62 c-e 56.21 c-j 47.11 k-n 56.73 b
6 65.43 c 56.37 c-j 49.90 h-n 49.40 h-n 65.05 c 48.05 i-n 54.25 d-l 53.26 c-l 55.21 b
9 56.87 c-i 50.24 h-n 47.49 j-n 45.47 k-n 54.51 d-k 52.50 f-m 43.75 mn 45.25 k-n 49.51 c
12 64.25 c 58.25 c-h 51.25 f-m 45.50 k-n 64.75 c 59.25 c-g 52.50 f-m 41.75 n 54.68 b
Total mean 62.52 a 56.22 bc 51.61 cd 47.63 de 60.42 ab 55.35 c 51.67 cd 46.84 e
NMU concentration
(mM)
Soaking
Non-soaking
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Control 88.5 a 85.59 b 87.04 a
3 67.70 d-g 57.15 h-k 56.16 i-l 59.47 g-i 73.46 c-e 70.48 c-e 68.25d-g 49.01 l-n 62.71 b
6 73.65 c-e 65.72 e-h 67.19 d-g 46.25 mn 75.78 cd 73.09 c-e 61.36f-i 49.25 k-n 64.03 b
9 66.14 e-h 44.22 no 52.63 i-m 43.87 no 78.30 bc 73.09 c-e 51.26j-n 38.30 o 55.97 c
12 67.50 d-g 69.17 d-f 54.58 i-m 52.09 j-n 68.56 d-f 65.98 e-h 44.14 no 15.54 p 54.69 c
Total mean 68.74 b 59.06 c 57.64 c 50.42 d 74.02 a 70.66 b 56.25 c 38.02 e
Sodium azide
concentration (mM)
Soaking Non-soaking
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Control 85.75 a 87 a 86.37 a
2 71.75 bc 60.75 e-i 62.5 c-g 55.75 g-l 67.5 b-e 62 d-h 60.75 e-i 52.5 h-m 61.68 b
4 71 b-d 66 b-f 59.25 e-j 51.25 i-n 71.75 b 70.75 b-d 62.5 c-g 51. 25i-n 62.96 b
6 57.75 f-k 54.5 g-l 48 l-o 44.75 m-p 55.75 g-l 55 g-l 48.25 k-o 43 n-q 50.87 c
8 48.75 k-o 43.25 n-q 40.25 o-r 34.75 qr 50.5 j-n 43.75 m-q 37.25 p-r 32 r 41.31 d
Total mean 62.31 a 56.12 bc 52.5 c 46.62 d 61.37 a 57.87 ab 52.18 c 44.68 d
1Means in each column with a common letter are not significantly differed at LSD5%.
Total mean
Total mean
Total mean
Total mean

Emrani et al. 12607
Table 4. Mean comparison of germination rate index for dosages, pre-treatment and treatment period and their interactions in EMS, ENU, NMU and sodium azide treated canola seeds.
EMS concentration
(%)
3 h 6 h
Soaking
9 h 12 h 3 h
Non-soaking
6 h 9 h 12 h
Total mean
Control 37.90 a 1 35.43 ab 36.66 a
0.4 25.77 bc 21.16 cd 11.48 d-g 7.24 f-h 32.48 ab 21.57 cd 13.87 d-f 8.57 e-h 17.77 b
0.8 25.39 bc 7.34 f-h 0.37 h 0 h 18.13 c-e 6.75 f-h 3.39 gh 0.13 h 7.69 c
1.2 20.92 cd 3.29 gh 0.18 h 0 h 18.48 c-e 7.29 f-h 0.11 h 0 h 6.28 c
1.6 2.92 gh 0 h 0 h 0 h 14.89 d-f 0.80 h 0 h 0 h 2.32 d
Total mean 18.75 a 7.94 b 3.01 b 1.81 b 20.99 a 9.10 b 4.34 b 2.17 b
ENU
(mM)
concentration
2 h 4 h
Soaking
6 h 8 h 2 h
Non-soaking
4 h 6 h 8 h
Total mean
Control 26.12 b 18.39 cd 22.25 a
3 16.66 c-g 16.47 c-g 14.52 f-k 14.02 f-k 12.21 i-k 19.42 c 14.57 e-k 11.92 jk 14.97 b
6 16.46 c-g 15.33 d-i 11.59 k 14.96 e-j 18.60 cd 13.70 f-k 15.77 d-h 16.05 d-h 15.31 b
9 14.58 e-k 13.54 g-k 14.21 f-k 13.74 f-k 16.50 c-g 23.23 b 16.84 c-f 16 d-h 16.08 b
12 24.39 b 17.85 c-e 16.63 c-g 12.89 h-k 31.36 a 25.59 b 24.46 b 19.61 c 21.60 a
Total mean 18.02 b 15.79 c 14.23 d 13.90 d 19.66 a 20.48 a 17.91 b 15.89 c
NMU concentration
(mM)
Soaking Non-soaking
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Total mean
Control 29 a 28.89 a 28.94 a
3 19.21 c-f 13.78 k-m 13.01 m-o 14.56 j-m 18.56 d-g 17.83 f-i 14.78 j-m 10.07 p-r 15.22 c
6 22.74 b 18.14 e-h 15.72 i-l 9.31 q-s 20.27 c-e 21.13 bc 13.55 l-o 9.57 q-s 16.30 b
9 14.53 j-m 10.20 p-r 11.54 o-q 7.51 st 20.75 b-d 14.94 j-m 8.64 rs 5.67 t 11.72 e
12 19.43 c-f 16.80 g-j 12.18 n-p 9.50 q-s 22.67 b 16 h-k 9.17 rs 2.26 u 13.50 d
Total mean 18.97 b 14.73 d 13.11 e 10.22 g 20.56 a 17.47 c 11.53 f 6.89 h
Sodium azide
concentration (mM)
2 h 4 h
Soaking
6 h 8 h 2 h
Non-soaking
4 h 6 h 8 h
Total mean
Control 26.77 a-f 30.31 a 28.54 a
2 25.68 a-h 18.44 h-k 17.67 h-k 14.55 k 26.51 a-g 28.54 a-c 20.51 d-k 14.51 k 20.80 b
4 21.07 b-k 19.25 f-k 15.41 jk 13.80 k 28.90 ab 25.55 a-h 24.30 a-i 18.12 h-k 20.80 b
6 20.41 e-k 15.64 jk 14.55 k 15.05 jk 28.48 a-d 24.11 a-i 21.51 b-k 17.71 h-k 19.68 b
8 20.51 d-k 18.73 g-k 15.60 jk 16.40 i-k 27.85 a-e 22.79 a-j 20.75 c-k 17.16 i-k 19.97 b
Total mean 21.91 ab 18.01 bc 15.80 bc 14.95 c 27.93 a 25.24 a 21.76 ab 16.87 bc
1Means in each column with a common letter are not significantly differed at LSD5%.

12608 Afr. J. Biotechnol.
Table 5. Mean comparison of radicle length for dosages, pre-treatment and treatment period and their interactions in EMS, ENU, NMU and
sodium azide treated canola seeds.
EMS concentration (%)
3
Soaking
6 h 9 h 12 h 3 h
Non-soaking
6 h 9 h 12 h
Total
mean
Control 4.82 a 1 4.25 ab 4.53 a
0.4 5.22 a 4.15 ab 1.70 e-h 1.47 e-h 4.65 a 3.85 a-d 1.95 d-g 1.27 e-h 3.03 b
0.8 3.87 a-c 1.91 e-g 0.08 gh 0 h 3.95 a-c 2.50 b-e 1.60 e-h 0.45 f-h 1.79 c
1.2 5.15 a 1.05 e-h 0.05 gh 0 h 4.42 a 2.07 c-f 0.45 f-h 0 h 1.65 c
1.6 1.72 e-h 0 h 0 h 0 h 3.90 a-c 0.45 f-h 0 h 0 h 0.75 d
Total mean 3.99 a 1.77 b 0.45 c 0.36 c 4.23 a 2.21 b 1 bc 0.43 c
ENU concentration(mM)
2 h
Soaking
4 h 6 h 8 h 2 h
Non-soaking
4 h 6 h 8 h
Total
mean
Control 8.73 a-c 9.53 ab 9.13 a
3 6.96 c-j 7.08 c-h 8.33 a-g 7.47 c-h 8.24 a-g 6.94 c-j 6.30 g-j 7.77 b-h 7.39 cd
6 8.65 a-c 7.66 b-h 6.59 d-j 6.56 e-j 6.98 c-i 7.45 c-h 4.95 j 6.08 h-j 6.86 d
9 5.04 ij 6.89 c-j 9.68 ab 8.28 a-g 7.71 b-h 7.89 a-h 7.47 c-h 8.61 a-d 7.70 bc
12 8.36 a-f 8.84 a-c 9.91 a 7.18 c-h 8.08 a-h 8.47 a-e 6.43 f-j 7.48 c-h 8.09 b
Total mean 7.25 ab 7.61 ab 8.62 a 7.37 ab 7.75 ab 7.68 ab 6.28 b 7.48 ab
NMU concentration(mM)
2 h
Soaking
4 h 6 h 8 h 2 h
Non-soaking
4 h 6 h 8 h
Total
mean
Control 9.08 a 9.59 a 9.33 a
3 7.64 b 5.42 d-f 6.39 cd 6.96 bc 9.68 a 7.92 b 6.27 cd 5 e-h 6.91 b
6 6.15 cd 4.39 gh 4.06 hi 2.71 jk 7.83 b 6.23 cd 4.58 f-h 2.35 kl 4.79 c
9 5.70 de 3.40 ij 1.69 l-n 1.40 l-n 7.10 bc 5.09 e-g 1.87 k-m 1.35 mn 3.45 d
12 5.17 e-g 4.21 g-i 2.28 k-m 1.42 l-n 6.97 bc 4.34 g-i 2.02 k-m 0.78 n 3.40 d
Total mean 6.16 b 4.35 c 3.60 d 3.12 e 7.89 a 5.89 b 3.68 d 2.37 f
Sodium azide concentration (mM) Soaking
Non-soaking
Total
mean
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Control 5.16 d-g 6.23 a-f 5.69 bc
2 6.70 a-d 6.65 a-d 6.35 a-f 6.97 a-c 6.33 a-f 7.22 ab 7.80 a 6.01 b-f 6.75 a
4 6.65 a-d 6.92 a-c 6.53 a-e 5.60 b-g 6.72 a-d 5.79 b-g 4.81 e-g 6.14 a-f 6.14 b
6 5.20 d-g 6.08 a-f 4.21 g 5.45 c-g 6.49 a-f 6.28 a-f 4.86 e-g 5.56 b-g 5.52 c
8 5.67 b-g 5.14 d-g 5.77 b-g 4.81 e-g 6.52 a-f 5.97 b-f 5.15 d-g 5.26 c-g 5.53 c
Total mean 6.05 a 6.19 a 5.71 a 5.70 a 6.51 a 6.31 a 5.65 a 5.74 a
1 Means in each column with a common letter are not significantly differed at LSD5%.
rate (Tables 3 and 4). Two hour treatment of non-
presoaked seeds with 3 mM NMU led to the highest
radical length and seedling height (Tables 5 and 6). Nonpresoaked
seeds treated with 12 mM NMU for eight
hours induced the lowest values for all the traits of
germination percentage, germination rate index, radicle
length, and seedling height. Means of seed viability for
NMU treated seeds varied between 91% for control to
36% for the one with 12 mM NMU for 8 h (Table 7).
These two treatment conditions caused the extreme
amounts of germination percentage, too.
Sodium azide
Control and 8 mM canola non-presoaked seeds treated
with NaN3 resulted in the highest and lowest mean values
of germination percentage, respectively (Table 3).
Increased mutagen significant for the 4 h treatment
duration. The least germination rate belonged to the
presoaked significant for the 4 h treatment duration. The
least germination rate belonged to the presoaked
treatment with 4 mM sodium azide for 8 h (Table 4). In
contrast, non-pre-soaked non-treated seeds (control)

Emrani et al. 12609
Table 6. Mean comparison of seedling height for dosages, pre-treatment and treatment period and their interactions in EMS, ENU,
NMU and sodium azide treated canola seeds.
EMS concentration
(%)
Soaking Non-soaking
Total
mean
3 h 6 h 9 h 12h 3 h 6 h 9 h 12 h
Control 2.05 a 1 1.58 a-d 1.81 a
0.4 1.62 a-c 1.57 a-e 0.92 c-h 0.77 d-i 1.75 ab 1.52 a-f 0.97 b-h 0.80 d-i 1.24 b
0.8 1.37 a-f 0.96 b-h 0.08 i 0 i 1.47 a-f 1.07 b-g 0.75 e-i 0.80 d-i 0.81 c
1.2 2.07 a 0.47 g-i 0.05 i 0 i 2.10 a 1.10 b-g 0.20 hi 0 i 0.75 c
1.6 0.75 e-i 0 i 0 i 0 i 1.75 ab 0.22 hi 0 i 0 i 0.34 d
Total mean 1.45 ab 0.75 cd 0.26 d 0.19 d 1.76 a 0.97 bc 0.48 cd 0.4 cd
ENU
concentration(mM)
Soaking Non-soaking Total
mean
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Control 3.31 l-n 3.60 i-n 3.45 d
3 4.07 f-j 4.73 c-e 3.93 g-m 5.86 a 4.56 c-g 4.96 b-d 4.12 e-i 4.37 d-h 4.57 a
6 4.17 e-i 4.67 c-f 5.58 ab 4.04 f-k 5.43 ab 3.69 i-n 3.15 n 3.77 h-n 4.31 b
9 3.88 h-m 4.75 c-e 3.45 j-n 3.58 i-n 5.17 bc 3.43 k-n 3.29 mn 3.46 j-n 3.87 c
12 3.34 l-n 3.67 i-n 3.94 g-l 3.33 l-n 3.67 i-n 3.75 h-n 3.63 i-n 3.40 l-n 3.59 d
Total mean 3.86 c-e 4.45 ab 4.22 bc 4.20 bc 4.70 a 3.95 cd 3.54 e 3.75 de
NMU
concentration(mM)
Soaking Non-soaking Total
mean
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8
Control 3.93 b-d 3.84 b-f 3.88 a
3 3.12 j-l 3.88 b-e 3.40 f-j 3.42 e-j 4.25 ab 3.42 e-j 3.75 c-g 3.61 d-i 3.61 b
6 3.35 g-j 2.84 k-m 2.46 m-o 2.85 k-m 4.19 a-c 3.44 e-j 3 j-l 1.99 pq 3.01 c
9 3.26 h-k 3.44 e-j 2.45 m-p 1.49 rs 3.71 d-h 3.19 i-k 2.07 o-q 1.31 s 2.61 d
12 2.67 l-n 2.28 n-p 2.37 n-p 1.81 qr 4.44 a 2.46 m-o 2.01 o-q 0.74 t 2.35 e
Total mean 3.1 b 3.11 b 2.67 c 2.39 d 4.14 a 3.12 b 2.70 c 1.91 e
Sodium azide
concentration(mM)
Soaking Non-soaking Total
mean
2 h 4 h 6 h 8 h 2 h 4 h 6 h 8 h
Control 3.34 b-e 3.58 a-e 3.46 a
2 3.56 a-e 3.74 a-c 3.18 b-e 3.41 b-e 3.09 de 3.41 b-e 3.42 b-e 3.57 a-e 3.42 a
4 3.25 b-e 3.80 ab 3.62 a-e 3.05 de 3.64 a-e 3.40 b-e 3.41 b-e 3.45 a-e 3.45 a
6 3.26 b-e 3.40 b-e 3.32 b-e 3.03 e 3.54 a-e 3.57 a-e 3.06 de 3.22 b-e 3.30 a
8 3.37 b-e 3.16 b-e 3.19 b-e 3.16 b-e 4.10 a 3.70 a-d 3.14 c-e 3.31 b-e 3.39 a
Total mean 3.36 ab 3.52 a 3.32 ab 3.16 b 3.59 a 3.52 a 3.25 ab 3.38 ab
1 Means in each column with a common letter are not significantly differed at LSD5%.
exhibited the highest mean value of germination
percentage (Table 3). Changes in sodium azide concentration
also affected radicle length of mutant seedlings.
Non-presoaked seeds treated with 2 mM sodium azide
for 6 h produced seedlings with longer radicles than any
other treatment. On the other hand, the treatment with 6
mM sodium azide for 6 h induced the least radical length
in pre-soaked seedlings (Table 5). The highest seedling
height belonging to non-presoaked seeds treated with 8
mM sodium azide for 2 h did not vary significantly from
the same value recorded for the control treatment under
similar non-soaking conditions. The lowest amount of
seedling height belonged to 8 h treatment with 6 mM
sodium azide in presoaking conditions (Table 6). The
highest seed viability belonged to control among the
studied treatments of NaN3 (Table 7). Means of seed
viability varied between 51% (8 mM/8 h) and 86.7%
(control). Treatment with 8 mM sodium azide for eight
hours induced the lowest germination percentage, too.
Seed viability means grouped genotypes into 9 different

12610 Afr. J. Biotechnol.
Table 7. Mean comparison of seed viability for dosages and treatment period and their interactions in EMS, ENU, NMU and sodium
azide treated canola seeds.
EMS concentration (%)
3 h
Treatment duration
6 h 9 h 12 h
Total mean
Control
a 1
89.7
0.4 85.7 a 75.3 b 58.3 c 42.3 d 65.4 a
0.8 78 b 60 c 41 d 28 ef 51.75 a
1.2 44.7 d 36.7 de 23 f 5 g 27.35 b
1.6 38.9 d 25.3 f 7 g 0 h 17.8 c
Total mean 61.82 a 49.32 ab 32.32 b 18.82 c 43.51
ENU concentration (mM)
2 h
Treatment duration
4 h 6 h 8 h
Control 89.3 a
Total mean
3 87 a 74.3 c 55.7 fg 55.7 fg 68.17 a
6 80.3 b 55.7 fg 47 ij 48.3 h-j 57.82 b
9 66.7 d 54.7 f-h 54 f-h 44.7 j 55.02 b
12 63 de 57.3 ef 53.3 f-i 49.7 g-j 55.82 b
Total mean 74.25 a 60.5 b 52.5 c 49.6 c 60.98
NMU concentration (mM)
2 h
Treatment duration
4 h 6 h 8 h
Total mean
Control 91 a
3 80 b 81.7 b 70 d 54.7 f 71.6 a
6 74.7 c 68.7 d 57 ef 45.3 hi 61.42 b
9 59.3 e 49.3 gh 43.3 i 50 g 50.47 c
12 58.3 ef 48 gh 46.3 g-i 36 j 47.15 d
Total mean 68.07 a 61.92 b 54.15 c 46.5 d 59.63
Sodium azide concentration (mM)
2 h
Treatment duration
4 h 6 h 8 h
Total mean
Control 86.7 a
2 82.3 ab 84.7 a 77.7 bc 79 bc 80.92 a
4 71.3 d-f 74.7 c-e 68.3 f 71.7 d-f 71.5 b
6 77 cd 55.3 g 53.7 g 53 g 59.75 c
8 70.3 ef 66.7 f 57.3 g 51 g 61.32 c
Total mean 75.22 a 70.35 b 64.25 c 63.67 d 69.45
1 Means in each column with a common letter are not significantly differed at LSD5%.
groups, but the variation between genotypes was higher
for germination percentage which divided genotypes into
11 different groups.
Correlation coefficients
The results of correlation analysis indicated the highly
significant positive relationships between germination
percentage, on one side, and germination rate, radicle
length, seedling height and seed viability, on the other, in
EMS and NMU treated canola seeds (Tables 8). For ENU
treatment, significant and positive correlations were
observed between germination percentage and germination
rate (r=0.56*) and between germination percentage
and seed viability (r=0.83**). For sodium azidetreated
seeds, no significant relationship was observed
between germination percentage and seedling height
(Table 8). A positive and significant relationship was
observed between radicle length and seedling height for
all the treatments with the exception of ENU treated
seeds where this relationship was negatively significant
(Table 8). Correlation coefficients between seed viability
and other traits were positive for most of the treatments

Table 8. Correlation coefficients between variables measured on EMS, ENU, NMU and sodium azide treated canola seeds.
Emrani et al. 12611
EMS GP GR RL SH SV
Germination percentage (GP) 1 0.97 1 0.94 0.92 0.93
Germination rate index (GR) 1 0.93 0.89 0.89
Radicle length (RL) 1 0.98 0.86
Seedling height (SH) 1 0.85
Seed viability (SV) 1
ENU GP GR RL SH SV
Germination percentage (GP) 1 0.56 0.31 0.06 0.83
Germination rate index (GR) 1 0.51 -0.43 0.27
Radicle length (RL) 1 -0.50 0.26
Seedling height (SH) 1 0.27
Seed viability (SV) 1
NMU GP GR RL SH SV
Germination percentage (GP) 1 0.96 0.88 0.83 0.80
Germination rate index (GR) 1 0.87 0.78 0.81
Radicle length (RL) 1 0.92 0.90
Seedling height (SH) 1 0.79
Seed viability (SV) 1
Sodium azide GP GR RL SH SV
Germination percentage (GP) 1 0.73 0.53 0.43 0.76
Germination rate index (GR) 1 0.31 0.50 0.59
Radicle length (RL) 1 0.50 0.68
Seedling height (SH) 1 0.52
Seed viability (SV) 1
but seed viability was not correlated with germination rate
index, radicle length and seedling height under ENU
treatment conditions.
DISCUSSION
Flowering plants are particularly well adapted to random
mutagenesis because large, saturated mutant populations
can be generated through chemical mutagenesis.
Such populations can then be screened for the particular
phenotypes using ‘reverse screened’ tools, which are
conducted based on gene sequence for mutations in the
target gene (Stephenson et al., 2010). It is important,
therefore, to determine the level of mutagen treatment
necessary to achieve the utmost mutation load in an
important oilseed crop species such as canola. The
interdependence of treatment variables that influence the
degree of M1 seed lethality induced by a mutagen is
clearly illustrated by the interactions between mutagen
concentration, treatment period and pretreatment
observed in this study. When one considers that these
are only a few of the treatment variables that could have
been investigated, it becomes even more apparent that
the reaction of mutagen with the cellular constituents is
complex, underscoring the necessity for close control of
experimental conditions to ensure repeatable treatment
effects (Fowler and Stefansson, 1972).
In this study, inverse relations were found between
mutagen concentration and both rate and percentage of
M1 seed germination in canola. These results are in
agreement with the findings of previous research with
other plants (Afsar et al., 1980; Fowler and Stefansson,
1972; Padavai and Dhanavel, 2004; Singh and Kole,
2005). In the case of EMS, treatments with 1.2% for 12 h
and 1.6% for 9 and 12 h brought complete lethality in
both pretreatment conditions (Table 3). Fowler and
Stefansson (1972) reported that increasing of EMS
concentration from 0 to 1% adversely affected
germination percentage. The interaction between dosage
and duration of treatment for germination percentage was
significant. This result shows the importance of duration
of mutagen treatment in finding an optimal mutagenic
dose. Pretreatment had no significant effects on traits in
most of the treatments in this study. Soaking increases
mutagen penetration into seeds and leads to higher
metabolic activities, but there would be no need for
presoaking if the duration of treatment with mutagen is
long enough (Fowler and Stefansson, 1972).
In general, EMS treated seeds produced the lowest

12612 Afr. J. Biotechnol.
values for all traits (Tables 3, 4, 5 and 6). From a
germination percentage aspect, mutagens ranked in the
following descending order: NMU>sodium azide>
ENU>EMS. Therefore, EMS had the highest lethality
dose in this experiment so that most seeds treated with
1.6% EMS or treated for 12 h did not even germinate.
Hence, to obtain the highest variability and number of
suitable mutants, it is inevitable to use lower dosages of
this mutagen over shorter treatment periods. In flax,
Bacelis (2001) studied the efficiency of chemical
mutagens and found ENU as the most efficient mutagen
followed by NMU and EMS. Although, a positive
correlation is evident to exist between seedling failures
and mutation frequency, this relationship is not linear
(Afsar et al., 1980; Fowler and Stefansson, 1972). This is
because at higher concentrations of the mutagen, some
mutants were eliminated from the population in the first
generation, or they became sterile if they did survive.
This is due to mutagenic effects on plant genes and/or
chromosomal aberrations. The extent of reduction in
growth is related to the mechanism of action for a given
mutagen. Mutagens may inhibit an energy supply system
resulting in the inhibition of mitosis which can be
associated with seedling growth depression. Seed’s
physiological conditions during treatment greatly influence
the magnitude of growth depression (Afsar et al., 1980).
Thus, breeders are interested in finding a mutagenic
dose that induces adequate mutagenic outcome but
which results in low sterility and lethality. Efficiency of the
LD50 criterion has been validated by almost all
researchers (Das and Haque, 1997; Gustafson, 1989; Hu
and Rutger, 1992; Snustad and Simmons, 2006).
According to this criterion, treatment with 0.8% EMS
solution for 6 h has led to 50% lethality compared to that
of control (Table 3). Nevertheless, this mutagenic treatment
may be proposed as the appropriate treatment
conditions when one considers overall genomic
aberrations caused by a higher mutagenic dose. Jabeen
and Mirza (2004) subjected Capsicum annum seeds to
different treatment levels of EMS (0.01, 0.1 and 0.5%)
and two durations of exposure (3 and 6 h) and suggested
that using 0.5% EMS for 3 h could induce appropriate
morphological mutations. Das and Haque (1997) also
studied the responses of sesame seeds to gamma rays
and EMS in M1 generation. In their study, the optimum
dosages for mutation induction were 0.7 to 0.9% EMS as
determined by the LD50 criterion. The optimum dosage of
EMS for rice was 8 h treatment with 1% EMS according
to Padma and Reddy (1977). Compared to the control,
treatment with the 12 mM ENU solution for eight hours
and non-soaking pre-treatment induced 50% reduction in
germination percentage in canola seeds (Table 3) and
this treatment would, hence, be an optimal dose of ENU
in mutagenic studies.
In the case of NMU, treatments of seeds with the 9 mM
solution for 8 h could be proposed for enhancing the
mutagen efficiency. This finding also confirms the earlier
results of Ramulu (1972) with sorghum who observed that
lower dosages of NMU are more efficient than higher
concentrations. Mean comparisons of the effect of
sodium azide treatment revealed that 8 h non-soaking
seed treatment with 6 mM solution of this mutagen
induced 50% reduction in germination percentage compared
to that of the control treatment (Table 3).
Treatment with the 8 mM sodium azide solution for 4 h
was also suitable according to the LD50 criterion as the
two treatments did not significantly differ. The choice of
either of these two treatment conditions depends upon
experimental conditions and supplements along with
breeder’s expert opinion. On one hand, application of
lower mutagen concentrations is safer because it causes
less sterility and abnormalities. From a breeding point of
view, however, application of higher mutagen concentrations
results in the higher frequency of induced
mutations. Hence the first treatment would be a suitable
sodium azide treatment condition in this study.
A positive relationship was observed between seed
viability and other traits which were highly significant in
most treatments (Table 8). The strong significant and
positive correlation between germination percentage and
seed viability revealed that the standard germination test
could unbiasedly predict seed viability in canola. In the
case of ENU treatment, there was a negative correlation
between seedling height and radicle length (r=-0.50*).
This inverse relationship may be due to the imbalanced
allocation of seed storage to the development of radicle
and seedling.
Conclusion
The significant effects of mutagen dosages and treatment
periods on seed viability and seed germination as well as
on seedling characteristics for the tested mutagens were
observed. The 0.8% ethyl methanesulfonate (EMS) for 6
h, 12 mM ENU and 6 mM sodium azide for 8 h and 9 mM
NMU for 4 h were considered as optimum treatment conditions.
This study was one step toward exploring the
most desirable treatment conditions for enhancing
mutation efficiency in the canola breeding programs as
well as genetic studies. Further research is required to
determine the effects of other variables such as genotype,
temperature, pH, and post-treatment on mutagen
action and M1 plant survival and reproduction.
ACKNOWLEDGEMENTS
This work was partially funded by Center of Excellence
for Oilseed Crops at Isfahan University of Technology,
Isfahan, Iran.
REFERENCES
Afsar AM, Konzak CF, Rutger JN, Nilan RA (1980). Mutagenic effects of
sodium azide in rice. Crop Sci. 20: 663-668.
Ahmad I, Day JP, MacDonald MV, Ingram DS (1991). Haploid culture

and UV mutagenesis in rapid-cycling Brassica napus for the
generation of resistance to chlorsulfuron and Alternaria brassicicola.
Ann. Bot. 67: 521-525.
AOSA (2000). Tetrazolium testing handbook. Contrib. 29. Handbook on
seed testing. Lincoln, NE: AOSA. p. 302.
Bacelis K (2001). Experimental mutagenesis in fiber flax breeding.
Biologia, 1: 40-43.
Barro F, Fernandez-Escobar J, De La Vega M, Martin A (2002).
Modification of glucosinolate and eruic acid contents in doubled
haploid lines of Brassica carinata by UV treatment of isolated
microspores. Euphytica, 129: 1-6.
Bhatia CR, Nichterlin K, Maluszynski M (1999). Oilseed cultivars
developed from induced mutations and mutations altering fatty acid
composition. Mut. Breed. Rev., 11: 1-36.
Carlton AE, Cooper CS, Wiesner LE (1968). Effect of seed pod and
temperature on speed of germination and seedling elongation of
sainfoin (Onobrychis viciaefolia Scop). Agron. J. 60: 81-84.
Das ML, Haque MM (1997). Response of sesame seeds to gamma rays
and EMS in M1 generation. Bangladesh J. Bot. 26: 75-78.
Elias S, Garay A, Schweitzer L, Hanning S (2006). Seed quality testing
of native species. Native Plant, J. 7: 15-19.
FAO, FAOSTAT (2011). Available at:
http://faostat.fao.org/site/339/default.aspx/. (Accessed 15 January,
2011).
FAO/IAEA Mutant Varieties Database. (2011). Available at:
http://mvgs.iaea.org/Search.aspx/.
Ferrie AMR, Taylor DC, MacKenzie SL, Rakow G, Raney JP, Keller WA
(2008). Microspore mutagenesis of Brassica species for fatty acid
modifications: a preliminary evaluation. Plant Breed., 127: 501-506.
Fowler DB, Stefansson BR (1972). Effects of the mutagenic agent EMS
on the M1 generation of rape (Brassica napus). Can. J. Plant Sci. 52:
53-62.
Gustafson A (1989). Mutation and gene recombination as spelling tools
in plant breeding. In: Olsson G (ed). Res. Result Plant Breed., pp. 34-
53.
Hu J, Rutger JN (1992). Pollen characteristics and genetics of induced
and spontaneous genetic male sterile mutants in rice. Plant Breed.,
109: 97-107.
Jabeen N, Mirza B (2004). Ethyl methane sulfonate induces
morphological mutations in Capsicum annuum. Int. J. Agric. Biol. 6:
340-345.
Karrfalt RP (2011). Seed Testing. Available online at:
http://www.nsl.fs.fed.us/wpsm/chapter5.pdf /.
Kharkwal MC (1998). Induced mutation in chickpea (Cicer arietinum L.).
І. Comparative mutagenic effectiveness and efficiency of physical
and chemical mutagens. Indian J. Genet. 58: 159-167.
Kott L (1998). Application of doubled haploid technology in breeding of
oilseed Brassica napus. Agric. Biotech. News Infor. 10: 69-74.
Kott L, Wong R, Swanson E, Chen J (1996). Mutation and selection for
improved oil and meal quality in Brassica napus utilizing microspores
culture. In Jain SM, Sopory SK, Veilleux RE (eds). In vitro haploid
production in higher plants. Springer, Berlin Heidelberg New York, 2:
151-167.
Landho L, Jorgensen RB (1997). Seed germination in weedy Brassica
campestris and its hybrids with B. napus: Implications for risk
assessment of transgenic oilseed rape. Euphytica, 97: 209-216.
MacDonald MV, Ahmad I, Menten JOM, Ingram DS (1991). Haploid
culture and in vitro mutagenesis (UV light, X-rays, and gamma rays)
of rapid cycling Brassica napus for improved resistance to disease. In
Plant mutation breeding for crop improvement, IAEA, Vienna, 2: 129-
138.
MacDonald MV, Ingram DS (1986). Toward the selection in vitro for
resistance to Alternaria brassicicola (Schw)Welts., in Brassica napus
ssp. oleifera (Metzg.) Sinsk., winter oilseed rape. New Phytol. 104:
621-629.
McCallum CM, Comai L, Greene EA, Henikoff S (2000). Targeting
Induced Local Lesions IN Genomes (TILLING) for Plant Functional
Genomics. Plant Physiol. 123: 439-442.
McDonald BE (2011). Canola Oil: Nutritional Properties. Canola Council
Publications. Available online at:
http://www.canolacouncil.org/health_nutritional.aspx/ (Accessed 5
January 2011).
Emrani et al. 12613
Medrano H, Millo E, Guerri J (1986). Ethyl-methane-sulphonate effects
on anther culture of Nicotiana tabacum. Euphytica, 35: 161-168.
Newsholme DM, MacDonald MV, Ingram DS (1989). Studies of
selection in vitro for novel resistance to phytotoxic products of
Leptospheria maculans (Desm.) Ces.& De Not in secondary
embryogenic lines of Brassica napus ssp. oleifera (Metzg.) Sinsk.,
winter oilseed rape. New Phytol. 113: 117-126.
Osorio J, Fernandez-Martinez J, Mancha M, Garces R (1995). Mutant
sunflowers with high concentration of saturated fatty acid in the oil.
Crop Sci. 37: 739-742.
Padavai P, Dhanavel D (2004). Effects of EMS, DES and colchicine
treatment in soybean. Crop Res. 28: 118-120.
Padma A, Reddy GM (1977). Genetic behavior of five induced dwarf
mutants in an Indica rice cultivar. Crop Sci. 17: 860-863.
Parry MA, Madgwick PJ, Bayon C, Tearall K, Hernandez-Lopez A,
Baudo M, Rakszegi M, Hamada W, Al-Yassin A, Ouabbou H, Labhilili
M, Phillips AL (2009). Mutation discovery for crop improvement. J.
Exp. Bot. 60: 2817-2825.
Patil A, Taware SP, Raut VM (2011). Induced variation in quantitative
traits due to physical (γ rays), chemical (EMS) and combined
mutagen treatments in soybean [Glycine max (L.) Merrill]. Soybean
Genet. Newslett. Available online at
http://www.soygenetics.org/articleFiles/40inducedvariationinquantativ
etraitsduetophysica,chemi%5B1%5D.pdf/. Vol. 31.
Ramulu SK (1972). A comparison of mutagenic effectiveness and
efficiency of NMU and MNG in Sorghum. Theor. Appl. Genet. 42:
101-106.
Rowland GG (1991). An EMS-induced low linoleic acid mutant in
McGregor flax (Linum usitatissimum L.). Can. J. Plant Sci. 71: 393-
396.
Sala CA, Bulos M, Echarte AM (2008). Genetic analysis of an induced
mutation conferring imidazolinone resistance in sunflower. Crop Sci.
48: 1817-1822.
SAS Institute Inc (2008). SAS/STAT ® 9.2 User's Guide. Cary, NC: SAS
Institute Inc.
Schnurbush T, Mollers C, Becker HC (2000). A mutant of Brassica
napus with increased palmitic acid content. Plant Breed. 119: 141-
144.
Singh R, Kole CR (2005). Effect of mutagenic treatments with EMS on
germination and some seedling parameters in mungbean. Crop Res.
30: 236-240.
Snustad DP, Simmons MJ (2006). Principles of Genetics. 4 th ed. Wiley,
Hoboken, NJ.
Spasibionek S (2006). New mutants of winter rapeseed (Brassica
napus L.) with changed fatty acid composition. Plant Breed., 125:
259-267.
Steel RGD, Torrie JH (1980). Principles and Procedures of Statistics, A
Biometrical Approach, 2 nd Edition. McGraw-Hill. New York.
Stephenson P, Baker D, Girin T, Perez A, Amoah S, King GJ,
Østergaard L (2010). A rich TILLING resource for studying gene
function in Brassica rapa. Plant Biol. 10: p. 62.
Swanson EB, Coumans MP, Brown GL, Patel JD, Beversdorf WD
(1988). The characterization of herbicide tolerant plants in Brassica
napus L. after in vitro selection of microspores and protoplasts. Plant
Cell Rep., 7: 83-87.
Swanson EB, Herrgesell MJ, Arnoldo M, Sippell DW, Wong RSC
(1989). Microspore mutagenesis and selection: canola plants with
field tolerance to the imidazolinones. Theor. Appl. Genet. 78: 525-
530.
Szarejko I, Forster BP (2007). Doubled haploidy and induced mutation.
Euphytica, 158: 359-370.
Velasco L, Fernandez-martinez JM, De Haro A (2008). Inheritance of
reduced linolenic acid content in the Ethiopian mustard mutant N2-
4961. Plant Breed. 121: 263-265.
Wong RSC, Swanson E (1991). Genetic modification of canola oil: high
oleic acid canola.. In Haberstroh C, Morris CE (eds.), Fat and
Cholesterol Reduced Food. Gulf, Houston, Texas, pp. 154-164.

African Journal of Biotechnology Vol. 10(59), pp. 12614-12625, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.728
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
T-DNA integration patterns in transgenic maize lines
mediated by Agrobacterium tumefaciens
Lin Yang 1 , Feng-Ling Fu 1 , Zhi-Yong Zhang 1 , Shu-Feng Zhou 1 , Yue-Hui She 2 and Wan-Chen Li 1 *
1 Maize Research Institute, Sichuan Agricultural University, Ya’an, Sichuan 625014, P.R. China.
2 Agronomy Faculty, Sichuan Agricultural University, Ya’an, Sichuan 625014, P.R. China.
Accepted 1 September, 2011
To explore transfer deoxyribonucleic acid (T-DNA) integration patterns in the maize genome, we
improved the protocol of thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR), and
amplified the flanking sequences around T-DNA integration sites from 70 independent transgenic
maize lines mediated by Agrobacterium tumefaciens. Out of 64 specific amplified fragments, 32 and 9
are homologous to the sequences of the maize genome and the expression plasmid, respectively. For
26 of them, a filler sequence was found flanking the cleavage sites. These results demonstrate that
cleavage occurs not only during the T-DNA borders but also inside or outside the borders. The border
sequences and some inside sequences can be deleted, and filler sequences can be inserted.
Illegitimate recombination is a major pattern of T-DNA integration, while some hot spots and preference
are present on maize chromosomes.
Key words: Agrobacterium tumefaciens, maize, thermal asymmetric interlaced PCR, transfer DNA,
transgenics.
INTRODUCTION
Agrobacterium tumefaciens-mediated transformation is
the most widely utilized technique to generate transgenic
events of plants (Kole et al., 2010). The transfer
deoxyribonucleic acid (T-DNA), carrying the engineered
expression construct, is transported from the bacterial
tumour-inducing plasmid and integrated into the plant
genome. This property of T-DNA is also used for the
inactivation of plant genes by insertion mutagenesis (Zhu
et al., 2010). The integration and structure of a transgene
*Corresponding author. E-mail: aumdyms@sicau.edu.cn /
aumdyms@163.com. Tel: 86-835-2882526, Fax: +86-835-
2882154.
Abbreviations: T-DNA, Transfer deoxyribonucleic; CTAB, cetyl
trimethylammonium bromide; TAIL-PCR, thermal asymmetric
interlaced polymerase chain reaction; AD, arbitrary degenerate
primers.
locus can have profound effects on the level and stability
of transgene expression (Kole et al., 2010; Zeng et al.,
2010). A lot of effort has been paid to elucidation of the
integration mechanism of T-DNA in the host genome.
Illegitimate integration by non-homologous recombination
was suggested for T-DNA integration in plant chromosomes
(Kim et al., 2007), whereas site-specific integration
and homologous recombination were identi-fied in
many other transformed events (Thomas and Jones,
2007; Zhang et al., 2007). Sometimes, the integration of
T-DNA can induce chromosomal rearrange-ment
including translocation, inversion, deletion and insertion
(Zeng et al., 2010; Zhu et al., 2010). Furthermore, various
lengths of the bacterial plasmid backbone DNA sequence
were found contained in the host genome of
Agrobacterium-mediated transformats (Shou et al., 2004;
Windels et al., 2003; Zeng et al., 2010). Based on the
sequence analysis of 236 T-DNA transgenic rice lines
(Zhu et al., 2006), believed that mul-tiple mechanisms are
involved in T-DNA integration in plants.
In Arabidopsis and tobacco, the T-DNA integration

Yang et al. 12615
Figure 1. Nested specific primers complementary to inside flanking sequences of T-DNA left border and right border in
plasmid pCAMBIA1390. LS1, LS2, LS3, LS4 and LS5, nested specific primers complementary to the inside flanking
sequence of the T-DNA left border; RS1, RS2, RS3, RS4 and RS5, nested specific primers complementary to the inside
flanking sequence of the T-DNA right border in plasmid pCAMBIA1390; LB, the left border; RB, the right border; P-Ubi,
maize ubiquitin promoter; P451, 451 bp fragment homologous to P1 protein (protease) gene of maize dwarf mosaic virus;
intron, intron of maize actin gene; T-nos, terminator of nopaline synthase; P-35S, cauliflower mosaic virus 35S promoter;
Hpt, hygromycin phosphotransferase gene; T-35S, cauliflower mosaic virus 35S terminator.
pattern was found to be highly determined by the transformed
target cell (De Buck et al., 2009; Shimizu et al.,
2001). Maize was domesticated from the grass teosine in
central America over the last ~ 10,000 years (Doebley et
al., 2006). The maize genome has undergone several
rounds of genome duplication. Its 10 chromosomes are
structurally diverse and have endured dynamic changes
in chromatin composition. Over the last 3,000,000 years,
the size of the maize genome has expanded dramatically
to 2.3 gigabases via proliferation of long terminal repeat
retrotransposons (SanMiguel et al., 1998). The complex
repetition and diversity of the maize genome make it a
bigger challenge to explore T-DNA integration
mechanism than other plants (Schnable et al., 2009;
Zhou et al., 2009). Up to now, few documents have been
available on T-DNA integration patterns in maize (Shou
et al., 2004; Zhao et al., 2003). In the present study, we
improved the protocol of thermal asymmetric
interlaced polymerase chain reaction (TAIL-PCR)
(TAIL-PCR, Liu et al., 1995; Sessions et al., 2002),
amplified the flanking sequences around T-DNA
integration sites from 70 independent transgenic
maize lines mediated by A. tumefaciens, and explore
the T-DNA integration patterns in the maize genome.
MATERIALS AND METHODS
Transformed maize lines and template DNA extraction
Template DNA samples were extracted by cetyl trimethylammonium
bromide (CTAB) method from 70 transgenic maize lines of
homologous T2 generation. All of these lines were independently

12616 Afr. J. Biotechnol.
Figure 2. Nested specific primers complementary to inside flanking sequences of T-DNA left border and right border in plasmid
pCAMBIA1300. LS1, LS2, LS3, LS4 and LS5, nested specific primers complementary to the inside flanking sequence of the T-DNA
left border; RS6, RS7 and RS8, nested specific primers complementary to the inside flanking sequence of the T-DNA right border in
plasmid pCAMBIA1300; LB, the left border; RB, the right border; P-Ubi, maize ubiquitin promoter; P150, 150 bp fragment
homologous to P1 protein (protease) gene of maize dwarf mosaic virus; intron, intron of maize actin gene; T-nos, terminator of
nopaline synthase; P-35S, cauliflower mosaic virus 35S promoter; Hpt, hygromycin phosphotransferase gene; T-35S, cauliflower
mosaic virus 35S terminator.
derived from the positive calli, which were isolated from immature
embryos of maize inbred line “18-599”, and transformed by A.
tumefaciens EHA105. This microbe strain harboured the
engineered plasmids pCAMBIA1390 and pCAMBIA1300, that
contained a hairpin expression construct of 451 and 150 bp
fragments homologous to P1 protein (protease) gene of maize
dwarf mosaic virus, respectively (Figures 1 and 2). The T-DNA
integration into the maize genome had been identified to be singlecopy
by southern blotting (Zhang et al., 2010, the data of
pCAMBIA1390 unpublished).
Amplification of flanking sequences by TAIL-PCR
For TAIL-PCR amplification of the flanking sequences around the T-
DNA integration sites, 6 arbitrary degenerate primers (AD) of 15-17
bp length were designed according to the conserved amino acid
sequences of the universal proteins in eukaryotes (Table 1, Liu et
al., 1995). Five nested specific primers (LS1, LS2, LS3, LS4 and
LS5) complementary to the inside flanking sequence of the T-DNA
left border, 5 nested specific primers (RS1, RS2, RS3, RS4 and
RS5) complementary to the inside flanking sequence of the T-DNA
right border in plasmid pCAMBIA1390, and 3 nested specific
primers (RS6, RS7 and RS8) complementary to the inside
flanking sequence of the T-DNA right border in
pCAMBIA1300 (Figures 1 and 2), were designed and
synthesized at Invitrogen. The reaction system of 25 µl contained
12.5 µl of 2×Taq PCR MasterMix (Biomed-Tech), 20 ng of the
template DNA, 4 pmol of one of the nested specific primers, and 40
pmol of one of the six arbitrary degenerate primers. For the
secondary and tertiary rounds of the amplification, the products of
the former round amplification was diluted 10-fold and used as
templates. The products of the secondary and tertiary round
amplification were separated by 2% argarose gel electrophoresis.
The specific bands were recovered using Agarose Gel DNA
Purification Kit Ver 2.0 (TaKaRa).
Repeat PCR amplification of TAIL-PCR products
To confirm that the separated bands were specific fragments
amplified by a combination of an AD primer and a nested specific
primer, the recovered product of the longest band in each
electrophoretical lane of the secondary round was used as template
to conduct repeat PCR amplification, with the same arbitrary
degenerate primer and nested specific primers as used in the
secondary and tertiary rounds of TAIL-PCR amplification. A
consensus annealing temperature (52°C) was used to mediate the

Table 1. Arbitrary degenerate primes.
Primer Sequence
AD1 NTC GAS TWT SGW GTT
AD2 NGT CGA SWG ANA WGA A
AD3 NGT ASA SWG TNA WCA A
AD4 STT GNT AST NCT NTG C
AD5 AGW GNA GWA NCA WAG G
AD6 TGW GNA GWA NCA SAG A
S, G/C; W, A/T; N, A/T/C/G.
difference of annealing temperatures between the AD primer and
the nested specific primers. The elongation time was determined
based on the speed of 1000 bp/min. The amplified product was
separated by 2% argarose gel electrophoresis.
Sequence analysis
According to the specificity confirmation by the repeat PCR
amplification, the recovered products of specific fragments amplified
in the tertiary round TAIL-PCR were cloned into PMD18-T vector
(TaKaRa), and sequenced with three replications at SinoGenoMax.
After removing the sequences of PMD18-T vector and the
expression constructs, local alignment was conducted between the
sequences of the specific fragments and the maize genome (line
B73), downloaded from maize Sequence
(http://www.maizesequence.org), or the expression plasmid. The
threshold identity and expect value were set to ≥90% and ≤e -100 ,
while the alignment coverage was more than 85% of the sequences
of the specific fragments.
RESULTS
Specificity of TAIL-PCR products
From 60 of the total 70 transgenic maize lines, 42 and 33
fragments were amplified by the combinations of the AD
and the nested specific primers complementary to the
inside flanking sequence of the T-DNA left border
and right border, respectively. By the repeat PCR
amplification, 64 out of the 75 recovered products were
confirmed to be specific fragments amplified from 57
transgenic maize lines. These fragments ranged in size
from 400-1000 bp. The amplification efficiency of AD4
and AD6 was higher than the other AD primers (Figure
3). By the sequence analysis, 41 out of the 64 specific
fragments were demonstrated to be the flanking
sequences outside the left border (26 fragments) or right
border (15 fragments) of the integrated T-DNA
sequences. Thirty-two (78.0%) and nine (21.9%) of them
are homologous to the sequences of the maize genome
and the expression plasmid, respectively (Table 3). For
the other 23 specific fragments, the identities and expect
values of sequence alignment with the sequences of
either the maize genome or the expression plasmid were
out of the threshold criterions.
Yang et al. 12617
Flanking sequences around T-DNA integration sites
By the sequence analysis, 32 of the 41 flanking
sequences were demonstrated to be homologous to the
maize genome (Table 3). For 26 of them, a filler
sequence of 3-63 bp long was found flanking the maize
genomic sequence (Figure 4). These filler sequences
were homologous neither among themselves nor to the
sequences of the maize genome or the expression
plasmids. For transgenic lines 1, 7, 8, 14, 15, 26, 32 and
46 (19.5%), the specific fragments were unable to be
amplified by a nested specific primer the most adjacent to
the left or right borders (LS5 or RS5), but by a nested
specific primer farther from the left or right borders (LS3,
RS3 or RS4, Figure 1). Nine of the specific fragments
(21.9%) were found to be homologous to the backbone
sequences of expression plasmids pCAMBIA 1300 or
pCAMBIA1390. The length of the integrated plasmid
sequences ranged from 360-1000 bp (Table 3).
T-DNA integration sites
Out of the 32 flanking sequences homologous to the
maize genome, eleven were found homologous to the
sequences at more than one physical site on three to ten
chromosomes (Table 3), indicating that their integration
sites are repetitive sequences. Because of the
incompletion of the sequence data of the maize genome
and the diversity of the genomic sequences between the
acceptor maize line “18-599” and sequenced maize line
“B73”, it was difficult to precisely identify the detail
integration sites in the repetitive sequences which are
highly homologous.
The other 21 flanking sequences were found
homologous to the sequences at a single physical site on
one chromosome. These precisely indentified integration
sites distributed on all the 10 chromosomes, while seven
of them (33.3%) clustered on chromosome 1. Sixteen
(76.2%) of the 21 integration sites had relative distances
to the centromeres of the integrated chromosome arms
more than 0.50, implying that T-DNA integration prefers
to the distal ends of chromosomes. The integration sites
of lines 14, 19 and 35 were close adjacent to those of
lines 15, 26 and 47, and the integration sites of lines 12,
13, 21 and 46 were close adjacent each other.
Especially, the integration sites of lines 12 and 13 are
exactly overlapped. These two lines were speculated to
be derived from the same transformed event. Of these 21
integration sites, the four were precisely located between
adjacent base pairs A/T and T/A, 14 between A/T and
G/C, and three between G/C and C/G. The T-DNA
integration site in line 59 was found during the encoding
sequence of nucleic acid binding protein

12618 Afr. J. Biotechnol.
Figure 3. Specific bands amplified by the repeat PCR. AD, arbitrary degenerate primers; LS, nested specific primers
complementary to the inside flanking sequence of the T-DNA left border; RS, nested specific primers complementary to the
inside flanking sequence of the T-DNA right border. For each pair of the two electrophoresic lanes, the left lane was loaded
with the repeat PCR product amplified using the secondary round product of TAIL-PCR as template, and the right lane was
loaded with the repeat PCR product amplified using the tertiary round product of TAIL-PCR as template.
(LOC100280490, Table 3). Further study should be
conducted to explore the influence of this integration to
protein function and phenotype.
DISCUSSION
From 10 of the total 70 transgenic maize lines, it was
unsuccessful to amplify detectable products both in the
secondary and tertiary rounds of TAIL-PCR. This might
be due to the poor adaptability of the 6 AD primers to the
flanking sequences of the T-DNA integrated sites of these
10 transgenic maize lines. 11 of the 75 recovered
products of the secondary round amplification were not
confirmed to be specific fragments by the repeat PCR
amplification. In TAIL-PCR amplification, non-specific
fragments were probably amplified by 2 AD primers
because the concentration of AD primes was 10-fold of
the nested specific primers, and the annealing
temperatures were increased slowly from low

Figure 3. Contd
temperatures in several steps (Table 2).
For 23 of the 64 specific fragments, the identities and
expect values of sequence alignment with the sequences
of either the maize genome or the expression plasmid
were out of the threshold criterions. This could be
referred to the incompletion of the sequence data of the
maize genome, and to the diversity of the genomic
sequences between the acceptor maize line “18-599” and
the sequenced maize line “B73”. Non-specific
amplification is the major constraint of TAIL-PCR. On the
basis of the standard TAIL-PCR (Liu et al., 1995) and
its improved procedure (Sessions et al., 2002), we
further improved the temperature cycles of the 3
successive rounds by gradient screening of optimal
annealing temperature for the nested specific primers
(Table 2), and verified the specificity of the amplified
fragments by the repeat PCR. By this improved
procedure, 64 out of the 75 recovered products were
confirmed to be specific fragments (Figure 3). This
amplification efficiency of specific fragments (85.3%)
matches with the protocol of high-efficiency TAIL-PCR
Yang et al. 12619
proposed by Liu et al. (2007). The simple improvements
we made are useful for identification of flanking
sequences around T-DNA integration sits.
In several other researches, the filler DNA sequences
were found to be homologous to the sequences of the
host genomes or the expression plasmids in some extent.
It was explained by the molecular mechanism of
microhomology-mediated end joining (De Buck et al.,
1999; Windels et al., 2003; Zeng et al., 2010). In this
study, the filler DNA sequences of 26 transgenic lines
were homologous neither among themselves nor to the
sequences of the maize genome or the expression
plasmids. This result implies that the filler DNA
sequences can be inserted by some other mechanisms
such as modification and rearrangement of T-DNA
sequence (Forsbach et al., 2002; Kole et al., 2010).
In available data, the left and right border sequences
are considered as cleavage sites of T-DNA integration in
the transformation mediated by A. tumefaciens (Kole et
al., 2010). In this study, the backbone sequences of the
expression plasmids were found around the T-DNA

12620 Afr. J. Biotechnol.
Table 2. Temperature cycles of three TAIL-PCR rounds.
Reaction Cycle Thermal setting
Primary
Secondary
Tertiary
1 93°C, 3 min; 95°C, 1 min
5 94°C, 30 s; 68°C, 1 min; 72°C, 2.5 min
1 94°C, 30 s; 25°C, 3 min, ramping to 72°C, over 3 min; 72°C, 2.5 min
15 94°C, 15 s; 68°C, 1min; 72°C, 2.5 min;
94°C, 15 s; 68°C, 1min; 72°C, 2.5 min
94°C, 15 s. 44°C, 1min; 72°C, 2.5 min
1 72°C, 5min
12 94°C, 15 s; 68°C, 1 min; 72°C, 2.5 min
94°C, 15 s; 68°C, 1 min; 72°C, 2.5 min
94°C, 15 s. 44°C, 1 min; 72°C, 2.5 min
1 72°C, 5 min
14 94°C, 40 s; 45°C, 1 min; 72°C, 2.5 min
1 72°C , 10 min
Table 3. T-DNA integration sites in the maize genome.
Transgenic
maize lines
1 AD6
2 AD5
3 AD5
6 AD6
7 AD4
arbitrary
degenerate
primes
Nested
specific
primers
RS1,
RS2,
RS4
LS2,
LS4,
LS5
LS2,
LS4,
LS5
RS1,
RS4,
RS5
LS1,
LS2,
LS3
Integration site
Chr5 111733188-
111733633
Plasmid
pCAMBIA 1390
Plasmid
pCAMBIA 1390
Chr1, Chr2, Chr3,
Chr4, Chr5, Chr6,
Chr7, Chr8, Chr9,
Chr10
Length
(bp)
445
368 99
538 99
500-550 >95
Chr4 Chr6 Chr8 ~500 >98
Similarity
(%)
Nucleotides
of inserted
position
99 T/G 0.06
Relative
distant to
centromere

Table 3. Contd.
8 AD3
9 AD5
12 AD6
13 AD1
14 AD4
15 AD6
16 AD6
19 AD4
20 AD6
21 AD2
25 AD4
RS2,
RS3,
RS4
LS2,
LS4,
LS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
RS1,
RS2,
RS3
RS2,
RS3,
RS4
LS2,
LS4,
LS5
RS1,
RS4,
RS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
Chr2 Chr5 Chr7 550-600 >99
Chr1, Chr2, Chr3,
Chr4, Chr5, Chr6,
Chr7, Chr8, Chr9,
Chr10
Chr1 288462705-
288462064
Chr1 288462705-
288462064
Chr3 72021965-
72021615
Chr3 72021282-
72021741
Chr9 112696401-
112695807
Chr6 111104512-
111103976
Plasmid
pCAMBIA 1390
Chr1 288462382-
288462046
Plasmid
pCAMBIA 1390
450-500 >97
641 97 C/G 0.93
641 96 C/G 0.93
350 98 G/A 0.24
459 99 A/T 0.24
594 99 T/G 0.53
536 97 C/T 0.52
592 99
336 97 G/A 0.93
590 99
Yang et al. 12621

12622 Afr. J. Biotechnol.
Table 3. Contd.
26 AD2
30 AD5
31 AD4
32 AD4
33 AD4
34 AD1
35 AD6
37 AD6
39 AD6
40 AD4
46 AD5
47 AD4
48 AD3
RS1,
RS2,
RS3
LS2,
LS4,
LS5
RS1,
RS4,
RS5
RS2,
RS3,
RS4
LS2,
LS4,
LS5
RS1,
RS4,
RS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
RS1,RS
4,RS5
RS1,RS
4, RS5
LS1,
LS2,
LS3
LS2,
LS4,
LS5
LS2,
LS4,
LS5
Chr6 111103788-
111104198
Plasmid
pCAMBIA 1390
410 97 C/T 0.52
590 100
Chr2 Chr5 Chr7 ~400 >95
Chr2 Chr5 Chr7 ~400 >95
Plasmid
pCAMBIA 1390
Chr1 102485634-
102486191
Chr3 225058224-
225057782
Chr1 275129001-
275129338
Chr1, Chr2, Chr3,
Chr4, Chr5, Chr6,
Chr7, Chr8, Chr9,
Chr10
386 96
557 99 A/C 0.23
442 97 T/G 0.96
337 97 T/T 0.85
450-500 >99
Chr1 Chr3 ~400 >97
Chr1 288462876-
288462064
Chr3 225058115-
225057645
Plasmid
pCAMBIA 1390
812 96 A/C 0.93
470 97 T/A 0.96
592 99

Table 3. Contd.
49 AD4
50 AD2
51 AD3
58 AD4
59 AD5
60 AD2
62 AD1
65 AD6
66 AD6
67 AD2
68 AD4
70 AD4
LS2,
LS4,
LS5
LS2,
LS4,
LS5
RS6,
RS7,
RS8
RS6,
RS7,
RS8
RS6,
RS7,
RS8
LS2,
LS4,
LS5
LS1,
LS4,
LS5
LS1,
LS4,
LS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
LS2,
LS4,
LS5
Chr10
137382709-
137383092
Plasmid
pCAMBIA 1390
Chr 8 23230124-
23230519
Chr1, Chr2,
Chr3, Chr4,
Chr5, Chr6,
Chr7, Chr8,
Chr9, Chr10
Chr4 240459215-
240459685
Chr10 17568721-
17568245
Chr2 13523648-
13524073
Chr1 300174871-
300175332
383 96 G/T 0.87
1086 99
395 99 A/T 0.50
~1000 >95
Chr1,Chr3,Chr6 ~500 >95
Plasmid
pCAMBIA 1300
Chr1,Chr3,Chr6,
Chr9
Chr4 141448908-
141448482
470 91 A/G 0.96
476 99 T/G 0.71
425 100 A/G 0.85
461 92 C/C 1.00
744 100
~500 >98
426 93 T/C 0.30
Yang et al. 12623
Relative distance to centromere was calculated as the ratio of the distance of the integration site to centromere (Mb) divided by the full length
(Mb) of the integrated chromosome arm. For transgenic lines 7, 8, 9, 10, 32, 33, 41, 42, 61, 70 and 74, the flanking sequences adjacent to
the integration sites were found homologous to the maize genomic sequences at multiple physical sites on three to ten chromosomes.
integration sites (Table 3). Nine of the flanking sequences
were amplified by the nested specific primers farther from
the borders (LS3, RS3 or RS4, Figure 1). These results
suggest that the cleavage occurs not only during the T-
DNA borders but also inside or outside the borders. The
border sequences of T-DNA are not cleavage sites but

12624 Afr. J. Biotechnol.
Figure 4. Filler DNA sequences flanking the maize genomic sequences. The suspension points (…) represent
sequences adjacent the left and right cleavage sites.
recognition sites of cleavage. If the cleavage site is inside
the borders, the border sequences, as well as some
sequences of different length inside the borders, can be
deleted in the process of T-DNA integration. The nested
specific primer cannot anneal at the most adjacent
sequence to the left or right borders. If the cleavage site
is outside the borders, some of the backbone sequences
can be integrated into the maize genome. The length
variation of the integrated plasmid sequences suggests
that the cleavage sites are variable among the different
transgenic lines. Similar results were obtained by Shou et
al. (2004) and Zhu et al. (2006).
In previous studies (Brunaud et al., 2002), the adjacent
base pairs of the integration sites were considered to
have preference to A/T base pair, referring to its less
stable pairing than G/C base pair. In this study, most of
the adjacent base pairs of the integration sites were
found to be other than A/T base pairs (Table 3). This
result should also be explained by modification and
rearrangement of T-DNA sequence (Forsbach et al.,
2002; Kole et al., 2010).
According to the sequence analysis of integration sites,
eleven out of thirty-two integration sites were found
among repetitive sequences (Table 3). This ratio (34.4%)
is much less than the proportion of repetitive sequences
in the maize genome (SanMiguel et al., 1998; Zhou et al.,
2009). The preference of T-DNA integration into nonrepetitive
sequences was also found in other plants
(Szabados et al., 2002). Therefore, we conclude that T-
DNA integration have some hot spots on maize
chromosomes, and preference to the distal chromosomal
ends and non-repetitive sequences, while illegitimate
recombination is still a major pattern of T-DNA integration
into the maize genome.
ACKNOWLEDGEMENTS
This work was supported by the Projects of Development
Plan of the State Key Fundamental Research (973
Project) (2009CB118400), and the National Key Science
and Technology Special Project (2008ZX08003-004 and

2009ZX08003-012B). We thank Professors Zhi-Zhong
Chen and De Ye at China, Agricultural University for their
kindly providing experiment facilities.
REFERENCES
De Buck S, Podevin N, Nolf J, Jacobs A, Depicker A (2009). The T-DNA
integration pattern in Arabidopsis transformants is highly determined
by the transformed target cell. Plant J. 60:134-145.
Doebley JF, Gaut BS, Smith BD (2006). The molecular genetics of crop
domestication. Cell, 127:1309-1321.
Kim SI, Veena, Gelvin SB (2007). Genome-wide analysis of
Agrobacterium T-DNA integration sites in the Arabidopsis genome
generated under non-selective conditions. Plant J. 51:779-791.
Kole C, Michler CH, Abbott AG, Hall TC (2010). Transgenic crop plants:
the principles and development. Springer, Berlin.
Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995). Efficient isolation
and mapping of Arabidopsis thaliana T-DNA insert junctions by
thermal asymmetric interlaced PCR. Plant J. 8:457-463.
Liu YG, Chen YL (2007). High-efficiency thermal asymmetric interlaced
PCR for amplification of unknown flanking sequences.
BioTechniques, 43:649-656.
SanMiguel P, Gaut BS, Tikhonov A, Nakajimal Y, Bennetzen JL (1998).
The paleontology of intergene retrotransposons of maize. Nat. Genet.
20:43-45.
Schnable PS, Ware D, Fulton RS, Stein JC, Wei FS, Pasternak S, Liang
CZ, Zhang JW, Fulton L, Graves TA, Minx P, Reily DA, Laura
Courtney L, Kruchowski SS, Tomlinson C, Strong C, Delehaunty K,
Fronick C, Bill Courtney B, Rock SM, Belter E, Du FY, Kim K, Abbott
RM, Cotton M, Levy A, Marchetto P, Ochoa K, Jackson SM, Gillam B,
Chen WZ, Yan L, Higginbotham J, Cardenas M, Waligorski J,
Applebaum E, Phelps L, Falcone J, Kanchi K, Thane T, Scimone A,
Thane N, Henke J, Wang T, Ruppert J, Shah N, Rotter K, Hodges J,
Ingenthron E, Cordes M, Kohlberg S, Sgro J, Delgado B, Mead K,
Chinwalla A, Leonard S, Crouse K, Collura K, Kudrna D, Currie J, He
R, Angelova A, Rajasekar S, Mueller T, Lomeli R, Scara G, Ko A,
Delaney K, Wissotski M, Lopez G, Campos D, Braidotti M, Ashley E,
Golser W, Kim H, Lee S, Lin J, Dujmic Z, Kim W, Talag J, Zuccolo A,
Fan CZ, Sebastian A, Kramer M, Spiegel L, Nascimento L, Zutavern
T, Miller B, Ambroise C, Muller S, Spooner W, Narechania A, Ren L,
Wei S, Kumari S, Faga B, Levy MJ, McMahan L, Buren PV, Vaughn
MM, Ying K, Yeh CT, Emrich SJ, Jia Y, Kalyanaraman A, Hsia AP,
Barbazuk WB, Baucom RS, Brutnell TP, Carpita NC, Chaparro C,
Chia JM, Deragon JM, Estill JC, Fu Y, Jeddeloh JA, Han YJ, Lee H,
Li PH, Lisch DR, Liu SZ, Liu ZJ, Nagel DH, McCann MC, SanMiguel
P, Myers AM, Nettleton D, Nguyen J, Penning BW, Ponnala L,
Schneider KL, Schwartz DC, Sharma A, Soderlund C, Springer NM,
Sun Q, Wang H, Waterman M, Westerman R, Wolfgruber TK, Yang
LX, Yu Y, Zhang LF, Zhou SG, Zhu QH, Bennetzen JL, Dawe RK,
Jiang JM, Jiang N, Presting GG, Wessler SR, Aluru S, Martienssen
RA, Clifton SW, McCombie WR, Wing RA, Wilson RK (2009). The
B73 maize genome: complexity, diversity, and dynamics. Science.
326:1112-1115.
Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich
B, Ho P, Bacwaden J, Ko C, Clarke JD, Cotton D, Bullis D, Snell J, T
Miguel, D Hutchison, Kimmerly B, Mitzel T, Katagiri F, Glazebrook J,
Law M, Goff SA (2002). A high-throughput Arabidopsis reverse
genetics system. Plant Cell. 14:2985-2994.
Shimizu K, Takahashi M, Goshima N, Kawakami S, Irifune K, Morikawa
H (2001). Presence of SAR-like sequence in junction regions
between an introduced transgene and genomic DNA of cultured
tobacco cells: Its effect on transformation frequency. Plant J. 26:375-
384.
Shou H, Frame BR, Whitham SA, Wang K (2004). Assessment of
transgenic maize events produced by particle bombardment or
Agrobacterium-mediated transformation. Mol .Breed. 13: 201-208.
Yang et al. 12625
Thomas CM, Jones JDG (2007). Molecular analysis of Agrobacterium
T-DNA integration in tomato reveals a role for left border sequence
homology in most integration events. Mol. Genet. Genomics.
278:411-420.
Windels P, De Buck S, Van Bockstaele E, De Loose M, Depicker A
(2003). T-DNA integration in Arabidopsis chromosomes. Presence
and origin of filler DNA sequences. Plant Physiol. 133:2061-2068.
Zeng FS, Zhan YG, Zhao HC, Xin Y, Qi F-H, Yang CP (2010).
Molecular characterization of T-DNA integration sites. Trees. 24:753-
762.
Zhang ZY, Fu FL, Gou L, Wang HG, Li WC (2010) RNA interferencebased
transgenic maize resistant to maize dwarf mosaic virus. J.
Plant Biol. 53:297-305
Zhang J, Guo D, Chang Y, You C, Li X, Dai X, Weng Q, Zhang J, Chen
G, Li X, Liu H, Han B, Zhang Q, Wu C (2007). Non-random
distribution of T-DNA insertions at various levels of the genome
hierarchy as revealed by analyzing 13804 T-DNA flanking sequences
from an enhancer-trap mutant library. Plant J. 49:937-959.
Zhao X, Coats I, Fu P, Gordon-Kamm B, Lyznik LA (2003). T-DNA
recombination and replication in maize cells. Plant J. 33:149-159.
Zhou S, Wei F, Nguyen J (2009). A single molecule scaffold for the
maize genome. PLoS. Genet. 5:1-14.
Zhu QH, Ramma K, Eamens AL, Dennis ES, Upadhyaya NM (2006).
Transgene structures suggest that multiple mechanisms are involved
in T-DNA integration in plants. Plant Sci., 171:308-322.
Zhu C, Wu J, He C (2010). Induction of chromosomal inversion by
integration of T-DNA in the rice genome. J. Genet. Genomics.
37:189-196.

African Journal of Biotechnology Vol. 10(59), pp. 12626-12668, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1001
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Ecological features of Tricholoma anatolicum in Turkey
Hasan Hüseyin Doğan 1 * and Ilgaz Akata 2
1 Selçuk University, Faculty of Science, Department of Biology, Campus, 42031 Konya, Turkey.
2 Ankara University, Faculty of Science, Department of Biology, 06100, Ankara Turkey.
Accepted 18 August, 2011
Tricholoma anatolicum H.H. Doğan & Intini was first published as a new species in 2003, and it is known
as “Katran Mantarı” in Turkey. It has great importance in trading and is also exported to Japan.
However, there is no extensive information on its ecological status. To reveal its features of ecological
status, we studied eight different places in Turkey in the years of 2005 and 2009. According to our
results, this species makes an ectomycorrhizal association with Cedrus libani trees. The distribution
area of the species is Taurus Mountain between 1,400 and 1,700 m elevations from the Mediterranean
region. The morphological features of the species are closer to Tricholoma magnivelare (Peck) Redhead
than the other members of Matsutake group. Its characteristic features are white to cream-coloured
fruiting body, a special odour like tar, different aroma and cyanophilic spores. In general, it grows on
well-drained and infertile sandy soil in C. libani forests, which are more than 25 years old. The fruiting
period is from October to November and also grows in Mediterranean climate type.
Key words: Ectomycorrhizal fungi, Matsutake group, Mediterranean region, Tricholoma anatolicum, Turkey.
INTRODUCTION
Some ectomycorrhizal fungi have edible fruiting bodies,
which are harvested and sold on a considerably large
market in the world. This trading is especially important in
the northern hemisphere countries in Asia, the USA,
Canada and Japan. The volume of this trade in these
countries is higher than 3 billion US$ per year (Yun et al.,
1997).
Tricholoma genus is an important ectomycorrhizal
edible fungal genera of large economic value, and some
important taxa in that respect are as follows: T.
matsutake (S. Ito et Imai) Sing. (hong or true matsutake)
from Japan, China and Korea; T. magnivelare (Peck)
Redhead (white matsutake) in Canada, Mexico and the
USA; T. caligatum (Viv.) Ricken, which mainly occurs in
Europe and North Africa, particularly in Algeria, Morocco
and the USA; T. bakamatsutake Hongo (false
matsutake); T. quercicola M. Zang; T. dulciolens Kytöv.;
T. fulvocastaneum Hongo, T. robustum (Alb. & Schwein.)
Ricken, T. focale (Fr.) Ricken and T. zelleri (D.; T.
*Corresponding author. E-mail: hhuseyindogan@yahoo.com.
Tel: +90535 8835145.
robustum (Alb. & Schwein E. Stuntz & A. H. Sm.)
Ovrebo & Tylutki in all northern hemisphere countries
(Zeller and Togashi, 1934; Redhead, 1984; Arora, 1986;
Kytövuori, 1988; Bon, 1991; Hosford et al., 1997; Wang
et al., 1997; Intini, 1999; Intini et al., 2003; Kranabetter et
al., 2002; Bidartondo & Bruns, 2002 Galli, 2003).
T. matsutake produces the most valued mushroom
(matsutake) in association with pines, including Pinus
densiflora Sieb. et Zucc. in the Far East and Pinus
sylvestris L. in Scandinavia, and with both pines and oaks
in the foothills of Tibet. Other matsutake mushrooms,
such as T. anatolicum in Turkey and T. magnivelare from
the North Pacific Coast area of Canada and North
America as well as Mexico, respectively produce fruit
bodies morphologically similar to matsutake in
association with other Pinaceae plants in their natural
habitats. T. bakamatsutake and T. fulvocastaneum from
Asia are solely associated with Fagaceae. None of these
matsutake mushrooms has been cultivated yet, and the
mechanisms involved in their symbioses remain
inadequately studied; neither has the systematics of
these apparently related mushroom species been
definitively established (Yamada et al., 2010). The bestknown
species between them are T. matsutake and T.

Figure 1. Distribution map of Tricholoma anatolicum in Turkey.
magnivelare, which are known as matsutake. The
popularity and high economic value of these two species
are due to their special aroma and taste (Intini, 1999;
Intini et al., 2003). Harvesting and sales (domestic and/or
international) of T. anatolicum is a major trade in Turkey.
Its habitat, morphological characteristics, odour and
flavour are different from T. matsutake and T.
magnivelare (Viviani, 1834; Ito and Imai, 1925; Zeller and
Togashi, 1934; Bon, 1984; Riva, 1988a, b, 1998;
Kytövuori, 1988; Hosford et al., 1997; Yun et al., 1997;
Mankel et al., 1998; Berguis and Danell, 2000;
Kranabetter et al., 2002).
MATERIALS AND METHODS
The material of the present study was collected in eight different
localities from Karaman-Başyayla; Adana-Kozan, Göller; Adana-
Kozan, Görbiyes; Adana-Feke; Adana-Aladağ; Antalya-Gazipaşa,
Karatepe; Antalya-Gazipaşa, Asarbaşı; Kahramanmaraş-Andırın,
Elmadağ (Figure 1). Ecological observations of the studied localities
were performed in 2005 and 2009. The last decade climatic
features were obtained from the Meteorology Station, and the
climatic features of the studied areas were determined according to
Emberger (Akman, 1999). The tree age, height, site and stand
characteristics in the forest were observed according to Oner et al.
Doğan and Akata 12627
(2009). The soil temperatures were measured by a digital
thermometer. The pH of the soil was also measured by a digital pH
meter. The chemical features of the soil were determined according
to Doğan et al. (2006). The soils were measured by a ruler at the
different depth to find the mycelial growth and mycorrhizal roots.
Thin layer sections of the roots were prepared to reveal the
mycorrhizal position of the species and their pictures were taken.
Microscopical features were examined with an optical microscope
at different magnifications. Spores, basidia and hyphae were
examined and measured with an ocular micrometer. Plant species
were identified by Muhittin Dinç (Biology Department, Selçuk
University, Literature Faculty, Konya).
Collected specimens are kept at Mushroom Application and
Research Centre, Selcuk University, Konya/Turkey.
RESULTS
Morphological description
Tricholoma anatolicum H.H. Doğan & Intini
Pileus: 4 to 20 cm in diameter at first hemispherical, then
convex to plane (Figure 2); surface: weakly viscid when
moist, shining and silky when dry, smooth and whitish to
pale cream in the centre, white to pale cream when

12628 Afr. J. Biotechnol.
Figure 2. A mature fruit body with completely opened pileus.
young, light brownish to brown-ochreous with age by the
soil remnants, radial fibrillose, often adpressed scales;
margin: rolled in and with whitish fibrils, attached to the
stipe by a cortinate like veil when young; cortinate
like veil: persistent and very variable, but it exists all the
time; lamellae: white to whitish when young, light
yellowish with age, narrow, slightly notched-adnexed,
edges smooth; stipe: 4 to 10 (15) cm long, 1 to 3 (5) cm
diameter, cylindric to conic, tapered to the base, stiff and
very hard; annulus: superior, patent or slightly hanging,
persistent annulus white, fibrillose-membranous; flesh: 2
to 5 cm thick, white, very solid; odour: fragrant, very
distinct and similar to the cedar of Lebanon (known as
Katran = Tar); taste: very mild and pleasant; spores:
broadly elliptic, smooth, hyaline with oil drops,
cyanophilic, 6 to 7.5 (8.5) × 4 to 5 (5.5) µm (Figure 3a).
Basidia: 35 to 42 (48) × 7.5 to 8.5 (9) µm, clavate, 4spored,
cystidia sparse (Figure 3b); pileal surface: formed
by more or less flat hyphae 7 to 28 µm wide, hyaline to
light brownish-brown in Melzer‟s reagent (Figure 4).
Species examined
Turkey; Karaman-Başyayla, Katranlı plateau, elevation
1,400 to 1,700m in A. cilicica subsp.cilicica-C. libani
forest, where the type species was collected. This
species was also identified in the following localities:
Adana-Kozan, Göller, Çamboğazı, in A. cilicica subsp.
cilicica-C. libani forest, under C. libani, 1,515 m,
26.10.2008, HD3929; Adana-Kozan, Görbiyes, Ahır
kuyusu, in A. cilicica subsp. cilicica-C. libani forest, under
C. libani, 1,500 m, 27.10.2008, HD4054; Adana-Feke,
Aytepesi, in C. libani forest, 1,600 m, 28.10.2008,
HD4147; Adana-Aladağ, Katran çukuru, in C. libani
forest, 1,400 m, 24.11.2007, HD3043; Antalya-Gazipaşa,
Karatepe, in C. libani-A. cilicica subsp. isaurica forest,
under C. libani, 1,450 m, 09.10.2006, HD2533; Antalya-
Gazipaşa, Asarbaşı, in A. cilicica subsp. isaurica-C. libani
and J. excelsa, under C. libani, 1,520 m, 18.10.2009,
HD3709; Kahramanmaraş-Andırın, Elmadağ, in A. cilicica
subsp.cilicica-C. libani forest, under C. libani, 07.11.2008,
HD4257 (Figure 1). It was also found from
Kahramanmaraş-Göksun, Soğukpınar (Kaya et al.,
2009), Adana-Feke, Hıdıruşağı village; Muğla-Fethiye,
Arpacık village, Yaylakoru and Gedre; Muğla-Fethiye,
Babadağ, Antalya-Kaş, Sütleğen village, Osmaniye-
Kaypak, Yarpuz and Çulhalı villages (Solak, 2009).
Habitat and fruiting body formation
T. anatolicum primarily grows under C. libani in the
Mediterranean region, particularly in Taurus Mountain.

