2 - World Journal of Gastroenterology

World Journal of 

Gastrointestinal Oncology 

World J Gastrointest Oncol 2011 February 15; 3(2): 19-32 

www.wjgnet.com 

ISSN 1948-5204 (online)

Editorial Board 

2009-2013 

The World Journal of Gastrointestinal Oncology Editorial Board consists of 404 members, representing a team of 

worldwide experts in gastrointestinal oncology. They are from 41 countries, including Argentina (1), Australia (9), 

Austria (1), Belgium (4), Brazil (2), Bulgaria (1), Canada (4), Chile (2), China (51), Czech Republic (1), Finland (3), 

France (5), Germany (18), Greece (12), Hungary (2), India (9), Iran (3), Ireland (2), Israel (4), Italy (34), Japan (47), 

Kuwait (2), Mexico (1), Netherlands (8), New Zealand (2), Norway (1), Poland (4), Portugal (5), Romania (1), Saudi 

Arabia (1), Serbia (2), Singapore (4), South Korea (27), Spain (11), Sweden (6), Switzerland (2), Syria (1), Thailand 

(1), Turkey (6), United Kingdom (13), and United States (91). 

PRESIDENT AND EDITOR-IN- 

CHIEF 

Lian-Sheng Ma, Beijing 

STRATEGY ASSOCIATE 

EDITORS-IN-CHIEF 

Jian-Yuan Chai, Long Beach 

Antonio Macrì, Messina 

Markus K Menges, Schwaebisch Hall 

GUEST EDITORIAL BOARD 

MEMBERS 

Da-Tian Bau, Taichung 

Jui-I Chao, Hsinchu 

Chiao-Yun Chen, Kaohsiung 

Shih-Hwa Chiou, Taipei 

Tzeon-Jye Chiou, Taipei 

Jing-Gung Chung, Taichung 

Yih-Gang Goan, Kaohsiung 

Li-Sung Hsu, Taichung 

Tsann-Long Hwang, Taipei 

Long-Bin Jeng, Taichung 

Kwang-Huei Lin, Taoyuan 

Joseph T Tseng, Tainan 

Jaw Y Wang, Kaohsiung 

Kenneth K Wu, Miaoli 

Tzu-Chen Yen, Taoyuan 

MEMBERS OF THE EDITORIAL 

BOARD 

Argentina 

Lydia Inés Puricelli, Buenos Aires 

Australia 

Ned Abraham, Coffs Harbour 

Stephen John Clarke, Concord 

Michael McGuckin, South Brisbane 

Muhammed A Memon, Queensland 

Liang Qiao, Westmead 

Rodney J Scott, New South Wales 

Joanne Patricia Young, Herston 

Xue-Qin Yu, Kings Cross 

Xu-Dong Zhang, Newcastle 

Austria 

Michael Gnant, Vienna 

Belgium 

Wim P Ceelen, Ghent 

Van Cutsem Eric, Leuven 

Xavier Sagaert, Leuven 

Jan B Vermorken, Edegem 

Brazil 

Raul A Balbinotti, Caxias do Sul RS 

Sonia Maria Oliani, São Paulo 

Bulgaria 

Krassimir Dimitrow Ivanov, Varna 

Canada 

Alan G Casson, Saskatoon 

Hans Chung, Toronto 

WJGO|www.wjgnet.com I 

Rami Kotb, Sherbrooke 

Sai Yi Pan, Ottawa 

Chile 

Alejandro H Corvalan, Santiago 

Juan Carlos Roa, Temuco 

China 

Feng Bi, Chengdu 

Yong-Chang Chen, Zhenjiang 

Chi-Hin Cho, Hong Kong 

Ming-Xu Da , Lanzhou 

Xiang-Wu Ding, Xiangfan 

Jin Gu, Beijing 

Qin-Long Gu, Shanghai 

Hai-Tao Guan, Xi’an 

Chun-Yi Hao, Beijing 

Yu-Tong He, Shijiazhuang 

Jian-Kun Hu, Chengdu 

Huang-Xian Ju, Nanjing 

Wai-Lun Law, Hong Kong 

Shao Li, Beijing 

Yu-Min Li, Lanzhou 

Ka-Ho Lok, Hong Kong 

Maria Li Lung, Hong Kong 

Simon Ng, Hong Kong 

Wei-Hao Sun, Nanjing 

Qian Tao, Hong Kong 

Bin Wang, Nanjing 

Kai-Juan Wang, Zhengzhou 

Wei-Hong Wang, Beijing 

Ya-Ping Wang, Nanjing 

Ai-Wen Wu, Beijing 

Zhao-Lin Xia, Shanghai 

Xue-Yuan Xiao, Beijing 

Dong Xie, Shanghai 

Yi-Zhuang Xu, Beijing 

February 15, 2011

Guo-Qiang Xu, Hangzhou 

Winnie Yeo, Hong Kong 

Ying-Yan Yu, Shanghai 

Siu Tsan Yuen, Hong Kong 

Wei-Hui Zhang, Harbin 

Li Zhou, Beijing 

Yong-Ning Zhou, Lanzhou 

Ondrej Slaby, Brno 

Czech Republic 

Finland 

Riyad Bendardaf, Turku 

Pentti Ilmari Sipponen, Helsinki 

Markku Voutilainen, Jyväskylä 

France 

Bouvier Anne-Marie, Cedex 

Stéphane Benoist, Boulogne 

Ouaissi Mehdi, Cedex 

Isabelle V Seuningen, Cedex 

Karem Slim, Clermont-Ferrand 

Germany 

Han-Xiang An, Marburg 

Karl-Friedrich Becker, München 

Stefan Boeck, Munich 

Dietrich Doll, Marburg 

Volker Ellenrieder, Marburg 

Joachim P Fannschmidt, Heidelberg 

Ines Gütgemann, Bonn 

Jakob R Izbicki, Hamburg 

Gisela Keller, München 

Jörg H Kleeff, Munich 

Axel Kleespies, Munich 

Hans-Joachim Meyer, Solingen 

Lars Mueller, Kiel 

Marc A Reymond, Bielefeld 

Robert Rosenberg, München 

Oliver Stoeltzing, Mainz 

Ludwig G Strauss, Heidelberg 

Greece 

Ekaterini Chatzaki, Alexandroupolis 

Eelco de Bree, Heraklion 

Maria Gazouli, Athens 

Vassilis Georgoulias, Crete 

John Griniatsos, Athens 

Ioannis D Kanellos, Thessaloniki 

Vaios Karanikas, Larissa 

Georgios Koukourakis, Athens 

Gregory Kouraklis, Athens 

Dimitrios H Roukos, Ioannina 

Konstantinos Nik Syrigos, Athens 

Ioannis A Voutsadakis, Larissa 

Hungary 

László Herszényi, Budapest 

Zsuzsa Schaff, Budapest 

India 

Uday Chand Ghoshal, Lucknow 

Ruchika Gupta, New Delhi 

Kalpesh Jani, Gujarat 

Ashwani Koul, Chandigarh 

Balraj Mittal, Lucknow 

Rama Devi Mittal, Lucknow 

Susanta Roychoudhury, Kolkata 

Yogeshwer Shukla, Lucknow 

Imtiaz Ahmed Wani, Kashmir 

Iran 

Mohammad R Abbaszadegan, Mashhad 

Reza Malekezdeh, Tehran 

Mohamad A Pourhoseingholi, Tehran 

Ireland 

Aileen Maria Houston, Cork 

Colm Ó’Moráin, Dublin 

Israel 

Nadir Arber, Tel Aviv 

Dan David Hershko, Haifa 

Eytan Domany, Rehovot 

Yaron Niv, Patch Tikva 

Italy 

Massimo Aglietta, Turin 

Azzariti Amalia, Bari 

Domenico Alvaro, Rome 

Marco Braga, Milan 

Federico Cappuzzo, Rozzano 

Fabio Carboni, Rome 

Vincenzo Cardinale, Rome 

Luigi Cavanna, Piacenza 

Riccardo Dolcetti, Aviano 

Pier Francesco Ferrucci, Milano 

Francesco Fiorica, Ferrara 

Gennaro Galizia, Naples 

Silvano Gallus, Milan 

Milena Gusella, Trecenta 

Roberto F Labianca, Bergamo 

Massimo Libra, Catania 

Roberto Manfredi, Bologna 

Gabriele Masselli, Roma 

Simone Mocellin, Padova 

Gianni Mura, Arezzo 

Gerardo Nardonen, Napoli 

Francesco Perri, San Benedetto del Tronto 

Francesco Recchia, Avezzano 

Vittorio Ricci, Pavia 

Fabrizio Romano, Monza 

Antonio Russo, Palermo 

Daniele Santini, Roma 

Claudio Sorio, Verona 

Cosimo Sperti, Padova 

Gianni Testino, Genova 

Giuseppe Tonini, Rome 

Bruno Vincenzi, Rome 

Angelo Zullo, Rome 

Japan 

Keishiro Aoyagi, Kurume 

Suminori Akiba, Kagoshima 

WJGO|www.wjgnet.com II 

Narikazu Boku, Shizuoka 

Yataro Daigo, Tokyo 

Itaru Endo, Yokohama 

Mitsuhiro Fujishiro, Tokyo 

Osamu Handa, Kyoto 

Kenji Hibi, Yokohama 

Asahi Hishida, Nagoya 

Eiso Hiyama, Hiroshima 

Atsushi Imagawa, Okayama 

Johji Inazawa, Tokyo 

Terumi Kamisawa, Tokyo 

Tatsuo Kanda, Niigata 

Masaru Katoh, Tokyo 

Takayoshi Kiba, Hyogo 

Hajime Kubo, Kyoto 

Yukinori Kurokawa, Osaka 

Chihaya Maesawa, Morioka 

Yoshinori Marunaka, Kyoto 

Hishairo Matsubara, Chiba 

Osam Mazda, Kyoto 

Shinichi Miyagawa, Matsumoto 

Eiji Miyoshi, Suita 

Toshiyuki Nakayama, Nagasaki 

Masahiko Nishiyama, Saitama 

Koji Oba, Kyoto 

Masayuki Ohtsukam, Chiba 

Masao Seto, Aichi 

Tomoyuki Shibata, Aichi 

Mitsugi Shimoda, Tochigi 

Haruhiko Sugimura, Hamamatsu 

Tomomitsu Tahara, Aichi 

Shinji Takai, Osaka 

Satoru Takayama, Nagoya 

Hiroya Takiuchi, Osaka 

Akio Tomoda, Tokyo 

Akihiko Tsuchida, Tokyo 

Yasuo Tsuchiya, Niigata 

Takuya Watanabe, Niigata 

Toshiaki Watanabe, Tokyo 

Hiroshi Yasuda, Kanagawa 

Yo-ichi Yamashita, Hiroshima 

Hiroki Yamaue, Wakayama 

Hiroshi Yokomizo, Kumamoto 