Figure 3. (a) Spores; (b) basidia and cystidia (scale bar = 10 µm).
The elevation of the forest is between 1,400 to 1,700 m.
The soil features are sandy and well-drained. It can also
overgrow with bushes of Astragalus microcephalus
Willd. in C. libani fores t in October to November. C.
libani forest can con-stitute pure stands to mixed with
Abies cilicica (Ant. & Kotschy) Carr. subsp. isaurica
Coode & Cullen., A. cilicica (Ant. & Kotschy) Carr. subsp.
cilicica and rarely Juniperus excels M. Bieb.
Nevertheless, T. anatolicum always occurs in pure stands
of C. libani or mixed with herb layers of A. microcephalus,
Doğan and Akata 12629
which is considered an indicator plant for the growth
areas of T. anatolicum. C. libani and A. microcephalus
may also grow in stony places, but it is impossible to find
T. anatolicum in such areas.
T. anatolicum has distinctive fungal colonies in the soil
and produces a dense mycelial mass; the Japanese have
termed such compact mass of mycelia as „shiro‟, which
are formed between host trees or occasionally around
them (Yun et al., 1997). It is white to pale and consists of
a compact mycelial mass that colonises everything in the

12630 Afr. J. Biotechnol.
Figure 4. Hyphae of the pileus (scale bar = 10 µm)
soil including plant roots, soil granules and rocks, and
gaps between soil granules. The surface of the mycelial
mass is just below the litter layer, and in deep soils it can
be 10 to 15 cm from top to bottom. Typically, the mycelial
mass of T. anatolicum develops mainly in soils under C.
libani and A. microcephalus. Mycelial mass usually
develops when forest trees are about 20 to 30 years old.
However, the best-developed phase can be found with
trees more than 30 years old. The mycelial mass and
fruiting body of T. anatolicum is smaller with young trees
(under 20 years) because these forests are not welldeveloped
and it is not a pure stand; therefore the soil is
not of good quality for T. anatolicum in such places.
The fungus normally begins to grow when trees are
about 30 years old and more than 10 m in height.
Ectomycorrhizal fungi are abundant, and, generally, the
shrub and herb layers are poorly developed. Production
reaches the maximum in a 50 to 100-year-old forests. T.
anatolicum production is the greatest when the forest is
pure and old, with its habitat sandy soil. C. libani can also
grow on stony and calcareous spots in the same localities
but it is impossible to find T. anatolicum on such spots.
Some fungi and plant species accompany to T.
anatolicum in the same area. More than 50 species of
higher fungi were determined in C. libani and other
stands on soil, some of them being the following:
Agaricus langei (F. H. Møller & Jul. Schäff.) Maire,
Boletopsis leucomelaena (Pers.) Fayod, Cortinarius
bulliardii (Pers.) Fr., C. elegantissimus Rob. Henry, C.
europaeus (M. M. Moser) Bidaud, Moënne-Locc. &
Reumaux, C. latus (Pers.) Fr., C. odorifer Britzelm., C.
splendens Rob. Henry ssp. meinhardii (Bon) Brandrud &
Melot, C. venetus (Fr.) Fr. var. montanus, Geastrum
fimbriatum Fr., G. rufescens Pers., G. triplex Jungh.,
Geopora arenicola (Lèv.) Kers, Gomphus clavatus (Pers.)
Gray, Hebeloma mesophaeum (Pers.) Fr., Hygrophorus
marzuolus (Fr.) Bres., Lepista nuda (Bull.) Cooke,
Lycoperdon perlatum Pers., Lyophyllum infumatum
(Bres.) Kühn., L. semitale (Fr.) Kühn., Macrolepiota
excoriata (Schaeff.) M. M. Moser, Melanoleuca cognata
(Fr.) Konrad & Maubl. var. cognata Kühner, M. exscissa
(Fr.) Singer, M. humilis (Pers.) Pat., M. paedida (Fr.)
Kühner & Maire, M. polioleuca (Fr.) G.Moreno, M. stridula
(Fr.) Singer, M. substrictipes Kühner, Ramaria flava
(Schaeff.) Quél., Russula ochroleuca (Pers.) Fr., R.
pallidospora J.Blum ex Romagn., Sarcodon glaucopus
Maas Geest. & Nannf., S. imbricatus (L.) P. Karst.,
Tricholoma album (Schaeff.) P.Kumm., T. apium J.
Schff., T. equestre (L.) P. Kumm., T. orirubens Quél., T.
pardalotum Herink & Kotl., T. portentosum (Fr.) Quél., T.
cedretorum (Bon) A.Riva var. cedretorum, T.
scalpturatum (Fr.) Quél., T. stans (Fr.) Sacc., T. virgatum
(Fr.) P. Kumm. and Tulostoma fimbriatum (Fr).
Distinct plants growing in C. libani forest are as follows:
Achillae spp., Alyssum spp., Ballota spp., Barbarea spp.,
Carthamus spp., Cotoneaster nummularia Fisch. & Mey.,

Craetagus spp., Crocus spp., Dianthus zonatus Fenzl.,
Euphorbia spp., Marrubium spp., Phlomis spp., Pilosella
hoppeana (Schultes) C.H. & F.W.Schultz, Poa bulbosa
L., Polygonum spp. and Silene italica (L.) Pers.
Soil features
The soil is generally sandy and moist but not very wet,
and the litter layer is about 3 cm in depth. T. anatolicum
is most likely to be found in stands that appear to be in
rich condition for needle litter of C. libani and A.
microcephalus stands. T. anatolicum was found in welldrained,
sandy loams with rich soils for organic
substance including litter layers situated in the northwest
part and with 20 to 45% slope. The litter layer varies in
thickness from 0.5 to 3 cm. Generally, the most
productive soils are acidic to neutral, well-drained, and
infertile. The soil features are as follows: pH 5 to 7,
0.03% salt, 1.5 to 3% CaCO3 and organic matter is about
3%.
Climatic features
The climate types of the areas were determined
according to Emberger (Akman, 1999). Climatic data
from the studied areas were used for climatic analysis
(Figure 5).
The climatic results are as follows: Adana is under the
influence of rather rainy-mild Mediterranean climate and
the ombrothermic diagram shows that the arid period
starts from May until September; Akseki is under the
influence of rainy-cold Mediterranean climate and the
ombrothermic diagram shows that the arid period starts
from June until September; Gazipaşa is under the
influence of rainy Mediterranean climate and the
ombrothermic diagram shows that the arid period starts
from April until September; Göksun is under the influence
of semi arid-upper glacial Mediterranean climate and the
ombrothermic diagram shows that the arid period starts
from May until September; Kahramanmaraş is under the
influence of semi arid and upper cool Mediterranean
climate and the ombrothermic diagram shows that the
arid period starts from May until September; Karaman is
under the influence of arid upper and very cold
Mediterranean climate and the ombrothermic diagram
shows that the arid period starts from May until
September; Kozan is under the influence of rather rainy
Mediterranean climate and the ombrothermic diagram
shows that the arid period starts from May until
September.
T. anatolicum fruits between October and November
(mainly during October), though yields are closely tied to
the climate. Like many other macrofungi, primordia begin
to form when temperatures drop after summer and soil
Doğan and Akata 12631
moisture rises. The average temperatures and precipitations
for the month of October are 21.9°C and 43.1
mm for Adana, 15.6°C and 17.9 mm for Akseki, 10.5°C
and 40.1 mm for Göksun, 19.6°C and 32.6 mm for
Kahramanmaraş, 13°C and 19.2 mm for Karaman and
22.3°C and 49 mm for Kozan. The average temperatures
and precipitations for the month of November are
15.10°C and 59.5 mm for Adana, 9.6°C and 152.7 mm for
Akseki, 3.9°C and 66.4 mm for Göksun, 11.9°C and 84.5
mm for Kahramanmaraş, 6.4°C and 35.1 mm for
Karaman and 16.2°C and 66.2 mm for Kozan. The best
month for the yield of T. Anatolicum is October. In this
month, the temperature is neither very high nor low; it is
usually between 10 to 20°C and days under 0°C are
much rarer than in November. In November, the
temperature is between 5 to 18°C, lower than that in
October. There are also more days under 0°C in
November than in October.
The optimum soil temperature for primordial formation
is between 10 to 20°C. However, expansion of the
primordia can occur at much lower soil temperatures. T.
anatolicum can be picked until lower temperatures occur;
it can be found when night air temperature is around 0 to
10°C, and soil temperatures decrease below 0°C. Fruiting
bodies can be found in November when the soil
temperature is close to 0°C. It was collected many times
in frozen soil but if this situation persists for a long time,
the yields will suddenly decrease and T. anatolicum
season will finish. Overall, T. anatolicum yields are
highest when there is plenty of rain in spring, a relatively
mild summer, and a moist, warm autumn. Primordia
usually begin to form in October when the soil temperature
between 5 to 10 cm is approximately 15 to 20°C,
and there has been about 30 to 40 mm of mild
precipitation. From then on, 4 to 10 mm of rain every
week is enough to ensure further growth of fruiting
bodies. Nevertheless, there can be much fewer rainy
days in some years or much more. If the rainy days are
more and plentiful, the production will be greater.
However, if the soil temperature climbs higher than 20 or
drops below 15°C, primordia will abort. Good harvesting
time is between 15 and 20°C and 50 to 100 mm of rainfall
in 10 to 15 showers between November and until mid
October.
Morphology and anatomy of T. anatolicum
mycorrhizal colonisation
T. anatolicum makes an ectomycorrhizal colonisation with
C. libani roots. There is an outer zone at the “mycorrhizal
colonisation” where only mycelia are found which
advances 5 to 10 cm per year. This is followed by a zone
of maximum mycelial growth and mycorrhizal colonisations
on the roots where the soil is extremely
hydrophilic, a zone where fruiting bodies are produced

12632 Afr. J. Biotechnol.
Figure 5. The Ombrothermic diagrams of the localities.

Figure 6. Hartig net covers on root. The arrow shows the mycelia.
about 5 cm under the topsoil, a powdery mycelial zone
where the roots have begun to collapse, one where the
soil is beginning to recover its normal state and structure,
and the oldest zone (10 to 15 cm) from the mycorrhizal
colonisation where the soil has returned to normal. There
is also a mantle and well developed Hartig net. White
thick layer of hyphae covers the lateral and main roots
(Figure 6). Sometimes labyrinthine hyphal systems occur
between cortical cells similar to those formed by typical
ectomycorrhizal fungi. From this, hyphae penetrate
between the outer layers of cells of rootlets and short
and long lateral roots (Figure 7).
Harvesting and grading
T. anatolicum fruiting bodies begin to open when they
break through the soil surface. Before this period, it is
impossible or very difficult to see them outside due to the
fact that the litter layer completely covers them. Therefore,
considerable expertise is required to recognize the
cracks and bulges of the soil, which indicates that a
fruiting body is just below the soil surface. To find these
highly-valued fruiting bodies, collectors often use rakes,
sticks, or small adzes to remove the litter layer, dig
through the topsoil, and expose the immature fruiting
bodies. This process causes considerable damage not
only to the mycelial mass but also to other young
primordia and to the soil structure. There is no advice
available to collectors on the best ways of collection with
Doğan and Akata 12633
minimal disturbance to the ecosystem or any penalty to
prevent this collection method. The collectors pick the
mushrooms without following any rules and by applying
very ordinary methods. It must be prevented as soon as
possible to stop the ecological damage. Thereafter,
individual collectors, who are villagers from the mountain
places, sell to wholesalers who set up purchase points in
the villages. T. anatolicum are then taken overnight to the
special collection centre. After enough quantity is taken,
they are cleaned from the soil remnants and put into
plastic bags without use of any process and are then
exported to Japan by airplane. Prices are largely
determined by supply and demand. Shape and colour are
important attributes as well as its smell, taste, and flavour
for the value of T. anatolicum for collectors.
One specimen of T. anatolicum can grow up to 20 cm
in diameter, but they do not reach as high a price,
apparently due to an unsatisfactory texture. Once the
mushroom begins to open, it is downgraded to second
quality. The lowest grading is being awarded to fullyopened
mushrooms, badly affected by insect larvae and
worms. Lower prices are paid for the lower grades
despite first quality T. anatolicum having the best taste.
Normally, T. anatolicum is white with light cream to dirty
cream or light brown patches but both handling and
storage cause discoloration, turn it to brown, and reduces
its value. Its surface can also be dirty and turn to light
brown by the soil texture if the soil is wet or damp. The
grading system for T. anatolicum is not exactly clear and
it is very ordinary in Turkey. Nevertheless, there are

12634 Afr. J. Biotechnol.
Figure 7. The lateral section of root. The arrow shows the mycelia.
mainly 4 grades for first quality (Figure 8); it is very
important to have unopened caps for the grading system.
Grade 1 is unopened caps about 8 to10 cm diameter,
grade 2 is 6 to 8 cm, grade 3 is 4 to 6 cm and grade 4 is
about 4 cm or just started to open (Figure 9). The second
quality is out of grade, which are half partly or fully
opened, broken, attacked by insects or very smallunopened
caps or opened and more than 10 cm
diameter. Out of grade is not bought by the wholesalers;
they primarily prefer grades 1 and 2 categories.
Prices and production of T. anatolicum
Exportation of T. anatolicum to Japan commenced in late
1990. The current production and exportation values are
scarcely known because there is not any official control
system for their export. Certain special collectors manage
the collection and exportation and they do not want to
explain how many kilos of T. anatolicum are collected
and exported per year. Nevertheless, approximately more
than 50 tonnes are exported to Japan per year. There is
no orderly production, but amount depends on the
climatic conditions in the collection season. Some years
the climatic conditions can be rainless and dry, while
other years can be very wet and rainy. During the
rainless season, T. anatolicum can grow without any rain
by using the root system of the host plant but the yield
decreases and the mushroom quality is very low, while
when the rainy season is good enough, mushroom
quality will be exceptional and yield increases steadily.
More also, collectors often receive a relatively low price
than mushroom wholesalers since the entire mushroom
must be sold as fresh and exported as soon as possible.

Figure 8. The first quality grading.
While the average wholesale price is 100 $ per one kilo,
which is the price for exportation from Turkey to Japan,
local collectors can gain about 10 $ for one kilos of T.
anatolicum. These prices however vary during the
season or depend on its abundance or scarcity.
DISCUSSION
T. anatolicum grows in C. libani forest and makes an
ectomycorrhizal association with this tree‟s roots. This
fungus prefers sandy and rich soil for organic matter in
the forest. The fruiting time is from October until late
November. There are some mycorrhizal species growing
in the same habitat and they play an indicator role to find
T. anatolicum in the Cedrus forest. These species are as
follows: Boletopsis leucomelaena, Cortinarius spp.,
Russula spp. and T. cedretorum var. cedretorum. It is
sometimes possible to confuse T. anatolicum with T.
cedretorum var. cedretorum, but there are some
differences between them. First, T. cedretorum has a
white colour when young, which changes white to pink
Doğan and Akata 12635
when old, and secondly, it has no cortinate-like velar
remnant.
Kytövuori (1989), Wang et al. (1997), Kranabetter et al.
(2002) and Hosford et al. (1997) provided the habitat and
the morphological features of T. caligatum, T.
nauseosum, T. matsutake and T. magnivelare. Features
of T. anatolicum and similar species are given in (Table
1). Bergius and Danell (2000) reported that T. matsutake
and T. nauseosum should be treated as the same
species. The oldest is T. nauseosum, but they suggested
that the name of T. matsutake should be retained. For
this reason, T. nauseosum and T. matsutake are given in
the same column. T. anatolicum has been known
erroneously as T. caligatum somewhere in Turkey. The
taste of T. caligatum is bitter, strong, and repellent.
Additionally, the brown scales and fibres on T. caligatum
tend to be darker, which is more similar to chestnut
brown and more prominent. T. caligatum is mycorrhizal
with hardwoods or pine trees as opposed to the coniferloving
matsutake group. In contrast, T. anatolicum has a
mild and pleasant taste and special smell that comes
from Cedrus libani’s extract (Katran = Tar). Therefore, its

12636 Afr. J. Biotechnol.
Figure 9. A fruit body that just started opening.
local name is “Katran-Sedir Mantarı”. The meaning of
„Katran‟ is a special extract taken from C. libani (Tar),
and the meaning of „Mantarı‟ is Mushroom. T. anatolicum
is also different from T. caligatum by its special habitat,
which is C. libani and A. microcephalus. It is very difficult
to find T. caligatum in C. libani forest. T. anatolicum can
also be easily recognised from T. caligatum by its bigger
and whiter pileus, thick and white stipe, bigger and
cyanophilic spores, long hyphae and special habitat.
T. anatolicum is also different from T. matsutake
according to DNA analysis (Intini et al., 2003) and it has
some morphological and ecological difference such as:
pileus colour of T. matsutake is more brown than T.
anatolicum, smell and taste is different, stipe has brown
scales, basidia are bigger and last and the habitat is quite
different. The habitat of T. anatolicum is restricted to C.
libani, while T. matsutake can grow in very large habitats
such as deciduous and conifer forest. According to DNA
analysis, the closest species to T. anatolicum is T.
magnivelare (Intini et al., 2003). Nevertheless, there are
important differences between them. First, pileus colour
is darker than T. anatolicum, secondly, T. anatolicum has
fragrant odour like Cedar tree, while T. magnivelare has
spicy odour and taste, thirdly, the lamellae are white and
no trace of spotted brown on it in age while T.
magnivelare has spotted brown on lamellae in age, also
the spores of T. anatolicum are cyanophilic and longer
than T. magnivelare, and lastly their habitats are different;
T. anatolicum grows only in C. libani forest and it is
restricted to the Mediterranean region, while T.
magnivelare grows in deciduous and conifer forests and
its distribution area is very large in northern America. In
addition, the fruiting period for T. anatolicum is also later
than the other relative species.
ACKNOWLEDGEMENT
Selcuk University Scientific Research Projects Co-
ordinating Office, Konya/Turkey (SÜ-BAP-06401046 and

Table 1. Comparison of T. anatolicum, T. caligatum, T. nauseosum-matsutake and T. magnivelare.
Character T. anatolicum T. caligatum T. nauseosum-matsutake T. magnivelare
Pileus
Odour and
taste
Lamellae
Stipe
Spores
4 to 20 cm, hemispherical, convex to plane,
white to pale creamy when young, brown to
brownish-ochraceous with age.
Fragrant, like that cedar of Lebanon (C.
libani), taste very mild, pleasant
Narrow, adnexed, whitish, yellowish with
age
4 to 10(15) × 1 to 3(5) cm, cylindric to conic,
tapered to base, annulus superior, very
close the lamellae, fibrillose, membranous,
above the annulus white, below the annulus
ochraceous-brown zones
6 to 7.5 (8.5) × 4 to 5 (5.5) µm, broadly
elliptic, cyanophilic
3 to 12 cm, subumbonate, blackish
brown, with dark brown scales.
Strong, just like that Inocybe
corydalina, taste sweetish-bitter to
bitter
6 to 20 (30) cm, convex to plano-convex,
radially fibrillose, with adpressed scales,
centre brown to light brown
Strong, sweetish, like that I. corydalina,
taste very mild, pleasant
Close, broad, sinuate, whitish Close, broad, straight, emarginated, white
4 to 10 × 1 to 2.5 cm, with
persistent and ascending annulus 7
to 25 mm down from the lamellae,
more or less transverse, blackish
brown zones on a lighter
background
5.7 to 7.3 × 4.3 to 5.4 (5.9) µm,
broadly ellipsoid
5 to 20 (25) × 1.5 to 2.5 cm, even thickness
or slightly tapering or enlarging downwards,
persistent annulus on the upper part of the
stipe, 5 to 15(30) mm downwards from
lamellae more or less transverse brown
zones on the lighter background
6.6 to 8.4 (9.1) × 5.0 to 6.3 µm, broadly
ellipsoid, hyaline
Basidia Clavate, 35 to 42 (48) × 7.5 to 8.5 (9) µm Clavate, 27 to 42 × 5.5 to 7.5 µm Clavate, 35-50 × 6.5 to 9 µm
Pileal
surface
Distribution
and ecology
More or less flat hyphae, 7 to 28 µm wide,
hyaline to light brownish-brown in Melzer‟s
reagent
On Toros Mountain in Turkey, elevation
1400 to 1700 m, C. libani and A.
microcephalus
More or less flat hyphae, 7 to 16
µm wide
Mediterranean region, South
France, Spain, NW Africa, Pinus
forests, Abies, Picea and Quercus.
Flat and very thin-walled, 7 to 25 µm wide
Fennoscandia, Japan, China, Korea,
Pinus sylvestris, P. densiflora, P. thunbergii,
P. pumila, Tsuga sieboldii, T. divesifolia,
Picea jezoen-sis, Quercus mongolica
Doğan and Akata 12637
5 to 25 cm, convex to
plano-convex, white
when young, yellow to
orange or brownish
stains in age
Spicy smell, distinctly
fragrant, very mild
White, spotted brown in
age, crowded, adnate to
adnexed to sinuate.
Stipe 4 to 15 × 1 to 6
cm, similar colours as
the cap, veil sheathing
from the base, thick,
white, forming a cottony
annulus
5 to 7 × 4.5 to 5.5 µm,
subglobose to short
elliptic
Canada to the Western
United States, Mexico,
Canada
Abies magnifica, A.
grandis, Tsuga
heterophylla,
Pseudotsuga menziensii,
Pinus spp. Quercus spp.
Growing time October to November October to December July to October June to October

12638 Afr. J. Biotechnol.
11701426) supported this work. We would like to thank
them for their financial support.
REFERENCES
Akman Y (1999). İklim ve Biyoiklim. Kariyer Matbaacılık Ltd. Şti. Ankara.
Arora D (1986). Mushrooms demystified. Ten Speed Press. Berkeley.
U.S.A.
Bergius N, Danell E (2000). The Swedish matsutake (Tricholoma
nauseosum Syn. T. matsutake): distribution, abundance and ecology.
Scand. J. For. Res. 15: 318-325.
Bidartondo MI, Bruns TD (2002). Fine-level mycorrhizal specificity in the
Monotropoideae (Ericaceae): specifitiy for fungal species groups.
Mol. Ecol. 11(3): 557-569.
Bon M (1984). Les tricholomes de France et d‟Europe occidentale.
Lechevalier. Paris.
Bon M (1991). Flore Mycologique d‟Europe 2-Tricholomataceae 1.
Crdp-Amiens. Saint Leu.
Doğan HH, Şanda M, Uyanöz R, Öztürk C, Çetin Ü (2006). Contents of
Metals in Some Wild Mushrooms Its Impact in Human Health. Biol.
Trace Element Res. 110: 79-94.
Galli R (2003). I Tricolomi. Edinatura. Milano.
Hosford D, Pilz D, Molina R, Amaranthus M (1997). Ecology and
management of the commercially harvested american matsutake
mushroom. USDA, Forest Service: Pacific Northwest Research
Station. General technical Report PNW-GTR. p. 412.
Intini M (1999). Tricholoma caligatum e Tricholoma matsutake (due
Tricholoma simili a confronto). BGMB, 42(2): 81-89.
Intini M, Doğan HH, Riva A (2003). Tricholoma anatolicum Spec. Nov.:
A new member of the matsutake group. Micol. e Veget. Medit. 18(2):
135-142.
Ito S, Imai S (1925). On the taxonomy of shii-take and matsutake. Bot.
Mag. 39: 319-328.
Kaya A, Uzun Y, Karacan İH (2009). Macrofungi of Göksun
(Kahramanmaraş) district. Turk J Bot. 33: 131-139.
Kranabetter JM, Trowbridge R, Macadam A, Mclennan D, Friesen J
(2002). Ecological descriptions of pine mushroom (Tricholoma
magnivelare) habitat and estimates of its extent in northwestern
British Columbia. For. Ecol. Manage. 158: 249-261.
Kytövuori I (1988). The Tricholoma caligatum group in Europe and
North Africa. Karstenia, 28: 65-77.
Mankel A, Kost G, Kothe E (1998). Re-evaluation of the phylogenetic
relationship among species of the genus Tricholoma. Microbiol. Res.
153: 377-388.
Oner N, Doğan HH, Ozturk C, Gurer M (2009). Determination of fungal
diseases, site and stand characteristics in mixed stands in Ilgaz-
Yenice forest district, Cankiri, Turkey. J. Environ. Biol. 30(4): 567-
575.
Redhead SA (1984). Mycological observations 13-14: on Hypsizygus
and Tricholoma. Trans. Mycol. Soc. Jpn. 25: 1-9.
Riva A (1988a). Tricholoma. Saronno, Liberia Editrica Giovanna Biella I-
21047. Milano.
Riva A (1988b). Fungi Europaei Vol.3, Tricholoma (Fr.) Staude. Edizioni
Candusso. Alassio, Italia.
Riva A (1998). Fungi non delineati-raro vel haud perspecte et explorate
descripti aut definite picti. Tricholoma (Fr.) Staude. Mykoflora.
Alassio, Italia.
Solak MH (2009). Sedir Mantarı, Tricholoma anatolicum. Gastro. 49: 41-
43.
Viviani D (1834). I Funghi d‟Italia e principamente le loro specie
Mangereccie, velenose, o sospette descritte ed illustrate con
tavole disegnate, ecolorite dal vero. Genova. Italia.
Yamada A, Kobayashi H, Murata H, Kalmiş E, Kalyoncu F, Fukuda M
(2010). In vitro ectomycorrhizal specificity between the Asian red pine
Pinus densiflora and Tricholoma matsutake and allied species from
worldwide Pinaceae and Fagaceae forests. Mycorrhiza, 20: 333-339.
Yun W, Hall RI, Evans LA (1997). Ectomycorrhizal fungi with edible
fruiting bodies 1. Tricholoma matsutake and related fungi. Econ. Bot.
51(3): 311-327.
Zeller SM, Togashi K (1934). The American and Japanese Matsutake.
Mycologia. 26: 544-548.

African Journal of Biotechnology Vol. 10(59), pp. 12639-12649, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1647
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effect of plant growth promoting rhizobacteria on root
morphology of Safflower (Carthamus tinctorius L.)
Asia Nosheen, Asghari Bano*, Faizan Ullah, Uzma Farooq, Humaira Yasmin and Ishtiaq
Hussain
Department of Plant Sciences, Quaid-i-Azam University, Islamabad, Pakistan.
Accepted 8 August, 2011
Rooting characteristics significantly affect the water-use patterns and acquirement of nutrient for any
plant species. Plant growth promoting rhizobacteria improve the plant growth by a variety of ways like
the production of phytohormones, nitrogen fixation, phosphate solubilization and improvement in root
morphology etc, and are also useful in cutting down the cost of chemical fertilizers. The present
investigation was carried out to determine the comparative effect of plant growth promoting
rhizobacteria (PGPR), Azospirillum brasilense, Azotobacter vinelandii and Pseudomonas stutzeri, either
alone or in combination with different doses of chemical fertilizers [full dose (Urea at 60 kg ha -1 and
DAP at 30 kg ha -1 ), half dose (Urea 30 kg ha -1 and DAP 15 kg ha -1 ) and quarter dose (Urea 15 kg ha -1 and
DAP 7.5 kg ha -1 )] on root morphology and root distribution pattern of safflower (Carthamus tinctorius L.)
viz. cvv. Thori and Saif-32 in the soil. The PGPR were applied as seed inoculation at 10 6 cells/ml prior to
sowing. P. stutzeri either alone or in combination with full dose of chemical fertilizers, was highly
effective in increasing the root area in cv. Saif-32, whereas, the percent increase due to A. brasilense
was comparable to that of treatment with full dose of chemical fertilizers. P. stutzeri inoculation resulted
in significantly higher root length in both the cultivars. Significantly, higher root width (54%) of cv. Thori
was observed in treatment receiving inoculation with A. vinelandii and supplemented with half dose of
chemical fertilizers, whereas maximum root width of cv. Saif-32 was recorded in treatment
supplemented with half dose of chemical fertilizers. It is inferred that PGPR inoculation especially those
of A. brasilense and P. stutzeri either alone and more so in combination with half dose of chemical
fertilizers, are highly effective in improving root morphology and growth in safflower.
Key words: Root area, safflower, plant growth promoting rhizobacteria (PGPR), root growth, chemical
fertilizers.
INTRODUCTION
Plant growth promoting rhizobacteria (PGPR) are freeliving
soil-borne bacteria that colonize the rhizosphere
and when applied to seed or crops, enhance the growth
of plants (Kloepper et al., 1980). They have been
reported to increase the percentage seed germination,
emergence, shoot growth, root growth, total biomass of
the plants, induce early flowering and increase the grain
yield (Van-Loon et al., 1998; Ramamoorthy, 2001). These
improvements in growth attributes of plants caused by
PGPR are brought about due to their potential of nitrogen
fixation and production of phytohormones like auxin,
gibberellins, cytokinin, and phosphate solubilization,
*Corresponding author. E-mail: banoasghari@gmail.com.
resulting in the availability of nutrients to plants and
increase in roots permeability (Enebak and Carey, 2000).
As a primary target, root is the organ that shows the
first stimulating bacterial effects. This was particularly
remarkable in plants inoculated with Azospirillum spp.
(Okon, 1985). Plant growth promoting rhizobacteria have
been reported for altering the root architecture of plants
(Mantelin et al., 2006). Auxin, a phytohormone, is
considered to positively affect the growth of roots.
However, the auxin mutants were found to retain the
capacity to elongate their root hairs when inoculated by
PGPR (Desbrosses et al., 2009).
Previous experiments showed that inoculation with
Azospirillum markedly improved yields, which were
accompanied by better water and mineral uptake and
remarkable positive alterations in the growth and

12640 Afr. J. Biotechnol.
morphology of root (Creus et al., 2004; Dobbelaere et al.,
2001). The mechanisms involved in root distribution can
be measured by quantifying root length, diameter and
surface area (Gamalero et al., 2002). Therefore, an
increase in the degree of branching of roots associated
with improved root morphology would contribute to a
better plant growth and ultimately greater yields.
Safflower has been grown from a long of time for its
colorful petals, which was used in food coloring and
flavoring agent, as a source of vegetable oils and also for
preparing textile dye in the Far East, Central and
Northern Asia and European Caucasian (Esendal, 2001).
Regarding the human health and nutritional physiology,
vegetable oil is one of the fundamental components in
foods that have important functions. Consumers have
demanded healthier oils, naturally low in saturated fats.
From this perspective, safflower has received a lot of
importance as a source of vegetable oil. The seeds of
safflower contain 35 to 50% oil, 15 to 20% protein and 35
to 45% hull fraction (Rahamatalla et al., 2001). This plant
is considered as a drought tolerant crop, which is capable
of obtaining moisture from levels not available to the
majority of crops (Weiss, 2000). Safflower can also be
grown successfully on soil with poor fertility and in areas
with relatively low temperatures (Koutroubas and
Papakosta, 2005). Safflower is also being used as a
source of alternative fuel (biodiesel) these days.
The current investigation was therefore aimed to compare
the effect of PGPR, either alone or in combination
with different doses of chemical fertilizers, on root growth
and morphology of safflower.
MATERIALS AND METHODS
The experiment was carried out in complete randomized design
(CRD) at the Department of Plant Sciences, Quaid-i-Azam
University, Islamabad. Certified seeds of Safflower cv. Thori and
Saif 32 were obtained from National Agriculture Research Centre
(NARC), Islamabad. The seeds were sown in plastic pots (11 × 8
cm 2 ) filled with autoclaved (temperature 121°C and pressure 15
Pascal) loamy soil and sand in 1:1 ratio under controlled sterilized
conditions in a growth chamber (16 h light period at 24°C, 8 h dark
period at 18°C and 60% relative humidity) and watered with
autoclaved sterilized water. Seedlings were harvested after one
month of sowing.
Method of seed inoculation
The seeds of safflower were surface sterilized with 95% ethanol
followed by soaking in 10% clorox with intermittent stirring for 5 min
and subsequently washed three times with sterilized distilled water.
The Azospirillum brasilense (isolated from rhizosphere of wheat),
Azotobacter vinelandii Khsr1 (isolated from roots of Chrysopogon
aucheri) and Pseudomonas stutzeri Khsr3 (isolated from the roots
of Solanum surattense) was applied as seed inoculation at10 6
cells/ml and the number of bacterial colonies/seed were measured
4 × 10 5 .
For inoculum preparation, 24 h old fresh cultures were inoculated
in 100 ml broth of Luria-Bertani media (LB), kept on shaker (Excell
E24, New Brunswick Scientific Incubator shaker Series, New
Gersey, USA) for 72 h at 120 rpm and centrifuged for 10 min at
10,000 rpm. Supernatant was discarded and pellet was diluted with
distilled water up to 100 ml and then optical density was measured
at 600 nm wavelength. Sterilized seeds were soaked in culture for 4
h and then sown.
Chemical fertilizers were applied in the form of urea (source of
nitrogen) and diammonium phosphate (DAP) (source of
phosphorus) at 60 kg ha -1 and 30 kg ha -1 , respectively. The
fertilizers were applied at the time of sowing in the form of aqueous
solution. The mode of application / treatments is shown in Table 1.
Parameters studied
The plants were harvested after one month of sowing and root
morphology was determined using ‘Root Law’ (Washington State
University) software. The phytohormone production (IAA and GA
etc.) and the capabilities of the respective PGPR viz. A. brasilense,
A. vinelandii and P. stutzeri were demonstrated by Ilyas and Bano
(2010), Naz et al. (2009) and Naz and Bano (2010), respectively.
Statistical analysis
The data were analyzed statistically by Statistix version 8.1
technique and comparison among mean values of treatments was
made by Duncan’s Multiple Range Test (Duncan, 1955).
RESULTS AND DISCUSSION
A dynamic root system is important for regulating the
availability of water to the plant (Toorchi et al., 2002).
This spatial allocation of roots and their biomass in the
soil are the greater determinants of the ability of crops to
gain the nutrients and water essential for growth (Li et al.,
2006). During the current investigation, it was observed
that in cv. Thori, all the treatments significantly increased
the root area; however, maximum increase (90, 91 and
90%) was recorded in P. stutzeri alone when supplemented
with half and quarter doses of chemical fertilizers,
respectively (Figure 1). Nevertheless, quarter dose of
chemical fertilizers and inoculation with A. brasilense
showed similar results (88 and 87%) as compared to
untreated control. These results indicate the positive role
of PGPR in enhancing root growth, which may counteract
the fertilizer effect. However, the inoculation of A.
brasilense along with application of half and quarter
doses of chemical fertilizers markedly improved (79 and
61%) the root area than un-inoculated control. The
impact of A. vinelandii and P. stutzeri co-inoculation was
more pronounced (86%) than that of A. brasilense and A.
vinelandii co-inoculation, which was 51% greater with
both treatments, compared with untreated control,
respectively. In case of cv. Saif-32, significant increase in
root area was observed in almost all the treatments
except A. brasilense + quarter dose of chemical
fertilizers. Whereas, inoculation with P. stutzeri along with
full dose of chemical fertilizers exhibited maximum (47%)
increase in root area. Furthermore, A. brasilense and A.
vinelandii significantly increased the root area by 33 and
39% when inoculated with half dose of chemical

Table 1. Treatment of seeds of safflower.
Nosheen et al. 12641
S/N Treatment Abbreviation
1 Control (Without inoculation and without chemical fertilizers) C
2 Chemical fertilizers full dose (Urea 60 kg ha -1 and DAP 30 kg ha -1 ) CFF
3 Chemical fertilizers half dose (Urea 30 kg ha -1 and DAP 15 kg ha -1 ) CFH
4 Chemical fertilizers quarter dose (Urea 15 kg ha -1 and DAP 7.5 kg ha -1 ) CFQ
5 Azospirillum brasilense SP
6 A. brasilense + full dose of chemical fertilizers (Urea 60 kg ha -1 and DAP 30 kg ha -1 ) SPF
7 A. brasilense + half dose of chemical fertilizers (Urea 30 kg ha -1 and DAP 15 kg ha -1 ) SPH
8 A. brasilense + quarter dose of chemical fertilizers (Urea 15 kg ha -1 and DAP 7.5 kg ha -1 ) SPQ
9 Azotobacter vinelandii BT
10 A. vinelandii + full dose of chemical fertilizers (Urea 60 kg ha -1 and DAP 30 kg ha -1 ) BTF
11 A. vinelandii + half dose of chemical fertilizers (Urea 30 kg ha -1 and DAP 15 kg ha -1 ) BTH
12 A. vinelandii + quarter dose of chemical fertilizers (Urea 15 kg ha -1 and DAP 7.5 kg ha -1 ) BTQ
13 A. brasilense + A. vinelandii SPBT
14 Pseudomonas stutzeri P
15 P. stutzeri + full dose of chemical fertilizers (Urea 60 kg ha -1 and DAP 30 kg ha -1 ) PF
16 P. stutzeri + half dose of chemical fertilizers (Urea 30 kg ha -1 and DAP 15 kg ha -1 ) PH
17 P. stutzeri + quarter dose of chemical fertilizers (Urea 15 kg ha -1 and DAP 7.5 kg ha -1 ) PQ
18 P. stutzeri + A. vinelandii P BT
Root Area (cm (cm3) 2 )
30
25
20
15
10
5
0
qr
i
q
Control
CFF
gh
m
d
f
d
fg
c
m
f
k
c
no
CFH
CFQ
SP
SPF
SPH
SPQ
r
p
e
p
ij
p
BT
BTF
BTH
Treatments
b
p
hi
p
BTQ
SPBT
j
P
d
hi
k
a
c
op
c
mn
i
PF
PH
PQ
PBT
l
cv Thori
cv Saif 32
Figure 1. Effect of A. brasilense, A. vinelandii, P. stutzeri and chemical fertilizers on root area (cm 3 ) of
safflower viz. cvv. Thori and Saif-32. The experiment was carried out in pots with three replicates. All
such means which share a common English letter are similar; otherwise differ significantly at P

12642 Afr. J. Biotechnol.
R oot length (cm )
250
200
150
100
50
0
no
o
hi
fgh
gh
l
Control
CFF
c
e
bc
e
mno
ghi
k
d
e
lm
CFH
CFQ
SP
SPF
SPH
SPQ
lmn
BT
e
k
ij
f
Treatments
ab
e
a
e
BTF
BTH
BTQ
SPBT
fg
a
P
d
d
fgh
a
a
e
cv Thori
jk
hi
PF
PH
PQ
PBT
cv Saif 32
Figure 2. Effect of A. brasilense, A. vinelandii, P. stutzeri and chemical fertilizers on root length (cm) of safflower viz. cvv.
Thori and Saif-32. The experiment was carried out in pots in three replicates. All such means which share a common
English letter are similar; otherwise differ significantly at P

Root Width (cm)
0.25
0.2
0.15
0.1
0.05
0
st
pq
t
Control
CFF
d
st
b
ijk
kl jkl
lm
c
c
hi
c
CFH
CFQ
SP
SPF
SPH
SPQ
mn
mno
rs
hij
q
de
Treatments
gh
jk
a
BT
BTF
BTH
BTQ
SPBT
fg ef
de
ijk
nop opq
opq
q
mn
mn
r
P
PF
Nosheen et al. 12643
cv Thori
cv Saif 32
de
PH
PQ
PBT
Figure 3. Effect of A. brasilense, A. vinelandii, P. stutzeri and chemical fertilizers on root width (cm)
of safflower viz. cvv. Thori and Saif-32. The experiment was carried out in pots with three replicates.
All such means which share a common English letter are similar; otherwise differ significantly at
P

12644 Afr. J. Biotechnol.
Figure 4. Morphological variations shown in root architecture of safflower cv. Thori under
various treatments of chemical fertilizers (urea and DAP). The plants were harvested after
one month of sowing. C, Control ((without inoculation and chemical fertilizers); CFF,
chemical fertilizers full dose (Urea 60 kg ha -1 and DAP 30 kg ha -1 ); CFH, chemical
fertilizers half dose (Urea 30 kg ha -1 and DAP 15 kg ha -1 ); CFQ, chemical fertilizers
quarter dose (Urea 15 kg ha -1 and DAP 7.5 kg ha -1 ).
Figure 5. Morphological variations in root of safflower cv. Thori under various
treatments of A. brasilense alone and in combination with different doses of
chemical fertilizers (urea and DAP). The plants were harvested after one month
of sowing. SP, Azospirillum brasilense; SPF, A. brasilense + full dose of chemical
fertilizers (urea 60 kg ha -1 and DAP 30 kg ha -1 ); SPH, A. brasilense + half dose of
chemical fertilizers (urea 30 kg ha -1 and DAP 15 kg ha -1 ); SPQ,A. brasilense +
quarter dose of chemical fertilizers (urea 15 kg ha -1 and DAP 7.5 kg ha -1 ).

Figure 6. Morphological variations in root of safflower cv. Thori under various
treatments of A. vinelandii alone and in combination with different doses of
chemical fertilizers (urea and DAP). The plants were harvested after one month of
sowing. BT, Azotobacter vinelandii; BTF, A. vinelandii + full dose of chemical
fertilizers (urea 60 kg ha -1 and DAP 30 kg ha -1 ); BTH, A. vinelandii + half dose of
chemical fertilizers (urea 30 kg ha -1 and DAP 15 kg ha -1 ); BTQ, A. vinelandii +
quarter dose of chemical fertilizers (urea 15 kg ha -1 and DAP 7.5 kg ha -1 ); SPBT,
A. brasilense+A. vinelandii.
Figure 7. Morphological variations in root of safflower cv. Thori under various
treatments of P. stutzeri alone and in combination with different doses of chemical
fertilizers (urea and DAP). The plants were harvested after one month of sowing.
P, Pseudomonas stutzeri; PF, P. stutzeri + full dose of chemical fertilizers (urea 60
kg ha -1 and DAP 30 kg ha 1 ); PH, P. stutzeri + half dose of chemical fertilizers (urea
30 kg ha -1 and DAP 15 kg ha -1 ); PQ, P. stutzeri + quarter dose of chemical
fertilizers (urea 15 kg ha -1 and DAP 7.5 kg ha -1 ); PBT, P. stutzeri + A. vinelandii.
Nosheen et al. 12645

12646 Afr. J. Biotechnol.
Figure 8. Morphological variations shown in root architecture of safflower cv. Saif-32 under
various treatments of chemical fertilizers (Urea and DAP). The plants were harvested after one
month of sowing. C, Control (without inoculation and chemical fertilizers); CFF, chemical
fertilizers full dose (urea 60 kg ha -1 and DAP 30 kg ha -1 ); CFH, chemical fertilizers half dose
(urea 30 kg ha -1 and DAP 15 kg ha -1 ); CFQ, chemical fertilizers quarter dose (urea 15 kg ha -1
and DAP 7.5 kg ha -1 ).
Figure 9. Morphological variations in root of safflower cv. Saif-32 under various
treatments of A. brasilense alone and in combination with different doses of
chemical fertilizers (urea and DAP). The plants were harvested after one month
of sowing. SP, Azospirillum brasilense; SPF, A. brasilense + full dose of chemical
fertilizers (urea 60 kg ha -1 and DAP 30 kg ha -1 ); SPH, A. brasilense + half dose of
chemical fertilizers (Urea 30 kg ha -1 and DAP 15 kg ha -1 ); SPQ, A. brasilense +
quarter dose of chemical fertilizers (urea 15 kg ha -1 and DAP 7.5 kg ha 1 ).

Figure 10. Morphological variations in root of safflower cv. Saif-32 under various
treatments of A. vinelandii alone and in combination with different doses of chemical
fertilizers (Urea and DAP). The plants were harvested after one month of sowing. BT,
Azotobacter vinelandii; BTF, A. vinelandii + full dose of chemical fertilizers (urea 60 kg ha -1
and DAP 30 kg ha -1 ); BTH, A. vinelandii + half dose of chemical fertilizers (urea 30 kg ha -1
and DAP 15 kg ha -1 ); BTQ, A. vinelandii + quarter dose of chemical fertilizers (urea 15 kg
ha -1 and DAP 7.5 kg ha -1 ); SPBT, A. brasilense +A. vinelandii.
Figure 11. Morphological variations in root of safflower cv. Saif-32 under
various treatments of P. stutzeri alone and in combination with different
doses of chemical fertilizers (urea and DAP). The plants were harvested
after one month of sowing. P, Pseudomonas stutzeri; PF, P. stutzeri + full
dose of chemical fertilizers (urea 60 kg ha -1 and DAP 30 kg ha 1 ); PH, P.
stutzeri + half dose of chemical fertilizers (urea 30 kg ha -1 and DAP 15 kg
ha -1 ); PQ, P. stutzeri + quarter dose of chemical fertilizers (urea 15 kg ha -1
and DAP 7.5 kg ha -1 ); P BT: P. stutzeri + A.
Nosheen et al. 12647

12648 Afr. J. Biotechnol.
alone and in combination with full, half and quarter dose
of chemical fertilizers caused 27, 39, 24 and 35%
increase as compared to un-inoculated control. P. stutzeri
supplemented with full dose of chemical fertilizers
exhibited 35% increase in root width as compared to the
control. Moreover A. brasilense and A. vinelandii coinoculation
resulted in 52% increase in root width as
compared to A. vinelandii and P. stutzeri co-inoculation.
The beneficial effects of PGPR on root growth have
been reported in wheat (Levanony and Bashan, 1989).
Previous studies showed that plant growth promotion
activity of Azospirillum was primarily related to its impact
on root growth and morphology (Okon, 1985). Similarly,
PGPR inoculation caused the production of lengthy root
hairs, stimulated the production of lateral roots, and
improved the root diameter and area respectively (Creus
et al., 2004; Dobbelaere et al., 1999). Maximum root
diameter was recorded in treatment having being
inoculated with A. vinelandii, establishing the production
of root system with greater biomass in cv. Thori, whereas
in the same variety, A. brasilense produced roots with
small width, indicating its potential role in improving the
root surface area. P. stutzeri was highly effective in
improving the root area and length in safflower. These
results are in agreement with previous findings of
Egamberdieva and Hoflich (2003) whose report showed
that inoculation of wheat with Pseudomonas caused
significant increase in root length and growth.
The production of phytohormones namely auxins,
cytokinins, and gibberellins, is the most commonly
invoked mechanism of plant growth promotion exerted by
PGPR (Garcı´a de Salamone et al., 2001). Among them,
auxins are thought to play the major role in the
development of root system. The PGPR investigated
during current investigation have been reported for their
production of phytohormones in the culture medium (Ilyas
and Bano, 2010; Naz et al., 2009; Naz and Bano, 2010),
which might have contributed to the improvement of the
rooting system of safflower. Pseudomonas and Azospirillum
has the potential to synthesize plant hormones that can
replace indole acetic acid (IAA) to stimulate root growth in
wheat and vegetable soybean, respectively
(Egamberdieva, 2010; Molla et al., 2001). Dobbelarere et
al. (1999) suggested that secretions of plant growth
promoting substances such as auxins, gibberellins and
cytokinins by the bacteria seem to be responsible for
these effects. Desbrosses et al. (2009) also reported that
auxin mutants were found to retain the capacity to
elongate their root hairs when inoculated by PGPR. The
inoculation effects of A. brasilense along with half dose of
chemical fertilizers were greater on root area than the
application of full dose of chemical fertilizers and without
inoculation of this PGPR strain. These results are in
agreement with previous findings of Okon and Kapulnik
(1986) that root surface area and length were increased
due to Azospirillum inoculation. This stimulatory effect of
PGPR inoculation might be due to increased rate of cell
division as reported in wheat’s root (Levanony and
Bashan, 1989).A. vinelandii markedly increased the root
diameter in safflower. This microbe has been reported for
the production of auxin and cytokinin in the culture
medium (Naz et al., 2009), which might have contributed
to increase in the root diameter in safflower because the
beneficial effects of auxin on root diameter have been
reported earlier (Christopher et al., 2004). It was
observed that cv. Saif-32 was more responsive to
Azospirillum inoculation than cv.Thori. These results are
also in agreement with previous findings that those
effects of Azospirillum on root growth are dependant on
the type of cultivar inoculated (Vande-Broek et al., 2000).
Similarly, Chanway et al. (1988) observed that the extent
of positive effects of the bacteria on plant growth varied
with the species or variety of the host plant.
Conclusion
It is inferred that A. brasilense and P. stutzeri are
effective PGPR strains that improved the root morphology
of safflower as evidenced by their impact on root
area, length and diameter, respectively. It is therefore
recommended that inoculation with these PGPR, either
alone or more so in combination with half and quarter
doses of chemical fertilizers, could be highly beneficial in
improving the water and nutrient availability to safflower
plants. Moreover, the impact of selected PGPR strains
was different on two safflower cultivars. Therefore, before
the selection of PGPR strains for safflower there should
be screening of cultivars that benefit from association
with these beneficial microbes.
REFERENCES
Chanway CP, Nelson LM, Holl FB (1988). Cultivar-specific growth
promotion of spring wheat (Triticum aestivum L.) by co-existent
Bacillus species. Can. J. Microbiol. 34: 925-929.
Christopher L, Rosier, Frampton J, Goldfarb B, Wise FC, Frank A,
Blazich (2004). Growth stage, auxin type and concentration influence
rooting of Virginia pine stem cuttings. Hort. Sci. 39(6): 1392-1396.
Creus CM, Sueldo RJ, Barassi CA (2004). Water relations and yield in
Azospirillum inoculated wheat exposed to drought in the field. Can. J.
Bot. 82: 273-281.
Desbrosses G, Contesto C, Varoquaux F, Galland M, Touraine B
(2009). A PGPR-Arabidopsis interaction is a useful system to study
signaling pathways involved in plant developmental control. Plant
Signal Behav. 4(4): 321-323.
Dobbelaere S, Croonenborghs A, Thys A, Broek AV, Vanderleyden J
(1999). Phytostimulatory effect of A. brasilense wild type and mutant
strains altered in IAA production on wheat. Plant Soil. 212: 155-164.
Dobbelaere S, Croonenborghs A, Thys A, Ptacek D, Vanderleyden J,
Dutto P, Labandera Gonzalez C, Caballero Mellado J, Aguirre J,
Kapulnik F, Brener Y, Burdman S (2001). Responses of
agronomically important crops to inoculation with Azospirillum. Aust.
J. Plant Physiol. 28: 871-879.
Duncan DB (1955). Multiple range and Multiple F Tests. Biometrics, 11:
1-42.
Egamberdieva D (2010). Colonization of tomato roots by some
potentially human-pathogenic bacteria and their plant-beneficial
properties. Euro. Asia J. Biol. Sci. 4: 112-118.
Egamberdieva D, Hoflich G (2003). Influence of growth-promoting
bacteria on the growth of wheat in different soils and temperatures.

Soil Biol. Biochem. 35: 973-978.
Eissenstat DM, Yanai RD (2002). Root life span, efficiency, and
turnover. In: Waisel Y, Eshel A, Kafkafi U (eds) Plant roots, the
hidden half. Marcel Dekker, New York, pp. 221-238.
Enebak SA, Carey WA (2000). Evidence of induced systemic protection
to fusiform rust in loblolly pine by plant growth promoting
rhizobacteria. Plant Dis. 84: 306-308.
Esendal E (2001). Safflower production and research in Turkey. Vth
International Safflower Conference, Williston, North Dokota, Sidney,
Montona, USA, 203-206.
Gamalero E, Martinotti M, Trotta A, Lemanceau P, Berta G (2002).
Morphogenetic modifications induced by Pseudomonas fluorescens
A6RI and Glomus mosseae BEG12 in the root system of tomato
differ according to plant growth conditions. New Phytol. 155: 293-300.
Garcia de IE, Hynes RK, Nelson LM (2001). Cytokinin production by
plant growth promoting rhizobacteria and selected mutants. Can. J.
Microbiol. 47: 404-411.
Ilyas N, Bano A (2010). Azospirillum strains isolated from roots and
rhizosphere soil of wheat (Triticum aestivum L.) grown under different
soil moisture conditions. Biol. Fertil. Soils. 46: 393-406.
Kloepper JW, Leong J, Teintze M, Schroth MN (1980). Enhanced plant
growth by siderophores produced by plant growth-promoting
rhizobacteria. Nature, 286: 885-886.
Koutroubas SD, Papadoska DK (2005). Adaptation, grain yield and oil
content of safflower in Greece. VIth International Safflower
Conference, Istanbul 6-10 June 2005: pp. 161-167.
Levanony H, Bashan Y (1989). Enhancement of cell division in wheat
root tips and growth of root elongation zone induced by Azospirillum
brasilense Cd. Can. J. Bot. 67: 2213-2216.
Li L, Sun JH, Zhang FS, Guo TW, Bao XG, Smith FA (2006). Root
distribution and interactions between intercropped species.
Oecologia, 147: 280-290.
Mantelin S, Desbrosses G, Larcher M, Tranbarger TJ, Cleyet-Marel JC,
Touraine B (2006). Nitrate-dependent control of root architecture and
N nutrition are altered by a plant growth-promoting Phyllobacterium
sp. Planta. 223: 591-603.
Molla AH, Shamsuddn ZH, Halimi MS, Marziah M, Puteh AB (2001).
Potential for enhancement of root growth and nodulation of soybean
co inoculated with Azospirillum and Bradyrhizobium in laboratory
systems. Soil. Biol. Biochem. 33: 457-463.
Nosheen et al. 12649
Naz I, Bano A, Hassan T (2009). Isolation of phytohormones producing
plant growth promoting rhizobacteria from weeds growing in Khewra
salt range, Pakistan and their implication in providing salt tolerance to
Glycine max L. Afr. J. Biotechnol. 8(21): 5762-5766.
Naz I, Bano A (2010). Biochemical, molecular characterization and
growth promoting effects of phosphate solubilizing Pseudomonas sp.
isolated from weeds grown in salt range of Pakistan. Plant Soil.
334:199-207
Okon Y (1985). Azospirillum as a potential inoculant for agriculture.
Trends Biotechnol. 3: 223-228.
Okon Y, Kapulnik Y (1986). Development and function of Azospirilluminoculated
roots. Plant Soil. 90: 3-16.
Rahamatalla AB, Babiker EE, Krishna AG, El Tinay AH (2001).
Changes in fatty acids composition during seed growth and
physicochemical characteristics of oil extracted from four safflower
cultivars. Plant Foods Human Nut. 56: 385-395.
Ramamoorthy V, Viswanathan R, Raguchander T, Prakasam V,
Samiyappan R (2001). Induction of systemic resistance by plant
growth promoting rhizobacteria in crop plants against pests and
diseases. Crop Prot. 20: 1-11.
Ramamoorthy V, Viswanthan R, Raguchander T, Prakasam V,
Samiyappan R (2001). Induction of systemic resistance by plant
growth promoting rhizobacteria in crop plants against pest and
diseases. Crop Prot. 20: 1-11.
Toorchi M, Shashidhar HE, Sharma N, Hittalmani S (2002). Tagging
QTLs for maximum root length in rainfed lowland rice (Oryza sativa
L.) using molecular markers. Cell. Mol. Biol. Lett. 7: 771-776.
Vande B, Dobbelaere A, Vanderleyden J, Vandommelen A (2000).
Azospirillum-plant root interactions: signaling and metabolic
interactions, in: Prokaryotic Nitrogen Fixation: A Model System for
Analysis of a Biological Process, Triplett EW (ed.) Horizon Scientific
Press, Wymondham, UK, pp. 761-777.
Van-Loon LC, Bakker PA, Pieterse CMJ (1998). Systemic resistence
induced by rhizosphere bacteria. Ann. Rev. Phytopathol. 36: 453-
483.
Waisel Y, Eshel A (2002). Functional diversity of various constituents of
a single root system. In: Waisel Y, Eshel A, Kafkafi U (eds) Plant
roots, the hidden half. Marcel Dekker, New York, pp. 157-174.
Weiss EA (2000). Oilseed Crops (second edition). Blackwell Science,
Oxford.

African Journal of Biotechnology Vol. 10(59), pp. 12650-12652, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1005
ISSN 1684–5315 © 2011 Academic Journals
Short Communication
High-efficiency regeneration of peanut (Arachis
hypogaea L.) plants from leaf discs
Lili Geng 1 , Lihong Niu 1 , Changlong Shu 1 , Fuping Song 1 , Dafang Huang 2 and Jie Zhang 1 *
1 State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of
Agricultural Sciences, Beijing 100193, China.
2 Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China.
Accepted 1 July, 2011
A high-efficiency regeneration system for peanut plants was established. The regeneration frequency of
leaf discs reached 40.9% on Murashige and Skoog medium supplemented with 0.5 mg l -1 naphthylacetic
acid and 0.5 mg l -1 thidiazuron. The regenerated shoots elongated, developed roots and produced
seeds. This procedure was highly efficient and is feasible for the genetic transformation of peanuts.
Key words: Peanut, regeneration, high efficiency.
INTRODUCTION
Peanut, one of the most important oil crops, is a good
source of oils, proteins, calories and vitamins. Peanuts
are also a safe alternative to reduce hunger in Asia,
Africa and Latin America. Global peanut production has
reached 34.42 million metric tons, with China producing
the highest amount of peanuts any country can produce.
Peanut yields are substantially reduced because of the
damage caused by subterranean insects and bacterial
and fungal diseases (Vargas et al., 2008). The recalcitrance
of peanuts to tissue regeneration and genetic
transformation impedes the development of genetically
modified approaches for pest and disease control.
Several exogenous genes have been introduced into
peanuts by particle bombardment (Chu et al., 2008) or
Agrobacterium-mediated transformation (Bhatnagar et
al., 2010), but these genetic transformation approaches
are time-consuming and labor-intensive, and a vast
amount of explants are needed due to the low frequency
of regeneration in peanuts. The successful exploitation of
in vitro techniques in peanuts depends on the establishment
of efficient regeneration systems. Leaflets are
the most widely used explants in peanut tissue culture.
Several other types of explants, such as cotyledonary
nodes (Srinivasan et al., 2010), epicotyls, hypocotyls
(Marion et al., 2008), axillary meristems (Singh and
Hazra, 2009) and cotyledons (Bhatnagar et al., 2010;
*Corresponding author. E-mail: jzhang@ippcaas.cn.
Tiwari and Tuli, 2008), have also been used in peanut
regeneration systems. Although, great efforts have been
made to enhance the frequency of regeneration in
peanuts, it was still difficult to obtain a sufficient number
of explants in a short period of time. It even takes 4 to 6
months for explants to regenerate and recover from
selection (Bhatnagar et al., 2010).
The proper combination of hormones could induce the
proliferation of meristematic tissues and convert the
explants into complete plants. In this study, a reproducible
and high-efficiency regeneration system for
peanuts was established using young leaves in medium
supplemented with naphthylacetic acid and thidiazuron.
MATERIAL AND METHODS
Mature peanut seeds of Baisha1016 without shells were sterilized
by incubating them in 75% ethanol for 1 min and then in mercuric
chloride for 4 min. The seeds were washed three times with
sterilized water. The two cotyledons of one seed were separated
using a scalpel, and the one with the intact embryo was put on
basal MS medium (Murashige and Skoog, 1962) supplemented
with 30 g l -1 sucrose and 7.5 g l -1 agar. Plants were kept in the
growth chamber with a 14 h/35 µmol m -2 s -1 photoperiod at 26 to
28°C. The leaf margin of six-day-old seedlings was cut off, and the
leaf discs were put on different media to develop shoots (Figure
1a).
To assess the optimal shoot induction medium, basal MS
medium was supplemented with different concentrations of
naphthylacetic acid (NAA) (0, 0.5, 1 or 2 mg l -1 ) and thidiazuron (0,
0.2, 0.5 or 1 mg l -1 ). Sixteen medium combinations based on MS

Figure 1. Regeneration of peanuts from leaf discs. A, Leaf discs; b, shoots regenerated from a leaf disc; c, induced
buds; d, shoots elongation; e, rooting; f, transplantation of seedling and seed-setting.
medium were prepared and transferred to plastic Petri dishes.
Then, 35 leaf discs were selected for each medium. The number of
buds was counted after 40 days. The rate of inducing buds was
calculated by dividing the number of explants that developed
induced buds by the total number of explants.
To determine the optimal shoot elongation medium, basal MS
medium was supplemented with different concentrations of 6benzylaminopurine
(6-BA) (4 or 8 mg l -1 ) and naphthylacetic acid
(0.5 or 1 mg l -1 ). Four medium combinations based on MS medium
were prepared, and then 30 shoots were selected for each medium.
The number of elongating shoots was counted after 20 days. The
percentage of shoots elongating was calculated by dividing the
number of the elongating shoots by the total number of explants.
Regenerated shoots were transferred to root induction medium,
which consisted of MS medium supplemented with 0.5 mg l -1
naphthylacetic acid. Shoots with robust roots were transplanted to
pots (11 cm high and 13 cm in diameter) with nutritional soil and
vermiculite mixture (volume ratio 2:1).
RESULTS
The sterilized peanut embryos developed into seedlings
with 8 or 12 leaves after 6 days. The leaf margins were
cut off, and the leaf discs were put on media containing
various combinations of hormones to determine which
combination is the most effective to induce buds. The
result shows that buds were regenerated from discs on
some medium combinations, but the frequency of bud
formation was below 15% for all media, except MS
a
d
b
e
Geng et al. 12651
medium supplemented with 0.5 mg l -1 naphthylacetic acid
and 0.5 mg l -1 thidiazuron (labeled as L medium), for
which the frequency of bud formation was 31.4%. Buds
were visible on leaf discs, 20 days after placement on L
medium (Figure 1c), and the induced buds developed
into shoots in the next 20 days (Figure 1b). The average
rate of induced buds reached 40.9% based on the results
of three independent experiments on L medium (Table 1).
Regenerated buds were subcultured onto MS media
supplemented with 6-benzylaminopurine and naphthylacetic
acid; otherwise, the explants would develop
abnormal adventitious buds. The results show that the
frequency of shoot elongation ranged from 26.7 to 83.3%
(Table 2). Based on three independent experiments, 79%
of shoots (Table 2) grew about 2 more centimeters in 20
days on MS medium supplemented with 8 mg l -1 6benzylaminopurine
and 0.5 mg l -1 naphthylacetic acid
(Figure 1d). These shoots were able to develop roots on
MS medium supplemented with 0.5 mg l -1 naphthylacetic
acid (Figure 1e). Then, the seedlings were transplanted
to pots, and the whole plant became stronger in the
greenhouse. Furthermore, these plants had a normal
ability to produce seeds (Figure 1f).
DISCUSSION
Prior to this study, the highest reported frequency of
c
f

12652 Afr. J. Biotechnol.
Table 1. Percentage of induced buds on L medium.
Repeat Number of explant Number of shoot explant Percentage of shoot explant (%)
1 35 11 31.4
2 35 16 45.7
40.9±8.3
3 35 16 45.7
Table 2. Effect of 6-benzylaminopurine and naphthylacetic acid on the elongation of shoots in peanuts.
6-BA
(mg l -1 )
NAA
(mg l -1 )
Number of
explant
Number of elongating
shoot
Percentage of elongating shoot
(%)
4 0.5 30 8 26.7
4 1 30 13 43.3
8 1 30 6 20.0
8 0.5
induced shoots was 34.7% (Akasaka et al., 2000), which
was obtained by growing peanut leaves on thidiazuroncontaining
medium. In this study, the optimal medium,
containing naphthylacetic acid and thidiazuron, performed
better than the media studied before. In the initial
experiment, 16 combinations of 6-benzylaminopurine (0,
5, 7.5 or 10 mg l -1 ), naphthylacetic acid and thidiazuron
were used to investigate the effects on bud formation.
Most explants developed abnormal enlarged tissue. The
results indicate that excessively high concentrations of
cytokinins have side-effects on shoot organogenesis,
although, a high cytokinin-to-auxin ratio has been shown
to lead to shoot regeneration (Kakani et al., 2009).
A fast and efficient regeneration system is a
prerequisite for the genetic transformation of peanuts and
the improvement of peanut production and quality
through molecular breeding. Explants did not exhibit good
regeneration ability on medium containing a single
hormone, and a proper cytokinin-to-auxin ratio is important
during organism development. Peanut tissue culture
has been previously investigated in some studies, and
several explants were used. However, the long period of
tissue culture and the low frequency of regeneration
made the genetic transformation of peanuts to be
significant for undertaking. In this study, 40.9% of
explants developed multiple buds on MS medium supplemented
with 0.5 mg l -1 naphthylacetic acid and 0.5 mg l -1
thidiazuron. This procedure improved the regeneration
efficiency and obviated the need for a laborious
regeneration process.
ACKNOWLEDGMENTS
This study was supported by 973 Projects of China
30 25 83.3
30 24 80.0
29 22 75.9
79.7±3.7
(2009CB118902 and 2007CB109203) and National
Science and Technology Major Project (2009ZX08009-
030B).
REFERENCES
Akasaka Y, Daimon H, Mii M (2000). Improved plant regeneration from
cultured leaf segments in peanut (Arachis hypogaea L.) by limited
exposure to thidiazuron. Plant Sci. 156(2): 169-175.
Bhatnagar M, Prasad K, Bhatnagar-Mathur P, Narasu ML, Waliyar F,
Sharma KK (2010). An efficient method for the production of markerfree
transgenic plants of peanut (Arachis hypogaea L.). Plant Cell
Rep. 29(5): 495-502.
Chu Y, Deng XY, Faustinelli P, Ozias-Akins P (2008). Bcl-xl transformed
peanut (Arachis hypogaea L.) exhibits paraquat tolerance. Plant Cell
Rep. 27(1): 85-92.
Kakani A, Li G, Peng Z (2009). Role of AUX1 in the control of organ
identity during in vitro organogenesis and in mediating tissue specific
auxin and cytokinin interaction in Arabidopsis. Planta, 229(3): 645-
657.
Marion J, Bach L, Bellec Y, Meyer C, Gissot L, Faure JD (2008).
Systematic analysis of protein subcellular localization and interaction
using high-throughput transient transformation of Arabidopsis
seedlings. Plant J. 56(1): 169-179.
Murashige T, Skoog F (1962). A revised medium for rapid growth and
bio assays with tobacco tissue cultures. Physiol. Plantarum. 15(3):
473-497.
Singh S, Hazra S (2009). Somatic embryogenesis from the axillary
meristems of peanut (Arachis hypogaea L.). Plant Biotechnol. Rep.
3(4): 333-340.
Srinivasan T, Kumar K, Kirti P (2010). Establishment of efficient and
rapid regeneration system for some diploid wild species of Arachis.
Plant Cell Tissue Org. Cult. 101(3): 303-309.
Tiwari S, Tuli R (2008). Factors promoting efficient in vitro regeneration
from de-embryonated cotyledon explants of Arachis hypogaea L.
Plant Cell Tissue Org. Cult. 92(1): 15-24.
Vargas GS, Haro R, Oddino C, Kearney M, Zuza M, Marinelli A, March
GJ (2008). Crop management practices in the control of peanut
diseases caused by soilborne fungi. Crop Prot. 27(1): 1-9.

African Journal of Biotechnology Vol. 10(59), pp. 12653-12656, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1819
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
A pilot study on the isolation and biochemical
characterization of Pseudomonas from chemical
intensive rice ecosystem
Prakash Nathan 1 , Xavier Rathinam 1 , Marimuthu Kasi 1 , Zuraida Abdul Rahman 2 and
Sreeramanan Subramaniam 3 *
1 Department of Biotechnology, Faculty of Applied Sciences, AIMST University, Semeling, 08100 Bedong, Kedah Darul
Aman, Malaysia.
2 Biotechnology Research Centre, MARDI-Headquater, Persiaran Mardi-UPM, 43400, Serdang, Selangor, Malaysia.
3 School of Biological Sciences, Universiti Sains Malaysia, 11800, Minden, Penang, Malaysia.
Accepted 19 May, 2011
In recent times, there has been a renewed interest in the search of plant growth promoting rhizobacteria
(PGPR) for sustainable crop production. Rice is an economically important food crop, which is
subjected to infection by a host of fungal, viral and bacterial pathogens. In this study, an attempt was
made to isolate Pseudomonas spp., a potent PGPR in the rhizosphere. Through appropriate
microbiological and biochemical methods, the study demonstrated the presence of fluorescent and nonfluorescent
Pseudomonads in the rhizosphere of chemical intensive rice growing environments.
Augmentation of such PGPR including, Pseudomonads in the rice ecosystems will ensure a healthy
micro climate for rice.
Key words: Pseudomonas, rice, plant growth promoting rhizobacteria (PGPR).
INTRODUCTION
Rice is a staple food crop of economic importance,
especially in Asia. Rice production is limited by diseases
caused by fungi, bacteria and viruses, causing annual
loss of 5% (Song and Goodman, 2001). Plant growth
promoting rhizobacteria (PGPR) are a heterogeneous
group of bacteria that are found in the rhizosphere and
rhizoplane which can improve plant growth.
Pseudomonas spp. is one of the most promising groups
of PGPR which can control plant pathogenic microbes in
the soil (O’Sullivan and O’Gara, 1992). Rice is one of the
major food crops grown in Malaysia, particularly in Kedah
Darul Aman State. Exploitation of naturally occurring
native Pseudomonas spp. can be a part of
environmentally sustainable crop protection system.
Biological control using PGPR from the genus
*Corresponding author: E-mail: sreeramanan@gmail.com. Tel:
6016-4141109. Fax: 604-6565125.
Abbreviations: PGPR, Plant growth promoting rhizobacteria;
KMB, King’s medium B metals.
Pseudomonas is an effective substitute for chemical
pesticides to suppress plant diseases (Compant et al.,
2005). The biocontrol mechanism to suppress fungal
pathogens by Pseudomonas spp. normally involves the
production of antibiotics (Nagarajkumar et al., 2004).
Pseudomonas fluorescens has a gene cluster that
produces a suite of antibiotics, including compounds such
as 2,4-diacetylphloroglucinol (2,4-DAPG), phenazine,
pyrrolnitrin, pyoluteorin and biosurfactant antibiotics
(Angayarkanni et al., 2005). The objective of this study
was to isolate Pseudomonas spp. from rice rhizosphere
and to further identify and characterize the isolates using
standard microbiological and biochemical tests.
MATERIALS AND METHODS
Rhizobacteria were isolated from the rhizosphere of rice plants
randomly selected from paddy fields in Sungai Petani, Kedah. The
randomly selected rice plants were carefully pulled out from the soil
without damaging the roots. The roots were shaken to dislodge any
loosely adhering soil. Undamaged root pieces that were 2 to 3 cm
long were used for the isolation of bacteria (Vidhyasekaran and

12654 Afr. J. Biotechnol.
PPT1b
Rabindran, 1996). The King’s medium B (KMB) was used to
isolate P. fluorescens from the processed sample in the flask (King
et al., 1954) as described by Vidhyasekaran and Rabindran (1996).
The processed samples were serially diluted from 10 -1 to 10 -5 and
0.5ml of each dilution was aseptically spread onto Petri plates
containing KMB. The plates were then incubated for 3 days at 30 ±
1°C. The growth of rhizobacterial colonies on KMB plates were
observed and recorded continuously for 3 days. The selected
isolates of rhizobacteria were subjected to further confirmatory
biochemical tests.
Standard microbiological tests were conducted for rapid
identification of Pseudomonas colonies on the KMB plates, which
included colony morphology, Gram staining, motility test and
fluorescent pigment test. Pure culture of Pseudomonas spp. was
obtained following successive selection of fluorescing colonies on
KMB under UV light at 365 nm (Rachid and Ahmed, 2005). The
isolates were characterized to be identified as P. fluorescens by
performing growth at 4 and 41°C and biochemical tests including
oxidase, catalase, gelatin hydrolysis and nitrate reduction test
(Reynolds, 2004). Motility of the isolates was determined using SIM
(sulfide-indole-motility) medium. The ability of the isolates to grow at
4 and 41°C was determined by growing the isolates in Luria Bertani
(LB) medium at respective temperatures. For oxidase test, bacterial
inoculum was placed on a sterile filter paper and a drop of Kovac’s
reagent was added to the inoculum. Immediate colour change to
purple gives positive scores (Reynolds, 2004). For the catalase test,
the bacterial cultures on LB media were scraped with a toothpick
and suspended in a drop of 3% H2O2 on a glass slide. Formation of
bubbles indicates a positive reaction, while without any bubbles
shows negative reaction (Smibert and Krieg, 1981). Gelatin
hydrolysis test was performed by stabbing the inoculum of the
isolates into the gelatin medium. Liquefied gelatin gives positive
response, while solid gelatin shows negative response (Reynolds,
2004). Nitrate reduction test was conducted to determine the ability
of the isolates to reduce nitrate to nitrite or further to free nitrogen
gas. Nitrate broth with Durham tube was prepared in a screw-cap
tube. The tubes were then inoculated with the isolates and
incubated at 30 ± 1°C for 2 days. After incubation, the tubes were
first checked for gas production. Then, nitrate reagent A and B were
sequentially added to each tube. The appearance of red colour in
PPT1a
PPT1c PPT1d
Figure 1. Isolates PPT1a, PPT1b, PPT1c and PPT1d showing
fluorescence under UV (365 nm) light.
the presence of nitrite gives a positive reaction. Negative reaction
occurs when the solution turns pink-red after the addition of nitrate
reagent C. Tube without colour change after the addition of reagent
C, indicates that the isolate can reduce nitrate to nitrite and to
nitrogen gas which also gives a positive response (Reynolds,
2004).
RESULTS AND DISCUSSION
All the isolates were large, circular, convex with an entire
margin, and light to dark yellow in colour on KMB
medium. The Pseudomonas isolates, PPT1a, PPT1b,
PPT1c, PPT1d (Figure 1) and PPT2a, PPT2b, PPT3a
and PPT3b (Figure 2) exhibited green fluorescence under
UV (365 nm) light.
All the identified isolates, except for the control showed
positive reaction on motility, oxidase, catalase and growth
at 4°C (Table 1). However, negative responses were also
identified for some Pseudomonas isolates such as for
gelatin hydrolysis and nitrate reduction test as well as the
ability of the bacteria to grow at 41°C.
Eight isolates of Pseudomonas species that nearly
resemble P. fluorescens were identified from the total of
14 isolates. All the eight isolates were found to grow on
the KMB with a typical Pseudomonas bacterial colony
morphology. According to Todar (2004), more than half of
the Pseudomonas bacteria produce pyocyanin which is a
blue-green pigment, while the nonpathogenic saprophyte
P. fluorescens produces fluorescent pigment that is
soluble and greenish. In this study, all the eight identified
gram-negative Pseudomonas isolates were found to be
green fluorescent on KMB under ultraviolet light at 365
nm. All the isolates were motile, catalase and oxidase
positive, confirming them to be Pseudomonas spp.

PPT3b
PPT2a
PPT3a PPT2b
Figure 2. Isolates PPT2a, PPT2b, PPT3a and PPT3b showing
fluorescence under UV (365 nm) light.
Table 1. Biochemical characterization of bacterial field isolates.
S/N
Bacterial field
isolate
Motility Growth
at 4°C
Growth
at 41°C
Oxidase
test
Catalase
test
Nathan et al. 12655
Gelatin
hydrolysis
Nitrate
reduction
1 PKM1a + + + + + - -
2 PKM1b + + + + + + -
3 PKM2a + + + + + - -
4 PKM2b + + + + + - -
5 PKM3a + + - + + + +
6 PKM3b + + - + + + +
7 PPT1a + + - + + + +
8 PPT1b + + - + + - -
9 PPT1c + + + + + - -
10 PPT1d + + - + + + +
11 PPT2a + + - + + + +
12 PPT2b + + + + + - -
13 PPT3a + + + + + - +
14 PPT3b + + - + + + +
(Bergey’s Manual of Determinative Bacteriology, 1974).
Angayarkanni et al. (2005) reported that P. fluorescens
can dissolve solid gelatin into a liquid form in room
temperature with the presence of an enzyme known as
PPT1a, PPT1d, PPT2a and PPT3b, were found to be
positive for gelatin hydrolysis.
Some species such as P. fluorescens strains are
capable of denitrification and able to grow anaerobically
in nitrate media. Todar (2004) reported that incubation
temperature around 30°C favours the growth of
denitrifying biotypes of P. fluorescens, while temperatures
above 37°C may be conducive for other Pseudomonas
species. Based on the test results, isolate PPT1a,
PPT1d, PPT2a, PPT3b, PKM3a, PKM3b and PPT3a
showed nitrate reduction activity. Isolates PKM3a,
PKM3b, PPT1a, PPT1d, PPT2a and PPT3b showed a
positive response for oxidase, catalase, motility, gelatin
liquefaction and growth at 4°C, but not at 41°C. The
results of this study indicates that all the six identified
Pseudomonas isolates have similar characteristics with
that of P. fluorescens, and this confirms that these
isolates may belong to the group of P. fluorescens. This

12656 Afr. J. Biotechnol.
study is assumed to be important as the agriculturally
beneficial antibiotic-producing P. fluorescens could be
one of the potential candidates in the development of
microbial pesticides to manage rice diseases, for
sustained crop productivity.
REFERENCES
Angayarkanni T, Kamalakannan A, Santhini E, Pradeepa D (2005).
Identification of biochemical markers for the selection of
Pseudomonas fluorescens against Pythium spp. In: Asian
Conference on Emerging Trends in Plant-Microbe Interactions. Univ.
Madras, Chennai. pp. 295-303.
Bergey DH, Buchanan RE, Gibbons NE. Eds. (1974). Part 7: Gramnegative
aerobic rods and cocci: Pseudomonas fluorescens. In:
Bergey’s Manual of Determinative Bacteriology 8 th Edition. Baltimore:
The Williams & Wilkins Company. pp. 221-223.
Compant S, Duffy B, Nowak J, Clement C, Barka EA (2005). Use of
plant growth-promoting bacteria for biocontrol of plant diseases:
Principles, mechanism of action and future prospects. Mini review.
Appl. Environ. Microbiol., 71(9): 4951-4959.
King EO, Ward MK, Raney DE (1954). Two simple media for the
demonstration of pyocyanine and fluorescein. J. Lab. Clin. Med., 44.
301-307.
Nagarajkumar M, Bhaskaran R, Velazhahan R (2004). Involvement of
secondary metabolites and extracellular lytic enzymes produced by
Pseudomonas fluorescens in inhibition of Rhizoctonia solani, the rice
sheath blight pathogen. Microbiol. Res., 159: 73-81.
O’Sullivan DJ, O’Gara F (1992). Traits of fluorescent Pseudomonas
spp. involved in suppression of plant root pathogen. Microbiol. Rev.,
56: 662-626.
Rachid D, Ahmed B (2005). Effect of iron and growth inhibitors on
siderophores production by Pseudomonas fluorescens. Afr. J.
Biotechnol., 4(7): 697-702.
Reynolds J (2004). Lab procedures manual: Biochemical tests.
Richland College. http://www.rlc. dcccd.edu/mathsci/Reynolds
/micro/lab_manual/TOC.html
Smibert RM, Krieg NR (1981). Chapter 20: General characterization. In:
Manual of methods for general bacteriology. Washington: Am. Soc.
Microbiol.. pp. 409-441.
Song F, Goodman RM (2001). Molecular Biology of disease resistance
in rice. Physiol. Mol. Plant Pathol., 59: 1-11.
Todar K (2004). Pseudomonas and related bacteria. Todar’s online
textbook of bacteriology. http://textbookofbacteriology.net
/Pseudomonas.etc.html accessed on 6 April 2006.
Vidhyasekaran P, Rabindran R (1996). Development of a formulation of
Pseudomonas fluorescens PfALR2 for management of rice sheath
blight. Crop Prot., 15(8): 715-721.

African Journal of Biotechnology Vol. 10(59), pp. 12657-12661, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1618
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Microbial degradation of textile industrial effluents
Shanooba Palamthodi 1 *, Dhiraj Patil 2 and Yatin Patil 2
1 Department of Biotechnology Engineering, Tatyasaheb Kore Institute of Engineering and Technology, Warananagar,
India.
2 Department of Biotechnology Engineering, Kolhapur Institute of Engineering and Technology, Kolhapur, India.
Accepted 8 August, 2011
Textile waste water is a highly variable mixture of many polluting substance ranging from inorganic
compounds and elements to polymers and organic products. To ensure the safety of effluents, proper
technologies need to be used for the complete degradation of dyes. Traditionally, treatments of textile
waste water involve physical or chemical methods. But both physical and chemical methods have many
short comings. Biodegradation is an eco friendly activity it can produce little or no secondary hazard. In
this work, the in situ degradation of textile industrial effluent was carried out. The degradation of two
different dyes, blue and green colour has been studied. The isolated organism which showed the ability
to degrade dye was characterized and identified as Paenibacillus azoreducers using various
biochemical techniques. The degradation of dye was confirmed via the decolourisation assay and by
the measurement of COD and BOD values. A trickling bed reactor was designed and the treatment of
effluent from a textile industry was effectively carried out.
Key words: Biodegradation, textile wastewater, secondary hazard, Paenibacillus azoreducens, decolourisation,
trickling bed reactor.
INTRODUCTION
Environmental problems such as appearance of colour in
discharges from various industries, combined with the
increasing cost of water for industrial sector, have made
the treatment and reuse of effluent increasingly attractive
to the industry. Textile industry is one of the oldest
industries in India with over 1000 industries. Taking into
account the volume and composition of effluent, the
textile wastewater is rated as the most polluting among
all in the industrial sectors (Zehra et al., 2003; Vilaseca et
al., 2010; Awomeso et al., 2010). In general, the
wastewater from a typical textile industry is characterized
by high values of BOD, COD, colour and pH (Tufekci et
al., 2007; Yusuff and Sonibare, 2004). It is a complex and
highly variable mixture of many polluting substances
ranging from inorganic compounds and elements to
polymers and organic products (Brown and Laboureur,
1983). In-complete use and the washing operations give
the textile wastewater a considerable amount of dyes
*Corresponding author. E-mail: Shanooba_pm@tkietwarana.org
or shanooba.pm@gmail.com. Tel: 09960495337 or
09960495436.
(Mathur et al., 2005). The untreated textile wastewater
can cause rapid depletion of dissolved oxygen if it is
directly discharged into the surface water sources due to
its high BOD value. The effluents with high levels of BOD
and COD values are highly toxic to biological life. The
high alkalinity and traces of chromium which is employed
in dyes adversely affect the aquatic life and also interfere
with the biological treatment processes (Brown et al.
1993). It induces persistent colour coupled with organic
load leading to disruption of the total ecological/symbiotic
balance of the receiving water stream (Puvaneswari et
al., 2006). Dyes with striking visibility in recipients may
lead to reduced light penetration in aquatic environment
which will significantly affect the photosynthetic activity.
The high concentration of nitrogen in the textile industrial
effluents can cause the eutrophication of closed water
bodies. In addition, coloured water is objectionable as it
can spoil the beauty of water environments (Andleeb et
al., 2010; Ashutosh et al., 2010).
In view of the earlier mentioned adverse effects, the
textile industry effluent should be discharged after proper
treatment. The dyes are stable to light, heat and oxidizing
agents, and it is difficult to remove the dyes from
effluents. This makes the effective and economic

12658 Afr. J. Biotechnol.
treatment of the effluents containing various dyes an
important environmental problem. Traditionally, both
physical and chemical methods such as coagulation,
ozonation (Lin and Lin, 1993), precipitation, adsorption by
activated charcoal, ultrafiltration, nanofiltration (Akbari et
al., 2002), electrochemical oxidation, electrocoagulation
(Kobya et al., 2003; Alinsafi et al., 2005) etc were used in
the treatment of the textile industrial effluents (Vilaseca et
al., 2010; Ramesh et al., 2007). But both methods have
many short comings (Andleeb et al., 2010; Lorimer et al.,
2001; Babu et al., 2007). Chemical methods like
coagulation often produce excess amount of chemical
sludge which create problems of its disposal. Physical
methods like adsorption by activated charcoal often need
high capital investment. Hence, most of the physical and
chemical methods of effluent treatment are not accepted
by the industries due to their high cost, low efficiency and
inapplicability to a wide variety of dyes.
Currently, much research has been focused on the
biodegradation of the industrial effluents (Andleeb et al.,
2010; Melgoza et al., 2004; Sapci and Ustun, 2003). It
mainly shows interest towards the pollution control using
bacteria, fungi in combination with physicochemical
methods (McMullan et al., 2001; Beydilli et al.,1998). The
biomass can absorb the chromophores and also these
chromophores can be reduced in low redox potential
environments. The attractive features of biological
treatment are low cost, renewable and regenerative
activity and little or no secondary hazard (Sharifi et al.,
2001; McKinney et al., 1965; Morias and Zamora, 2005).
The conventional biological processes are not effective
because the dye content in the textile effluent is toxic to
the microorganisms used (Kim et al., 2002; Koch et al.,
2002). In situ degradation of the effluent is a novel
method under the biodegradation process. In this
method, the microorganisms isolated from the site of
pollution and the same microorganism can be used for
the treatment of the effluent (Olukanni et al., 2006;
Puvaneswari et al., 2006).
MATERIALS AND METHODS
Collection of the effluent sample
Aseptic techniques were followed during effluent collection. 350 ml
samples were collected and put in the sterile reagent bottles (500
ml capacity). The samples were subjected to immediate preliminary
analysis. This sample served as the source for the isolation of
micro-organism.
Preliminary analysis of effluent
Absorbance, pH, COD and BOD value of the effluent was
measured.
Isolation and characterization of the organism
The organisms were isolated from the effluent using the pour plate
and streak plate techniques on nutrient agar plates. Pure cultures of
the identified organisms were made and characterized by the
staining methods, hanging drop technique and the various
biochemical tests.
Preparation of mass cultures
To enhance the degradation of effluent, mass cultures of the
isolated organisms were prepared from the pure cultures.
Degradation of dyes
Degradation of the dyes was examined through the decolourization
assay, determination of pH, COD and BOD values.
Dye decolourization assay
To enhance the bacterial growth, the media was formulated as
follows: water- 50 ml and dye- trace amount. To this media, 5 ml of
the mass culture was added and kept in overnight incubation at
room temperature in the rotary shaker. Degree of decolourization
was quantified by measuring the change in optical density at
characteristic wavelength of each dye sample:
A initial - A final
D = x 100
A initial
Where, D is decolourisation; A initial is the initial absorbance and A
final is the final absorbance.
Design of a trickling filter
A trickling filter was designed considering the waste water
characteristics of 25 m 3 /d flow rate, BOD value of 600 mg/l. The
theoretical BOD reduction efficiency was calculated to 81%. The
height of the tank was 6 m and diameter was 2.3 m. The material
used for packing was small river rock of 2.5 to 7.5 cm. Packing
diameter was 2.3 m and the packing height was 4.5 m. Volume of
the reactor to be filled with the packing material was 18.69 m 3 and
the quantity required was 24297 kg.
Under drain characteristics
The under drain and support system for rock packing consists of
beam and column.
RESULTS
Isolation and identification of microbes from effluent
Isolated organisms were Bacillus species and the
organism which showed maximum efficiency for dye
degradation was identified as Paenibacillus azoreducens
by using biochemical and 16S rRNA gene sequencing.
This organism was observed as pale yellow colour colony
on nutrient agar plates (Figures 1 and 2).
The gram staining of isolated organism showed that the
organism is gram variant. The results of various

Figure 1. Isolated colonies on nutrient agar plates.
Figure 2. Phase contrast view of isolate.
biochemical tests are listed in the Table 1.
Degradation of dye
The colour degradation was observed overnight and the
loss of colour was monitored over the period of time
Palamthodi et al. 12659
(Figures 3 and 4). The estimated cost of the equipment
for the treatment process is given in Table 2.
DISCUSSION
The aim of this work was to biologically degrade the

12660 Afr. J. Biotechnol.
Table 1. Results of the biochemical tests.
S/N Test Result
1 Catalase test Positive
2 Starch hydrolysis Positive
3 Oxidase test Negative
4 Motility test Highly motile
5 Nitrate reduction test Positive
Figure 3. Degradation of green dye.
Figure 4. Degradation of blue dye.
dyes, that is, using bacteria that can survive in the
conditions imposed by the effluent. The bacterium that
was isolated from the effluent was identified to be P.
azoreducens. Using this bacterium, effective degradation
was obtained in 24 h. The main benefit of employing this
technique is that the culture has an optimal temperature
of 37°C and optimum pH of 7. In addition to this, the
inherent advantages of microorganism, like rapid growth,
less space requirement, etc makes this an efficient
method for treatment of textile industrial effluent. Using
trickling filter designed for the earlier mentioned process,
the BOD level could be reduced from 600 to 100 mg/l
only.
However, the value must be reduced to below 30 mg/l

Table 2. Estimated cost of equipment.
to make it commercially and environmentally attractive.
Hence, in an industrial application, it is recommended to
use two of such tricking filters in series.
Conclusion
The process of bringing down the BOD levels of waste
below 30 mg/l before discharging into surface water
sources has been studied in detail in this work. The
present invention indicates that microbial decolourisation
could be a viable means in ridding dye waste water. Dye
molecule absorption into the cell surface appears to be
quick and is often completed in some hours and there is
no specific nutrient requirement. This do not seem to be a
specific process but direct reactive dyes could all be
cleared out of solution using the same approach. It can
be conclude from this study that the blue and green
colour reactive dyes are completely degraded using the
biological treatment.
Evidence from this study suggests that biological colour
removal of textile wastewater is sufficient to meet the
requirements. Furthermore, the carbon and nitrogen
concentration within the waste water may also be
biologically treated and reduced. The findings of this
research correspond well with results of similar studies
found in the literature.
REFERENCES
Akbari A, Desclaux S, Remigy JC, Aptel P (2002). Treatment of textile
dye effluents using a new photografted nanofiltration membrane.
Desalination, 149: 101-107.
Alinsafi A, Khemis M, Pons MN, Leclerc JP, Yaacoubi A, Benhammou
A, Nejmeddine A (2005). Electro-coagulation of reactive textile dyes
and textile wastewater. Chem. Eng. Process, 44: 461-470.
Andleeb S, Atiq N, Ali MI, Hussnain RR, Shafique M, Ahmad B, Ghumro
PB, Hussain M, Hameed A, Ahmad S (2010). Biological treatment of
textile effluent in stirred tank bioreactor. Int. J. Agric. Biol. 12: 256-
260.
Ashutosh V, Raghukumar C, Verma P, Shouche YS, Naik CG (2010).
Four Marine-Derived Fungi for Bioremediation of Raw Textile Mill
Effluents. Biodegradation. 21: 217-233
. Awomeso JA, Taiwo AM, Gbadebo AM, Adenowo JA (2010). Studies
on the pollution of waterbody by textile industry effluents in Lagos,
Nigeria. J. Appl. Sci. Environ. Sanit. Sby. 5: 353-359.
Babu R, Parande AK, Raghu S, Kumar TP (2007). Cotton Textile
Processing: Waste Generation and Effluent Treatment. J. Cotton. Sci.
11: 141-153.
S/N Cost detail Cost in lakhs
1 Piping 0.125
2 Packing (river rock) 0.05
3 Compressors/blowers(150 L) 0.80
4 Concrete 0.15
5 Grating (stainless steel) 0.30
Total 1.425
Palamthodi et al. 12661
Beydilli MI, Pavlostathis SG, Tincher WC (1998). Decolorization and
toxicity screening of selected reactive azo dyes under methanogenic
conditions. Water Sci. Technol. 38: 225- 232.
Brown D, Laboureur P (1983). The Aerobic Biodegrability of Primary
Aromatic Amines. Chemosphere, 12: 405 -414.
Brown, Mark A, Stephen C (1993). Predicting Azo Dye toxicity. Environ.
Sci. Technol. 23: 249 -324.
Kim TH, Park C, Lee J, Shin EB, Kim S (2002). Pilot scale treatment of
textile wastewater by combined process (fluidized biofilm processchemical
coagulation-electrochemical oxidation). Water Res. 36:
3979-3988.
Kobya M, Can OT, Bayramoglu M (2003). Treatment of textile
wastewaters by electrocoagulation using iron and aluminum
electrodes. J. Hazard. Mater. B100: 163-178.
Koch M, Yediler A, Lienert D, Insel G, Kettrup A (2002). Ozonation of
hydrolyzed azo dye reactive yellow 84 (CI). Chemosphere, 46: 109-
113.
Lin SH, Lin CH (1993). Treatment of textile wastewater by ozonation
and chemical coagulation. Water Res. 27: 1743-1748.
Lorimer JP, Mason TJ, Plattes M, Phull SS, Walton DJ (2001).
Degradation of dye effluent. Pure Appl. Chem. 73:1957-1968.
Mathur N, Bhatnagar P, Bakre P (2005). Assessing mutagenicity of
textile dyes from Pali. Appl. Ecol. Environ. Res. 4: 111-118.
McKinney RE, Pleffer JT (1965). Effect of Biological Waste Treatment
on Water Quality. Am. J. Public Health, 55: 772-781.
McMullan G, Meehan C, Conneely A, Kirby N, Robinson T, Nigam P
(2001). Mini-review: microbial decolourisation and degradation of
textile dyes. Appl. Microbiol. Biotechnol. 56: 81-87.
Melgoza RM, Cruz A, Buitron G (2004). Anaerobic/Aerobic Treatment
of Colorants Present in Textile Effluents. Water Sci. Technol. 50: 149-
155.
Morias JL, Zamora PP (2005). Use of advanced oxidation process to
improve the biodegradability of mature landfill leachate. J. Hazard.
Mater. 123: 181-186.
Olukanni OD, Osuntoki AA, Gbenle GO (2006). Textile effluent
biodegradation potentials of textile effluent-adapted and non-adapted
bacteria. Afr. J. Biotechnol. 5: 1980-1984.
Puvaneswari N, Muthukrishnan J, Gunasekaran P (2006). Toxicity
Assessment and Microbial Degradation of Azo Dyes. Indian J. Exp.
Biol. 44: 618-626.
Sapci Z, Ustun B (2003). The Removal Of Color and Cod From Textile
Wastewater by Using Waste Pumice. EJEAFChe. 2: 286-290.
Sharifi MK, Azimi C, Khalili MB (2001). Study of the Biological
Treatment of Industrial Waste Water by the Activated Sludge Unit.
Iranian J. Publ. Health, 30: 87-90.
Tufekci N, Sivri N, Toroz I (2007). Pollutants of Textile Industry
Wastewater and Assessment of its Discharge Limits by Water Quality
Standards. Turk. J. Fish. Aquat. Sci. 7: 97-103.
Vilaseca M, Gutie MC, Grimau VL, Mesas ML, Crespi M (2010).
Biological Treatment of a Textile Effluent After Electrochemical
Oxidation of Reactive Dyes. Water Environ. Res. 82:176-181.
Yusuff RO, Sonibare JA (2004). Characterization of Textile Industries
Effluents in Kaduna, Nigeria and Pollution Implications. Global nest:
Int. J. 6: 212-221.

African Journal of Biotechnology Vol. 10(56), pp. 12662-12670, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1661
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Yield and storability of green fruits from hot pepper
cultivars (Capsicum spp.)
Awole, S., Woldetsadik, K. and Workneh, T. S.*
School of Bioresources Engineering and Environmental Hydrology, Faculty of Engineering, University of Kwa-Zulu Natal,
Private Bag X0l, Pietermaritzburg, Scottsville 3209, South Africa.
Accepted 1 April, 2011
Five hot pepper (Capsicum spp.) cultivars were grown using randomized complete block design (RCBD)
with three replications. Green peppers were stored under two storage conditions (ambient and
evaporative cooling) with three replications. The plant growth characters yield and yield related traits
were assessed. Melka Zala, PBC 600 and Mareko Fana had taller plants and had more number of
branches. Melka Zala and Melka Dima were observed to be late and early maturing cultivar,
respectively. The highest numbers of total marketable fruits were recorded in PBC 600, while the lowest
numbers were recorded in Melka Eshet and Melka Zala. The highest mean pod weight and fresh pod
yield were recorded in Melka Dima, while the lowest was recorded in PBC 600. Cultivars and storage
conditions had significant (P ≤ 0.05) effect on the shelf life of the peppers. Storage at ambient
conditions resulted in high weight loss. The lowest moisture content was recorded in PBC 600. The
evaporative cooler reduced weight loss and maintained higher marketability. The lowest weight loss
was found in Mareko Fana stored in the evaporative cooler. On day 16, all pepper fruits stored at
ambient conditions were unmarketable, while those stored in the evaporative cooler were kept up to 28
days.
Key words: Pepper, yield, cultivar, evaporative cooling, weight loss, moisture content, marketability.
INTRODUCTION
Pepper (Capsicum spp.) is grown in many countries of
the world and its production for culinary and vegetable
uses has been increased from time to time. In Ethiopia
today, it is extensively produced and used. It is actually
considered as a national spice. Even though no
documented information is available, it was introduced to
Ethiopia probably by the Portuguese in the 17 century. As
a food, pepper has low energy value (25 kcal/100 g), but
it is an excellent source of vitamins A (530 IU/100 g) and
C (128 mg/100 g) and a good source of vitamin B2 (0.05
mg/100 g), potassium (195 mg/100 g), phosphorus (22
mg/100 g) and calcium (6 mg/100 g) (Bosland, 1996).
The high nutritive and culinary value of pepper gives
them a high demand in the market year round. Capsicum
*Corresponding author. E-mail: Seyoum@ukzn.co.za. Tel:
+27(0)33-2606140. Fax: +27(0)33-2605818.
Abbreviations: RH, Relative humidity; PWL, Physiological
weight loss.
spp. is used fresh or dried, whole or ground into powder
and alone or in combination with other flavoring agents.
The climatic and soil conditions of Ethiopia allow
cultivation of a wide range of fruit and vegetable crops.
The country has a vast potential for production of fresh
fruit and vegetable varieties for domestic and export
markets, primarily for the densely populated urban areas
such as Addis Ababa and also, for the neighboring
foreign markets such as Djibouti, Somalia and the Middle
East (Lemma et al., 1994). However, growing and
marketing of fresh produce in Ethiopia is complicated by
high postharvest losses which are estimated to reach as
high as 25 to 35% of the produced volume for vegetables
(Agonafir, 1991). This huge loss is mainly attributed to
poor storage facilities, poor means of transportation and
handling (Kebede, 1991). Total postharvest losses for hot
pepper is estimated to be about 28.6 and 38.7% during
the dry and wet seasons, respectively. Bruising is
considered to be the major cause of wastage, followed by
physiological and pathological damages in the field as
well as faulty packing house and storage management

(Mohammed et al., 1992). In Ethiopia, there is lack of
proper means of postharvest handling of fruits and
vegetables and generally, very little emphasis is given to
postharvest handling of perishable produce (Tadesse,
1991). Availability of appropriate low cost storage
facilities can encourage farmers to increase fruit and
vegetable production, since it enables them to withhold
the produce without quality deterioration for days or
weeks until they could obtain a reasonable sale for their
produce. Fresh produce needs low temperature and high
relative humidity (RH) during storage and transportation.
Therefore, reducing the temperature and increasing the
RH are primary means of maintaining product quality
during storage and transportation. Reduced temperature
decreases physiological, biochemical and microbiological
activities, which are the causes of deterioration of quality
attributes such as flavour, texture, colour and nutritive
value (Thompson et al., 1998).
Amjad et al. (2010) reported result on effect of
packaging material and different storage regimes on shelf
life and biochemical composition of green hot pepper
fruits. Temperature of the surrounding air and produce
can be reduced by forced air cooling, hydro cooling,
vacuum cooling, ice cooling and adiabatic cooling
(Thompson et al., 1998). However, most of these cooling
methods are unaffordable by the small-scale peasant
farmers, retailers and wholesalers in Ethiopia, as they
require high initial cost and power sources. In spite of
that, it is essential to control storage temperature and RH
during storage, as they are the main causes of fruits and
vegetables deterioration during ripening and storage. Low
temperature and high RH can be achieved using evaporative
cooling (Workneh and Woldetsadik, 2001), which
is a very economical and relatively efficient technique to
store products than other mechanical refrigerators
(Chakraverty et al., 2003). In Ethiopia, research on
vegetables in general and chilli in particular has been
aimed primarily at identification of new varieties for high
yield and disease resistance as well as cultural practices
for increasing yield but no information is available on the
postharvest quality and shelf life of green fruits of the
released cultivars under different storage conditions. Hot
pepper varieties have been developed and released by
the Ethiopian agricultural research institute but no
information is available on the postharvest quality and
shelf life of green fruits of the released varieties under
different storage conditions. Therefore, the main objective
of this study is to look at the agronomic components,
yield and some postharvest quality of green pepper. The
specific objectives of this study are to determine the yield
and postharvest storage quality of different varieties of
hot pepper.
MATERIALS AND METHODS
Site description
The experiment was conducted at Haramaya University
Awole et al. 12663
Experimental Station, site located at Dire Dawa, during the autumn
season of 2007/2008. The area is located in the eastern part of the
country lying between 9°27 to 9°49'N latitude and 41°38' to 42°9′E
longitude. It is located 520 km east of the capital city, Addis Ababa,
along the Ethiopia - Djibouti railway. The altitude of the area is
about 1100 m.a.s.l. The mean annual rainfall is 520 mm and means
maximum and minimum temperatures range from 28 to 34.6°C and
14.5 to 21.6°C, respectively. Soil of the site is sandy loam with a pH
of 8.4 (Belay, 2002).
Plant materials
Five cultivars of hot pepper (Capsicum spp.) namely Mareko Fana,
PBC 600, Melka Zala, Melka Dima and Melka Eshet of hot pepper
were used for this study. The first two were released in 1976, while
the rest were released in 2004 by the Ethiopian institute of
agricultural research (Lemma et al., 1994). In Ethiopia, green fresh
hot peppers are consumed together with the most important
traditional food such as injera with stew. Among the other hot
pepper cultivars in the country, the mentioned five cultivars are the
most preferred ones. Hence, these five cultivars were selected for
their yield and their storability under evaporative cooling or ambient
environmental conditions.
Treatments and design of field experiment
The field experiment was executed at Dire Dawa of Haramaya
University Farm under irrigation using randomized complete block
design with three replications. Seeds of the pepper varieties were
raised on nursery bed at Haramaya University main campus and
transplanted to the field 55 days after emergence at a spacing of 60
cm between rows and 40 cm between plants. The plots comprised
ten rows. The spacing between plots in each replication was 1 m,
while the spacing between adjacent replications was 2 m. All plots
received recommended cultural practices uniformly (Lemma et al.,
1994) including the control of insects and diseases.
Sample preparation and storage experiment
For the postharvest quality and shelf life studies, fruits harvesting
was carried out at green mature stage when 50.0% of the plants
attained fruits with green maturity stage. Fruits with bruises, sign of
infection or those different from the group were discarded from the
samples. Uniform, unblemished pepper fruits having similar size
and color were then selected and hand washed with tap water to
remove soil particles and to reduce microbial population on the
surface. Then, the fruits were surface dried with soft cloth and
subdivided and stored in evaporative cooler and at room
temperature in three replications.
Evaporative cooler
A multi-layer, improved version of evaporative cooler developed by
the Food Science and Postharvest Technology, Department of
Haramaya University, (Getenit et al., 2008) was used as storage
environment in this investigation. The inner dimensions of the unit
were 2 x 2 x 1.3 m, having a capacity for about 0.5 ton fruits. The
frame was constructed from 25 mm × 25 mm × 4 mm angel iron.
The side and the top surface of the cooler are covered with sheet
metal (1 mm thickness). The cooler consist of three major units
including an air conditioning unit, a watering system and storage
chamber (Getenit et al., 2008).

12664 Afr. J. Biotechnol.
Table 1. Mean plant height, branch number and days to flower and maturity, mean fruit number, fruit weight and yield of hot pepper
cultivars.
Cultivar
treatment
PH
(cm)
BN DF DM TFN/P MFN/P UMFN/P MPW
(g)
MY
(ton/ha)
Melka Dima 53.6 b 10.3 c 66.7 e 125.0 e 23.9 b 20.4 b 3.4 a 17.0 a 20.0 a 23.9 b
Melka Eshet 42.7 c 8.9 d 87.7 b 147.7 b 16.2 c 14.7 c 1.2 c 12.4 b 11.3 b 16.2 c
Melka Zala 59.6 a 14.1 a 90.0 a 150.0 a 16.9 c 14.8 c 2.4 b 11.3 b 9.4 bc 16.9 c
Mareko Fana 58.1 a 13.3 ab 82.0 d 142.3 d 24.3 ab 21.6 b 2.5 b 7.4 c 6.0 c 24.3 ab
PBC 600 59.2 a 12.7 b 85.0 c 145.0 c 27.5 a 25.4 a 3.8 a 6.6 c 4.7 c 27.5 a
Significance *** *** *** *** ** ** *** *** ** **
SE ± 0.9 0.4 0.6 0.5 1.1 1.0 0.1 0.7 14.4 1.1
LSD (0.05) 2.9 1.3 1.8 1.6 3.4 3.1 0.4 2.3 4.7 3.4
CV (%) 2.9 5.6 1.2 0.6 8.3 8.4 11.2 7.3 24.0 8.3
TFN/P
Means within a column followed by the same letter (s) are not significantly different according to least significant difference test (probability
P ≤ 0.05), where ** and *** indicate significant difference at P ≤ 0.01 or 0.001, respectively. PH, Plant height (cm); BN, branch number; DF,
days to flowering; DM, days to maturity; TFN/P, total fruit number per plant; MFN/P, marketable fruit number per plant; UMFN/p,
unmarketable fruit number per plant; MPW, mean pod weight; MY, marketable yield.
Measurements
Agronomic characteristics, yield and yield components
The heights (cm) of 15 randomly taken sample plants were
measured from the ground level to the highest point at blooming
stage: The number of primary and secondary branches of 15
randomly taken sample plants of at blooming stage was recorded.
Days to 50.0% flowering was recorded when approximately 50.0%
of the plants in a plot formed some flowers that were in bloom. Days
to fruit maturity was recorded when approximately 70% of the plants
in a plot had fruits that attained physiological maturity. The total
numbers of physiologically mature fruits per plant were counted
over the harvest period on 15 randomly selected plant samples per
plot. Using 15 sample plants per plot at each harvest, fruits were
categorized as marketable and unmarketable. Fruits which were
cracked, damaged by insect, diseases, birds and sunburn, etc.
were considered as unmarketable, while fruits which were free of
damage were considered as marketable. Mean number and weight
of marketable and unmarketable fruits were then calculated to
record numbers and weight per plot. Mean pod weight was
calculated from fruits of successive harvests from 15 random
sample plants, that is, total marketable pod weight of sample plants
divided by the total number of marketable fruits harvested. Finally,
total weight of fruits free from crack, damage by insect and
diseases, etc. from the central three rows over the harvest period
was recorded to estimate marketable yield per hectare.
Moisture content
This parameter was determined using 10 g sample from each
treatment that was cut into pieces, dried in a forced air circulation
oven at 70.0°C to a constant weight as described by Antoniali et al.
(2007) and results expressed in percentage.
Physiological weight loss
Physiological weight loss (PWL) was determined following the
method described by Waskar et al. (1999). Stored fruits from each
treatment were weighed at the start of the experiment and at four
days interval for four weeks. The differential weight loss was
calculated for each interval and converted into percentage by
dividing the change with the initial weight recorded on each
sampling interval.
Percentage marketable fruits
The marketable quality of the fruits was subjectively assessed
according to Mohammed et al. (1999). On each sampling time,
marketability of the fruits was judged using a 1 to 9 rating with 1 =
unusable, 3 = unsalable (poor), 5 = fair, 7 = good, 9= excellent to
evaluate the fruit quality. The size, color, firmness surface defects,
sign of mould growth and shrinkage were used, as visual
parameters for the rating. Fruits that received a rating of five and
above were considered marketable, while those rated less than five
were considered unmarketable.
Statistical procedures
The data were subjected to the analysis of variance for randomized
complete block design following the procedure by Gomez and
Gomez (1988) using the Statistical Analysis System (SAS) 6.12
version software (SAS Institute Inc., Cary, NC). Least significant
difference (LSD) test was used to separate the means at 5, 1 and
0.1% probability levels.
RESULTS AND DISCUSSION
Agronomic characteristics
Significant differences (P ≤ 0.05) were observed in plant
height and number of branches among the hot pepper
varieties studied (Table 1). The plant height ranged from
42.7 cm in Melka Eshet to 59.6 cm in Melka Zala. Melka
Zala, PBC 600 and Mareko Fana had the tallest plants
with no significant difference among them. Melka Dima
had plants with intermediate height (53.6 cm), while the
shortest plants were observed in Melka Eshet. This result
is in agreement with that of Engles (1984) who reported

that, Ethiopian pepper cultivars have plant height ranges
between 18.0 and 77.0 cm and also, with the range of
58.0 to 85.0 cm reported by EARO (2005). Ado (1987)
and Gomez et al. (1988) also reported plant height in the
range of 47 to 69 cm for different varieties of Capsicum
spp.
The number of branches in Melka Dima and Melka
Eshet were significantly (P ≤ 0.05) lower than the other
varieties (Table 1). Melka Zala followed by Mareko Fana,
but with no significant difference among them, had the
highest number of branches per plant. Melka Eshet had
the least number of branches. In general, the tallest
plants tended to have more number of branches per plant
which was partly due to the increased growing points
(nodes) in taller varieties.
Significant (P ≤ 0.05) variations were observed among
the hot pepper varieties in the number of days plants
attain 50% flowering and 70% physiological maturity.
Melka Zala required the longest time (90 days) until 50%
of the plants to flower and 150 days until they mature.
Melka Dima required the shortest time (67 days) to flower
and 125 days to mature. The remaining three varieties
were also found to be late relatively with a maturity date
ranging from 142.0 to 147.7 days, which were
significantly (P ≤ 0.05) different among each other. Ado et
al. (1987) reported 127 to 140 days for maturity of
different Capsicum species. Lemma et al. (1994) also
indicated a range of 96 to 99 and 100 to 126 days to
flowering and maturity, respectively, for different
Capsicum genotypes including varieties in the present
study. In another study, Geleta (1998) reported 74 to 97
days and 114 to 158 days for flowering and maturity,
respectively, of 18 Capsicum genotypes grown at
Melkassa Research Center. The results indicate that, the
traits are affected by both genotype and environment.
Yield and yield components
Both total and marketable fruit number per plant showed
significant difference (P ≤ 0.05) among the pepper
varieties (Table 1). The highest total and marketable
fruits per plant were recorded in PBC 600 followed by
Mareko Fana and Melka Dima with no significant
difference between the later varieties. Melka Eshet and
Melka Zala had the lowest fruit number per plant. The
fruit number per plant in this study is in accordance with
previous reports by Ado et al. (1987) who observed fruits
number per plant ranging from 8 to 70 in 16 Capsicum
accessions. It is clear that, environmental and genetic
factors regulate the number of fruits. Bakker and Uffellen
(1988) indicated that the total number of fruits per plant
depends on the mean daily temperature. They reported
that, as the mean daily temperature increase the number
of fruits per plant also increased. Erickson and Markhart
(1997) noted that, temperature is the primarily factor in
the decrease of fruit production as reduced fruit set was
due to flower abortion and not due to decreased flower
Awole et al. 12665
initiation or plant growth. Cocharn (1964) showed that,
the poor fruit set at high temperature to be due to
excessive transpiration by the plant which could partly be
the cause for the differences observed in this study.
In the present study, unmarketable fruit number per
plant were observed to be relatively low, ranging from
7.7% in PBC 600 to 14.4% in Melka Dima (Table 1). Most
of the unmarketable fruits were small sized and
deformed. Godfrey and Yosef (1992) reported that, from
15.0 to 44.0% fruits of pepper can be unmarketable.
However, in the present study percentage of unmarketable
fruit was found to be lower.
Mean pod weight of the varieties ranged from 6.6 in
PBC to 17.0 g in Melka Dima and was found to be
significantly (P ≤ 0.05) different among varieties (Table
1). Ado et al. (1987) reported mean pod weight of 16
pepper varieties to be in the range of 3.3 to 28.6 g, which
is in agreement with the present finding. The highest pod
weight was recorded in Melka Dima, followed by Melka
Eshet and Melka Zala. Mareko Fana and PBC 600, which
had the highest number of fruit per plant, recorded the
least mean fruit weight (56.0 and 61.0% less than Melka
Dima, respectively). In general, as the number of fruits
per plant increases, the size of individual fruits tends to
be smaller. This could be due to competition among fruits
for carbohydrate or due to genetic factors. Restricting fruit
set allows the plant to develop and retain large sized
fruits (Rylski and Spigelman, 1986). However, Melka
Dima was found to have the heaviest fruits though the
number of fruits per plant was also relatively high which
show better adaptability of the cultivar to the climate of
the study area.
There was significant (P ≤ 0.05) difference in the
marketable yield of fresh pepper fruits among the
varieties which were harvested four times over two
months period (Table 1). The highest marketable yield
was recorded in Melka Dima (20 ton/ha) which was about
1.8 times more than the yield of the second ranking
cultivar, Melka Eshet and 3.3 times more than Mareko
Fana. The highest yield of Melka Dima could be mainly
due to higher mean pod weight and relatively larger
number of marketable fruits obtained. Legesse et al.
(1990) also reported positive correlation between mean
pod weight and yield of hot pepper genotypes. There was
no significant (P > 0.05) difference in the marketable yield
per ha of PBC 600, Mareko Fana and Melka Zala, though
the later cultivar had nearly two fold fresh pod yield over
the other two varieties. The yield recorded in this study
was by far better than the one reported by EARO (2005)
for 8 lines that yielded 0.8 to 3.7 ton/ha at Melkassa
research center which could be due to intensive
management practice in this study as well as very low
incidence of diseases and insect damage.
Physiological weight loss
The interaction effects of varieties and storage

12666 Afr. J. Biotechnol.
Table 2. The interaction effect of storage environment and varieties on the physiological weight loss (%) of pepper fruit during
storage period of 28 days at Dire Dawa.
Storage environment/
cultivar treatment
Storage period (days)
4 8 12 16 20 24 28
Evaporative cooling
Melka Dima 2.73 e 9.58 d 13.34 c 17.22 e 27.87 a 29.77 a 35.47 b
Melka Eshet 2.80 e 8.08 f 13.35 c 17.52 e 18.85 b 20.28 b 29.07 c
Melka Zala 2.49 f 8.73 e 9.90 d 11.40 g 14.37 d 16.93 d 38.94 a
Mareko Fana 1.73 g 8.59 e 10.24 d 11.66 g 11.76 e 15.78 e 18.28 e
PBC 600 2.81 e 7.28 g 7.65 e 15.56 f 16.48 c 17.60 c 22.70 d
Ambient storage
Melka Dima 7.39 c 18.73 a 22.50 a 30.42 a - - -
Melka Eshet 6.17 d 14.14 b 22.48 a
26.17 c - - -
Melka Zala 7.51 c 13.95 b 22.36 a 26.19 c - - -
Mareko Fana 8.45 b 11.55 c 19.60 b
27.65 b - - -
PBC 600 9.21 a 13.83 b 20.22 b 21.24 d - - -
Significance *** *** *** *** *** *** ***
SE ± 0.12 0.19 0.22 0.32 0.22 0.27 0.21
LSD (0.05) 0.24 0.40 1.30 0.66 0.72 0.89 0.69
CV (%) 3.88 2.88 2.42 2.67 2.13 2.36 1.26
Means within a column followed by the same letter (s) are not significantly different at P ≤ 0.05; where *** indicate significant difference at
P ≤ 0.001.
environment resulted in a significant (P ≤ 0.05) variation
in the percent weight loss of the pepper varieties (Table
2). During the initial storage period (day 4), PBC 600 and
Mareko Fana stored at ambient condition were found to
have the highest percentage of weight loss of 9.2 and
8.5%, respectively. However, Mareko Fana stored in the
evaporative cooler showed the lowest percentage weight
loss (1.7%) on the same date. On day 8, mean percent
weight loss of fruits stored at ambient condition had
70.0% weight loss, than the fruits stored in the
evaporative cooler. In the later stage, however, the
difference in the weight loss of fruits under the two
storage environments tended to narrow down. After day
16, nearly all pepper fruits stored at ambient condition
were unmarketable, while those stored in the evaporatively
cooled chamber remained marketable up to 28
days. After 28 days of storage in evaporatively cooled
chamber, the maximum weight loss was recorded in
Melka Zala (38.9%) and minimum loss in Mareko Fana
(18.3%).
The higher percentage weight loss in pepper stored at
ambient conditions compared with those stored in the
evaporative cooler appeared to relate to the RH and
temperature surrounding the produce. The evaporative
cooler had 28.5 to 40.0% more air humidity as well as 6.0
to 14.0°C less cool than the ambient storage conditions,
thereby being capable of reducing excessive moisture
loss from the produce. The types of surfaces and
underlying tissues of fruit may also have a marked effect
on the rate of water loss (Wills et al., 1998) which could
be seen as reasons for the differences observed among
the varieties.
Quality of most fruits and vegetables is affected by
water loss during storage, which depends on the
temperature and RH of the storage conditions (Pentzer,
1982). Hardenburg et al. (1986) mentioned that, storage
under low temperature is the most efficient method to
maintain quality of fruits and vegetables due to its effects
on reducing respiration rate, ethylene production,
ripening, senescence and rot development. High temperature
increases the vapour pressure difference between
the fruit and the surrounding, which is the driving
potential for faster moisture transfer from the fruit to the
surrounding air (Ryall and Pentzer, 1982; Hardenburg et
al., 1986; Salunkhe et al., 1991). In the present study, the
lower temperature and higher relative humidity maintained
by the evaporatively cooled chamber when
compared with the ambient condition could be the reason
for the low percentage of weight loss possibly through
reducing respiration and transpiration rate. Accordingly,
the higher physiological weight loss shown at ambient
condition can be associated with increased cell wall
degradation leading to exposure of cell water for easy
evaporation combined with higher membrane, perme-

Awole et al. 12667
Table 3. The interaction effect of storage environment and varieties on the moisture content (%) of pepper fruits during 28 days of storage.
Storage environment/
cultivar treatment
Storage period (days)
0 4 8 12 16 20 24 28
Evaporative cooling
Melka Dima 91.74 a 91.41 ab 91.13 a 90.35 a 89.84 a 88.97 a 88.67 a 86.40
Melka Eshet 92.53 a 92.35 a 91.10 a 89.68 a 89.36 a 87.98 a 87.65 ab 83.99
Melka Zala 91.11 abc 89.94 abc 90.40 ab 85.61 bc 87.74 ab 88.60 a 88.02 ab 86.56
Mareko Fana 89.76 bc 88.94 cde 88.73 bc 87.25 bc 86.71 abc 85.37 b 84.80 bc 83.43
PBC 600 89.40 c 88.09 de 87.35 cd 86.94 bc 86.62 abc 85.22 b 83.72 c 82.83
Ambient storage
Melka Dima 91.74 a 88.20 cd 86.11 d 86.76 bc 85.12 abc - - -
Melka Eshet 92.53 a 89.53 bc 89.34 ab 86.72 ab 83.84 bc - - -
Melka Zala 91.11 abc 85.49 def 86.64 cd 85.64 c 84.13 c - - -
Mareko Fana 89.76 bc 86.67 def 84.70 de 83.21 d 78.85 d - - -
PBC 600 89.40 c 84.50 f 83.64 e 84.42 d 75.01 d - - -
Significance * ** ** ** *** ** ** ns
SE ± 0.53 0.30 0.25 0.47 0.52 0.48 1.05 1.06
LSD (0.05) 1.72 1.62 1.74 1.74 2.84 1.55 3.41 3.74
CV (%) 0.53 0.59 0.49 0.93 1.06 0.94 2.09 2.18
Means within a column followed by the same letter (s) are not significantly different at P ≤ 0.05; ns *, **, *** indicate non significant, significant
difference at P ≤ 0.05, 0.01 or 0.001, respectively. The data from day 16 onwards is meant for the evaporatively cooled storage only.
ability due to faster metabolism and ripening rate at high
temperature storage (Dumville and Fry, 2000).
Moisture content
Moisture content of fruits of five hot pepper varieties
stored under two storage conditions showed significant
variation (P ≤ 0.05) during the storage periods studied at
Dire Dawa (Table 3). At harvest, Melka Eshte and Melka
Dima had significantly more moisture content than
Mareko Fana and PBC 600, while Melka Zala did not
show difference in moisture content from all cultivars.
During the storage period of 4 to 12 days, Melka Eshte
and Melka Dima stored in the evaporatively cooled
chamber retained more moisture compared with majority
of the treatments. At ambient conditions, Melka Eshte
fruits had relatively more moisture content compared with
the other varieties, under the same storage condition,
except on day 16. Significant differences among the
cultivars were observed through out the storage period
except on the last day of storage. This could be due to
differences in fruit tissues of the skin wax contents of
cultivars. Maalekuu et al. (2006) noted that, the difference
in water loss rate among different genotypes could be
attributed to factors such as their cuticlular wax content,
difference in cell membrane degradative enzymes and
their effects on membrane integrity and membrane lipid
composition.
There was a general decreasing trend in the moisture
content of the varieties with storage time under both
storage conditions. However, the percentage decrease in
moisture content was pronounced in fruits stored at
ambient condition. This may be due to the ripening
process undergo throughout the storage period as
ripening of pepper fruit causes changes in the permeability
of cell membranes, making them more sensitive to
loss of water (Goodwin and Mercer, 1972; Suslow, 2000;
Antoniali et al., 2007).
The difference in moisture contents of fruits under the
two storage conditions could be attributed to the lower
temperature and higher relative humidity in the
evaporative cooler than in ambient conditions (Figure 1),
which could have reduced the amount and rate of moisture
loss. Moreover, the lower temperature in the
evaporative cooler could have reduced respiration rate
and thus, delayed fruit ripening and subsequently, lowered
permeability to moisture loss (Atta-Aly and Brecht,
1995).
Marketability
The interaction effect among cultivars and storage conditions
significantly (P ≤ 0.05) affected percentage of
marketable pepper during the storage period (Table 4).
On day 4, all pepper stored in the evaporative cooler
were marketable, while under the ambient storage there
were 1.3 to 5.2% unmarketable fruits in the different
cultivars.

12668 Afr. J. Biotechnol.
Temperature (°C)
Relative humidity (%)
35
30
25
20
15
10
5
0
120
100
80
60
40
20
0
EC Am
6:00 8:00 10:00 12:00 14:00 16:00 18:00
6:00 8:00 10:00 12:00 14:00 16:00 18:00
Hour (day time)
Figure 1. Day time dry-bulb average ambient conditions (Am) and evaporative cooler (EC) temperature and RH during
storage of pepper fruit for a period of 28 days.
Marketability of pepper stored at ambient environment
was about 98.7% in Mareko Fana that the highest percentage,
while Melka Eshet had the lowest percentage
(94.8%) of marketable fruits. On day 8, marketability of
fruits under the cooler was greater than 96.0%, whereas
under ambient condition it dropped below 61.0% in Melka
Eshet and 70.0% in Mareko Fana. On day 16, the
percentage of marketability of the other pepper in the
cooler remained more than 80.0% except in Melka Eshet,
while at ambient storage condition, the percentage of
marketable pepper fruits in all of the varieties were less
than 25.0%.
The extended storage life of pepper fruits stored in the
evaporative cooler could be attributed from the increased
RH and reduced temperature. From the stated results, it
appears that reduced storage temperature as a result of
adiabatic cooling of the incoming air has advantageously
decreased the rate of pepper fruits deterioration. Storage
temperatures have strong positive correlation with the
rate at which physiological, biochemical and microbiological
changes occur during storage (Ryall and
Lipton, 1979; Hardenburg et al., 1986). Thus, the lower
the storage temperature the lower would be the rate of
deterioration of the stored produce.
In the evaporative cooler, about 82.0% of Mareko Fana
fruit remained marketable until three weeks. While in the
other varieties percentage of marketability dropped to a
level of 62% in Melka Eshte and 77.3% in Melka Zala.

Awole et al. 12669
Table 4. The interaction effect of storage environments and varieties on the marketability (%) of pepper fruit during 28 days of
storage.
Storage environment/
cultivar treatment
Storage period (days)
4 8 12 16 20 24 28
Evaporative cooling
Melka Dima 100 a 97.9 c 87.1 c 80.2 c 70.0 d 46.0 d 19.3 d
Melka Eshet 100 a 96.6 d 83.8 d 75.2 d 62.0 e 34.0 e 9.3 e
Melka Zala 100 a 98.4 b 89.1 b 82.7 b 77.3 b 56.0 b 30.7 b
Mareko Fana 100 a 98.9 a 91.8 a 87.3 a 82.2 a 59.8 a 37.6 a
PBC 600 100 a 96.3 d 87.8 c 80.7 c 74.0 c 51.6 c 23.3 c
Ambient storage
Melka Dima 95.6 e 65.3 h 29.3 h 16.0 h - - -
Melka Eshet 94.8 f 60.7 i 20.0 i 12.7 i - - -
Melka Zala 96.9 c 67.1 f 33.3 f 19.8 f - - -
Mareko Fana 98.7 b 69.6 e 39.3 e 24.0 e - - -
PBC 600 96.5 d 65.9 g 31.3 g 18.0 g - - -
Significance *** *** *** *** *** *** ***
SE ± 0.08 0.19 0.61 0.38 0.38 0.26 0.55
LSD (0.05) 0.18 0.40 1.27 0.80 1.23 0.86 1.80
CV (%) 0.15 0.41 1.77 1.33 0.90 0.92 3.99
Means within a column followed by the same letter (s) are not significantly different at P ≤ 0.05, *** indicate significant difference at P ≤
0.001. The data from day 16 onwards is meant for the evaporatively cooled storage.
Overall, Mareko Fana fruits stored in the evaporative
cooler performed better than the other varieties and most
of them stayed marketable, while Melka Eshte was the
least. The result showed that, maintaining lower temperature
and higher RH in the storage combined with
selecting cultivars having long shelf life could improve
marketability of pepper for a relatively longer period.
A comparison based on the overall mean marketable
pepper fruits after two weeks (day 16) clearly show that,
pepper fruit marketability could be increased nearly fourfold
using the evaporative cooler storage system,
compared with the ambient condition. This could be
mainly due to the fact that, low storage temperature
reduces the rate of respiration and physiological activity
leading to retarded senescence of fruit in storage (Pinto
et al., 2004). Moreover, the increased RH in the cooler
reduces shrinkage of fruits through moisture loss.
Hardinsburg et al. (1986) reported that the effective
method of maintaining quality and controlling decay of
peppers is by a rapid cooling after harvest followed by
storage at low temperature with a high RH.
The visual appearance and marketability of pepper fruit
stored in the evaporative cooler remained fresh and shiny
with good pod color for a reasonable period of storage
time. Shriveling and discoloration at ambient temperature
and rotting in pepper fruits stored in the evaporative
cooler storage were major causes for a decline in
percentage of marketability, with time. This result agrees
with previous reports that showed significant improve-
ment in the shelf life of fruits and vegetables stored in
evaporative cooler, in which losses associated with decay
were also observed (Workneh and Woldetsadik, 2001).
Although, storing pepper varieties in the evaporative
cooler extend their shelf life, it was hardly possible to
control loss due to fruits decay. This is due to the fact that
evaporative cooler, although reduced the storage
temperature, was not able to maintain the temperature to
optimum level for storing pepper fruits for an extended
period. Therefore, it appears that a combination of
disinfection, modified atmosphere packaging and storage
in evaporative cooler might improve the storage life of
green pepper and other perishable produce.
Conclusions
Melka Zala, PBC 600 and Mareko Fana pepper varieties
grown at Dire Dawa produced 58.1 to 59.6 cm tall plants
with no significant difference among them, while the
cultivar Melka Eshet (42.7 cm) had the shortest plants.
The tall varieties also tended to have more number of
branches. Melka Zala required about 150 days reaching
the first harvest, while Melka Dima was found to be the
earliest cultivar, with a maturity date difference of 25 days
with the late cultivar. The remaining three varieties had
maturity date in the range of 142.3 to 147.7 days. The
highest numbers of total and marketable fruits were
recorded in PBC 600 and Mareko Fana, respectively,

12670 Afr. J. Biotechnol.
with a significant difference in marketable fruit number
among them. The lowest total and marketable fruit
numbers were recorded in Melka Eshet. Numbers of
marketable fruits ranged from 14.7 in Melka Eshet to 25
in PBC 600. The lowest mean pod weight was recorded
in PBC 600 which was about 61.0% less than in Melka
Dima that produced fruits of the bigger size. Melka Dima
also produced the highest marketable yield which was
77.0 and 114.0% over the second and third ranking
Melka Eshet and Melka Zala varieties, respectively and
323.0% more than the lowest yielder PBC 600 cultivar
that gave 4.7 ton/ha marketable yield. The highest weight
loss was recorded in Melka Dima stored at ambient
condition, while lowest weight loss was observed in
Mareko Fana stored in the evaporative cooler. The
highest and lowest fruit moisture contents were recorded
in Melka Eshet and PBC 600, respectively, throughout
the storage period. After 12 days of storage in the
evaporative cooler, Mareko Fana had more than 90.0%
of the fruits in a marketable condition, while in the
remaining varieties marketability dropped to 84.0 and
88.0%. After 16 days of storage, nearly all pepper fruits
stored at ambient condition were found to be
unmarketable, while those stored in the evaporative
cooler chamber were kept up to 28 days.
REFERENCES
Acedo AL (1997). Ripening and disease control during evaporative
cooling storage of tomatoes. J. Trop. Sci. 37: 209-213.
Ado SG, Samarawira I, Olarewaju JD (1987). Evaluation of local
accession of pepper (Capsicum annum) at Samaru, Nigeria.
Capsicum Newslett. 17-18.
Agonafir Y (1991). Economics of horticultural production in Ethiopia.
Acta Hortic. 270: 15-19.
Amjad M, Iqbal J, Iqbal Q, Nawaz A, Ahmad T, Rees D (2010). Effect of
packaging material and different storage regimes on shelf life and
biochemical composition of green hot pepper fruits. Acta Hortic. 876:
227-234.
Antoniali S, Leal PAM, de Magalhães AM, Fuziki RT, Sanches J (2007).
Physico-chemical characterization of ‘Zarco HS’ yellow bell pepper
for different ripeness stages. Sci. Agric. 64:19-22.
Atta-Aly MA, Brecht JK (1995). Effect of postharvest high temperature
on tomato fruit ripening and quality. Proceedings of the International
Symposium "Postharvest Physiology, Pathology and Technologies
for Horticultural Commodities: Recent Advances" A. pp. 250-256.
Bakker JC, Van Uffelen JAM (1988). The effect of diurnal temperature
regimes on growth and yield of glasshouse sweet pepper. Nether. J.
Agric. Sci. 36: 201–208.
Belay A (2002). Factors influencing loan repayment performance of
rural women in eastern Ethiopia: The case of Dire Dawa area. An
M.Sc. Thesis presented to the School of Graduate Studies of
Alemaya University. pp 1-102.
Bosland PW (1996). Capsicum: Innovative uses of an ancient crop. In:
Janic J (ed.), progress in new crops. ASHS, press, Arligton, VA. pp
479- 487
Chakraverty A, Mujumdar SA, Raghavan SG, Ramaswamy SH (2003).
Handbook of Postharvest Technology. Cereals, fruits, Vegetables
Tea and Spices. Marcel. Deker, Inc., New York. Basel. p. 521.
Cochran HL (1964). Changes in pH of the pimiento during maturation.
Proc Am. Soc. Hort. Sci. 84: 409-411.
Dumville JC, Fry SC (2000). Uronic acid-containing
oligosaccharins: Their biosynthesis, degradation and signaling roles
in non-diseased plant tissues. Plant Physiol. Biochem. 38: 125-140.
EARO (2004). Ethiopian Agricultural Research Organization 2002/03
Annual report, EARO. Addis Ababa.
Engles JMM (1984). Capsicum, an Improtant Spice in Ethiopia.
Capsicum Newslett. 3: 19-25.
Erickson AN, Markhart AH (1997). Development and abortion of flowers
in capsicum annum exposed to high temperature. Hort. Technol. 7: p.
8.
Rylski I, Spigelman M (1986). Fruits and tree nuts, 2nd edition, AVI,
Westport CT. Effects of shading on plant development, yield and fruit
quality of sweet pepper grown under conditions of high temperature
and radiation. Sci. Hortic. 29: 31-35.
Geleta L (1998). Genetic Variability and association for yield, quality
and other traits of hot pepper (Capsicum spp.). An M.Sc Thesis
presented to the School of Graduate Studies of Alemaya University.
Getenit H, Workneh TS, Woldetsdik K (2008). The effect of cultivar,
maturity stage and storage environment on quality of tomatoes. J.
Food Eng 87: 467-498.
Godfrey SA, Turuwork WA, Tadelle A (1985). Review of Tomato
Research in Ethiopia and Proposal for future Research and
Development direction. In: Godfrey-Sam-Aggrey and Bereke Tsehi
(eds.). Proceedings of the First Ethiopian Horticultural Workshop. pp.
236-249.
Gomez KA, Gomez AA (1988). Statistical Procedures for Agricultural
Research. John Willey and Sons, New York. p. 390
Goodwin TW, Mercer EI (1972). Introduction to Plant Biochemistry.
Pergamon Press, Oxford. p. 359.
Hardenburg RE, Watada AE, Wang CY (1986). The commercial storage
of fruits, vegetables, florist, and nursery stocks. Agriculture
Handbook, Washington. 66: 1-130.
Kebede E (1991). Processing of horticultural produce in Ethiopia. Acta
Hortic. 270: 301-311.
Legesse G, Zelleke A, Bejiga G (1999). Character association and path
analysis of yield and its components in hot pepper (Capsicum
annuum L.). Acta Agronomica Hungarica, 47: 391-396.
Lemma D, Edward H, Terefe B, Berga L, Seifu G (1994). Horticultural
research: past present and future trends. Procceedings of the second
national horticultural workshop of Ethiopia. IAR/FAO, Addis Ababa.
Maalekuu K, Elkind Y, Frenkel AL, Lurie S, Fallik E (2006). The
relationship between water loss, lipid content, membrane integrity
and LOX activity in ripe pepper fruit after storage. Postharvest Biol.
Technol. 42: 248- 255.
Mohammed M, Wilson LA, Pi LA, Gomes P (1992). Postharvest losses
and quality changes in hot peppers (Capsicum frutescens L.) in the
roadside marketing system in Trinidad. Trop. Agric. 69: 333-340.
Mohammed M, Wilson LA, Gomes PL (1999). Postharvest sensory and
physiochemical attributes of processing and non-processing tomato
cultivar. J. Food Qual. 22: 167-182.
Pinto AC, Alues RE, Pereira EC (2004). Efficiency of different heat
treatment procedures in controlling disease of mango fruits.
Proceedings of the seventh international mango symposium. Acta
Hortic. 645: 551-553.
Ryall AL, Lipton WJ (1979). Vegetables as living products. Respiration
and heat production . Handling , transportation and storage of fruits,
2 nd ed., The AVI Publishing Company, Westport. Vol. 1. p. 421.
Ryall AL, Pentzer WT (1982). Handling, transportation and storage of
fruits and vegetables. Vol. 2.
Salunkhe DK, Bolin HR, Reddy NR (1991). Storage, Processing, and
Nutritional Quality of Fruits and Vegetables. 2 nd ed. Fresh Fruits and
Vegetables. Vol. I p. 365.
Suslow T (2000). Bell peppers hit with late season losses to decay.
Perishable Handling Quart. Issu. 101: p. 1.
Tadesse F (1991). Postharvest losses of fruit and vegetable in
horticultural state farms, Ethiopia. Acta Hortic. 270: 261-270.
Thompson JF, Mitchell FG, Runsey TR, Kasmire RF, Crisosto CH
(1998). Commercial cooling of fruits, vegetables and flowers, UC
Davis, USA, DANR publication, No 21567: 61-68.
Wills R, Glasson EM, Graham D, Joyce D (1998). Postharvest. An
introduction to the physiology and handling of fruit, vegetables and
ornamentals. 4 th ed. UNSW Press. p. 21
Workneh TS, Woldetsadik K (2001). Natural ventilation evaporative
cooling of Mango. J. Agri. Biotech. Environ. 2: 1-2

African Journal of Biotechnology Vol. 10(59), pp. 12671-12675, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.598
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effects of different cooking methods on the consumer
acceptability of chevon
Nomasonto M. Xazela, Voster Muchenje* and Upenyu Marume
Department of Livestock and Pasture Science, University of Fort Hare, P. Bag X1314, Alice 5700, Republic of South
Africa.
Accepted 8 August, 2011
Consumers expect the meat products on the market to have the required nutritional value, be
wholesome, fresh and lean and have adequate juiciness, flavour and tenderness. A study was
conducted to establish consumer acceptability of chevon prepared using different traditional cooking
methods in terms of acceptance of flavour, tenderness, off-flavour, aroma intensity and juiciness
through sensory evaluation. A panel of 48 participants drawn from the University of Fort Hare student
body of different tribes was used. There was a significant association (P < 0.05) between aroma
intensity scores and the different tribes. Majority of the Xhosa, Shona and Zulu panelists had higher
aroma intensity scores whereas the Ndebele panelist gave low aroma intensity scores. Cooking
methods significantly (P < 0.05) affected all the sensory attributes under consideration. Goat meat
mixed with vegetables and the intestines had the highest mean sensory scores all round. The high
connective tissue in the meat did not significantly (P < 0.05) affect the panelist scores for tenderness. In
conclusion, cooking methods was observed to have a bearing on the acceptability of chevon by
consumers and should be taken into consideration when preparing chevon for home consumption and
for promotion.
Key words: Aroma, boiling, consumer background, flavour, gender, indigenous goat, roasting, tenderness.
INTRODUCTION
Chevon is red meat that is often viewed as potential
competitor to beef and sheep meat (Simela and Merkel,
2008). Chevon is almost universally acceptable but with
cultural traditions and social and economic conditions
influencing consumer preference (Webb et al., 2005;
Xazela et al., 2011). Chevon also offers a reasonable
economic option for agriculture and diversification under
conditions suitable for ruminants (Webb et al., 2005). A
cross culture-education-ethnic study in multicultural
South Africa revealed that the use of goat meat is linked
to (African) cultural activities (Mahanjana and Cronje,
2000). According to Simela et al. (2008), most sensory
evaluations of chevon that employed trained taste panels
generally showed that chevon and chevon products are
of high quality. Chevon has also been reported to contain
higher collagen and has lower solubility than sheep meat
*Corresponding author. E-mail: vmuchenje@ufh.ac.za.
Tel: +27 40 602 2059. Fax: +27 86 628 2967.
and its intramuscular connective remains unchanged
during postmortem aging (Kannan et al., 2005).
An increase in consumer demand for high quality
products has led to a growth in the use of new cooking
methods and technologies that satisfy the consumer
needs (Garcıa-Segovia et al., 2007). Generally, meat is
usually cooked before it is eaten, which result to
important physical changes in the meat texture that may
affect consumer perception of the meat. Although, factors
such as health concerns, changes in demographic
characteristics, the need for convenience, changes in
distribution systems, price and cultural values can affect
consumer acceptability of goat meat, cooking methods
could also have a significant impact on eating quality and
general acceptability of goat meat (Resurreccion, 2003).
Above this, cooking method could change the nutritional
value, freshness, juiciness, flavour and tenderness of
meat resulting in varied perceptions of goat meat by
different sections of the society (Hoffman and Wiklund,
2006).
In general, very little goat meat is consumed in South

12672 Afr. J. Biotechnol.
Table 1. Mean scores for aroma intensity, initial impression of juiciness, first bite and sustained impression of
juiciness of goat meat cooked in four different ways.
Sensory attribute Plain Mixed with vegetable Roasted Intestine
Aroma intensity 5.12 ± 0.22 b 5.22 ± 0.22 b 5.71± 0.22 a 6.35 ± 0.22 a
Initial juiciness 4.62 ± 0.19 b 6.10 ± 0.19 a 4.25 ± 0.19 b 6.25 ± 0.19 a
Sustained juiciness 5.21 ± 0.19 bc 5.75 ± 0.19 ab 4.6 ± 0.19 c 6.4 ± 0.19 a
First bite 5.45 ± 0.21 b 6.29 ± 0.2 a 5.16 ± 0.2 b 6.52 ± 0.2 a
Tenderness 5.33 ± 0.18 b 5.77 ± 0.18 a 5.19± 0.18 b 6.41 ± 0.18 a
Amount
tissue
of connective 4.38 ± 0.22 bc 5.19 ± 0.22 ab 4.25 ± 0.22 b 5.42 ± 0.22 a
Overall flavour intensity 5.29 ± 0.21 b 5.42 ± 0.21 a 5.33 ± 0.21 a 6.08 ± 0.21 a
Off-flavour intensity 3.19 ± 0.21 a 2.17 ± 0.21 b 3.27 ± 0.21 a 3.92 ± 0.21 a
Means within a row having different superscripts are significantly different (P < 0.05).
Africa and there has been only limited research on the
qualities and acceptability of chevon by consumers.
Additionally, whether (and to what extent) such consumer
acceptability would be influenced by cooking methods
has not been documented. Therefore, the objective of the
study was to evaluate consumer acceptability of chevon
prepared using different traditional cooking methods in
terms of acceptance of flavour, tenderness, off-flavour,
aroma intensity and juiciness.
MATERIALS AND METHODS
Site description
The study was conducted at Honeydale Research Fort Hare farm.
The farm is located 5 km east of the town of Alice, Eastern Cape,
South Africa and is 520 m above sea level. It is located 32.48°
latitude and 26.53° longitude. It is situated in the False Thornveld of
the Eastern Cape, and the vegetation is characterised by several
trees, shrubs, and grass species with Acacia karroo, Themeda
triandra, Panicum maximum, Digitaria eriantha, Eragrostis spp.,
Cynodon dactylon, and Pennisetum clandestinum being the
dominant plant species. The average rainfall is approximately 480
mm per year, and mostly comes in summer. Mean temperature of
the farm is about 18.7°C per year. The topography of the area is
generally flat with a few steep slopes.
Meat sample cooking
A carcass from the non-descript indigenous goat breed raised on
natural pastures was used for this experiment. The goat was
stunned and humanely slaughtered using traditional procedures at
the University of Fort Hare farm slaughter facility. After skinning and
evisceration, the dressed carcass was weighed and chilled for 24 h.
Together with the offals (intestines and tripe), meat from the
shoulders, thighs and the lumber region including the longissimus
dorsi and ham muscles were used for sensory analysis. The meat
from the different regions was dissected and diced into fragments of
about 3 by 3 cm, mixed together and divided into four equal
portions aligned to the four cooking methods: 1) meat boiled in
water with salt added for 1 h; 2) salted meat roasted; 3) salted meat
boiled mixed with vegetables; and 4) boiled with intestines and
tripe. Boiling in all cases was done for 1 h while roasting was done
until the meat was ready for consumption.
Sensory evaluation
Meat from each method was evaluated alone and tasting for each
method was done randomly by a consumer panel composed of
students at the University of Fort Hare (a total of 48). The panellists
were of different gender (28 males and 20 females), ages (average
age 21 ± 2.32) and tribes (Shona, Xhosa, Zulu and Ndebele). All
the participants were taught how to infer and record scores for each
variable tasted. The waiting period between meat sample tasting
was 10 min. After tasting, the panellists were instructed to rinse
their mouth with water before tasting the next sample to avoid
crossover effects. Each participant completed evaluation form rating
the characteristics of each sample.
Eight point descriptive scales were used to evaluate aroma
intensity (1 = extremely bland to 8 = extremely intense), initial
impression of juiciness (1 = extremely dry to 8 = extremely juicy),
first bite (1 = extremely tough to 8 = extremely tender), sustained
impression of juiciness (1 = extremely dry to 8 = extremely juicy),
muscle fibre and overall tenderness (1 = extremely tough, to 8 =
extremely tender), amount of connective tissue (1 = extremely
abundant to 8 = none ), overall flavour intensity (1 = extremely
bland to 8 = extremely intense) and off-flavour intensity (1 = none to
8 = extremely intense) (ISO 8586-1, 1993). The off-flavour
indicators were livery/bloody, cooked vegetable, pasture/grassy,
animal like/kraal (manure), metallic, sour and unpleasant.
Statistical analyses
The effect of cooking method on aroma intensity, initial impression
of juiciness, first bite, sustained impression of juiciness, fibre and
overall tenderness, amount of connective tissue, overall flavour
intensity and relevant off-flavour intensity was analyzed using the
general linear model procedure of SAS (2003). Tukey’s HSD
procedure was used for comparison of means.
RESULTS AND DISCUSSION
Cooking method significantly affected the sensory scores
for aroma intensity, juiciness and first bite of Chevon
(Table 1). Panelists scored roasted meat and intestines
having significantly higher (P < 0.05) aroma intensity
scores than the plain and mixed with vegetable. Aroma of
the roasted meat and intestines did not differ (P < 0.05)
whilst that of plain cooked meat and that mixed with

Table 2. Gender perceptions of the effect of cooking methods on some important sensory attributes
Xazela et al. 12673
Gender Plain Mixed with vegetable Roasted Intestine
Aroma intensity
Male 4.6 ± 0.08 a 4.6 ± 0.07 a 5.6 ± 0.03 b 5.7 ± 0.07 a
Female 5.5 ± 0.11 b 5.8 ± 0.11 b 4.3 ± 0.06 a 4.2 ± 0.07 b
Initial and sustained impression of juiciness
Male 4.5 ± 0.08 a 4.8 ± 0.08 a 5.1 ± 0.06 4.6 ± 0.07
Female 4.9 ± 0.11 b 5.6 ± 0.11 b 5.0 ± 0.06 4.2 ± 0.07
Muscle fibre and overall tenderness
Male 5.1 ± 0.07 a 4.7 ± 0.07 a 5.2 ± 0.07 4.2 ± 0.07
Female 5.5 ± 0.09 b 5.3 ± 0.09 b 5.1 ± 0.07 4.4 ± 0.07
Amount of connective tissue (residue)
Male 4.8 ± 0.07 a 4.6 ± 0.06 a 4.2 ± 0.07 3.9 ± 0.07 a
Female 5.3 ± 0.10 b 4.9 ± 0.10 b 4.6 ± 0.07 4.6 ± 0.07 b
Values within column with different superscript are significant different (P < 0.05).
vegetables were similar. In terms of both initial
impression of juiciness and sustained impression of
juiciness scores, the meat mixed with vegetables and
intestines were rated significantly (P < 0.05) superior to
the plain cooked meat and the roasted meat. The plain
cooked meat was regarded as moderately juicier whilst
the roasted meat had the lowest sustained impression of
juiciness scores. However, first bite scores showed that
the meat mixed with vegetables and the intestines were
more soft and tender than the cooked plain and roasted
(P < 0.05). Ideally, meat quality levels combine the
capacity to retain high nutritional value in the cooked form
and to excel in functional roles such as flavor
development, tenderness and juiciness of the cooked
product among other roles (Muchenje et al., 2008a,
2009c).
Muscle fibre and overall tenderness, amount of
connective tissue, overall flavour intensity and relevant atypical
flavor were significantly (P < 0.05) affected by
cooking method. Muscle fibre and overall tenderness
scores indicated that the panelists regarded meat mixed
with vegetables and the intestines as highly tender (P <
0.05) compared to the plain cooked and roasted which
were moderately tender to tough. Sensory tenderness
score is direct reflection of the shear force values.
Generally, overall tenderness is closely associated with
the amount of connective tissue in meat (Kannan et al.,
2005; Calkins and Hodgen, 2007; Muchenje et al.,
2008b). Although, the meat mixed with the vegetables
and the intestines had significantly (P < 0.05) abundant
connective tissues than the plain cooked and roasted
meat, it seemed that the connective tissue abundance did
not affect panelist scores for the overall tenderness. This
therefore support the previous observations that amount
of connective tissues alone is insufficient to explain
tenderness of goat meat (Muchenje et al., 2008b).
Factors such as cooking method, fat content, muscle
fibre composition, electrical stimulation and aging regime
also can affect tenderness (Dzudie et al., 2000; Muchenje
et al., 2008a, 2009c).
Overall flavour intensity and relevant off-flavour
intensity were closely associated with cooking method.
Mean overall flavour intensity scores for the four cooking
methods were generally moderate though the plain
cooked meat had significantly low (P < 0.05) scores than
the other three. Relevant off-flavour refers to the flavour
that is present over and above typical flavour such as
livery, bloody, metallic, grassy, and cooked vegetables
(Meinert et al., 2007; Muchenje et al., 2008b; 2010).
Mean relevant off-flavour scores for all cooking methods
were generally low with the meat mixed with vegetables
significantly having the lowest score. The low score for
meat mixed with vegetables could be due to the masking
effect caused by vegetable compounds. Webb et al.
(2005) observed that goat meat is highly suitable for
making traditional meals that would appeal to consumers
whether or not they are accustomed to eating goat meat.
More often than not, consumer perceptions on the
acceptability of meat are linked to socio-cultural factors,
especially in the African context. Although, goat meat and
meat products are also of satisfactory eating quality,
factors such as gender, tribe and age tend to affect
acceptability of chevon from one community to the next
(Mahanjana and Cronje, 2000; Dyubele et al., 2010;
Chulayo et al., 2011). Results from this study suggest
that female consumers tend to give higher scores in most
of the sensory attributes and hence find chevon more
acceptable (Table 2). Similar observations were also
made by Simela et al. (2008), Rousset et al. (2005, 2008)
and Xazela et al. (2011). The effect of tribe was also

12674 Afr. J. Biotechnol.
Table 3. Perceptions of different tribes of the effect of cooking methods on some important sensory attributes.
Tribe Plain Mixed with vegetable Roasted Intestine
Aroma intensity
Xhosa 4.7 ± 0.09 a 4.9 ± 0.09 5.1 ± 0.09 5.0 ± 0.09
Shona 5.3 ± 0.15 b 5.0 ± 0.13 5.4 ± 0.13 5.1 ± 0.13
Zulu 5.1 ± 0.13 b 4.7 ± 0.13 5.2 ± 0.13 5.0 ± 0.13
Initial and sustained impression of juiciness
Xhosa 4.5 ± 0.09 a 4.7 ± 0.09 5.1 ± 0.08 4.8 ± 0.09
Shona 4.9 ± 0.14 b 5.0 ± 0.14 5.1 ± 0.12 5.2 ± 0.14
Zulu 4.7 ± 0.15 b 4.9 ± 0.15 5.4 ± 0.15 4.9 ± 0.15
Muscle fibre and overall tenderness
Xhosa 4.9 ± 0.08 a 4.8 ± 0.08 4.9 ± 0.08 4.7 ± 0.08
Shona 5.5 ± 0.13 b 5.3 ± 0.12 4.9 ± 0.12 5.0 ± 0.12
Zulu 5.6 ± 0.14 b 5.0 ± 0.14 5.1 ± 0.14 4.9 ± 0.14
Amount of connective tissue (residue)
Xhosa 4.7 ± 0.09 a 4.5 ± 0.09 4.6 ± 0.08 a 4.8 ± 0.09
Shona 5.0 ± 0.14 a 5.3 ± 0.14 4.5 ± 0.13 a 5.1 ± 0.14
Zulu 5.5 ± 0.15 b 5.1± 0.15 4.9 ± 0.15 b 5.0± 0.15
Values within column with different superscript are significant different (P < 0.05).
apparent.
The Shona and Zulu panelists gave higher scores for
all sensory scores than the Xhosa panelists (Table 3).
The low rating given by the Xhosas could be attributed to
characteristic nature of the Xhosa tribe who generally
prefer mutton over goat meat because of cultural reasons
as observed in other studies (Radder and le Roux, 2005;
Krystallis and Arvanitoyannis, 2006; Dyubele et al.,
2010). Generally, the common culture of a particular tribe
in any community is the most likely the overriding reason
on the perceptions of the goat meat and the cooking
methods used (Resurrección, 2003; García-Segovia et
al., 2007). The culture of a community is in itself a very
complex phenomenon influenced by available resources,
pragmatic practices and beliefs (Webb et al., 2005). The
consumption of goats can therefore be affected by
gender, regions and the eating habits of different
communities as reported elsewhere (Webb et al., 2005;
Garcı´a-Segovia et al., 2007).
Conclusion
The findings obtained from this study clearly show that
cooking method affect sensory quality of goat meat. Goat
meat mixed with vegetables and the intestines had the
highest scores all round. The high connective tissue in
the meat did not affect the panelist scores for tenderness.
Off-flavour scores were on the acceptable end. The
findings from the study however could have been
improved if, pH, cooking loss, shear and other meat
quality attributes had been taken into consideration.
REFERENCES
Calkins CR, Hodgen JM (2007). A fresh look at meat flavour. Meat Sci.
77: 63-80.
Chulayo AY, Muchenje V, Mwale M, Masika PJ (2011). Effects of some
medicinal plants on consumer sensory characteristics of village
chicken meat. Afr. J. Biotechnol. 10: 815-820.
Dyubele NL, Muchenje V, Nkukwana TT, Chimonyo M (2010).
Consumer sensory characteristics of broiler and indigenous chicken
meat: A South African example. Food Quality Pref. 21: 815-819.
Dzudie T, Ndjouenkeu R, Okubanjo A (2000). Effect of cooking methods
and rigor state on the composition, tenderness and eating quality of
cured goat loins. J. Food Eng. 44(3): 149-153.
García-Segovia P, Andrés-Bello A, Martínez-Monzó J (2007). Effect of
cooking method on mechanical properties, colour and structure of
beef muscle (M pectoralis), J. Food Eng. 80(3): 813-821.
Hoffman LC, Wiklund E (2006). Game venison-meat for the modern
consumer. Meat Sci. 74(1): 197-208.
ISO (International Organisation for Standardisation) (1993). Sensory
analysis; general guidance for selection, training and monitoring of
assessors. Part I. Selected assessors. ISO 8586-1:1993. ISO,
Geneva, Switzerland, p. 26.
Kannan G, Gadiyaram KM, Galipallli S, Carmichael A, Kouakou B,
Pringle TD, McMillin KW, Gelaye SW (2005). Meat quality in goats
as influenced by dietary protein and energy levels, and post-mortem
aging. Small Rumin. Res. 61(1): 45-52.
Krystallis A, Arvanitoyannis IS (2006). Investigating the concept of meat
quality from the consumers’ perspective: The case of Greece. Meat
Sci. 72 (1): 164-176.
Mahanjana AM, Cronje PB (2000). Factors affecting goat production in

the communal farming system in the Eastern Cape region of South
Africa. South Afr. J. Anim. Sci. 30: 149-154.
Meinert L, Andersen LT, Bredie WLP, Bjergegaard C, Aaslyng MD
(2007). Chemical and sensory characterization of pan-fried pork
flavour: Interactions between raw meat quality, ageing and frying
temperature. Meat Sci. 75 (2): 229-242.
Muchenje V, Dzama K, Chimonyo M, Raats JG, Strydom PE (2008b).
Meat quality of Nguni, Bonsmara and Angus steers raised on natural
pasture in the Eastern Cape, South Afr. Meat Sci. 79: 20-28.
Muchenje V, Dzama K, Chimonyo M, Strydom PE, Hugo A, Raats JG
(2008a). Sensory evaluation and its relationship to physical meat
quality attributes of beef from Nguni and Bonsmara steers raised on
natural pasture. Animal, 2(11): 1700-1706.
Muchenje V, Chimonyo M, Dzama K, Strydom PE, Ndlovu T, Raats JG
(2010). Relationship between off-flavour descriptors and flavour
scores in beef from cattle raised on natural pasture. J. Muscle. Food,
21: 424-432.
Muchenje V, Dzama K, Chimonyo M, Strydom PE, Hugo A, Raats JG
(2009c). Some biochemical aspects pertaining to beef eating quality
and consumer health: Rev. Food Chem. 112: 279-289.
Radder L, le Roux R (2005). Factors affecting food choice in relation to
venison: A South African example. Meat Sci. 71(3): 583-589.
Xazela et al. 12675
Resurreccion AVA (2003). Sensory aspects of consumer choices for
meat and meat products. Meat Sci. 66: 11–20.
Rousset S, Deiss V, Juillard E, Schlich P, Droit-Volet S (2005).
Emotions generated by meat and other food products in women. Br.
J. Nutr. 94: 609-619.
Rousset S, Schlich P, Chatonnier A, Barthomeuf L, Droit-Volet S
(2008). Is the desire to eat familiar and unfamiliar meat products
influenced by emotions expressed on eaters faces Appetite 50(1):
110-119.
Simela L, Merkel R (2008). The contribution of chevon from Africa to
global meat production. Meat Sci. 80(1): 101-109.
Simela L, Webb EC, Bosman MJC (2008). Acceptability of chevon from
kids, yearling goats and mature does of indigenous South African
goats: A case study. S. Afr. J. Anim. Sci. 38: p. 3.
Webb EC, Casey NH, Simela L (2005). Goat meat quality. Small
Rumin. Res. 60 (1): 153-166.
Xazela NM, Chimonyo C, Muchenje V, Marume U (2011). Consumer
sensory evaluation of meat from South African goat genotypes fed on
a dietary supplement. Afr. J. Biotechnol. 10(21): 4436-4443.

African Journal of Biotechnology Vol. 10(59), pp. 12676-12683, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.112
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Biot number - lag factor (Bi-G) correlation for tunnel
drying of baby food
Tomislav Jurendić and Branko Tripalo*
Department of Process Engineering, Faculty of Food Technology and Biotechnology, University of Zagreb,
10000 Zagreb, Croatia.
Accepted 27 July, 2011
To obtain mass transfer coefficients of three baby food mixtures on cereal basis in a tunnel dryer, Bi-G
drying correlation can be used. Experimental moisture content values for three mixtures at three
different air temperatures (60, 80 and 100°C) and air velocities (0.5, 1.0 and 1.5 m/s) during tunnel drying
were collected. Effective moisture diffusivities coefficients were calculated in two ways and for
mixtures 1, 2 and 3 and ranged between 1.51 × 10 -8 to 52.7 × 10 -8 m 2 /s, 1.05 × 10 -8 to 64.9 × 10 -8 m 2 /s and
0.107 × 10 -8 to 53.1 × 10 -8 m 2 /s, respectively. At lower drying temperature, moisture diffusivities values
calculated in two ways agreed better than at higher temperature. The influence of baby food
composition on mass transfer parameters was observed.
Key words: Baby food, exponential drying model, mass transfer coefficients, tunnel drying.
INTRODUCTION
Drying represent one of the oldest and still important way
of food preservation (Ježek et al., 2008). Besides drying
as a technology, there is growth of various innovative
technologies like ultrasound, high hydrostatic pressure,
extrusion, pulsed electric fields and tribomechanical
activation for food preservation which could be used for
various purposes mostly in a way of pretreatment or
enhanced processing (Herceg et al., 2004; Brnčić et al.,
2006; Bosiljkov et al., 2011). Dehydrated baby food is
one of the most important daily baby meals. Dehydrated
baby food can be produced using various techniques like
*Corresponding author. E-mail: btripalo@pbf.hr. Tel: +385 1
4605 276. Fax: +385 1 4605 200.
Nomenclature: A, Constant; B, constant; Bi, Biot number
(dimensionless); c, parameter in linear function; D, moisture
diffusivity (m 2 /s); Fo, Fourier number (dimensionless); G, lag
factor (dimensionless); K, drying constant (1/s); k, moisture
transfer coefficient (m/s); L, characteristic dimension, slab half
thickness (m); μ, root of the transcendental characteristic
equation; R 2 , correlation coefficient; RH, relative humidity;
RMSE, root mean square error; S, drying coefficient (1/s); t,
drying time (s); T, air temperature (°C); Y, dimensionless
moisture content; X, moisture content (kg/kg, dry basis); Exp,
experimental; I, initial; 1, first characteristic value.
spray drying and drum drying. Products produced in
these ways have very low moisture content (2 to 5%, wet
basis). It is known that the main objective of any drying
process is to produce a dried product of desired quality at
minimum cost and maximum throughput by optimizing
the design and operating conditions (Brnčić et al., 2004;
Sun et al., 2005). Both aforementioned drying methods,
spray drying and drum drying consume high quantity of
energy. During the last three decades, the rise of energy
prices was accompanied by increasingly stringent
legislation on pollution, working conditions and safety. To
optimize energy consumption, new drying methods and
dryer design are required (Strumillo et al., 1995; Brnčić et
al., 2010) as much as new methods for pre-treatment of
foodstuffs before drying. Extrusion cooking could be
taken into consideration for producing of directly
expanded food that is acceptable as enriched snack
(Brnčić et al., 2009, 2009b). Quantitative understanding
of the fundamental mechanism of the moisture distributions
and heat transport within the product is crucial for
process design, quality control and energy savings
(McMinn, 2004). Developing drying models and determining
moisture transport parameters are of particular
interest for efficient mass transfer analysis (Mrkić et al.,
2002, 2007; Ježek et al., 2006). Several heat and mass
transfer models were reviewed together with obtained
drying parameters (Saravacos and Maroulis, 2001).

To characterize the mass transfer during the drying
regular geometry solid objects (infinite slab, infinite
cylinder and sphere) Dincer and Dost (1995, 1996) developed
and verified analytical model. Based on analogy
between cooling and drying profiles drying process
parameters (drying coefficient S and lag factor G) were
introduced. Dincer and Hussain (2004) developed new
Biot number Bi and lag factor G (Bi-G) correlation to
determine the mass transfer parameters for solids drying
processes using a large number of experimental data.
The new correlation was found to be suitable for use in
practical drying application. McMinn (2004) used new
correlation in the drying of lactose powder.
The published data of moisture diffusivity values in food
products show a huge variability from 10 -12 to 10 -8 m 2 /s
(Zogzas et al., 1996). In literature, no detailed studies
were found to predict mass process parameters of
dehydrated cereal-based baby food during tunnel drying.
The aim of this work was to determine the mass
transfer parameters using Bi-G correlation at different
drying temperatures and air velocities during tunnel
drying. New correlation will enable designers and
operators an accurate and simple analytical tool to conduct
design analysis and relevant calculations. Designers
and engineers will be able to provide the optimum
solution to various aspects of drying operations (process
control, operating conditions and energy use) without
undertaking actual experimental trials (Dincer, 1998). The
reducing of experimental drying trials for mixtures of baby
food is very important, because the components which
are added, especially vitamins and minerals, are very
expensive.
Effective moisture diffusivity was calculated by using
drying constant obtained in semi-log plot of experimental
data and from model equations.
MATERIALS AND METHODS
Experiment
The drying experiments on baby food were performed in a pilotplant
tunnel dryer designed and manufactured at the Faculty of
Food Technology and Biotechnology in Zagreb, Croatia. The dryer
consist of a tunnel, electrical heater and fan, and is equipped with
controllers for controlling temperature and air velocity.
The components of mixture 1 were water, wheat flour (30%),
sugar (8%), corn starch and vitamins, the components of mixture 2
were water, wheat flour (25%), soya flour, milk powder, sugar (4%)
and vitamin mixture and the components of mixture 3 were water,
corn flour (37%), powdered sugar (3%), vitamins and mineral
mixture. The chemical analysis of the three wet mixtures showed
that mixture 1 consisted of water (56%), proteins (3.5%), sugars
(38.9%), fats (0.53%) and ash (0.15%). Mixture 2 consisted of water
(61%), proteins (6.3%), sugars (27%), fats (4.76%) and ash (0.79%)
and mixture 3 of water (65%), proteins (2.7%), sugars (30.2%), fats
(0.89%) and ash (0.25%). Because of the added soya flour, mixture
2 characterized higher percent of fats and proteins, while mixture 1
had higher sugar content. All percentages are given on wet basis.
The initial moisture content was determined by the AOAC method
no. 931.15 (AOAC, 1990).
Jurendić and Tripalo 12677
50 g of wet mixtures were prepared 30 min before drying. To
conduct the drying experiments at 60, 80 and 100°C (+-1°C) and at
air velocity 0.5, 1.0 and 1.5 m/s, wet mixtures were placed into
aluminum trays (size: diameter 100 × height 5 mm). Moisture loss
was recorded at 1 min interval during 1 h and later at 5 min interval
till the end of the drying by digital balance of 0.01 g accuracy
(Mettler-Toledo, model PB602-L, Switzerland). The drying was
continued until the variation in the moisture content loss was less
than 0.01 g during three measurements. Relative humidity RH (%)
of the air in the tunnel dryer was measured by Testo 177-H1
(Lenzkirch, Germany). Experiments were conducted in triplicates.
Data analysis
The moisture transfer characteristics of the baby food samples were
evaluated using semi-logarithmic plots (lnY-t) and the Bi-G
correlation proposed (Dincer and Hussain, 2004).
The experimental data were non-dimensionalised using equation
(Doymaz and Pala, 2002; Velić et al., 2004; Mrkić et al., 2007):
Semi-logarithmic plots lnY-t were constructed and described by
linear function (Mrkić et al., 2007):
The value K (s -1 ) drying constant can be used to determine
moisture diffusivity D for a slab of thickness L by the equation
(Marinos-Kouris and Maroulis, 1995):
Where, L is slab half-thickness (m).
Using least-square method, the dimensionless moisture content
Y was expressed in terms of lag factor G and drying coefficient S.
The moisture diffusivity D was computed using the model
developed by Dincer and Dost (1996):
Where, μ1 is a simplified expression for the roots of the
characteristic equation for a slab geometry:
To verify and apply the model, the dimensionless moisture
distribution Y was calculated for slab geometry (Dincer and Dost,
1996):
Where,
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)

12678 Afr. J. Biotechnol.
Table 1. Drying parameters obtained from linear model of drying curve in semi-logarithmic plot lnY-t.
Baby food
Mixture 1
Mixture 2
Mixture 3
Drying condition Drying parameter
T (°C) v (m/s) RH (%) K D × 10 -8 (m 2 /s)
60 0.5 32 0.009 2.28
60 1.0 34 0.0111 2.81
60 1.5 34 0.0116 2.94
80 0.5 38 0.0125 3.17
80 1.0 31 0.0137 3.47
80 1.5 29 0.0196 4.96
100 0.5 39 0.0170 4.31
100 1.0 42 0.0203 5.14
100 1.5 38 0.0254 6.43
60 0.5 26 0.0079 2.00
60 1.0 33 0.0079 2.00
60 1.5 43 0.0084 2.13
80 0.5 41 0.0144 3.65
80 1.0 40 0.0146 3.70
80 1.5 38 0.0170 4.31
100 0.5 39 0.0203 5.14
100 1.0 36 0.0186 4.71
100 1.5 37 0.0274 6.94
60 0.5 29 0.0005 0.127
60 1.0 28 0.0004 0.107
60 1.5 31 0.0006 0.152
80 0.5 38 0.0004 0.107
80 1.0 29 0.0004 0.107
80 1.5 28 0.0005 0.127
100 0.5 27 0.0007 0.177
100 1.0 31 0.0008 0.203
100 1.5 33 0.0007 0.177
(9)
(10)
The moisture transfer coefficient k was calculated from Biot number
Bi definition:
(11)
The Biot number was calculated from the relation between Biot
number Bi and lag factor G (Bi-G) (Dincer and Hussain, 2004):
(12)
Using root mean square error RMSE the predicted moisture ratio
was compared to experimental moisture ratio (McMinn, 2006;
Srikiatden and Roberts, 2008):
(13)
As RMSE approaches zero, the closer the prediction is to the
experimental data (Srikiatden and Roberts, 2008).
RESULTS AND DISCUSSION
For all experiments, drying curves were fitted well
(R 2 >0.94) with straight lines described by Equation 2. In
all cases straight lines with constant slope K were
obtained, which indicates that drying of mixtures 1, 2 or 3
took place in one falling rate period with constant
moisture diffusivity D. Table 1 shows the values of K and
D obtained from Equation 3. The values of effective
diffusion coefficient D for food materials are in the range

Figure 1. Experimental average dimensionless moisture content of
mixture 1 dried under different drying conditions.
Figure 2. Experimental average dimensionless moisture content of
mixture 2 dried under different drying conditions.
of 10 -13 to 10 -6 m 2 /s, and most of them are accumulated in
the region 10 -11 to 10 -8 (Marinos-Kouris and Maroulis,
1995). The values D for mixtures 1 and 2 were in this
region also, but values for mixture 1 were in the region of
10 -7 . This indicates that the binding water capacity of
mixture 3 is weaker than of the other two mixtures. The
reason for that can be different physical structure and
composition of mixture 3 that influence the moisture
transfer characteristics. From Table 1, it can clearly be
seen that the moisture diffusivity is an increasing function
of temperature (Marinos-Kouris and Maroulis, 1995) and
increasing function of air velocity.
Figure 1 shows the experimental average dimensionless
moisture content of mixture 1 under different drying
conditions. Drying curves show that the rate of drying
Jurendić and Tripalo 12679
Figure 3. Experimental average dimensionless moisture content
of mixture 3 dried under different drying conditions.
increased with increasing drying air temperature and
velocity. High effect of air velocity on drying rate was
observed in all cases. At the same temperature with
increasing the air velocity, the drying rate was increased
also. At the beginning of drying, differences in shape of
drying curves were smaller while at the end of the
processes, the differences were higher. This indicates
that the influence of temperature and air velocity on
drying kinetics is higher towards the end than at the
beginning of the process. For broccoli drying, influence of
temperature on drying kinetics was lower towards the end
than at the beginning of the process (Mrkić et al., 2007).
Figure 2 shows the experimental average dimensionless
moisture content of mixture 2 under different drying
conditions. The influence of air temperature on drying
kinetics was not pronounced at 100 and 80°C. At 60°C,
the influence of the temperature can be seen, because
the drying took place longer than at 80 and 100°C,
respectively. Figure 3 shows the experimental average
dimensionless moisture content of mixture 3 under
different drying conditions. From the beginning of drying,
the influence of air temperature and velocity can be
clearly seen. With increasing air temperature and
velocity, the time required to achieve certain moisture
content decreased.
Table 2 shows calculated drying parameters of
regression model using Equation 4. The experimental
moisture content was turned dimensionless. The received
data were more than the regressed against time. The
drying coefficient S and lag factor G were obtained. The
lag factor G is an indicator of the magnitude of both
internal and external resistance to moisture transfer from
the product and the drying coefficient S indicates the
drying capability of the solid object (Dincer and Dost,
1995). An increase of S values is observed with increase
in the air velocity and temperature. An increase of S

12680 Afr. J. Biotechnol.
Table 2. Drying parameters of regression model.
Baby food
Mixture 1
Mixture 2
Mixture 3
Drying condition Drying parameter
T (°C) v (m/s) RH (%) G S R 2 RMSE
60 0.5 32 0.9212 0.0066 0.9950 0.0689
60 1.0 34 0.9206 0.0072 0.9984 0.0774
60 1.5 34 0.9211 0.0078 0.9922 0.0601
80 0.5 38 0.9193 0.0084 0.9935 0.0575
80 1.0 31 0.9222 0.0097 0.9874 0.0435
80 1.5 29 0.9500 0.0159 0.9867 0.0522
100 0.5 39 1.0969 0.0111 0.9827 0.0418
100 1.0 42 1.0301 0.0119 0.9914 0.0658
100 1.5 38 1.0284 0.0154 0.9938 0.0579
60 0.5 26 0.9215 0.0045 0.9861 0.0824
60 1.0 33 0.9243 0.0048 0.9864 0.0683
60 1.5 43 0.9483 0.0052 0.9859 0.0699
80 0.5 41 1.0469 0.0133 0.9148 0.0598
80 1.0 40 0.9512 0.0133 0.9953 0.0354
80 1.5 38 0.9659 0.0147 0.9989 0.0351
100 0.5 39 1.0245 0.0129 0.9958 0.0742
100 1.0 36 1.0179 0.0103 0.9883 0.0817
100 1.5 37 1.0253 0.0166 0.9958 0.0788
60 0.5 29 1.1096 0.0136 0.9822 0.0959
60 1.0 28 1.0969 0.0156 0.9914 0.0803
60 1.5 31 1.0625 0.0202 0.9936 0.0692
80 0.5 38 1.0499 0.0149 0.9918 0.0830
80 1.0 29 1.0452 0.0159 0.9910 0.0706
80 1.5 28 1.0424 0.0170 0.9896 0.0755
100 0.5 27 1.0412 0.0196 0.9799 0.0923
100 1.0 31 1.0411 0.0237 0.9934 0.0783
100 1.5 33 1.0439 0.0258 0.9919 0.0809
value with air temperature was observed during the
drying of lactose powder using different methods
(McMinn, 2004). Values of lag factor G were higher than
1 at higher temperature (100°C) by drying of mixtures 1
and 2 and lower than 1 at lower temperature (60 and
80°C). For mixture 3, all lag factors G values were higher
than 1, what verify the presence of internal resistance to
mass transfer within the baby food slab. Good agreement
between the observed and predicted results can be
observed (R 2 >0.98). Only a few data; mixture 2 at 80°C
and 0.5 m/s and mixture 3 at 100°C and 0.5 m/s had
lower degree of correlation (R 2

Table 3. Mass transfer parameters.
Jurendić and Tripalo 12681
Baby food
Drying condition
T (°C) v (m/s) RH (%) μ1
Drying parameter
Bi D × 10 -8 (m 2 /s) k × 10 -5 (m/s)
60 0.5 32 -1.6539 0.0064 1.51 0.0039
60 1.0 34 -1.6763 0.0063 1.60 0.0041
60 1.5 34 -1.6562 0.0064 1.76 0.0045
Mixture 1 80 0.5 38 -1.7212 0.0061 1.78 0.0043
80 1.0 31 -1.6211 0.0066 2.31 0.0061
80 1.5 29 -0.8062 0.0146 15.2 0.0895
100 0.5 39 0.8196 0.6821 10.4 2.83
100 1.0 42 0.4432 0.1272 38.1 1.93
100 1.5 38 0.4279 0.1216 52.7 2.56
60 0.5 26 -1.6425 0.0065 1.05 0.0027
60 1.0 33 -1.5476 0.0071 1.24 0.0035
60 1.5 43 -0.8472 0.0139 4.54 0.0254
80 0.5 41 0.5713 0.1958 25.6 2
Mixture 2 80 1.0 40 -0.776 0.0152 13.9 0.0839
80 1.5 38 -0.447 0.0228 46.2 0.421
100 0.5 39 0.3923 0.1098 52.3 2.29
100 1.0 36 0.3280 0.0924 59.7 2.20
100 1.5 37 0.4002 0.1122 64.9 2.92
60 0.5 29 0.8640 0.9261 11.4 4.23
60 1.0 28 0.8196 0.6821 14.5 3.97
60 1.5 31 0.6664 0.2910 28.4 3.31
80 0.5 38 0.5638 0.1904 29.5 2.24
Mixture 3 80 1.0 29 0.5598 0.1876 31.9 2.39
80 1.5 28 0.5396 0.1743 36.5 2.54
100 0.5 27 0.5313 0.1693 43.4 2.94
100 1.0 31 0.5307 0.1689 52.5 3.55
100 1.5 33 0.5513 0.1818 53.1 3.86
product.
Using the lag factor G, the μ1 was calculated from
Equation 6. The μ1 values are detailed in Table 3.
Furthermore, using μ1, S and L values, the moisture
diffusivity was calculated by Equation 5. The calculated
diffusivities are shown in Table 3. Comparing diffusivities
values obtained through Equations 3 and 5, some
differences were seen. At higher temperature, differences
between the two methods of calculation were greater for
mixtures 1 and 2, but for mixture 3 the obtained
differences were much greater. The variability in moisture
diffusivity values by the same samples can be explained
by using different methods of calculation, and Zogzas
and Maroulis (1996) reported it in their work also.
Dincer and Hussain (2002) noticed a wide variation of
moisture diffusivities data of the same foodstuffs using
different methods of its estimation. The same conclusion
was reported by drying of broccoli (Mrkić et al., 2007). In
this work, the calculated values of moisture diffusivities
are in the range of values for food materials presented by
Marinos-Kouris and Maroulis (1995).
The moisture transfer coefficient k was determined
using Equation 11 and values are presented in Table 3.
Calculated values ranged between 0.0039 × 10 -5 to 2.83
× 10 -5 m/s for mixture 1, 0.0027 × 10 -5 and 2.92 × 10 -5
m/s for mixture 2 and 2.24 × 10 -5 and 4.23 × 10 -5 m/s for
mixture 3 depending on air temperature and velocity.
Through Equation 7, Bi-G correlation was verified. The
predicted dimensionless moisture content was calculated
using A1 value from Equation 8 and B1 value from
Equation 9. The agreement between the experimental
and predicted values is given in Table 4. As shown, the
results of the model agreed very well with the
experimental data, except for the values for mixture 1
dried at 100°C R 2

12682 Afr. J. Biotechnol.
Table 4. Agreement between experimental and predicted values calculated through Equation 7.
Baby food
Mixture 1
Mixture 2
Mixture 3
non-dimensional moisture content for all the three
mixtures at different air temperatures and velocities.
Calculated D values using lag factor and drying
coefficient and using only drying coefficient were very
close to each one at 60 and 80°C for mixture 1 and 60°C
for mixture 2. For other conditions, D values differed 10
times or more. The influence of baby food composition on
mass transfer parameters was observed.
REFERENCES
AOAC (1990). Official Methods of Analysis (15 th ed). Association of
Official Analytical Chemists, Arlington, VA, USA.
Bosiljkov T, Tripalo B, Brnčić M, Ježek D, Karlović S, Jagušt I (2011).
Influence of High Intensity Ultrasound with Different Probe Diameter
on the Degree of Homogenization (variance) and Physical Properties
of cow Milk. Afr. J. Biotechnol., 10(1): 34-41.
Brnčić M, Tripalo B, Ježek D, Bosiljkov T (2004). Drying of Alcalyzed
Cocoa-Bean, Proceedings of the 2 nd Central European Meeting 5 th
Croatian Congress of Food Technologists, Biotechnologists and
Nutritionists, October 17-20, Opatija, Croatia, 292-299.
Drying condition Drying parameter
T (°C) v (m/s) RH (%) R 2 RMSE
60 0.5 32 0.9953 0.1705
60 1.0 34 0.9958 0.1854
60 1.5 34 0.9923 0.1955
80 0.5 38 0.9560 0.3261
80 1.0 31 0.9875 0.1913
80 1.5 29 0.9868 0.0869
100 0.5 39 0.7956 0.2373
100 1.0 42 0.7929 0.3029
100 1.5 38 0.9585 0.2115
60 0.5 26 0.9870 0.1521
60 1.0 33 0.9869 0.2119
60 1.5 43 0.9864 0.1814
80 0.5 41 0.9977 0.0867
80 1.0 40 0.9953 0.1367
80 1.5 38 0.9989 0.0699
100 0.5 39 0.9968 0.0985
100 1.0 36 0.9889 0.0954
100 1.5 37 0.9963 0.0398
60 0.5 29 0.9425 0.2941
60 1.0 28 0.9649 0.2945
60 1.5 31 0.9683 0.2365
80 0.5 38 0.9576 0.2762
80 1.0 29 0.9652 0.2985
80 1.5 28 0.9584 0.3052
100 0.5 27 0.9599 0.3020
100 1.0 31 0.9744 0.2761
100 1.5 33 0.9828 0.2808
Brnčić M, Tripalo B, Ježek D, Semenski D, Drvar N, Ukrainczyk M
(2006). Effect of twin-screw extrusion parameters on mechanical
hardness of direct-expanded extrudates. Sadhana, 31(5): 527-536.
Brnčić M, Bosiljkov T, Ukrainczyk M, Tripalo B, Rimac Brnčić S, Karlović
S, Karlović D, Ježek D, Vikić TD (2009a). Influence of Whey Protein
Addition and Feed Moisture Content on Chosen Physicochemical
Properties of Directly Expanded Corn Extrudates. Food Bioprocess
Tech. DOI:10.1007/s11947-009-0273-0.
Brnčić M, Tripalo B, Rimac Brnčić S, Karlović S, Župan A, Herceg Z
(2009). Evaluation of textural properties for whey enriched direct
extruded and puffed corn based products. Bulg. J. Agric. Sci., 15(3):
204-213.
Brnčić M, Karlović S, Rimac Brnčić S, Penava A, Bosiljkov T, Ježek D,
Tripalo B (2010). Textural properties of infra red dried apple slices as
affected by high power ultrasound pretreatment. Afr. J. Biotechnol.,
9(41): 6907-6915.
Dincer I (1998). Moisture loss from wood products during drying – Part
II: Surface moisture content distributions. Energy Sources, 20(1): 77-
83.
Dincer I, Dost S (1995). An analytical model for moisture diffusion in
solid objects during drying. Drying Technol., 13(1&2): 425-435.
Dincer I, Dost S (1996). A modeling study for moisture diffusivities and
moisture transfer coefficients in drying of solid objects. Int. J. Energ.
Res., 20: 531-539.
Dincer I, Hussain MM (2002). Development of a new Bi-Di correlation

for solids drying. Int. J. Heat Mass Transfer, 45: 3065-3069.
Dincer I, Hussain MM (2004). Development of a new Biot number and
lag factor correlation for drying applications. Int. J. Heat Mass
Transfer, 47: 635-658.
Doymaz I, Pala M (2002). The effects of dipping pretreatments on airdrying
rates of the seedless grapes. J. Food Eng., 52(4): 413-417.
Herceg Z, Lelas V, Brnčić M, Tripalo B, Ježek D (2004).
Tribomechanical micronization and activation of whey protein
concentrate and zeolite. Sadhana, 29(1): 13-26.
Ježek D, Tripalo B, Brnčić M, Karlović D, Vikić-Topić D, Herceg Z
(2006). Modeling of convective carrot drying. Croat. Chem. Acta,
79(3): 385-391.
Ježek D, Tripalo B, Brnčić M, Karlović D, Rimac Brnčić S, Vikić-Topić D,
Karlović S (2008). Dehydration of celery by infra red drying. Croat.
Chem. Acta. 81(2): 325-331.
Marinos-Kouris D, Maroulis ZB (1995). Transport properties for the
drying of solids. In: Handbook of Industrial Drying (Ed: Mujumdar A),
Marcel Dekker, New York: pp. 113-159.
McMinn WAM (2004). Prediction of moisture transfer parameters for
microwave drying of lactose powder using Bi-G drying correlation.
Food Res. Int., 37(10): 1041-1047.
McMinn WAM (2006). Thin-layer modeling of the convective,
microwave, microwave-convective and microwave-vacuum drying of
lactose powder. J. Food Eng., 72: 113-123.
Mrkić V, Tripalo B, Delonga K, Ježek D, Brnčić M, Ručević M (2002).
Effect of Blanching and Infrared Radiation Drying Temperature on the
Flavonol Content of Onions (Allium cepa L), Proceedings of the 4 th
Croatian Congress of Food Technologists, Biotechnologists and
Nutritionists, October 3-5, Opatija, Croatia, pp. 167-172.
Jurendić and Tripalo 12683
Mrkić V, Ukrainczyk M, Tripalo B (2007). Applicability of moisture
transfer Bi-Di correlation for convective drying of broccoli. J. Food
Eng., 79: 640-646.
Saravacos GS, Maroulis ZB (2001). Transport properties of food.
Marcel Dekker, New York.
Strumillo C, Jones PL, Zylla R (1995). Energy Aspects in Drying. In:
Handbook of Industrial Drying (Ed: Mujumdar A), Marcel Dekker,
New York, pp. 1241-1275.
Srikiatden J, Roberts JS (2008). Predicting moisture profiles in potato
and carrot during convective hot air drying using isothermally
measured effective diffusivity. J. Food Eng., 84: 516-525.
Sun L, Islam MdR, Ho JC, Mujumdar AS (2005). A diffusion model for
drying of heat sensitive solid under multiple heat input modes.
Bioresource Technol., 96: 1551-1560.
Velić D, Planinić M, Tomas S, Bilić M (2004). Influence of air velocity on
kinetics of convection apple drying. J. Food Eng., 64: 97-102.
Zogzas NP, Maroulis, ZB (1996). Effective moisture diffusivity
estimation from drying data. Comparison between various methods of
analysis. Drying Technol., 14(7&8): 1543-1573.
Zogzas NP, Maroulis ZB, Marinos-Kouris D (1996). Moisture diffusivity
data compilation in foodstuffs. Drying Technol., 14(10): 2225-2253.