Yutaka Yonemura, Osaka 

Reigetsu Yoshikawa, Hyogo 

Kuwait 

Fahd Al-Mulla, Safat 

Salem Alshemmari, Safat 

Mexico 

Oscar GA Rodriguez, Mexico 

Netherlands 

Jan Paul De Boer, Amsterdam 

Bloemena Elisabeth, Amsterdam 

Peter JK Kuppen, Leiden 

Gerrit Albert Meijer, Hattem 

Anya N Milne, Utrecht 

Godefridus J Peters, Amsterdam 

Cornelis FM Sier, Leiden 

Peter Derk Siersema, Utrecht 

New Zealand 

Lynnette R Ferguson, Auckland 

Jonathan Barnes Koea, Auckland 

Norway 

Kjetil Søreide, Stavanger 

February 15, 2011

Contents Monthly Volume 3 Number 2 February 15, 2011 

EDITORIAL 

BRIEF ARTICLES 

19 Intestinal lymphangiectasia in adults 

Freeman HJ, Nimmo M 

24 T(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas are 

heterogeneous with respect to the VH gene mutation status 

Sagaert X, Maes B, Vanhentenrijk V, Baens M, Van Cutsem E, De Hertogh G, Geboes K, 

Tousseyn T 

WJGO|www.wjgnet.com February 15, 2011|Volume 3| ssue 2|

Contents 

ACKNOWLEDGMENTS 

APPENDIX 

ABOUT COVER 

AIM AND SCOPE 

FLYLEAF 

EDITORS FOR 

THIS ISSUE 

NAME OF JOURNAL 

World Journal of Gastrointestinal Oncology 

LAUNCH DATE 

October 15, 2009 

SPONSOR 

Beijing Baishideng BioMed Scientific Co., Ltd., 

Room 903, Building D, Ocean International Center, 

No. 62 Dongsihuan Zhonglu, Chaoyang District, 

Beijing 100025, China 

Telephone: 0086-10-8538-1892 

Fax: 0086-10-8538-1893 

E-mail: baishideng@wjgnet.com 

http://www.wjgnet.com 

EDITING 

Editorial Board of World Journal of Gastrointestinal Oncology, 




Telephone: +0086-10-8538-1891 

Fax: +0086-10-8538-1893 

E-mail: wjgo@wjgnet.com 


PUBLISHING 

Baishideng Publishing Group Co., Limited, 

Room 1701, 17/F, Henan Bulding, 

No.90 Jaffe Road, Wanchai, 

Hong Kong, China 

WJGO|www.wjgnet.com 

Fax: 00852-3115-8812 

Telephone: 00852-5804-2046 



SUBSCRIPTION 

Beijing Baishideng BioMed Scientific Co., Ltd., 




Telephone: 0086-10-8538-1892 

Fax: 0086-10-8538-1893 



ONLINE SUBSCRIPTION 

One-Year Price 216.00 USD 

PUBLICATION DATE 

February 15, 2011 

CSSN 

ISSN 1948-5204 (online) 

PRESIDENT AND EDITOR-IN-CHIEF 

Lian-Sheng Ma, Beijing 

STRATEGY ASSOCIATE EDITORS-IN-CHIEF 

Jian-Yuan Chai, Long Beach 

Antonio Macrì, Messina 

Markus K Menges, Schwaebisch Hall 


Volume 3 Number 2 February 15, 2011 

I Acknowledgments to reviewers of World Journal of Gastrointestinal Oncology 

I Meetings 

I-V Instructions to authors 

Freeman HJ, Nimmo M. Intestinal lymphangiectasia in adults. 

World J Gastrointest Oncol 2011; 3(2): 19-23 

http://www.wjgnet.com/1948-5204/full/v3/i2/19.htm 

World Journal of Gastrointestinal Oncology (World J Gastrointest Oncol, WJGO, online ISSN 

1948-5204, DOI: 10.4251) is a monthly peer-reviewed, online, open-access, journal 

supported by an editorial board consisting of 404 experts in gastrointestinal oncology 

from 41 countries. 

The major task of WJGO is to report rapidly the most recent advances in basic 

and clinical research on gastrointestinal oncology. The topics of WJGO cover the 

carcinogenesis, tumorigenesis, metastasis, diagnosis, prevention, prognosis, clinical 

manifestations, nutritional support, molecular mechanisms, and therapy of benign and 

malignant tumors of the digestive tract. This cover epidemiology, etiology, immunology, 

molecular oncology, cytology, pathology, genetics, genomics, proteomics, pharmacology, 

pharmacokinetics, nutrition, diagnosis and therapeutics. This journal will also provide 

extensive and timely review articles on oncology. 