African Journal of Biotechnology Vol. 10(59), pp. 12684-12690, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.2203
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Optimization of the technology of extracting watersoluble
polysaccharides from Morus alba L. leaves
Zhonghai Tang 1 , Shiyin Guo 1 , Liqun Rao 1 , Jingping Qin 1 , Xiaona Xu 3 and Yizeng Liang 2 *
1 College of Bioscience and Biotechnology, Hunan Agriculture University, Changsha 410128 ,China.
2 Research Center of Modernization of Chinese Traditional and Herbal Drug Modernization, College of Chemistry and
Chemical Engineering, Central South University, Changsha, Hunan,P. R. China.
3 College of Chemistry and Chemical Engineering, University of South China, Hengyang, Hunan, China.
Accepted 19 May, 2011
To optimize the parameters for extracting water-soluble polysaccharides from mulberry leaves using hot
water, the extraction process was optimized by the orthogonal test through the single-factor experiment.
Experiments were carried out using an L9 (3 4 ) orthogonal design to examine the effects of extraction
temperature, extraction duration, concentration of the material and concentration of ethanol on the
polysaccharide yield. The optimum extraction conditions determined were as follows: concentration of
material was equal to 1:24, extraction temperature was 70°C, extraction duration was 90 min and
concentration of ethanol was equal to 80%. Under these conditions, the yield of polysaccharides was
2.64%.
Key words: Polysaccharides, Morus alba L., extraction technology, single-factor experiment, orthogonal test.
INTRODUCTION
Mulberry (Morus alba L.) belongs to the family Moraceae
and is a perennial deciduous plant. Mulberry leaves have
medicinal properties and the tree is found in the list of
edible plants declared by the Chinese Ministry of Health.
It has a high nutritional and medicinal value, and the
active ingredients mainly comprise of polysaccharides,
alkaloids, peptides, flavonoids, polyphenols and so on.
Various parts of the mulberry are used as medicine in
China, Japan and Korea to treat diabetes, paralytic
stroke, and beriberi (Kim et al., 2003). However, the total
area available for mulberry cultivation is decreasing, and
mulberry trees are susceptible to frost damage (Lee et
al., 2011). According to Shen Nong's Materia Medica,
mulberry leaves are characterized by a sweet-and-bitter
taste, are cold in nature, belong to the lung-liver channel,
have an antiobesity function, soothe the liver and improve
eyesight (Zhao et al., 2008; Nair et al., 2004). They have
been applied in traditional medicine for the treatment of
* Corresponding author. E-mail: yizeng_liang@263.net. Fax:
+86-731-8825637.
diabetes. Modern pharmacological and clinical studies
have shown that the active ingredient in mulberry,
namely, polysaccharides, lower blood sugar and blood
pressure, regulate immunity, and have antibacterial,
antiviral and other physical activities (Alamo et al., 2004;
Hosseinzadeh et al., 1999; Kodama et al., 2004; Noriko
et al., 2005). The Japanese people have studied deeply
the effective ingredients of mulberry (Yatsunami et al.,
2008). They found that the polysaccharides could lower
blood sugar and therefore, they analyzed the structures.
In China, the polysaccharides from mulberry leaves have
been used as regulators of blood glucose concentration
in alloxan-induced diabetes in rats (Fang et al., 1999).
China has abundant mulberry resources and proposes to
develop functional foods and hypoglycemic drugs with
the natural, medicinally effective polysaccharide
ingredient extracted from M. alba L. leaves (Chen et al.,
1996; Yang et al., 1984).
The methods used for the extraction of polysaccharides
from M. alba L. leaves (hot water extraction and
ultrasound extraction) were compared. Hot water
extraction is widely used because it is simple, easy to
industrialize and involves low cost; nevertheless, the yield

is less and the process is time-consuming. The yield from
ultrasonic extraction is slightly higher than that of hot
water extraction, the amount of time spent is short, and
the amount of extract needed is less; however, its higher
costs are not conducive for industrialization and
amplification, and the equipments are costlier. Therefore,
it is currently limited to the laboratory. We used hot water
extraction to extract water-soluble polysaccharides from
mulberry leaves. On the basis of the single-factor
experiment, an orthogonal experimental array was
adopted to study the effect of several important factors
that affect the yield of polysaccharides and the
technological conditions were further optimized.
MATERIALS AND METHODS
Mulberry leaves were collected from the Hunan Institute of
Sericulture (Silkworm and Mulberry Improvement Center of China,
Changsha subcenters) after the first frost of the year, dried at 50°C,
sifted through a 40-mesh sieve and stored in a dryer box.
The trichloroacetic acid, ethanol, sulfuric acid, glucose and
anthrone were of analytical grade. An electric constant-temperature
water bath, electrically heated hot air oven (Shanghai Jing Hong
Experimental Equipment Co., Ltd.), rotary evaporator (Yarong
Biochemical Instrument Factory), recycled water pumps (Instrument
Factory of Yu Gongyi City, China), high-speed centrifuge and UV-
Vis-754 ultraviolet-visible spectrophotometer (Shanghai Precision
Instrument Co., Ltd.) were used.
The process of extraction
Mulberry leaves were subjected to hot water extraction. The
temperature and duration of extraction was investigated in the
single-factor study. The extract thus obtained was filtered using
gauze filters. The filtrate was concentrated under vacuum, and
different volumes of 10% trichloroacetic acid were added to deposit
proteins. Subsequently, alcohol precipitation (using different
concentrations) was carried out, and the precipitate obtained was
redissolved in distilled water, then the polysaccharide content was
determined after the solution was further diluted.
Single-factor experiment
After determining the most appropriate volume of trichloroacetic
acid needed to deposit proteins, we used single factor of different
raw material concentrations, extraction temperatures, extraction
durations, number of extractions and ethanol concentrations, to
examine the effect of each factor on the polysaccharide yield.
Orthogonal experiment
On the basis of the single-factor experiment, an orthogonal array
was adopted to study the effects of the various important factors,
and then the best technological conditions were obtained.
The determination of polysaccharide content
The polysaccharide content was determined by the anthronesulfuric
acid method (Morris 1948). Obtaining the standard curve,
different concentrations of glucose (in the same volume) were taken
Tang et al. 12685
in test tubes, and 0.5 ml of anthrone reagent and 5 ml of
concentrated sulfuric acid were added to these tubes. They were
placed in a boiling water bath for 15 min; then, they were cooled to
room temperature. Distilled water was treated similarly for use as
the blank control. The optical density was determined by colorimetry
at the wavelength of 620 nm. The extinction-concentration
regression equation was Y = 12.688X + 0.0576; the correlation
coefficient for this regression equation was 0.9991.
Before determination of the polysaccharide content in the
sample, 10% trichloroacetic acid was added to the vacuumconcentrated
filtrate for precipitation of proteins. Then, 80% ethanol
was added, and the tubes were left undisturbed overnight. The
tubes were centrifuged, the precipitated pellet was washed with
alcohol and distilled water, made up to a fixed volume with distilled
water, and analyzed using the anthrone colorimetric method to
measure the polysaccharide content in the diluted solution.
RESULTS AND DISCUSSION
The single-factor experiment
Effect of different volumes of trichloroacetic acid on
removal of proteins
Mulberry leaf extract (5 ml) was put in six test tubes, and
the following volumes of 10% trichloroacetic acid were
added to these tubes: 0.0, 0.2, 0.4, 0.6, 0.8 and 1.0 ml,
respectively. After mixing, the tubes were stored for 24 h
at 4°C; later, they were centrifuged at 4000 rpm for 15
min, the supernatant was removed, and the dry deposits
were weighed. The results are shown in Figure 1.
Addition of 0.6 ml of 10% trichloroacetic acid for every 5
ml of extract was considered the optimum.
Effect of different extraction temperatures on the
extraction rate
The extraction temperature has an important effect on the
extraction rate and the costs of the process. 10 g of the
material were taken, and water was added to obtain a
solid : liquid ratio of 1:18. The extraction was carried out
for 60 min at the following temperatures: 60, 70, 75, 80,
85, 90, and 100°C. The concentration of ethanol used for
precipitation was 80%. The results are shown in Figure
2.The results showed that a greater solubility of
polysaccharides was obtained as the temperature
increased from 70 to 80°C, and the extraction rate
decreased when the temperature was above 70°C, with a
gradual leveling off after 80°C. Polysaccharide extracts
from M. alba L. leaves coalesced tightly with the protein,
and contain large quantities of inorganic small molecule
impurities, and high temperature may cause degradation
of the polysaccharides, thus resulting in a decreased
extraction rate (Zhang, 2005). Considering that very high
temperatures may affect the molecular structure and
activity of polysaccharides and easily degrade them, in
addition to vaporization of water at high temperatures,
which is also not conducive for industrial operations, we

12686 Afr. J. Biotechnol.
Precipitation weight (g)
0.060
0.050
0.040
0.030
0.020
0.010
0.000
0.0 0.2 0.4 0.6 0.8 1.0
Volume of TCA (ml/5 ml of extraction)
Figure 1. Effect of different trichloroacetic acid quantities on protein precipitation.
Extraction rate (%)
1.600
1.200
0.800
0.400
0.000
chose the temperature of 70°C for the extraction.
Effect of different extraction durations on extraction
rate
To study the effect of extraction duration on yield, 10 g of
raw material were taken, and the solid : liquid ratio was
set as 1:80. The extraction temperature was 80°C, and
the extraction durations were 30, 45, 60, 75, 90, and 105
60 70 80 90 100
Extraction temperature (°C)
Figure 2. Effect of different extraction temperatures on
extraction rate.
min for a single extraction. Further, 80% ethanol was
added, and polysaccharide analysis was carried out. The
results are shown in Figure 3. Generally, the longer the
extraction duration, the more the dissolved
polysaccharides and the higher was the extraction rate.
There was a significant increase after 75 min, with the
highest rate observed at 90 min, which was followed by a
slight decrease. Therefore, the appropriate duration of
extraction was 90 min.

Extraction rate (%)
1.200
1.000
0.800
0.600
0.400
(%)
0.200
0.000
Effect of different concentrations of the material on
extraction rate
The solid-to-liquid ratio has a major effect on the
extraction rate of polysaccharides. The more the quantity
of water, the more conducive the conditions are for the
spread of the mass of polysaccharides; however,
problems may develop due to the longer time needed for
evaporation of the large quantities of water.
10 g of the material were again taken for determination
of this parameter. The extraction temperature was set at
80°C and extraction was carried out for 60 min. The solidto-liquid
ratios used were 1:12, 1:15, 1:18, 1:21, 1:24 and
1:27 for a single extraction. Subsequently, 80% ethanol
was added, and polysaccharide analysis was carried out,
as described earlier. The results are shown in Figure 4.
The results showed that for the solid-to-liquid ratios in the
range of 1:12 to 1:27, the polysaccharide extraction rate
increased with increase in volume of the solvent.
Between the ratios 1:18 and 1:24, the increase was more
pronounced, with the highest been at the ratio of 1:24,
followed by slow increases. It is certain that in actual
production, too much liquid will not only consume much
more solvent, but also reduce the concentration of
polysaccharides in the follow-up operation and consume
more energy. Therefore, a solid-to-liquid ratio of 1:24 was
considered suitable for the extraction.
30 50 70 90
Extraction time (min)
Figure 3. Effect of different times on extraction rate.
Tang et al. 12687
Effect of number of extraction times on extraction
rate
10 g of material were taken, with solid-to-liquid ratio of
1:80 and extraction was carried out for 60 min at 80°C.
The extract was obtained by repeating the process 1, 2, 3
and 4 times. Later, 80% ethanol was added, and the
extract was analyzed for polysaccharide content. The
results are shown in Figure 5.
The results showed that the polysaccharide content
decreased obviously after a single extraction, whereas, it
decreased to zero at the third extraction. Therefore, to
save more energy and shorten the production period,
extraction of the leaves twice was considered to give
better yields.
Effect of different concentrations of ethanol on
extraction rate
In the process of ethanol precipitation of polysaccharides,
the concentration of ethanol had a great effect on the
polysaccharide yield. According to Figure 6, for
precipitation of polysaccharides, 80% ethanol was the
best.
The result of the single-factor experiment indicated that
the optimum conditions for extraction were a solid-to-

12688 Afr. J. Biotechnol.
Extraction rate (%)
rate
Extraction
1.800
1.500
1.200
0.900
0.600
0.300
0.000
(%)
0.800
0.600
0.400
0.200
(0.200)
1\12
1\15
1\18
1\21
1\24 1\27
1 2 3 4 5 6
Material quality concentration
n
liquid ratio of 1:24 for a period of 90 min at 80°C with an
ethyl alcohol concentration of 80%.
The design of the orthogonal test
Integrating the results from the single-factor test, four
factors influencing the polysaccharide yield greatly were
selected: extraction duration, solid-to-liquid ratio,
Figure 4. Effect of different material quality
concentrations on extraction rate.
0.000
1.0 2.0 3.0 4.0
Extraction times (min)
Figure 5. Effect of different extraction times on
extraction rate.
extraction temperature and ethyl alcohol concentration.
Subsequently, a four-factor and three-level orthogonal
test (Table 1) was designed according to the L9 (3 4 ) table.
The results are shown in Table 2.
From Table 2 which shows the range-analysis results,
the effects of the various factors on polysaccharide yield
are in the following descending order: C > A > D > B, that
is, extraction temperature > extraction duration > ethanol
concentration > solid-to-liquid ratio. According to the

Extraction rate (%)
1.000
0.800
0.600
0.400
0.200
0.000
Table 1. Factors and levels of orthogonal test.
Factor level
40 50 60 70 80 90
Extraction time (min)
(A)
Concentration of ethanol (%)
Figure 6. Effect of different concentration of ethanol on
extraction rate.
Solid to liquid ratio
(B)
Extraction temperature
(C)
Tang et al. 12689
Ethanol concentration (%)
(D)
1 75 1:21 60 70
2 90 1:24 70 80
3 105 1:27 80 90
orthogonal experimental results, the optimum conditions
for extraction of polysaccharides from M. alba L. leaves
showed A2B2C2D3 as the following: a solid-to-liquid liquid
ratio of 1:24, extract for 90 min at 70°C using an ethyl
alcohol concentration of 80%. The highest extraction rate
was 2.64% under optimum conditions.
In comparison with the published papers, there are
some methods for the extraction of polysaccharides. In
the Zhao’s report, material was stirred in 1.0 M NaOH
and the supernatant was obtained by filtration, then the
protein in the supernatant was removed using the Sevag
method (Zhao et al., 2008; Whistler, 1965).
Polysaccharides had been extracted by circumfluence
with methanol or ethyl acetate from sample (Liu et al.,
2007). The defatted figs powder was extracted with water
under ultrasound assistant (Yang et al., 2009). Currently,
some reports have stated that it is difficult to purify
polysaccharides, mainly because the structure of
polysaccharides is complex; further, not enough basic
research has been carried out on polysaccharide
extraction in depth (Yao et al., 2002). In the last century,
some researchers have purified polysaccharides using
natural clarifying agents, including type II ZTCl+I and
chitosan (Yokoyama, 1992). The use of a clarifying agent
is superior to the traditional method which involves water
extraction and alcohol precipitation in the context of
removing impurities such as protein, wax, tannin and
resin, and retaining the effective elements such as
polysaccharides and soluble solids. It has the merits of
high efficiency, low cost, simple operation and good
stability. Of course, the use of clarifying agents affects the
quality and stability of the products to a certain extent.
Therefore, it is suggested that further works should be
performed on the isolation and identification of the key
components from water-soluble polysaccharides of M.
alba L. leaves.
ACKNOWLEDGEMENTS
This work was financially supported by the International
Cooperation Project on Traditional Chinese Medicines,
Ministry of Science and Technology, China (no.
2007DFA40680), Key Technological Item of the

12690 Afr. J. Biotechnol.
Table 2. L9(3 4 ) try scheme and test result.
Test number
(A)
Factor
(B) (C) (D)
Extraction rate (%)
1 1 1 1 1 0.504
2 1 2 2 2 1.144
3 1 3 3 3 1.095
4 2 1 2 3 1.524
5 2 2 3 1 1.499
6 2 3 1 2 0.623
7 3 1 3 2 0.407
8 3 2 1 3 0.875
9 3 3 2 1 0.998
K1 2.744 2.435 2.002 3.002 ∑xi=8.670
K2 3.646 3.518 3.666 2.174 n=9
K3 2.280 2.717 3.002 3.494
X1 0.915 0.812 0.667 1.001
X2 1.215 1.173 1.222 0.725
X3 0.760 0.906 1.001 1.165
R 1.366 1.084 1.664 1.320
S=R 2 /9 0.207 0.130 0.308 0.194
Education Department, Hunan Province, P. R. China
(09A039), the Technological Item of Hunan Province, P.
R. China (06SK3061) and the Youth Grant of Hunan
Agriculture University (10QN20).
REFERENCES
Alamo A, Melnick SJ, Escalon E, Garcia PI Jr, Wnuk SF, Ramachandran
C ( 2004). Immune stimulating properties of a novel polysaccharide
from the medicinal plant Tinospora cordifolia. Int. J.
Immunopharmacol., 4(13): 1645-1659.
Chen FJ, Lu J, Zhang YY (1996). Pharmacological studies on Morus(I):
Deffect of total polysaccharide of Morus(TPM) on carbohydrate
metabolism in diabetic mice. J. Shenyang Pharm. Univ., 13(1): 24-26.
Fang X, Li XY, Chen WP, Jiang ZD, Zhu XR (1999). A mulberry extracts
on hypoglycemic diabetic rats the initial observation. Zhej Med. J.
21(4): 218-230.
Hosseinzadeh H, Sadeghi A (1999). Antihyperglycemic effects of Morus
nigra and Morus alba in mice. Pharm. Pharmacol. Lett., 9(2): 63-65.
Kim JW, Kim SU, Lee HS, Kim I, Ahn MY, Ryu KS (2003). Determination
of 1-deoxynojirimycin in Morus alba L. leaves by derivatation with 9fluorenylmethyl
chloroformate followed by reversed-phase highperformance
chromatography. J. Chromatogr., 1002:93-99
Kodama N, Murata Y, Nanba H (2004). Administration of a
polysaccharide from Grifola frondosa stimulates immune function of
normal mice. J. Med. Food, 7(2):141-145.
Lee Y, Lee DE, Lee HS, Kim KS, Lee WS, Kim SH, Kim MW (2011).
Influence of auxins, cytokinins, and nitrogen on production of rutin
from callus and adventitious roots of the white mulberry tree (Morus
alba L.). Plant Cell Tiss. Organ Cult., 105(1):9-19.
Liu GQ, Zhang KC (2007). Enhancement of polysaccharides production
in Ganoderma lucidum by the addition of ethyl acetate extracts from
Eupolyphaga sinensis and Catharsius molossus. Appl. Microbiol.
Biotechnol., 74(3): 572-577.
Morris DL (1948). Quantitative ditermination of carbohydrates with
Dreywood’s anthrone reagent. Science. 107:254-255.
Whistler LR (1965). Removal of moteln: sevag medical in carbohydrate
chemistry. Academic, New York. pp. 76-82.
Yang XM, Yu W, Ou ZP, Ma HL, Liu WM, Ji XL (2009). Antioxidant and
immunity activity of water extract and crude rolysaccharide from
Ficus carica L. Fruit. Plant Foods Hum. Nutr., 64(2):167-173.
Yatsunami K, Ichida M, Onodera S (2008). The relationship between 1deoxynojirimycin
content and alphaglucosidase inhibitory activity in
leaves of 276 mulberry cultivars (Morus spp.) in Kyoto. Jpn. Nat.
Med., 62(1): 63-66.
Yokoyama T, Setoyama T, Fujita N, Nakajima M, Maki T, Fujii K (1992).
Novel direct hydrogenation process of aromatic carboxylic acids to
the corresponding aldehydes with zirconia catalyst. Appl. Catal A-
Gen. 23(51): 149-161.
Zhang LH (2005). Extraction, Isolation, Purification and Structure Probe
of Polysaccharide from Mulberry Leaves. Tianjin Univ. China Master’s
Full-text Database.
Zhao L, Zhao GH, Du M, Zhao ZD, Xiao LX, Hu XS (2008). Effect of
selenium on increasing free radical scavenging activities of
polysaccharide extracts from a Se-enriched mushroom species of
the genus Ganoderma. Eur. Food Res. Technol., 226(3): 499-505.
Zhao XY, Ding KJ, Hu JW (2008). The study on the plant
polysaccharides. J. Liaoning univ. Med. 10(3): 140-41.

African Journal of Biotechnology Vol. 10(59), pp. 12697-12701, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.164
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effect of sodium hypochlorite on the shear bond
strength of fifth- and seventh-generation adhesives to
coronal dentin
Mohammad Esmaeel Ebrahimi Chaharom, Mehdi Abed Kahnamoii, Soodabeh Kimyai* and
Mohammadreza Hajirahiminejad Moghaddam
Department of Operative Dentistry, Faculty of Dentistry, Tabriz University of Medical Sciences, Tabriz, Iran.
Accepted 2 May, 2011
The aim of this study was to investigate the effect of sodium hypochlorite (NaOCl) on the shear bond
strength of fifth- and seventh- generation adhesive resins to coronal dentin. Thirty human third molars
were selected and sectioned into two halves buccolingually. Sixty samples were randomly divided into
four groups (n = 15). The crowns were separated from the roots. Subsequent to the removal of pulp
tissue, the inner surfaces of tooth crowns were rubbed using 600-grit silicon carbide paper in order to
obtain flat dentin surface. In group 1, Single Bond (the fifth generation adhesive resin) was used. In
group 2, single bond adhesive resin was used subsequent to NaOCl solution application. In groups 3
and 4, the same procedures as described for groups 1 and 2, were repeated respectively, except for the
fact that instead of the fifth generation adhesive resin, the seventh generation adhesive resin (Clearfil
S3 Bond) was used. Subsequent to composite resin placement over dentin surfaces, the samples were
subjected to shear bond strength test. Data were analyzed using ANOVA and Tukey test. The
significance level was set at p

12698 Afr. J. Biotechnol.
microorganisms, dissolution of tissue tags, the removal of
collagen layer and dehydration of dentin (Ozturk and
Ozer, 2004). Various studies have evaluated the effect of
canal irrigation solutions, such as NaOCl, on
endodontically treated teeth which have been restored
using fifth-and sixth-generation dentin-bonding resins
(Ozturk and Ozer, 2004; Nikaido et al., 1999; Morris et
al., 2001; Ari et al., 2003; Hayashi et al., 2005). It has
been reported that the use of 5% NaOCl has a negative
influence on the bond strength of fifth- and sixthgeneration
adhesive resins to the lateral walls of the pulp
chamber (Ozturk and Ozer, 2004; Hayashi et al., 2005;
Fawzi et al., 2010). However, little information is available
about the effect of NaOCl on the restoration of such teeth
with seventh-generation adhesives. The aim of the
present study was to evaluate the effect of NaOCl on the
shear bond strength of a fifth- and seventh-generation
adhesive to coronal dentin.
MATERIALS AND METHODS
Thirty heathy human third molars, which had been extracted at
most, two months before the study, were used in this in vitro study.
On the whole, 60 specimens were prepared because tooth crowns
were divided into two halves in a buccolingual direction. The teeth
were placed in 0.5% chloramines T solution after they were
extracted and kept at 4°C. One week before the laboratory
procedures, the teeth were cleaned of any calculus or soft tissue
remnants and stored in distilled water. The specimens were
randomly divided into four groups of 15.
At first, the crowns were separated from the roots at about 1 mm
apical to cemento-enamel junction (CEJ) using a diamond saw
(Isomet, Buehler, Lake Bluff, USA) in a low-speed straight
handpiece under constant water spray. Then the crowns were
divided in half in a buccolingual direction. After removal of pulp
remnants, the inner surfaces of the crowns were ground to produce
a flat and smooth dentin surface; to this end, 600-grit silicon carbide
abrasive paper was used under constant water spray. After 3
cutting procedures, the diamond saw was replaced by a new one
and a new piece of silicon carbide paper was used for each tooth.
Then the prepared dentin specimens were mounted in self-cured
acrylic resin (Triplex, Ivoclar Vivadent AG, FL-9494
Schaan/Liechtenstein).
In group 1, the exposed dentin surface was etched with 35%
phosphoric acid gel (Scotchbond Etchant, 3M ESPE, St. Paul, MN,
USA) for 15 s; then the surface was rinsed with water spray for 15 s
and dried with a gentle air current in a manner in which the dentin
surface preserved its shiny appearance. Then, the fifth-generation
Single Bond (3M ESPE, St. Paul, MN, USA) adhesive resin was
applied according to manufacturer’s instructions. Z100 composite
resin (3M ESPE, St. Paul, MN, USA) and transparent plastic
cylinders with an inner diameter of 2 mm and a height of 2 mm were
used to produce composite cylinders. The transparent cylinders
were filled with the A1 shade of composite resin and placed on the
prepared dentin surface which had been fixed with a clamp. Then it
was covered with a piece of clear matrix band and pressed with
finger pressure; then extra composite resin was removed with an
explorer. Light-curing was performed with an Astralis 7 light-curing
unit (Ivoclar Vivadent AG, FL-9494 Schaan/Liechtenstein) at a light
intensity of 400 mW/cm 2 , while the tip of the light conductor was
perpendicular to the surface; the exposure time added up to 40 s,
20 s from each direction. The specimens were kept in distilled water
for 24 h at 37°C. Then a thermocycling procedure, consisting of 500
cycles, was carried out at 55 ± 2°C / 5 ± 2°C with a dwell time of 30
s and a transfer time of 10 s. Then the shearing bond strength was
measured using a universal testing machine (Hounsfield Test
Equipment, Model H5K-S, Tinius Olsen Ltd, Surrey, England); a
chisel-shaped blade was placed at tooth-composite interface at a
strain rate of 0.5 mm/min. Shear bond strengths were recorded in
Newton and converted to mega Pascal (MPa).
The procedures in group 2 were similar to those in group 1;
however, in this group before acid application, the exposed dentin
surface was irrigated with 10 ml of 5.25% NaOCl (Merck, Germany)
for 5 min and then rinsed with distilled water for 1 min (Ozturk and
Ozer, 2004).
In groups 3 and 4, the procedures were the same as those in
groups 1 and 2, except for the fact that in these groups seventhgeneration
dentin-bonding resin (Clearfil S3 Bond, Kuraray Medical
Inc., Tokyo, Japan) was used according to manufacturer’s
instructions.
The specimens were evaluated under a stereomicroscope by two
examiners (Nikon, Tokyo, Japan) at magnification of 20× after bond
failure and failure modes were classified as follows (Ozturk and
Ozer, 2004):
1. Adhesive failure: Sound dentin without any traces of composite
restorative material on dentin surface.
2. Cohesive failure: Failure in the bulk of the dentin or the
restorative material.
3. Mixed failure: A combination of adhesive and cohesive failures.
Statistical analysis
Data for shear bond strength were analyzed with one-way ANOVA
and pairwise comparisons were made by Tukey test. Statistical
significance was set at p

Table 1. Mean shear bond strength (MPa) and standard deviations for Single Bond and Clearfil S3 bond.
Type of
pretreatment
Chaharom et al. 12699
Single Bond (fifth-generation adhesive) Clearfil S3 bond (seventh-generation adhesive)
Mean ± SD Minimum Maximum Mean ± SD Minimum Maximum
Without NaOCl 32.38 ± 5.78 23.80 41.70 25.91 ± 5.03 18.80 37.50
With NaOCl 28.12 ± 3.95 23.50 36.21 22.15 ± 3.96 14.90 29.40
Table 2. Mode of failure for adhesive resins.
Type of
pretreatment
Single Bond (fifth-generation adhesive) Clearfil S3 bond (seventh-generation adhesive)
Adhesive Cohesive Mixed Adhesive Cohesive Mixed
Without NaOCl 9 2 4 9 4 2
With NaOCl 10 3 2 11 3 1
fifth- and seventh-generation adhesive resins after the
use of NaOCl (p = 0.245).
Failure mode
Table 2 shows the results of the evaluation of failure
modes of the specimens under a stereomicroscope. As it
can be observed, in all the groups, the majority of the
failures were of the adhesive type.
DISCUSSION
A durable bond between the tooth structure and
composite resin is necessary for the clinical success of
tooth-colored restorations because bond failure at
restoration margins results in the microleakage of oral
liquids and penetration of bacteria, leading to recurrent
caries. Acid etching increases bond strength of
composite resins to enamel. In this technique, after
etching the enamel with phosphoric acid, the resin
penetrates into the etched surfaces and produces
micromechanical retention after curing (Torii et al., 2002).
The formation of a hybrid layer is necessary for dentin
bonding. In total etch systems, at first, the smear layer
which has covered the prepared dentin surface is
removed and the underlying dentin is decalcified. Dentin
decalcification exposes the collagen network. In the next
step, the adhesive resin should completely penetrate into
the exposed collagen network (Torii et al., 2002).
Recent advances in adhesive systems have once again
led to the concept of using the smear layer as a substrate
for bonding. Development of self-etch adhesives has
increased the odds of using the smear layer as a part of
the hybrid layer. The bonding mechanism of self-etch
adhesives is dependent on penetration into the smear
layer, demineralization of the substrate under the smear
layer, penetration of the resin into the demineralized
dentin and finally, the formation of the hybrid layer. This
process preserves the dentin mass and at the same time,
dissolves the hydroxylapatite crystals around the collagen
fibers, allowing the monomers of the adhesive to
penetrate into the periphery of collagen fibers. Dentin
demineralization and monomer penetration occur
simultaneously and there is no need for separate rinsing
and drying steps. Therefore, saving time and better
clinical efficacy are advantages of self-etch adhesive
systems (Erhardt et al., 2004).
Two characteristics of dentin-bonding systems, which
are often evaluated, are bond strength and sealing ability.
An ideal dentin adhesive should have a high bond
strength and should completely prevent microleakage. It
appears high bond strength will decrease microleakage;
however, the relationship between bond strength and
microleakage is not clear cut. Nevertheless, it has been
demonstrated that bond strength is a better determinant
in evaluating the potential of adhesive bonding when
compared to sealing ability (Ozturk and Ozer, 2004).
On the other hand, NaOCl is a non-specific proteolytic
material which can remove organic materials and
magnesium and carbonate ions (Perdigão et al., 2000).
NaOCl is widely used as an intracanal irrigation solution
because of its antimicrobial and tissue dissolving
properties. NaOCl destroys phospholipids and disrupts
cellular metabolism. It has oxidative properties and
deactivates bacterial enzymes and destroys lipids and
fatty acids (Estrela et al., 2002).
The aim of the present study was to evaluate the effect
of NaOCl on shearing bond strength of two fifthgeneration
(Single Bond) and seventh-generation
(Clearfil S3 bond) adhesive systems.
The results of the present study showed that the use of
5.25% NaOCl significantly decreased shearing bond
strength to dentin (p

12700 Afr. J. Biotechnol.
chloride and oxygen; the oxygen released from this
chemical breakdown prevents polymerization of the
adhesive (Rueggeberg and Margeson, 1990). Application
of 10% sodium ascorbate subsequent to the use of
NaOCl significantly increases bond strength of single
bond adhesive to dentin (Vongphan et al., 2005). Since
ascorbic acid and its salts have anti-oxidative properties
(Gutteridge, 1994), it is probable that sodium ascorbate
decreases oxidative potential of NaOCl through reduction
reaction. Sodium ascorbate allows the adhesives to
polymerize and neutralizes the negative effects of NaOCl
in preventing polymerization of adhesive systems (Lai et
al., 2001).
Decrease in bond strength as a result of the use of
NaOCl can also be attributed to damages to the organic
matrix of dentin, especially to collagen fibers (Nikaido et
al., 1999). Approximately 22 wt% of dentin is composed
of organic materials, which predominantly consist of type
I collagen; they have an important role in the mechanical
properties of dentin. NaOCl reacts with amino acids of
dentin proteins and breaks down peptide chains;
therefore, it may change the mechanical properties of
dentin by destroying the organic content of dentin
(Marending et al., 2007). In addition, NaOCl can react
with the amino acids of type I collagen fibers to produce
chloramine. Chloramine is a potent oxidative agent,
which can compete with the free radicals released from
the adhesive as a result of light activation to prematurely
terminate the polymerization reaction (Rueggeberg and
Margeson, 1990).
The results of the present study are consistent with the
results of previous studies (Ozturk and Ozer, 2004;
Nikaido et al., 1999; Perdigão et al., 2000; Lai et al.,
2001). They showed that NaOCl damages the organic
component of dentin; therefore, organic monomers do not
sufficiently penetrate into the demineralized dentin,
resulting in a lack of proper bond strength. They pointed
out that collagen fibers have an important role in the
process of adhesion.
Contrary to the results of the present study, some
studies have reported that NaOCl increases the bond
strength of some adhesive systems (Vargas et al., 1997;
Prati et al., 1999; Saboia et al., 2000; Osorio et al., 2010).
They attributed bond strength increase to the elimination
of collagen layer and concluded that the elimination of
collagen layer is beneficial for a better adhesion in some
systems. The discrepancies in the results of those
studies and the present study might be attributed to
differences in sample preparation methods. In the earliermentioned
studies, the surfaces of the samples were
initially etched with phosphoric acid and then NaOCl was
applied. The use of phosphoric acid eliminated the smear
layer and demineralized dentin; subsequently, collagen
layer was eliminated by NaOCl. The process led to a
better penetration of the adhesive into inter-tubular
dentin. However, in the present study, NaOCl was used
prior to the application of adhesive resins. Furthermore,
the irrigation time of NaOCl can be considered as another
reason for different results. In a study carried out by
Cecchin, NaOCl application was repeated every 5 min for
1 h and this yielded higher microtensile bond strength of
XENO III self-etching adhesive resin to dentin (Cecchin et
al., 2010).
It is suggested that the composite-dentin interface,
produced by different adhesive resins subsequent to
NaOCl pretreatment, evaluated by scanning electron
microscopy in future studies.
According to the results of the present study, there was
no difference in the shearing bond strength of fifth- and
seventh-generation adhesive resins and the use of
NaOCl decreased the shearing bond strength of both
adhesive resins.
ACKNOWLEDGEMENT
The authors extend their sincere appreciation to the office
of the Vice Chancellor for Research, Tabriz University of
Medical Sciences, for financial support of this research.
REFERENCES
Ari H, Yaşar E, Belli S (2003). Effects of NaOCl on bond strengths of
resin cements to root canal dentin. J. Endod. 29(4): 248-251.
Cecchin D, Farina AP, Galafassi D, Barbizam JV, Corona SA, Carlini-
Júnior B (2010). Influence of sodium hypochlorite and EDTA on the
microtensile bond strength of a self-etching adhesive system. J. Appl.
Oral .Sci. 18(4): 385-389.
Erhardt MC, Cavalcante LM, Pimenta LA (2004). Influence of
phosphoric acid pretreatment on self-etching bond strengths. J.
Esthet. Restor. Dent. 16(1): 33-40.
Estrela C, Estrela CR, Barbin EL, Spanó JC, Marchesan MA, Pécora JD
(2002). Mechanism of action of sodium hypochlorite. Braz. Dent. J.
13(2): 113-117.
Fawzi EM, Elkassas DW, Ghoneim AG (2010). Bonding strategies to
pulp chamber dentin treated with different endodontic irrigants:
microshear bond strength testing and SEM analysis. J. Adhes. Dent.
12(1): 63-70.
Gutteridge JM (1994). Biological origin of free radicals, and
mechanisms of antioxidant protection. Chem. Biol. Interact. 91(2-3):
133-140.
Hayashi M, Takahashi Y, Hirai M, Iwami Y, Imazato S, Ebisu S (2005).
Effect of endodontic irrigation on bonding of resin cement to radicular
dentin. Eur. J. Oral. Sci. 113(1): 70-76.
Lai SC, Mak YF, Cheung GS, Osorio R, Toledano M, Carvalho RM, Tay
FR, Pashley DH (2001). Reversal of compromised bonding to
oxidized etched dentin. J. Dent. Res. 80(10): 1919-1924.
Marending M, Luder HU, Brunner TJ, Knecht S, Stark WJ, Zehnder M
(2007). Effect of sodium hypochlorite on human root dentine-mechanical,
chemical and structural evaluation. Int. Endod. J. 40(10):
786-793.
Morris MD, Lee KW, Agee KA, Bouillaguet S, Pashley DH (2001).
Effects of sodium hypochlorite and RC-prep on bond strengths of
resin cement to endodontic surfaces. J. Endod. 27(12): 753-757.
Nikaido T, Takano Y, Sasafuchi Y, Burrow MF, Tagami J (1999). Bond
strengths to endodontically-treated teeth. Am. J. Dent. 12(4): 177-
180.
Osorio R, Osorio E, Aguilera FS, Tay FR, Pinto A, Toledano M (2010).
Influence of application parameters on bond strength of an "all in
one" water-based self-etching primer/adhesive after 6 and 12 months
of water aging. Odontology, 98(2): 117-125.

Ozturk B, Ozer F (2004). Effect of NaOCl on bond strengths of bonding
agents to pulp chamber lateral walls. J. Endod. 30(5): 362-365.
Perdigão J, Lopes M, Geraldeli S, Lopes GC, García-Godoy F (2000).
Effect of a sodium hypochlorite gel on dentin bonding. Dent. Mater.
16(5): 311-323.
Prati C, Chersoni S, Pashley DH (1999). Effect of removal of surface
collagen fibrils on resin-dentin bonding. Dent. Mater. 15(5): 323-331.
Rueggeberg FA, Margeson DH (1990). The effect of oxygen inhibition
on an unfilled/filled composite system. J. Dent. Res. 69(10): 1652-
1658.
Saboia VP, Rodrigues AL, Pimenta LA (2000). Effect of collagen
removal on shear bond strength of two single-bottle adhesive
systems. Oper. Dent. 25(5): 395-400.
Torii Y, Itou K, Nishitani Y, Ishikawa K, Suzuki K (2002). Effect of
phosphoric acid etching prior to self-etching primer application on
adhesion of resin composite to enamel and dentin. Am. J. Dent.
15(5): 305-308.
Van Meerbeek B, Van Landuyt K, De Munck J, Inoue S, Yoshida Y,
Perdigao J, Lambrechts P, Peumans M (2006) Bonding to enamel
and dentin In: Summitt JB, Robbins JW, Hilton TJ, Schwartz RS (eds)
Fundamentals of Operative Dentistry. A Contemporary Approach
Quintessence, China, pp. 183-248.
Chaharom et al. 12701
Vargas MA, Cobb DS, Armstrong SR (1997). Resin-dentin shear bond
strength and interfacial ultrastructure with and without a hybrid layer.
Oper. Dent. 22(4): 159-166.
Vongphan N, Senawongse P, Somsiri W, Harnirattisai C (2005). Effects
of sodium ascorbate on microtensile bond strength of total-etching
adhesive system to NaOCl treated dentine. J. Dent. 33(8): 689-695.

African Journal of Biotechnology Vol. 10(59), pp. 12691-12696, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.2359
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Intracellular expression of human calcitonin (hCT) gene
in the methylotrophic yeast, Pichia pastoris
Ali Salehzadeh 1 *, Hamideh Ofoghi 2 , Farzin Roohvand 3 , Mohammad Reza Aghasadeghi 3
and Kazem Parivar 1
1 Department of Biology, Faculty of Science, Islamic Azad University, Science and Research Branch, Tehran, Iran.
2 Iranian Research Organization for Science and Technology, Tehran, Iran.
3 Hepatitis and AIDS Department, Pasteur Institute of Iran, Tehran, Iran.
Accepted 20 May, 2011
This study utilized the Pichia pastoris expression system for expression of the synthetic human
calcitonin (hCT) gene, a small peptide hormone secreted by the thyroid gland in mammals and
ultimobranchial glands in lower vertebrate. The P. pastoris vector (pPICZB) contains the alcohol
oxidase gene promoter (AOX1), which under the induction of methanol allows for the expression of
heterologous protein gene inserted downstream in the vector. KM71H (mut s ) strain of P. pastoris was
used as the host cell. Molecular analysis, including polymerase chain reaction (PCR), sequencing,
restriction enzyme analysis and survival of P. pastoris to increase concentration of zeocin antibiotic
showed that human calcitonin gene was successfully integrated into the P. pastoris genome. The
expected peptide which had an apparent molecular mass of 5.5 kDa was detected by Tricine-SDS-PAGE
analysis and confirmed by enzyme-linked immunosorbent assay (ELISA).
Key words: Pichia pastoris, human calcitonin, KM71H (mut s ), Tricine-SDS-PAGE.
INTRODUCTION
Calcitonin (CT) is a peptide hormone produced by
specialized C-parafollicular cells of the thyroid glands in
mammals or by cells of the ultimobranchial glands in fish
and reptiles. CT plays an important role in regulating
phosphorus and calcium metabolism, decreasing blood
calcium concentrations and inhibiting bone resorption.
Natural CT and synthesized analog are widely used in
clinical practice for the treatment of postmenopausal
osteoporosis, Paget’s disease of bone, bone pain, spinal
stenosis, acute pancreatitis and gastric ulcer (Li et al.,
2009). Following the increase of the proportion of the
elderly people in the world, osteoporosis has become a
*Corresponding author. E- mail: salehzadehmb@yahoo.com.
Tel: +989126932196.
Abbreviations: CT, Calcitonin; hCT, human calcitonin; SDS-
PAGE, sodium dodecyl sulphate poly acrylamide gel
electrophoresis; PMSF, phenylmethylsulfonyl fluoride.
major threat to the public health due to its high morbidity
and mortality (Lim et al., 2004). Low bone mass and
deterioration of bone micro architecture are the major
characteristics of osteoporosis, which results in increased
bone brittleness and thus is associated with an increased
risk of fracture. CT is one of the effective and safe agents
for the treatment of osteoporosis (Munoz-Torres et al.,
2004). Gills of salmon and pig thyroid glands are the
main source of CT that is used in clinical practice (Tanko
et al., 2004). However, these heterologous products are
short of resources and thus expensive. CT activity is not
species-specific which make it possible to use animal CT
(porcine, salmon and eel) for treatment of human
patients. However, due to immunological reactions, the
prolonged application of animal CT leads to a gradual
decrease or loss of activity. That is why the long term
treatment of human patients with CT requires
homologous human calcitonin (hCT)(Azria 1989). Thus,
genetic engineering techniques with hCT gene as the
target gene may provide solutions to the earlier-
mentioned problem. In this study, we described the

12692 Afr. J. Biotechnol.
construction of a recombinant plasmid including pPICZB
vector and hCT gene for intracellular expression in Pichia
pastoris strain KM71H.
MATERIALS AND METHODS
Strains, plasmids and material
Escherichia coli TOP 10F’ and P. pastoris KM71H (arg4
aox1::ARG4) strains (Invitrogen, USA) were used for plasmid
construction and expression, respectively. Zeocin and pPICZB
expression vector were purchased from Invitrogen. Pfu DNA
polymerase, DNA ladders, T4 DNA ligase and restriction enzymes
was supplied by Fermentas (Lithuania). PCR purification kit was
from Roche (Germany). Plasmid extraction kit was from Bioneer
(Korea). Primers were synthesized by Bioneer and low range
protein molecular weight marker was from Sigma (Germany). PCR-
Script plasmid (Clontech, USA) containing synthetic hCT gene was
used for amplification of hCT gene. All other chemicals and media
components were of analytical grade and obtained from Merck
(Germany).
Construction of the expression vector
The synthesized hCT gene with this sequence 5´-
ATGTGTGGGAATCTGAGTACTTGCATGCTTGGCACATACACCC
AAGATTTCAACAAGTTTCATACTTTTCCACAGACAGCTATTGGT
GTTGGAGCACCTTAA-3´ was used as the template for PCR
amplification with specific primers designed for cloning in pPICZB
vector. The forward primer: 5´-CGGAATTC
ATAATGTGTGGGAATCTGAG-3´ contained an EcoRI restriction
site at the 5´-end (underlined in the primer sequence) and a yeast
consensus sequence (bolded) (Romanos et al., 1992).
The reverse primer: 5´-
GCTCTAGATAAGGTGCTCCAACACCAATAGC-3´ contained an
XbaI restriction site at 5´ end (underlined in the primer sequence).
The forward primer has an ATG initiation codon but the reverse
primer does not have a stop codon. This condition led to an open
reading frame (ORF) starting from ATG to C-terminal myc epitope
tag and C-terminal polyhistidine (6xHis) tag and finally to a stop
codon. After initial denaturation at 94°C for 5 min, hCT gene
amplification was carried out through 33 cycles of denaturation (60
s at 94°C), annealing (60 s at 62°C) and extension (60 s at 72°C),
followed by a final elongation (5 min at 72°C) in a Bio Rad (USA)
thermocycler.
Cloning and transformation
The PCR product was gel-purified and digested with EcoRI and
XbaI before cloning into pPICZB. After transforming into E. coli
Top10, one recombinant plasmid designated as pPICZB_hCT was
selected on a low salt LB agar plate containing 25 µg/ml zeocin.
The insertion was checked by restriction enzyme analysis and
sequencing. The enzyme for restriction analysis was Bgll. The DNA
sequencing primer was designed according to 5' AOX1 priming site
on the pPICZB vector. The sequence was: 5´-
GACTGGTTCCAATTGACAAGC-3´. DNA sequencing was
performed by MWG (Germany).
For P. pastoris integration, 10 µg of recombinant plasmid was
linearized with SacI, and transformed into P. pastoris by
electroporation. For electroporation, linearized recombinant plasmid
was mixed with competent KM71H cells. The mixture was
immediately transferred to a pre-chilled 0.2 cm electroporation
cuvette and incubated on ice for 5 min. About 1 ml of ice-cold 1 M
sorbitol was immediately added to the cuvette after electroporation
on a Gene Pulser (Bio-Rad, USA). The charging voltage,
capacitance and resistance were 1.5 kV, 25 µF and 200 Ω,
respectively. The transformants were selected at 28°C on the
YPDS (1% (w/v) yeast extract, 1 M sorbitol, 2% (w/v) peptone and
2% (w/v) D-glucose) agar plates containing 100 µg/ml zeocin for 3
days. The integration of the hCT gene into the genome of P.
pastoris was confirmed by PCR using 5'AOX1 and 3'AOX1 primers.
DNA extraction from P. pastoris for PCR was done following a
standard protocol. The sequence of 3'AOX1 primers was: 5´-
GCAAATGGCATTCTGACATCC-3´. For screening of multicopy
integration of hCT gene, colonies were grown on 100 µg/ml zeocin
YPDS medium and were transferred to 200 µg/ml, then 500 µg/ml
and finally to 1000 µg/ml zeocin YPDS medium. The clones grown
on 1000 µg/ml zeocin YPDS medium were the multicopy integrants
and selected for expression in KM71H.
Expression of hCT gene in KM71H
P. pastoris transformants were grown on 50 ml of fresh buffered
minimal glycerol complex medium, BMGY (1% (w/v) yeast extract,
2% (w/v) peptone, 100 mM potassium phosphate (pH 6.0), 1.34%
(w/v) YNB, 0.0004% (w/v) biotin and 1% (v/v) glycerol) at 30°C
(approximately 16 to 18 ho in 250 rpm) until an OD600 of 2 to 6
was reached. To induce hCT gene expression in P. pastoris, the
cell pellet was harvested by centrifuging at 1500 to 3000 g for 5 min
at room temperature and was resuspended in buffered minimal
methanol medium, BMMY (1% (w/v) yeast extract, 2% (w/v)
peptone, 100 mM potassium phosphate (pH 6.0), 1.34% (w/v) YNB,
0.0004% (w/v) biotin and 0.5% methanol) using 1/5 volume of the
original culture (10 ml) in a shaking incubator (250 rpm). Absolute
methanol was added every 24 h to a final concentration of 0.5%
(v/v) to maintain induction. The culture pellet was collected after 3
days and stored at -80°C until ready to assay.
Protein extraction and SDS-PAGE
Cell pellets was stored at -80°C, thawed quickly on ice. The
following reagents including 100 µl breaking buffer (50 mM sodium
phosphate (pH 7.4), 1 mM PMSF (phenylmethylsulfonyl fluoride or
other protease inhibitors), 1 mM EDTA and 5% glycerol were added
to 1 ml cell pellet and resuspended. An equal volume of acidwashed
glass beads (size 0.5 mm) was added. The sample was
vortexed for 30 s, and was then incubated on ice for 30 s. This step
was repeated for a total of 8 cycles. The sample was centrifuged at
14000 rpm for 10 min at 4°C. The clear supernatant was transferred
to a new microtube. Electrophoresis was performed using Bio-Rad’s
Mini Protean II Redi-Gel System. The expression of the
recombinant hCT was analyzed by Tricine–SDS-PAGE (15%)
according to the method of Schagger (2006). 5 µl of supernatant
(cell lysate) with 5 µl 2X SDS-PAGE Gel Loading buffer (sample
buffer). was mixed and boiled for 10 min and loaded per well. The
bands were visualized by staining with silver nitrate.
ELISA
ELISA was performed with commercial hCT detection kit (Diasorin,
Italy). Principle of the procedure is two-site immunoluminometric
assay (sandwich principle). Two different highly specific monoclonal
antibodies are used for the coating of the solid phase (magnetic
particles) and for the tracer. This kit is suitable for the quantitative
determination of hCT and have measurement that range from 1.0 to
2000 pg/ml. 75 µl of sample and 75 µl of control were added to 100
µl of tracer in separate vials. The vials were incubated for 10 min at
room temperature and then 20 µl of magnetic particles was added.

EcoRI hCT gene XbaI
The vials were incubated for 10 min at room temperature and
incubation, followed by a wash cycle. The LIAISON ® Analyser
(USA) automatically calculated the hCT concentration in each
sample by means of a calibration curve which is generated by a 2point
calibration master curve procedure. The results are expressed
in pg/ml.
RESULTS
Cloning of hCT gene in pPICZB
For the construction of the pPICZB-hCT recombinant
plasmid, hCT gene from PCR-Script-hCT vector was
subcloned into the pPICZB vector using forward and
reverse primers. No mutations were found in the
nucleotide sequence of the inserted fragment after
sequencing. The mature hCT peptide sequence had an
initiation consensus sequence for expression in P.
pastoris and was inserted in frame with the c-myc epitope
and polyhistidine (Figure 1). The DNA sequence of the
pPICZB-hCT vector predicts that the recombinant protein
will contain 55 amino acids including 32 amino acids in
the mature hCT peptide and the remaining 23 amino
acids comprising the c-myc epitope, and 6XHis tag. The
Figure 1. Schematic representation of hCT gene and pPICZB
vector. hCT gene was cloned between EcoRI and XbaI sites and
is in frame with c- myc epitope and 6XHis tag. The vector has a
strong promoter (AOX1) and a gene for resistance in zeocin
antibiotic.
Salehzadeh et al. 12693
expected molecular weight of the recombinant product is
5.5 kDa.
Molecular analysis of positive clones
After plasmid extraction from E. coli, PCR and restriction
analysis was done for the confirmation of insert
orientation. PCR was done by primers used for cloning.
PCR product was approximately 120 bp equal to hCT
gene size in the PCR-Script-hCT. Since two Bgll
restriction sites are present in the MCS of uncloned
pPICZB, restriction analysis of pPICZB-hCT was done by
Bgll enzyme. The pPICZB control vector produced four
fragment including 1403, 1211, 682 and 32 bp, while the
pPICZB-hCT produced two fragments of 1972 and 1403
bp, which coincided with expectation (Figure 2).
Screening of elecroporated clones and expression of
hCT gene
Approximately, 60 transformants of the KM71 strain were
generated. Forty (40) clones were isolated and screened

12694 Afr. J. Biotechnol.
by PCR with 5'AOX1 and 3'AOX1 primers. Some of the
clones contained the expected 364 bp DNA fragment,
indicating that the hCT gene was integrated into the P.
pastoris genome. These forty clones also were screened
on YPDS medium including 200, 500 and 1000 µg/ml
zeocin. Six clones which were positive in PCR and grown
on 1000 µg/ml zeocin-YPDS medium were selected for
expression on BMMY medium and one was used for
expression. After 3 days, KM71H was harvested and
protein extraction was performed. The recombinant hCT
produced intracellular KM71H. The peptide was analyzed
by Tricine-SDS-PAGE and the band corresponding to the
expected size (5.5 kDa) was visible on the gel. This
protein band was not detected in the control KM71H
sample (Figure 3). The amount of recombinant hCT
which was analyzed by ELISA was 1100 pg/ml.
DISCUSSION
In order to produce recombinant pharmaceutical peptides
and proteins, there is a need to have a set of different
expression systems. Bacteria offer the advantage of high
space-time yields and are favorable with respect to
cultivation costs. However, as the major drawback, posttranslational
modification of peptides or proteins, needed
for human applications, does not occur in bacteria. In the
M 1 2 3
Figure 2. The restriction analysis of pPICZB vector on 1%
agarose gel. M, 1 Kb ladder; 1, pPICZB control; lanes 2 and 3
are positive clone including pPICZB-hCT vector.
last decade, P. pastoris became one of the favorite expression
systems for the production of various proteins of
interest (Macauley et al., 2005). This report describes the
production of hCT in the methylothropic yeast P. pastoris
strains KM71H (Mut s ). The benefits of P. pastoris for
expression of hCT and other protein are abundant. When
compared with mammalian cells, P. pastoris does not
require a complex growth medium or culture con-ditions.
Furthermore, it is particularly suited to foreign protein
expression due to ease of genetic manipulation, example
gene targeting, high-frequency DNA transformation,
cloning by functional complementation, high levels of
protein expression at the intra- or extracellular level, and
the ability to perform higher eukaryotic protein
modifications, such as glycosylation, disulphide bond
formation and proteolytic processing (Cregg et al., 1985).
The glycosylated gene products generally have much
shorter glycosyl chains than those expressed in
Saccharomyces cerevisiae, thus making P. pastoris a
much more attractive host for the expression of human
recombinant proteins (Cereghino et al., 2002). Pichia can
be grown to very high cell densities using minimal media
(Wegner et al., 1990) and integrated vectors contribute to
the genetic stability of the recombinant elements, even in
continuous and large scale fermentation processes
(Romanos, 1995). Therefore, the powerful genetic
techniques available, together with its economic use,

B1 B M
make P. pastoris a system of choice for heterologous
protein expression. Some proteins that cannot be expressed
efficiently in bacteria, S. cerevisiae or the insect
cell/baculovirus system, have been successfully produced
in functionally active form in P. pastoris (Cereghino
et al., 2002).
hCT has been previously expressed in E. coli (Yabuta
et al., 1995), potato (Ofoghi et al., 2000), silkworm (Yang
et al., 2002), insect cells (Yang, 2002), Staphylococcus
carnosus (Dilsen et al., 2000) and NIH3T3 cells (Li et al.,
2009).
Osteoporosis is characterized with low bone mass and
deterioration of bone microarchitecture which can cause
decreased bone strength and an increased risk of
fracture (Lim et al., 2004). Calcitonin is one of the most
effective reagents for osteoporosis with antalgic activities
(Munos et al., 2004). It is believed that salmon calcitonin
can inhibit bone resorption, reduce bone mass loss and
relieve bone pain (Patel et al., 1993). But oral or nasal
administration of salmon calcitonin can cause many side
effects in osteoporosis patients. Otherwise, long-term
application of animal calcitonins leads to a sharp activity
decrease in clinical use of osteoporosis due to the
accumulation of antibodies against these heterologous
26.6 kD
17 kD
14.2 kD
6.5 kD
Figure 3. SDS-PAGE of proteins extracted from
KM71H strain. M, Protein marker; B, KM71H
control; B1, induced sample, the arrow show
expressed hCT gene in KM71H.
Salehzadeh et al. 12695
calcitonins (Merli et al., 1996). With the problems in using
salmon calcitonin, production of hCT in a suitable host
can overcome these problems.
In summary, to our knowledge, for the first time, we
successfully expressed hCT gene in P. pastoris. The
expressed hCT gene was detected by SDS-PAGE and
ELISA but the amount was low and need optimization.
REFERENCES
Azria M (1989). The Calcitonin. Paris: Karger.
Cereghino GP, Cereghino JL (2002). Production of recombinant
proteins in fermenter cultures of the yeast Pichia pastoris. Curr. Opin.
Biotechnol., 13(4): 329-332.
Cregg JM, Barringer KJ, Hessler AY (1985). Pichia pastoris as a host
system for transformations. Mol. Cell Biol., 5(12): 3376-3385.
Dilsen S, Paul W (2000). Fed-batch production of recombinant human
calcitonin precursor fusion proteinusing Staphylococcus carnosus as
an expression-secretion system. Appl. Microbiol. Biotechnol., 54(3):
361-369.
Li X, Jiang G, Wu D, Wang X, Zeng B (2009). Construction of a
recombinant eukaryotic expression plasmid containing human
calcitonin gene and its expression in NIH3T3 cells. J. Biomed.
Biotechnol., 2009: 241390.
Lim LS, Takahashi PY (2004). Osteoporosis intervention in men with hip
fracture. Age Ageing. 33(5): 507-508.

12696 Afr. J. Biotechnol.
Macauley-Patrick S, Fazenda ML, McNeil B, Harvey LM (2005).
Heterologous protein production using the Pichia pastoris expression
system. Yeast, 22: 249-270.
Merli S, De Falco S, Verdoliva A, Tortora M, Villain M, Silvi P, Cassani
G, Fassina G (1996). An expression system for the single-step
production of recombinant human amidated calcitonin. Protein Expr.
Purif., 7(4): 347-354.
Munoz-Torres M, Alonso G, Raya MP (2004). Calcitonin therapy in
osteoporosis. Treat Endocrinol., 3(2): 117-132.
Ofoghi H, Moazami N, Domonsky NN, Ivanov I (2000). Cloning and
expression of human calcitonin gene in transgenic potato plant.
Biotechnol. Letters, 22: 611-615.
Patel S, Lyons A R, Hosking DJ (1993). Drugs used in the treatment of
metabolic bone disease. Clin. Pharmacol. therapeutic use. Drugs,
44(4): 594-617.
Romanos M (1995). Advances in the use of Pichia pastoris for highlevel
gene expression. Curr. Opin. Biotechnol., 6: 527–533.
Romanos MA, Scorer CA, Clare JJ (1992). Foreign Gene Expression in
Yeast: A Review. Yeast, 8:423-488.
Schagger H (2006). Tricine-SDS-PAGE. Nature Protocols, 1(1): 16-22.
Tanko LB, Bagger YZ, Alexandersen P (2004). Safety and efficacy of a
novel salmon calcitonin (sCT) technology-based oral formulation in
healthy postmenopausal women: acute and 3-month effects on
biomarkers of bone turnover. J. Bone Miner. Res., 19(9): 1531-1538
Wegner GH (1990). Emerging applications of the methylotrophic yeasts.
FEMS Microbiol. Rev., 7(3-4): 279-283.
Yabuta M, Suzuki Y, Ohsuye K (1995). High expression of a
recombinant human calcitonin precursor peptide in Escherichia coli.
Appl. Microbiol. Biotechnol., 42(5): 703-708.
Yang GZ (2002). Couple production of human calcitonin and rat
peptidylglicine alpha amidation monooxigenase in insect cells.
Chinese J. Biotechnol., 18(1): 20-40.
Yang GZ, Chen ZZ, Da-fu C, Bo-liang L (2002). Production of
recombinant human calcitonin from silkworm (B. mori) larvae infected
by baculovirus. Protein Pept. Lett., 9(4): 323-329.

African Journal of Biotechnology Vol. 10(59), pp. 12702-12706, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1399
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Biological study of the effect of licorice roots extract on
serum lipid profile, liver enzymes and kidney function
tests in albino mice
Maysoon Mohammad Najeeb Mohammad Saleem 1 , Arieg Abdul Whab Mohammad 1 , Jazaer
Abdulla Al-Tameemi 2 and Ghassan Mohammad Sulaiman 1 *
1 Division of Biotechnology, Department of Applied Science, University of Technology, Baghdad, Iraq.
2 Division of Applied Chemistry, University of Technology, Baghdad, Iraq.
Accepted 29 August, 2011
This study was carried out to elucidate the effects of oral administration of Glycyrrhiza glabra root
extract on serum lipid profile, liver enzymes, kidney function test, and glucose concentration in albino
mice when compared with ten male mice used as control. 40 male mice were treated for one month and
equally allocated into four groups: the first group (G1) was used as the control group. The second (G2),
third (G3) and fourth groups (G4) were treated with 1 ml of 0.2, 0.7 and 1 mg mL -1 day -1 , respectively.
There was statistically high significance difference between treated and untreated groups for all
biochemical parameters, showing a remarkable effect on serum lipid profile, enzymes and kidney
function test. G. glabra root extract at low dose act as anti-lipidaemic agent, has hepatoprotective
activity for liver cell, prevents renal failure and is an anti-hyperglycemic agent.
Key words: Glycyrrhiza glabra, liver enzymes, serum lipid profile, kidney function test, glucose concentration.
INTRODUCTION
Glycyrrhiza glabra (GG) (Licorice or sweet wood,
Fabaceae- Papilionaceae) is a traditional medicinal herb
that grows in various parts of the world and it has
ethnobotanical history. Its roots have some nutritive value
and medicinal properties. The dried roots of this plant
were employed by Iraqi, Egyptian, Chinese, Greek,
Indian, as food and medicinal remedies for thousands of
years (Olukoga and Donaldson, 1998; Ross, 2001)
Phytochemical analysis of G. glabra root extract showed
that it contains saponin, triterpenes (glycyrrhizin,
glycyrrhetinic acid and liquirtic acid), flavoniods (liquirtin,
isoflavonoids and formononetin) and other constituents
such as coumarins, simple sugar and polysaccharide like
starch, pectin, amino acids, tannins, choline, phytosterols,
mineral salts and various other substance (Fukai
et al., 1998).
The more important compounds are glycyrrhizin and
*Corresponding author. E-mail: gmsbiotech@hotmail.com. Tel:
+964 790 2781890.
glycyrrhizic acid, which are believed to be partly
responsible for anti-ulcer, anti-inflammatory, anti- diuretic,
anti-epileptic, anti-hepatotoxic, anti-viral activities, antiallergic
and anti-oxidant property of the plant as well as
their ability to fight low blood pressure (Ross, 2001;
Arystanova et al., 2001; Al Qarawi et al., 2001).
Furthermore, G. glabra extract have been shown to
possess anti-depressant-like, memory enhancing
activities and produce anti-thrombotic effects. On other
hand, the root extracts are reported to exhibit antiangiogenic
activities and radio-protective effects (Vaya et
al., 1997; Belinky et al., 1998). The other important
compound is glabridin, it is the major flavonoid, present
specifically in licorice; it has various physiological
activities such as cytotoxic, anti-tumor promoting, antimicrobial,
estrogenic and anti-proliferative activity against
human breast cancer cells. It also affects melanogensis,
inflammation, low density lipoprotein (LDL) oxidation and
protection of mitochondria functions from oxidative
stresses (Khatta and Simpson, 2010). Glabridin is
reported to be a potent anti-oxidant towards LDL
oxidation (Vaya et al., 1997; Belinky et al., 1998), where-

as isoliquritigenin is known to have vasore-laxant effect,
anti-platelet, anti-viral, estrogenic activity and has
protective potential against cerebral ischemic injury (Zhan
and Yang, 2006).Licorice roots contains flavonoids, which
have lipophilic characteristic and anti-oxidative properties
(Rice-Evans et al., 1996), among several flavonoid and
isoflavan glabridin that protect LDL from oxidation
induced by free radical generating system (Vaya et al.,
1997; Zhan and Yang, 2006). The anti-oxidant activity of
flavonoids is related to their chemical structure (Rice-
Evans et al., 1996). Consumption of polyphenolic
flavonoids in the diet was inversely associated with
morbidity and mortality from coronary heart disease
(Hertog et al., 1993). Polyphenolic flavonoids may
prevent coronary artery disease by reducing plasma
cholesterol levels and their ability to inhibit LDL oxidation
(Fuhrman and Aviram, 2001; Fuhrman et al., 2002). Antihyperlipilaemic
and anti-hypertriglyrceridaemic properties
of G. glabra have also been reported (Sitohy et al., 1991).
The liver damage caused by pathogens as well as
chemical agents is of similar nature and a proper
treatment regime or plan is absent for both. The fact that
reliable liver drugs are explicitly inadequate in allopathic
medicine urged the scientists to explore herbal remedies
(Trivedi and Rawal, 2000). In traditional medical
practices, followed throughout the world, herbs play a
major role in the management of various liver disorders.
Diabetes mellitus is a group of syndromes characterized
by hyperglycemia: altered metabolism of lipids,
carbohydrates and proteins, as well as an increased risk
of complications from vascular diseases (Yoshinari et
al., 2009). The chronic hyperglycemia of diabetes is
associated with long-term damage, dysfunction and
failure of various organs (Lyra et al., 2006).
Phytochemicals isolated from plant sources are used
for the prevention and treatment of several medical
problems including diabetes mellitus (Waltner-Law et al.,
2002). There are more than 800 plant species showing
hypoglycemic activity. The aim of this study was to
demonstrate the effect of biochemical parameters of G.
glabra root extract at three different doses on the serum,
lipid profile, liver enzymes, pancreatic enzyme, kidney
function test and glucose concentration in albino male
mice.
MATERIALS AND METHODS
The roots of G. glabra were purchased from the local herbal
merchandise, Baghdad, Iraq and were air dried, ground to powder
and stored overnight at 4°C.
Extraction
250 g of crushed G. glabra were weighted and added to 500 ml
ethanol (30%) in soxhelate apparatus at 50°C for 60 min, then left
to cool with continuous slow mixing and then the solution was
Saleem et al. 12703
filtered in the rotary evaporator at 60°C until a thick solution was
gotten. After that, the solution was dried in the incubator at 37°C for
one to two days until it became a crushed dried, then it was taken
and stored in the refrigerator at 4°C. The resulted deposit was
dissolved in distilled water to prepare the doses.
Laboratory animals and sample collection
Albino male mice were obtained from the Laboratory Animal
Production Unit of Biotechnology Division, University of Technology.
All mice were kept under constant environmental conditions (24 to
26°C and 55 to 60% humidity) with a 12-hour light/dark cycle. They
were housed in polypropylene cages with wood dust and given free
access to food and tap water ad libitum. The animals were
procured, maintained, and used in accordance with 'Guide for the
Care and Use of Laboratory Animals in Biotechnology Division, and
approved by the University of Technology, Animal Ethical
Committee'. Experimental groups were organized as four groups
that included ten animals each.
The first group (G1) was the control groups which did not receive
the extract. G2, G3 and G4 included the animals which were orally
administered G. glabra root extract at 0.2, 0.7 and 1 mg mL -1 day -1 ,
respectively. At the end of the experiment, after 30 days of
receiving the extract, all the animals were sacrificed and blood
samples were taken by puncture for biochemical analysis of serum,
total cholesterol, triglyceride, high density lipoprotein-cholesterol
(HDL-c), very low density lipoprotein-cholesterol (VLDL-c), low
density lipoprotein-cholesterol (LDL-c), liver enzymes [gamma
glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP)],
pancreatic enzyme amylase, glucose concentration and kidney
function test (urea, uric acid, creatinineconcentrations).
Biochemical assay
Serum cholesterol, triglyceride, HDL, GGT, ALP, amylase, glucose,
urea, uric acid and creatinine levels were measured by
commercially available kits in spectrophotometer.
Statistical analysis
Data were presented as mean ± standard deviation (SD). To get
such data, the individual values were tabulated in a sheet of the
statistical programme GraphPad Prism version 5.01 (GraphPad
software, Inc., La Jolla, CA, USA). The difference between means
was assessed by Duncan's test, in which P ≤ 0.05 was considered
significant.
RESULTS
The result of this present study revealed that oral
administration of G. glabra root extract to the animals for
one month at three different doses, 0.2, 0.7 and 1 mg mL -
1 day -1 show significant decrease in total cholesterol and
triglyceride concentration, and a significant increase in
HDL-c concentration when compared with the untreated
group. Very low density and low density lipoprotein was
markedly reduced in the treated group in comparison with
the untreated, as shown in Table 1 as compared with the
control group values.

12704 Afr. J. Biotechnol.
Table 1. Effect of G. glabra root extract on serum lipid profile in mice (parameters as mean ± SD).
Parameter (mg dL -1)
Dose (mg mL -1 day -1 Control
)
G1 (0.2) G2 (0.7) G3 (1)
Cholesterol 211.10±6.65 A 182.10±5.19 B 166.10±3.81 C 150.40±5.12 D
Triglyceride 153.80±3.29 A 133.60±2.91 B 114.70±5.16 C 90.00±4.10 D
HDL -c 40.70±4.11 A 54.50±3.97 B 63.60±2.71 C 74.70±4.00 D
VLDL-c 30.76±3.45 A 26.72±2.23 B 22.94±2.11 C 18.00±1.24 D
LDL –c 139.64±4.52 A 100.88±3.48 B 79.56±3.78 C 57.7±2.90 D
Different capital letters show significant difference (P ≤ 0.05) between means of rows; HDL, high density lipoprotein; LDL,
low density lipoprotein; VLDL, very low density lipoprotein.
Table 2. Effect of G.glabra root extract on the liver enzymes, pancreatic enzyme and glucose in mice (parameters
as mean ± SD).
Parameter
Dose mg mL -1 day -1
Control G1 (0.2) G2 (0.7) G3 (1)
GGT( UL -1 ) 38.20± 4.61 A 27.60± 1.42 B 19.50± 1.08 C 14.80± 1.31 D
ALP (UL -1 ) 41.60± 2.27 A 37.40 ±1.57 B 28.80± 1.31 C 20.10± 2.13 D
Amylase (UL -1 ) 107.30± 4.52 A 83.30 ± 3.43 B 68.10± 2.64 C 54.30± 3.23 D
Glucose (mg dL -1 ) 77.80±3.61 A 59.10 ± 5.48 B 49.40±3.13 C 34.70± 3.09 D
Different capital letters show significant difference (P ≤ 0.05) between means of rows.
Table 3. Effect of G. glabra root extract on the kidney function tests in mice (parameters as mean ± SD).
Parameter (mg dL -1)
Dose mg mL -1 day -1
Control G1 (0.2) G2 (0.7) G3 (1)
Urea 45.30±3.19 A 34.00±3.23 B 24.90±2.92 C 23.10±2.13 D
Uric acid 5.80±0.78 A 4.50±0.70 B 3.30±0.48 C 1.8±0.63 D
Creatinine 16.10±0.99 A 13.50±0.97 B 9.30±0.82 C 6.90±0.73 D
Different capital letters show significant difference (P ≤ 0.05) between means of rows.
Table 2 demonstrates the effect of oral administration
of G. glabra root extract on liver enzyme (GGT and ALP)
and pancreatic enzyme (amylase); significant reduction
were observed in all these enzymes and a decrease in
glucose concentration was also observed when compared
with the control croup values.
Table 3 illustrates the effect of oral administration of G.
glabra root extract on kidney function test, urea, uric acid
and creatinine concentrations; it shows significant
decrease in the concentration of the treated group when
compared with the control group values.
DISCUSSION
Dyslipidamia, which can range from hypercholesterolemia
to hyperlipoproteinemia, is one of the many
modifiable risk factors for coronary artery disease (CAD),
stroke and peripheral vascular disease (Chong
and Bachenheimer, 2000). High level of total cholesterol
is one of the major risk factors for coronary heart
diseases and it is well known for hyperlipidemia and the
incidence of atherosclerosis and increase in diabetes and
hypertension (Tan et al., 2005). The liver and some other
tissues participate in the uptake, oxidation and metabolic
conversion of free fatty acid, synthesis of cholesterol and
phospholipids and secretion of specific classes of plasma
lipoprotein. Lowering of serum lipid level through dietary
or drug therapy seems to be associated with a decrease
in the risk of vascular disease and related complications.
Though there was a large class of hypolipidemic drugs
used in the treatment, none of the existing ones available
worldwide is fully effective, absolutely safe and free from
side effect (Betteridge, 1997). Hence, efforts are being
made to find out safe and effective agents that may be
beneficial in correcting the lipid metabolism and
preventing cardiac diseases. Among natural materials,
medical plants have been shown to have antihyperlipidemic
properties (Sitohy et al., 1991)
Result of this study reveals that oral administration of

G. glabra root extract at three different doses to the
animals for 30 days caused a significant reduction in
serum total cholesterol and triglyceride as shown in Table
1. This is similar to that reported by others (Waltner-Law
et al., 2002; Shalaby et al., 2004). The authors of
previously mentioned studies attributed the hypocholesterlmic
effect of G. glabra to the presence of certain
isoflavones, which act as anti-oxidants via inhibition of
LDL-cholesterol oxidation and which inhibit the local
mechanism of atherosclerosis. Moreover, it was reported
that the glycosides of G. glabra prevent accumulation of
cholesterol in cells as well as human blood serum
(Nikitina et al., 1995).
The repeated administration of GG ethanolic extract for
a period of 30 days resulted in a significant increase in
HDL-c, when compared with untreated animals. It is well
documented that while low level of HDL-c is indicative of
high risk for coronary artery disease, an increase in HDL
level is considered beneficial. Epidemiological studies
have also shown that high HDL-cholesterol levels could
potentially contribute to anti-atherogenesis, including
inhibition of LDL oxidation to protect the endothelial cells
from the cytotoxic effects of oxidized LDL (Assmann and
Nofer, 2003).
The presented result on LDL-cholesterol and VLDLcholesterol,
showed a significant decrease as shown in
Table 1. A significant decline in plasma LDL-cholesterol
in treated group could be correlated with saponin content
of GG root; saponin enhances the hepatic LDL-receptor
levels, increase hepatic uptake of LDL-cholesterol and
aids its catabolism to bile acid (Venkatesan et al., 2003).
Saponin is known to lower triglyceride by inhibiting
pancreatic lipase activity. Furthermore, the decline in
VLDL cholesterol levels in treated group could be directly
correlated to decline in triglyceride levels of these groups,
as it is well established that VLDL particles are the main
transporters of triglyceride in plasma (Hertog et al.,
1993). Thus, a simultaneous decline in both triglyceride
and VLDL-cholesterol in treated group indicates the
possible effect of saponins, and on the other hand, the
effect of phytosterol content of the root on triglyceride
metabolism through a decreased absorption of dietary
cholesterol (Hertog et al., 1993; Fuhrman and Aviram,
2001).
The presence of phytosterols and saponins in GG root
could be important in cholesterol elimination. Phytosterols
are reported to displace intestinal cholesterol and reduce
cholesterol absorption from intestine (Ikeda and Sugano,
1998). Saponins are capable of precipitating cholesterol
from micelles and interfere with enterohepatic circulation
of bile acids, making it unavailable for intestinal absorption
(Fuhrman et al., 2002). Thus, the presently noted
reduced cholesterol level in dyslipaedmic animals
administered ethanolic extract and its fractions could be
due to both phytoesterol and saponin content of GG root.
The beneficial effect of dietary flavonoid derived from
Saleem et al. 12705
the ethanolic extract of licorice root against atherosclerotic
lesion development in association with inhibitor
of LDL oxidative atherosclerotic mice has been
demonstrated (Fuhrman et al., 2002). Investigation of the
relationship between excretion and liver dysfunction is
important for predicting the pharmacokinetic in patient
with liver dysfunction to avoid drug adverse reaction.
Some of the constituent's plants of the herbal mixture
namely G. glabra are traditionally used and scientifically
proven for the treatment of the liver disorder (Roche and
Samuel, 2008).
There was significant reduction in the levels of liver
enzymes (GGT and ALP) and pancreatic enzyme
amylase and also glucose concentration. This was
observed after treatment of animals with GG extract in
comparison with the untreated animals at all tested
doses. Our results reveal that GG reduced significantly
the level of hepatic enzymes in serum of animals. This
can be explained by hepatoprotective effect of GG by
inhibitory effect on immunomediated cytotoxicity against
the hepatocyte. It has been demonstrated that the root of
GG is a traditional medicine used mainly for the treatment
of peptic ulcer, hepatitis, pulmonary and skin disease,
although the clinical studies suggest that it has several
other useful pharmacological properties like anti-inflammatory,
anti-viral, hepatoprotective and cardio protective
effects. Glycyrrhizinic acid, the major component of
licorice shows hepatoprotective effect by preventing
changes in cell membrane permeability, and increasing
survival rate of hepatocyte (Maurya et al, 2009).
In hyperglycemia, free amino groups of proteins react
slowly with the carbonyl groups of reducing sugars such
as glucose, to yield a Schiff’s-base intermediate (Bucala,
1999). Such alterations in blood glucose level could be
due to the stress of the diabetic injury and this is in
agreement with the reports of others (Fuhrman et al.,
2002; Powell et al., 2005) which shows that diabetes is
one of the metabolic causes of steatosis (the presence of
fat droplets within the hepatocytes). In addition, Kleiner et
al. (2005) emphasized that steatosis could take one of
two forms either as multiple small vesicles (microvesicular)
or a single large vesicle that may cause
ballooning of the hepatocyte (macro-vesicular) so that it
resembles a mature adipocyte.
Our results also showed a significant decrease in the
concentration of urea, uric acid and creatinine after oral
administration of GG extract. This is in agreement with
the reports of others (Fukai et al., 1998) as it has been
reported that anti-nephritis activity of glabradin, a pyranis
of lavan isolated from GG, was evaluated after its oral
administration to mice with glomerular disease, by
measuring urinary protein execration, blood urea nitrogen
and serum creatinine level, which reduced the amount of
the earlier parameters significantly. Glycyrrhizinc acid
exhibit anti-inflammatory activity by inhibitory glucocoticod
metabolism (Sitohy et al., 1991; Fukai et al., 1998).

12706 Afr. J. Biotechnol.
Hyperuricemia is a metabolic disorder which plays an
important role in the development of gout and several
oxidative stress diseases such as cancer and
cardiovascular diseases. Elevated levels of monosodium
urate or uric acid crystals, are deposited on the cartilage
of a specific joint, tendons and surrounding tissues. This
in turn causes an inflammation of these tissues that is
very painful and sensitive. Today, there are a growing
number of scientific studies to support traditional and
natural remedies. Nitric oxide also has been implicated in
both osteoarthritis and rheumatoid arthritis, while studies
show that anti-oxidant scavenge this oxidant and
potentially aid in the treatment or prevention of symptoms
of arthritis (Strazzullo and Puig, 2007).
Conclusion
This study reveals that GG had various effect on mice in
the reduction of serum lipid profile, kidney function and
glucose concentration and has been shown to have
significant free radical quenching effect and potent antioxidant
agents against cardiovascular, kidney and liver
diseases.
REFERENCES
Al Qarawi A, Rahman HA, Mougy SE (2001). Hepatoprotective activity
of Liquorice in rat liver injury models. J. Herb. Sp. Med., 8: 7-14.
Arystanova T , Irismetov M, Sophekova A (2001). Chromatographic
determination of glycyrrhizinic acid in Glycyrrhiza glabra. Preparation.
Chem. Nat. Com., 37: 89-91.
Assmann G, Nofer J (2003). Atheroprotective effects of high-density
lipoproteins. Annu. Rev. Med., 54: 321-341.
Belinky PA, Aviram M, Fuhrman B, Rosenblat M, Vaya J (1998). The
antioxidative effects of the isoflavan glabridin on endogenous
constituents of LDL during its oxidation. Athersclerosis, 137: 49-61.
Betteridge J (1997). Lipid Disorders in Diabetes Mellitus. In: Text Book
of Diabetes, Pickup JC, Williams G (Eds.). Blackwell .Science.
London. pp. 1-35.
Bucala R (1999). Advanced glycosylation end products and diabetic
vascular diseases. In: Oxidative stress and vascular disease, Keaney
Jr. JF Ed. Kluwer Acad. Pub. Dord., pp. 287-303.
Chong PH, Bachenheimer BS (2000). Current, new and future
treatments in dyslipidaemia and atherosclerosis. Drugs, 60: 55-93.
Fuhrman B, Aviram M (2001). Flavonoieaseds protect LDL from
oxidation and attenuate atherosclerosis. Curr. Opin. Lipidol., 12: 41-
48.
Fuhrman B, Volkova N, Kaplan M, Presser D, Attias J, Hayek T, Aviram
M (2002). Antiatherosclerotic effect of licorice extract
supplementation on hypercholesterolemic pateints: Increased
resistance of LDL to atherogenic modifications reduced plasma lipid
levels and decreased systolic blood pressure. Nutrition, 18: 268-273.
Fukai T, Baosheng C, Maruno K, Migakawa Y, Konoshi M (1998). An
isopernylated flavonone from Glycyrrhiza glabra and re-assay of
liquorice phenols. Phytochemistry, 49: 2005-2013.
Hertog MG, Feskens EJ, Hollman PC, Katan MB, Kromhout D (1993).
Dietary antioxidant flavonoids and risk of coronary heart disease the
Zutphen. Lancet., 342: 1007-1011.
Ikeda I, Sugano M (1998). Inhibition of cholesterol absorption by plant
sterols for mass intervention. Curr. Opin. Lipidol. 9: 527-531.
Khatta KF, Simpson TJ (2010). Effect of gamma irradiation on the
antimicrobial and free radical scavenging activities of glycyrrhiza
glabra root. Radiat. Phys. Chem., 79: 507-512.
Kleiner DE, Brunt EM, Natta MV, Behling C, Contos MJ,Cummings
OW, Ferrell LD, Liu Y C, Torbenson MS, Unalp-Arida A, Yeh M,
McCullough AJ, Sanyal AJ (2005). Design and validationof a
histological scoring system for nonalcoholicfatty liver disease.
Hepatology, 41: 1313-1321.
Lyra R, Oliveira M, Lins D, Cavalcanti N (2006). Prevention of type 2
diabetes mellitus. Arq. Bras. Endocrinol. Metabol., 50: 239-249.
Maurya SK, Raj K, Srivastava AK (2009). Antidyslipidaemic activity of
glycyrrhiza glabra in high fructose diet induced dyslipidaemic Syrian
golden hamsters. Indian J. Clinc. Biochem. 24: 404-409.
Nikitina NA, Khalilov EM, Torkhovskaia TI, Tertov VV, Orekhov AN
(1995). Decrease in atherogenicity of blood serum in vitro under the
effect of polyunsaturated phosphatidylcholine micelles (In Russian).
Biull. Eksp. Biol. Med., 119: 497-501.
Olukoga A, Donaldson, D (1998). Historical perspectives on health, the
history of Licorice: The plant, its extract, cultivation. J. R. Sco. Health,
118: 300-304.
Powell EE, Jonsson JR, Clouston AD (2005). Steatosis: Co-factor in
other liver diseases. Hepatology, 42: 5-13.
Rice-Evans CA, Miller NJ, Paganga G, (1996). Structure antioxidant
activity relationship of flavonoids and phenolic acids. Free radical.
Biol. Med., 20: 933-956.
Roche B, Samuel D (2008). Liver transplantation in viral hepatitis:
Prevention of recurrence. Best pract. Res. Clin. Gastroen., 22: 1153-
1169.
Ross IA (2001). Glycyrrhiza glabra. Medicinal plants of the world.
Chemical constituents, traditional and modern medicinal uses,
Humana Press, Totowa, N. J., 2: 191–240.
Shalaby MA, Ibrahim HS, Mahmoud EM, Mahmoud AF (2004). Some
effects of glycyrrhiza glabra (licorice) roots extract on male rats.
Egyptian J. Nat. Toxins., 1: 83-94.
Sitohy MZ, El Massry RA, El Saadany SS, Labib SM (1991). Metabolic
effect of licorice root (glycyrrhiza glabra) on lipid distribution pattern
liver and renal functions of albino rats. Food Nahrung. 35: 799-806.
Strazzullo P, Puig JG (2007). Uric acid and oxidative stress: Relative
impact on cardiovascular risk. Nutr. Metab. Cardiovasc. Dis., 17: 409-
414.
Tan BK, Tan CH, Pushparaj PN (2005). Anti-diabetic activity of the
semi-purified fractions of Averrhoa bilimbi in high fat diet fedstreptozotocin-induced
diabetic rats. Life Sci., 76: 2827-2839.
Trivedi N, Rawal UM (2000). Hepatoprotective and toxicological
evaluation of Androgrphis paniculata on severe liver damage. Ind. J.
Pharmacol., 32: 288-293.
Vaya J, Belinky PA, Aviram M (1997). Antioxidant constituents from
licorice roots: Isolation, structure elucidation and anti oxidative
capacity toward LDL oxidation. Free radical Biol. Med., 23: 302-313.
Venkatesan N, Devaraj SN, Devaraj H (2003). Increased binding of LDL
and VLDL to apo B, E receptors of hepatic plasma membrane of rats
treated with Fibernat. Eur. J. Nutr., 42: 262-271.
Waltner-Law ME, Wang XL, Law BK, Hall RK, Nawano M, Granner DK
(2002). Epigallocatechingallate, a constituent of green tea, represses
hepaticglucose production. J. Biol. Chem., 277: 34933-34940.
Yoshinari O, Sato H, Igarashi K (2009). Antidiabetic effect of pumpkin
and its components, trigonielline and nicotinic acid, on Goto-Kakizaki
rats. Biosci. Biotechnol. Biochem., 73: 1033-1041.
Zhan C, Yang J, (2006). Protective effects of isoliquiritigenin in transient
middle cerebral artery occlusion-induced focal cerebral isachemia in
rats. Pharmacol. Res., 53: 303-309.

African Journal of Biotechnology Vol. 10(59), pp. 12707-12710, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Assessment of immune response and safety of two
recombinant hepatitis B vaccines in healthy infants in
India
Ashok, G. 1 , Rajendran, P. 1 *, Jayam, S. 2 , Karthika, R. 2 , Kanthesh, B. M. 1 , Vikram, Reddy, E. 1 ,
and Kulkarni, P. S 3
1 Department of Microbiology, Dr ALM PG Institute of Basic Medical Sciences, University of Madras, Taramani, Chennai-
600 113, India.
2 Paediatric ward, Vijaya Health Centre, Chennai- 600 008, India.
3 Serum Institute of India Ltd, 212/2, Hadapsar, Pune-411028, India.
Accepted 1 June, 2011
Hepatitis B infection and its sequel continue to be a worldwide health problem, especially in the
developing countries. The pool of chronic carriers of hepatitis B virus is built up in childhood and is
then maintained in older children and adults. Therefore, it is important to give protection during infancy.
Effective vaccines to prevent hepatitis B infection are available. This study was undertaken to evaluate
the immune response and reactogenicity of two recombinant hepatitis B vaccines available in Indian
market, in normal healthy infants. Infants of 6-8 weeks of age were screened for eligibility criteria. All
the eligible subjects had negative baseline serum HBsAg and anti-HBs. The subjects received three
doses of 10 µg of Gene Vac-B or Engerix-B at 6, 10 and 14 weeks of age. GeneVac-B is an indigenously
manufactured vaccine, while Engerix-B is an imported vaccine. The vaccinees were assessed for
immune response and safety parameters. The anti-HBs antibody titer was obtained 1 month after 3 rd
dose of vaccine and was considered seroconverted if more than 1 mIU/ml, and seroprotective if more
than 10 mIU/ml. Total of 126 subjects were considered for analysis. One month after 3 rd dose,
seroconversion was 100% for both the vaccines and seroprotection was 94.36% for Gene Vac-B, and
92.72% for Engerix B. The GMT of anti- HBs antibodies were 149.47 mIU/ml for Gene Vac- B and 153.28
mIU/ml for Engerix B. Four cases of incessant cry were observed during the study period. The
indigenous vaccine, Gene Vac-B and the imported vaccine, Engerix-B showed high immunogenicity and
safety profile in Indian infant population. Both vaccines were comparable.
Key words: Hepatitis-B vaccine, gene vac-B, infants, immunogenicity, reactogenicity.
INTRODUCTION
Hepatitis B virus (HBV) infection and its sequel continue
to be a worldwide health problem, especially in the
developing countries. HBV is acquired primarily by
parenteral routes (WHO, 2004). The younger the age of
the infection, the higher the chances of becoming a
chronic carrier. Infection acquired during infancy is rarely
cleared up, and more than 90% of infected infants
develop chronic infection. In this case, the signs and
*Corresponding author. E-mail: rajendranparam@hotmail.com.
Tel: 044-24725617 or 044-24725617. Fax: 91-44-24926709.
symptoms may not be evident for many years and may
end up with chronic liver diseases later in life (WHO,
2004; McMahon et al., 1985).
In India, overall prevalence of hepatitis-B is 2.4%
(Batham et al., 2007). Community studies indicate that
about 3 to 5% of children below 5 years of age are
carriers of HBsAg with horizontal transmissions playing
an important role (Lodha et al., 2001). It is also revealed
that the pool of chronic carriers of hepatitis B virus is built
up in childhood and is then maintained in older children
and adults (Singh et al., 2000). Despite the introduction of
hepatitis B vaccines in the immunization schedule for
many years in India, drastic reduction in the prevalence

12708 Afr. J. Biotechnol.
rate has not yet been achieved because it may take
decades to achieve the same as the Hepatitis B virus has
penetrated deeply the population both horizontally and
vertically.
All these issues highlight the need of completing hepatitis
B immunization during infancy. The Indian Academy
of Pediatric (IAP) has recommended HBV vaccination in
Indian infant population in line with the recommendation
of the World Health organization (WHO) (IAP guidebook
on Immunization, 2007).
Serum Institute of India Ltd., Pune, India has developed
an indigenous recombinant vaccine; Gene Vac-B which
was licensed in 2001. The vaccine provides adequate
protection against HBV in adults (Vijayakumar et al.,
2004; Kulkarni et al., 2006), adolescents (Vijayakumar et
al., 2004; Kakrani et al., 2003), and infants (Shivananda
et al., 2006; Sapru et al., 2007). However, more information
on the uniformity of the vaccine induced seroconversion
efficiency of the vaccine is needed for every
state of India. Therefore, this study was undertaken to
evaluate further the immune response and reactogenicity
of Gene Vac-B in comparison with Engerix-B
(GlaxoSmithKline Beecham) in normal healthy infants
from the city of Chennai in the state of Tamilnadu, when
given at 6, 10 and 14 weeks of age.
MATERIALS AND METHODS
Study design
This was an open label, prospective study in healthy infants of 6 to
8 weeks of age. The study was conducted at Sahishnatha Vijaya
Institute of Child Health, Vijaya Health Centre, Chennai, from
December 2004 to June 2006. Parents of the infants were fully
informed about the study, and written informed consent was
obtained before subject participation. Total of 204 subjects were
screened for eligibility criteria. The study protocol was approved by
the institutional ethics committees of Dr. ALM Post Graduate
Institute of Basic Medical Science, University of Madras, Taramani,
Chennai, India, and Sahishnatha Vijaya Institute of Child Health,
Vijaya Health Centre, Chennai.
Study vaccines
The recombinant vaccine, Gene Vac-B was derived from Hansenula
polymorpha (yeast) with aluminum hydroxide (≤1.25 mg) as
adsorbent and thiomersal (0.01) as preservative. The dose of
vaccine was 0.5 ml (10 µg). The vaccine (Batch No: S-50313, MFG
date: Dec-2004, expiry date: April 2006) was provided by the
Serum Institute of India limited, Pune.
Engerix- B vaccine (Batch No: AhBv B 035AA, MFG date:
February-2004, expiry date: January 2007) was used to compare
the efficacy of Gene Vac-B Vaccine. It is derived from the yeast
Saccharomyces cerevisiae with same adsorbent and preservative.
Vaccines were administered intramuscularly in the antero-lateral
region of thigh by paramedical personnel.
Study population
The healthy infants of 6 to 8 weeks of age, of both sex, and whose
parents gave the written informed consent were included in the
study. The exclusion criteria were acute febrile illness, any other
infection, evidence of skin disease, conditions associated with
immunosuppression, infants receiving immunosuppressive therapy,
previous hepatitis B vaccination, hypersensitivity to any component
of vaccine, presence of HBsAg or Anti-HBs antibody and
participation in any other clinical trial one month before and during
the course of study.
Methodology
After signing the informed consent, medical history was taken from
parents and infants were subjected to clinical examination. Blood
samples were collected by paramedical personnel before the
vaccination for HBsAg, and anti-HBs antibodies. The subjects were
vaccinated with 0.5 ml of either Gene Vac- B or Engerix-B by simple
randomization at 6, 10 and 14 weeks of age along with DTP
vaccine.
The subjects were followed till 1 month after 3 rd dose. Medical
history and physical examination were conducted in all four visits.
The parents were informed to carefully monitor the child for any
adverse events and communicate to the pediatricians immediately.
The blood samples were again collected one month after 3 rd dose
for serum anti-HBs antibodies.
Serology
All serum samples from the vaccinees were assayed for the
quantitative levels of anti HBsAg antibodies using Diasorin anti-HBs
3.0 kits. The anti-HBs standards, supplied by M/s Sanofi Pasteur,
France were used to develop the calibrated linear graph by the
software installed in the ELISA reader- Biotech model ELx 800. A
titre of ≥ 1 IU/ml was interpreted as seroconversion and a titer ≥ 10
IU/ml was considered as seroprotection.
Geometric mean titres (GMT) of anti HBs were calculated by
taking anti-log of mean of log transformed anti-HBs antibody
concentrations. Proportion of seroconversion and seroprotection in
percentages were compared between groups using Fisher’s exact
test. GMT of anti HBs antibodies were compared between groups
using Mann-Whitney test. Seroconversion and seroprotection rates
between males and females of both groups were also tested by
Fisher’s exact test. GMTs between males and females were tested
by Mann-Whitney test in both the groups. P value (≤ 0.05) was
considered statistically significant.
RESULTS
A total of 204 normal healthy subjects were screened for
eligibility criteria. 24 children (HBsAg positive -7, anti-HBs
antibody -17) were found to be screening failure. 54
subjects failed to report on follow up visit. Therefore, a
total of 126 subjects were considered for final analysis,
wherein, 71 subjects had received Gene Vac-B vaccine
and 55 subjects received Engerix-B vaccine. 52% were
male in Gene Vac-B group and 61% in Engerix-B group.
The percentages of post-vaccination seroconversion
were 100% in both vaccine groups. Similarly, the percentages
of post-vaccination seroprotection were 94.36 and
92.72% in Gene Vac-B and Engerix-B group respectively
(Table 1). The difference was not statistically significant
(P > 0.05). GMT of anti HBs antibody in Gene Vac-B

Table 1. Immune response of the Gene Vac-B ® and the Engerix-B ® vaccine recipients 1 month after 3 rd
dose.
Parameter Group I: Gene Vac-B (n = 71) Group II : Engerix-B (n=55)
Seroconversion (N & %) 71 (100%) * 55 (100%)
Seroprotection (N & %) 67 (94.36%) * 51 (92.72%)
GMT (mIU/ml) 149.47 * 153.28
GSD (mIU/ml) ** 3.6940 3.3189
95% Confidence Interval 109.69- 203.65 110.84 -211.98
*: not significant (p ≥ 0.05); **: GSD, antilog of standard deviation of log-transformed titres.
Table 2. Gender wise analysis of immunogenicity of the two vaccines tested.
Ashok et al. 12709
Parameter
Group I: Gene Vac-B
Male (n = 37) Female (n = 34)
Group II: Engerix-B
Male (n = 34) Female (n = 21)
Seroconversion 100 % 100 % 100 % 100 %
Seroprotection 97.29 % 91.17 % 94.17 % 90.47 %
GMT (mIU/ml) 122.80 185.13 161.17 141.31
GSD (mIU/ml) * 4.12 3.17 2.69 4.48
95% Confidence Interval 76.52-197.01 123.65-277.14 114.02-178.8 71.38- 279.38
*GSD, antilog of standard deviation of log-transformed titres.
group was 149.47 mIU/ml and that of Engerix-B group
was 153.28 mIU/ml and was comparable in both vaccine
groups (Table 1).
Gender wise analysis of serological results is given in
Table 2. The seroconversion and seroprotection were
similar in both genders in the vaccine groups. Similarly,
there was no difference in the GMTs induced by both the
vaccines on the basis of gender.
Table 3 shows distribution of subjects in both the
groups according to antibody levels. Titres ranging from 5
to 1400 mIU/ml were seen in both groups, and the
number of children showing different titration levels are
almost the same in both groups. Incessant cry was the
only adverse event reported during the study, which was
observed in 2 subjects from each group after receiving 1 st
dose of the study vaccines. No serious adverse event
was reported during the study period.
DISCUSSION
WHO recommends three-dose schedules of hepatitis-B
vaccine during infancy in all the countries (WHO, 2004).
This is especially relevant in India where the disease is
highly endemic. The three doses regime at 6, 10, and 14
week is commonly practiced in India since it coincides
with DTP and Oral polio vaccines. Naturally this schedule
increases the compliance.
When administered in the complete series of 3 doses,
10 µg dose of hepatitis B vaccine usually gives protection
to >95% of infants. Engerix-B induced a seroconversion
of 98.5% when administered at 2, 4 and 6 months of
age (Goldfarb et al., 1996). When administered to infants
of 0, 1, and 6 months of age, Engerix-B showed 96%
seroprotection (Goldfarb et al., 1994). Recombivax of
Merck protected 99% of infants when administered at 2,
4, and 6 months of age (Greenberg et al., 1996). Another
Indian vaccine, Shanvac-B, is also equally protective
when administered in infants of 6, 10, 14 weeks of age
(Velu et al., 2007).
Similarly, Gene Vac-B has shown high immunogenicity
in earlier studies conducted in infant population.
Shivananda et al. (2006) reported 96% seroprotection
with GeneVac-B. Sapru et al. (2007) also found comparable
results, wherein the first dose of Gene Vac-B was
given at birth and second and third dose at 6, and 14
weeks. In another study involving high risk newborn
infants born to hepatitis B surface antigen (HBsAg)
positive mothers, Gene Vac-B was compared with
Engerix-B and Shanvac-B. All infants were seroprotected
for 1 year; irrespective of the vaccine they received (Velu
et al., 2007).
The results of this study are in line with published
literature on GeneVac-B and other recombinant hepatitis-
B vaccines. Again, Gene Vac-B vaccine was found to be
highly immunogenic. The seroconversion, seroprotection
and GMT of anti HBs antibodies were comparable to
those with Engerix-B.
When compared with different immunization schedules
(0, 1 and 6 months 13 and 2, 4 and 6 months) (Goldfarb et
al., 1994) evaluated in other clinical studies in infant
population, vaccination schedule of 6, 10, 14 wks
provides comparable immune response with added
advantage of compliance of the subjects. One of the risk

12710 Afr. J. Biotechnol.
Table3. Anti-HBs antibody titre in infants one month after 3 rd dose.
Antibody titre (mIU/ml) Group I: Gene Vac-B (n=71) Group II: Engerix-B (n=55)
0-10 4 (5.6 %) 4 (7.3 %)
11-100 32 (45.1 %) 20 (36.4 %)
101-500 24 (33.8 %) 25 (45.5 %)
501-1000 10 (14.1 %) 4 (7.3 %)
>1000 1 (1.4 %) 2 (3.6 %)
Total 71 (100 %) 55 (100%)
factors associated with non-response to hepatitis B
vaccine is supposed to be male gender (Kubba et al.,
2003). However, this was not evident in our study.
Seroconversion, seroprotection and GMT were similar in
male and female infants with both the vaccines.
The distribution of subjects in both the groups
according to antibody levels was also assessed. The
distribution in various ranges seemed to be comparable
in both the groups, with a majority falling above 100
mIU/ml titres.
Hepatitis B vaccines are considered one of the safest
vaccines and serious adverse events are exceedingly
rare (Plotkin and Orenstein, 1999). We found no
difference in reactogenicity profile between the two
vaccines. Incessant cry was reported in both vaccine
groups. Both the study vaccines were very safe.
To conclude, the new Indian vaccine; Gene Vac-B is as
immunogenic and safe as Engerix-B in infants. Moreover,
there is an added advantage of cost effectiveness (IDR
triple I, 2007). It is note worthy that China has brought
down the HBV prevalence rate to 2.1% among all
children and in 1.0% among children born after 1999
(Xiaofent et al., 2009).
ACKNOWLEDGEMENT
The Authors thank Prajakt J. Barde, Asst. Medical
Director, Serum Institute of India, Pune, for reviewing the
manuscript.
REFERENCES
WHO Position Paper. Hepatitis B vaccines (2004). Wkly Epidemiol.
Rec. 79(28): 255-263.
McMahon BJ, Alward WL, Hall DB, Heyward WL, Bender TR, Francis
DP, Maynard JE (1985). Acute hepatitis B virus infection: relation of
age to the clinical expression of disease and subsequent
development of the carrier state. J. Infect. Dis., 151(4): 599-603.
Batham A, Narula D, Toteja T, Sreenivas V, Puliyel JM(2007).
Sytematic Review and meta analysis of Prevalence of Hepatitis B in
India. Indian Pediatr. 44(9): 663-675.
Lodha R, Jain Y, Anand K, Kabra SK, Pandav CS (2001). Hepatitis B in
India: a review of disease epidemiology. Indian Pediatr. 38(4): 349-
371.
Singh J, Bhatia R, Khare S, Patnaik SK, Biswas S, Lal S, Jain DC,
Sokhey J (2000). Community studies on prevalence of HBsAg in
two urban populations of southern India. Indian Pediatr. 37(2):149-
152.
Hepatitis B (2007). Vaccine. IAP guidebook on Immunization
http://www.iapindia.org.
Vijayakumar V, Hari R, Parthiban R, Mehta J, Thyagarajan SP (2004).
Evaluation of immunogenicity and safety of Gene Vac-B: A new
recombinant hepatitis b vaccine in comparison with Engerix B and
Shanvac B in healthy adults. Ind. J. Med. Microbiol. 22(1):34-38.
Kulkarni PS, Raut SK, Phadke MA, Patki PS, Jadhav SS, Kapre SV,
Dhorje SP, Godse SR (2006). Immunogenicity of a new, low-cost
recombinant hepatitis B vaccine derived from Hansenula
polymorpha in adults. Vaccine, Apr 24; 24(17): 3457-3460.
Vijayakumar V, Shraddha M, Subhadra N, Saravanan S, Sundararajan
T, Thyagarajan SP (2004). Immunogenicity and safety of 10 mg and
20 mg doses of Gene Vac-B, a recombinant hepatitis B vaccine, in
healthy adolescents. Indian J. Gastroenterol. 23(1): 34-35.
Kakrani AL, Bharadwaj R, Karmarkar A, Joshi S, Yadav S, Bhardwaj S,
Kulkarni P, Kulkarni S (2003). Immune responses induced by two
dose strengths of an yeast-derived recombinant hepatitis B vaccine
in adolescents. Indian J. Gastroenterol. 22(2): 71-72.
Shivananda VS, Srikanth BS, Mohan M, Kulkarni PS (2006).
Comparison of two hepatitis B vaccines (GeneVac-B and Engerix-B)
in healthy infants in India. Clin. Vaccine, Immunol.13(6): 661-664.
Sapru A, Kulkarni PS, Bhave S, Bavdekar A, Naik SS, N Pandit AN
(2007). Immunogenicity and Reactogenicity of Two Recombinant
Hepatitis B Vaccines in Small Infants: A Randomized, Double-Blind
Comparative Study. J. Trop. Pediatr. 53(5):303-307.
Goldfarb J, Medendorp SV, Garcia H, Nagamori K, Rathfon H, Krause
D (1996). Comparison study of the immunogenicity and safety of 5-
and 10-microgram dosages of a recombinant hepatitis B vaccine in
healthy infants. Pediatr. Infect. Dis. J. 15(9): 764-767.
Goldfarb J, Baley J, Medendorp SV, Seto D, Garcia H, Toy P, Watson
B, Gooch MW, Krause D (1994). Comparative study of the
immunogenicity and safety of two dosing schedules of Engerix-B
hepatitis B vaccine in neonates. Pediatr. Infect. Dis. J. 13 (1): 18-22.
Greenberg DP, Vadheim CM, Wrong VK, Marcy SM, Partridge S.,
Greene T, Chiu CY, Margolis HS and Ward JI(1996). Comparative
safety and immunogenicity of two recombinant Hepatitis B vaccines
given to infants at two, four and six months of age. Pediatr. Infect.
Dis.15; 590-596.
Velu V, Nandakumar S, Shanmugam S, Jadhav SS, Kulkarni PS,
Thyagarajan SP (2007). Comparison of three different recombinant
hepatitis B vaccines: Gene Vac-B, Engerix B and Shanvac B in high
risk infants born to HBsAg positive mothers in India. World J.
Gastroenterol. 13(22): 3084-3089.
Kubba AK, Taylor P, Graneek B, Strobel S (2003). Non-responders to
hepatitis B vaccination: a review. Commun. Dis. Public Health,
6(2):106-112.
Plotkin SA, Orenstein WA (1999). Vaccines. 3rd ed. Philadelphia:
Saunders. p. 173.
IDR triple I (2007). Pharmacy Compendium. 371.
Xiaofent Liang, Shengli Bi, Weizhong Yong et al (2009).Evaluation of
impact of Hepatitis B vaccination among children born during 1992-
2005 in China. J. Infect. Dis., 200: 39-47.

African Journal of Biotechnology Vol. 10(59), pp. 12711-12716, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.363
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Differential expression of cytochrome P450 genes in a
laboratory selected Anopheles arabiensis colony
Givemore Munhenga 1,2 and Lizette L. Koekemoer 1,3 *
1 Vector Control Reference Unit , National Institute for Communicable Diseases, NHLS, Private Bag X4, Sandringham,
Johannesburg 2131, South Africa.
2 School of Animal, Plant and Environmental Sciences, University of the Witwatersrand, Johannesburg, South Africa.
3 Malaria Entomology Research Unit, School of Pathology, Faculty of Health Sciences, University of the Witwatersrand,
Johannesburg, South Africa.
Accepted 22 August, 2011
In southern Africa pyrethroid, resistance in Anopheles arabiensis is mainly mediated by cytochrome
P450s. The spectra of P450 genes involved are not fully understood. We report on the transcriptional
profile of six P450 genes previously implicated in pyrethroid resistance from a laboratory selected
permethrin-resistance. Quantification of expression levels of CYP6Z1, CYP6Z2, CYP6Z3, CYP6M2,
CYP6P3 and CYP4G16 was performed using qPCR from a susceptible and permethrin resistant selected
colony. CYP6Z1, CYP6Z2 and CYP6M2 were significantly up-regulated in the selected colony with a
relative fold over expression of 4.7, 1.7 and 1.4 respectively. Increase in expression levels of three
genes in the selected strains suggests their roles in permethrin metabolism. These results provide
useful information on future studies to develop new insecticides and tools for detecting and managing
insecticide resistance.
Key words: KwaZulu-Natal, Anopheles arabiensis, pyrethroid resistance, cytochrome P450, synergist
INTRODUCTION
Anopheles arabiensis remains a very important malaria
vector in countries experiencing hot and dry weather
conditions such as southern Africa, Ethiopia, Eritrea and
Sudan (Coetzee, 2000). This species is the main vector
in South Africa and Zimbabwe where vector control
strategies mainly rely on the use of insecticides (Maharaj
et al., 2005; Masendu et al., 2005). Pyrethroids are the
preferred insecticide in these two countries. However,
intensive use of insecticides in both public health and
agriculture has led to the development of resistance in
various mosquito vector species (Ellisa et al., 1993;
Awolola et al., 2002; Stump et al., 2004; Munhenga et al.,
2008, Mouatcho et al., 2009) and is a cause of concern in
any malaria control programme where insecticides are a
corner stone for vector control.
Insecticide resistance to pyrethroids is mainly through
target site insensitivity and or metabolic detoxification of
*Corresponding author. E-mail: givemorem@nicd.ac.za or
lizettek@nicd.ac.za.
the insecticide by enzymes. Target site resistance to
pyrethroids and DDT termed knockdown resistance, has
been thoroughly studied and is due to a substitution at a
single codon in the sodium channel gene (Martinez et al.,
1998; Ranson et al., 2000). Understanding the molecular
basis of target site resistance led to development of
sensitive diagnostic tools (Martinez et al., 1998, Lynd et
al., 2005; Bass et al., 2007, Vezenegho et al., 2009).
Resistant allele frequency is determined with these tools
thereby making it possible for vector control managers to
monitor and determine the impact of resistance.
However, the same cannot be said of metabolic based
resistance mechanisms. In metabolic resistance, when
an insect is exposed to insecticide, this results in either
an overproduction of specific enzymes, leading to
increased metabolism or sequestration, or secondly, an
alteration in the catalytic centre of the enzyme unit that
metabolizes the insecticides and this results in production
of enzymes which can efficiently detoxify the insecticide
(Li et al., 2007). The enzymes responsible for detoxification
of insecticides are transcribed by three members
of large multigene enzyme systems: monooxygenases

12712 Afr. J. Biotechnol.
(P450’s), non-specific esterases (NSE), and glutathione
S-transferases (GST’s), (Hemingway and Ranson, 2004).
The intricate mechanisms involved are, however, not fully
understood. Through biochemical and synergist assays it
has been established that P450s play a central role in
conferring insecticide resistance in insect species (Scharf
et al., 1997; Brooke et al., 2001; Awolola et al., 2009;
Mouatcho et al., 2009). In mosquito species, increased
activities of P450s have been associated with pyrethroid
resistance (Ellisa et al., 1993; Etang et al., 2007;
Munhenga et al., 2008). However, this alone is not
informative enough as cytochrome P450s are known to
consist of multigene superfamilies of enzymes playing
different roles in oxidative metabolism of endogenous
compounds (Mansuy, 1998; Feyereisen, 1999), and only
a few being attributed to insecticide detoxification. With
increased threat on malaria vector control caused by
insecticide resistance attributed to P450s, there has been
an interest in understanding the role of individual P450s
genes involved in insecticide resistance. It is envisaged
that identification of these candidate genes will be useful
in development of more sensitive diagnostic tests for
effective monitoring of metabolic based resistance
development.
Cytochrome P450 enzymes confer insecticide
resistance via increased levels of P450 activity resulting
from elevated expression of P450 genes. This upregulation
has been recorded in 25 P450 genes,
belonging to four families; CYP4, CYP6, CYP9, and
CYP12 (Feyereisen, 1999; David et al., 2005). Detailed
studies in Anopheles gambiae have shown that there is a
cluster of cytochrome P450 genes located in the
chromosome arm 3R associated with pyrethroid
resistance (Ranson et al., 2004). This locus consists of
several P450 genes of which CYP6Z1 (Nikou et al., 2003;
David et al., 2005), CYP6Z2 (Muller et al., 2007a),
CYP6Z3 (Muller et al., 2007b) and CYP6M2 (Muller et al.,
2007a; Djouaka et al., 2008) have been implicated in
pyrethroid resistance. While progress has been made in
understanding candidate P450 genes putatively involved
in pyrethroid resistance in A. gambiae and Anopheles
funestus, there is limited information on the role of
individual P450s in insecticide resistant A. arabiensis
despite its equally important role in malaria transmission.
Here, we report the transcriptional analysis of six
P450s genes from a permethrin-resistant A. arabiensis
laboratory strain which is under continuous permethrin
selection pressure. Previous analysis implicated elevated
cytochrome P450 enzyme activity as the main pyrethroid
resistant mechanism in this strain (Mouatcho et al.,
2009).
MATERIALS AND METHODS
Insect strains
Two A. arabiensis laboratory colonies, designated KWAG and
KWAG-Perm, maintained in the Botha DeMeillon insectary (Vector
Control Reference Unit, South Africa) were used in this study.
KWAG originated from Mamfene, KwaZulu-Natal, and was
colonized in 2005 from a wild population showing permethrin
resistance (78%) (Mouatcho et al., 2009). This colony reverted back
to fully permethrin susceptible in the absence of selection pressure.
However, a subpopulation of the same colony was placed under
permethrin pressure and resulted in a pyrethroid resistant colony
called KWAG-Perm (details on colony can be found in Mouatcho et
al., 2009).
Insecticide susceptibility test
The standard WHO susceptibility tests for adult mosquitoes was
carried on KWAG and KWAG-Perm using test-kits and insecticideimpregnated
filter papers supplied by the WHO (WHO, 1998).
Three day old adults reared from the two colonies were exposed to
0.75% permethrin. Each test consisted of 25 mosquitoes per tube
with two controls. Four replicates were done for each colony. All
filter papers were tested; both prior to and after exposure to an
insecticide susceptible A. arabiensis colony (KGB) in order to
confirm insecticidal activity. For each bioassay, knockdown of
mosquitoes was recorded after 60 min and mortality scored after 24
h. Each exposure tube was allowed 24 h recovery during which
time 10% (w/v) sugar solution was available. Population
susceptibility was classified according to the WHO criterion, which
considers mortality above 98% and below 80% representative of
susceptible and resistant populations, respectively (WHO, 1998).
Synergist analysis
Synergistic assay using piperonyl butoxide (PBO) was conducted
on the permethrin selected colony to confirm involvement of P450s
in permethrin resistance using the method described in Mouatcho
et al. (2009).
P450 gene quantification
RNA extraction
Total RNA was extracted (Paton et al., 2000) from three day old
adult mosquitoes from both the unselected (also called baseline
colony) and the permethrin resistant selected colony. To minimize
gene expression variations, RNA was extracted from 10 mosquitoes
per treatment for each of the three biological replicates. For each
biological repeat, adult males and females from the baseline and
permethrin selected colony were collected simultaneously and
immediately used for RNA extraction. After extraction, RNA quality
and quantities were assessed using the NanoDrop ND-1000
spectrophotometer (Nanodrop Technologies, Oxfordshire, UK) at
230, 260 and 280 nm.
cDNA synthesis
Synthesis of cDNA was carried out on 2 µg of total RNA using High
Capacity RNA-to-cDNA kit (Applied Biosystems, Forster City, CA,
USA; Cat no. 4387406) following the manufacturer’s instructions.
Total cDNA was quantified using a Nanodrop spectrophotometer.
Primer design
The full length CYP6Z2, CYP6Z3 and CYP4G16 gene sequence of
A. gambiae deposited on NCBI website, (http://www.ncbi.nlm.

Munhenga and Koekemoer 12713
Table 1. Primer pair sequences of oligonucleotide primers and annealing temperatures used for P450 gene quantification.
Gene Accession
number
CYP6Z1 AF487535
CYP6Z2
CYP6Z3
CYP6M2 AY193729
CYP6P3
CYP4G16
18S
S7
ribosomal
rpL8
bactin
tbp
Gapdh
AY380336
Primer Sequence (5’TO 3’) Transcript Annealing
length temperature (°C)
CYP6Z1_qF
CYP6Z1_qR
TTA CAT TCA CAC TGC ACG AG
CTT CAC GCA CAA ATC CAG AT
146 bp 56.6
CYP6Z2_F
CYP6Z3_R
CYP6Z3_F
CYP6Z3_R
CYP6M2_F
CYP6M2_R
CYP6P3_F
CYP6P3_R
CYP4G16_F
CYP4G16_R
18S_F
18S_R
S7_F
S7_R
rpL8_F
rpL8_R
bactin_F
bactin_R
tbp_F
tbp_R
gapdh_F
gapdh_R
nih.gov/), were used to design the specific primers (Table 1), using
the Beacon Designer 3.0 software (Biorad, Hercules, CA, USA).
Specificity of the primers was confirmed by sequencing genomic
DNA from A. arabiensis specimens from the selected cohorts. For
CYP6Z1, CYP6M2, and CYP6P3, the primer sequence designed
for A. gambiae s.s were used (Nikou et al., 2003; Muller et al.,
2007a). Specificity of primers was confirmed by sequencing PCR
products post amplification.
Selection of reference genes for gene quantification
Six reference genes: beta actin (bactin), 18S ribosomal RNA (18S),
M2 ribosomal protein L8 (rpL8), tata box binding protein (tbp),
glucose-6-phosphate dehydro-genase (gapdh) and ribosomal (S7)
were selected for assessment as these genes have previously been
used as reference genes by others (Nishimura et al., 2006; Muller
et al., 2008). For each gene, full length gene sequence of A.
gambiae deposited on the NCBI website was used to design
specific primer using the Beacon Designer software (Biorad,
Hercules, CA, USA). Table 1 summarizes the primer pair sequence
ATC GCT TCG GTG TTC TTC
AAT CAA TTC AGG CTG GAG AG
CAA CAA CCT GTA CCA CAA GTC
GGA TCG TGC TCT TCA TTG C
GTA TGA TGC AGG CCC GTA TAG
GCC ATA ATG AAA CTC TCC TTC G
AGC TAA TTA ACG CGG TGC TG
AAG TGT GGA TTC GGA GCG TA
TAG AGC GGT GCC TTA TGG
CGA TTC CAA GCG GTG AAG
TAC CTG GGC GTT CTA CTC
CTT TGA GCA CTC TAA TTT GTT C
GTG CCG GTG CCG AAA CAG AA
AGC ACA AAC ACT CCA ATA ATC
AAG
CAT CAG CAC ATC GGT AAG
ACA GAG CAC TCA CTA CTC
182 bp 53.9
162 bp 53.9
112 bp 55.3
121bp 53.2
158 bp 53.9
130 bp -
472 bp -
162 bp -
ACC AAG AGC CTG AAG CAC
CGA GCA CGA CAC ACT ATA TAC 123 bp -
GAC ATC GTC ATC AAC AAC
CCG TAC AGG TAA TCT TCC
GAC TGC CAC TCG TCC ATC
CCT TGG TCT GCA TGT ACT TG
181 bp -
139 bp -
of the reference genes assessed. Each gene was amplified in
triplicate for the three biological repeats of the two strains KWAG
and KWAG-Perm). PCR conditions were optimized and 5 µl of the
amplified product were electrophoresed on a 2.5% agarose gel to
verify amplicon size. The remainders of the amplicons were sent to
Inqaba biochemical industry for sequencing to confirm whether the
right amplicon was amplified. Threshold values (Cq) were directly
used to compare differences in expression of each reference gene
between the susceptible and resistant samples.
Relative quantification of P450 genes
Quantification of expression levels of each gene (CYP6Z1,
CYP6Z2, CYP6Z3, CYP6M2, CYP6P3 and CYP4G16) was
performed in a CFX 96 real time PCR machine (Biorad, Hercules,
CA, USA). 18S rRNA gene was used as the reference gene.
Concurrently, a standard curve was generated for both the target
and housekeeping genes using a 2 fold dilution series from 80 to
0.076 ng. Each dilution concentration for the standard curve was
done in duplicate, while reactions for the target gene and 18S rRNA

12714 Afr. J. Biotechnol.
Table 2. General expression levels of candidate reference genes in A. arabiensis KWAG-Perm (selected) and KWAG-base
(unselected) colonies.
Candidate reference gene KWAG-Perm F12 [Cq (mean ± SE)] KWAG-base [Cq (mean ± SE)] P value
Bactin 29.7 ± 0.368 23.9 ± 0.133 0.000
18S rRNA 11.8 ± 0.111 12.0 ± 0.121 0.052
rpL8 Failed to amplify Failed to amplify -
tbp 36.6 ± 0.485 32.9 ± 0.121 0.000
gadph 25.1 ± 0.352 18.4 ± 0.182 0.000
S7 25.6 ± 0.225 18.1 ± 0.086 0.000
were performed in triplicate for each biological sample.
All amplification reactions were carried out in a total volume of
25µl containing 12.5 µl 2X iQ TM SYBR ® Green Supermix (Bio-Rad,
Hercules, CA; Cat No. 170-882) , 200 mM of each specific primer
pair specific for each gene and 100 ng of cDNA template. The
qPCR cycling conditions consisted of: initial denaturation step at
95°C for 3 min, followed by 40 cycles of denaturation at 94°C for 15
s; annealing was varied from 53.2 to 56.6°C for 30 s for each gene
(Table 1), primer extension at 72°C for 25 s and a final auto
extension at 72°C for 5 min. Acquisition of data was carried out at
each cycle immediately after the extension step. A final auto
extension step was incorporated at 72°C for 25 s. After the cycling
protocol, a final step was applied to all reactions by continuously
monitoring fluorescence through the dissociation temperature of the
PCR products at a temperature transition rate of 0.5°C/s to
generate a melt curve. Melt curve and agarose gel analysis were
conducted for each gene to ensure that a single amplicon was
amplified. Relative expression levels of each gene were calculated
using the comparative cycle threshold method described by Pfaffl
(2001). Briefly, amplification efficiencies for the target and
housekeeping gene were automatically calculated by the CFX
software manager (Bio-Rad, Hercules, CA, USA), with relative gene
quantities normalized against the 18S ribosomal RNA (18S).
Expression levels between the baseline (calibrator) and permethrin
selected colony (sample) were statistically analyzed using the CFX
software manager (Biorad). Statistical difference in expression
levels was analyzed using REST 2008 statistical package (Corbett
LifeSciences).
RESULTS AND DISCUSSION
WHO susceptibility tests carried out simultaneously on
unselected (KWAG) and permethrin selected colony
(KWAG-Perm) showed that the selected strain was
resistant to permethrin (42% mortality, n = 100) while the
baseline colony showed an average mortality of 97.8% (n
= 100). These results confirmed the level of pyrethroid
resistance in KWAG-Perm as reported by Mouatcho et al.
(2009).
Synergist assays performed using PBO, an inhibitor of
monooxygenase showed that susceptibility to permethrin
was restored in the permethrin selected colony. Mortality
24 h post-exposure of synergized samples was 98.3% (n
= 200) while unsynergized samples recorded a mortality
of 41.8% (n= 200). The differences in mortality 24 h post
exposure between synergized and unsynergized samples
using PBO was statistically significant (χ 2 =0.4, DF = 4, P
< 0.05). This strongly suggests that pyrethroid resistance
in this colony is mediated by monooxygenases.
Six genes were evaluated as reference genes and
Table 2 shows the mean real-time PCR threshold cycle
(Cq) values of genes tested. Of the six, only 18S showed
no variation in general expression levels between the
selected and unselected samples. Therefore, it was
chosen as the reference gene in this investigation.
Quantification analysis of P450 gene transcription
levels revealed that only three P450 genes, CYP6Z1,
CYP6Z2, and CYP6M2 were up regulated in a permethrin
resistant A. arabiensis strain (Figure 1). CYP6Z1 showed
the highest level of transcription with a relative fold over
expression of 4.7. There was a statistically significant
difference in the mRNA expression level between the two
strains (KWAG and KWAG-Perm) (P

Normalised relative fold over expression
6.5
6
5.5
5
4.5
4
3.5
3
2.5
2
1.5
1
0.5
0
CYP6Z1 CYP6Z2 CYP6Z3 CYP6M2 CYP6P3 CYP4G16
P450 genes
Munhenga and Koekemoer 12715
Figure 1. Constitutive expression of the six P450 genes in permethrin A. arabiensis selected strain (KWAG-Perm) normalised to 18S
ribosomal RNA in susceptible (base) and resistant (selected) adult females. Data are presented as mean ± SE of three replicates.
arabiensis from South Africa although they have been
associated with pyrethroid resistance in other malaria
vectors (Muller et al., 2007a; Muller et al., 2008).
Conclusions
These three genes identified are most likely not the only
genes involved in pyrethroid resistant A. arabiensis from
South Africa and a large scale approach such as
microarray analysis will provide additional information on
this complex resistance mechanism. Once these genes
have been identified, a field trial study will be conducted
to investigate if these genes can be used for “early
detection” of pyrethroid resistance in A. arabiensis from
South Africa. This will provide an additional tool to the
National Malaria Control Program (NMCP) that might be
used in annual surveillance activities.
ACKNOWLEDGEMENTS
We thank Prof. Maureen Coetzee for providing valuable
comments on this manuscript and we are indebted to
Ursula Gorniak from Biorad for assisting with the primer
designs. This study received financial support from
the Multinational Initiative on Malaria (MIM) project A
40036 through the UNICEF/UNDP/World Bank/WHO
Special Programme for Research and Training in Tropical
Diseases (TDR); South African Medical Research
Council and the National Health Laboratory Service
Research Trust, African Doctoral Dissertation Research
Fellowship (ADDRF) offered by the African Population
and Health Research Centre (APHRC) in partnership with
the International Development Research Centre (IDRC)
and Ford Foundation and the National Research
Foundation/Department of Science and Technology
(NRF/DST) Research Chair Initiative.
REFERENCES
Awolola TS, Oduola OA, Strode C, Koekemoer LL, Brooke BD, Ranson
H (2009). Evidence of multiple pyrethroid resistance mechanisms in
the malaria vector Anopheles gambiae sensu stricto from Nigeria.
Trans. R. Soc. Trop. Med. Hyg. 103: 1139-1145.
Awolola TS, Brooke BD, Hunt RH, Coetzee M (2002). Resistance of the
malaria vector Anopheles gambiae s.s to pyrethroids insecticides in
south-western Nigeria. Ann. Trop. Med. Parasitol. 96: 849-852.
Bass C, Nikou D, Donnelley MJ, Williamson MS, Ranso H, Ball A,
Vontas J, Field LM (2007). Detection of knockdown resistance (kdr)
mutations in Anopheles gambiae: a comparison of two new highthroughput
assays with existing methods. Mal J. p. 6.
Brooke BD, Kloke G, Hunt RH, Koekemoer LL, Temu EM, Taylor ME,
Smll G, Hemingway J, Coetzee M (2001). Bioassay and biochemical
analyses of insecticide resistance in Southern Africa Anopheles
funestus (Diptera: Culicidae) Bull. Entomol. Res. 91: 265-272.
Coetzee M, Crag M, Le Sueur D (2000). Distribution of African malaria
mosquitoes belonging to the Anopheles gambiae complex. Parasitol.
Today, 16: 74-77.
David J-P, Strode C, Vontas J, Nikou D, Vaughan A, Pignatelli PM,
Louis C, Hemingway J, Ranson H (2005). The Anopheles gambiae
detoxification chip: A highly specific microarray to study metabolic-

12716 Afr. J. Biotechnol.
based insecticide resistance in malaria vectors. Proc. Nat. Acad. Sci.
USA, 102: 4080-4084.
Djouaka RF, Bakare AA, Coulibaly ON, Akogbeto MC, Ranson H,
Hemingway J, Strode C (2008). Expression of the cytochrome P450s,
CYP6P3 and CYP6M2 are significantly elevated in multiple pyrethroid
resistant populations of Anopheles gambiae s.s from Southern Benin
and Nigeria. BMC Genomics, 9: p. 538.
Ellisa N, Mouchet J, Riviere F, Meunier JY, Yao K (1993). Resistance of
Anopheles gambiae s.s to pyrethroids in Cote d’Ivoire. Ann. Soc.
Belg. Med. Trop. 73: 291-294.
Etang J, Manga L, Toto J-C, Guillet P, Fondjo E, Chandre F (2007).
Spectrum of metabolic-based resistance to DDT and pyrethroids in
Anopheles gambiae s.l. populations from Cameroon. J. Vec. Ecol. 32:
123-133.
Feyereisen R (1999). Insect P450 enzymes. Annu. Rev. Entomol. 44:
507-533.
Hemingway J, Ranson H (2000). Insecticide resistance in insect vectors
of human diseases. Annu. Rev. Entomol. 45: 371-391.
Li X, Schuler MA, Berenbaum MR (2007) Molecular mechanisms of
metabolic resistance to synthetic and natural xenobiotics. Annu. Rev.
Entomol. 52: 231-253.
Lynd A, Ranson H, McCall PJ, Randle PN, Black IV CM, Walker DE,
Donnelly, MJ (2005). A simplified high-throughput method for
pyrethroid knock-down resistance (kdr) detection in Anopheles
gambiae. Mal J. 4: p. 16.
Maharaj R, Mthembu DJ, Sharp BL (2005). Impact of DDT reintroduction
on malaria transmission in Kwazulu-Natal. S. Afr. Med. J.
95: 871-874.
Mansuy D (1998). The great diversity of reactions catalyzed by
cytochromes P450. In: Comp. Biochem. Physiol. C Pharmacol.
Toxicol. Endocrinol. 121: 5-14.
Masendu HT, Hunt RH, Koekemoer LL, Brooke BD (2005). Spatial and
temporal distributions and insecticide susceptibility of malaria vectors
in Zimbabwe. Afr. Entomol. 13: 25-34.
Martinez-Torres D, Chandre F, Williamson MS, Darriet F, Serge JB,
Devonshire AL, Gulliet P, Pasteur N, Pauron D (1998). Molecular
characterization of pyrethroid knockdown resistance (kdr) in the
major malaria vector Anopheles gambiae s.s. Insect Mol. Biol. 7: 179-
184.
Mouatcho JC, Munhenga G, Hargreaves K, Brooke B D, Coetzee M,
Koekemoer LL (2009). Pyrethroid resistance in a major African
malaria vector, Anopheles arabiensis, from Mamfene, northern
Kwazulu/Natal. S. Afr. J. Sci. 105: 127-131.
Muller P, Warr E, Stevenson BJ, Pignatelli PM, Morgan JC, Steven A,
Yawson AE, Mitchell SN, Ranson H, Hemingway J, Paine MJI,
Donnelly MJ (2008). Field-caught permethrin-resistant Anopheles
gambiae over express CYP6P3, a P450 that metabolises pyrethroids.
PLoS Genet. p. 4.
Muller P, Donnelly MJ, Ranson H, (2007a). Transcription profiling of
Muller P, Warr E, Stevenson BJ, Pignatelli PM, Morgan JC, Steven a
recently colonized pyrethroid resistant Anopheles gambiae strain
from Ghana, BMC Genomics, 8: p. 36.
Muller P, Chouaibou M, Pignatelli P, Etang J, Walker ED, Donnelly MJ,
Simard F, Ranson H (2007b). Pyrethroid tolerance is associated with
elevated expression of antioxidants and agricultural practice in
Anopheles arabiensis sampled from an area of cotton fields in
Northern Cameroon. Mol. Ecol. 17: 1145-1155.
Munhenga G, Masendu RH, Brooke BD, Hunt RH, Koekemoer LL
(2008). Pyrethroid resistance in the major malaria vector Anopheles
arabiensis from Gwave, a malaria-endemic area in Zimbabwe. Mal J.
7: 247.
Nikou D, Ranson H, Hemingway J (2003). An adult-specific CYP6 P450
gene is over expressed in a pyrethroid-resistant strain of the malaria
vector, Anopheles gambiae. Gene, 318: 91-102.
Nishimura M, Koeda A, Susuki E, Shimizu T, Kawano Y, Nakayama M,
Satoh, T (2006). Effects of protypical drug-metabolising enzyme
inducers on mRNA expression of housekeeping genes in primary
cultures of human and rat hepatocytes. Biochem. Biophys. Res.
Commun. 346: 1033-1039.
Penilla RP, Rodriguez AD, Hemingway J, Torres JL, Arrendo-Jimenez
JI, Rodriguez, MH (1998). Resistance management strategies in
malaria vector control. Baseline data for a large-scale field trial against
Anopheles albimanus in Mexico. Med. Vet. Entomol. 12: 217-233.
Paton MG, Parakrama SHP, Giakoumaki E, Roberts N, Hemingway J
(2000). Quantitative analysis of gene amplification in insecticide
resistant Culex mosquitoes. Biochem. J. 346: 17-24.
Ranson H, Paton MG, Jensen B, McCarroll L, Vaughan A, Hogan JR,
Hemingway J, Collins FH (2004). Genetic mapping of genes
conferring permethrin resistance in the malaria vector, Anopheles
gambiae. Insect Mol. Biol. 13: 379-386.
Ranson H, Jensen B, Vulule JM, Wang X, Hemingway J, Collins FH
(2000). Identification of a point mutation in the voltage-gated sodium
channel gene of Kenyan Anopheles gambiae associated with
resistance to DDT and pyrethroids. Insect. Mol. Biol. 9: 491-497.
Scharf M, Kaakeh W, Bennet G (1997). Changes in an insecticideresistant
field population of German cockroach (Dictyoptera:
Blattellidae) after exposure to an insecticide mixture. J. Econ.
Entomol 90: 38-48.
Stump AD, Atieli FK, Vulule JM, Besansky NJ (2004). Dynamics of the
pyrethroid knockdown resistance allele in western Kenyan
populations of Anopheles gambiae in response to insecticide-treated
bed net trials. Am. J. Trop. Med. Hyg. 70: 591-596.
Vezenegho SB, Brooke BD, Hunt RH, Coetzee M, Koekemoer LL
(2009). Malaria vector mosquito composition, sporozoite rate and
insecticide susceptibility status in Guinea Conakry, West Africa. Med.
Vet. Entomol. 23: 326-334.
World Health Organization (1998). Test procedures for insecticide
resistance monitoring in malaria vectors, bio-efficacy and persistence
of insecticides on treated surfaces. Document
WHO/CDS/CPC/MAL/98.12. Geneva, Switzerland.

African Journal of Biotechnology Vol. 10(59), pp. 12722-12728, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.468
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Novel family- and genus-specific DNA markers
in Mugilidae
Shan-Hu Lai 1,2 , Yao-Horng Wang 3 , Kuo-Tai Yang 4 , Chia-Hsuan Chen 1,5 and Mu-Chiou Huang 1 *
1 Department of Animal Science, National Chung Hsing University, 250 Kuob Kung Road, Taichung 402, Taiwan.
2 Center of General Education, Jen-Teh Junior College Medicine, Nursing and Management, No. 79-9,
Sha Luen Hu, Xi-Zhou Li, Houlong Town, Miaoli 356, Taiwan.
3 Department of Nursing, Yuanpei University, No. 306 Yuanpei Street, Hsinchu 300, Taiwan.
4 Institute of Biomedical Sciences, Academia Sinica, 128 Academia Road, Section 2, Nankang, Taipei 115, Taiwan.
5 Livestock Research Institute, Council of Agriculture, Executive Yuan, 112, Muchang, Xinhua Dist., Tainan City 712,
Taiwan.
Accepted 19 May, 2011
In this study, we identified novel family- and genus-specific DNA markers in Mugilidae fish. Genomic
DNA was isolated from the blood of fish of 15 families and eighty (80) random primers were used for
random amplified polymorphic DNA (RAPD) fingerprinting. When the primer OPAV04 was employed, a
novel specific PCR product was observed in the Mugilidae family. In addition, another novel specific
PCR product was also observed in the Liza genus while using primer OPAV10. Sequencing analysis
revealed that the novel family- and genus-specific DNA fragments were 857 and 419 bp, respectively,
and no similar sequences were found in GenBank. Two primers sets were designed based on the
family- and genus-specific sequences to confirm the RAPD results and the 571 and 187 bp predicted
bands were successfully amplified by PCR. Intriguingly, these two novel specific DNA markers were
also effectively used for terrestrial and aquatic animal discrimination. Therefore, the novel family- and
genus-specific DNA markers identified in this study can be used as an effective tool for rapid and
accurate determination of the Mugilidae family and Liza genus, and even for cross-species
identification.
Key words: Mugilidae, family- and genus-specific sequences, DNA markers.
INTRODUCTION
The Mugilidae family fish, referred to as mullets or grey
mullets, are ray-finned fish inhabiting coastal and
brackish waters of all tropical and temperate regions
worldwide. The Mugilidae family includes 17 genera and
a total of 72 valid species, most classified in the genera
Mugil and Liza, which have 18 and 24 species,
respectively (Thomson 1997; Nelson 2006). Along the
Taiwan coast, 12 species of 7 genera of Mugilidae have
been recorded in “The Fish Database of Taiwan”
(http://fishdb.sinica.edu.tw/).
Mugil cephalus is a member of the Mugilidae family that
migrates to the Taiwan coast and spawns in winter every
*Corresponding author. E-mail: mchuang@mail.nchu.edu.tw.
Tel: +886-4-2285-2469. Fax: +886-4-2286-0265
year. Its fry tend to group in the estuary and are easily
captured as a pond culture source. Currently, the food
fish of M. cephalus are almost all pond-cultivated in
Taiwan. The M. cephalus is an important source of
income for the aquaculture industry in Taiwan: “karasumi”
is the processed product of the eggs obtained from
female M. cephalus, and has a high economic value.
Traditionally, morphological identification of fish is made
according to the appearance, anatomy and useful
taxonomic characteristics, such as hylogenetics,
osteology, morphometrics, etc. (Harrison et al., 2007;
Rossi et al., 1998a; Trewavas and Ingham, 1972). It is
difficult to distinguish between the genera Mugil and Liza
(Rossi et al., 1998a) by appearance and morphology, and
the economic value of M. cehpalus is quite a bit higher
than that of Liza affinis. Therefore, a molecular technique
must be developed to distinguish the genera Liza in the

Mugilidae family for necessary identification purposes. So
far, studies on fish species identification in Mugilidae
have included karyotype analysis (Nirchio et al., 2009;
Rossi et al., 2005) using in situ hybridization techniques,
genetic distance distribution by mt-DNA analysis
(Papasotiropoulos et al., 2002, 2007), analysis of
evolutionary relationships by allozyme electrophoresis
(Rossi et al., 1998b, 2004; Turan et al., 2005), nucleic
acid data (Fraga et al., 2007; Rossi et al., 2004), and 16S
r-RNA mt-DNA (Liu et al., 2010; Rossi et al., 2004)
methods for phylogeny verification.
The RAPD technique is applied for genetic analysis,
analysis of phylogenic relationships and gender and
species identification in fish (Barman et al., 2003; Chen et
al., 2009; Elo et al., 1997; Govindaraju and Jayasankar,
2004; Horng et al., 2006; Wu et al., 2007). In this study,
due to the characteristics of RAPD technology of simple
manipulation, rapidity, and low cost, we employed this
technique to identify food fish species in Taiwan. We
expect to find a bio-marker for use as an adjuvant tool for
early fish species identification to help minimize
morphological discrimination errors in aquaculture.
MATERIALS AND METHODS
Sample collection
A total of 15 families and 63 fish were sampled from traditional
markets, supermarkets and pond cultures in the central region of
Taiwan. Blood samples were collected from the hearts of the fish of
the families Mugilidae, Cichlidae, Elopidae, Polynemidae,
Sillaginidae, Cyprinidae, Sparidae, Trichiuridae, Sciaenidae,
Chanidae, Epinephelus, Moronidae, Nemipteridae, Siganidae and
Latidae. The gender of the fish for the 15 families was not
considered in this study.
Genomic DNA preparation
Extraction of genomic DNA from fish blood cells was performed as
described previously (Huang et al., 2003). Each whole blood
sample was washed in TNE buffer (10 mM Tris-HCl, 150 mM NaCl,
10 mM EDTA) by centrifugation at 2000×rpm for 5 min and the
process was repeated several times until the supernatant was clear.
The pellet was then resuspended in TNE buffer and stored at -20°C
for frozen and thawed treatment. The pre-treated sample was
mixed with 300 µl of 10% NH4Cl, 75 µl proteinase K (10 mg/ml), 25
µl collagenase (3.8 IU/µl) and 200 µl of 10% SDS, and incubated at
55°C for 24 h with gentle agitation in a water bath. Genomic DNA
was purified using phenol/chloroform extraction and isopropanol
precipitation. Isolated genomic DNA was then dried and dissolved in
a suitable volume of 2dH2O ready for use. The terrestrial animal
genomic DNAs of Brown Tsaiya ducks, Beijing ducks, angus, goats,
pigeon, landrace, duroc and Yorkshire pigs prepared in our
laboratory previously were used for species comparison.
RAPD-PCR analysis
The RAPD-PCR protocol followed was as described previously
(Horng and Huang, 2003). Briefly, amplification was performed in a
final volume of 15 µl containing 100 mM Tris-HCl (pH8.0), 1.5 mM
Lai et al. 12723
MgCl2, 50 mM KCl, 100 mM dNTPs, 0.14 mM primers (Operon
Technologies, Inc., Alameda, CA, USA), 100 ng of template DNA
and 0.5U Taq polymerase (DyNAzyme, Finnzymes Oy., Keilaranta,
Espoo, Finland). Eighty (80) random primers (OPAA, OPAV, OPAO
and OPC series) were used for RAPD-PCR. The reaction was
carried out in a thermal cycler (HYBAID OminGrid) with the
following amplification condition: 94°C for 5 min followed by 45
cycles of 1min at 94°C, 1 min at 36°C, and 2 min at 72°C, with a
final extension at 72°C for 10 min. The amplicons were separated
by electrophoresis on 2% agarose gel and visualized by staining
with ethidium bromide (1.5 µg/ml) via UV light.
Specific fragment isolation, cloning and sequencing
The family- and genus-specific fragments were purified from
agarose gel using a QIAquick Gel Extraction Kit (Qiagen Inc.,
Valencia, CA, USA) and cloned into pCR II-TOPO vector using a
TOPO Cloning Kit (Invitrogen, Carlsbad, CA, USA) according to the
manufacturer’s instructions. The confirmed construct, containing a
specific fragment was sequenced using an ABI Prime BigDye
Terminator Cycle Sequencing Ready Reaction Kit (Applied
Biosystems, Foster City, CA, USA) and an ABI 3100 DNA
Sequencer (Applied Biosystems, Foster City, CA, USA), was used
for the analysis.
Identification of family- and genus-specific fragments by PCR
Primers were designed from the family- and genus-specific
fragment sequences using GCG sequence analysis software
(Genetic Computer Group, Madison, WI, USA) as follows: familyspecific
primers- MugilAV04SpeF1, 5’-aacacctctcatttctcaaacc-3’ and
MugilAV04SpeR1, and 5’-ttctgccatccaaattgatcc-3’; genus-specific
primers- LizaAV10SpeF1, 5’-cgaacacccctacttttgatg-3’ and
LizaAV10SpeR1, and 5’-ttctgccatccaaattgatcc-3’. The 18S
ribosomal gene was used as an internal control (18S-F: 5’ctcccctcccgttacttgga-3’
and 18S-R: 5’-ttggttttggtctgataaatgca-3’)
(Suchyta et al., 2003). The PCR conditions were the same as those
used for RAPD-PCR, while the annealing temperature was raised to
62°C. The sizes of the PCR products were predicted as follows:
family-specific length, 571 bp; genus-specific length, 187 bp and
18S, 100 bp, and were subjected to electrophoresis on 2% agarose
gel as described previously.
RESULTS
Finding the family- and genus-specific bands by
RAPD-PCR
Four random primers series (OPAA, OPAV, OPAO and
OPC series) were used for RAPD-PCR to search for a
specific DNA marker among ten families of fish bought
from traditional markets, supermarkets and pond cultures
in Taiwan. Most random primers yielded multiple bands
representing polymorphism of RAPD fingerprinting
between fishes. One of these primers, OPAV04
(TCTGCCATCC), amplified a major fragment in the
RAPD fingerprints of all Mugilidae tested, but not in the
other families (Figure 3). For further investigation, the
specific DNA fragment was purified from agarose gel and
inserted into the pCR II-TOPO vector for sequencing. A
sequence length of 857 bp was obtained (Figure 1) and

12724 Afr. J. Biotechnol.
Figure 1. A novel family-specific DNA sequence (857 bp) of Mugilidae cloned from the
RAPD fingerprints. Two primers, MugilAV04SpeF1 and MugilAV04SpeR1 (underlined),
were designed based on the specific sequence for easy Mugilidae family identification
by PCR.
Figure 2. A novel genus-specific DNA sequence (419 bp) of Liza cloned from the RAPD
fingerprints. Two primers, LizaAV10SpeF1 and LizaAV10SpeR1 (underlined), were designed
based on the specific sequence for easy genus identification in Mugilidae by PCR.
has been submitted to GenBank (Accession Number,
HM991290).
Intriguingly, we also found that the primer OPAV10
(GGACCTGCTG) amplified a significant band only in the
RAPD fingerprints of the genera Liza from the Mugilidae
tested (Figure 4). At the same time, we also purified the
genus-specific fragment, cloned and sequenced it: its
sequence length was 419 bp (Figure 2), and it has also
been submitted to GenBank (Accession Number,
DQ641039).
BLAST analysis revealed that these two specific
fragments had no homologous sequences aligned with
the nucleotide database. Thus, the cloned sequences
could be considered novel family- and genus - specific

Lai et al. 12725
Figure 3. RAPD fingerprints of 15 popular food fish families in Taiwan. Genomic DNA isolated from fish blood was amplified
with random primer OPAV04, which produced a specific band on the RAPD fingerprints only in the Mugilidae family (black
arrow indicated). M: Bio-100 bp ladder markers, 1. Liza spp., 2. Liza affinis, 3. Liza haematocheilus, 4. Mugil cephalus, 5.
Nemipterus virgatus, 6. Chanos chanos, 7. Siganus guttatus, 8. Trichiurus lepturus, 9. Epinephelus spp., 10. Lateolabrax
japonicu, 11. Lates calcarifer, 12. Elops machnata, 13. Tilapia zillii, 14. Aristichthys nobilis, 15. Eleutheronema rhadinus
and B is blank.
Figure 4. RAPD fingerprints of 10 popular food fish families in Taiwan. Genomic DNA isolated from fish blood was amplified with
random primer OPAV10, which produced a specific band on the RAPD fingerprints only in the Liza genus (black arrow indicated).
M: Bio-100 bp ladder markers, 1. Liza spp., 2. Liza affinis, 3. Liza haematocheilus, 4. Mugil cephalus, 5. Chanos chanos, 6.
Pennahia argentata, 7. Siganus spp., 8. Trichiurus spp., 9. Evynnis spp., 10. Pennahias macrocephalus, 11. Psenopsis spp., 12.
Sillago spp., 13. Tilapia spp., 14. Eleutheronema spp. and B is blank.
sequences for Mugilidae and Liza spp. identification,
respectively.
Validation of family- and genus-specific DNA
fragments by PCR analysis
Two sets of primers, MugilAV04SpeF1/R1 and
LizaAV10SpeF1/R1, were designed based on the family-
and genus-specific sequences, respectively (Figures 1
and 2). The 18S ribosomal gene was used as the internal
control. As predicted, the PCR results showed a 571 bp
clear band using the family-specific primer set only in the
Mugilidae family (Figure 5A, lanes 1~4), whereas the 18S
gene product was observed in all fish. On the other hand,
using the genus-specific primer set revealed a 187 bp
band only in the Liza genus (Figure 5B, lanes 1~3). To
confirm the accuracy and confidence limits of the PCR
method, other individual fish were tested, and the family-
and genus-specific bands were amplified in all Mugilidae

12726 Afr. J. Biotechnol.
Figure 5. PCR analysis for family and genus identification in 10 popular food fish families in Taiwan. Genomic DNA
isolated from fish blood was further amplified with family-specific primer, genus-specific primer and control 18S ribosomal
gene primer sets. The family-specific PCR product (571 bp) was present only in Mugilidae (A), whereas the genusspecific
PCR product (187 bp) was visualized only in Liza (B). The internal control 18S ribosomal gene presented a 100
bp band in all samples tested. M: Bio-100 bp ladder markers, 1. Liza spp., 2. Liza affinis, 3. Liza haematocheilus, 4.
Mugil cephalus, 5. Chanos chanos, 6. Pennahia argentata, 7. Siganus spp., 8. Trichiurus spp., 9. Evynnis spp., 10.
Pennahias macrocephalus, 11. Psenopsis spp., 12. Sillago spp., 13. Tilapia spp., 14. Eleutheronema spp. and B is blank.
and Liza spp., respectively (data not shown). Thus, these
results indicated that our family- and genus-specific
primer sets could indeed be used as an accurate and
efficient PCR-based method for family and genus
identification in aquaculture.
Identification of the difference between terrestrial and
aquatic animals
To further validate the uniqueness and specificity of the
novel Mugilidae family-specific primer set, genomic DNA
samples from terrestrial animals, such as bovine, porcine,
goat, chicken, duck DNA etc., were tested by PCR. As
shown in Figure 6, no 571 bp clear band was observed in
any terrestrial samples, only in the aquatic sample
Mugilidae. Similarly, the Liza spp. genus-specific primer
set also amplified a significant signal (187 bp) and was
detected in the aquatic and not the terrestrial animals
tested (data not shown). These results strongly indicated
that the novel Mugilidae family- and Liza genus-specific
fragments can be used for cross-species identification.
DISCUSSION
The original purpose of this study was to find a unique
DNA marker for the discrimination of terrestrial and
aquatic animals in Taiwan. Firstly, we collected popular
families of food fish in Taiwan and isolated genomic DNA
from blood as described in materials and methods. The
random amplified polymorphic DNA-polymerase chain
reaction (RAPD-PCR) technique has been successfully
applied for species identification and sexing of animals
(Bardakci and Skibinski, 1994; Chen et al., 2009; Horng
et al., 2006; Kovács et al., 2000; Partis; Wells, 1996; Wu
et al., 2007). In this study, the RAPD fingerprints of fish
were amplified using random primers, and multiple major
and minor bands in the fingerprints of the samples could
be observed in each lane. This indicated that some DNA
sequences were homologous and/or conserved in
individuals. Using the OPAV04 primer, a specific fragment
was found to be present only in the Mugilidae family
tested (Figure 3). After specific fragment purification,
cloning, sequencing and PCR verification, a Mugilidae
family-specific 871 bp fragment was obtained. BLAST
analysis of this specific sequence revealed that no
nucleotide sequence was similar to the family-specific
fragment, which suggested that it could be used as a
novel identification marker for the Mugilidae family.
In addition, we found that the RAPD fingerprints
obtained using the OPAV10 primer contained a significant
band in the Liza genus of the Mugilidae family (Figure 4).
After further investigation by fragment purification,
cloning, sequencing and PCR confirmation, a Liza genusspecific
419 bp fragment was obtained. As with the
family-specific fragment, there were no homologous
sequences aligned with the nucleotide database.

Lai et al. 12727
Figure 6. Discrimination of terrestrial and aquatic animals by PCR. Genomic DNA isolated from terrestrial and aquatic animals
was further amplified using the family-specific primer set. A significant band (571 bp) was clearly displayed only in the aquatic
but not in the terrestrial animals tested. Lanes 1 and 2: Brown Tsaiya duck, 3 and 4: Beijing duck, 5 and 6: Angus, 7 and 8:
Goat, 9: Pigeon, 10: Landrace, 11: Duroc, 12: Yorkshire, 13~17: Mugilidae Liza spp..
Fortunately, no significant similarity was found between
the Mugilidae family-specific and Liza genus-specific
fragments by BLAST alignment. This result suggested
that both the family- and genus-specific fragment may be
used as novel discrimination markers in aquaculture
fisheries.
The Mugilidae family consists of 17 genera and a total
of 72 valid species, most of which are classified in the
genera Mugil and Liza, which contain 18 and 24 species,
respectively (Thomson 1997; Nelson 2006). Traditionally,
morphological identification of fish is made according to
appearance, anatomy and useful taxonomic characteristics
(Rossi et al., 1998a). Unfortunately, the
appearances of the genera M. cephalus and L. affinis are
very similar and it is difficult to distinguish between the
two. M. cephalus is an important source of income for the
aquaculture industry in Taiwan; “karasumi” is the
processing product of eggs obtained from female M.
cephalus, with a high economic value, while L. affinis is of
a relatively low economic value. In this study, we
developed a novel Mugil molecular marker (Figure 1),
and a Liza genus-specific fragment (Figure 2), to distinguish
between the genera Mugil and Liza (Figure 5). The
Liza genus-specific DNA marker provides a rapid, simple,
accurate and useful tool for distinguishing between
genera in M. cephalus fry and Liza affinis, preventing
Liza affinis fry contamination at an early stage of
classification.
Recently, vegetarian food has become more popular for
reasons of health and religion. As the name implies,
vegetarian food does not contain any terrestrial or aquatic
animal products. Some merchants add animal products to
vegetarian foods to raise the flavor and umami – the
common approach to raise the umami in vegetarian foods
is via aquatic components supplementation. The same
also occurs in meat processing products. It is therefore
necessary to develop a molecular technique for identification
of the components of processing products.
RAPD-PCR analysis is commonly used for specific
identification in meat and seafood products (Bossier,
1999; Martinez and Yman, 1998). Our finding of a familyspecific
DNA marker that can be used to distinguish
between terrestrial and aquatic animals is important
(Figure 6), and indicates that the novel family-specific
fragment can be used as a DNA marker for cross-species
identification.
In conclusion, we have developed novel Mugilidae
family- and Liza genus-specific DNA markers from RAPD
fingerprints. Two primer sets, MugilAV04SpeF1/R1 and
LizaAV10SpeF1/R1, were accurately and rapidly used for
family and genus determination in aquaculture and even
for cross-species identification by PCR.
REFERENCES
Bardakci F, Skibinski DO (1994). Application of the RAPD technique in
tilapia fish: species and subspecies identification. Heredity, 73: 117-
123.
Barman HK, Barat A, Yadav BM, Banerjee S, Meher PK, Reddy PVGK,
Jana RK (2003). Genetic variation between four species of Indian
major carps as revealed by random amplified polymorphic DNA
assay. Aquaculture, 217: 115-123.
Bossier P (1999). Authentication of seafood products by DNA patterns.
J. Food Sci., 64: 189-193.
Chen J, Wang Y, Yue Y, Xia X, Du Q, Chang Z (2009). A novel malespecific
DNA sequence in the common carp, Cyprinus carpio. Mol.
Cell. Probes, 23: 235-239.
Elo K, Ivanoff S, Vuorinen JA, Piironen J (1997). Inheritance of RAPD
markers and detection of interspecific hybridization with brown trout
and Atlantic salmon. Aquaculture, 152: 55-65.
Fraga E, Schneider H, Nirchio M, Santa-Brigida E, Rodrigues-Filho LF,
Sampaio I (2007). Molecular phylogenetic analyses of mullets
(Mugilidae, Mugiliformes) based on two mitochondrial genes. J. Appl.

12728 Afr. J. Biotechnol.
Ichthyol., 23: 598-604.
Govindaraju GS, Jayasankar P (2004). Taxonomic relationship among
seven species of groupers (Genus Epinephelus; Family Serranidae)
as revealed by RAPD fingerprinting. Mar. Biotechnol., 6: 229-237.
Harrison IJ, Nirchio M, Oliveira C, Ron E, Gaviria J (2007). A new
species of mullet (Teleostei: Mugilidae) from Venezuela, with a
discussion on the taxonomy of Mugil gaimardianus. J. Fish Biol., 71:
76-97.
Horng YM, Huang MC (2003). Male-specific DNA sequences in pigs.
Theriogenol., 59(3-4): 841-848.
Horng YM, Wu CP, Wang YC, Huang MC (2006). A novel molecular
genetic marker for gender determination of pigeons. Theriogenol., 65:
1759-1768.
Huang MC, Lin WC, Horng YM, Rouvier R, Huang CW (2003). Femalespecific
DNA sequences in geese. Br. Poult. Sci., 44: 359-364.
Kovács B, Egedi S, Bártfai R, Orbán L (2000). Male-specific DNA
markers from African catfish (Clarias gariepinus). Genetica, 110: 267-
276.
Liu J-Y, Brown CL, Yang T-B (2010). Phylogenetic relationships of
mullets (Mugilidae) in China Seas based on partial sequences of two
mitochondrial genes. Biochem. Syst. Ecol., 38: 647-655.
Martinez I, Malmheden Yman I (1998). Species identification in meat
products by RAPD analysis. Food Res. Int., 31: 459-466.
Nelson JS (2006). Fishes of the World. 4th ed. John Wiley and Sons,
Inc, New York.
Nirchio M, Oliveira C, Ferreira I, Martins C, Rossi A, Sola L (2009).
Classical and molecular cytogenetic characterization of Agonostomus
monticola, a primitive species of Mugilidae (Mugiliformes). Genetica,
135: 1-5.
Papasotiropoulos V, Klossa-Kilia E, Alahiotis S, Kilias G (2007).
Molecular phylogeny of Grey Mullets (Teleostei: Mugilidae) in Greece:
Evidence from sequence analysis of mtDNA segments. Biochem.
Genet., 45: 623-636.
Papasotiropoulos V, Klossa-Kilia E, Kilias G, Alahiotis S (2002). Genetic
divergence and phylogenetic relationships in Grey Mullets (Teleostei:
Mugilidae) based on PCR–RFLP analysis of mtDNA segments.
Biochem. Genet., 40: 71-86.
Partis L, Wells RJ (1996). Identification of fish species using random
amplified polymorphic DNA (RAPD). Mol. Cell. Probes, 10: 435-441.
Rossi A, Gornung E, Sola L, Nirchio M (2005). Comparative molecular
cytogenetic analysis of two congeneric species, Mugil Curema and
M. Liza (Pisces, Mugiliformes), characterized by significant karyotype
diversity. Genetica, 125: 27-32.
Rossi AR, Capula M, Crosetti D, Campton DE, Sola L (1998a). Genetic
divergence and phylogenetic inferences in five species of Mugilidae
(Pisces: Perciformes). Mar. Biol., 131: 213-218.
Rossi AR, Capula M, Crosetti D, Sola L, Campton DE (1998b). Allozyme
variation in global populations of striped mullet, Mugil cephalus
(Pisces: Mugilidae). Mar. Biol.,131: 203-212.
Rossi AR, Ungaro A, De Innocentiis S, Crosetti D, Sola L (2004).
Phylogenetic analysis of Mediterranean Mugilids by allozymes and
16S mt-rRNA genes investigation: Are the Mediterranean species of
Liza Monophyletic? Biochem. Genet., 42: 301-315.
Suchyta SP, Sipkovsky S, Halgren RG, Kruska R, Elftman M, Weber-
Nielsen M, Vandehaar MJ, Xiao L, Tempelman RJ, Coussens PM
(2003). Bovine mammary gene expression profiling using a cDNA
microarray enhanced for mammary-specific transcripts. Physiol.
Genomics, 16: 8-18.
Thomson JM (1997). The Mugilidae of the world. Mem. Queensl. Mus.,
41: 457-562.
Trewavas E, Ingham SE (1972). A key to the species of Mugilidae
(Pisces) in the Northeastern Atlantic and Mediterranean, with
explanatory notes. J. Zool.,167: 15-29.
Turan C, Caliskan M, Kucuktas H (2005). Phylogenetic relationships of
nine mullet species (Mugilidae) in the Mediterranean Sea.
Hydrobiologia, 532: 45-51.
Wu CP, Horng YM, Wang RT, Yang KT, Huang MC (2007). A novel sexspecific
DNA marker in Columbidae birds. Theriogenol., 67: 328-333.