I-III Editorial Board 

Responsible Assistant Editor: Na Liu Responsible Science Editor: Jin-Lei Wang 

Responsible Electronic Editor: Wen-Hua Ma Proofing Editorial Office Director: Jin-Lei Wang 

Proofing Editor-in-Chief: Lian-Sheng Ma 

EDITORIAL OFFICE 

Jin-Lei Wang, Director 





Telephone: 0086-10-8538-1891 

Fax: 0086-10-8538-1893 



COPYRIGHT 

© 2011 Baishideng. All rights reserved; no part of this 

publication may be reproduced, stored in a retrieval 

system, or transmitted in any form or by any means, 

electronic, mechanical, photocopying, recording, or 

otherwise without the prior permission of Baishideng. 

Author are required to grant World Journal of 

Gastrointestinal Oncology an exclusive license to publish. 

SPECIAL STATEMENT 

All articles published in this journal represent the 

viewpoints of the authors except where indicated 

otherwise. 

INSTRUCTIONS TO AUTHORS 

Full instructions are available online at http://www. 

wjgnet.com/1948-5204/g_info_20100312180518.htm. 

If you do not have web access please contact the editorial 

office. 

ONLINE SUBMISSION 

http://www.wjgnet.com/1948-5204office 

February 15, 2011|Volume 3| ssue 2|

Online Submissions: http://www.wjgnet.com/1948-5204office 

wjgo@wjgnet.com 

doi:10.4251/wjgo.v3.i2.19 

Intestinal lymphangiectasia in adults 

Hugh James Freeman, Michael Nimmo 

Hugh James Freeman, Department of Medicine (Gastroenterology), 

University of British Columbia, Vancouver, BC, V6T 

1W5, Canada 

Michael Nimmo, Department of Pathology, University of British 

Columbia, Vancouver, BC, V6T 1W5, Canada 

Author contributions: Freeman HJ and Nimmo M contributed 

equally to this work. 

Correspondence to: Dr. Hugh James Freeman, MD, CM, 

FRCPC, FACP, Freeman, Department of Medicine (Gastroenterology), 

University of British Columbia, Vancouver, BC, V6T 

1W5, Canada. hugfree@shaw.ca 

Telephone: +1-604-8227216 Fax: +1-604-8227236 

Received: July 26, 2010 Revised: January 31, 2011 

Accepted: February 7, 2011 

Published online: February 15, 2011 

Abstract 

Intestinal lymphangiectasia in the adult may be characterized 

as a disorder with dilated intestinal lacteals 

causing loss of lymph into the lumen of the small intestine 

and resultant hypoproteinemia, hypogammaglobulinemia, 

hypoalbuminemia and reduced number 

of circulating lymphocytes or lymphopenia. Most often, 

intestinal lymphangiectasia has been recorded in children, 

often in neonates, usually with other congenital 

abnormalities but initial definition in adults including the 

elderly has become increasingly more common. Shared 

clinical features with the pediatric population such as 

bilateral lower limb edema, sometimes with lymphedema, 

pleural effusion and chylous ascites may occur 

but these reflect the severe end of the clinical spectrum. 

In some, diarrhea occurs with steatorrhea along with 

increased fecal loss of protein, reflected in increased fecal 

alpha-1-antitrypsin levels, while others may present 

with iron deficiency anemia, sometimes associated with 

occult small intestinal bleeding. Most lymphangiectasia 

in adults detected in recent years, however, appears 

to have few or no clinical features of malabsorption. 

Diagnosis remains dependent on endoscopic changes 

confirmed by small bowel biopsy showing histological 

evidence of intestinal lymphangiectasia. In some, video 

capsule endoscopy and enteroscopy have revealed more 



© 2011 Baishideng. All rights reserved. 

EDITORIAL 

extensive changes along the length of the small intestine. 

A critical diagnostic element in adults with lymphangiectasia 

is the exclusion of entities (e.g. malignancies 

including lymphoma) that might lead to obstruction 

of the lymphatic system and “secondary” changes in the 

small bowel biopsy. In addition, occult infectious (e.g. 

Whipple’s disease from Tropheryma whipplei) or inflammatory 

disorders (e.g. Crohn’s disease) may also present 

with profound changes in intestinal permeability and 

protein-losing enteropathy that also require exclusion. 

Conversely, rare B-cell type lymphomas have also been 

described even decades following initial diagnosis of 

intestinal lymphangiectasia. Treatment has been historically 

defined to include a low fat diet with medium-chain 

triglyceride supplementation that leads to portal venous 

rather than lacteal uptake. A number of other pharmacological 

measures have been reported or proposed but 

these are largely anecdotal. Finally, rare reports of localized 

surgical resection of involved areas of small intestine 

have been described but follow-up in these cases is 

often limited. 


Key words: Intestinal lymphangiectasia; Adults; Submucosa 

Peer reviewer: Ioannis A Voutsadakis, MD, PhD, Department 

of Medical Oncology, University Hospital of Larissa, Larissa 

41110, Greece 

Freeman HJ, Nimmo M. Intestinal lymphangiectasia in adults. 