African Journal of Biotechnology Vol. 10(59), pp. 12729-12737, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1558
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effects of banana wilt disease on soil nematode
community structure and diversity
Shuang Zhong 1 , Yingdui He 1 , Huicai Zeng 1 , Yiwei Mo 2 , ZhaoXi Zhou 2 , XiaoPing Zang 2 and
Zhiqiang Jin 1 *
1 Chinese Academy of Tropical Agricultural Sciences Haikou Experimental Station, Hainan Haikou, 570102, China.
2 Chinese Academy of Tropical Agricultural Sciences South Subtropical crops Research Institute, Guangdong Zhanjiang,
524091, China.
Accepted 26 August, 2011
Effects of banana wilt disease caused by Fusarium oxysporum f. sp. cubense (FOC) on soil nematode
community composition were investigated in Hainan province China. The results show that 31
nematode genera in the disease and control regions were identified. The disease area was mainly
dominated by Acrobeles, Acrobeloides, Chiloplacus and Aphelenchus, while Pelodera, Protorhabditis,
Ditylenchus and Basiria dominated in the control area. Paratylenchus was the dominant genus in both
areas. The abundance of total nematodes, bacterivore (10 to 30 cm), plant parasites and omnivorespredators,
the values of diversity (H′), maturity index (MI), plant parasite index (PPI), structure index (SI),
enrichment index (EI), soil pH, the contents of total organic carbon (TOC), total nitrogen (TN), total
phosphorus (TP) and alkaline nitrogen (AN) in the disease area were significantly lower (P < 0.01) than
in the control. However, those of fungivores (10 to 20 cm) and dominance (λ) exhibited quite a reverse
result. In the disease area, the abundance of total nematodes and bacterivore decreased (P < 0.01) and
plant parasites increased (P

12730 Afr. J. Biotechnol.
nematode, Meloidogyne incognita, severely restricted
plant root growth and decreased annual yield loss by 40
to 80% (Haseeb et al., 2005; Goswami et al., 2007).
Yucel et al. (2009) reported that tomato wilt disease was
hastened considerably in the presence of M. incognita
and Meloidogyne javanica, which created a food base for
Fusarium oxysporum and increase their invasive
potential.
In order to investigate the effects of pathogen causing
banana wilt disease on soil ecosystem in banana
plantation, there is a need to develop a set of indicators
that are able to quantify changes in soil ecosystem
stability and monitor rapid response to various
disturbances. Soil nematodes as a component of the soil
ecosystem interact with biotic and abiotic soil factors
(Hohberg, 2003). Because of this interaction, nematodes
are excellent bio-indicators of soil health. They form a
dominant group of organisms with high abundance and
biodiversity, which play an important role in nutrient
recycling within the soil (Neher, 2001; Schloter et al.,
2003). Nematodes are heterotrophs in the higher food
chain compared to microorganisms and serve as
integrators of soil pro-perties and environment
disturbance related to their food source, predators and
parasites (Ferris, 2010). They show rapid reaction to the
disturbance or stress caused by banana wilt disease in
temperate and tropical regions (Pattison et al., 2008).
Both the classification of soil nematodes into trophic
groups and understanding of nematode life strategies,
whether colonisers or persisters (c-p), are useful
measurement to detect the changes of soil microbial
composition in banana wilt disease areas and provide
information about the level of disturbance (Berkelmans et
al., 2003; Stirling et al., 2004).
FOC enriched soils show a reduced biodiversity. Under
such conditions the populations of bacterivores (mainly in
Rhabditidae, Pangrolaimidae and Cephalobidae), plant
parasites (mainly in Meloidogynidae, Hoplolaimidae,
Pratylenchidae and Rotylenchulidae) and omnivores or
predators (mainly in Qudsianematidae) decreased in
contrast to other nematode groups, while the proportion
of fungivores (dominated by Aphelenchidae and Aphelenchoididae)
exhibited a reverse condition (Poornima et al.,
2007; Quénéhervé, 2008; Duyck et al., 2009). It is
accepted that nematodes of certain fauna composition,
together with its ecological indices, has emerged as a
useful monitor of disturbance or stress soil conditions
(Goodsell et al., 2009).
Until now, many researches had reported parasitic
nematodes interacted with the fungal wilt disease among
various vegetation types and soil types (Haseeb et al.,
2006; Goswami and Tiwari, 2007). However, there is little
information about using soil nematode as bio-indicators to
measure the level of disturbance caused by FOC. The
objective of this study is to compare the differences between
soil nematodes trophic groups and ecological indices in
banana wilt diseased and un-diseased soil and determine
how soil chemical and biological properties have been
changed due to banana wilt disease. We expect that soil
nematodes are useful bio-indicators to measure the effects
of FOC on soil ecosystem health of banana plantation.
MATERIALS AND METHODS
Site description
This investigation was conducted at LeDong banana wilt disease
experimental site (18° 23′ -18° 52′ N, 108°36′ - 109°05′ E), Chinese
Academy of Tropical Agricultural Sciences, Hainan, China. The
mean annual temperature is 21.5-28.5°C and the mean annual
precipitation is 1600 to 2600 mm with no frost period all year. The
annual mean wind velocity is 2.0 to 2.5 m s -1 . The test soil is
classified as sandy loam with 4.9 g kg -1 total organic C, 0.7 g kg -1
total N, 0.4 g kg -1 total P, 25.1 g kg -1 total K and pH 6.0. Banana
plants of cvs. Baxijiao (AAA) were sowed in a conventional tillage
system. Each banana plant was fertilized by adding 0.5 kg N, 0.3 kg
P2O5 and 1.5 kg K2O, respectively. Two sites, the disease area
(banana wilt disease soil) and control (healthy banana soil) were
arranged with three replicates.
Sampling, extraction and identification of nematodes
The soil samples were collected at depth intervals of 0 to 10, 10 to
20 and 20 to 30 cm below the soil surface on booting stage (March
19, 2010) within the plant rows of banana plants, and 50 cm from
the base of the banana plant. Each sample comprised five soil
cores (3.0 cm in diameter) and were placed in individual plastic bag
and then immediately stored in 4°C condition.
Nematodes were extracted from 100 g soil sample (fresh weight)
by a modified cotton-wool filter method (Verschoor and de Goede,
2000). The abundance of nematodes was expressed per 100 g dry
weight soil. Nematodes were identified to genus level using an
inverted compound microscope. The classification of trophic groups
was assigned to: bacterivores (BF), fungivores (FF), plant parasites
(PP) and omnivores-predators (OP), based on known feeding
habits or stomach and pharyngeal morphology (Yeates et al.,
1993).
Soil chemical analysis
Total organic C (TOC) was analyzed by dry combustion, using a
Shimadzu TOC 5000 Total C analyzer. Soil pH was determined with
a glass electrode in 1 : 2.5 soil : water solution (w/v). Total nitrogen
(TN) was determined by semi-microkjeldahl method. Total P (TP)
was digested by H2SO4-HClO4 and determined by Molybdenumblue
complex method. Total K (TK) was analyzed by Flame
photometer (FP 640, Shanghai, China). Alkaline N (AN), available P
(AP) and available K (AK) were described by Rayment and
Higginson (1992).
Statistical analysis
The following nematode ecological indices were calculated: (1)
dominance λ = ∑ P i 2 ; (2) diversity H’ = − ∑ Pi (ln Pi) , where Pi is the
proportion of individuals in the ith taxon; (3) maturity index MI
(excluding plant parasites), MI = ∑ v(i)·f(i), where v(i) is the c-p
value of i-taxon, f(i) is the frequency of i-taxon, which measures
disturbances for environment; (4) plant parasite index PPI, which
was determined in a similar manner for plant parasitic genera
(Yeates and Bongers, 1999); (5) Enrichment index (EI) was
calculated as EI = 100 e / (b + e), structure index (SI) was

Table 1. Changes in soil chemical parameters between disease and control area in three levels soil depths.
Region
Disease
area
CK
Effects
Soil depth
(cm)
Parameter
Zhong et al. 12731
pH TOC (g/kg) TN (g/kg) TP (g/kg) TK (g/kg) Alkaline N (mg/kg) Available P (µg/kg) Available K (µg/g)
0 - 10 5.17 ± 0.03 a 4.03 ± 0.46 a 0.77 ± 0.15 a 0.44 ± 0.06 a 22.08 ± 2.03 a 31.87 ± 7.84 a 68.41 ± 19.09 a 48.27 ± 11.74 a
10 - 20 5.05 ± 0.09 b 2.72 ± 0.15 b 0.61 ± 0.09 a 0.35 ± 0.11 a 23.31 ± 8.20 a 23.20 ± 3.96 b 32.85 ± 4.43 a 38.39 ± 15.10 a
20 - 30 5.15 ± 0.04 a 2.61 ± 0.33 b 0.65 ± 0.09 a 0.34 ± 0.13 a 21.91 ± 2.84 a 28.74 ± 8.70 b 33.31 ± 2.38 a 42.39 ± 1.68 a
0 - 10 5.29 ± 0.08 b 6.15 ± 0.37 b 0.82 ± 0.10 b 0.34 ± 0.01 a 25.73 ± 2.16 a 74.40 ± 11.03 a 24.98 ± 3.87 a 72.80 ± 13.77 a
10 - 20 5.97 ± 0.12 ab 6.45 ± 0.1 b 0.76 ± 0.10 b 0.33 ± 0.02 a 26.63 ± 3.43 a 60.69 ± 4.39 b 28.08 ± 2.61 a 46.25 ± 1.79 b
20 - 30 6.48 ± 0.8 a 7.28 ± 0.18 a 0.95 ± 0.09 a 0.34 ± 0.01 a 30.85 ± 2.56 a 62.34 ± 1.31 b 33.25 ± 2.62 a 46.61 ± 9.74 b
Site

12732 Afr. J. Biotechnol.
Table 2. Average percentage dominance values (c-p) for nematode genera in banana wilt disease area and control area (%).
Trophic groups/genus c-p b)
Disease area (cm) CK (cm)
0 - 10 10 - 20 20 - 30 0 - 10 10 - 20 20 - 30
Ba a) 55.2 47.5 41.7 36.0 48.7 46.8
Pelodera* c) 1 0.0 0.0 0.0 4.5 18.9 12.1
Protorhabditis* 1 0.0 0.8 1.2 15.7 6.5 7.7
Panagrolaimus 1 2.7 1.9 1.3 1.1 2.3 2.5
Monhystera 1 1.6 0.6 0.0 1.0 0.9 1.0
Eucephalobus 2 2.2 0.0 0.0 2.3 2.8 6.1
Heterocephalobus 2 0.9 1.9 0.9 1.7 1.4 1.8
Acrobeles* 2 18.7 2.5 0.0 0.0 0.0 0.0
Acrobeloides* 2 16.8 16.8 17.2 7.5 7.3 7.6
Cervidellus 2 0.7 0.0 1.0 0.0 0.0 0.0
Chiloplacus* 2 4.0 12.4 11.4 0.5 0.0 0.5
Plectus 2 3.3 3.3 0.9 0.0 0.9 0.8
Wilsonema 2 1.1 0.0 0.0 0.0 0.0 0.0
Chronogaster 2 0.0 0.0 0.9 0.0 1.1 0.5
Prismatolaimus 3 2.6 6.7 5.7 1.7 6.0 5.7
Alaimus 4 0.6 0.6 1.2 0.0 0.6 0.5
Fu 18.4 22.4 19.9 17.0 6.8 12.5
Ditylenchus* 2 1.6 7.2 8.6 12.5 3.4 3.3
Aphelenchus* 2 16.1 14.6 9.8 4.0 1.7 7.9
Aphelenchoides 2 0.7 0.6 1.5 0.0 1.1 0.0
Tylencholaimus 4 0.0 0.0 0.0 0.5 0.6 1.3
PP 23.1 27.9 36.8 45.0 42.2 40.2
Basiria* 2 1.8 5.3 7.7 12.1 18.7 14.0
Tylenchus 2 0.0 0.0 0.0 0.8 1.7 1.0
Filenchus 2 0.0 1.6 0.9 6.1 2.8 2.8
Paratylenchus* 2 21.3 17.6 25.7 18.5 15.3 15.5
Helicotylenchus 3 0.0 0.0 0.0 6.5 3.1 6.2
Rotylenchus 3 0.0 0.8 1.9 0.0 0.6 0.5
Hirschmanniella 3 0.0 0.6 0.0 0.7 0.0 0.0
Longidorella 4 0.0 2.0 0.6 0.3 0.0 0.0
OP 3.3 2.2 1.6 2.0 2.3 0.5
Thonus 4 1.5 1.1 0.9 0.0 0.6 0.5
Dorydorella 4 0.5 0.0 0.0 0.5 0.9 0.0
Microdorylaimus 4 1.3 1.1 0.7 0.7 0.9 0.0
Prodorylaimus 5 0.0 0.0 0.0 0.8 0.0 0.0
a) Ba = bacterivores, Fu = fungivores, PP = plant parasites, OP = omnivores-predators; b) numbers following the functional groups
indicate the c-p values (Bongers and Bongers, 1998; Ferris et al., 2001); c) * dominant genera ( >10%)
29.1% in 20 to 30 cm; in the control area, 36.9% soil
nematode distributed in 0 to 10 cm, 33.2% in 10 to 20 cm
and 29.9% in 20 to 30 cm. The abundance of total
nematodes was significantly lower (P

250
200
150
100
50
abundance of total nematodes.
Nematodes trophic groups
Nematode/100 g dry soil
0
**
0-10 10-20 20-30
Soil Depth (cm)
**
Disease area
Figure 1. Changes in abundance (individuals per 100 g dry soil) of total nematodes
between banana wilt disease area and control area in the three soil level depths
(Significant levels: **, P

12734 Afr. J. Biotechnol.
Nematode/100g dry soil
Nematode/100g dry soil
150
100
50
0
150
100
50
0
*
Nematode number of BF
**
0-10 0 - 10 cm 10 10-20 - 20 cm 20-30 20 - cm 30 0-10 0 - 10 cm 10 10-20 - 20 cm 20-30 20 - cm 30
Soil Depth (cm)
Nematode number of PP
*
0-10 0 - 10 cm 10 10-20 - 20 cm 20-30 20 - cm30
0-10 0 - cm10 10-20 10 - 20 cm 20-30 20 - cm 30
Soil Depth (cm)
**
*
Disease area
CK
Nematode/100g dry soil
Nematode/100g dry soil
150
100
50
0
150
100
50
0
Nematode number of FF
**
Soil Depth (cm)
Nematode number of OP
**
Soil Depth (cm)
Figure 2. Abundance of four trophic groups of soil nematodes between banana wilt disease area and control area in the three soil level
depths (Significant levels: **, P

Zhong et al. 12735
Table 3. Changes in the values of nematode ecological indices between banana wilt disease area and control area in the three soil
level depths.
Region
Disease
area
CK
Effects
Soil depth
(cm)
Indices
λ H’ MI PPI EI SI
0 - 10 0.16 ± 0.03 a 2.23 ± 0.12 a 1.74 ± 0.06 a 2.00 ± 0.02 b 34.94 ± 0.51 a 25.30 ± 2.70 b
10 - 20 0.12 ± 0.01 a 2.37 ± 0.10 a 1.73 ± 0.11 a 2.09 ± 0.15 a 37.50 ± 0.92 a 29.73 ± 7.04 a
20 - 30 0.15 ± 0.01 a 2.24 ± 0.11 a 1.78 ± 0.09 a 2.08 ± 0.06 a 36.65 ± 4.98 a 30.17 ± 14.36 a
0 - 10 0.11 ± 0.02 ab 2.44 ± 0.02 a 2.09 ± 0.03 a 2.18 ± 0.03 b 78.88 ± 1.31 b 35.48 ± 12.54 b
10 - 20 0.12 ± 0.01 a 2.49 ± 0.13 a 2.12 ± 0.04 a 2.22 ± 0.03 a 86.54 ± 1.20 a 58.14 ± 9.67 a
20 - 30 0.10 ± 0.01 b 2.55 ± 0.11 a 2.14 ± 0.10 a 2.17 ± 0.05 b 78.89 ± 1.29 b 43.03 ± 11.94 a
Site

12736 Afr. J. Biotechnol.
the profile of 10 to 30 cm in the disease area and control
area because plant roots were mainly distributed in this
region and it was relatively easy for plant parasites to get
food resources (Zhi et al., 2008).
Comparison of soil nematode ecological indicators
between banana wilt disease soil and healthy soil
Diversity index (H’) gives more weight to rare species
with higher values showing a greater diversity, while
dominance index (λ) gives more weight to common
species (Ferris and Bongers, 2006). The average value
of H’ was 8.5% lower in the disease area than in the
control area, while that of λ was 23.3% higher in the
disease area than in the control area, which was in
agreement with the results of Pattison et al. (2008) in
north Queensland. These apparent differences were
attributed to a decline in abundance of omnivorespredators
and enhancement in abundance of fungivores
in the disease area (Neher et al., 2005). Furthermore,
Acrobeles, Acrobeloides, Chiloplacus and Aphelenchus
comprised 64.4% of the abundance of total nematodes in
the disease area, which contributed to a significantly
lower diversity and higher dominance of nematodes in
the disease area relative to the control area (Kimpinski
and Sturz, 2003).
The average values of MI and PPI were 17.5% and
2.3% lower in the disease area than in the control area.
The low values of MI and PPI in the disease area were
attributed to a more unstable environmental condition and
more disturbed soil food web compared to the control
area (Yeates, 2003). The MI values of smaller than two
(MI

species on banana nematodes. InfoMusa, 15: 2-6.
Dominguez J, Negrin MA, Rodriguez CM (2003). Evaluating soil sodium
indices in soils of volcanic nature conducive or suppressive to
fusarium wilt of banana. Soil Biol. Biochem. 35: 565-575.
Dominguez J, Negrin MA, Rodriguez CM (2008). Soil potassium indices
and clay-sized particles affecting banana wilt expression caused by
soil fungus in banana plantation development on transported volcanic
soils. Commun. Soil Sci. Plan. 39: 397-412.
Duyck PF, Pavoine S, Tixier P (2009). Host range as an axis of niche
partitioning in the plant-feeding nematode community of banana
agroecosystems. Soil Biol. Biochem. 41: 1139-1145.
Ferris H (2010). Form and function: metabolic footprints of nematodes in
the soil food web. Euro. J. Soil Boil. 46: 97-104.
Ferris H, Bongers T (2006). Nematode indicators of organic enrichment.
J. Nematol. 38: 3-12.
Ferris H, Bongers T, de Goede RGM (2001). A framework for soil food
web diagnostics: extension of the nematode faunal analysis concept.
Appl. Soil Ecol. 18: 13-29.
Goodsell PJ, Underwood AJ, Chapman MG. (2009). Evidence
necessary for taxa to be reliable indicators of environmental
conditions or impacts. Mar. Pollut. Bull. 58: 323-331.
Goswami BK, Pandey RK, Goswami J, Tewari DD (2007). Management
of disease complex caused by root knot nematode and root wilt
fungus on pigeonpea through soil organically enriched with Vesicular
Arbuscular Mycorrhiza, karanj (Pongamia pinnata) oilseed cake and
farmyard manure. J. Environ. Sci. Health B. 42: 899-904.
Goswami J, Tiwari D (2007). Management of Meloidogyne incognita
and Fusarium oxysporum f. sp. Iycopersici Disease Complex on
Tomato by Trichoderma harzianum, Tinopsora longifolia and Glomus
fasciculatum. Pestic. Res. J. 19(1): 51-55.
Haseeb A, Sharma A, Abuzar S, Kumar V (2006). Evalution of
resistance in different cultivars of chickpea against Meloidogyne
incognita and Fusarium oxysporum f. sp. ciceri under field conditions.
Indian Phytopath. 59(2): 234-236.
Haseeb A, Sharma A, Shukla PK (2005).Studies on the management of
root-knot nematode, Meloidogyne incognita-wilt fungus, Fusarium
oxysporum disease complex of green gram, Vigna radiata cv ML-
1108. J. Zhejiang Univ. 6B(8): 736-742.
Hohberg K (2003). Soil nematode fauna of afforested mine sites:
genera distribution, trophic structure and functional guilds. Appl. Soil
Ecol. 22: 113-126.
Kimpinski J, Sturz AV (2003). Managing crop root zone ecosystems for
prevention of harmful and encouragement of beneficial nematodes.
Soil Tillage Res. 72(2): 213-221.
McKenzie NJ, Dixon J (2006). Monitoring soil condition across Australia:
Recommendations from the Expert Panels. National Land and Water
Resource Audit, Australian Government, Canberra, Australia.
Nasir N, Pittaway PA, Pegg K (2003). Effects of organic amendments
and solarisation on Fusarium wilt in susceptible banana plantlets,
transplanted into naturally infested soil. Aust. J. Soil. Res. 54: 251-
257.
Neher DA (2001). Role of nematodes in soil health and their use as
indicators. J. Nematol. 33: 161- 168.
Neher DA, Wu J, Barbercheck ME, Anas O (2005). Ecosystem type
affects interpretation of soil nematode community measures. Appl.
Soil Ecol. 30: 47-64.
Nieminen JK (2009). Modelling the interactions of soil microbes and
nematodes. Nematology, 4(11): 619-629.
Pattison AB, Moody PW, Badcock KA, Smith LJ, Armour JA, Rasiah V,
Cobon JA, Gulino LM, Mayer R (2008). Development of key soil
health indicators for the Australian banana industry. Appl. Soil Ecol.
40: 155-164.
Penga HX, Sivasithamparama K, Turner DW (1999). Chlamydospore
germination and Fusarium wilt of banana plantlets in suppressive and
conducive soils are affected by physical and chemical factors. Soil
Biol. Biochem. 31: 1363-1374.
Poornima K, Angappan K, Kannan R, Kumar N, Kavino M, Balamohan
TN (2007). Interactions of nematode with the fungal Panama wilt
disease of banana and its management. Nematol. Medit. 35: 35-39.
Quénéhervé P (2008). Integrated management of banana nematodes.
In: Ciancio A, Mukerji KG. (Eds.), Integrated Management of Fruit
Crops Nematodes. Springer, The Netherlands, pp. 1-54.
Zhong et al. 12737
Rayment GE, Higginson FR (1992). Australian Laboratory Hand book of
Soil and Water Chemical Methods. Inkata Press, Sydney, Australia.
pp. 25-133.
Rossouw J, van Rensburg L, Claassens S, van Rensburg PJJ (2008).
Nematodes as indicators of ecosystem development during platinum
mine tailings reclamation. Environmentalist, 28: 99-107.
Schloter M, Dilly O, Munch JC (2003). Indicators for evaluating soil
quality. Agric. Ecosyst. Environ. 98: 255-262.
Seneviratne G (2009). Collapse of beneficial microbial communities and
deterioration of soil health: a cause for reduced crop productivity.
Curr. Sci. India, 5(96): 633.
Sharma BR, Dutta S, Roy S, Debnath A, De Roy M (2010). The effect of
soil physico-chemical properties on rhizome rot and wilt disease
complex incidence of ginger under hill agro-climatic region of west
Bengal. Plant Pathol. J. 2(26): 198-202.
Shreenivasa KR, Krishnappa K, Reddy BMR, Ravichandra NG, Karuna
K, Kantharaju V (2005). Integrated Management of Nematode
complex on banana. Indian J. Nematol. 1(36): 37-40.
Stirling GR, Stirling AM, Seymour NP, Bell MJ (2004). Use of free-living
nematodes in soil food-web diagnostics: An example from the
vertosols of the northern grain belt. Proceedings of the Third
Australasian Soilborne Diseases Symposium, Rowland Flat, South
Australia. South Aust. Res. Dev. Institute, pp. 3-4.
Verschoor BC, de Goede RGM (2000). The nematode extraction
efficiency of the Oostenbrink elutriator-cottonwool filter method with
special reference to nematode body size and life strategy.
Nematology, 2: 325-342.
Wang KH, McSorley R, Marshall A, Gallahe RN (2006).Influence of
organic Crotalaria juncea hay and ammonium nitrate fertilizers on soil
nematode communities. Appl. Soil Ecol. 31: 186-198.
Wu HS, Yang XN, Fan JQ, Miao WG, Ling N, Xu YC, Huang QW, Shen
Q (2009). Suppression of Fusarium wilt of watermelon by a bioorganic
fertilizer containing combinations of antagonistic
microorganisms. Bio. Control, 54: 287-300
Yeates GW (2003).Nematodes as soil indicators: functional and
biodiversity aspects. Biol. Fertil. Soils, 37: 199-210.
Yeates GW, Bongers T (1999). Nematode diversity in agroecosystem.
Agric. Ecosyst. Environ. 74: 113-135.
Yeates GW, Bongers T, de Goede RGM, Freckman DW, Georgieva SS
(1993). Feeding habits in soil nematode families and genera - an
outline for soil ecologists. J. Nematol. 25: 315-331.
Yeoung-Seuk B, Guy RK (2008). Influence of a Fungus-Feeding
Nematode on Growth and Biocontrol Efficacy of Trichoderma
harzianum. Phytopathology, 3(91): 301-306.
Yucel S, Ozarslandan A, Colak A (2009). Methyl bromide alternatives
for controlling fusarium wilt and root knot nematodes in tomatoes in
Turkey. Acta. Hortic. 808: 381-385.
Zhi DJ, Li HY, Nan WB (2008). Nematode communities in the artificially
vegetated belt with or without irrigation in the Tengger Desert, China.
Euro. J. Soil Boil. 44: 238-246.

African Journal of Biotechnology Vol. 10(59), pp. 12738-12744, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.2005
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effect of interaction of 6-benzyl aminopurine (BA) and
sucrose for efficient microtuberization of two elite
potato (Solanum tuberosum L.) cultivars, Desiree and
Cardinal
Aafia Aslam 1 *, Aamir Ali 2 , Naima Huma Naveed 2 , Asif Saleem 2 and Javed Iqbal 1
1 Seed Centre, University of the Punjab, Quaid-e-Azam Campus, 54590, Lahore, Pakistan.
2 Department of Biological Sciences, University of Sargodha, Sargodha, Pakistan.
Accepted 1 September, 2011
Single node and multinode explants of two potato cvs., Desiree and Cardinal were tested for in vitro
microtuber production. Explants were taken from tissue culture laboratory of Seed Centre, University of
the Punjab, Lahore, Pakistan in 2004. Experiments were designed in completely randomized pattern. 34
media treatments of Murashige and Skoog (1962) with varying concentrations of sucrose (4, 6, 8, 10 and
12%) either alone or in combination (5-8% sucrose) with 6-benzyl amino purine (BA) were studied. In the
case of cv. Desiree, medium MB10 (BA 6 mg/l, sucrose 6%) and for cv. Cardinal, medium MK20 (BA 5
mg/l, sucrose 8%) in term of induction, mean number and mean fresh weight per single node explant
were optimized. In comparison, cv. Desiree genotypically was observed to be slightly slow in
response to in vitro microtuber induction and development than cv. Cardinal.
Key words: Potato, microtuberproduction, 6-benzyl aminopurine (BA), sucrose.
INTRODUCTION
Potatoes, with the conventional method of vegetative
propagation are often prone to attack by pathogens such
as fungi, bacteria and viruses, thereby resulting in poor
quality and yields (Aafia et al., 2007). Seed tubers are the
most common source of plant material in potato
reproduction. Recently, plant tissue culture technology
has become very popular and has a visible impact on the
production of virus free seed potatoes. Basic and
prebasic seeds of potato produced through tissue culture
are free of viruses (viruses like PVY, PVX, PVM, PVA,
PVA and PLRV). With evidence for strong and consistent
analogies between microtubers and field grown tubers for
their induction, growth and development, several
components such as the rapid and near synchronous
*Corresponding author. E-mail: aamirali73@hotmail.com.
Abbreviations: BA, 6-Benzyl aminopurine; MS, Murashige and
Skoog.
induction and growth, which can be modified by a range of
exogenous compounds or conditions, make the
microtuber a valuable model system (Coleman et al.,
2001). Microtuber production is one of the strategies
under this perspective. Because of their small size and
weight, microtubers have tremendous advantages in
terms of disease free, storage, transportation and
mechanization (Kanwal et al., 2006). A number of
research groups all over the world are trying to show this
revolution (Gopal et al., 2004; Zhijun, et al., 2005; Zhang,
2006). Nowadays, exogenous supply of cytokinin and
cytokinin-like compounds in microtuber growth media has
been getting much attention for future perspective (Shibli
et al., 2001). However, cytokinin stimulates transition of
axillary buds into stolons, which could be useful in
tuberization in vitro but not maintenance of shoot
cultures (Vinterhalter et al., 1997).
The objective of the present study was to produce
virus free in vitro microtubers in terms of induction
time, mean number and mean fresh weight of microtubers
per single node and multinode explants, and

Aslam et al. 12739
Table 1a. Effect of sucrose concentrations on in vitro induction, mean number and mean fresh weight of microtubers from single and
multinode explants of Solanum tuberosum L. Var. Desiree.
Media
number
Sucrose
(%)
Microtuber
induction
(days)
Single node explant Multinode explant
Mean
number of
microtubers
Mean FW (g)
of
microtubers
Microtuber
induction
(days)
Mean no.
of
microtuber
Mean FW
(g) of
microtubers
M1 4 48 b 1.2±0.2 b 0.03±0.03 a 41 b 1.9±0.02 ab 0.03±0.02 a
M2 6 34 e 1.6±0.3 a 0.03±0.02 a 31 c 2.1±0.21 a 0.04±0.02 a
M3 8 38 d 1.5±0.3 a 0.04±0.30 a 33 c 1.9±0.32 ab 0.04±0.03 a
M4 10 43 c 1.3±0.3 ab 0.03±0.02 a 39 b 2.0±0.21 a 0.03±0.04 a
M5 12 52 a 1.2±0.2 b 0.03±0.52 a 48 a 1.7±0.09 b 0.03±0.18 a
LSD 2.678
0.293
Means followed by different letters in the same column differ significantly at P = 0.05 according to Duncan’s new multiple range test.
evaluation of genotypic responses of two potato
cultivars. The protocols developed in this study can be
used for the production of disease free, high yielding
and premium quality microtubers throughout the year
without seasonal limitations. These developed microtubers
can be grown under controlled conditions for the
production of pre-basic potato seed which after a
couple of generations can be supplied to farmers for
commercial crop production.
MATERIALS AND METHODS
Healthy virus free potato tubers were obtained from Tissue Culture
Laboratory of Seed Centre, University of the Punjab, Lahore,
Pakistan in 2004. These tubers were washed several times with
detergent followed by several times rinses with distilled water, dried
and placed in dark room for eight weeks till sprouting started. One
week old sprouts were dipped in 15% NaOCl solution for 15 to 20
min, given three washings with autoclaved distilled water and
inoculated on prepared MS medium. After 4 weeks of inoculation,
the buds were sprouted into full plantlets that contained 7 to 8
nodes. These were excised into singlenode (one node) and
multimode (three nodes) explants and used for microtuberizaton
experiments. The MS media used was supplemented with
sucrose (4, 6, 8, 10 and 12%) either alone or in combination with BA
at varying concentrations. The pH of the medium was adjusted at
5.74. In each test tube, 10 ml media was dispensed and capped
before autoclaving. The media was autoclaved at 121°C for 15 min
under the pressure of 15 Ib/In 2 . After inoculation, the vials were
transferred to growth room where temperature was kept at 27 ±
1°C and 16 h day light. Data was recorded for time taken for
microtuber formation, mean number of microtubers per plant
and mean fresh weight of microtubers, both from multinode
and single node explant at different concentrations of BA and
sucrose. Experiments were designed in completely randomized
pattern. When microtubers became matured, they were
harvested into sterilized Petri plates aseptically. Following the
analysis of variance (ANOVA), means were used to find simple
correlation between the performance of genotypes in various in
vitro treatments and the corresponding performances of these
genotypes in in vitro conditions. Duncan’s new multiple range test
was also used where applicable (Steel and Torrie, 1980).
0.026
3.608
RESULTS AND DISCUSSION
0.244
Effect of sucrose on microtuberization
0.017
Table 1 summarizes the results of microtuber induction in
cultivars Desiree and Cardinal on MS medium supplemented
with different concentrations of sucrose (4, 6, 8, 10
and 12%) without any growth regulator. The medium M2
containing 6% sucrose was proved to be optimal in terms
of minimum time of induction (34 and 31 days), mean
number (1.2 and 1.9) and fresh weight (0.03 and 0.04 g)
of microtuber per single and multinode explant,
respectively in cv. Desiree. For cv. Cardinal, the medium
M8 containing 8% of sucrose, the minimum time of
induction (22 and 17 days), mean number (1.9 and 2.3)
and fresh weight (0.03 and 0.04 g) of microtuber per
single and multinode explant, respectively was optimized.
In comparing both cvs. in terms of microtuber induction
(Tables 1 and 2), multinode explants were observed to be
earlier tuberized in vitro than single node explants (Figures
1 and 2). It might be due to the presence of some
endogenous level of cytokinin in multinode explant than
single node. Among media without any addition of hormone
(Table 1a and b), 6 and 8% sucrose level was found to be
optimal for both cultivars, respectively. Khuri and Moorby
(1995) proposed that the high sucrose level on one hand
provides a good carbon source which was easily
assimilated and converted to starch for the microtuber
growth and on the other it secures an uninterrupted
synthesis of starch due to high osmotic potential
provided by the excess sucrose. Carlson (2004) and
Sushruti et al. (2004) also reported best microtuber
supplemented with 10% sucrose contents. Data
presented in Table 1a and b showed that by further
increasing the concentration of sucrose, not only time
taken for microtuberization was increased but mean
number of microtubers per culture vial were also
decreased both in single node as well as multinode

12740 Afr. J. Biotechnol.
explants.
Effect of BA and sucrose on microtuberization
As far as the combined action of BA and high concen-
Figure 1. Microtuber induction of multinode explant var.
Cardinal (2x).
Figure 2. Different stages of microtuber formation from
multinode explant Var. Desiree (1x).
tration of sucrose is concerned, it was observed that low
concentration (1.0 to 3.0 mg/l BA) failed to show
significant effect on microtuberization response as
shown in Table 2. Aksenoa et al. (2000) reported that
cytokinin and sucrose at high concentration stimulated
induction response in MS medium supplemented with

Aslam et al. 12741
Table 1b. Effect of sucrose concentrations on in vitro induction, mean number and mean fresh weight of microtubers from single and
multinode explants of Solanum tuberosum L. Var. Cardinal.
Media
number
Sucrose
(%)
Microtuber
induction
(days)
M1 4 47 a
M2 6 44 b
M3 8 22 e
M4 10 29 d
M5 12 34 c
LSD
2.018
Single node explant Multinode explant
Mean number
of microtubers
0.8± 0.21 c
0.9± 0.30 c
1.9± 0.04 a
1.5 ± 0.04 b
1.5 ± 0.04 b
0.226
Mean FW (g) of
microtubers
0.02 ± 0.02 a
0.03 ± 0.09 a
0.03 ± 0.07 a
0.03 ± 0.42 a
0.03 ± 0.07 a
Microtuber
induction
(days)
43 a
38 b
17 e
22 d
26 c
Mean number
of microtuber
1.1 ± 0.32 d
1.4 ± 0.44 cd
2.3 ± 0.32 a
1.6 ± 0.26 bc
1.9 ± 0.29 ab
Means followed by different letters in the same column differ significantly at P=0.05 according to Duncan’s new multiple range test.
0.013
3.220
0.469
Mean FW
(g) of
microtubers
0.03± 0.09 a
0.03 ± 0.01 a
0.04 ± 0.02 a
0.04± 0.21 a
0.03 ± 0.21 a
Table 2a. Effect of BA and sucrose concentrations on in vitro induction, mean number and mean fresh weight of microtubers from single and
multinode explants of Solanum tuberosum Var. Desiree.
Media
number
BA
(mg/l)
Sucrose
(%)
Microtuber
induction
(days)
Single node explant Multinode explant
Mean number
of
microtubers
Mean FW (g)
of
microtubers
Microtuber
induction
(days)
Mean
number of
microtuber
0.016
Mean FW
(g) of
microtubers
MB1 4.0 5 24 a 1.6±0.30 de 0.02±0.07 b 21 a 2.6±0.50 abc 0.04±0.05 b
MB2 4.0 6 19 b 1.7±0.20 e 0.04±0.40 b 16 bc 2.9±0.37 ab 0.06±0.04 ab
MB3 4.0 7 18 bc 1.7±0.30 cde 0.04±1.17 b 17 b 2.8±0.39 abc 0.04±0.06 b
MB4 4.0 8 18 bc 1.9±0.24 cd 0.04±0.93 b 15 bcd 3.0±0.38 a 0.04±0.01 b
MB5 5.0 5 17 bcd 1.7±1.10 cde 0.03±0.02 b 14 cde 2.5±0.72 bc 0.08±0.82 ab
MB6 5.0 6 16 bcd 1.8±0.62 cd 0.04±0.04 b 13 de 2.8±0.83 abc 0.08±0.29 ab
MB7 5.0 7 16 bcd 1.7±0.30 cde 0.10±0.03 ab 14 cde 2.4±0.43 c 0.06±1.00 ab
MB8 5.0 8 15 cd 2.0±1.10 abc 0.12±0.03 ab 13 de 2.5±0.41 bc 0.11±0.34 ab
MB9 6.0 5 14 d 2.3±0.68 ab 0.14±0.60 ab 12 e 2.9±0.31 ab 0.08±0.29 ab
MB10 6.0 6 14 d 2.4±0.13 a 0.21±0.91 a 12 e 3.0±0.40 a 0.13±0.48 a
MB11 6.0 7 16 bcd 1.9±0.59 cd 0.19±0.08 a 14 cde 2.9±0.24 ab 0.10±0.09 ab
MB12 6.0 8 15 cd 1.4±0.54 e 0.18±0.04 a 13 de 2.9±1.10 ab 0.11±0.47 ab
LSD
3.027
0.345
Means followed by different letters in the same column differ significantly at P = 0.05 according to Duncan’s new multiple range test.
8% sucrose. According to Nawsheen (2001), the optimal
production of microtubers was obtained in MS medium
tuber initiation. Best response for cv. Desiree was
obtained in MB10 medium containing 6.0 mg/l BA with
6% sucrose. At this concentration, microtuber formation
started after 14 and 12 days of inoculation for both single
node and multinode explants, respectively (Figures 3, 5
and 7). The mean number (2.4 and 3.0 microtubers) and
the maximum mean fresh weight (0.21 and 0.13 g) of
microtuber per single node and multinode explant,
respectively was optimized. Azzopardi (1997) used
tuberization medium containing high level of BA (5.0 mg/l)
and sucrose (8%) to get optimal production of microtubers
(Figures 4, 6 and 8). With the same medium composition
0.119
2.482
0.409
0.065
but with the addition of CCC (2-chloroethyltrimethylammonium
chloride) in concentration of 500 mg/l, the
maximum mean number of 44.5 microtubers per 100 ml
flask were obtained by Haque (1996). The BA at 14 mg/l
in MS medium supplemented with 8% sucrose was found
to be an optimum medium by Mogollon et al. (2000). In
the case of cv. Cardinal, results were found to be
optimal in the medium MB20 containing 5.0 mg/l BA and
8% of sucrose in terms of minimum time of induction (11
and 09 days), mean number (2.6 and 4.1) and fresh
weight (0.23 and 0.05 g) of microtuber per single and
multinode explant, respectively. Size of microtubers was
crucial for sprouting in vivo. It was suggested that only
microtubers larger than 250 mg can be used to produce

12742 Afr. J. Biotechnol.
Table 2b. Effect of BA and sucrose concentrations on in vitro induction, mean number and mean fresh weight of microtubers from single and
multinode explants of Solanum tuberosum Var. Cardinal.
Media
number
BA
(mg/l)
Sucrose
(%)
Microtuber
induction
(days)
Single node explant Multinode explant
Mean
number of
microtubers
Mean FW (g)
Of
microtubers
0.09 ± 0.02 cd
0.13 ± 0.06 bcd
0.11 ± 0.56 cd
0.05 ± 0.03 d
0.04 ± 0.04 d
0.05 ± 0.03 d
1.20 ± 0.03 a
0.23 ± 0.02 b
0.16± 0.04 bc
0.13± 0.06 bcd
Microtuber
induction
(days)
Mean
number of
microtuber
Mean FW
(g) of
microtubers
MB1 4.0 5 14 bcd 2.1 ± 0.49 bc
12 bc 2.3 ± 0.33 c 0.05 ± 0.13 b
MB2 4.0 6 12 fg
1.7 ± 0.34 d
12 bc
2.8 ± 0.38 bc
0.04 ± 0.52 b
MB3 4.0 7 13 cdef
1. 9 ± 0.44 cd
12 bc
2.9 ± 0.43 bc
0.04 ± 0.49 b
MB4 4.0 8 12 fg
2.1 ± 0.31 bc
11 cd
3.1 ± 0.27 abc
0.03 ± 0.42 b
MB5 5.0 5 15 abc
2.3 ± 0.34 ab
12 bc
3.2 ± 0.06 abc
0.03± 0.04 b
MB6 5.0 6 17 a
2.1 ± 0.16 bcd
14 ab
3.8 ± 0.09 ab
0.04± 0.71 b
MB7 5.0 7 14 bcde
2.2 ± 0.16 bc
14 ab
3.8 ± 0.09 ab
0.04± 0.04 b
MB8 5.0 8 11 g
2.6 ± 0.47 a
9 d
4.1± 0.39 a
0.05± 0.51 b
MB9 6.0 5 14 bcd
1.9± 1.25 cd
13 abc
2.8 ± 0.90 bc
0.05 ± 0.63 b
MB10 6.0 6 16 ab
1.7± 1.29 d
15 a
2.9 ± 1.4 bc
0.06± 0.54 b
MB11 6.0 7 13 defg 1.8± 1.01 cd 0.11± 0.06 cd 14 ab 3.2± 0.62 abc 0.65± 0.54 a
MB12 6.0 8 12 efg
2.1 ± 0.29 bc
0.048 ± 0.34 d
12 bc
3.2 ± 0.03 abc
0.03± 0.32 b
LSD
1.850 0.352 0.092 2.017 0.897 0.076
Means followed by different letters in the same column differ significantly at P = 0.05 according to Duncan’s new multiple range test.
minitubers in vivo (Al-Safadi et al., 2000).
Conclusion
From the results, it appears that BA in combination with
high sucrose promotes in vitro microtuber induction and
development. To obtain higher number and larger size
microtubers, the media supplemented with BA and higher
sucrose level were found to be optimal for both cvs.
Figure 3. In vitro tuberization of nodal explant on MS medium
containing 6% sucrose and 6.0 mg/l BA Var. Cardinal (1x)
Desiree and Cardinal. Single node explants were
observed to be preferred over multinode explant. The BA
is stimulatory to starch metabolizing enzymes, thus
creating a strong metabolic sink. As a result, subsequent
accumulation of starch occurred which is seen as the
swelling of the microtuber. This combined ability can be
termed as an excessive substrate (high sucrose level)
and stimulus (BA) that triggers the enzymatic activity
in the tuberization processes. The cv. Desiree
genotypically, was found to be slightly slow in growth in in

Figure 4. In vitro tuberization of nodal explant on MS medium
containing 8% sucrose and 5.0 mg/l BA Var. Desiree (1x).
Figure 5. Microtubers harvested from MS medium containing
6% sucrose and 6.0 mg/l BA (1x).
Figure 6. Microtubers harvested from MS medium containing
8% sucrose and 5.0 mg/l BA (1x).
Aslam et al. 12743
Figure 7. Well developed microtubers of Cardinal obtained
from MS medium containing 6% sucrose and 6.0 mg/l BA.
Figure 8. Well developed microtubers of Desiree obtained from
MS medium containing 6% sucrose and 6.0 mg/l BA.
vitro microtuberization experiments than cv. Cardinal.
REFERENCES
Aafia A, Aamir A, Javed I (2007). An efficient protocol for microtuberization
in Potato (Solanum tuberosum L) cv. Cardinal. Life Sci. Int. J. 1(3): 340-
345.
Aksenova NP, Konstamtinova TN, Golyanovskaya SS, Kossmann J,
Willmitzer L, Romanov (2000). In vitro microtuberization in Potato.
Russ. J. plant physiol. 133(1): 23-27.
Al-Safadi B, Ayyoubi Z, Jawdat D (2000). The effect of gamma irradiation
on potato microtuber production in vitro. Plant Cell, Tissue Org. Cult.
61(3): 183-187.
Azzopardi N (1997). Micropropagation of Solanum tuberosum varieties
(Alpha and Desiree) for the productiuon of seed tubers (MSc
thesis). Institute of Agriculture Univ. Malta Malta.
Carlson C, Groza HI, Jiang J (2004). Induction of in vitro minimum
potato plant growth and microtuberization. Am. J. Potato Res. 81(1):
p. 50
Coleman WK, Donnelly DJ, Coleman SE (2001). Potato microtubers as
Research Tools: A Review. Am. J. Potato Res. 78: 47-55.
Gopal J, Chamail A, Sarkar D (2004). In vitro production of microtubers

12744 Afr. J. Biotechnol.
for conservation of potato germplasm: effect of genotype, abscissic
acis and sucrose. In vitro cell, Dev. Biol. Plant, 40: 486-490.
Haque MI (1996). In vitro microtuberization. Bdesh J. Bot. 25(1): 87-93.
Kanwal A, Ali A, Shoaib K (2006) In vitro microtuberization of Potato
(Solanum tuberosum L.) cultivar Kuroda- A new variety in Pakistan.
Int. J. Agric. Biol. 8(3): 337-340.
Khuri S, Moorby J (1995). Investigation into the role of sucrose in
Potato cv. ESTIMA microtuber production in vitro. Ann. Bot. 75(3):
296-303.
Mogollon N, Gallardo M, Hernandez N (2000). Effects of
benzylaminopurine, sucrose and culture method on microtuberization
of potatoes (Solanum tuberosum L.) cv. Andinita. Proceedings of the
Interamerican Society for Tropical. Horticulture, 42: 451-455
Murashige I, Skoog F (1962). A revised medium for rapid growth and
bioassay with tobacco tissue cultures. Physiol. Plant. 15: 473-487.
Nawsheen (2001). The effect of sucrose concentration in
micropropagation of Potato. Acta Hortic. 462: 959-963.
Shibli RA, Abu-Ein AM, Ajlouni MM (2001). In vitro and in vivo
multiplication of virus free “Spunta” potato. Pak. J. Bot. 33(1): 35-41.
Steel RGD, Torrie JH (1980). principles and procedures of statistics, 2 nd
edn. McGraw Hill Book Co. Inc. New York. 232-249.
Sushruti S, Chanemougasoundharam A, Debabrata S, Suman K (2004).
Carboxylic acids affect induction, development and quality of Potato
(Solanum tuberosum L.) Plant Growth Regul. 44(3): 219-229.
Vinterhalter D, Calovic M, Jevtic S (1997). The relationship between
sucrose and cytokinin in the regulation of growth and branching in
Potato. cv. Desiree shoot cultures. Acta Hortic. 462(13): 319-323.
Zhang ZJ, Zhou WJ, LI HZ, Zhang GQ, Sbrahmaniyan K, Yu JQ (2006).
Effect of jasmonic acid on in vitro explant growth and
microtuberization in Potato. Biologia Planta, 50(3): 453-456.
Zhijun Z, Weijun Z, Huizhen L (2005). The role of GA, IAA and BAP in
the regulation of in vitro shoot growth and microtuberization in Potato.
Acta. Physiol. 27: p. 363.

African Journal of Biotechnology Vol. 10(59), pp. 12745-12753, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB10.1266
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Meiothermus sp. SK3-2: A potential source for the
production of trehalose from maltose
Kian Mau Goh 1 *, Charles Voon 1 , Yen Yen Chai 1 and Rosli Md. Illias 2
1 Department of Biological Sciences, Faculty of Biosciences and Bioengineering (FBB), Universiti Teknologi Malaysia,
81310 Skudai, Johor, Malaysia.
2 Department of Bioprocess Engineering, Faculty of Chemical and Natural Resources Engineering, Universiti Teknologi
Malaysia, 81310 Skudai, Johor, Malaysia.
Accepted 10 March, 2011
Trehalose has similar chemical formula as maltose. In terms of price, trehalose is much more expensive
than maltose. A pink-pigmented bacterium identified as Meiothermus sp. SK3-2 was found to be able to
convert maltose to trehalose. Based on fatty acids analysis, the Meiothermus sp. SK3-2 may be a new
strain that produce trehalose synthase (TreS). Meiothermus sp. SK3-2 achieved a better biomass
growth in MM medium containing maltose. Besides that, TreS activity yield was also higher in MM
medium, approximately 3.5, 1.8 and 0.3 fold than that in PY medium, thermophilic Bacillus medium and
Castenholz medium, respectively. The optimum working temperature and pH for Meiothermus sp. SK3-2
TreS was 65°C and pH 6.0, respectively. Ammonium chloride at 10 mM increased the activity
significantly, while calcium chloride at 5 mM decreased the activity by about 80% and the activity was
fully retarded by 10 mM CaCl2. It was found that the product specificity of this TreS was influenced by
factors like temperature, pH and buffer system used. Analysis of the nucleotide sequence revealed the
presence of an open reading frame of 2,890 bp which encoded a 963 amino acid protein. In conclusion,
Meiothermus sp. SK3-2 TreS could serve as an alternative source to trehalose production.
Key words: Maltose, Meiothermus, trehalose, trehalose synthase.
INTRODUCTION
Trehalose is a disaccharide of two glucose monomers
that resembles maltose. Unlike maltose, trehalose is nonreducing
and is found naturally in invertebrates, plants,
yeasts, fungi and some prokaryotes bacteria. The
presence of this disaccharide is known to increase the
survival rate of some species typically during environment
stress. Due to that, diverse research has been done
to study the applications of trehalose.
*Corresponding author. E-mail: gohkianmau@utm.my. Tel:
+607-5534346. Fax: +607-5531112.
Abbreviations: GPase, α-1,4-D-Glucan phosphorylase;
MTHase, maltooligosyl trehalose trehalohydrolase; MTSase,
maltooligosyl trehalose synthase; PCR, polymerase chain
reaction; TreS, trehalose synthase; TPase, trehalose
phosphorylase; Topt., optimum temperature.
Formulation of vaccines is an important determinant for
the stability of the drug. Certainly in developing countries,
the need of stable vaccines at room temperature during
storage, handling and logistic is crucial (Amorij et al.,
2008). Addition of trehalose in vaccine for an example in
Newcastle disease (ND) strain I-2 (Wambura, 2009) has
indeed proven its importance.
Besides that, trehalose has been reported as a stabilizing
ligand or osmolytes for improving the stability of
protein during storage. Supplements of trehalose at
concentration of 10 to 30% improved the thermostability
of bovine serum albumin (BSA) (Lavecchia and Zuorro,
2010), while protein secondary structure for thermolabile
firefly luciferase was greatly stabilized by the addition of
trehalose and magnesium sulfate (Ganjalikhany et al.,
2009). Trehalose has also been found to stabilize amylolitic
enzyme such as α-amylase (Yadav and Prakash,
2009) and glucose oxidase (Paz-Alfaro et al., 2009).

12746 Afr. J. Biotechnol.
Trehalose is also a good cryopreservative for animal cells
(Shiva et al., 2010). Other function and applications of
trehalose were earlier suggested elsewhere, (Higashiyama,
2002).
In spite of many usages, the conventional approach to
obtain trehalose was extraction from yeast. In the 1990s,
the cost for trehalose was USD$700/kg (Paiva and
Panek, 1996). Since then, enzymatic approach to produce
trehalose was preferred as the production cost is lower
while yield is higher than the conventional approach. At
least three enzymatic reactions were known to produce
trehalose. In two-step reactions, enzyme GPase and
TPase convert starch into intermediates which are further
transform into trehalose. The second mechanism also involves
two reaction steps in which combination of
MTSase/TDFE and MTHase/TFE are able to produce
trehalose from maltodextrins. To date, only trehalose
synthase (TreS) converts maltose directly into trehalose
in a single step reaction (Schiraldi et al., 2002). In this
work, a locally isolated Meiothermus strain that exhibited
TreS activity was reported. Characterization of the strain
was described and the factors that affect the performance
of this enzyme were reported. The strain was isolated
from a famous geothermal spring in Malaysia. Sungai
Klah (SK) is a streamer hot spring located at N 3°59'44",
E:101°23'36" in Malaysia. It is one of the hottest springs
with temperature range from 60 to 110°C.
MATERIALS AND METHODS
Sample source and isolation
The temperature and pH of the collected water sample was 70°C
and pH 7.3, respectively. The collected water samples were kept at
4°C until use. Samples of 100 µl were spread on thermophilic
Bacillus medium (pH 7.5) (Atlas, 2004) containing (g/L): peptone,
8.0; yeast extract, 4.0 and NaCl, 3.0; solidified with 1.0% (w/v)
GELRITE and 0.1% (w/v) CaCl2·2H2O. All the plates were
incubated at 55°C for two days. Repeated streaking on the same
solid medium was done until purified single colonies were obtained.
Purity of the cultures was determined by colony morphology and
microscopic observation.
Microscopic and phenotypic characterization
Cellular morphology was observed under a light microscope (Leica
DMLS) at 1000× magnification. The microorganisms were observed
according to their cellular shape, arrangement and Gram-staining
reaction.
Fatty acid compositions
Analysis of cellular fatty acid methyl esters (FAME) was performed
at the MIDI Sherlock, India (Royal Life Sciences Pvt. Ltd.).
Comparison with established Meiothermus and Thermus sp. was
done manually.
16S rDNA sequence and phylogenetic analysis
Genomic DNA was extracted using Yeastern Biotech Genomic DNA
extraction kit after treating the cell wall with lysozyme solution. The
16S rDNA gene was amplified by PCR with YEAtaq DNA
polymerase (Yeastern Biotech) using bacteria-specific universal
forward primer 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and
reverse primer 1525R (5'-AAGGAGGTGATCCAGCCGCA-3')
(Baker et al., 2003). The PCR product was cloned into pGEM-T
system (Promega) and sequenced. A phylogenetic tree was
constructed by neighbor-joining method with a bootstrap value of
1000 replicates using software package MEGA 4.0 (Tamura et al.,
2007).
Biomass production using various media
A total of four media were used to screen for the best medium in
terms of biomass production and TreS activity. The media recipe
was in accordance with Atlas (2004), unless stated. The media
were named as MM (Sinkiewicz and Synowiecki, 2009) (g/L):
peptone, 5.0; yeast extract, 1.0; maltose, 5.0; the PY medium:
peptone, 0.4; yeast extract, 0.2; starch, 1.0 and the Castenholz
medium: nitrilotriacetic acid, 0.5; CaSO4. 2H2O, 0.5; MgSO4.7H2O,
0.5; NaCl, 0.04; KNO3, 0.5; NaNO3, 3.4; Na2HPO4.2H2O, 0.878;
FeCl3.6H2O, 0.01; ZnSO4.7H2O, 0.0025; H3BO3, 0.0025;
CuSO4.5H2O, 0.25; Na2MoO4.2H2O, 0.25; CoCl2.6H2O, 0.45;
tryptone, 5.0; yeast extract, 5.0. The original thermophilic Bacillus
medium that was used to isolate the strain was compared as well.
The growth was done simultaneously at 55°C.
Enzyme activity determination
After 48 h of culturing, the cells were lysed with sonicator and
centrifuged to collect the crude enzyme. The crude enzyme was
then reacted with maltose for 2 h at optimum temperature and pH.
The column used for detecting the sugars of interest was
WATERS ® NH2-column, while the mobile phase was 75:25 of
acetonitrile and purified water. The flow rate was controlled at 0.6
ml/min. As for the standards, high purity grade of glucose,
trehalose, maltose and maltotriose were prepared.
Optimum pH and temperature
The tested optimum pH range of the crude TreS activity was 5.5 to
8.0 using 20 mM sodium phosphate buffer, while the optimum
temperature was determined by incubating the enzyme with
maltose at different temperatures, ranging from 25 to 75°C.
Cloning of trehalose synthase gene
The isolated genomic DNA of Meiothermus SK3-2 was used as
template. Degenerated forward primer 5'-GTGGAYCCYCTYTG
GTACAAGG-3' and reverse primer 5'-TSKCCGGCCKKKKCCGK
CCASGG-3' were synthesized by a local company; First Base Sdn.
Bhd. Amplification using GoTaq polymerase (Promega) was
conducted in 50 µl under the following condition: initial denaturation
at 94°C for 2 min, followed by 30 cycles of 94°C for 50 s, 55°C for

0.01
98
84
74
93
100
Goh et al. 12747
79 Meiothermus sp. SK3-2 GU129930.1
95
91
Meiothermus rosaceus AF312766.1
Meiothermus ruber NR 027600.1
Meiothermus taiwanensis NR 025191.1
Meiothermus cerbereus Y13595.1
Meiothermus timidus AJ871168.1
Meiothermus chliarophilus NR 026244.1
Meiothermus silvanus NR 027600.1
Thermus thermophilus GU129930.1
Thermus aquaticus strain YT-1 NR 025900.1
Pyrococcus horikoshii D45214.1
Figure 1. Phylogenetic analysis of Meiothermus sp. SK3-2 and other taxa from Meiothermus and Thermus species. P.
horikoshii was chosen as an outgroup. Tree was generated with MEGA 4.0 program with bootstrap of 1000.
30 s, 72°C for 3 min and final extension at 72°C for 5 min.
RESULTS AND DISCUSSION
Morphological and biochemical analysis
Meiothermus sp. SK3-2 pure colonies appeared to be in
circular forms, convex elevations, smooth margins and
glistening surfaces. The size of the colonies was
approximately 0.9 mm and they were pink pigmented.
Under the light microscope with 1000× magnification,
cells were fine, occurred in chains and stained Gramnegative.
Meiothermus sp. SK3-2 had the optimum
growth at 55 to 65°C with maximum tolerance at 70°C.
The strain has a very broad range of growth pH, ranging
from pH 6.5 to 10.0. However, the preferred growth pH
was in the range of pH 7.5 to 8.5.
Phylogenetic analysis
Almost the complete 16S rDNA sequence of Meiothermus
sp. SK3-2 was found to be 1482 bp in length and has
been deposited with the accession number GU129930.
Neighbor-joining statistical method with bootstrap
replications number of 1000 was used to construct the
phylogenetic tree (Figure 1). Meiothermus strain SK3-2
and other reported Meiothermus strains formed a sister
line of descent with the species of Thermus genus.
Meiothermus and Thermus are closely related genera
inside the order of Thermales and were previously
categorized as the same genus. Meiothermus sp. SK3-2
has close16S rDNA similarity with Meiothermus rosaceus,
Meiothermus ruber, Meiothermus taiwanensis and
Meiothermus cerbereus. The phylogeny showed that
strain SK3-2 was more distantly related with Meiothermus
timidus, Meiothermus chliarophilus and Meiothermus
silvanus.
Mean fatty acid composition of Meiothermus sp. SK3-
2
Meiothermus sp. SK3-2 fatty acids are predominantly iso-
and anteiso-branched (Table 1). This is in good
agreement with other known Meiothermus strains with
iso- and anteiso-branched C15 and C17 fatty acid the
major acylchains. Straight chain saturated fatty acids and
unsaturated branched-chain fatty acids were found in
minor concentrations.
Determination of the best medium for biomass
production and enzyme activity
Four different media were used to grow Meiothermus
SK3-2. As strain SK3-2 grew slowly, sampling was done
every 8 h up to 48 h. According to Figure 2, Meiothermus
SK3-2 grew moderately in thermophillic Bacillus medium,
the medium that was previously used to isolate the strain.

12748 Afr. J. Biotechnol.
Table 1. Fatty acids comparison of various Meiothermus species.
Fatty acid 1 2 3 4 5
13:0 iso 0.6 0.4 0.4 0.7 1.5
14:0 iso 1.4 0.6 1.3 0.7 2.6
15:0 iso 20.7 25.9 30.9 38.4 35.5
15:0 anteiso 30.8 22.5 6.5 2.9 6.2
15:0 - 0.2 3.3 2.0 2.0
16:1 ω7c alcohol 0.6 - 0.7 - 2.0
16:0 iso 3.9 1.6 4.8 2.6 4.1
16:0 7.1 5.5 4.9 6.1 5.1
15:0 iso 3OH 0.7 - 0.2 - 0.6
15:0 2OH 0.8 - 0.9 0.3 0.4
17:0 iso 10.3 12.7 16.5 17.4 6.0
17:0 anteiso 9.8 6.9 4.4 2.4 1.6
17:1 ω8c 1.6 - 0.6 - 0.7
17:0 0.5 0.3 2.1 1.7 0.4
17:0 iso 3OH 0.6 - 1.5 - 4.7
1, Meiothermus sp. SK3-2; 2, M. silvanus; 3, M. ruber; 4, M. taiwanensis; 5, M. cerbereus.
600 nm
Figure 2. The effect of medium to cell growth of strain SK 3-2. Sampling was done every 8
hours. (■: MM medium, �: Castenholz medium, �: PY medium, �: thermophilic Bacillus
medium).
PY medium, which was supplemented with 0.1% starch,
did not significantly promote the growth. Castenholz
medium, on the other hand, minimized the lag phase of
the strain and within 20 h, maximum growth rate was
achieved. Although, the growth of cells in MM medium at
24 h was only half of the biomass using Castenholz
medium, prolonged incubation of 48 h maximized the
biomass up to approximately seven fold. The results
imply that Meiothermus SK3-2 readily utilized maltose (in
MM medium) but not starch as the main carbon source
(PY medium). This suggests that M. SK3-2 is unable to
hydrolyze starch. Some species such as M. ruber (Nobre
et al., 1996) and M. cerbereus (Chung et al., 1997)
were reported unable to utilized starch too;

Figure 3. Effect of temperature to performance of TreS. Using maltose as substrate,
trehalose forming activity was highest at 65°C while glucose was produced more at 50°C.
(■: trehalose forming, �: glucose forming).
however, M. chliarophilus and M. silvanus could (Nobre
et al., 1996).
Subsequently, equal volumes of Meiothermus SK3-2
cultures of the four media were centrifuged to collect cell
pellets and were sonicated. Cell-free lysate that contained
crude TreS was quantified using HPLC. For MM
medium, besides promoting high biomass weight,
Meiothermus SK3-2 exhibited the highest trehalose
synthase activity. Castenholz, thermophillic Bacillus and
PY media enabled the cells to exhibit comparatively lower
activity of 77, 35 and 22%, respectively of the activity
achieved in the MM medium. This suggested that, the
production of enzyme is cell weight associated and the
additional of maltose encouraged both cell propagation
and enzyme yield.
Effect of temperature and pH on enzyme activity
The enzyme samples were subjected to five temperatures;
25, 40, 50, 65 and 75°C. The highest enzyme
productivity obtained was at 65°C (Figure 3). When the
reaction mixture was incubated in room temperature, the
amount of trehalose was three times lesser than that
incubated at the optimum temperature. The optimum
temperature of 65°C is comparable with those of other
TreS from thermopiles, such as Thermus ruber TreS
(Sinkiewicz and Synowiecki, 2009) and Thermus
aquaticus TreS (Nishimoto et al., 1996) and was higher
than that of the thermophilic strain Thermobifida fusca
(Topt: 25°C) (Wei et al., 2004). A TreS gene from hyperacidophilic,
thermophilic archaea Picrophilus torridus
(Chen et al., 2006) was previously cloned. Its optimum
temperature of 45°C was much lower than that of TreS
from Meiothermus SK3-2. Other mesophilic trehalose
Goh et al. 12749
synthase for example in Corynebacterium nitrilophilus
NRC (Asker et al., 2009) and Arthrobacter aurescens
(Xiuli et al., 2009) had optimum temperatures of 35 and
25°C, respectively. This suggests that, Meiothermus
SK3-2 TreS may serve as a potential candidate for
application as heat tolerant enzymes and are more
feasible in industries.
It was found that Meiothermus SK3-2 TreS produced
glucose as a byproduct of the intramolecular transglycosylation.
The optimum temperature for this by-reaction
was 50°C, however higher temperature is needed to
produce trehalose. Therefore, it was suggested that
product specificity was strongly determined by the
reaction temperature.
The pH range of 5.5 to 8.0 was tested to determine the
optimum activity for Meiothermus SK3-2 TreS. Transglycosylation
reaction of Meiothermus SK3-2 TreS was
significantly influenced by the pH of the reaction. The
highest trehalose production happened at pH 6.0 and
gradually decreased, as the pH was increased. In
contrast, the transglycosylation reaction for glucose production
as a by-product was highest at pH 7.0 (Figure 4).
The results elucidate that, product specificity of TreS is
greatly influenced by temperature and pH and such claim
was not demonstrated clearly in earlier publications.
Effect of substrate concentrations and incubation
time on production of trehalose
Three different concentrations of maltose; 30, 60 and 90
mM were prepared in sodium phosphate buffer at pH 6.0
(Figure 5). The reaction was carried out at 65°C up to 16
h. Trehalose formation was rapid and reached the
maximum amount at an average of 7 h. When 30 mM

12750 Afr. J. Biotechnol.
Figure 4. Effect of pH to optimum performance of TreS. Using maltose as substrate, trehalose
forming activity was highest at pH 6.0 while glucose was produced more at pH 7.0. (■:
trehalose forming;�: glucose forming).
Trehalose production (ug/ml)
Figure 5. Production of trehalose using different concentrations of maltose (�, 30 mM
maltose; �, 60 mM maltose; ■, 90 mM maltose).
maltose was used as substrate, the maximum of approximately
120 µg trehalose/ml was formed. The amount of
trehalose formed was about 2.5 fold when 90 mM
maltose was utilized.
Effect of supplements on TreS activity
The effects of various supplements on trehalose production
are shown in Table 2. The control for this experiment
was the normal reaction of TreS on maltose without any
supplements. It was earlier mentioned that, glucose was
(h)
a by-product of Meiothermus SK3-2 trehalose synthase.
By additional of 1, 5 and 10 mM of glucose to the
reaction, the trehalose-forming activity dropped and was
only 65, 50 and 30%, respectively of that of the control.
This finding is in agreement with T. fusca TreS (Wei et
al., 2004) where glucose was reported as a competitive
inhibitor. Most possibly, the glucose binds at the same
location of the substrate binding site of the enzyme and
therefore, causes a hindrance to the conversion of the
substrate to product.
Besides glucose as a by-product, it was found that
maltotriose was also formed as a by-product by

Table 2. Relative activity of TreS in various supplement.
Supplement Relative activity (%)
Control 100
1 mM glucose 65
5 mM glucose 50
10 mM glucose 30
1 mM maltotriose 91
5 mM maltotriose 76
10 mM maltotriose 73
1 mM CaCl2
66
5 mM CaCl2
18
10 mM CaCl2
0
5 mM NH4Cl 114
10 mM NH4Cl 132
Meiothermus TreS. However, maltotriose peaks on HPLC
chromatogram was less significant during the first few
hours of the reactions. In prolonged reaction, for example
after 8 h, maltotriose peak was easily inspected on the
chromatogram. Table 2 shows that, when 1, 5 and 10
mM maltotriose was added into the reaction tubes, the
inhibition of Meiothermus SK3-2 Tres was found to be 9
to 27%. Comparison of glucose at equal concentration,
with maltotriose showed that maltotriose had less inhibition
effect. Maltotriose may binds more weakly to the
binding pocket of TreS.
The additional of CaCl2 is known to increase the
thermostability or activity of many amylolytic enzymes.
However, CaCl2 had extremely negative effect on TreS.
The relative activity was only 66% at 1 mM concentration,
while the reaction was fully retarded at 10 mM CaCl2.
This finding is in good agreement with TreS from P.
torridus (Chen et al., 2006); however, opposite observation
was noticed for A. aurescens trehalose synthase
(Xiuli et al., 2009).
Previously, comprehensive analysis of the effect of
metal ions and reagents on the activity of TreS from T.
aquaticus, A. aurescens and P. torridus were reported
(Nishimoto et al., 1996; Chen et al., 2006; Xiuli et al.,
2009). Nevertheless, trehalose synthase were found sensitive
to most of the tested salts. For the first time, it was
found that with the addition of 5 and 10 mM ammonium
chloride, the relative activity of TreS increased to 114 and
132%, respectively.
Effect of different buffer systems on product
specificity of trehalose synthase
Different buffer systems could offer different buffering and
ionic strength and therefore, influence the activity,
Goh et al. 12751
stability or even product specificity of enzymes. It was
found that pH 6.0 was the optimum pH for Meiothermus
SK3-2 TreS. At that pH, besides catalyzing the formation
of trehalose from maltose, the in house TreS also
produced glucose and maltotriose as by-products. The
effect of various buffers to product specificity was studied
also. Sodium phosphate, potassium phosphate, MES and
citrate buffer of pH 6.0 were compared. Data shown in
Figure 6 refers to the ratio of trehalose, glucose and
maltotriose at the 8 th hour of the reaction period.
Interestingly, most of the substrate maltose was
converted into glucose and maltotriose. When sodium
phosphate, potassium phosphate and citrate buffer were
used for reaction, the percentage of trehalose produced
was less than 20%. However, double increase in the
percentage was observed for the reaction carried out in
MES buffer. The actual reason behind this is unknown;
however, MES buffer system may create a slight different
protein structure conformation such as the active site or
binding pocket that changes the product specificity profile
2,886 bp that encoded a 962 amino acid protein.
DNA and protein sequence of Meiothermus SK3-2
TreS
Gene that encodes for Meiothermus SK3-2 TreS was
amplified using degenerated primers designed by
comparing four deposited trehalose synthase genes in
the NCBI database. The full-length gene of Meiothermus
SK3-2 TreS has been submitted to Genbank with accession
number HM587953. Analysis of the nucleotide
revealed a large, uninterrupted, single open reading
frame of 2,890 bp that encoded a 963 amino acid protein.
The predicted pI and molecular weight was 5.17 and 110
kDa, respectively. The sequence size of Meiothermus
SK3-2 TreS was much bigger than that of other cloned
trehalose synthase, for example A. aurescens TreS with
1,797 bp or 598 amino acids (Xiuli et al., 2009). However,
based on the public database, it seemed that TreS from
thermophile bacteria, that is, T. aquaticus has also
relatively longer sequence. Analysis for detecting repeat
sequence was done and replication sequence was not
identified for all the trehalose synthase from the thermophillic
strains. Thus, this suggests that the mature
sequence was indeed intact and probably monomeric.
Representative TreS amino acid sequences from ten
different bacteria source were aligned using Acceryls DS
Align123 program. The lengths for this sequence varied;
yet approximately, the first 490 amino acids shared
similarity of more than 60%. Five highly conserved
regions were identified and are summarized in Table 3.
These regions were taken with the cutoff of five consecutive
identical residues. Based on TreS Meiothermus
SK3-2 numbering, the strictly conserved regions were

12752 Afr. J. Biotechnol.
Figure 6. Effect of various buffer systems to product specificity of trehalose synthase (SP,
sodium phosphate; PP, potassium phosphate; MES, 2-(N-morpholino) ethanesulfonic acid.
Table 3. Strictly conserved region in trehalose synthase from various sources: Meiothermus SK3-2 (this study); A. aurescens
(ACL80570); Pimelobacter sp. (BAA11303); Corynebacterium glutamicum ATCC13032 (NP601502); Sphaerobacter thermophilus
DSM20745 (YP003319350); P. torridus DSM_9790 (YP022847); Salinibacter ruber (YP003570903); M. ruber DSM1279 (YP003508484);
T. thermophilus HB8 (YP143744) and Thermus caldophilus (AAD50660).
Origin of strain Region 1 Region 2 Region 3 Region 4 Region 5
Meiothermus SK-32
168
QPDLN
304
FLRNHDELTLE
339
GIRRRL
372
YYGDEIGMGD
A. aurescens
194
QPDLN
331
FLRNHDELTLE
366
GIRRRL
399
YYGDEIGMGD
Pimelobacter sp.
178
QPDLN
322
FLRNHDELTLE
357
GIRRRL
390
YYGDEIGMGD
C. glutamicum
215
QPDLN
353
FLRNHDELTLE
388
GIRRRL
421
YYGDEIGMGD
S. thermophilus
181
QPDLN
316
FLRNHDELTLE
351
GIRRRL
384
YYGDEIGMGD
P. torridus
171
QPDLN
306
FLRNHDELTLE
341
GIRRRL
374
YYGDEIGMGD
Salinibacterruber
173
QPDLN
314
FLRNHDELTLE
349
GIRRRL
382
YYGDEIGMGD
M. ruber
167
QPDLN
303
FLRNHDELTLE
338
GIRRRL
371
YYGDEIGMGD
T. thermophilus
167
QPDLN
303
FLRNHDELTLE
338
GIRRRL
371
YYGDEIGMGD
T. caldophilus
167
QPDLN
303
FLRNHDELTLE
338
GIRRRL
371
YYGDEIGMGD
168 to 172, 304 to 314, 339 to 344, 372 to 381 and 391
to 396.
Conclusions
A new pink-pigmented Meiothermus strain was isolated
from Malaysian’s hot spring. It was found that trehalose
synthase from this strain produced trehalose, maltose
and maltotriose at different ratio and was greatly
influenced by the reaction parameters. The gene that
encodes the TreS protein was isolated. This enzyme had
high optimum temperature which makes it a suitable
candidate in the production of trehalose in single step
reaction.
REFERENCES
391
VRTPMQ
418
VRTPMQ
409
VRTPMQ
440
VRTPMQ
403
VRTPMQ
393
VRTPMQ
401
VRTPMQ
390
VRTPMQ
390
VRTPMQ
390
VRTPMQ
Amorij JP, Huckriede A, Wilschut J, Frijlink HW, Hinrichs WLJ (2008).
Development of stable influenza vaccine powder formulations:
challenges and possibilities. Pharm. Res. 25: 1256-1273.
Asker MMS, Ramadan MF, El-Aal SKA, El-Kady EMM (2009).
Characterization of trehalose synthase from Corynebacterium
nitrilophilus NRC. World J. Microbiol. Biotechnol. 25: 789-794.
Atlas RM (2004). Handbook of microbiological media: CRC Press, Boca
Raton, Florida, USA.
Baker GC, Smith JJ, Cowan DA (2003). Review and re-analysis of
domain-specific 16S primers. J. Microbiol. Methods, 55: 541-555.
Chen YS, Lee GC, Shaw JF (2006). Gene cloning, expression, and
biochemical characterization of a recombinant trehalose synthase
from Picrophilus torridusin Escherichia coli. J. Agric. Food Chem. 54:
7098-7104.
Chung AP, Rainey F, Nobre MF, Burghardt J, Costa MSD (1997).
Meiothermus cerbereus sp. nov., a new slightly thermophilic species
with high levels of 3-hydroxy fatty acids. Int. J. Syst. Bacteriol. 47:

1225-1230.
Ganjalikhany MR, Ranjbar B, Hosseinkhani S, Khalifeh K, Hassani L
(2009). Roles of trehalose and magnesium sulfate on structural and
functional stability of firefly luciferase. J. Mol. Catal. B: Enzyme, 62:
127-132.
Higashiyama T (2002). Novel functions and applications of trehalose.
Pure Appl. Chem. 74: 1263-1270.
Lavecchia R, Zuorro A (2010). Effect of trehalose on thermal stability of
Bovine Serum Albumin. Chem. Lett. 39: 38-39.
Nishimoto T, Nakada T, Chaen H, Fukuda S, Sugimoto T, Kurimoto M ,
Tsujisaka Y (1996). Purification and characterization of a
thermostable trehalose synthase from Thermus aquaticus. Biosci.
Biotechnol. Biochem. 60: 835-839.
Nobre MF, Truper HG, da Costa MS (1996). Transfer of Thermus ruber
(Loginova et al., ( 1984), Thermus silvanus (Tenreiro et al., 1995),
and Thermus chliarophilus (Tenreiro et al., 1995) to Meiothermus
gen. nov. as Meiothermus ruber comb. nov., Meiothermus silvanus
comb. nov., and Meiothermus chliarophilus comb. nov., respectively,
and emendation of the genus Thermus. Int. J. Syst. Evol. Microbiol.
46: 604-606.
Paiva CL, Panek AD (1996). Biotechnological applications of the
disaccharide trehalose. Biotechnol. Annu. Rev. 2: 293-314.
Paz-Alfaro KJ, Ruiz-Granados YG, Uribe-Carvajal S, Sampedro JG
(2009). Trehalose-mediated thermal stabilization of glucose oxidase
from Aspergillus niger. J. Biotechnol. 141: 130-136.
Schiraldi C, Di Lernia I, De Rosa M (2002). Trehalose production:
exploiting novel approaches. Trends Biotechnol. 20: 420-425.
Goh et al. 12753
Shiva SRN, Jagan Mohanarao G, Atreja SK (2010). Effects of adding
taurine and trehalose to a Tris-based egg yolk extender on buffalo
(Bubalus bubalis) sperm quality following cryopreservation. Anim.
Reprod. Sci. 119: 183-190.
Sinkiewicz I, Synowiecki J (2009). Activity and primary characterization
of enzyme from Thermus ruber cells catalyzing conversion of maltose
into trehalose. J. Food Biochem. 33: 122-133.
Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: molecular
evolutionary genetics analysis (MEGA) software version 4.0. Mol.
Biol. Evol. 24: 1596-1599.
Wambura PN (2009). Formulation of novel trehalose flakes for storage
and delivery of newcastle disease (strain I-2) vaccine to chickens.
Afr. J. Biotechnol. 8: 6731-6734.
Wei YT, Zhu QX, Luo ZF, Lu FS, Chen FZ, Wang QY, Huang K, Meng
JZ, Wang R , Huang RB (2004). Cloning, expression and
identification of a new trehalose synthase gene from Thermobifida
fusca genome. Acta Biochim. Biophys. Sin. 36: 477-487.
Xiuli W, Hongbiao D, Ming Y, Yu Q (2009). Gene cloning, expression,
and characterization of a novel trehalose synthase from Arthrobacter
aurescens. Appl. Microbiol. Biotechnol. 83: 477-482.
Yadav JK, Prakash V (2009). Thermal stability of α-amylase in aqueous
cosolvent systems. J. Biosci. 34: 377-387.