World J Gastrointest Oncol 2011; 3(2): 19-23 Available from: 

URL: http://www.wjgnet.com/1948-5204/full/v3/i2/19.htm 

DOI: http://dx.doi.org/10.4251/wjgo.v3.i2.19 

INTRODUCTION 

Waldman et al [1] first detailed cases of intestinal lymphangiectasia 

almost 50 years ago. In their cases, edema and hypoproteinemia 

were present with both hypoalbuminemia 

and hypogammaglobulinemia. Estimated measurements 

WJGO|www.wjgnet.com 19 

February 15, 2011|Volume 3|Issue 2|

Freeman HJ et al . Intestinal lymphangiectasia 

of the total body albumin pool using a radio-labeled albumin 

method were reduced while fecal excretion was 

increased. In some, steatorrhea was also present. Biopsies 

of the small bowel are needed to confirm the diagnosis [2] . 

These show prominent dilated lymphatics in the lamina 

propria region of the villous structure, often with extension 

into submucosa (Figures 1 and 2). Others have commented 

that these changes may be difficult to detect since 

dilation of intestinal lacteals or lymph containing capillaries 

may be quite focal [3] . Familial presentations were also 

recorded [1] . Most often affected were children and young 

adults, although even historically, diagnosis was initially 

also occasionally defined in older, even elderly, adults. The 

precise cause of intestinal lymphangiectasia with enteric 

protein loss remains obscure but changes in regulatory 

molecules involved in lymphangiogenesis have been reported 

in the duodenal mucosa [4] . 

CLINICAL FEATURES 

Commonly reported clinical findings have traditionally 

described pitting edema, usually in a symmetrical distribution 

involving the lower limbs. If severe edema is evident, 

facial and scrotal (or vaginal) involvement may occur. 

Effusions may also develop in pleural, pericardial and 

peritoneal cavities with gross chylous ascites. Sonographic 

evidence of fetal ascites has also been reported [5] . Rarely, 

lymphedema (that may be difficult to differentiate from 

edema due to hypoalbuminemia and low oncotic pressure) 

and the so-called “Stemmer’s sign” (i.e. skin fibrosis on 

dorsum of the second toe due to chronic lymphedema) [6] 

have been described. It should be emphasized, however, 

that many of these clinical features likely reflect the severe 

end of the spectrum of clinical changes, especially 

in adults with intestinal lymphangiectasia. In recent years, 

directly due to the emergence of newer endoscopic methods, 

particularly video capsule endoscopy in adults, detection 

of mucosal changes suggestive of lymphangiectasia 

seem to be relatively common. For example, in a recent 

evaluation of 1866 consecutive endoscopic examinations, 

histological confirmation of duodenal lymphangiectasia 

was evident in 1.9% [7] . More significant, even if lymphangiectasia 

persisted on consecutive endoscopic studies over 

a year apart, there was no clinical evidence of malabsorption 

[7] . Therefore, it would seem that in most histologically-confirmed 

intestinal lymphangiectasia, clinical features 

may be very limited and the classical “textbook” recorded 

changes may be more reflective of the most severe end of 

the clinicopathological spectrum in adults. 

In some, an abdominal mass may be noted [8] , either 

on clinical evaluation or with radiological imaging studies, 

particularly ultrasound (with or without endoscopy) 

or computerized tomography. These masses are usually 

cystic and often represent associated lymphangiomas. The 

latter are entirely benign lesions that may be associated 

with lymphangiectasia in either small or large bowel [9,10] . 

The most commonly reported intestinal site is the duodenum 

[11] , in part, perhaps, because these have been easier 

to detect with endoscopic evaluation showing a smooth, 

Figure 1 Low power view of dilated lymphatics involving mucosa and submucosa 

in intestinal lymphangiectasia. In this section, the mucosal changes 

are patchy rather than continuous in distribution, emphasizing the multifocal nature 

of the disorder. 

Figure 2 High power view showing mucosal involvement with dilated 

lymphatics in intestinal lymphangiectasia. Surface epithelial cells are normal. 

Lymphatic protein is present in the dilated lymphatics of the intestinal mucosa. 

soft, polypoid cystic lesion with a broad base [10] . In others, 

a segmental area of edema and wall thickening may occur 

causing a localized obstruction and, occasionally, resulting 

in a segmental intestinal resection [12] . To some degree, 

evolving imaging methods not available during the era of 

the initial description of this disorder have enhanced our 

appreciation for these more extensive lymphatic changes. 

A rare association of intestinal lymphangiectasia with 

celiac disease has been noted [13] ; however, in most with 

primary intestinal lymphangiectasia, the intestinal mucosa 

appears to be otherwise normal on routine microscopic 

evaluation apart from the dilated lacteals. In addition, 

iron deficiency may occur [14] but it is not clear if there is 

any impairment of iron absorption in primary intestinal 

lymphangiectasia even if it primarily localized in the duodenum. 

Chronic occult blood loss may occur in some [15] 

and non-specific small bowel ulceration has been noted [14] . 

Rarely, massive bleeding has been recorded [16,17] . In a recent 

study using capsule endoscopy [18] , an intriguing but statistically 

significant association with coincident small bowel 

angiodysplasia was noted, suggesting another possible 

mechanism for occult blood loss with lymphangiectasia. 

Recurrent hemolysis with uremia may occur [19] and, possibly, 

urinary iron loss from ongoing intravascular hemolysis 



may result. The mechanisms involved for malabsorption 

of fat and fat soluble vitamins are not fully defined and 

need to be further explored. However, osteomalacia associated 

with vitamin D deficiency has been noted [20] and 

tetany attributed to hypocalcemia has been reported [21] . 

Rarely, yellow nails have been described (i.e. “yellow 

nail syndrome”) in primary intestinal lymphangiectasia 

with dystrophic ridging and loss of the nail lunula. In addition, 

lymphedema and pleural effusions were noted [22] . 

Finally, an intriguing association with autoimmune polyglandular 

disease type 1 has been described [23,24] . 

DIAGNOSIS 

Diagnosis is defined by endoscopic evaluation and biopsy 

of duodenum and/or jejunum [1, 2] or alternatively from 

surgically resected small intestine. Dilated lacteals are detected 

in the mucosa, sometimes extending into the submucosa 

(Figures 1 and 2). Usually, the overlying small intestinal 

epithelium is completely normal. Sometimes, ileal 

biopsies from ileocolonoscopy may show the small intestinal 

histopathological changes. High-resolution magnifying 

video endoscopy may have an important role in detection 

of intestinal lymphangiectasia [25] . Video capsule studies 

may permit evaluation of the extent of the lymphangiectasia 

including the “yellow nail syndrome” and has 

been confirmed with surgical exploration [27-29] . Doubleballoon 

enteroscopy has also emerged in the evaluation 

of malabsorption and up to 13% of patients were found 

to have yellow and white submucosal plaques, likely to be 

lymphangiectasis [30,31] . Although radiotracers and direct 

lymphatic imaging were often historically used, magnetic 

resonance imaging has also been applied in patients with 

intestinal lymphangiectasia to evaluate intestinal, mesenteric 

and thoracic duct changes [32] . 

Associated immunological changes have been described 

in a number of studies [33-36] . These findings include 

hypoproteinemia, hypoalbuminemia and hypogammaglobulinemia. 

Lymphocytopenia occurs with B-cell depletion 

reflected by diminished immunoglobulins IgG, IgA and 

IgM, as well as T-cell depletion, especially in the number 

of CD4+ T-cells as naïve CD45RA+ lymphocytes. In addition, 

functional changes occur including impaired antibody 

responses and prolonged skin allograft rejection may 

result. Finally, a recent report indicates that T-cell thymic 

production failed to compensate for enteric T-lymphocyte 

loss suggesting multiple mechanisms are involved in lymphopenia 

associated with lymphangiectasia [37] . 

Enteric protein loss may be suspected if fecal alpha- 

1-antitrypsin is increased. Radio-labeled albumin studies 

may demonstrate increased loss but prolonged scanning 

may be required as protein loss may be periodic or intermittent. 

In some cases, localization of the site of protein 

loss may also be possible [38] . Imaging with ultrasound 

or computerized tomography may define intestinal wall 

thickening, mesenteric “edema” or ascites [39-41] . Magnetic 

resonance imaging has also been reported for use in the 

diagnosis of protein losing enteropathy [42] . Lymphoscintigraphy 

may also be used to anatomically define the 

lymphatic system but this procedure has largely become 

historical, less often performed and may correlate poorly 

with the severity of protein loss [43] . 

It is especially critical to ensure that changes of intestinal 

lymphangiectasia are not secondary to some other 

cause, particularly from a “downstream” obstruction, 

including another intestinal disease (e.g. Crohn’s disease, 

Whipple’s disease from Tropheryma whipplei infection [44] , intestinal 

tuberculosis), radiation- and/or chemotherapy-induced 

retroperitoneal fibrosis, or even a circulatory cause 

(e.g. constrictive pericarditis). Many gastric disorders (e.g. 

Mentrier’s disease) or inflammatory disorders involving the 

intestine (e.g. protein losing enteropathy in systemic lupus 

erythematosus) may also cause protein loss without intestinal 

lymphangiectasia [45] . Finally and particularly significant 

are malignant lymphomas that may secondarily cause 

lymphatic obstruction and intestinal lymphangiectasia with 

intestinal protein loss. In these, resolution of the proteinlosing 

enteropathy with the intestinal lymphangiectasia 

may result from lymphoma treatment [46-48] . Conversely, it 

also conceivable that lymphoma may complicate the clinical 

course of long-standing intestinal lymphangiectasia 

per se. Both intestinal and extra-intestinal lymphomas have 

been described, usually B-cell type, during the course of 

long-standing intestinal lymphangiectasia [49] . A definite 

mechanism has not been defined although depressed immune 

surveillance may result from ongoing and persistent 

depletion of immunoglobulins and lymphocytes. 

THERAPY 


Treatment has traditionally included a low fat diet along 

with a medium-chain triglyceride oral supplement [50] . 