African Journal of Biotechnology Vol. 10(59), pp. 12754-12761, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1041
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Synthesis and application of polyethylene
glycol/vinyltriethoxy silane (PEG/VTES) copolymers
Yin-Chun Chao 1 , Shuenn-Kung Su 1 , Ya-Wun Lin 2 , Wan-Ting Hsu 2 and Kuo-Shien Huang 2 *
1 Department of Materials Science and Engineering, National Taiwan University of Science and Technology, Taipei, 106
Taiwan.
2 Department of Materials Engineering, Kun Shan University, Yung Kang, Tainan, 71003 Taiwan.
Accepted 27 June, 2011
Many studies have explored dye wastewater treatment methods; however, concerns relating to the dye
wastewater composition and cost still exist. In this study, we used polyethylene glycol (PEG) and
vinyltriethoxy silane (VTES) in different proportions to produce a series of PEG-VTES copolymers, to
investigate the interaction between various dyes and the impact of these copolymers on dye
absorption. The copolymer molecular structure was confirmed by Fourier transform infrared
spectroscopy (FT-IR) and their impact on dye absorption and dye interaction was investigated. We
demonstrate that the series of copolymers produced displayed enhanced dye decolorization with
increasing copolymer dose and time. Additionally, the PEG/VTES copolymers and dyes interacted, as
the copolymer enabled a shift of the λmax of UV, reducing the absorbance. We also demonstrate that
addition of the copolymers reduced the overall zeta electrical potential value of the dye solution and
improved dye decolorization most potently at the lowest PEG-VTES molar ratio (2:1).
Key words: Polyethylene glycol, copolymer, compound, decolorization.
INTRODUCTION
With the development of the dye industry, dye wastewater
has emerged as a major source of water pollution. In
addition to a large number of organic substances, dye
wastewater possesses a deep color, toxicity and may
pollute the environment (Qi et al., 2009; Valeria et al.,
2008). Wastewater treatment methods include adsorption
procedures, chemical coagulation, membrane separation,
ultrasonic processes, oxidation processes, electrolytic
procedures and biological methods. These methods are
effective but are not without their disadvantages. Fenton’s
reagent and membrane filter techniques have been
applied to all dye types, but may cause sludge; the ozone
half-life is only 20 min after it is injected into water,
electrochemical destruction is safer but has high
electrical power costs and activated carbon adsorption
can remove various dyes, but is not cost-effective (Tim et
al., 2001). Thus, developing new copolymers for
wastewater treatment is required and the copolymer
*Corresponding author. E-mail: hks45421@ms42.hinet.net. Tel:
886-6-2050266. Fax: 886-6-2728944.
adsorption of dyes can be used to enhance textile color
prior to dye pre-treatment.
Polyethylene glycol (PEG; molecular formula H-(O-
CH2-CH2)n-OH) is a high-molecular weight polyether
compound produced by the interaction of ethylene oxide
with water, ethylene glycol or ethylene glycol oligomers.
PEG is a glycol non-ionic surface active agent in which
the oxygen atoms are hydrophilic, while the -CH2-CH2-
displays lipophilicity, meaning PEG is soluble in water
and most organic solvents (Inui et al., 2010; Zhao et al.,
2010; Sawant and Torchilin, 2010). PEG has many
physical and biological properties, including hydrophilicity,
dissolubility, non-toxicity, non-immunogenicity and no
reject reactions. It is widely used in the pharmaceutical
industry, agriculture, food handling, biological and
material science and chemical engineering fields
(Kitagawa et al., 2010). In recent years, a PEG functional
monomer has been used to prepare hydrogels of differing
structures (Hazer, 1992; Yildiz et al., 2010; Lynn and
Bryant, 2011; Diez, 2009; Stahl et al., 2010). For wastewater
treatment, PEG has served as a carrier for the
immobilization of activated sludge.
Vinyltriethoxy silane (VTES) is a silane containing

Table 1. Code description of vary copolymers.
PEG: VTES (mole ratio) Code
3 : 1 PV25
2 : 1 PV33
1 : 1 PV50
1 : 2 PV67
1 : 3 PV75
unsaturated double bonds. It produces graft or hydrolytic
condensation with free radicals (Zhi et al., 2011). Olefin
homo- or copolymers can be cross-linked with vinyltriethoxy
silane (Youngchan et al., 2008; Sachin et al.,
2005), including low-density polyethylene (LDPE), highdensity
polyethylene (HDPE), polypropylene (PP),
polyvinyl chloride (PVC), chlorinated polyethylene (CPE),
ethylene propylene rubber (EPR), ethylene vinyl acetate
(EVA) and other ethylene copolymers. Copolymers and
VTES are cross-linked through hydrolysis and condensation
reactions with alkoxy groups, which greatly
increase the impact strength, heat resistance, chemical
resistance, creep resistance, wear-resistance and
adhesive properties of the copolymers. Additionally,
VTES can use Sol-Gel to compose heterocyclic azo dyes
(Yen and Chen, 2010), but no relevant study on its
application to dye wastewater treatment has been
reported.
Many studies have explored dye wastewater treatment
methods; however, concerns related to the complex dye
wastewater composition and cost still exist. In this study,
we used the copolymerization of PEG and VTES in
varying proportions. We found that the copolymer
contains the ability of decolorization; the decolorization
can be rated the highest when the PEG: VTES (mole
ratio) was 2:1. The copolymer also interacted with dyes
and resulted in λmax of the dye solution shifted to the
wavelength. In addition, by adding the copolymer, a lower
zeta potential was obtainable and increased the
accumulation of the dye particles.
MATERIALS AND METHODS
Polyethylene glycol (PEG, M.W. 400), triethoxyvinylsilane (97%,
VTES) (Acros Organics), and ceric ammonium nitrate (CAN) (Acros
Organics) were obtained from Hayashi Pure Chemical Ind., Ltd.
Polyacrylamide (solid content 90%, commercially sold as highmolecule
coagulant, PAAm) was purchased from Seimao Chemical
Material Co., Ltd. and C.I. Direct Blue 146 was purchased from C.I.
Direct Blue 146.
Assay determination and methods
We used a FT-IR (Bio-Rad Digilab FTS-3000) and UV/vis
spectrophotometer (UV-vis) (JASCO V-530). The testing conditions
were 475 to 660 nm. For the decolorization rate test method, 0.05
g/l of dye solution was prepared and 100 ml of the solution was
added to the PEG/VTES copolymer. The solution was then stirred
for 20 min at 1000 rpm and left to stand for 4, 6, 8, 10, 12 or 24 min.
OH
SO 3Na
N N
OCH 3
N N
NaO 3S
Chao et al. 12755
The absorbance was assessed using the UV/vis spectrophotometer
decolorization rate (R) calculated as follows:
Everlight Chemical Industrial Corp.; the structural formula is as
follows:
Decolorization rate (R) = [ 1-(A/A0) ] × 100%
Where A0 = absorbance of the maximum wave prior to
decolorization; A = absorbance of the maximum wave after
decolorization (Ming et al., 2000).
PEG/VTES copolymer preparation
For the PEG/VTES copolymer preparation, PEG 400 was added to
a 250 ml reaction flask containing four necks, a stirring rod and a
thermometer. VTES was added dropwise into the solution through
an additional funnel. The solution was then stirred at ambient
temperature for 30 min and 0.5 g ammonium ceric nitrate was
added. The temperature of the solution was then increased to 60°C
for 6 h. The product numbers are shown in Table 1 (Arslan and
Hazer, 1999).
RESULTS AND DISCUSSION
FT-IR analysis of the copolymers
Figure 1 represents the infra-red spectra of PV67, VTES
and PEG. As shown in Figure 1c, the PEG characteristic
absorption peaks were 1296 and 1249 cm -1 , representing
the -C-O-C- absorption peak and 1103 and 945 cm -1 ,
representing the -C-O- absorption peak (Zhimei et al.,
2011; Hong et al., 2010; Philip et al., 2010). From Figure
1b, the VTES characteristic absorption peaks were 1101
and 775 cm -1 , representing the -Si-O-R- absorption peak,
956 cm -1 representing the -Si-OEt absorption peak and
1292 cm -1 representing the -Si-C-absorption peak (Yen
and Chen, 2010; Rakesh et al., 2004). Figure 1a displays
the PEG and VTES characteristic absorption peaks. As
PEG and VTES produced ether bonds, a wider
absorption band at 1105 cm -1 was evident, the -Si-C-
absorption peak at 1292 cm -1 shifted to 1298 cm -1 and
the -C-O-C peak at 1249 cm -1 shifted to 1255 cm -1 .
At 1644 cm -1 , the C=C absorption peak of the PV67
was weaker than that of VTES's, because copolymer still
contains a small amount of PEG impurity.
Figure 2 shows the infra-red spectra of products PV25,
PV33, PV50, PV67 and PV75. Increasing doses of VTES
led to more obvious hydrolytic condensation. The
characteristic -Si-O-R- absorption peak at 1091 to 1105
cm -1 represents a wide absorption band with increasing
doses of VTES. The -Si-O-R- absorption peak at 765 cm -1
NH

12756 Afr. J. Biotechnol.
Absorbance (a.u.)
A
B
C
Figure 1. IR spectra of the PV67, VTES and PEG. A, PV67; B, VTES; C, PEG.
also tended to be more significant.
1800 1700 1600 1500 1400 1300 1200 1100 1000 900 800 700
Application of PEG-VTES copolymers to dye solution
decolorization
The impact of the PEG and VTES molar ratio and
absorption time on the decolorization rate are shown in
Table 2. The decolorization rate (R%) in the dye solution
with the addition of the copolymers increased with time.
Table 2 demonstrates that PV33 displayed the optimal
decolorization rate, which was slightly increased
compared with PV25. Thus, the decolorization effects
increased with increasing doses of VTES during the
copolymer reaction, when the VTES dosage was less
than 33%. Following a comparison of PV50, PV67 and
PV75, the decolorization rate observed was PV50 >
PV67 > PV75. It was evident that the decolorization
displayed the reverse effect when the VTES dosage
exceeded 33%. PV33 displayed the optimal decolorization
effect, in the order of PV33 > PV25 > PV50 >
PV67 > PV75. The affinity proportion was optimal when
the synthetic copolymer of PEG: VTES molar ratio was
2:1. Under high-speed rotation, the product and dye
solution are mixed and as they collide in solution,
hydrogen bonds with an -OH in the dye molecular
Wavenumber (cm -1 )
-
structure and -SO3 decomposed from the dye molecules
are produced, leading to absorption and deposition
(Yongchun and Enpu, 2003). When VTES is present in
small proportions, the hydrophilic product dissolves in
water, meaning the adsorbed dye cannot deposit and the
discoloration effect worsens. If the VTES dosage is
excessive, the product becomes too lypophobic, so it
does not fully mix with the dye solution, reducing the
absorption effect. As shown in Table 2, as the time for the
product dye absorption increased, the decolorization ratio
increased. If the absorption time reaches 24 h, the
decolorization rate of PV25, PV33, PV50 and PV67
exceeded 90%. Polyacrylamide (PAAm) is the wastewater
treatment agent currently used in industry. For
comparison, the copolymer product decolorization ratio
exceeded that of PAAm. After several hours, the
decolorization rate of the product increased, while PAAm
displayed no significant effect. PAAm can be combined
with dyes; however, the solution viscosity increases when
PAAm is dissolved in water. As a result, the solid solution
displays a slow separation speed and the flocculate
displays a poor separation effect that does not deposit
quickly. Figure 3 shows the decolorization effect in the
dye solution with the addition of PV33 or PAAm. When
PV33 was added for 8 h, it was clearer than when PAAm
was added for same hours; there was still a deep color,

Absorbance (a.u.)
A
B
C
D
E
1500 1400 1300 1200 1100 1000 900 800 700
Figure 2. IR spectra of the copolymers. A, PV25; B, PV33; C, PV50, D, PV67; E, PV75.
Table 2. The effect of the decolor processing time on the decolor rate (%).
Copolymer a
4 6
Decolor process time (h)
8 10 12 24
PV25 74.14 80.59 82.18 82.27 82.91 92.10
PV33 77.09 81.55 82.60 83.61 85.19 93.04
PV50 71.89 76.09 80.58 80.29 83.17 92.22
PV67 69.27 74.76 75.15 77.79 79.06 91.34
PV75 35.12 54.02 58.98 60.44 63.46 72.12
PAAm 22.61 23.27 23.54 24.04 24.53 26.39
a The concentration was 1.0 g/100 ml.
and some flocculate had failed to deposit. Additionally,
the decolorization effect of PV33 increased with time over
24 h, while the decolorization effect of polyacrylamide
was not alter, consistent with the data in Table 2.
Impact of the PEG-VTES copolymer concentration on
the decolorization ratio of the dye solution
Table 3 illustrates the effects of the varying concen-
Wavenumber (cm -1 )
Chao et al. 12757
trations of the PEG-VTES copolymers on the
decolorization rate (R%) of the dye solution. Table 3
shows that the levels of PV25, PV33 and PV75 increased
with increasing doses of the copolymers, while the
decolorization rate also increased. Taking PV33 as an
example, the decolorization ratio was 69.53% when the
PV33 dosage was 0.5 g/100 ml, which increased
to83.30% when the PV33 dose increased to 3.0 g/100 ml.
As the product dosage increased, the increasing collision
rate of the product and dye molecules occurs, increasing

12758 Afr. J. Biotechnol.
Figure 3. The effect of the PV33 and PAAm on the decolor solutions under various
processing time [8 h: PV33 (A); PAAm(B); 24 h; PV33 (C); PAAm(D)].
Table 3. The effect of the copolymers concentrations on the decolor rate a (%).
Copolymer
Concentration of copolymer (g/100 ml) b
0.5 1.0 2.0 3.0
PV25 60.46 74.14 76.04 80.22
PV33 69.53 77.09 77.42 83.30
PV75 2.63 35.12 40.58 44.52
a Time of the decoloration was 4 h; b dye solution volume was 100 ml.
hydrogen bond production, leading to adsorption and
deposition, which increased the decolorization effect.
Interaction between PEG-VTES copolymer and dyes
Figure 4 shows the UV absorption spectrum of PV33 in
the dye solution, where A = the solution without product.
The PV33 concentrations of Figure 4B to I were 6.0×10 -4 ,
9.0×10 -4 , 1.5×10 -3 , 2.0×10 -3 , 3.0×10 -3 , 4.0×10 -3 , 5.0×10 -3
and 6.0×10 -3 g/l, respectively. The λmax of the dye solution
without the product was 566 nm, which did not change in
the presence of 6.0×10 -4 g/l PV33. However, the λmax of
the dye solution shifted to the shorter wavelength of 565
nm when the PV33 concentration increased to 9.0×10 -4
g/l. Further increases in the PV33 concentration led to
further shifts in the λmax towards shorter wavelengths.
When the PV33 concentration increased to 6.0×10 -3 g/l,
the λmax of the dye solution shifted to a shorter
wavelength (536 nm) compared with the dye solution
without the product, because the interaction between the
PV33 hydrophobic group and the dye affinity produced
new compounds (Sis and Birinci, 2009; Ofir et al., 2007;
Wanwisa et al., 2008). The compound formation led to a
blue shift in the UV absorption spectrum. The UV
absorbance reduced with increasing concentrations of
PV33, due to PV33 dye adsorption reducing the dye
concentration.
Zeta electrical potential under the interaction
between PEG-VTES copolymers and dyes
Figure 5 shows the zeta electrical potential in the
interaction between the PEG-VTES copolymers and
dyes. Figure 5A to E represent PV25, PV33, PV50, PV67

Absorbance
0.40
0.38
0.36
0.34
0.32
0.30
0.28
0.26
0.24
0.22
0.20
0.18
0.16
F
G
H
I
Figure 4. UV-Vis absorption spectra of the PV33. A, No added copolymer, concentration of the PV33 (g/l); B,
6.0×10 -4 ; C, 9.0×10 -4 ; D, 1.5×10 -3 ; E, 2.0×10 -3 ; F, 3.0×10 -3 ; G, 4.0×10 -3 ; H, 5.0×10 -3 ; I, 6.0×10 -3 ).
and PV75, respectively. Figure 5 shows that the zeta
potential value was lowest for PV33, while PV75
displayed the highest value. For the dye solution, the dye
particles and distributed media displayed frictional
electrification. Once the dye particles were electrified, the
dye molecules displayed electrostatic repulsion, meaning
that contact and accumulation between the dye particles
did not occur. The addition of the PEG-VTES copolymers
reduced the surface load of dye particles, reducing this
repulsive force. The particles were accumulated and
deposited during collisions (Lai and Chen, 2008; Sergey
et al., 2010; Safavi et al., 2008). When the dye solution
was added with PV33, the lowest zeta electrical potential
may have resulted from efficient dye accumulation and an
optimal decolorization effect. When PV75 was added to
the dye solution, the highest zeta electrical potential
means little effect on the reduction of the dye surface
load occurred. Thus, the particle accumulation effect was
not as efficient as PV25, PV33, PV50 or PV67 following
PV75 addition. These results are consistent with the
decolorization effects observed. Table 3 illustrates the
effects of the varying concentrations of the PEG-VTES
copolymers on the decolorization rate (R%) of the dye
solution. Table 3 shows that the levels of PV25, PV33 and
PV75 increased with increasing doses of the copolymers,
while the decolorization rate also increased. Taking PV33
500 550 600 650
Wavelength (nm)
C
D
E
Chao et al. 12759
as an example, the decolorization ratio was 69.53% when
the PV33 dosage was 0.5 g/100 ml, which increased to
83.30% when the PV33 dose increased to 3.0 g/100 ml.
As the product dosage increased, the increasing collision
rate of the product and dye molecules occurs, increasing
hydrogen bond production, leading to adsorption and
deposition, which increased the decolorization effect.
Interaction between PEG-VTES copolymer and dyes
A B
Figure 4 shows the UV absorption spectrum of PV33 in
the dye solution, where A = the solution without product.
The PV33 concentrations of Figure 4B to I were 6.0×10 -4 ,
9.0×10 -4 , 1.5×10 -3 , 2.0×10 -3 , 3.0×10 -3 , 4.0×10 -3 , 5.0×10 -3
and 6.0×10 -3 g/l, respectively. The λmax of the dye solution
without the product was 566 nm, which did not change in
the presence of 6.0×10 -4 g/l PV33. However, the λmax of
the dye solution shifted to the shorter wavelength of 565
nm when the PV33 concentration increased to 9.0×10 -4
g/l. Further increases in the PV33 concentration led to
further shifts in the λmax towards shorter wavelengths.
When the PV33 concentration increased to 6.0×10 -3 g/l,
the λmax of the dye solution shifted to a shorter
wavelength (536 nm) compared with the dye solution
without the product, because the interaction between the

12760 Afr. J. Biotechnol.
Zeta Potential (mV)
10
8
6
4
2
A
0
20 30 40 50 60 70 80
Figure 5. Zeta potential of the decolor solution. A, PV25; B, PV33; C, PV50; D, PV67; E, PV75.
PV33 hydrophobic group and the dye affinity produced
new compounds (Sis and Birinci, 2009; Ofir et al., 2007;
Wanwisa et al., 2008). The compound formation led to a
blue shift in the UV absorption spectrum. The UV
absorbance reduced with increasing concentrations of
PV33, due to PV33 dye adsorption reducing the dye
concentration.
Zeta electrical potential under the interaction
between PEG-VTES copolymers and dyes
Figure 5 shows the zeta electrical potential in the
interaction between the PEG-VTES copolymers and
dyes. Figure 5A to E represent PV25, PV33, PV50, PV67
and PV75, respectively. Figure 5 shows that the zeta
potential value was lowest for PV33, while PV75
displayed the highest value. For the dye solution, the dye
particles and distributed media displayed frictional
electrification. Once the dye particles were electrified, the
dye molecules displayed electrostatic repulsion, meaning
that contact and accumulation between the dye particles
did not occur. The addition of the PEG-VTES copolymers
reduced the surface load of dye particles, reducing this
repulsive force. The particles were accumulated and
deposited during collisions (Lai and Chen, 2008; Sergey
et al., 2010; Safavi et al., 2008). When the dye solution
B
C
VTES (mol%)
was added with PV33, the lowest zeta electrical potential
may have resulted from efficient dye accumulation and an
optimal decolorization effect. When PV75 was added to
the dye solution, the highest zeta electrical potential
means little effect on the reduction of the dye surface
load occurred. Thus, the particle accumulation effect was
not as efficient as PV25, PV33, PV50 or PV67 following
PV75 addition. These results are consistent with the
decolorization effects observed.
Conclusions
D
This study applied a titration of PEG and VTES to
investigate copolymerization and the impact of a series of
copolymers on both dye absorption and the interaction
between dyes. The following conclusions could be drawn
from this study; the product decolorization effect
increased as the VTES dose increased below 33% during
the reaction and the product decolorization effect reduced
when the VTES dose exceeded 33%. The order of the
product decolorization effects was PV33 > PV25 > PV50
> PV67 > PV75. The product decolorization rate
increased with increased time and product dosage and
for comparison, displayed a superior decolorization effect
than PAAm. The λmax of the dye solution in the absence of
the product was 566 nm. When the concentration of
E

PV33 reached 6.0×10 -3 g/l, the λmax of the dye solution
shifted to the shorter wavelength (536 nm) versus that of
the dye solution without product and the absorbance
lowered with increasing concentrations. The PEG/VTES
copolymers and dyes displayed an interaction and when
PV33 was added to the dye solution, the lowest zeta
electrical potential, indicating the most efficient accumulation
of the dye particles and optimal decolorization
effect occurred.
REFERENCES
Arslan H, Hazer B (1999). Ceric ion initiation of methyl metharcylate
using polytetrahydrofurane diol and polycaprolactone diol. Euro.
Polym. J. 35: 1451-1455.
Diez M, Mela P, Seshan V, Möller M, Lensen MC (2009). Nanomolding
of PEG-based hydrogels with sub-10-nm resolution. Small, 5(23):
2756-2760.http://dx.doi.org/10.1002/smll.200901313
Hazer B (1992). New macromonomeric initiators (macro-inimers) II
.gelation in the bulk polymerization of styrene with macroinimers.
Makromol. Chem. 193: 1081-1086.
Hong Y, Liutao L, Liqiang W, Zhiguo Z, Shiping Y (2010). Synthesis of
water soluble PEG-functionalized iridium complex via click chemistry
and application for cellular bioimaging. Inorg. Chem. Commun. 13:
1387-1390.
Inui O, Teramura Y, Iwata H (2010). Retention dynamics of amphiphilic
polymers PEG-lipids and PVA-Alkyl on the cell surface. ACS Appl.
Materials Interfaces, 2(5): 1514-
1520. http://dx.doi.org/10.1021/am100134v
Kitagawa F, Kubota K, Sueyoshi K, Otsuka K (2010). One-step
preparation of amino-PEG modified poly(methyl methacrylate)
microchips for electrophoretic separation of biomolecules. J. Pharm.
Biomed. Anal. 53(5)1272-
1277. http://dx.doi.org/10.1016/j.jpba.2010.07.008
Lai CC, Chen KM (2008). Dyeing properties of modified gemini
surfactants on a disperse dye-polyester system. Textile Res. J. 78(5):
382-389.
Lynn AD, Bryant SJ (2011). Phenotypic changes in bone marrow
derived murine macrophages cultured on PEG-based hydrogels
activated or not by lipopolysaccharide. Acta Biomaterialia. 7(1): 123-
132. http://dx.doi.org/10.1016/j.actbio.2010.07.033
Ming J, Zhao YJ, Zhang Y, Zhong H, Li RQ (2000). Decoloration of dye
wastewater using magaesium hydroxide. Technol. Water Treatment,
26(4): 245-248.
Ofir E, Oren Y, Adin A (2007). Electroflocculation: the effect of zetapotential
on particle size. Desalination, 204: 33-38.
Philip WL, Maya JJ, Rotimi ES (2010). Investigation of the degree of
homogeneity and hydrogen bonding in PEG/PVP blends prepared in
supercritical CO2: comparison with ethanol-cast blends and physical
mixtures. J. Supercrit. Fluids, 54: 81-88.
Qi W, Zhaokun L, Ning W, Jin L, Chengxi L (2009). The color removal of
dye wastewater by magnesium chloride/red mud (MRM) from
aqueous solution. J. Hazard. Mater. 170: 690-698.
Rakesh KS, Shraboni D, Amarnath M (2004). Surface modified ormosil
nanoparticles. J. Colloid Interface Sci. 277: 342-346.
Chao et al. 12761
Sachin J, Han G, Francesco P, Pieter M, Brahim M, Martin VD (2005).
Synthetic aspects and characterization of polypropylene–silica
nanocomposites prepared via solid-state modification and solgel
reactions. Polymer. 46: 6666-6681.
Safavi A, Abdollahi H, Maleki N, Zeinali S (2008). Interaction of anionic
dyes and cationic surfactants with ionic liquid character. J. Colloid
Interface Sci. 322: 274-280.
Sawant RR, Torchilin VP (2010). Polymeric micelles polyethylene glycolphosphatidylethanolamine
(PEG-PE)-based micelles as an example
Methods Mol. Biol. 624: 131-149.
Sergey VS, Nikolay OMP, Christian R (2010). A new application of
solvatochromic Pyridinium-N-Phenolate betaine dyes: examining the
electrophilicity of lanthanide shift reagents. Tetrahedron Lett. 51:
4347-4349.
Sis H, Birinci M (2009). Effect of nonionic and ionic surfactants on zeta
potential and dispersion properties of carbon black powders. Colloids
Surf., A. 341: 60-67.
Stahl PJ, Romano NH, Wirtz D, Yu SM (2010). PEG-based hydrogels
with collagen mimetic peptide-mediated and tunable physical crosslinks.
Biomacromolecules. 11(9): 2336-2344.
Tim R, Geoff M, Roger M, Poonam N (2001). Remediation of dyes in
textile effluent, a critical review on current treatment technologies with
a proposed alternative. Bioresour. Technol. 77: 247-255.
Valeria P, Valeria T, Cinzia P, Antonella A, Giovanni S, Giovanna CV
(2008). Decolourisation and detoxification of textile effluents by
fungal biosorption. Water Res. 42: 2911-2920.
Wanwisa K, Satit P, Thomas R, Thaned P (2008). Chitosan magnesium
aluminum silicate composite dispersions characterization of rheology,
flocculate size and zeta potential. Int. J. Pharm. 351: 227-235.
Yen MS, Chen CW (2010). The synthesis of vinyltriethoxysilanemodified
heteroaryl thiazole dyes and silica hybrid materials. Dyes,
Pigments, 86: 129-132.
Yildiz U, Kemik OF, Hazer B (2010). The removal of heavy metal ions
from aqueous solutions by novel pH-sensitive hydrogels. J.
Hazardous Materials. 183: 521-532.
Yongchun D, Enpu W (2003). Decoloration of direct dyeing wastewater
and its reuse Ind. Water Treatment, 23(8): 39-42.
Youngchan S, Deokkyu L, Kangtaek L, Kyung HA, Bumsang K (2008).
Surface properties of silica nanoparticles modified with polymers for
polymer nanocomposite applications. J. Ind. Eng. Chem. 14: 515-
519.
Zhao A, Zhou Q, Chen T, Weng J, Zhou S (2010). Amphiphilic PEGbased
Ether-Anhydride terpolymers synthesis, characterization, and
micellization. J. Appl. Polym. Sci. 118(6): 3576-
3585.http://dx.doi.org/10.1002/app.32724
Zhi H, Li C, Bin Z, Yuan L, De YW, Yu ZW (2011). A novel efficient
halogen-free flame retardant system for polycarbonate. Polym.
Degrad. Stab. 96: 320-327.
Zhimei S, Runliang F, Min S, Chenyu G, Yan G, Lingbing L, Guangxi Z
(2011). Curcumin-loaded PLGA-PEG-PLGA triblock copolymeric
micelles preparation, pharmacokinetics and distribution in vivo. J.
Colloid Interface Sci. 354: 116-123.

African Journal of Biotechnology Vol. 10(59), pp. 12762-12765, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.2997
ISSN 1684–5315 © 2011 Academic Journal
Full Length Research Paper
Fraud identification in fishmeal using polymerase chain
reaction (PCR)
Abbas Doosti*, Pejman Abbasi and Sadegh Ghorbani-Dalini
Biotechnology Research Center, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran.
Accepted 28 June, 2011
Fishmeal is an important commercial product that is obtained by processing the bones and whole fish.
It can be of great importance to enhance the feeding during the fattening of animals in poultry and
livestock. Detection of adulteration in fishmeal with other meats is important for livestock and poultry
production, and their health. The aim of this study was to identify fraud and adulteration in fishmeal
products using polymerase chain reaction (PCR) technique in Iran. Fishmeal samples of 124 were
collected from manufacturers and examined for presence of poultry and ruminants meats. Total DNA
was extracted from fishmeal samples and PCR was performed for gene amplification of meat species.
Out of 124 fishmeal products examined 9 (7.25%), 4 (3.22%) and 16 (12.9%) samples contaminated with
bovine, sheep and chicken, respectively. These findings showed few adulterations in used fishmeal in
Iran. The PCR is an effective and rapid technique with high accuracy that can be used to detect and
prevent fishmeal adulterations.
Key words: Fishmeal, adulteration, PCR.
INTRODUCTION
Fishmeal is a commercial product made of fish, bones
and fish processed offal. It is a good source of essential
amino acids, vitamins, phospholipids, fatty acids and
energy (Farajollahi et al., 2009). Fishmeal can be made
from almost any type of seafood but is generally
manufactured from wild-caught and small marine fish that
contain a high percentage of bones and oil, and usually
deemed not suitable for direct human consumption
(Farajollahi et al., 2009). Most fishmeal and fish oil is
manufactured from anchovies, sardines, capelin and
sand eels, and some of the fisheries that target these
species are considered to be well-managed (Bellagamba
et al., 2003).
The nutrient composition of fishmeal can vary
depending on the type and species of fish, the freshness
of the fish before processing and the processing methods
(Khatoon et al., 2006). High-quality fishmeal normally
contains between 60 and 72% crude protein by weight.
Fishmeal is a generic term for a nutrient-rich feed
ingredient used primarily in diets for domestic animals,
sometimes used as a high-quality organic fertilizer (Shi et
*Corresponding author. E-mail: biotechshk@yahoo.com. Tel:
+98-3813-361001. Fax: +98-3813-361001.
al., 2009). The vitamin content of fishmeal is highly
variable and influenced by several factors, such as origin
and composition of the fish, meal processing method and
product freshness (Nagase et al., 2009). The lipids in
fishes can be separated into liquid fish oils and solid fats.
Although most of the oil usually gets extracted during
processing of the fishmeal, the remaining lipid typically
represents between 6 and 10% by weight, but can range
from 4 to 20% (Cozzolino et al., 2009). Fish lipids are
highly digestible by all species of animals and are
excellent sources of the essential polyunsaturated fatty
acids (PUFA) in both the omega-3 and omega-6 families
of fatty acids. The majority of the fishmeal produced is
included in commercial diets for poultry, swine, dairy
cattle, mink and fish (Farajollahi et al., 2009). Worldwide,
millions of tons of fishmeal are produced annually.
Contrary to recent popular beliefs, most fishmeal and oil
are produced from sustainable, managed and monitored
fish stocks, reducing the possibility of over-fishing
(Bellagamba et al., 2003). Approximately 4 to 5 tons of
whole fish are required to produce 1 ton of dry fishmeal.
The quality of fishmeal is often questioned due to
adulteration with sheep, bovine and chicken, and it is
important for economic, safety of poultry and ruminants
(Khatoon et al., 2006). Several methods have been
developed recently to detect adulteration in fishmeal.

Table 1. Species-specific oligonucleotide primers and expected lengths of amplified segments.
Primer name Primer sequence Product size
Bovis
Sheep
Chicken
500 bp
400 bp
300 bp
200 bp
100 bp
F: 5´-GCCATATACTCTCCTTGGTGACA-3´
R: 5´-GTAGGCTTGGGAATAGTACGA-3´
F: 5´-ATGCTGTGGCTATTGTC-3´
R: 5´-CCTAGGCATTTGCTTAATTTTA-3´
Methods have been developed based on electrophoresis,
isoelectric focusing, chromatography, DNA hybridization,
polymerase chain reaction (PCR) and enzyme-linked
immunosorbent assay (ELISA) for detection of fishmeal
fraud (Ong et al., 2007). The purpose of this study was
the molecular detection of the rate of adulteration in
fishmeal with poultry and ruminants materials in Iran.
MATERIALS AND METHODS
Fishmeal sample and DNA extraction
A total of 124 samples of fishmeal were collected and examined for
presence of poultry and ruminants. Mitochondrial DNA (mtDNA)
was extracted from fishmeal samples using DNA extraction kit
(Roche applied science, Germany) according to the manufacturer’s
recommendations. The quality of extracted DNA was checked on
agarose gel electrophoresis and quantitation done by UVspectrophotometry.
Gene amplification
Species-specific oligonucleotide primers were used for gene
amplification (Luo et al., 2008). These primers and amplification
F: 5´-GGGACACCCTCCCCCTTAATGACA-3´
R: 5´-GGAGGGCTGGAAGAAGGAGTG-3´
1 2 3 4 5
274 bp 271 bp 266 bp
Figure 1. The electrophoresis of PCR products was generated by
species-specific oligonucleotide primers. Line 1 is a 100 bp DNA
ladder (Fermentas, Germany). Lines 2-5 are sheep, bovine, and
chicken amplified fragments, respectively and line 5 is negative
control.
271 bp
274 bp
266 bp
Doosti et al. 12763
fragment length are shown in Table 1. Species-specific DNA
segments of bovis, sheep and chicken were used for amplification
and detection of animal derived materials in fishmeal samples. PCR
amplification was carried out in a total volume of 25 µl in 0.5 ml
tubes containing 1 µg of mtDNA, 1 µM of each primers, 2 mM
Mgcl2, 200 µM dNTP, 2.5 µl of 10 × PCR buffer and 1 unit of Taq
DNA polymerase (Roche applied science, Germany).
PCR involved an initial denaturation at 94°C for 5 min; followed
by 30 cycles at 94°C for 1 min, annealing at 63°C for beef, 59°C for
sheep and 69°C for chicken, and extension at 72°C for 1 min; and a
final extension at 72°C for 6 min was done at the end of the
amplification. The PCR amplification products (10 µl) were
subjected to electrophoresis in a 1% agarose gel in 1 × TBE buffer
at 80 V for 30 min, stained with ethidium bromide, and images were
obtained in UVIdoc gel documentation systems (UK). The PCR
products were identified by 100 bp DNA size marker (Fermentas,
Germany).
RESULTS AND DISCUSSION
Amplification with species-specific oligonucleotide
primers revealed a 271, 274, and 266 bp from bovine,
sheep and chicken genomic DNA, respectively (Figure 1).
DNA extraction of fish, poultry, beef and pork were used

12764 Afr. J. Biotechnol.
Table 2. The range of poultry and ruminants derived materials in fishmeal samples in Iran.
Poultry and ruminants derived material Fishmeal samples (%)
Bovine 9 (7.25)
Sheep 4 (3.22)
Chicken 16 (12.9)
Total 23 (18.54)
for positive controls and were also run for each reaction
to ensure products obtained were of the correct size.
Tubes contained all mixture reaction without DNA was
used as negative controls.
PCR reactions for 124 samples of fishmeal were
denoted, 23 samples (18.54%) contaminated with poultry
and ruminants residuals. Out of 124 fishmeal products
examined 9 (7.25%), 4 (3.22%) and 16 (12.9%) samples
contaminated with bovine, sheep and chicken,
respectively.
Some samples were mixed with two or three bovine,
sheep and chicken residuals. The detail of the range of
poultry and ruminants derived material in fishmeal
samples of Iran is shown in Table 2.
Fishmeal is one of the important widely known
commercial products. It is also widely used as a food
source for variety of purposes such as poultry, pigs, cattle
and sheep (Cozzolino et al., 2009). The world-wide
supply of fishmeal is presently stable at several million
tons a year. Detection of adulteration and quality of
fishmeal is important for health of livestock, animal
nutrition and economic (Nagase et al., 2009). In addition,
determination of the species of origin of the meat
components in fishmeal products is an important task in
food hygiene, food codex, food control and veterinary
forensic medicine (Ayaz et al., 2006). Several methods
have been developed to identify fishmeal content. Each
method has advantages and disadvantages. The
conventional methodology used for the determination of
species origin in fishmeal and meat products had been
predominantly based on immunosorbent assay (ELISA),
immunochemical and electrophorectic analysis of protein.
Electrophoresis requires several hours and presents low
reproducibility (Ballin et al., 2009). Additionally, through
the acquisition of sequence data, DNA can potentially
provide more information than type of protein content,
due to the degeneracy of the genetic code and the
presence of many non-coding regions (Partis et al.,
2000). DNA hybridization (Wintero et al., 1990) and PCR
methods (Chikuni et al., 1994) have been used for the
identification of meats and fishmeal products. PCR is a
helpful technique for fishmeal and meat species
identification. The present study is focused on the use of
PCR technique for a rapid detection and identification of
meat species in fishmeal products of companies in Iran.
The results of this study showed good evidence for
molecular markers linked to genetic identification of
beef’s, sheep’s, and chicken’s meat in fishmeal products.
In current study from a total of 124 fishmeal samples, 23
samples (18.54%) contaminated with poultry and
ruminants derived materials. The ranges of bovine, sheep
and chicken meats in fishmeal samples are 7.25, 3.22
and 12.9%, respectively. In Iran beef and sheep meats
are abundant and cheaper than other meats, and
indicating the possibility of adulteration of companies for
economic reasons.
There are many studies for meat and fishmeal
adulterations. Hsieh et al. (1995) reported that beef or
lamb meat was found to be the contaminating species in
ground turkey sold in retail markets. The reasons for
substituting more expensive meat such as beef and lamb
with cheaper meat such as poultry include the use of the
unmarketable trimmings from expensive meats and
improper cleaning of the grinder between each change of
meat species prior to grinding (Hsieh et al., 1995). Meyer
et al. (1994) detected 0.5% pork in beef using the duplex
PCR technique. Their results revealed that PCR was the
method of choice for identifying meat species in muscle
foods. Furthermore, Meyer et al. (1995) detected 0.01%
soy protein in processed meat products using the nested-
PCR technique. Partis et al. (2000) detected 1% pork in
beef using RFLP, whereas Hopwood et al. (1999)
detected 1% chicken in lamb using PCR. Bellagamba et
al. (2003) detected mammalian and poultry adulteration
in fish meals and their results showed 0.125% beef,
0.125% sheep, 0.125% pig, 0.125% chicken and 0.5%
goat. The study of Aida et al. (2005) in Malaysia showed
PCR-RFLP is a potentially reliable technique for detection
of pig meat and fat from other animals for Halal
authentication. Khatoon et al. (2006) in Pakistan assayed
184 samples of fishmeal for proximate composition,
pepsin digestibility, salt, acid insoluble ash and
chromium. The results of their study showed a variation
in nutrient composition among samples. An inverse
relationship was observed between fat, ash, pepsin
digestibility, chromium and crude protein contents of
fishmeal. All the samples were adulterated with slightly
higher levels of sand and salt than recommended
(Khatoon et al., 2006).
Shally et al. used multiplex PCR technique for detection
of meat species via tracing of cytochrome b gene (Jain et
al., 2007). Ong et al. (2007) used three restriction
enzymes in PCR-RFLP using the mitochondrial
cytochrome b region to establish a differential diagnosis
which detect and discriminate between three meat
species and they showed this technique can be applied

to food authentication for the identification of different
species of animals in food products. Luo et al. (2008)
showed the application of a PCR for detection of beef,
sheep, pig and chicken derived materials in feedstuff and
indicated that high sensitivity and specificity of PCR
technique with a minimum detection level of 0.1%. Shi et
al. (2009) showed the feasibility of visible and near
infrared reflectance spectroscopy (NIRS) method for the
detection of fishmeal adulteration with vegetable meal.
The results of this study showed that the NIRS could be
used as a method to detect the existence and the content
of soybean meal in fishmeal. Nagase et al. (2009)
showed authentication of flying-fish-meal content of
processed food using PCR-RFLP. They distinguished
between flying fishes and the other fishes by combining
amplified DNA fragments with universally designed
primers and digesting the PCR products with AfaI and
MfeI restriction endonucleases.
Conclusion
In Iran, fishmeal is being used as a major animal protein
source and the results of current study suggested that full
screening of fishmeal samples will help to increase the
standard of animal feeds.
This study was performed at first time for molecular
detection of adulteration in fishmeal used in Iran. The
current study confirms previous findings and showed low
adulteration in used fishmeal in Iran. Since, the results of
this study might be useful for prevention and control of
adulterated and fraud in fishmeal products used in dairy
and poultry industry. So, molecular methods such as
PCR were suggested as an effective, rapid, reliable and
sensitive technique for the detection of adulteration in
fishmeal products used in dairy and poultry industry.
ACKNOWLEDGEMENTS
The authors thank the all staff of Biotechnology Research
Center of Islamic Azad University of Shahrekord Branch
in Iran for their sincere support.
REFERENCES
Aida AA, Che Man YB, Wong CMVL, Raha AR, Son R (2005). Analysis
of raw meats and fats of pigs using polymerase chain reaction for
Halal authentication. Meat Sci., 69: 47-52.
Ayaz Y, Ayaz ND, Erol I (2006). Detection of species in meat and meat
products using enzyme-linked immunosorbent assay. J. Muscle
Foods, 17: 214-220.
Ballin NZ, Vogensen FK, Karlsson AH (2009). Species determination –
Can we detect and quantify meat adulteration? Meat Sci., 83: 165-
174.
Bellagamba F, Valfrè F, Panseri S, Moretti VM (2003). Polymerase
chain reaction-based analysis to detect terrestrial animal protein in
fish meal. J. Food Prot., 66(4): 682-685.
Doosti et al. 12765
Chikuni K, Tabata T, Kosugiyama M, Monma M, Saito M (1994).
Polymerase chain reaction assay for detection of sheep and goat
meats. Meat Sci., 37: 337-345.
Cozzolino D, Restaino E, La Manna A, Fernandez E, Fassio A (2009).
Usefulness of near infrared refl ectance (NIR) spectroscopy and
chemometrics to discriminate between fishmeal, meat meal and soya
meal samples. Cien. Inv. Agr., 36(2): 209-214.
Farajollahi H, Aslaminejad AA, Nassiry MR, Sekhavati MH, Mahdavi1
M, Javadmanesh A (2009). Development and use of quantitative
competitive PCR assay for detection of poultry DNA in fish meal. J.
Anim. Feed. Sci., 18: 733-742.
Hopwood AJ, Fairbrother KS, Lockley AK, Bardsley RG (1999). An actin
gene-related polymerase chain reaction (PCR) test for identification
of chicken in meat mixtures. Meat Sci., 53: 227-231.
Hsieh YHP, Woodward BB, Ho SH (1995). Detection of species
substitution in raw and cooked meats using immunoassays. J. Food
Prot., 58: 555-559.
Jain S, Brahmbhait MN, Rank DN, Joshi CG, Solank JV (2007). Use of
cytochrome b gene variability in detecting meat species by multiplex
PCR assay. Indian J. Anim. Sci., 77(9): 880-888.
Khatoon S, NQ Hanif, Malik N (2006). Status of fish meal available for
poultry rations in Pakistan. Pak. Vet. J., 26(2): 97-98.
Luo J, Wang J, Bu D, Li D, Wang L, Wei H, Zhou L (2008).
Development and application of a PCR approach for detection of
beef, sheep, pig, and chicken derived materials in feedstuff. Agr. Sci.
China, 7(10): 1260-1266.
Meyer R, Candrian U, Luthy J (1994). Detection of pork in heated meat
products by the polymerase chain reaction. J. AOAC Int., 77: 617-
622.
Meyer R, Hofelein C, Luthy J, Candrian U (1995). Polymerase chain
reaction-restriction fragment length polymorphism analysis: A simple
method for species identification in food. J. AOAC Int., 78: 1542-
1551.
Nagase M, Maeta K, Aimi T, Suginaka K, Morinaga T (2009).
Authentication of flying-fish-meal content of processed food using
PCR-RFLP. Fish Sci., 75: 811-816.
Ong SB, Zuraini MI, Jurin WG, Cheah YK, Tunung R, Chai LC, Haryani
Y, Ghazali FM, Son R (2007). Meat molecular detection: Sensitivity of
polymerase chain reaction-restriction fragment length polymorphism
in species differentiation of meat from animal origin. ASEAN Food J.,
14(1): 51-59.
Partis L, Croan D, Guo Z, Clark R, Coldham T, Murby J (2000).
Evaluation of a DNA fingerprinting method for determining the
species origin of meats. Meat Sci., 54: 369-376.
Shi GT, Han LJ, Yang ZL, Liu X (2009). Methods of analyzing soybean
meal adulteration in fish meal based on visible and near infrared
reflectance spectroscopy. Guang Pu Xue Yu Guang Pu Fen Xi, 29(2):
362-366.
Wintero AK, Thomsen PD, Davies W (1990). A comparison of DNA
hybridization, immunodiffusion, countercurrentimmuno
electrophoresis and isoelectric focusing for detecting the admixture of
pork to beef. Meat Sci., 27: 75-91.

African Journal of Biotechnology Vol. 10(59), pp. 12766-12776, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.294
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Purification and characterization of a phytase from
Mitsuokella jalaludinii, a bovine rumen bacterium
G. Q. Lan 1,2 , N. Abdullah 1,3 , S. Jalaludin 4,5 and Y. W. Ho 1 *
1 Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia.
2 College of Animal Science and Technology, Guangxi University, Nanning, 530004 Guangxi, China.
3 Department of Biochemistry, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia.
4 Department of Animal Science, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia.
5 Academy of Sciences Malaysia, 50480 Kuala Lumpur, Malaysia.
Accepted 10 May, 2011
The phytase from Mitsuokella jalaludinii, a novel phytase-producing rumen bacterium, was purified 120fold
to near homogeneity and characterized. The phytase was completely cell-associated and about half
of the enzyme activity was released when the bacterial cells were incubated with 1.5 mol/l KCl solution
for 8 h. The optimum pH for phytase activity was in the range of 4.0 to 5.0 and the optimum temperature
was 55 to 60°C. The phytase was stable at pH 4.0 to 7.0. It was highly specific to sodium phytate as the
substrate, strongly inhibited by Cu 2+ , Zn 2+ , Fe 2+ and Fe 3+ , significantly stimulated by Ba 2+ and slightly
stimulated by Mn 2+ and Ca 2+ . The metal ions chelating agents, namely trisodium citrate, potassium
sodium tartrate and EDTA, did not show any inhibitory effect on the phytase activity of M. jalaludinii.
The phytase was also not inhibited by sulfhydryl inhibitor, 2-mercaptoethanol, and a carboxyl inhibitor,
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC).
Key words: Mitsuokella jalaludinii, bacterial phytase, rumen bacteria.
INTRODUCTION
Phytases, which catalyze the hydrolysis of phytate into
inorganic phosphate, inositol and inositol mono- to pentaphosphates,
appertain to the family of histidine acid
phosphatases (Pasamontes et al., 1997). Phytases are
present in many plants and microorganisms, especially
fungi. Phytases have also been reported to be present in
several bacterial species such as Pseudomonas spp.
(Richardson and Hadobas, 1997), Enterobacter sp.
(Yoon et al., 1996), Klebsiella aerogenes (Tambe et al.,
1994), Klebsiella terrigena (Greiner et al., 1997),
Klebsiella pneumonia (Sajidan et al., 2004), Escherichia
coli (Greiner et al., 1993), Bacillus subtilis (Powar and
Jagannathan, 1982; Shimizu, 1992; Kerovuo et al.,
1998), Citrobacter braakii (Kim et al., 2003) and
*Corresponding author. E-mail: ywho@ibs.upm.edu.my.
Tel: + 60-3-89472161. Fax: + 60-3-89472161.
Lactobacillus amylovorus (Sreeramulu et al., 1996). The
best characterized phytase, so far, is that from
Aspergillus ficuum. The phytase from A. ficuum NRRL
3135 was found to be a combination of activities from an
acid phosphatase and an 85 kDa glycosylated protein
with a preference for phytate as a substrate (Ullah, 1988).
The primary structure of phytase from A. ficuum has also
been determined using the chemical sequencing method
(Ullah, 1988). The enzymatic properties of phytases from
Aspergillus niger, Aspergillus terreus, Aspergillus
fumigatus, Emericella nidulans, Myceliophthora
thermophila and E. coli were characterized in detail by
Wyss et al. (1999). Of the bacterial phytases studied,
only phytases from Enterobacter sp. (Yoon et al., 1996),
B. subtilis (Powar and Jagannathan, 1982), B.
amyloliquefaciens (Ha et al., 1999) and L. amylovorus
(Sreeramulu et al., 1996) are extracellular while the
others are cell-bound (Greiner et al., 1993; Tambe et al.,
1994; Jareonkitmongkol et al., 1997; Yanke et al., 1999).

Most bacterial phytases have similar optimum temperatures
as fungi (50 to 60°C), but with a wider range of
optimum pH (4.0 to 7.5) (Yanke et al., 1999).
Although phytase activity from rumen bacteria was first
reported more than fifty years ago (Raun et al., 1956), it
was only much later that interest was generated to
identify phytase-producing rumen microorganisms. Yanke
et al. (1998) demonstrated that phytase activity was
present in numerous ruminal bacterial strains, particularly
Selenomonas ruminantium. In a subsequent study,
Yanke et al. (1999) undertook to characterize phytase
from S. ruminantium, and later D’Silva et al. (2000)
confirmed that the phytase of S. ruminantium was
distributed on the outer layer of the bacterial cell wall.
Except for these few reports on S. ruminantium, scanty
information is available on the characterization of phytase
from other rumen bacteria. Mitsuokella jalaludinii is a
phytase-producing bacterial species isolated from the
rumen of cattle (Lan et al., 2002a) and it has been found
to produce high phytase activity (Lan et al., 2002b, c,
2010). The study was carried out to purify and
characterize phytase from M. jalaludinii. To our
knowledge, this is a first report on the purification and
properties of a phytase from M. jalaludinii.
MATERIALS AND METHODS
Culture conditions and sample preparation
M. jalaludinii was maintained in an MF1 medium (pH 7.0) containing
10 g glucose, 4 g cellobiose, 4 g soluble starch, 10 g trypticase
peptone, 4 g yeast extract, 1.5 g L-cysteine.HCl.H2O, 100 ml
mineral solution, 50 ml 8% Na2CO3, 1 ml 0.05% hemin, 1 ml 0.1%
resazurin and 848 ml distilled water. The mineral solution comprised
0.45 g NaCl, 4.49 g (NH4)2SO4, 0.25 g CaCl2, 0.94 g MgSO4.7H2O,
3.45 g KCl and 1000 ml distilled water. The medium was prepared
using the anaerobic techniques of Hungate (1969). For phytase
production, MF1 medium containing 0.5% sodium phytate was
used. Sodium phytate solution was prepared by dissolving 5.0 g
sodium phytate in 100 ml of autoclaved MF1 medium, and the pH
adjusted to 7.1 before bubbling with oxygen-free CO2 until
colorless. The solution was filter-sterilized and 100 ml of it was
added aseptically into 900 ml of autoclaved MF1 medium. M.
jalaludinii was cultured in the medium anaerobically at 39°C for 8 h,
after which the culture was centrifuged at 8000 × g for 20 min at
4°C. The pellet was harvested (from 4 L of culture), washed twice
with 0.1 mol/l acetate buffer (pH 5.0) and used for phytase
purification.
Purification of phytase
The washed bacterial cell pellets were mixed with 250 ml 0.1 mol/l
cold acetate buffer (pH 5.0) (4°C) containing 1.5 mol/l KCl and
incubated overnight (8 h) after which it was centrifuged at 8000 × g
for 15 min. The cell free supernatant (crude extract) was collected
and concentrated to 50 ml using a concentrator (Centriplus TM , USA,
molecular weight cut-off is 10,000Da). The concentrated sample
was dialyzed against 20 mmol/l acetate buffer (pH 5.0) and then
used for ammonium sulfate precipitation at 45 to 85% saturation.
Lan et al. 12767
The fractions of precipitation showing phytase activities were
dissolved in a minimum volume of 0.1mol/l acetate buffer (pH 5.0),
pooled and dialyzed against 20 mmol/l acetate buffer (pH 5.0). Any
precipitation formed during dialysis was removed by centrifugation
at 10,000 × g for 30 min. All these operations described were
carried out at 4 ºC.
Anion exchange chromatography was carried out using a Bio-
Logic HR Chromatography System (Bio-Rad) under room
temperature. The dialyzed ammonium sulfate precipitated fraction
was loaded onto a UNO TM Q 1 anion column (Bio-Rad) equilibrated
with 20 mmol/l acetate buffer (pH 4.5). The column was washed
with 3 ml of the same buffer and the protein bound was eluted with
a linear gradient from 0 to 1.0 mol/l NaCl in 20 mmol/l acetate buffer
(pH 4.5). The flow rate was 1 ml/min and fractions of 1 ml each
were collected. Fractions showing phytase activity were pooled,
dialyzed against 20 mmol/l acetate buffer (pH 5.0) and
concentrated using the method previously described.
The concentrated fraction thus obtained was loaded again onto a
UNO TM Q 1 anion column. The column equilibration, buffer used,
flow rate and collected volume were the same as those described.
The eluted fractions showing phytase activities were pooled,
dialyzed against 20 mmol/l acetate buffer (pH 5.0) and
concentrated to about half of the original volume. After
concentration, protein purification was monitored by gradient
polyacrylamide gel electrophoresis (SDS-PAGE). Gradient
polyacrylamide gel electrophoresis was conducted using the
method of Laemmli (1970).
Phytase and protein assay
For the whole-cell phytase activity determination, the sample
preparation and method for measuring phytase activity were the
same as that described by Yanke et al. (1998) except that the
enzyme reaction time was set to 15 min. For the determination of
purified phytase (cell-free) activity, purified phytase was
appropriately diluted with 0.1 mol/l acetate buffer (pH 5.0). Then
0.01 ml of the diluted phytase sample was mixed with 1.24 ml
acetate buffer containing 0.2% sodium phytate and incubated at
39°C for 15 min (this mixture was designated as the standard assay
mixture). The reaction was terminated by adding 1.25 ml 5%
trichloroacetic acid (TCA). The released phosphorus was
determined by the method of Heinonen and Lahti (1981). A unit of
phytase activity is defined as the amount of enzyme that liberates 1
µmol P/min under the given assay conditions. Protein concentration
was measured by the method of Bradford (1976) using a protein
assay kit (Bio-Rad Lab., Richmond, CA) with bovine serum albumin
as the standard.
Characterization of phytase activity
The purified phytase was used for phytase activity characterization.
All tests were repeated three times, each with triplicates.
Effect of temperature on phytase activity
The substrate solution (0.1 mol/l acetate buffer containing 0.2%
sodium phytate, pH 5.0) was pre-incubated at the experimental
temperatures for 5 min, after which 0.01 ml of diluted phytase
solution (about 0.4 U phytase) was incubated with 1.24 ml of
substrate solution at 35, 39, 45, 50, 55, 60, 65, 70 and 75°C for 15
min. The released P was measured and the phytase activity was
calculated by the method previously described herein.

12768 Afr. J. Biotechnol.
Effect of pH on phytase activity and enzyme stability
The diluted phytase solution (0.01 ml) was mixed with various
buffers (1.24 ml) containing 0.2% sodium phytate and incubated at
39°C for 15 min. The buffers used were 0.1 mol/l glycine-HCL (pH
2.0, 2.5, 3.0 and 3.5), 0.1 mol/l sodium acetate buffer (pH 4.0, 4.5,
5.0 and 5.5), 0.1 mol/l sodium cacodylate-HCL (pH 6.0, 6.5 and 7.0)
and 0.1 mol/l Tris-HCL (pH 7.5 and 8.0).
To investigate the effect of different pH values on phytase
stability, 0.04 ml of purified phytase was mixed with 0.16 ml buffer
and incubated at room temperature for 60 min. The buffers used
were 0.2 mol/l citric-NaOH-HCL (pH 1.5, 2.0, 2.5 3.0, and 3.5), 0.2
mol/l sodium acetate buffer (pH 4.0, 4.5, 5.0 and 5.5), 0.2 mol/l
sodium cacodylate-HCL (pH 6.0, 6.5 and 7.0) and 0.2 mol/l tris-HCl
(pH 7.5 and 8.0). At the beginning (0 min) and the end (60 min) of
the incubation period, 0.02 ml of the mixture (phytase + buffer) was
mixed with 1.23 ml of 0.2 mol/l acetate buffer containing 0.2%
sodium phytate (pH 5.0) and incubated at 39°C for 15 min. The
released P was then determined as described herein.
Substrate specificity
Twelve (12) phosphate esters were used as substrates. They were
sodium phytate, α-D-glucose-1-phosphate, NADP, β-naphthyl
phosphate, D-fructose-1,6-diphosphate, ATP, D-fructose-6phosphate,
ρ-nitrophenyl phosphate, α-naphthyl acid phosphate,
DL-α-glycerophosphate, phosphoglycolic acid, and mannose-6phosphate.
The substrates were added separately to 0.1 mmol/l
acetate buffer solution to reach a final concentration of 2 mmol/l
and the pH was adjusted to 5.0. For every substrate, the assay
mixture was prepared by mixing 0.01 ml diluted phytase solution
with 1.24 ml substrate solution and the control assay mixture was
prepared by mixing 0.01 ml of thermally inactivated diluted phytase
solution (0 U phytase) with 1.24 ml substrate solution. The thermally
inactivated diluted phytase solution was prepared by incubating 0.5
ml of diluted phytase solution (in a clean glass tube) at 100°C for 10
min. The assay and control mixtures were incubated at 39°C for 15
min, after which the reaction was terminated by adding 1.25 ml of
5% TCA. The P concentrations in the assay and control mixtures
were determined separately using the method of Heinonen and
Lahti (1981). The difference in P concentrations between the assay
and control mixtures was used to calculate enzyme activity. The
relative activity of phytase using sodium phytate as a substrate was
considered as 100%.
Effects of reagents, ions and phosphate on phytase activity
The reagents used were NaN3, EDAC, 2-mercaptoethanol,
trisodium citrate, potassium sodium tartrate and EDTA and the ions
used were MgCl2, MnCl2, ZnCl2, CuCl2, BaCl2, CoCl2, CaCl2, FeSO4
and FeCl3. The reagent or cation solutions were prepared
separately by dissolving appropriate amounts of each reagent or
mineral compound in 0.1 mol/l acetate buffer (pH 5.0) to reach a
final concentration of 625 mmol/l. For phytase activity
determination, assay mixture was obtained by adding 0.01 ml of
diluted phytase solution (0.394 U phytase) and 0.1 ml of reagent or
cation solution to 1.14 ml 0.1 mol/l acetate buffer containing 0.2%
sodium phytate (pH 5.0). The final concentration of the reagent or
ion in the phytase assay mixture was 5 mmol/l. The standard assay
mixture (0.01 ml of diluted phytase solution + 1.24 ml of 0.1 mol/l
acetate buffer containing 0.2% sodium phytate) without reagent or
cation supplementation was used as the control. All assay mixtures
were incubated at 39°C for 15 min. Any precipitation formed during
the reaction was removed by centrifugation at 16,000 × g for 15 min
prior to spectrophotometric measurement of released P.
KH2PO4 was used to investigate the effect of phosphate on
phytase activity (whole cell phytase and purified phytase). Different
amounts of phosphate (KH2PO4) were added separately to 0.1 mol/l
acetate buffers containing 4 mmol/l phytate (pH 5.0) (substrate
solution) and to 0.1 mol/l sodium acetate buffers (pH 5.0) containing
M. jalaludinii whole-cell phytase (50 U phytase/ml) or diluted
purified phytase (50 U phytase/ml) to reach a final concentration of
0.0, 1.0, 2.0, 4.0, 6.0, 8.0 and 10.0 mmol/l. The pH of all the
solutions was kept at 5.0 by adjusting the pH with 2.0 mol/l HCl if
necessary. For phytase activity determination, 0.01 ml of phytase
solution and 1.24 ml of substrate solution (pH 5.0) (both solutions
contained the same phosphate concentration) were mixed and
incubated at 39°C for 15 min. The original phytase activity in the
assay mixture was about 0.4 U/ml. A. ficuum phytase (Sigma)
solution (50 U phytase/ml) instead of M. jalaludinii phytase was
used in the control assay mixture.
Distribution of enzymes
The fractionations of extracellular, periplasmic, cell-bound, and
intracellular enzymes were prepared using the method of Yoon et
al. (1996). In order to verify whether the phytase of M. jalaludinii
was associated with the membrane structure of the cells, the
washed intact cells collected from 10 ml of bacterial culture (10 h
incubation) were incubated in one-third original volume of 0.1 mol/l
acetate buffer (pH 5.0) containing an appropriate amount of ionic
compounds (0.25 to 3.5 mol/l KCl solution) or non-ionic compounds
(1.2% deoxycholate, 1.2% Triton X-100, and 1.2% Tween 80) for 10
h at 4°C. After incubation, the solution was centrifuged at 8000 × g
for 15 min at 4°C. The supernatant and cells were harvested and
the latter were resuspended in 10 ml of 0.1 mol/l acetate buffer (pH
5.0). The phytase activities of the different fractions were
determined using the method previously described herein.
Statistical analysis
Data obtained were analyzed using the General Linear Model
(GLM) procedure for analysis of variance (SAS Institute, 1997).
Significant differences among the treatment means were separated
by the Duncan’s new multiple range test at 5% level of probability.
RESULTS
Purification of phytase
A summary of the purification scheme is shown in Table
1. Through ammonium sulfate precipitation and anion
chromatographic purification (twice), the phytase of M.
jalaludinii was purified to about 120-fold and was eluted
as a single peak (Figure 1). However, this active fraction
migrated as two very close bands when subjected to
SDS-PAGE (Figure 2). Attempts to further purify the
fraction were unsuccessful as there was a very low
recovery rate after the second anion exchange
chromatography. This partially purified enzyme was used
for the characterization of phytase activity.

Table 1. Purification scheme of phytase from Mitsuokella jalaludinii
Step
Volume
(ml)
Total protein
(mg)
Total activity
(U)
Specific activity
(U/mg)
Lan et al. 12769
Purification
(folds)
Crude extract 250 240 2124 5.9 1
(HN4)2SO4 precipitation 25 110 1892 17.2 2.9
UNO Q 1 column 8 9.2 1216 137.9 23.4
UNO Q 1 column 4 0.6 423 705.0 119.5
Figure 1. Phytase-active fractions from the second anion exchange chromatography. (•)
absorbance (280 nm), (∆) NaCl gradient (mol/l), (- - -) phytase activity (U).
Effect of temperature on phytase activity
Phytase activity increased with increasing temperatures,
reaching a maximum at 55 to 60°C and then declining
very rapidly till it was almost undetectable at 75°C (Figure
3).
Effect of pH on phytase activity and stability
Phytase of M. jalaludinii was found to be most active in
the range of pH 4.0 to 5.0 at 39°C and virtually inactive at
pH 8.0 and pH 2.0 to 2.5 (Figure 4). The effect of pH on
phytase stability was tested in the pH range of 1.5 to 8.0.

12770 Afr. J. Biotechnol.
Figure 2. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) of purified phytase.
Lane 1: standard protein; Lane 2: protein with phytase activity from second anion
chromatography; Lane 3: protein with phytase activity from the first anion
chromatography; Lane 4: protein with phytase activity from ammonium precipitation.
Figure 3. Effect of temperature on the activity of M. jalaludinii phytase.
When the phytase was incubated in buffers with different
pH values for 60 min at room temperature, virtually no
loss in stability of M. jalaludinii phytase was observed at
pH 4.0 to 7.0, but at pH values less than 4.0 and more
than 7.0, the stability dropped drastically (Figure 5).
Substrate specificity
The results of the activities of M. jalaludinii phytase on 12
different phosphate esters used as substrates are
summarized in Table 2. The activity of M. jalaludini

Figure 4. Effect of pH on phytase activity of M. jalaludinii.
Figure 5. Effect of pH on the stability of M. jalaludinii phytase.
phytase was highest when sodium phytate was used as a
substrate and this showed that the enzyme was very
specific for phytic acid. The relative rates of hydrolysis of
the other 11 phosphate esters ranged from 0%
(phosphoglycolic acid and mannose-6-phoshpate) to
8.1% (α-D-glucose-1-phosphate) of the sodium phytate
hydrolysis rate.
Effects of reagents, ions and phosphate on phytase
activity
Results of the effects of reagents and cations on phytase
Lan et al. 12771
activity are shown in Table 3. All the reagents studied
had no significant (P > 0.05) effect on phytase activity.
Phytase activity was significantly (P < 0.05) activated by
Ba 2+ , Mn 2+ and Ca 2+ but not significantly (P > 0.05)
affected by Mg 2+ and Co 2+ . Cu 2+ and Zn 2+ significantly (P
< 0.05) inhibited phytase activity, and Fe 2+ and Fe 3+
almost completely (P < 0.05) inhibited the activity (Table
3)
The whole cell or the cell-free phytase activity of M.
jalaludinii was not phosphate-inhibited, even when the
phosphate concentration in the assay mixture was
increased to 10 mmol/l (Figure 6). In contrast, the
phytase activity of A. ficuum (which acted as a control),

12772 Afr. J. Biotechnol.
Table 2. Substrate specificity of M. jalaludinii phytase
Substrate Phytase activity (U)* Relative activity (%) †
Sodium phytate 0.3800 ± 0.0096 a 100.0
α-D-Glucose-1-phosphate 0.0308 ± 0.0014 b 8.1
NADP 0.0209 ± 0.0009 c 5.5
β-Naphthyl phosphate 0.0179 ± 0.0010 cd 4.7
D-Fructose-1, 6-diphosphate 0.0152 ± 0.0005 d 4.0
ATP 0.0110 ± 0.0010 de 2.9
D-Fructose-6-phosphate 0.0095 ± 0.0006 e 2.5
ρ-Nitrophenyl phosphate 0.0046 ± 0.0007 f 1.2
α-Naphthyl acid phosphate 0.0015 ± 0.0003 g 0.4
DL-α-Glycerophosphate 0.0004 ± 0.0001 h 0.1
Phosphoglycolic acid 0 0.0
Mannose-6-phosphate 0 0.0
*Values are means ± SE of combined values of three experiments, each with three replicates. a-h Means within the same column
with no common superscript differ significantly (P

Figure 6. Inhibitory effect of phosphate on phytase activity. ( ∆) M. jalaludinii
phytase (whole cell), (ο) M. jalaludinii phytase (cell free), (□) Aspergillus
ficuum phytase (cell free). The relative activity at 0 mmol/l of phosphate was
set at 100%. The original activity was 0.4 U/ml.
Table 4. Extraction of cell-associated phytase of M. jalaludinii*
Extraction compound Concentration (mol/l)
Phytase activity (%) †‡
Supernatant Cell-associated
None (control) 0.0 100.0
KCl 0.25 2.8 96.2
KCl 0.50 7.6 95.1
KCl 0.75 21.1 80.2
KCl 1.00 49.0 55.6
KCl 1.50 53.1 46.0
KCl 2.00 46.0 50.7
KCl 2.50 26.1 73.0
KCl 3.00 16.8 72.0
KCl 3.50 8.0 76.0
Deoxycholate 1.2% 1.2 95.1
Triton X-100 1.2% 6.7 94.6
Tween 80 1.2% 3.2 94.0
Lan et al. 12773
*All extractions were done in 0.1mol/l acetate buffer (pH 5.0). † Values are means of three experiments, each with four replicates.
‡ Percent activity of total cell phytase of control.
was drastically inhibited by phosphate added to the assay
mixture. At a low concentration of 1.0 mmol/l, only 19.4%
of activity of A. ficuum phytase was inhibited, but at high
concentrations of 4 mmol/l and 10 mmol/l, 60 and 97%
activities of A. ficuum phytase, respectively, were
inhibited.

12774 Afr. J. Biotechnol.
Localization of phytase of M. jalaludinii
The preliminary determination of the distribution of
phytase activities in the culture of M. jalaludinii showed
that 1.3% of phytase activity was in the cytoplasmic
fraction and 98.7% in the cell-bound fraction, but none
was found in the extracellular and periplasmic fractions.
Extraction of M. jalaludinii phytase from whole cells
increased with increasing KCl concentrations in the
incubation solution, reaching a maximum at a concentration
of 1.5 mol/l, after which the amount of phytase
released from the cells decreased with increasing
concentrations of KCl (Table 4). At the concentration of
1.5 mol/l KCl, about half (53.1%) of the total enzyme
activity was free from the cells into the supernatant. Only
a small percentage of the total enzyme was extracted
from the cells when non-ionic compounds such as
deoxycholate, Triton X-100 and Tween 80 were used,
respectively (Table 4).
DISCUSSION
The optimum temperature for phytase activity of M.
jalaludinii was 55 to 60°C. Although the optimum
temperature for phytase activity of Selenomonas
ruminantium JY35, an anaerobic rumen bacterium, is
also 55°C, the enzyme activity declines dramatically at
60°C (Yanke et al., 1999). The optimum temperatures of
phytase for most micro-organisms are in the range of 50
to 70°C. High optimum temperatures for phytase activity
have been observed in bacteria such as Klebsiella
aerogenes (60 to 70°C) (Tambe et al., 1994), and
Bacillus sp. DS11 (70°C) (Kim et al., 1998). Among
yeasts, Schwanniomyces castellii showed maximum
phytase activity at 77°C (Segueilha et al., 1992), while
Arxula adeninivorans and Pichia spartae at 75 to 80°C,
and Pichia rhodanensis at 70 to 75°C (Nakamura, 2000).
Phytase of Aerobacter aerogenes exhibited the lowest
optimum temperature at 25°C (Greaves et al., 1967).
The optimum pH of phytase activity of M. jalaludinii was
in the range of 4.0 to 5.0. The activity declined
significantly above pH 5.5. The moderately acidic pH
optimum of M. jalaludinii phytase indicates that this
enzyme belongs to the acidic phytases, as are most of
the so far characterized phytases of microorganisms:
Selenomonas ruminantium JY35, pH 4.0 to 5.5 (Yanke et
al., 1999); E. coli, pH 4.5 (Greiner et al., 1993);
Aerobacter aerogenes, pH 4 to 5 (Greaves et al., 1967);
Klebsiella aerogenes, pH 4.5 and 5.2 (Tambe et al.,
1994); Lactobacillus amylovorus, pH 4.4 (Sreeramulu et
al., 1996); Aspergillus terreus, pH 4.5 (Yamada et al.,
1968); Schwanniomyces castellii, pH 4.5 (Segueilha et
al., 1992); and all yeast strains studied by Nakamura et
al.( 2000), pH 3 to 5.5. These pH optima are different
from those of other bacterial phytases, such as pH 6.5 for
Bacillus subtilis (natto) N-77 (Shimizu, 1992), pH 7.0 for
Bacillus subtilis VTT E-68013 (Kerovuo et al., 1998) and
Bacillus sp. DS11 (Kim et al., 1998), and pH 7.0 – 7.5 for
Enterobacter sp. 4 (Yoon et al., 1996). Phytase from M.
jalaludinii was stable in the pH range of 4.0 to 7.0. When
the enzyme was incubated in more acidic buffers of pH
3.0 or less, about 34 to 96% of activity was lost. Similar
results have been reported by Kim et al. (1998) who
found that phytase from Bacillus sp. DS11 was stable at
a pH range of 4.0 to 8.0 and very low activity was
detected at pH values below 3.0. Greiner et al. (1993)
also found that phytase activity of E. coli was stable at pH
levels ranging from 3.0 to 9.0, but at pH values less than
3.0, the phytase stability decreased dramatically.
Wyss et al. (1999) pointed out that on the basis of
substrate specificity, phytases could be classified into two
classes: (i) phytases with broad substrate specificity such
as those from A. fumigatus, Emericella nidulans,
Myceliophthora thermophila (Wyss et al., 1999), canola
seed (Houde et al., 1990), germinated oat (Greiner and
Alminger, 1999), wheat (Nagai and Funahashi, 1962),
spelt (Konietzny et al., 1995), rye (Greiner et al., 1998)
and barley (Greiner et al., 1999); and (ii) phytases with
narrow substrate specificity, which are very specific for
phytate, such as those from A. niger, A. terreus, E. coli
(Wyss et al., 1999), Bacillus sp. DS11 ( Kim et al., 1998)
and Bacillus subtilis (natto) N-77 (Shimizu, 1992). The
results from this study showed that phytase from M.
jalaludinii belongs to the second class since it is highly
specific to sodium phytate and has very little or no activity
on other phosphate esters under the given assay
conditions. The very low specificity of M. jalaludinii
phytase to ρ-nitrophenyl phosphate, a general substrate
for acid phosphatase, indicates that the phytase is
different from the general acid phosphatase.
The metal ion chelating agents, namely trisodium
citrate, potassium sodium tartrate and EDTA did not
show any inhibitory effect on the phytase activity of M.
jalaludinii. Therefore, this enzyme, like many other
phytases is not a metallo-enzyme. The absence of effect
from the sulfhydryl inhibitor, 2-mercaptoethanol, on the
activity of M. jalaludinii phytase indicates that this enzyme
has no free and accessible sulfhydryl groups or the free
sulfhydryl groups play a negligible role in the enzyme
structure as in the activity. In contrast to the phytase of E.
coli (Greiner et al., 1993), the phytase of M. jalaludinii
was found to be insensitive to 1-ethyl-3-(3dimethylaminopropyl)
carbodiimide (EDAC), a carboxyl
inhibitor.
The study of the effect of metal ions on enzyme activity
revealed that phytase from M. jalaludinii displayed a
pattern of cation sensitivity similar to those of E. coli
(Greiner et al., 1993), Klebsiella terrigena (Greiner et al.,
1997) and Selenomonas ruminantium JY35 (Yanke et al.,
1999). The most significant inhibitory effect was by iron
cation. This has also been commonly observed in many

phytases from various sources. Greiner et al. (1993) and
Greiner and Alminger (1999) suggested that the inhibitory
effect of iron cations on E. coli and oat phytases was
attributed to the ability of the iron cations to combine with
phytate, which was evident by the presence of a
precipitate. However, in the study with Selenomonas
ruminantium JY35 phytase, Yanke et al. (1999) found
that precipitates were also obtained with Ba 2+ and Pb 2+ ,
but Ba 2+ did not inhibit the phytase activity and Pb 2+
significantly stimulated the activity. In the present study, it
was also found that precipitates were formed when Ba 2+ ,
Cu 2+ , Co 2+ , Fe 2+ or Fe 3+ was added into the substrate
solution to a final concentration of 5 mmol/l. However, the
inhibitory effects were only observed in Cu 2+ , Fe 2+ and
Fe 3+ . Co 2+ had no effect on enzyme activity. Ba 2+ was
found to significantly stimulate the phytase activity by up
to 50%. The reason for this is not known, and further
study is necessary to understand the mechanism(s)
involved.
It is generally recognized that inorganic phosphates
cause product inhibition (competitive inhibition) on
phytate hydrolysis (Howson and Davis, 1983). In the
present study, it was found that 60 and 97% of phytase
activity of A. ficuum was inhibited by 4 and 10 mmol/l
phosphate supplemented to the assay mixture,
respectively. However, no inhibition was detected on the
activity of M. jalaludinii phytase, even when phosphate
concentration was as high as 10 mmol/l in the assay
mixture. Kim et al. (1999) also reported that the phytase
activity of Bacillus amyloliquefaciens was not inhibited by
phosphate concentration of up to 5 mmol/l in the assay
mixture. The results from this study support the
suggestion of Yanke et al. (1998) that phytate is readily
hydrolysed by bacteria in the rumen, even though the
inorganic phosphate concentration in the rumen fluid can
be as high as 14 mmol/l when the animal is fed with
concentrate diet.
The study on the localization of phytase confirmed that
about 99% of phytase activity was cell-associated. The
phytase was readily extracted from the whole cell by high
concentration of KCl but not by Tween 80 and Triton X-
100. Similar results were also reported by D’Silva et al.
(2000) who found that the phytases of Selenomonas
ruminantium and Mitsuokella multiacidus (=M. multacida)
were readily extracted from the whole cells by high
concentrations of MgCl2 and KCl. By using transmission
electron microscopy, D’Silva et al. (2000) demonstrated
that the phytases of S. ruminantium and M. multiacidus
were associated with the outer membrane of the cell (out
layer of the cell wall).
This study showed that M. jalaludinii could be a
promising novel bacterial source of phytase. The
properties of the phytase from M. jalaludinii are
favourable for it to be used as an enzyme for improving
the availability of phytate phosphorus and minerals in
feedstuff for non-ruminants.
REFERENCES
Lan et al. 12775
Bradford MM (1976). A rapid and sensitive method for the quantitation
of microgram quantities of protein using the principle of protein-dye
binding. Analy. Biochem., 72: 248-252.
D’Silva CG, Bae HD, Yanke LJ, Cheng K-J, Selinger LB (2000).
Localization of phytase in Selenomonas ruminantium and Mitsuokella
multiacidus by transmission electron microscopy. Can. J. Microbiol.,
46: 391-395.
Greaves MP, Anderson G, Webley DM (1967). The hydrolysis of inositol
phosphates by Aerobacter aerogenes. Biochim. Biophys. Acta., 132:
412-418.
Greiner R, Konietzny U, Jany KD (1993). Purification and
characterization of two phytases from Escherichia coli. Arch.
Biochem. Biophys., 301: 107-113.
Greiner R, Haller E, Konietzny U, Jany KD (1997). Purification and
characterization of a phytases from Klebsiella terrigena. Arch.
Biochem. Biophys., 341: 201-206.
Greiner R, Konietzny U, Jany KD (1998). Purification and properties of a
phytase from rye. J. Food Biochem., 22: 143-161.
Greiner R, Alminger ML (1999). Purification and characterization of a
phytate-degrading enzyme from germinated oat (Avena sativa). J.
Sci. Food Agri., 79: 1453-1460.
Greiner R, Jany KD, Alminger ML (1999). Identification and properties
of a phytate-degrading enzymes from barley (Hordeum vulgare). J.
Cereal Sci., 30: 11-17.
Ha NC, Kim YO, Oh TK, Oh BH (1999). Preliminary X-ray
crystallographic analysis of a novel phytase from a Bacillus
amyloliquefaciens strain. Acta crystallogr. D. Biol. Crystallogr., 55:
691-693.
Heinonen JK, Lahti RJ (1981). A new and convenient colorimetric
determination of inorganic orthophosphate and its application to the
assay of inorganic pyrophosphatase. Analy. Biochem., 113: 313-317.
Houde RL, Alli I, Kermasha S (1990). Purification and characterization
of canola seed (Brassica sp.) phytase. J. Food Biochem., 14: 331-
351.
Howson SJ, Davis RP (1983). Production of phytate-hydrolysing
enzyme by some fungi. Enzyme Microbial. Technol., 5: 377-382.
Hungate RE (1969). A Roll Tube Method for Cultivation of Strict
Anaerobes. Methods Microbiol., 3B: 117-132.
Jareonkitmongkol S, Ohya M, Watanabe R, Takagi H, Nakamori S
(1997). Partial purification of phytase from a soil isolate bacterium,
Klebsiella oxytoca MO-3. J. Ferm. Bioeng., 83: 393-394.
Kerovuo J, Lauraeus M, Nurminen P, Kalkkinen N, Apajalahti J (1998).
Isolation, characterization, molecular gene cloning, and sequencing
of a novel phytase from Bacillus subtilis. Appl. Environ. Microbiol., 64:
2079-2085.
Kim YO, Kim HK, Bae KS, Yu JH, Oh TK (1998). Purification and
properties of a thermostable phytase from Bacillus sp. DS11. Enzyme
Microbial. Technol., 22: 2-7.
Kim DH, Oh BC, Choi WC, Lee JK, Oh TK (1999). Enzymatic evaluation
of Bacillus amyloliquefaciens phytase as a feed additive. Biotechnol.
Lett., 2: 925-927.
Kim H-W, Kim YO, Lee JH, Kim KK, Kim YJ (2003). Isolation and
characterization of a phytase with improved properities from
Citrobacter braakii. Biotechnol. Lett., 25: 1231-1234.
Konietzny U, Greiner R, Jany KD (1995). Purification and
characterization of a phytase from spelt. J. Food Biochem., 18: 165-
183.
Laemmli UK (1970). Cleavage of structural proteins during assembly of
the head of bacteriophage T4. Nature, 227: 680-685.
Lan GQ, Ho YW, Abdullah N (2002a). Mitsuokella jalaludinii sp. nov.
from the rumen of cattle in Malaysia. Int. J. Sys. Evol. Microbiol., 52:
713-718.
Lan GQ, Abdullah N, Jalaludin S, Ho YW (2002b). Culture conditions
influencing phytase production of Mitsuokella jalaludinii, a new
bacterial species from the rumen of cattle. J. Appl. Microbiol., 93:
668-674.
Lan GQ, Abdullah N, Jalaludin S, Ho YW (2002c). Optimization of

12776 Afr. J. Biotechnol.
carbon and nitrogen sources for phytase production by Mitsuokella
jalaludinii, a new rumen bacterial species. Lett. Appl. Microbiol., 35:
157-161.
Lan GQ, Abdullah N, Jalaludin S, Ho YW (2010). In vitro and in vivo
enzymatic dephosphorylation of phytase in maize-soya bean meal
diets for broiler chickens by phytase of Mitsoukella jalaludinii. Anim.
Feed Sci. Technol., 158: 155-164.
Nagai Y, Funahashi S (1962). Phytase (myoinositolhexaphosphate
phosphohydrolase) from wheat bran. Part I. Purification and substrate
specificity. Agri. Biol. Chem., 26: 794-803.
Nakamura Y, Fukuhara H, Sano K (2000). Secreted phytase activities of
yeasts. Biosci. Biotechnol. Biochem., 64: 841-844.
Pasamontes L, Haiker M, Henriquez-Huecas M, Mitchell D.B, van Loon
APGM (1997). Cloning of the phytases from Emericella nidulans and
the thermophilic fungus Talaromyces thermophilus. Biochim.
Biophys. Acta., 1353: 217-223.
Powar VK, Jagannathan V (1982). Purification and properties of
phytate-specific phosphatase from Bacillus subtilis. J. Bacteriol., 151:
1102-1108.
Raun A, Cheng E, Burroughs W (1956). Phytate phosphorus hydrolysis
and availability to rumen microorganisms. J. Agri. Food Chem., 4:
869-871.
Richardson AE, Hadobas PA (1997). Soil isolates of Pseudomonas spp.
that utilize inositol phosphate. Can. J. Microbiol., 43: 509-516.
Sajidan A, Farouk A, Greiner R, Jungblut P, Müller E-C, Borriss R
(2004). Molecular and physiological characterization of a 3-phytase
from the Rhizobacterium Klebsiella pneumonia ASRI. Appl. Microbiol.
Biotechnol., 65: 110-118.
SAS Insitute (1997). SAS ® Users Guide: Statistics: release 6.12.
Edition. SAS Institute Inc. Cary, NC.
Segueilha L, Lambrechts C, Boze H, Moulin G, Galzy P (1992).
Purification and properties of the phytase from Schwanniomyces
castellii. J. Ferm. Bioeng., 74: 7-11.
Shimizu M (1992). Purification and characterization of phytase from
Bacillus subtilis (natto) N-77. Biosci. Biotechnol. Biochem., 56: 1266-
1269.
Sreeramulu G, Srinivasa DS, Nand K, Joseph R (1996). Lactobacillus
amylovorus as a phytase producer in submerged culture. Lett. Appl.
Microbiol., 23: 385-388.
Tambe SM, Kaklij GS, Kelkar SM, Parekh LJ (1994). Two distinct
molecular forms of phytase from Klebsiella aerogenes: Evidence for
unusually small active enzyme peptide. J. Ferm. Bioeng., 77: 23-27.
Ullah AHJ (1988). Aspergillus ficuum phytase: Partial primary structure,
substrate selectivity, and kinetic characterization. Preparative
Biochem., 18: 459-471.
Wyss M, Brugger R, Kronenberger A, Rémy R, Fimbel R, Oesterhelt G,
Lehmann M, van Loon APGM (1999). Biochemical characterization of
fungal phytases (Myo-inositol hexakisphosphate
phosphohydrolases): Catalytic properties. Appl. Environ. Microbiol.,
65: 367-373.
Yamada K, Minoda Y, Yamamoto S (1968). Phytase from Aspergillus
terreus. Part I. Production, purification and some general properties
of the enzyme. Agri. Biol. Chem., 32: 1275-1282.
Yanke LJ, Bae HD, Selinger LB, Cheng K-J (1998). Phytase activity of
anaerobic ruminal bacteria. Microbiology, 144: 1565-1573.
Yanke LJ, Selinger LB, Cheng KJ (1999). Phytase activity of
Selenomonas ruminantium: a preliminary characterization. Lett. Appl.
Microbiol., 29: 20-25.
Yoon SJ, Yun JC, Hae KM, Kwang KC, Jin WK, Sang CI, and Yeon HJ
(1996). Isolation and identification of phytase-producing bacterium,
Enterobacter sp. 4, and enzymatic properties of phytase enzyme.
Enzyme Microbial. Technol., 18: 449-454.

African Journal of Biotechnology Vol. 10(59), pp. 12777-12781, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1165
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Effect of different levels and particle sizes of perlite on
carcass characteristics and tibia ash of broiler chicks
Hamid Reza Ebadi Azar 1 *, Kambiz Nazer Adl 1 , Yahya Ebrahim Nezhad 1 and Mohammad
Moghaddam 2
1 Department of Animal Science, Islamic Azad University, Shabestar Branch, Shabestar, Iran.
2 Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Tabriz, Tabriz, Iran.
Accepted 27 June, 2011
The objective of this study was to investigate the effects of different levels and particle sizes of perlite
in broiler chicks’ diets on carcass characteristics and tibia ash. For the stated purpose, 308 Ross
broiler chicks of 280-day-old were allocated to seven treatments and four replications in a factorial
experiment on the basis of randomized complete block design. One factor consisted of two particle
sizes of perlite (1.5 and 3 mm) and the other factor included three levels of perlite (1, 3 and 5% of diet).
A control treatment with no perlite was also included in the experiment. Based on the results obtained,
the perlite levels and particle sizes did not affect the weight percentage of net carcass, pectoral, thighs,
heart, liver, spleen and abdominal fat, however, they influenced the gizzard weight significantly
(P

12778 Afr. J. Biotechnol.
Figure 1. Microscopic image of the porous texture of perlite (Anonymous, 1993).
Materials and methods
Table 1. Chemical composition of perlite.
Element Percent
Si 33.8
Al 7.2
K 3.5
Na 3.4
Fe 0.6
Ca 0.6
Mg 0.2
Trace elements 0.2
O2
47.5
Water 3.0
Anonymous (1993).
In this study, 308 Ross broiler chicks of 280-day-old were allocated
to seven treatments and four replications in a factorial experiment
on the basis of randomized complete block design. Factors were
particle size (1.5 and 3 mm) and levels (1, 3 and 5% of diet) of
perlite. In addition, a treatment with no perlite was included as the
control group. Therefore, the experiment consisted of seven
treatments. In order to control the possible variation in
environmental factors, such as light and ventilation along the
experimental site, the site was divided into four complete blocks
and the treatments were randomly allocated in each block. The
perlite used in this study was extracted from perlite mines of East
Azerbaijan province and its purity was proved by chemical analysis
based on the recommendations of the relevant factory.
At day 49, carcass characteristics were assessed using Scholty
Sek technique and the remained tibia ash were measured through
the burning method by removing the organic material (Khosroshahi
Asl, 1997). Energy and protein content of the diets were identical
and they only differed in the levels and particle sizes of perlite.
Nutritional requirements of broiler chickens during the growing
periods were balanced according to the recommendations of the
National Research Council (NRC,1994) and using the user friendly
feed formulation done again (UFFDA) software. The diets used in
this research and supplied nutrients in starter, grower and finisher
periods are given in Table 2. Analysis of variance and mean
comparisons by Duncan’s new multiple range test (5% probability
level) were performed using MSTATC 11 and SPSS 16.0 software.
Effect of perlite on performance traits such as body weight, body
weight gain and feed conversion rate were reported elsewhere
(Ebadi Azar et al., Journal of Animal Science, Islamic Azad
University, Shabestar Branch; In print).
Results and Discussion
No significant differences were observed among the
experimental treatments for net carcass weight
percentage (Table 3). Yalcin et al. (1995) also found that

Table 2. Composition of the experimental diets.
Ebadi Azar et al. 12779
Ingredient Starter diet (days 1 to 21) Grower diet (days 22 to 42) Finisher diet (days 43 to 49)
Corn 43.91 44.26 46.86 49.36 54.74 54.92 54.30 56.72 57.87 57.44 56.37 59.49
Soybean meal (44% P) 33.93 34.58 35.91 37.31 25.66 26.25 27.42 28.96 21.16 21.72 22.86 24.32
Wheat 7.00 7.00 7.00 0.00 5.50 5.50 4.00 1.00 5.00 4.50 4.50 2.00
Barley 3.00 3.00 0.06 0.00 5.00 4.00 2.50 1.20 6.00 5.00 5.00 1.17
Wheat bran 5.03 3.02 0.00 0.00 4.00 3.00 2.50 0.50 4.97 4.84 2.25 1.50
Sunflower oil 3.50 3.50 3.50 4.65 1.75 1.98 2.92 3.25 2.00 2.50 3.00 3.50
Calcium carbonate 1.33 1.31 1.29 1.28 1.27 1.25 1.24 1.22 1.20 1.19 1.17 1.16
Dicalcium phosphate 1.27 1.30 1.34 1.35 1.12 1.14 1.16 1.19 0.94 0.94 0.98 1.00
Salt 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25
Mineral premix* 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25
Vitamin premix †
0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25
DL-Methionine 0.15 0.15 0.15 0.15 0.06 0.06 0.06 0.06 0.01 0.01 0.01 0.01
Vitamin E 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10
Cocsidio acetate 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.00 0.00 0.00 0.00
Perlite 0.00 1.00 3.00 5.00 0.00 1.00 3.00 5.00 0.00 1.00 3.00 5.00
Calculated nutritive values
ME, kcal/kg 2900 2900 2900 2900 2900 2900 2900 2900 2950 2950 2950 2950
CP (%) 20.85 20.85 20.85 20.85 18.125 18.125 18.125 18.125 16.594 16.594 16.594 16.594
P:ME ratio 139.09 139.09 139.09 139.09 160.00 160.00 160.00 160.00 177.78 177.78 177.78 177.78
Ca (%) 0.89 0.89 0.89 0.89 0.818 0.818 0.816 0.816 0.74 0.74 0.74 0.74
Available P (%) 0.40 0.40 0.40 0.40 0.362 0.362 0.362 0.362 0.322 0.322 0.322 0.322
Cl (%) 0.20 0.20 0.19 0.19 0.197 0.195 0.193 0.190 0.19 0.19 0.19 0.19
K (%) 0.92 0.91 0.89 0.90 0.77 0.77 0.77 0.77 0.70 0.70 0.70 0.70
Na (%) 0.13 0.13 0.13 0.13 0.126 0.125 0.124 0.122 0.125 0.125 0.123 0.122
Lysine (%) 1.16 1.17 1.19 1.22 0.95 0.95 0.97 0.98 0.83 0.84 0.85 0.87
Methionine (%) 0.45 0.44 0.45 0.45 0.35 0.35 0.35 0.36 0.34 0.34 0.34 0.34
Methionine + Cysteine
(%)
0.82 0.81 0.81 0.82
0.67 0.67 0.67 0.68
0.66 0.66 0.67 0.67
*Supply per kg food: 333 mg MnO; 220 mg ZnSO4 7H2O; 450 mg ferric citrate; 35 mg CuSO4 4H2O; 2 mg KIO3; 1 mg CoSO4 8H2O; 0.35 mg Na2SeO3. † Supply per
kg food: 900 µg retinol; 15 µg cholecalciferol; 2 mg menadione sodium bisulphate; 2 mg thiamine; 5 mg riboflavin; 15 mg calcium pantothenate; 30 mg niacin: 3.5
mg pyridoxine; 0.2 mg biotin; 0.6 mg folic acid; 0.02 mg vitamin B12; 200 mg choline chloride.

12780 Afr. J. Biotechnol.
Table 3. Mean values of carcass characteristics and tibia ash in 49-day old broiler chickens fed on diets containing different levels and particles sizes of perlite.
Treatment Carcass characteristic (percentage of live weight)
Particle size Level Net carcass Pectoral Thigh Heart Liver Gizzard Abdominal Fat Spleen
- 0% (control) 72.96 21.10 22.14 0.45 1.57 1.43 1.40 0.10 39.23
1.5 mm 1% 74.45 23.67 22.59 0.49 1.60 1.38 1.81 0.08 38.32
1.5 mm 3% 73.87 22.39 21.86 0.41 1.83 1.47 1.70 0.09 39.40
1.5 mm 5% 73.62 21.94 23.27 0.51 1.69 1.42 1.82 0.09 40.40
3 mm 1% 73.72 21.14 23.64 0.47 1.53 1.80 1.29 0.07 39.68
3 mm 3% 75.18 24.02 22.42 0.45 1.70 1.51 1.21 0.09 38.77
3 mm 5% 77.65 20.93 22.94 0.43 1.70 1.48 1.71 0.13 39.56
SEM 1.20 0.79 0.73 0.03 0.09 0.09 0.22 0.02 0.59
Control diet versus the other diets
Control diet 72.96 21.10 22.14 0.45 1.57 1.43 1.40 0.10 39.23
Other diets 74.75 22.35 22.79 0.46 1.68 1.51 1.59 0.09 39.36
Main effects
Particle size 1.5 mm 73.98 22.67 22.57 0.47 1.71 1.42b 1.78 0.08 39.38
3 mm 75.52 22.03 23.00 0.45 1.65 1.60 a 1.40 0.10 39.34
Level
1% 74.09 22.40 23.11
3% 74.53 23.20 22.14
0.48 1.56
0.43 1.77
5% 75.64 21.43 23.11 0.47 1.70
In each column and for each factor, the numbers which are not marked with the same characters, are significantly different (P

that using bentonite in broilers diets did not affect the
heart and liver weight. However, in another study,
examining the use of bentonite in diets contaminated with
mycotoxins, there was reduced damage to the liver tissue
and decrease in weight (Miazzo et al., 2005). This seems
to be due to aluminosilicates’ role in capturing heavy
cations and radioactive elements in their structural pores
and canals, thereby decreasing the poisoning effects of
mycotoxins (Mirabdolbagi et al., 2007b). Additionally, the
effect of aluminosilicates in forming stable complexes
with aflatoxins and decreasing their availability seems to
be another factor in the detoxification of gastrointestinal
tract and subsequently liver weight reduction (Kubena
and Harvey, 1993). The controversy between the results
of this study and the earlier mentioned reports may be
due to the lack of toxins in this research.
Weight percentage of gizzard was significantly affected
by the particle size of perlite (Table 3). The perlite with
the particle size of 3 mm caused the highest gizzard
weight. This was possibly due to the effect of larger
particles of food remaining and staying longer in gizzard,
increasing its wall muscle activity and subsequently
making it bulkier (Kilburn and Edwards, 2004). Nir et al.
(1994) and Huang et al. (2006) examining the broilers
carcass characteristics, stated that weight and volume of
gizzard had a direct relation with particle size of the diet.
There was no significant difference among the
treatments in terms of abdominal fat weight (Table 3).
Tatar (2006) investigating the effect of perlite on weight
percentage of abdominal fat, also showed that
aluminosilicate did not cause any difference between the
experimental groups. Other studies reported that adding
1.5 to 5% of aluminosilicates to the rations did not have
major influence on the abdominal fat of broilers (Yalcin et
al., 1995; Mirabdolbagi et al., 2007a, b).
Based on the findings of this study, different levels and
particle sizes of perlite did not affect the spleen weight of
broilers (Table 3). Mirabdolbagi et al. (2007a) reported
that using 2.5 to 5% of clinoptilolite in broilers diets did
not have any effect on their spleen weight. Nevertheless,
Miazzo et al. (2005) found that bentonite in diets
contaminated with aflatoxins, decreased the weight
percentage of spleen which is due to the effect of
aluminosilicates in blocking aflatoxins. The data in Table
3 showed that there was no significant variance regarding
tibia ash among groups, which is consistent with the
observations of Mirabdolbagi et al. (2007a). Based on the
reports of these researchers, using clinoptilolite in diets
did not affect the tibia ash of broilers. On the other hand,
Yalcin et al. (1995) declared that adding zeolite to broilers
rations caused an increase in tibia ash, which can
possibly be as a result of aluminosilicates and more
calcium absorption, regarding their high capacity in
bivalent cations exchange.
In conclusion, the results of this research showed that
although larger particles of perlite caused a raise in
gizzard weight, different levels and particle sizes of perlite
Ebadi Azar et al. 12781
had no major impact on broilers carcass improvement.
REFERENCES
Anonymous (1993). Perlite applications in filtration. Cooperative of
Azerbaijan regional mineral mines.
Anonymous (2006). Conversation with Iranian and Asia perlite
association managers. J. Cultivation Industry World. pp. 33: p. 3.
Dzhen S, Sakhalinian D (1987). Zeolite in the feed of broilers. Poult.
Abstracts 014-01196.
Huang DS, Li DF, Xing JJ, Ma YX, Li ZJ, Lv SQ (2006). Effects of feed
particle size and feed form on survival of Salmonella typhimurium in
the alimentary tract and cecal S. typhimurium reduction in growing
broilers. J. Poult. Sci. 85: 831-836.
Ingram DR, Aguillard CD, Laurent SM (1989). Bone development and
breaking strength as influenced by sodium zeolite A. J. Poult. Sci.
68(Suppl): 71-77.
Khosroshahi A (1997). Food analytical chemistry (Translation). Urmia
University Publications. pp. 137-141.
Kilburn J, Edwards HM (2004). The effect of particle size of commercial
soybean meal on performance and nutrient utilization of broiler
chicks. J. Poult. Sci. 83: 428-432.
Kubena LF, Harvey RB (1993). Effect of hydrated sodium calcium
aluminosilicate on aflatoxicosis in broiler chicks. J. Poult. Sci. 72:
651-657.
Lotfollahian H, Shariatmadari F, Shiva Azad M, and Mirhadi A (2004).
Effects of using two types of natural zeolite in diet on blood
biochemical factors, the relative weight of internal organs, and broiler
performance. J. Res. Construct. 64: 18-34.
Miazzo R, Peraltla MF, Magnole C, Salvano M, Ferrero S Chiacchiera
SM (2005). Efficiency of sodium bentonite as a detoxifier of broiler
feed contaminated with aflatoxin and fumonisin. J. Poult. Sci. 84: 1-8.
Minato H (1968). Characteristics and uses of natural zeolites.
Koatsugasu, 5: 536-547.
Mirabdolbagi J, Lotfollahian H, Hoseini S, Irajian G (2007a). Effects of
bentonite in broiler nutrition. Proceedings of second congress of
animal science and seafood, Anim. Sci. Res. Ins. Karaj. pp. 950-953.
Mirabdolbagi J, Lotfollahian H, Shariatmadari F, Shourmasti DK
(2007b). Effects of inactivated and activated clinoptilolite on broiler
performance. Proceedings of second congress of animal science and
seafood, Anim. Sci. Res. Ins., Karaj. pp. 942-946.
National Research Council (1994). Nutrition requirements of poultries.
National Academy Press, Washington, D.C.
Nir I, Hillel R, Shefet G, Nitsan Z (1994). Effect of grain particle size on
performance. 2. Grain texture interactions. J. Poult. Sci. 73(6): 781-
791.
Palic T, Vukicevic O, Resanovic R, Rajic I (1993). Possible applications
of natural zeolites in poultry production. Poultry Abstracts 021-
002130.
Santurio JM, Mallmann CA, Rosa AP, Appel G, Heer A, Dageforde S,
Bottcher M (1999). Effect of sodium bentonite on the performance
and blood variables of broiler chickens intoxicated with aflatoxins.
Brit. Poult. Sci. 40(1): 115-119.
Tatar A (2006). Comparison of the effects of different levels of perlite
and zeolite on broiler chicks performance. MSc thesis on animal
science. Department of Animal Science, University of Agricultural
Science and Natural Resources of Gorgan, IRAN.
Watkins KL, Southern LL (1991). Effect of dietary sodium zeolites A and
graded levels of calcium on growth, plasma and tibia characteristics
of chicks. J. Poult. Sci. 70: 2295-2303.
Watkins KL, Vagnoni DB, Southern LL (1989). Effect of dietary sodium
zeolite A and excess calcium on growth and tibia calcium and
phosphorus concentration in uninfected and eimeria acervulinainfected
chicks. J. Poult. Sci. 68: 1236-1240.
Yalcin S, Bilgili SE, McDaniel GR (1995). Sodium zeolite A: influence on
broiler carcass yields and tibia characteristics. Appl. Poult. Sci. 4: 61-
68.

African Journal of Biotechnology Vol. 10(59), pp. 12782-12788, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1148
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
The effect of butyric acid glycerides on performance
and some bone parameters of broiler chickens
Mehrdad Irani 1 *, Shahabodin Gharahveysi 1 , Mona Zamani 1 and Reza Rahmatian 2
1 Department of Animal Science, Qaemshahr Branch, Islamic Azad University, Qaemshahr, Iran.
2 Islamic Azad University, Shabestar Branch, Iran.
Accepted 4 July, 2011
A concern about enhancing the natural defense mechanisms of animals and reducing the massive use
of antibiotics led to the banning of studies in this field. So, this research was done to investigate the
effect of butyric acid glycerides and salinomycin sodium on the performance of the broiler chickens
(strain Ross 308). A total of 800 chickens were reared for 42 days. A 3 factor statistical design was
conducted with 4 replicates, and each factor contained 2 levels (25 broilers in each pen). The factors
were butyric acid glycerides (0 and 0.3% of diet), salinomycin sodium - an anticoccidial drug (0 and
0.5% of diet) - and litter moisture (normal litter with average moisture of 35% and wet litter with average
moisture of 75%). Data were collected and analyzed by SAS with GLM procedure. The results showed
that butyric acid glycerides had no significant effect on feed intake. Weight gain and feed conversion
ratio were not significantly affected by the mentioned factors. The effect of the treatments on the
number of Eimeria oocytes excreta in the second and fourth week of breeding and feed intake were
significant (p0.05). Considering the
result of this experiment, the use of butyric acid glycerides and salinomycin sodium in the
aforementioned levels had no positive effect on the performance of broiler chickens (p>0.05).
Key words: Butyric acid glycerides, salinomycin sodium, ross, performance and broilers.
INTRODUCTION
In the past, antibiotics have been included in animal feed
at sub-therapeutic levels, acting as growth promoters
(Dibner and Richards, 2005). Worldwide concern about
development of antimicrobial resistance and transference
of antibiotic resistance genes from animal to human
microbiota led to the placement of a ban on the use of
antibiotics as growth promoters (Mathur and Singh, 2005;
Salyers et al., 2004). There is the need to look for viable
alternatives that could enhance the natural defense
mechanisms of animals and reduce the massive use of
antibiotics (Verstegen and Williams, 2002). A way is to
use specific feed additives or dietary raw materials to
favorably affect animal performance and welfare,
*Corresponding author. E-mail: Dr_Mehrdadirani@yahoo.com.
particularly through the modulation of the gut microbiota
which plays a critical role in maintaining host health
(Tuohy et al., 2005). A balanced gut microbiota constitutes
an efficient barrier against pathogen colonization,
produces metabolic substrates such as vitamins and
short-chain fatty acids, and then stimulates the immune
system in a non-inflammatory manner. Using new feed
additives (for example, enzymes, organic acids, probiotics,
prebiotics and herbal extracts), towards hostprotecting
functions to support animal health, is a topical
issue in animal breeding and it creates fascinating
possibilities. Use of organic acids is very appropriate
because of the ease of use, accessibility, reinfection
improbability, positive effect on broiler performance, lack
of bacterial resistance, providing proper balance of
intestinal flora and prevention of feed nutrient destruction
(Waldroup and Kanis, 1995). Organic acids mechanism

of action is totally different from antibiotics. Organic acids
are lipophilic in their unsegregated form and can easily
pass through the bacterial cell membrane. An organic
acid is segregated inside the bacterial cell and cause pH
reduction in the cytoplasm which consequently cause
enzyme activity and material transfer disorders.
Bacterium tries to send H + ions out of the bacterial cell to
protect homeostasis, which is an endergonic activity.
Organic acids reduce accessible energy for other
bacterial activities through this way. Rcoo - ions can also
have negative effects on DNA and bacterial cell division.
So organic acids can act as bactericide combinations and
cause bacteria death (Chaveerach et al., 2008; Dibner
and Buttin, 2002; Griggs and Jacob, 2005; Partanen and
Mroz, 1999). Among short-chain fatty acids, butyric acid
has been specially noticed. The liquid form of butyric acid
is given to the bird mainly in combination with water,
while the powder form is given with their diet. By using
methods such as mineral carriers, esterification with
glycerol and also encap-sulation, organic acids are
protected from being absorbed in the upper parts of the
digestive system. A study by Bolton and Dewar (1965)
showed that 60% of butyric acid was absorbed only in
crop and less than 1% of this acid reached the lower
parts of the small intestine. So, butyric acid glycerides
were used in this experiment in order to prevent quick
absorption in upper parts of the digestive system. Various
beneficial experiments have shown that organic acids
were used to control disease causing bacteria such as
Salmonella, Campylobacter and E. coli (Chaveerach et
al., 2008; Van Immerseel et al., 2005), but only a few
researches have been done to study the effect of butyric
acid on other microorganisms of the digestive system.
This research was conducted to study the effect of
butyric acid glycerides on the performance of some bone
traits of the broiler chickens and the microbial population
of the digestive system, especially Eimeria Protozoan.
Different factors such as litter moisture and existence or
absence of anti-coccidial drug (salinomycin sodium),
were included in the experimental design in order to
measure the anti-microbial power of butyric acid.
MATERIALS AND METHODS
Birds and diets
In this research, a completely randomized design was selected with
factorial method. So, 3 factors were selected and the level number
of each factor was 2. A total of 800 male broiler chickens (Ross
308) were obtained from a local breeding farm. Experimental
factors were butyric acid glycerides (0 and 0.3% of the diet),
salinomycin sodium - anticoccidail substance (0 and 0.5% of the
diet) and litter moisture (normal litter with average moisture of 35%
and wet litter with average moisture of 75%). Upon arrival, chickens
were wing-banded, weighed and randomly allocated to 8 treatment
groups of 100 birds each. Each group was further divided into 4
Irani et al. 12783
replicates of 25 birds. All replicates were housed in 32 separate
wire-suspended cages equipped with plastic sides, and the bottoms
covered with clean wood shavings. Light was continuously provided
for the duration of the experiment. The temperature in the cages
was 32°C on arrival of the chickens. From day 8 of the experiment,
the temperature was gradually decreased by 2°C every day, until it
reached 20°C by day 14. However, feed and water were available
ad libitum.
UFFDA program was used for diets formulation, based on the
National Research Council recommended table (National Research
Council, 1994). However, mash diets were used in this experiment.
In order to compare the effect of butyric acid glycerides with
salinomycin sodium, this anti-coccidial drug was added to the
experimental diets with the amount of 0.5 kg/ton, during the grower
and finisher stages. Before the experiment, chemical analyses of
experimental diets were determined according to the methods of
AOAC (Association of Official Analytical Chemists, 1990). The
ingredients and the composition of the experimental diets are
presented in Table 1.
Butyric acid and salinomysin sodium were added to the basal diet
by substitution at the expense of corn. The starter diet was fed until
day 10, the grower diet was fed from day 11 to 28, and the finisher
diet was fed from day 29 to 42.
Traits and data collection
Data were collected as per the number of coccidia oocytes in the
excreta, feed intake, weight gain and feed conversion ratio, as well
as the amount of mineral storage in chicken tibia (ash, calcium and
phosphorus).
In order to determine the number of Eimeria oocytes, fresh
excreta samples were collected from the four corners and the
middle of each cage on days 14, 21, 28, 35 and 42 of the
experiment. Excreta collection was done in the evening and the
samples were stored overnight in a refrigerator. The oocytes of
each cage were counted the next day and the numbers were
expressed per g of excreta. For oocyte counting, a modified
McMaster counting chamber technique of Hodgson (1970) was
used. A 10% (w/v) feces suspension in a salt solution (151 g NaCl
mixed into 1 L of water) was prepared. After shaking thoroughly, 1
ml of the suspension was mixed with 9 ml of a salt solution (311 g
of NaCl mixed in 1 L of water). Then, the suspension was put into
the McMaster chamber using a micropipette and the number of
oocytes was counted (Peek and Landman, 2003).
Body weights were measured on days 10, 28 and 42. Feed
intakes were determined per week for every cage and were
expressed as g/bird/day. The feed conversion ratio was calculated
as feed intake per cage divided by weight gain of birds in the cage.
At the end of the experimental period (42 days of age), one broiler
chicken from each replicate was randomly selected. Live weights of
birds were recorded after a 12-h-hunger period. The selected birds
were subjected to feed withdrawal overnight, permitting gut
clearance, after which they were killed via neck cutting.
To study the effect of butyric acid glycerides on digestibility and
absorption of minerals in the diet, measurement and comparison of
the amount of mineral storage (ash, calcium and phosphorus) of the
tibia were done for treatments 1 and 3 on days 14 and 35 of the
breeding. After the chickens were suffocated by CO2, the left tibia
were removed from the body, packed in nylon bags, indexed and
transferred to a cool mortuary (4°C) for storage. To determine ash,
calcium and phosphorus contents, the bones were then transferred
to a lab where they were boiled in water and dried in an oven for 24
h following flesh and cartilage removal. The products were then

12784 Afr. J. Biotechnol.
Table 1. Composition of experimental diets.
Ingredient and analysis Starter Grower Finisher
ingredient
Corn 56.11 61.6
Soybean meal (44% CP) 34.71 27.94
Poultry wastage powder 2 3
Oil 1.27 1.26
DL-Methionine 0.34 0.28
L-Lysine HCL 0.26 0.24
Vitamin premix 1
0.25 0.25
Mineral premix 2 0.25 0.25
Salt 0.23 0.23
Sodium bicarbonate 0.17 0.16
Formycine gold 0.1 0.1
Oyster shell 0.04 -
Avilamycin 0.01 0.01
Salinomycin sodium - 0.05
Calculated analysis (%)
Metabolizable energy (kcal/kg) 2850 3000
Crude protein 21.1945 19.2978
Calcium 0.9892 0.9363
Total phosphorus 0.7200 0.7033
Available phosphorus 0.4711 0.4681
Sodium 0.1600 0.1600
Potassium 0.8707 0.7559
Chlorine 0.2300 0.2300
Crude fat 4.2316 4.6872
Crude fiber 3.1363 2.8974
Linoleic acid 2.2180 2.3255
Arginine 1.3660 1.2094
Lysine 1.3472 1.1808
Methionine + cystine 1.0080 0.9045
Methionine 0.6593 0.5781
Threonine 0.7967 0.7234
Tryptophan 0.2483 0.2173
67.31
21.91
4
1.42
0.22
0.2
0.25
0.25
0.24
0.15
0.1
0.01
0.01
0.05
3100
17.5038
0.8168
0.6219
0.4036
0.1600
0.6540
0.2300
5.2963
2.6905
2.5233
1.0667
1.0091
0.7967
0.4933
0.6556
0.1891
1 Content per 2.5 kg: Vitamin A, 9,000,000 IU; vitamin D, 2,000,000 IU; vitamin E,18,000 IU; vitamin K, 2,000 mg;
vitamin B1, 1.800 mg; vitamin B2, 6.600 mg; vitamin B3, 10.000 mg; vitamin B5, 30.000 mg; vitamin B6, 30.000 mg;
vitamin B9, 1.000 mg; vitamin B12, 15 mg; vitamin H2, 100 mg; choline chloride, 500,000 mg and antioxidant, 3000
mg; 2 Content per 2.5 kg: manganese, 100.000 mg; iron, 50,000 mg; zinc, 100,000 mg; copper, 10,000 mg; iodine,
1.000 mg; selenium, 200 ; mg; cobalt, 100 mg.
placed in Soxhlet apparatus for 16 h for fat extraction, after which
they were transferred to dry oven and electric furnace for 8 h
treatment in order to obtain ash. The ash was then weighed in order
to determine the ash percentage of the bones. It was then used to
determine the calcium and phosphorus contents using the standard
methods recommended by the Association of Official Analytical

Irani et al. 12785
Table 2. Main and interactive effects of experimental factors on the number of Eimeria oocytes per g of excreta in different weeks
of breeding.
Parameter
2 3
Week of breeding
4 5 6
Treatment (Interaction effect)
1 (A1B1C1) 52.75 ab ± 8.3 550 a ± 73.21 14625 ± 634 b
95025 a ± 4548 30350 a ± 607
2 (A1B1C2) 150 a ± 9.1 4850 a ± 39.1 2407750 ±3251 a
11150 a ± 850 26725 a ± 396
3 (A2B1C1) 0 b ±0.0 850 a ± 50 44300 b ± 4920 56900 a ± 9411 14850 a ± 933
4 (A2B1C2) 75 ab ± 5.7 450 a ± 18.3 12600 b ± 2400 10630 a ± 741 10650 a ± 767
5 (A1B2C1) 100 ab ± 8.6 400 a ± 25.8 300 b ± 21.4 36325 a ± 670 63350 a ± 297
6 (A1B2C2) 25 ab ± 2.3 350 a ± 26.7 4050 b ± 810 90825 a ± 6895 28375 a ± 2410
7 (A2B2C1) 50 ab ± 7.73 300 a ± 41.42 25 b ± 5.0 19650 a ± 175 52850 a ± 4024
8 (A2B2C2) 50 ab ± 4.36 350 a ± 26.4 125 b ± 25.4 49825 a ± 812 24750 a ± 185
Significant ** n.s
**
n.s
n.s
Factors (main effects)
Butyric acid glycerides (A)*
A1
81.94 a ± 7.5 1538 a ±67.7
A2
43.75 a ± 5.6 488 a ± 68.22
Significant n.s n.s
Salinomycin sodium (B)
B1
69.44 a ± 10.9 1675 a ± 40.2
B2
56.25 a ± 2.7 350 a ± 21
Significant
Litter moisture (C)
n.s n.s
C1
50.69 a ± 2.5 525 a ± 44.49
C2
75 a ± 10 1500 a ± 40.2
Significant n.s n.s
64938 a ± 6836
14263 a ± 3091
n.s
78075 a ± 6582
1125 a ± 402.3
n.s
14813 a ± 3069
64388 a ± 1685
n.s
58275 a ± 2844
58169 a ± 3154
n.s
67288 a ± 4015
49156 a ± 3912
n.s
51975 a ± 5571
64469 a ± 5921
n.s
37200 a ± 739
25775 a ± 799
n.s
20644 a ± 304
25775 a ± 279
n.s
40350 a ± 511
22625 a ± 235
n.s
* A1 and A2 were supplemented with 0 and 0.3% butyric acid glycerides, B1 and B2 were supplemented with 0 and 0.5% salinomycin
sodium, and C1 and C2 were supplemented with normal litter with an average moisture of 35% and wet litter with an average moisture of
75%, respectively; a,b means within columns with different superscripts differ significantly at P

12786 Afr. J. Biotechnol.
Table 3. Main and interactive effects of experimental factors on feed intake, weight gain and feed conversion ratio.
Parameter
Treatments (Interaction effect)
Feed intake (g) Body weight gain (g) Feed conversion ratio
1 (A1B1C1) 5151.99 a ± 180.2 1971.18 a ± 86.2 2.616 a ± 0.12
2 (A1B1C2) 4931.85 b ± 27.7 2003.43 a ± 95.9 2.465 a ± 0.11
3 (A2B1C1) 5020.81 ab ± 88.6 1996.04 a ± 196.1 2.532 a ± 0.20
4 (A2B1C2) 4935.62 ab ± 233.6 1927.33 a ± 111.5 2.577 a ± 0.19
5 (A1B2C1) 4903.86 b ± 83.6 2043.83 a ± 73.3 2.402 a ± 0.10
6 (A1B2C2) 4968.97 ab ± 123 2016.50 a ± 119.6 2.471 a ± 0.15
7 (A2B2C1) 4882.79 b ± 76.8 2020.48 a ± 119.6 2.424 a ± 0.16
8 (A2B2C2) 4977.02 ab ± 95 1998.13 a ± 99.5 2.494 a ± 0.10
Significant **
n.s
n.s
Factors (main effects)
Butyric acid glycerides (A)*
A1
4989.17 a ± 145.1
A2
4958.56 a ± 134.6
Significant n.s
Salinomycin sodium (B)
B1
5014.57 a ± 164.3
B2
4933.16 a ± 95.7
Significant n.s
Litter moisture (C)
C1
4989.86 a ± 151.4
C2
4957.86 a ± 127.3
Significant n.s
2008.74 a ± 94.2
1985.05 ab ± 127.7
n.s
1974.50 a ± 120.2
2019.74 a ± 99.7
n.s
2007.89 a ± 117.8
1986.35 a ± 106.5
n.s
2.489 a ± 0.13
2.507 a ± 0.17
n.s
2.548 a ± 0.16
2.448 a ± 0.12
n.s
2.495 a ± 0.17
2.502 a ± 0.13
n.s
* A1 and A2 were supplemented with 0 and 0.3% butyric acid glycerides, B1 and B2 were supplemented with 0 and 0.5% salinomycin
sodium, and C1 and C2 were supplemented with normal litter with an average moisture of 35% and wet litter with an average moisture
of 75%, respectively; a,b means within columns with different superscripts differ significantly at P 0.05). Some
researchers showed that using organic acids caused a
significant reduction in the microbial balance of the
digestive system and consequently improved the bird’s
performance (Van Immerseel et al., 2005), which did not
agree with the result of this experiment. This difference
can be because of these reasons: The tested strains in
those researches such as Salmonella and Campylobacter
were non-resistant against the acids, and the
effect of organic acids on organic acid-resistant strains
such as Eimeria was not studied in any of them. On the
other hand, since each organic acid has its own antimicrobial
power, using other acids or a mixture of acids
with synergetic effect could cause different results.
Also, Eimeria was studied, but since each organic acid
has its own anti-microbial power, using other acids or a
mixture of acids with synergetic effect could cause
different results. In addition, higher levels of butyric acid
glycerides may be needed to destroy excreta Eimeria
oocytes. In a study by Conway et al. (2002), it was
reported that salinomycin sodium had no significant effect
on the amount of infection by Eimeria Protozoan. These
researchers showed that salimycin in comparison with
diclazuril and roxarsone has less power to control the
Eimeria oocytes. Increasing the resistance of Eimeria
oocytes against ionospheres can also be one of the
reasons for the insignificant reduction of oocytes in
response to adding salinimycin sodium to the diet. This
result agree with the findings of Ali et al., (2002) and
Goncagul et al. (2004).
The effect of experimental treatments on the amount of
feed intake was significant (p

Table 4. Main and interactive effects of experimental factors on the amount of mineral storage in chicken tibia (ash,
calcium and phosphorus).
Treatment*
Ash (%) Calcium (%) Phosphorus (%)
14 days 35 days 14 days 35 days 14 days 35 days
1 (A1B1C1) 36.37 a ± 4.1 46.89 a ± 2.1
3 (A2B1C1) 38.51 a ± 3.1 45.85 a ± 2.5
Significant n.s n.s
12.66 a ± 1.8
12.72 a ± 1.1
n.s
15.09 a ± 2.4
16.44 a ± 1.09
n.s
12.23 a ± 1.3
13.25 a ± 0.8
n.s
Irani et al. 12787
13.40 a ± 0.6
13.66 a ± 0.5
n.s
*Treatment A1B1C1, without butyric acid glycerides and salinomycin sodium in a normal litter (control); A2B1C1 supplemented
with 0.3% butyric acid glycerides, without salinomycin sodium in a normal litter. a,b means within columns with different
superscripts differ significantly at P 0.05). The main effects of
butyric acid glycerides and litter moisture on weight gain
were not significant (p>0.05). This observation is in
agreement with the findings of Leeson et al. (2005).
Using salinomycin sodium with the amount of 5% in diet
caused an improvement in weight gain, but this
improvement was not significant (p>0.05), and was also
reported elsewhere (Ali et al., 2002). The experimental
treatments and factors had no significant effect on feed
conversion ratio (p>0.05) (Table 3), although salinomycin
sodium factor caused improvement in feed conversion
ratio.
Using butyric acid glycerides had no significant effect
on the percentage of tibia ash, calcium and phosphorus
at 14 and 35 days of age (p>0.05) (Table 4). However, on
these two dates, consumption of this feed additive and
consequently diet acidification, caused an insignificant
increase in the values of the mentioned parameters. A
study by Boling-Frankenbach et al. (2001) showed that
using citric acid caused a significant increase in tibia ash
and calcium, but the result of this study’s experiment did
not agree with the findings of Boling-Frankenbach et al.
(2001). This can be due to different acidity of butyric and
citric acids. In addition, unprotected organic acids were
lipophilic and were mainly absorbed in crop, but the
organic acid used in this experiment was butyric acid
glycerides and was mainly released in the lower parts of
the digestive system which has fewer absorption sites.
In conclusion, considering the existing condition in this
experiment and values of the parameters, butyric acid
glycerides and salinomycin sodium used in the
mentioned levels had no significant positive effect on the
performance of broiler chickens.
REFERENCES
Ali Tipu M, Pasha TN, Zulfiqar A (2002). Comparative efficiency of
salinomycin sodium and neem fruit (Azaudirachta indica) as feed
additive anticoccidials in broilers. Int. J. Poult. Sci. 1(4): 91- 93.
Association of Official Analytical Chemists. (1990). Official Methods of
Analysis of the Association of Official. Analytical Chemists. 15th ed.
AOAC, Washington, DC.
Boling-Frankenbach SD, Snow JL, Parsons CM, Baker DH (2001). The
effect of citric acid on the calcium and phosphorus requirements of
chicks fed corn- soya meal diets. Poult. Sci. 80: 783-788.
Bolton W, Dewar WA (1965). The digestibility of acetic, propionic and
butyric acids by the fowl. Br. Poult. Sci. 6: 103-105.
Chaveerach P, Keuzen Kamp DA, Lipman LJA, Van Knapen F (2008).
In vitro study on effect of organic acids on campylobacter jejuni coli
population in mixture of water and feed. Poult. Sci. 81: 621- 628
Conway DP, Mathis GF, Lang M (2002). The use of diclazuril in
extended withdrawal anticoccidial programs: Efficiency against
eimeria Spp. In broiler chickens in floor pens. Poult. Sci. 81: 349-352.
Dibner JJ, Buttin P (2002). Use of organic acids as a model to study the
impact of gut microflora on nutrition and metabolism. J. Apply Poult.
Research, 11: 453- 463
Dibner JJ, Richards JD (2005). Antibiotic growth promoters in
agriculture: history and mode of action. Poult. Sci. 84: 634-643.
Duncan DB (1955). Multiple range and multiple F tests. Biometrics, 11:
1-42.
Goncagul G, Gunadin E, Tayfuncaru K (2004). Antibiotic resistance
salmonella enteritidis of human and chick origin. Turk. J. Vet. Anim.
Sci. 28: 911-914.
Griggs JP, Jacob JP (2005). Alternatives to antibiotics for organic

12788 Afr. J. Biotechnol.
poultry production. J. Appl. Poult. Res. 14: 750-756.
Hodgson JN (1970). Coccidiosis: oocyst counting technique for
coccidiostat evaluation. Expansional Parasitol. 28: 99-102.
Leeson S, Namkung H, Antongiovanni M, Lee E (2005). Effect of butyric
acid on performance and carcass yield of broiler chickens. Poult. Sci.
84: 1418- 1422.
Mathur S, Singh R (2005). Antibiotic resistance in food lactic acid
bacteria-a review. Int. J. Food Microbiol. 105: 281-295.
National Research Council (1994). Nutrient Requirements of Poultry.
9th rev. ed.Washington, DC, USA, National Academy Press.
Partanen KH, Mroz Z (1999). Organic acids for performance
enhancement in pig diets. Nutritional Research Review, 12: 117- 145.
Peek HW, Landman WJ M (2003). Resistance to anticoccidial drugs of
Dutch avian Eimeria spp. field isolates originating from 1996, 1999
and 2001. Avian Pathol. 32: 391-401.
Pinchasov Y, Jensen LS (1989). Effect of short-chain fatty acids on
voluntary feed intake of broiler chicks. Poult. Sci. 68: 1612-1618.
Salyers AA, Gupta A, Wang Y (2004). Human intestinal bacteria as
reservoirs for antibiotic resistance genes. Trends Microbiol., 12: 412-
416.
SAS Institute (2004). SAS User's Guide. Statistics. Version 9.1 Edition.
SAS Institute, Inc., Cary, NC. USA.
Tuohy KM, Rouzaud GCM, Bruck WM, Gibson GR (2005). Modulation
of the human gut microflora towards improved health using
prebiotics-assessment of efficacy. Curr. Pharmaceut. Design, 11: 75-
90.
Van Immerseel F, Boyen F, Gantois I, Timbermont L, Bohez L, Pasman
F, Haesbrouck F, Ducatelle R (2005). Supplementation of coated
butyric acid in the feed reduce colonization and shedding of
salmonella in poultry. Poult. Sci. 84: 1851-1856.
Verstegen MWA, Williams BA (2002). Alternatives to the use of
antibiotics as growth promoters for monogastric animals. Anim.
Biotechnol. 13: 113-127.
Waldroup A, Kanis W (1995). Performance characteristics and
microbiological aspects of broiler fed diets supplemented with organic
acids. J. Food Prot., 58: 482-489.

African Journal of Biotechnology Vol. 10(59), pp. 12717-12721, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.565
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Predominant lactic acid bacteria isolated from the
intestines of silver carp in low water temperature
Farzad Ghiasi
Fisheries Department, Faculty of Natural Resources, University of Kurdistan, PO Box 416, Sanandaj, Iran. E-mail:
FGH@uok.ac.ir. Tel: 00988716620551. Fax: 00988716620550.
Accepted 12 August, 2011
The composition of intestinal lactic acid bacteria (LAB) in silver carp (Hypopthalmichthys molitrix) in
Gheshlaghdam Lake was analyzed based on morphology and biochemical tests in December 2009 to
March 2010. Most isolates were Gram-positive, non motile and catalase-negative bacilli that did not
produce gas from glucose. Growth at 15°C was positive for all isolates, while it was positive for some
isolates at 45°C.The results of the carbohydrate fermentation tests were positive reactions for most
sugars. The results show that in winter, the predominant LAB were Lactococcus plantarum,
Lactococcus raffinolactis and Lactococcus lactis, respectively.
Key words: Silver carp, lactic acid bacteria, intestine, Gheshlaghdam Lake.
INTRODUCTION
Lactic acid bacteria (LAB) are Gram-positive, nonsporulating
and catalase negative rods or cocci that
ferment various carbohydrates mainly to lactate and
acetate. Various amino acids, vitamins and minerals are
essential for their growth (Kandler and Weiss, 1986).
Accordingly, they are commonly associated with nutriatious
environments like foods, decaying material and the
mucosal surface of the gastrointestinal and urogenital
tract (Kandler and Weiss, 1986; Walstra et al., 1999).
Various authors have shown that LAB are also part of the
normal intestinal flora of fish (Ringø and Gatesoupe,
1998), with majority of the Lactobacillus species inhibiting
the intestinal tract. It has been postulated that
lactobacilli have several promoting effects, including the
prevention of diarrhea and intestinal infections (Isolauri
et al., 1991; Biller et al., 1995), alleviation of inflamematory
bowel disease (Sartor, 2004), production of
antimicrobial substances or bacteriocins against undesirable
pathogens (Bernet et al., 1994; Servin, 2004), and
regulation of gastrointestinal immunity (Christensen et
al., 2002). In addition, it has been reported that they
exert beneficial effects such as suppressing colon cancer,
decreasing serum cholesterol and aiding in digestion
or absorption of feed ingredients and synthesis of
vitamins (Pereira and Gibson, 2002; Rafter et al., 2007).
LABs are widely distributed in various animal intestines
(Devrise et al., 1987; Sakata et al., 1980). They are also
the biological basis for the production of great multitude
of fermented foods (Lasagno et al., 2002). The most
important contribution of these bacteria to fermented
products is to preserve the nutritive qualities of the raw
material and inhibit the growth of spoilage and pathogenic
bacteria (Mattila et al., 1992). There have been
several reports (Mitsuoka, 1990; Salminen and Wright,
1998) of LAB occurring among the major microbial
populations in animal intestines. It is well established that
some LAB improve the intestinal microflora and promote
the growth and health of animals (Mitsuoka, 1990;
Perdigon et al., 1995). Most probiotics contain single or
multiple strains of LAB and are part of the natural
microflora of many animals; they are generally regarded
as safe and may display antagonistic activities against
pathogenic bacteria (Byun et al., 1997; Garriga et al.,
1998). The intestinal microflora, especially LAB, may
influence the growth and health of fish. However, few
studies have reported the composition of intestinal LAB
flora in fish.
LABs are characterized as Gram-positive, usually nonmotile,
non-sporulating bacteria that produce lactic acid
as a major or unique product of fermentative metabolism.
Kandler and Weiss (1986) have classified Lactobacillus
isolates from temperate regions according to their
morphology, physiology and molecular characters.
Schleifer (1987) classified LAB based on the molecular
characteristics. LAB from food and their current
taxonomical status have been described by many authors

12718 Afr. J. Biotechnol.
Figure 1. Geographical location of Gheshlaghdam Lake.
(Huber et al. 2004; Ringø and Gatesoupe, 1998;
Salminen and Von Wright, 1998). Ringø and Gatesoupe
(1998) prepared a review of the LAB present in fish
intestine. Taxonomic studies on LAB from poikilothermic
animals are rare (Al-Harbi and Uddin, 2004; Asfie et al.,
2003; Huber et al., 2004; Ringø and Gatesoupe, 1998). A
previous study by Hagi (2004) indicated that the
predominant LAB composition in fish intestine was
changed seasonally.
The aims of this study were to characterize the
dominant lactic acid bacteria (LAB) isolated from the
intestines of various samples of the silver carp
(Hypophthalmichthys molitrix) in Gheshlaghdam lake in
Kurdistan province, Iran, in winter and to make a survey
of the presence of LAB in the intestinal content of fresh
water fish, silver carp, from a lake under the wild
condition basically to make a bank collection for spread
using this bacteria in food products especially in fish
food, as a probiotic. The results suggest that seasonal
isolation of LAB would lead to successful addition of
various probiotic LAB.
MATERIALS AND METHODS
Fish and experimental conditions
During winter, three times sampling were done, once per month in
2009 to 2010. In each sampling, five individuals adults silver carp
(mean weight 1.2 kg) belonging to the Gheshlaghdam Lake were
transferred to 500 L fiberglass indoor tank without water flow and
with continuous aeration. The water temperature was 5 ± 2°C
during the whole trail.
Experiment location
Kurdistan province, with an area of 28203 km 2 , is one of the
western provinces of Iran, adjacent to West Azarbaijan, Zanjan,
Hamedan, and Kermanshah provinces and having more than 230
km of shared border with Iraq. The geographical coordinates of the
Province are from 34° 44' to 36° 30' of northern latitude and from
42° 31' to 48° 16' of eastern longitude. The capital of the province is
Sanandaj, which is 1373 m above sea level. Gheshlaghdam Lake is
15 km far from Sanandaj (Figure 1), with water temperatures
varying between 4 to 6°C in winter.
Isolation of lactic acid bacteria
For the isolation of LAB, first, the fish were opened aseptically and
their whole intestines were removed. The intestines were dissected
and their contents were collected separately by carefully scraping
using a rubber spatula. 1 g of the intestine content was
homogenized with 9 ml of sterile normal saline and mixed for 1 min.
Subsequently, dilution series were prepared in sterile saline from
10 -1 to 10 -10. Samples were plated on to de Man- Rogosa and Sharp
(MRS) agar (Merck).The plates were incubated anaerobically at
37°C for 48 to 72 h. Approximately 20 well grown colonies were
picked from each plate for future examination.
Identification of the lactic acid bacteria spp.
Classification of the isolates was based on the established methods
using important biochemical and morphological observation and
tests previously described (Buller, 2004; Kazaki et al., 1992;
Kandler and Weiss, 1986). The selected isolates were examined

Table1. Differentiating characteristics of Lactobacillus species isolated from the intestine of silver
carp.
L. plantarum L. raffinolactis L. lactis
Growth at 10°C + + +
Growth at 45°C - - +
Gram staining + + +
Beta haemolytic - - -
Urea - - -
Motility - - -
Oxidase - - -
Indole - - -
Citrate - - -
Gelatin - - -
Mannose + - +
Raffinose - + -
Salicin + + +
Lactose + + +
Sorbitol + - -
Xylose + - -
Trehalose + - +
Glucose + - +
Melezitose + + -
Sucrose + - -
Ribose + - +
Arabinose - - -
Melibiose - + -
Cellobiose - + +
Mannitol + + +
Maltose + + +
Arginine hydrolase - - +
VP + + +
Gas from glucose + - -
Cfu/g 8- 9 × 10 3 5 - 6 × 10 3 2.9 - 4 × 10 1
microscopically for cellular morphology and Gram stain phonotype.
Catalase activity was tested by spotting colonies with 3% hydrogen
peroxide; grown at 10 and 45°C in MRS broth. Fermentation of
different sugar was determined by API 50 CH (Biomerieux);
production of acid and gas from 1% glucose (MRS broth without
beef extract); production of ammonia from arginine; indole
production in tryptone broth; Methyl red and Voges-Proskauer test
in methyl-red and Voges-Proskauer (MRVP medium).
Bacterial counts
Total counts and the number of LAB colonies for each isolate were
counted with the method described by Buller (2004). The
percentages of LAB were compared with total viable counts.
RESULTS
Total colony counts was 5.4×10 7 cfu/g. LAB isolates were
classified into the genera Lactobacillus and Lactococcus
based on their morphology and biochemical characters.
Ghiasi 12719
The differentiating characteristics of LAB species isolated
from the intestines of silver carp are shown in Table 1. All
isolates were Gram-positive, non-sporulating, facultative
anaerobic and catalase negative. The most isolates that
were able to grow at 10, but not at 45°C were bacilli that
did not produce gas from glucose. The results of the
carbohydrate fermentation tests were positive reactions
for most sugars. Hydrolysis of gelatin was not positive for
isolates. According to the biochemical tests and colony
count in pour plates, the number of the predominant LAB
species isolate from the intestines of silver carp were in
the order of Lactobacillus plantarum, Lactobacillus
raffinolactis and Lactococcus lactis.
DISCUSSION
Fish in all life stages have interactions with bacteria from

12720 Afr. J. Biotechnol.
the environment. Some relations are detrimental and
others are beneficial. Control of pathogen in fish farm
should be improved by studying the beneficial bacteria. A
growing concern about the high consumption of antibiotic
has shown the necessity of alternative methods for
disease control. In this study, we confirmed the presence
of Lactobacilli in the intestine of silver carp. However,
Maugin and Novel (1994) found that Lactococcus was the
major flora isolated from fish, and Kandler and Weiss
(1986) reported that "the occurrence of typical lactobacilli
is rare in fish and prawn". It is interesting to note that
majority of the Lactobacillus sp. that have been isolated
from adult fish were those species commonly found on
meat, animals and human (Kandler and Weiss, 1986).
There were a few reports of isolation of LAB from fresh
and seawater fish (Azizpour, 2009a, b; Balcázar et al.,
2007; Jankauskine, 2000; Cai et al., 1999; Cone, 1982).
In this study, we could not find more lactic acid bacteria
in the intestinal content of silver carp. This is explained by
the influence of season in the lactic acid bacteria
population in fish intestines. It has been reported that
bacterial microflora of fish intestine changed depending
on water temprature and season (Sugita et al., 1989; Alharbi
and Uddin, 2004; Hagi et al., 2004; Bucio, 2006).
Highest counts were found in summer and almost
absence counts were found in winter. This fact suggests
that selection of LAB for fish should be performed
seasonally. Previously, Hagi et al. (2004) reported that
the predominant LAB in silver carp intestine is L.
raffinolactis. This result is similar to ours, but probably
the discrepancy is due to differences between fish size
and water temperatures in Kasumigaura Lake and
Gheshlaghdam Lake. However, the results obtained in
this study demonstrate that isolates from silver carp could
be L. plantarum, L. raffinolactis and L. lactis in winter.
This result is considerable for distinguishing the strain of
isolate from silver carp intestines by means of molecular
techniques.
Conclusion
The ability of this isolates to colonize the intestine of
silver carp in winter highlights it as suitable species for
widespread use in aquaculture food to minimize
pathogen colonization in gastrointestinal tract. In this
study, some bacteria were characterized, which may be
of interest not only for aquaculture, but also for food
preservation.
REFERENCES
Al-Harbi AH, Uddin MN (2004). Seasonal variation in the intestinal
bacterial flora of hybrid tilapia (Oreochromis niloticus×Oreochromis
aureus) cultured in earthen ponds in Saudi Arabia. Aquaculture. 229:
37-44.
Asfie M, Yoshijima T, Sugita H (2003). Characterization of the goldfish
fecal microflora by the fluorescent in situ hybridization method.Fish.
Sci. 69: 21-26.
Azizpour K, Tokmechi A, Agh N (2009a.). Charactrization of lactic acid
bacteria isolated from the intestines of common carp of west
Azarbaijan, Iran J. Anim. Veterinary Advances 8(6): 1162-1164
Azizpour K(2009b). Biochemical Characterization of Lactic Acid
Bacteria Isolated from Rainbow Trout (oncorhynchus mykiss) of West
Azarbaijn, Iran. Res. J. Biol. Sci. 4 (3): 324-326.
Balcázar JL, De Blas I, Ruiz-Zarzuela I, Vendrell D, Calvo AC , Márquez
I, Gironés O, Muzquiz JL (2007).Changes in intestinal microbiota and
humoral immune response following probiotic administration in brown
trout (Salmo trutta). Br. J. Nutr. 97: 522–527
Bernet MF, Brassart D, Neeser JR, Servin AL (1994). Lactobacillus
acidophilus LA1 binds to cultured human intestinal cell lines and
inhibits cell attachment and cell invasion by enterovirolent bacteria.
Gut 35: 483-489.
Biller JA, Katz AJ, Flores AF, Buie TM, Gorbach SL (1995).Treatment of
recurrent Clostridium difficile colitis with lactobacillus GG. J. pediatric
gastroenterol. nutr. 21: 224-226
Bucio A, Hartermink R, Schrama JW, Verreth J, Rombouts FM (2006).
Presence of lactobacilli in the intestinal content of freshwater fish
from a river and from a farm with a recirculation system. Food
Microbiol. 23 (5): 476-482.
Byun JW, Park SC, Benno Y, Oh TK (1997).Probiotic effect of
Lactobacillus sp. DS-12 in flounder (Paralichthys olivaceus). J. Gen.
Appl. Microbiol. 43: 305-308.
Buller NB (2004). Bacteria from fish and other aquatic animals: A
practical identification manual.CABI pub. ISBN 0-85199-738-4.
Cai Y, Suyanandana, P Saman P, Benno Y (1999). Classification and
characterization of lactic acid bacteria isolated from the intestines of
common carp and freshwater prawns. J. Gen. Appl. Microbiol. 45:
177-184.
Christensen HR, Frøkiaer H, pestka J (2002).lactobacilli differentially
modulate expression of cytokines and maturation surface markers in
marine denderitic cells. Jurnal of immunology 168: 171-178
Cone DK (1982). A possible marine form of Ichthyobodo sp. on
haddock, Melanogrammus aeglefinus (L.), in the north-west Atlantic
Ocean. J. Fish. Diseases 5: 479-485.
Devrise LA, Kerckhove A, Kilpper-Balz AR, Schleifer KH (1987).
Characterization and identification of Enterococcus species isolated
from the intestines of animals. Int. J. Syst. Bacteriol. 37: 257-259
Dora I, Preira DI, Gibson GR (2002). Cholosterol assimilation by lactic
acid bacteria and bifidobacteria isolated from human gut. Appl.
Environ. Microbiol. 68:4689-4693.
Garriga M, Pascual M, Monfort JM, Hugas M (1998).Selection of
lactobacilli for chicken probiotic adjuncts. J. Appl. Microbiol. 84: 125-
132
Hagi T, Tanaka D, IwamuraY, Hoshino T (2004). Diversity and seasonal
changes in lactic acid bacteria in the intestinal tract of cultured
freshwater fish. Aquaculture 234: 335-346.
Huber I, Spanggaard B, Appel KF, Rossen L, Neilson T, Gram L (2004).
Phylogenetic analysis and in situ identification of the intestinal
microbial community of rainbow trout (Oncorhynchus mykiss
Walbaum). J. Appl. Microbiol. 96: 117-132
Isolauri E, Juntunen M, Rautanen T, Sillanaukee P, Koivula T (1991). A
human Lactobacillus strain (lactobacillus casei sp. Strain GG)
promotes recovery from acute diarrhea in children, Pediatrics 88: 90-
97
Jankauskine R (2000).The dependence of the species composition of
lactoflora in the intestinal tract of carps upon their age. Acta Zool.
Lituanica 10 (3): 78-83.
Kazaki M, Uchimaru T, Okaka S (1992). Experimental manual lactic
acid bacteria. Asakura-Shoten.Tokyo, pp.30-34
Kandler O, Weiss N (1986). Microbiology of mesu, a traditional
fermented bamboo shoot product, In: Bergey's Manual of Systematic
Bacteriol. Sneath PHA, Mair NS, Sharpe ME, Holt JG (Eds).
Baltimore: Williams, Wilkins 2: 1209 -1234
Lasagno M, Boaleto V, Raya R, Front De Valderz G, Eraso A ( 2002).
Selection of bacteriocin producer strains of lactic acid bacteria from a
dairy environment. Microbiologia 25: 37-44
Mattila-Sandholm T, Wirtanen G (1992). Biofilm formation in the

industry: a review. Food Rev. Int. 8 (1992): 573-603.
Maugin S, Novel G (1994). Characterization of lactic acid bacteria
isolated from seafood. J. Appl. Bacteriol. 76: 616-625
Mitsuoka T (1990). Intestinal Microbiology, Asakura-shoten, Tokyo. pp;
139-144.
Perdigon G, Alvarez S, Rachid M, Aguero G, Gibbato N (1995). Immune
system stimulation by probiotics. J. Dairy Sci. 78: 1597-1602
Rafter J, Bennett M, Caderni G, Clune Y, Hughes R, Karlsson PC,
Klinder A, O'Riordan, MO' Sullivan GC, Pool-Zobel B, Rechkemmer
G, Roller M, Rowland I, Salvadori M, Thijs H, Van Loo J, Watzl B,
Collins JK ( 2007). Dietary synbiotic reduces cancer risk factors in
polypectomised and colon cancer patients" Am. J. Clin. Nutr. Feb.
85(2): 488-96
Ringø E, Gatesoupe FJ (1980). Lactic acid bacteria in fish: A review.
Aquaculture 160: 177-203
Sakata T, Sugita H, Mitsuoka T, Kakimota D, Kadota H (1980). Isolation
and distribution of obligate anaerobic bacteria from the intestines of
freshwater fish. Bull. Jpn.Soc.Sci Fish. 46: 1249-1255
Salminen S,Wright A (1998).Lactic Acid Bacteria. Microbiol. and
Functional Aspects, Marcel Dekker, New York, pp. 211-242.
Ghiasi 12721
Sartor RB (2004). Therapeutic manipulation of the enteric microflora in
inflammatory bowel disease: antibiotics, probiotics and prebiotics.
Gastroentrology. 126: 1620-1633
Schleifer KH (1987). Recent changes in the taxonomy of lactic acid
bacteria. FEMS. Microbiol. Reviews 46: 201-203
Servin AL(2004). Antagonistic activities of lactobacilli and bifidobacteria
against microbial pathogens. FEMS Microbiol. Reviews 28: 405-440.
Sugita H, Iwata J, Miyajima C, Kubo T, Nuguchi T, Hashimoto K,
Deguchi, Y(1989). Change in microflora of puffer fish Fugu niphobles
with different water temperature. Mar. Biol. 101: 299-304
Walstra P, Geurts TJ, Noomen A, Jellema,A , Van Boekel, MJS
(1999).Daily technology : Principles of milk properties and processes.
Marcel Dekker. New york, pp. 727-728.

African Journal of Biotechnology Vol. 10(59), pp. 12789-12798, 3 October, 2011
Available online at http://www.academicjournals.org/AJB
DOI: 10.5897/AJB11.1727
ISSN 1684–5315 © 2011 Academic Journals
Full Length Research Paper
Construction of a mammalian cell expression vector
pAcGFP-FasL and its expression in bovine follicular
granulosa cells
RunJun Yang 1 , Meng Huang 2 , JunYa Li 2 * , ZhiHui Zhao 1 * and ShangZhong Xu 2
1 College of Animal Science and Veterinary Medicine, Jilin University, Changchun 130062, China.
2 Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, China.
3 Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, 266071,China.
Accepted 26 August, 2011
Fas ligand (FasL) is a cytokine that may be secreted or expressed as a transmembrane ligand at the cell
surface, and induces apoptosis by binding to the Fas. Ovarian follicular atresia and luteolysis are
thought to occur by apoptosis. To reveal the intracellular signal transduction molecules involved in the
process of follicular development in the bovine ovary, the Fas ligand gene was cloned using RT-PCR.
By deleting the stop codon, the amplified Fas ligand gene was directionally cloned in frame into the
eukaryotic expression vector pAcGFP-N1. The pAcGFP-bFasL recombinant plasmid was then
transfected into bovine follicular granulosa cells by using lipofectamine 2000. Expression of AcGFP was
observed under fluorescent microscopy and the transcription and expression of Fas ligand was
detected by RT-PCR and Western-blot. The results show that the pAcGFP-bFasL recombinant plasmid
was successfully constructed. AcGFP expression was detected as early as 24 h after transfection and
the percentage of AcGFP positive cells reached about 68%. As expected, a 847 bp fragment was
amplified by RT-PCR and a 59 kD target protein was detected by Western-blot from the transfected cells.
This study will thus serve as a valuable tool in understanding the mechanism of regulation of Fas ligand
on bovine oocyte formation and development.
Key words: Fas ligand, apoptosis, follicular granulosa cell.
INTRODUCTION
Morphological and biochemical studies have shown that
the demise of both somatic and germ cells in the ovary is
mediated by apoptosis (Morita et al., 1999). Coordination
between oocyte and granulosa cells is an essential
prerequisite to normal follicular development (Quirk et al.,
2001). Studies in rat and bovine granulosa cells have
demonstrated that cell–cell contact plays a vital role in
inhibiting granulosa cell apoptosis and regulating
proliferation (Lai et al., 2000). Hence, a role for gap and
tight junctions between granulosa cells and oocytes in
preventing granulosa cell apoptosis has been proposed.
*Corresponding author. E-mail: jl1@iascaas.net.cn,
zhzhao@jlu.edu.cn. Tel: +86-10-62892769. Fax: +86-10-
62816065.
Apoptosis is an important process that maintains
appropriate cell numbers by killing excess cells (Gjorret
et al., 2005). The Fas ligand (FasL)/Fas pathway is an
important pathway of apoptosis that controls cell
proliferation and tissue remodeling (Hsu and Kuo, 2008;
Vij et al., 2004). Fas is a transmembrane protein of the
TNF/nerve growth factor super family that is expressed
on both immune and non-immune cell types (Porter et al.,
2000). Fas, when bound by FasL, activate a signal
transduction pathway that eventually results in apoptosis
of the cell.
Bovine Fas ligand (FasL) is a 31 kDa type II membrane
protein of 277 amino acids and belongs to the tumor
necrosis factor ligand family (Taniguchi et al., 2002;
Townson et al., 2006). In the bovine ovary, the Fas/FasL
system may be regulated by gonadotropin-dependent
mechanisms and may play a role during attrition, follicular

12790 Afr. J. Biotechnol.
regression, and atresia, as evidenced by the expression
of Fas antigen in oocytes from fetal and adult ovaries and
in granulosa cells during the luteal phase. FasL also
mediates apoptosis in human granulosa luteal cell
cultures when these cells are pretreated with the Th1
cytokine, interferon-gamma (IFN-g) (Chen et al., 2005).
Hence, it can regulate the development of oocytes, to
maintain the equilibrium state of follicular development
(Moniruzzaman et al., 2007; Tourneur et al., 2003). This
reveals that Fas ligand plays an important role in the
regulation of oogenesis.
In the present study, we have inserted the cloned Fas
ligand gene into the eukaryotic expression vector
pAcGFP-Nl, successfully constructed fusion protein
recombinant plasmid pAcGFP-bFasL and transfected it
into follicular granulosa cells. It could provide technical
support for the basic research on the regulation of Fas
ligand on bovine oogonium development, and also
important for further research.
MATERIALS AND METHODS
Collection of bovine ovaries
Bovine ovaries were collected at a local abattoir and froze rapidly in
liquid nitrogen and then brought back to the laboratory.
Extraction of total RNA and cDNA synthesis
Total RNA was extracted from bovine ovary using a TRIzol kit
(Intrivogen Corporation, Carlsbad, California, USA), OD values
were measured by the use of UV spectrophotometer (PGeneral,
Beijing, China) and the RNA (OD260 / OD280 > 1.8) was chosen and
then reverse-transcribed using cDNA synthesis reverse transcription
kit (Takara, Dalian,China) to synthesize cDNA.
Gene cloning and sequence analysis
According to the Fas ligand gene total length sequence (GenBank
accession number: BankIt 1468310 Seq1 JN380921), a pair of
primers was designed: forward 5'TCTGGCCTTTGACA CCTG 3'
and reverse 5'CCTCCTGGTTCATGTCTTCG 3'. PCR amplification
cycles were performed as follows: 94°C for 90 s; 35 cycles of 94°C
for 30 s, 55.5°C for 30 s, and 72°C for 1 min; and a final extension
period at 72°C for 10 min. PCR products were run by
electrophoresis in 1.5% (w/v) agarose gels and stained with
ethidium bromide. Next the PCR products were purified and
recovered using the agarose gel DNA recovery kit (Tiangen, Beijing,
China). The purified Fas ligand genes were ligated with pMD19-T
vector (Takara, Dalian, China) and then the ligation products were
transformed into DH5α competent cells. The positive clones were
picked out and shaken overnight at 37°C and then a random
analysis of 8 clones with PCR and sequencing was conducted at
SinoGenoMax Company (Beijing, China).
Construction of a mammalian cell expression vector for
pAcGFP - bFasL fusion protein
According to the restriction enzyme mapping of ORF fragments of
bovine Fas ligand and multiple cloning sites of pAcGFP-N1 vector
(Clontech, Mountain View, CA, USA), BglII and EcoRI were chosen
as cloning sites Primers at the two ends of the Fas ligand open
reading frame were designed with a BglII restriction site and four
protective bases inserted before the ATG start codon in the
upstream primer. A Kozak sequence was also included to increase
the inserted gene expression level in eukaryotic cells. The forward
primer was designed as follows: 5'ACTAAGATCTGCCACCAT
GCAGCAGCCCTTGA A3' (AGATCT is BglII enzyme site, while
GCCACCATG is Kozak sequence). For the reverse primer, the stop
codon TAA was deleted and an EcoRI restriction site was inserted.
The Fas ligand open reading frame should be in frame with the
downstream AcGFP gene sequence to ensure coexpression with
the fusion protein. The reverse primer was designed as follows:
5'ACTAGAATTCCGAGTTTATATAAGCCAAA 3' (GAATTC is EcoRI
enzyme site).
In order to improve the amplification efficiency, the full length
coding region of the bovine Fas ligand gene was amplified by
touchdown PCR (TD-PCR) from the plasmid template, and PCR
cycles were performed as follows: 94°C for 90 s; 5 cycles of 94°C
for 30 s, 69°C for 30 s, and 72°C for 1 min; 5 cycles of 94°C for 30
s, 67°C for 30 s and 72°C for 1 min; 28 cycles of 94°C for 30 s,
65°C for 30 s, and 72°C for 1 min; and a final extension period at
72°C for 10 min.. The PCR product was recovered and cloned into
pMD19-T Simple vector, and then it was transformed into DH5α
competent cells. The positive clones were picked out and shaken
overnight at 37°C. Plasmids were extracted from sense colonies
using TIANprep Mini Plasmid Kit (Tiangen, Beijing, China) and
digested with BglII and EcoRI enzymes (Takara). A cDNA fragment
of 847 bp was recovered and directly ligated to the AcGFP-N1
eukaryotic expression vector that was previously digested with BglII
and EcoRI enzymes, and transformed into DH5α competent cells.
The positive clones were picked out and shaken overnight at 37°C.
Identification of recombinant plasmid pAcGFP-bFasL
After random analysis of 10 clones with PCR, plasmids were
extracted from sense colonies and digested with BglII and EcoRI
enzymes to confirm the expression of the bovine Fas ligand. The
DNA sequence of the ORF was determined using an automatic
DNA sequencer (ABI Prism 310, Foster, CA, USA). All of these
procedures were performed according to the manufacturer’s
instructions. The Recombinant Plasmid pAcGFP-bFasL was
amplified in DH5α cells, and then the EndoFree Plasmid was
extracted from the sense colonies using the EndoFree Plasmid Kit
(Tiangen), and stored at -20°C.
G418 cytotoxicity test for follicular granulosa cells
Follicular granulosa cells were obtained from the Cell Center of
Chinese Academy of Medical Sciences. The cells were plated on
24-well culture plates (Falcon, Franklin Lakes, NJ, USA) and
incubated in a CO2 incubator (Thermo, Marietta,Ohio,USA) at 37°C
for 24 h, with 5% CO2 in the air. After 24 h of culture, the DMEM
medium (GIBCO, Invitrogen, Carlsbad, California, USA)
supplemented with 10% (V/V) fetal bovine serum (GIBCO) and 1%
(V/V) L-glutamine (GIBCO) was replaced with DMEM medium
containing different concentrations of G418 (100, 200, 300, 400,
500, 600, 700, 800, 900 and 1000 µg/ml; Sigma, St. Louis, MO,
USA). Cells were incubated at 37°C in 5% CO2, and the media was
replaced every 72 h for two weeks of observation. The optimum
concentration of G418 as a selection agent for follicular granulosa
cell was found to be the lowest concentration, under which all of the
cells were killed 10 to 14 days after culture in DMEM with G418. We
determined this concentration to be 600µg/ml. After the cells spread
out fully, positive clones were reselected using 600 g/ml of G418.

28S
18S
5S
Figure 1. The result of total RNA from bovine
ovary.
Figure 2. The product of bovine Fas ligand
gene. The cDNA from bovine ovary acted as
template, Fas ligand forward primer and FasL
reverse primer were used to amplify the FasL
fragment. Total volume of the reaction was 20
µL. A 1037 bp fragment was detected by
electrophoresis on 1.2% agarose gel. M, DNA
Marker DL 2000; lanes 1 and 2: cDNA of bovine
Fas ligand.
Yang et al. 12791
Finally, cell clones which could stably express bovine Fas ligand
gene were chosen for subsequent analysis.
Transfection and fluorescence detection of fusion protein
One day before transfection, 0.5-2 × 10 5 follicular granulosa cells
were plated in 500 µL of growth medium without antibiotics per well
of a 24-well culture plate (Falcon). When the cells reached more
than 90% confluency, the growth medium (10% (V/V) fetal bovine
serum, 100 U/ml Penicillin-Streptomycin (GIBCO) and 1% (V/V) Lglutamine)
was replaced by Opti-MEM serum-free media (GIBCO).
For transfection, DNA was diluted in 50 µL Opti-MEM serum-free
media, and then mixed gently with Lipofectamine 2000 (GIBCO)
before use, and the appropriate amount was diluted in 50 µL of
Opti-MEM serum-free media and incubated for 5 min at room
temperature. After 5 min of incubation, the diluted DNA was
combined with diluted Lipofectamine 2000 (total volume = 100
µL) and was mixed gently and incubated for 20 min at room
temperature. 100 µL DNA-lipofectamine 2000 mixture was added to
each well containing the cells and medium. The cells were
incubated at 37°C in a CO2 incubator for 4 to 6 h, and then the
medium was changed to growth medium. The cells were put in a
1:10 or higher dilution of fresh growth medium 24 hours after
transfection. The positive cell clones were screened using G418.
Twelve hours later, the expression of AcGFP in the cells was
observed under a fluorescence microscope (NikonTE2000, Japan)
and the numbers of AcGFP-positive cells were counted under high
power magnification every 24 h.
Analysis of bovine Fas ligand by RT-PCR and western-blotting
To confirm the insertion of a bovine Fas ligand open reading frame,
the cells were harvested after a stable transfection screening with
G418. mRNA was extracted from the cells using Quickprep Micro
mRNA Purification Kit (Invitrogen), and then reverse-transcribed to
synthesize the cDNA. The primer for amplification of partial cDNA
sequence of bovine Fas ligand was designed as follows: forward 5'
ACTAAGATCTGCCACCATGCAGCAGCCCTTGAA 3' and reverse
5' ACTAGAATTCCGAGTTTATATAAGCCAAA 3'. PCR cycles were
performed as follows: 94°C for 90 s; 5 cycles of 94°C for 30 s,
69°C for 30 s, and 72°C for 1 min; 5 cycles of 94°C for 30 s, 67°C
for 30 s, and 72°C for 1 min; 28 cycles of 94°C for 30 s, 65°C for 30
s, and 72°C for 1 min; and a final extension period at 72°C for 10
min.
The other cells were washed twice with phosphate-buffered
saline (PBS, pH 7.4), treated with 10% (V/V) trichloro acid (Wako
Pure Chemical Industries, Osaka, Japan) at 4°C for 30 min, and
scraped off. These cells were then suspended in UTD buffer (9
mol/L urea (Wako), 2% (V/V) triton X-100 (Sigma), and 1% (W/V)
(±)-dithiothreitol (Wako)) and 2% (W/V) lithium dodecyl sulfate
(Wako). The whole cell lysate was separated by 15% (W/V)
gradient sodium dodecyl sulfate- polyacrylamide gel electrophoresis
(SDS-PAGE) and then transferred onto polyvinylidene difluoride
(PVDF) membranes (Bio-Red laboratories Inc, USA). The PVDF
membranes were stained with a 0.2% (W/V) Ponceau-S solution
(Sigma) at 25°C for 1 min and then immersed in blocking solution
(20 mM Tris-HCl (pH 7.6), 137 mM NaCl, and 0.1% (V/V) Tween-20
containing 5% (W/V) skim milk (Sigma)) for 30 min. They were then
incubated with rabbit anti-bovine Fas ligand polyclonal antibody
(Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA) at 4°C for 12
h. After a wash with blocking solution, they were incubated with
horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG
antibody (Golden Bridge, Beijing, China) at 25°C for 1 h.
Chemiluminescence was visualized using an ECL system
(Applygen Technologies Inc, Beijing, China) according to the
manufacturer’s direction.

12792 Afr. J. Biotechnol.
Figure 3. Construction and identification of pMD19T-bFasL. The pT-bFasL plasmid
acted as template, specificity primers were used to amplify the Fas ligand coding
region with BglII / EcoRI site. A 847 bp fragment was detected by electrophoresis.
The Fas ligand coding region was cloned into the pMD19-T Simple vector, then
transformed into DH5a and the plasmids were extracted from positive clones and
digested with BglI and EcoRI enzymes (Takara) for 6 h at 37°C following the
supplier’s direction. A: Result of bovine Fas ligand gene with BglI and EcoRI
cloning sites by PCR (M, DNA Marker DL 2000; lanes 1 and 2 represents cattle Fas
ligand). B: Identification of pT-bFasL (M, DNA Marker DL 5000; lanes 1 and 2, pT-
bFasL plasmid digestion by restrictive enzyme BglII / EcoRI).
Figure 4. Identification of recombinant plasmid
pAcGFP-bFasL by restriction enzyme digestion.
The restriction fragments of BglI / EcoRI was
cloned into the pAcGFP-N1 vector then
transformed into DH5a,the plasmids were
extracted from positive clones and digested with
BglI and EcoRI enzyme(Takara) for 6 hours at
37°C following the supplier’s direction. M, DNA
Marker DL 5000; lanes 1, 2 and 3 represent
pAcGFP-bFasL digestion by restrictive enzyme
BglI / EcoRI.
RESULTS
Bovine Fas ligand gene cloning and sequence
analysis
The experimental results showed that a cDNA fragment
with a molecular size of about 1037 bp was obtained by
RT-PCR amplification, consistent with the expected
fragment size (Figures 1 and 2 ). Using T/A cloning,
positive clones were randomly chosen and the double
stranded cDNAs were sequenced. The length of one
clone was 1037 bp, which contained an ORF of 834 bp
(277 amino acids). The alignment results showed that the
amplified sequence for bovine Fas ligand had 100%
homology with that reported in GenBank (NCBI).
Construction and identification of a eukaryotic
expressing vector of fusion gene bFas-pAcGFP
The 847 bp coding region of the Fas ligand gene was
amplified from pT-bFasL plasmid with specific primers by
TD-PCR (Figure 3). The expected fragments were
obtained by complete digestion of the PMD19-T-FasL
plasmid, which was extracted from the transformed
positive clones and digested using BglII and EcoRI. The
target gene fragment was successfully connected to the
5' end of the AcGFP cDNA, which was confirmed to have
the Fas ligand reading frame aligned with AcGFP. The
847 bp fragments were obtained by complete digestion of

Table 1. Cytotoxicity test of G418 to cultured follicular granulosa cells for 12 days.
Yang et al. 12793
G418 concentration (µg/ml) 100 200 300 400 500 600 700 800 900 1000
Survival rate (%) +++ ++ ++ + + - - - - -
+++ = Survival rate of 80%; ++ = survival rate of 50%; + = survival rate of 30%; - = survival rate of 0%.
the recombinant plasmid pAcGFP-bFasL, which was
extracted from the transformed positive clones using BglII
and EcoRI (Figure 4).
The sequence analysis showed that the bovine Fas
ligand gene was successfully cloned into BglII / EcoRI
site of the pAcGFP-N1 vector. The authors confirmed that
the Fas ligand coding region sequence and the AcGFP
gene sequence had the same reading frame. This was
achieved through deleting the stop codon TAA and
inserting the C base, such that the target gene and fusion
protein gene could be expressed at the same time. The
reconstructed plasmid was named the pAcGFP-bFasL
vector.
Determination of the minimum dose of G418 for
follicular granulosa cells
After three days of selection with different concentrations
of G418, the cells were found to be in various degrees of
death, with the number of floating and broken cells
increasing in treatments supplemented with higher than
600 µg/ml G418. Peak mortality was in the eighth to tenth
day exposure duration, and cells treated with 600 µg/ml
G418 or more were dead by the tenth day. The
concentration of 600 µg/ml was therefore considered as
the minimum dose of G418 for follicular granulosa cells to
cause cell death (Table 1).
Transfection of follicular granulosa cells with
pAcGFP-bFasL plasmid and G418 selection
The positive charge of the cationic liposome’s surface
and the phosphate backbone of pAcGFP-bFasL plasmid
DNA stably combine by electrostatic interaction to form
the DNA-liposome complex. The complex is adsorbed to
the cell membrane with the negative charge and then the
DNA complex transfers into the cells and forms the
inclusion bodies in the cytoplasm by fusion, osmosis of
cytomembrane and endocytosis. The DNA-liposome
complex transfers into cells and the anionic lipid of the
membrane diffuses into the complex because the
membrane loses its electrostatic balance. The anionic
lipid of the membrane then combines with the positive
ions of cationic liposomes, forming the neutral ion pair, so
that the pAcGFP-bFasL plasmid DNA break away from
the DNA-liposome complex, enter the cytoplasm, and
then enter the nucleus through the nuclear pore. Finally,
the bovine Fas ligand gene encoding protein is produced
by transcription and expression in the nucleus.
Cells transfected with the pAcGFP-bFasL plasmid by
lipofectamine 2000 were screened with G418 up to the
fourteenth day. The negative control cells were all dead,
but cell clones formed in experimental conditions.
Subsequently, the maintaining dose of G418 (600 ug/ml)
was used to the 18th day, when all cell degeneration and
necrosis disappeared and the resistant cells formed
positive clones and gradually proliferated. The expression
of AcGFP was detected in the plasma and nucleus using
fluorescent microscopy (Figure 5). More also, detection of
green fluorescence in the cells showed that the
untransfected cells appropriately lacked fluorescence,
whereas expression of AcGFP was discretely observed in
the nuclei of follicular granulosa cells transfected with
pAcGFP-bFasL; uniform cellular distribution of AcGFP
expression was detected in the pAcGFP-N1 transfection
group (Figure 6).
RT-PCR analysis of monoclonal cell strains following
selection with G418
The RNA of the monoclonal cells screened by G418 was
extracted. A bright 847 bp fragment was amplified in the
pAcGFP-bFasL transfected follicular granulosa cells by
RT-PCR, whereas the 847 bp strap was weak in the
pAcGFP-N1 transfected cells and the negative control
cells (Figure 7). The results show effective expression of
Fas ligand in the pAcGFP-bFasL transfected follicular
granulosa cells, suggesting that the pAcGFP-bFasL
successfully transfected the follicular granulosa cell.
Evaluation of expression product by SDS-PAGE
electrophoresis and Western blot analysis
SDS-PAGE analysis indicated that the fusion protein of
AcGFP-bFasL was expressed in pAcGFP-bFasL
transfected cells and its molecular weight was about 59
kD (Figure 8a, lanes 3 and 4). No expression of the
fusion protein of AcGFP-bFasL was detected in pAcGFP-
N1 transfected cells or negative control cells (Figure 8A,
lanes 1 and 2). These results serve as preliminarily
evidence that follicular granulosa cells transfected with
AcGFP expression vectors of the bovine Fas ligand gene
are capable of expressing fusion target proteins. The
expressed fusion protein showed specificities of FasL
polyclonal antibody, as proved by Western blot, and
further proved to be an immunocompetent protein (Figure
8B). Fas ligand is known to induce apoptosis of ovarian
granulosa cells and then make the follicular atresia, so it

12794 Afr. J. Biotechnol.
could maintain the equilibrium state of bovine follicular
development.
DISCUSSION
Apoptosis is an important phenomenon involved in cell
survival and death during differentiation and development
(Yamauchi et al., 2007; Yan et al., 2001). The death
ligand and receptor systems are considered to be
apoptosis-inducing factors (Arican and Ilgar, 2009).
Apoptosis can be mediated by caspase-8 activation via
the extrinsic or death receptor- mediated pathway,
resulting in formation of the death-inducing signaling
complex (DISC) containing the adapter molecule FADD
and procaspase 8 (Whitley et al., 2006; Yang et al.,
2008).
Figure 5. Sequence analysis of recombinant expression
vector pAcGFP-bFasL. The pAcGFP-bFasL plasmid was
transfected into follicular granulosa cells mediated by
Lipofectamine 2000. After transfection, green fluorescent
was observed by fluorescent microscopy. The expression
rates of green fluorescence in follicular granulosa cells
was 68% at 24 h after transfection. A: Transfected
follicular granulosa cells by pAcGFP-bFasL under
fluorescent microscope. B: Transfected follicular
granulosa cells by pAcGFP-bFasL under visible light.
Scale bar 100 µm.
A previous study performed in our lab using an
analyzing expression map showed that bovine Fas ligand
mRNA is highly expressed in lymphoid tissue, ovaries
and testes, compared to other tissues. This suggests that
Fas ligand expression in the lymphoid tissue plays an
important role in keeping the bovine immune environment
stable. Fas in testicular germ cells and ovary oocytes
interact with Fas ligand in sertoli cells and follicular
granulosa cells, an interaction that could keep the
spermatogenesis and oogenesis balanced. During the
development of the bovine oocytes, the Fas/FasL
pathway induces apoptosis of ovarian granulosa cells by
initiating an apoptosis signal, leading to follicular atresia.
Gene mutation or abnormal expression of Fas ligand in
the reproductive system can lead to an internal
environment disorder and abnormal spermatogenesis
and oogenesis, which could subsequently cause

Yang et al. 12795
Figure 6. The green fluorescence positive cells after transfected with pAcGFP-bFasL plasmid. After transfection, the
green fluorescence could be detected in follicular granulosa cells transfected by pAcGFP-bFasL and pAcGFP-N1
plasmid, while there was no AcGFP expression in follicular granulosa cells untransfected by any plasmid. AcGFP
could be observed in the nucleus and its lateral region in pAcGFP-bFasL transfection group and uniform distribution
throughout on whole cell in pAcGFP-N1 transfection group. A, B and C shows transfected follicular granulosa cells
under visible light, while D, E and F shows transfected follicular granulosa cells under fluorescent microscope. A and
D represent the control group; B and E: pAcGFP-bFasL transfection group; C and F: pAcGFP-N1 transfection group.
Scale bar 50 µm.
oligzoospermous or aspermia in bulls and reduce a cow’s
ovulation and conception rate.
When the authors constructed the eukaryotic
expression vector for the pAcGFP-bFasL fusion protein,
the authors took advantage of directional cloning, by
introducing BglII(AGATCT) and EcoRI(GAATTC) at two
sites in the upstream primer and downstream primer,
respectively. These two restriction enzymes produced
different 3’cohesive ends, which allowed the target gene
to be directionally connected to vector. The benefits of
this method are as follows: i) the vector fragment could
not be cyclized since the vector’s two cohesive ends did
not complement each other, so there were few false
positive recombinant clones; ii) because the foreign
bovine Fas ligand gene was inserted into recombinant
plasmid in one direction, it was not necessary to screen
for the right connection; and iii) restriction enzyme sites
were preserved, which was beneficial for further
identification. In addition, the Kozak sequence was
introduced after the upstream primer’s BglII site to
promote transcription and translation efficiency of the Fas
ligand gene in the recombinant plasmid (Michelon et al.,
2003; Moshfegh et al., 2000).
pAcGFP-bFasL was transfected into follicular granulosa
cell, with a transfection efficiency reaching 68%. After
screening for two weeks using 600 µg/ml of G418
(Vanhamme et al., 2007), the positive clones emitted
fluorescence, indicating that the bovine Fas ligand gene
was completely inserted into the follicular granulosa cell
genome and the fusion protein was stably expressed.
The molecular weight of the green fluorescent protein
was 28 kD and the bovine Fas ligand’s molecular weight
was 31 kD, so the fusion protein’s molecular weight was
about 59 kD, consistent with the detection using SDS-
PAGE electrophoresis and Western blotting. Furthermore,
Fas ligand’s antibody binding to the NC membrane
showed a specific reaction with the fusion protein,
indicating that the follicular granulosa cells transfected
with pAcGFP-bFasL highly expressed the immunecompetent
Fas ligand protein. Additional variables, such
as decreasing the concentration of colored solution,
increasing the rinse time, increasing the buffer volume,
and shortening exposure time, could improve the protein
immunoblotting ECL development effect.

12796 Afr. J. Biotechnol.
This research was designed to study the mechanism of
bovine oogonium’s proliferation and differentiation. Fas
ligand was inserted into pAcGFP-N1’s N end and the
fusion protein was expressed in the pAcGFP-N1 vector
driven by the CMV promoter, which is thought to improve
the expression level of Fas ligand in eukaryotic cells
while keeping its structure and function unchanged. The
AcGFP reporter protein can be detected 8-12 h after
transfection, and fluorescence detection is stable for a
long time (Itoh et al., 2010). AcGFP, as pAcGFP-bFasL’s
reporter gene, may improve transfection efficiency and
reduce cell death. It may also be beneficial for environ-
Figure 7. The expression of bovine Fas ligand mRNA on follicular
granulosa cells determined RT-PCR.Total RNA was extracted from
follicular granulosa cells and cDNA was prepared using universal primer.
Specificity primers were used to amplify the Fas ligand sequence and a
bright 847 bp fragment was detected by electrophoresis on 1.2 % agarose
gel in pAcGFP-bFasL transfection group. M, DNA Marker DL 5000; lane 1
represents control group; lane 2: pAcGFP-bFasL transfection group and
lane 3 represents pAcGFP-N1 transfection group.
ment regulation and simulation of oocyte gene expression in
vivo, which could be applied to study the regulation of
Fas ligand on differentiation and proliferation of oogonium
at the gene level.
In conclusion, by fusing the bovine Fas ligand gene to
the AcGFP gene, the mammalian expression vector of
the pAcGFP-bFasL fusion protein was constructed and
found to be highly expressed in transfected follicular
granulosa cells. This method could provide technical
support for basic research on the regulation of Fas ligand
on bovine oogonium development and become important
for further research in the field of bovine development

and reproduction.
ACKNOWLEDGEMENTS
Figure 8: Figure.8 The expression of AcGFP-bFasL fusion protein and AcGFP
protein in follicular granulosa cells after transfection. Protein sample were loaded
onto 15% SDS-PAGE to separate protein and transferred to nylon cellulose
membrane. The membrane was probed with anti bovine Fas ligand polyclonal
antibody and then was probed with perxidase-conjugated goat anti-rabbit
polyclonal antibody as the second antibody.Bound antibodies were detected with
the enhanced chemiluminescence(ECL) method.Figure 8A: M. Protein
molecular weight marker(MW marker);1.cell lysate of follicular granulosa cells of
control group; 2.cell lysate of follicular granulosa cells of pAcGFP-N1 transfection
group;3,4. cell lysate of follicular granulosa cells of pAcGFP-bFasL transfection
group; Figure 8B: 1.western blot analysis of pAcGFP-N1 transfection
group;2.western blot analysis of pAcGFP-bFasL transfection group.
The authors thank Chinese Academy of Medical
Sciences for providing the biological material. This work
was supported by National Natural Science Foundation of
China (no.31000991) and Doctoral Program Foundation
of Institutions of Higher Education of China
(no.20100061120039) and the National R.&D. Project of
Transgenic Organisms of Ministry of Science and
Technology, China (no. 2009ZX08007-005B and no.
2009ZX08009- 156B).
REFERENCES
Arican GO, Ilgar NN (2009). Induction of apoptosis and cell proliferation
inhibition by paclitaxel in FM3A cell cultures. Afr. J. Biotechnol. 8:
547-555.
Chen QM, Yano T, Matsumi H, Osuga Y, Yano N, Xu JP, Wada O, Koga
K, Fujiwara T, Kugu K, Taketani Y (2005). Cross-talk between
Fas/Fas ligand system and nitric oxide in the pathway subserving
granulosa cell apoptosis: A possible regulatory mechanism for
ovarian follicle atresia. Endocrinology, 146: 808-815.
Gjorret JO, Wengle J, Maddox-Hyttel P, King WA (2005). Chronological
appearance of apoptosis in bovine embryos reconstructed by somatic
cell nuclear transfer from quiescent granulosa cells. Reprod. Domest
Anim. 40: 210-216.
Hsu YL, Kuo PL (2008). The grape and wine constituent piceatannol
inhibits proliferation of human bladder cancer cells via blocking cell
cycle progression and inducing Fas/membrane bound Fas ligandmediated
apoptotic pathway. Mol. Nutr. Food Res. 52: 408-418.
Yang et al. 12797
Itoh K, Ohshima M, Inoue K, Hayashi H, Tsuji D, Mizugaki M (2010).
Generation of AcGFP fusion with single-chain Fv selected from a
phage display library constructed from mice hyperimmunized against
5-methyl 2'-deoxycytidine. Protein Eng. Des. Sel. 23: 881-888.
Lai KW, Cheng L, Tsang BK, O WS (2000). Galactosemia and rat
granulosa cell apoptosis. Biol. Reprod. 62: 220-220.
Michelon A, Michelon M, Simionatto S, Lagranha VL, Conceicao FR,
Vaz EK, Cerqueira GM, Dellagostin OA (2003). Effect of the Kozak
Sequence on Seroconversion of Mice Immunized with a DNA Vaccine
against Swine Colibacilosis. Braz. J. Microbiol. 34: 85-87.
Moniruzzaman M, Sakamaki K, Akazawa Y, Miyano T (2007). Oocyte
growth and follicular development in KIT-deficient Fas-knockout mice.
Reproduction, 133: 117-125.
Morita Y, Perez GI, Maravei DV, Tilly KI, Tilly JL (1999). Targeted
expression of Bcl-2 in mouse oocytes inhibits ovarian follicle atresia
and prevents spontaneous and chemotherapy-induced oocyte
apoptosis in vitro. Mol. Endocrinol. 13: 841-850.
Moshfegh KH, Redondo M, Wuillemin WA, Julmy F, Meyer BJ (2000).
Kozak sequence polymorphism of platelet adhesion receptor GPIb
alpha gene related to variation in receptor density is associated with
myocardial infarction. Eur. Heart. J. 21: 130-130.
Porter DA, Vickers SL, Cowan RG, Huber SC, Quirk SM (2000).
Expression and function of fas antigen vary in bovine granulosa and
theca cells during ovarian follicular development and atresia. Biol.
Reprod. 62: 62-66.
Quirk SM, Cowan RG, Harman RM (2001). Estradiol inhibits apoptosis
of granulosa cells induced by Fas ligand. Biol. Reprod. 64: 291-291.
Taniguchi H, Yokomizo Y, Okuda K (2002). Fas-Fas ligand system
mediates luteal cell death in bovine corpus luteum. Biol. Reprod. 66:
754-759.
Tourneur L, Mistou S, Michiels FM, Devauchelle V, Renia L, Feunteun J,
Chiocchia G (2003). Loss of FADD protein expression results in a
biased Fas-signaling pathway and correlates with the development of
tumoral status in thyroid follicular cells. Oncogene, 22: 2795-2804.
Townson DH, Putnam AN, Sullivan BT, Guo L, Irving-Rodgers HF
(2010). Expression and distribution of cytokeratin 8/18 intermediate
filaments in bovine antral follicles and corpus luteum: an intrinsic
mechanism of resistance to apoptosis. Histol Histopathol 25:889-900.

12798 Afr. J. Biotechnol.
Vanhamme L, Uzureau P, Felu C, De Muylder G, Pays E (2007). G418,
phleomycin and hygromycin selection of recombinant Trypanosoma
brucei parasites refractory to long-term in vitro culture. Mol. Biochem.
Parasit. 154: 90-94.
Vij N, Roberts L, Joyce S, Chakravarti S (2004). Lumican suppresses
cell proliferation and aids Fas-Fas ligand mediated apoptosis:
implications in the cornea. Exp. Eye. Res. 78: 957-971.
Whitley GSJ, Harris LK, Keogh RJ, Wareing M, Baker PN, Cartwright
JE, Aplin JD (2006). Invasive trophoblasts stimulate vascular smooth
muscle cell apoptosis by a Fas ligand-dependent mechanism. Am. J.
Pathol. 169: 1863-1874.
Yamauchi T, Tsukane M, Yoshizaki C (2007). Development and specific
induction of apoptosis of cultured cell models overexpressing human
tau during neural differentiation: Implication in Alzheimer's disease.
Anal. Biochem. 360: 114-122.
Yan W, Kero J, Suominen J, Toppari J (2001). Differential expression
and regulation of the retinoblastoma family of proteins during
testicular development and spermatogenesis: roles in the control of
germ cell proliferation, differentiation and apoptosis. Oncogene, 20:
1343-1356.
Yang LG, Geng LY, Fang M, Yi HM, Jiang F, Moeen-ud-Din M (2008).
Effect of overexpression of inhibin alpha (1-32) fragment on bovine
granulosa cell proliferation, apoptosis, steroidogenesis, and
development of co-cultured oocytes. Theriogenology, 70: 35-43.

UPCOMING CONFERENCES
2012 International Conference on Biotechnology and Food Engineering
ICBFE 2012 Dubai, UAE. August 4-5, 2012
15th European Congress on Biotechnology: "Bio-Crossroads",
Istanbul, Turkey, 23 Sep 2012

Conferences and Advert
August 2012
International Conference on Biotechnology and Food Engineering (ICBFE 2012)
Dubai, UAE, 4 Aug 2012
September 2012
Agricultural Biotechnology International Conference (ABIC2012), Christchurch, New
Zealand, 1 Sep 2012
15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23
Sep 2012
October 2012
Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of
Biotechnology
Related Journals Published by Academic Journals
■ Journal of Evolutionary Biology Research
■ Journal of Yeast and Fungal Research
■ Journal of Brewing and Distilling
■ African Journal of Biochemistry Research
■ African Journal of Food Science
■ African Journal of Plant Science