The latter directly enters the portal venous system and 

bypasses the intestinal lacteal system. Some believe that 

reduced dietary fat prevents lacteal dilation and possible 

rupture with loss of protein and lymphocyte depletion. 

In some, this therapy can cause reversal of clinical and 

biochemical changes, being more effective in children 

than adults [51] . In some that fail to respond, other forms 

of nutritional support have been required [52] . 

Other therapies have been reported. Tranexamic acid, 

an antiplasmin, has been used to normalize immunoglobulin 

and lymphocyte numbers [53] . Octreotide was reported 

to be useful but the mechanism is not clear [54] . Segmental 

small bowel resection for localized areas of lymphangiectasia 

has been recorded [55] . Steroids remain controversial 

although effectiveness in systemic lupus erythematosus 

with protein-losing enteropathy has been recorded. Infusions 

of intravenous albumin may provide temporary 

effectiveness but usually this exogenous source is also 

metabolized or lost. Management of lower limb edema is 

also important, usually with elastic bandages or stockings. 

The long-term natural history of intestinal lymphangiectasia 

has been evaluated only to a limited extent. In a 

recent report [56] , dietary intervention appeared to be effective 

in most cases, particularly in pediatric-onset disease. 

In the same report, 5% appeared to develop malignant 




transformation with lymphoma with the average duration 

to lymphoma diagnosis being over 30 years. 

REFERENCES 

1 Waldmann TA, Steinfeld JL, Dutcher TF, Davidson JD, Gordon 

RS Jr. The role of the gastrointestinal system in "idiopathic 

hypoproteinemia". Gastroenterology 1961; 41: 197-207 

2 Freeman HJ. Small intestinal mucosal biopsy for investigation 

of diarrhea and malabsorption in adults. Gastrointest 

Endosc Clin N Am 2000; 10: 739-753, vii 

3 Hart MH, Vanderhoof JA, Antonson DL. Failure of blind 

small bowel biopsy in the diagnosis of intestinal lymphangiectasia. 

J Pediatr Gastroenterol Nutr 1987; 6: 803-805 

4 Hokari R, Kitagawa N, Watanabe C, Komoto S, Kurihara C, 

Okada Y, Kawaguchi A, Nagao S, Hibi T, Miura S. Changes 

in regulatory molecules for lymphangiogenesis in intestinal 

lymphangiectasia with enteric protein loss. J Gastroenterol 

Hepatol 2008; 23: e88-e95 

5 Schmider A, Henrich W, Reles A, Vogel M, Dudenhausen 

JW. Isolated fetal ascites caused by primary lymphangiectasia: 

a case report. Am J Obstet Gynecol 2001; 184: 227-228 

6 Vignes S, Bellanger J. Primary intestinal lymphangiectasia 

(Waldmann's disease). Orphanet J Rare Dis 2008; 3: 5 

7 Kim JH, Bak YT, Kim JS, Seol SY, Shin BK, Kim HK. Clinical 

significance of duodenal lymphangiectasia incidentally 

found during routine upper gastrointestinal endoscopy. 

Endoscopy 2009; 41: 510-515 

8 Rao R, Shashidhar H. Intestinal lymphangiectasia presenting 

as abdominal mass. Gastrointest Endosc 2007; 65: 522-523, 

discussion 523 

9 Colizza S, Tiso B, Bracci F, Cudemo RG, Bigotti A, Crisci 

E. Cystic lymphangioma of stomach and jejunum: report of 

one case. J Surg Oncol 1981; 17: 169-176 

10 Camilleri M, Satti MB, Wood CB. Cystic lymphangioma of 

the colon. Endoscopic and histologic features. Dis Colon Rectum 

1982; 25: 813-816 

11 Davis M, Fenoglio-Preiser C, Haque AK. Cavernous lymphangioma 

of the duodenum: case report and review of the 

literature. Gastrointest Radiol 1987; 12: 10-12 

12 Lenzhofer R, Lindner M, Moser A, Berger J, Schuschnigg C, 

Thurner J. Acute jejunal ileus in intestinal lymphangiectasia. 

Clin Investig 1993; 71: 568-571 

13 Perisic VN, Kokai G. Coeliac disease and lymphangiectasia. 

Arch Dis Child 1992; 67: 134-136 

14 Iida F, Wada R, Sato A, Yamada T. Clinicopathologic consideration 

of protein-losing enteropathy due to lymphangiectasia 

of the intestine. Surg Gynecol Obstet 1980; 151: 

391-395 

15 Herfarth H, Hofstädter F, Feuerbach S, Jürgen Schlitt H, 

Schölmerich J, Rogler G. A case of recurrent gastrointestinal 

bleeding and protein-losing gastroenteropathy. Nat Clin 

Pract Gastroenterol Hepatol 2007; 4: 288-293 

16 Baichi MM, Arifuddin RM, Mantry PS. Acute gastrointestinal 

bleeding from focal duodenal lymphangiectasia. Scand J 

Gastroenterol 2007; 42: 1269-1270 

17 Lom J, Dhere T, Obideen K. Intestinal lymphangiectasia 

causing massive gastrointestinal bleed. J Clin Gastroenterol 

2010; 44: 74-75 

18 Macdonald J, Porter V, Scott NW, McNamara D. Small bowel 

lymphangiectasia and angiodysplasia: a positive association; 

novel clinical marker or shared pathophysiology? J Clin Gastroenterol 

2010; 44: 610-614 

19 Kalman S, Bakkaloğlu S, Dalgiç B, Ozkaya O, Söylemezoğlu O, 

Buyan N. Recurrent hemolytic uremic syndrome associated 

with intestinal lymphangiectasia. J Nephrol 2007; 20: 246-249 

20 Sahli H, Ben Mbarek R, Elleuch M, Azzouz D, Meddeb N, 

Chéour E, Azzouz MM, Sellami S. Osteomalacia in a patient 

with primary intestinal lymphangiectasis (Waldmann's dis- 

ease). Joint Bone Spine 2008; 75: 73-75 

21 Lu YY, Wu JF, Ni YH, Peng SS, Shun CT, Chang MH. Hypocalcemia 

and tetany caused by vitamin D deficiency in a child 

with intestinal lymphangiectasia. J Formos Med Assoc 2009; 

108: 814-818 

22 Samman PD, White WF. The “yellow nail” syndrome. Br J 

Dermatol 1964; 76: 153-157 

23 Bereket A, Lowenheim M, Blethen SL, Kane P, Wilson TA. 

Intestinal lymphangiectasia in a patient with autoimmune 

polyglandular disease type I and steatorrhea. J Clin Endocrinol 

Metab 1995; 80: 933-935 

24 Makharia GK, Tandon N, Stephen Nde J, Gupta SD, Tandon 

RK. Primary intestinal lymphangiectasia as a component 

of autoimmune polyglandular syndrome type I: a 

report of 2 cases. Indian J Gastroenterol 2007; 26: 293-295 

25 Cammarota G, Cianci R, Gasbarrini G. High-resolution magnifying 

video endoscopy in primary intestinal lymphangiectasia: 

a new role for endoscopy? Endoscopy 2005; 37: 607 

26 Kim JH, Bak YT, Kim JS, Seol SY, Shin BK, Kim HK. Clinical 

significance of duodenal lymphangiectasia incidentally 

found during routine upper gastrointestinal endoscopy. 

Endoscopy 2009; 41: 510-515 

27 Maunoury V, Plane C, Cortot A. Lymphangiectasia in 

Waldmann's disease. Clin Gastroenterol Hepatol 2005; 3: xxxiii 

28 Danielsson A, Toth E, Thorlacius H. Capsule endoscopy in 

the management of a patient with a rare syndrome--yellow 

nail syndrome with intestinal lymphangiectasia. Gut 2006; 

55: 196, 233 

29 Fang YH, Zhang BL, Wu JG, Chen CX. A primary intestinal 

lymphangiectasia patient diagnosed by capsule endoscopy 

and confirmed at surgery: a case report. World J Gastroenterol 

2007; 13: 2263-2265 

30 Fry LC, Bellutti M, Neumann H, Malfertheiner P, Monkemuller 

K. Utility of double-balloon enteroscopy for the 

evaluation of malabsorption. Dig Dis 2008; 26: 134-139 

31 Bellutti M, Mönkemüller K, Fry LC, Dombrowski F, Malfertheiner 

P. Characterization of yellow plaques found in the 

small bowel during double-balloon enteroscopy. Endoscopy 

2007; 39: 1059-1063 

32 Liu NF, Lu Q, Wang CG, Zhou JG. Magnetic resonance imaging 

as a new method to diagnose protein losing enteropathy. 

Lymphology 2008; 41: 111-115 

33 Strober W, Wochner RD, Carbone PP, Waldmann TA. Intestinal 

lymphangiectasia: a protein-losing enteropathy with 

hypogammaglobulinemia, lymphocytopenia and impaired 

homograft rejection. J Clin Invest 1967; 46: 1643-1656 

34 Weiden PL, Blaese RM, Strober W, Block JB, Waldmann TA. 

Impaired lymphocyte transformation in intestinal lymphangiectasia: 

evidence for at least two functionally distinct lymphocyte 

populations in man. J Clin Invest 1972; 51: 1319-1325 

35 Heresbach D, Raoul JL, Genetet N, Noret P, Siproudhis L, 

Ramée MP, Bretagne JF, Gosselin M. Immunological study in 

primary intestinal lymphangiectasia. Digestion 1994; 55: 59-64 

36 Fuss IJ, Strober W, Cuccherini BA, Pearlstein GR, Bossuyt 

X, Brown M, Fleisher TA, Horgan K. Intestinal lymphangiectasia, 

a disease characterized by selective loss of naive 

CD45RA+ lymphocytes into the gastrointestinal tract. Eur J 

Immunol 1998; 28: 4275-4285 

37 Vignes S, Carcelain G. Increased surface receptor Fas (CD95) 

levels on CD4+ lymphocytes in patients with primary intestinal 

lymphangiectasia. Scand J Gastroenterol 2009; 44: 

252-256 

38 Chiu NT, Lee BF, Hwang SJ, Chang JM, Liu GC, Yu HS. Protein-losing 

enteropathy: diagnosis with (99m)Tc-labeled human 

serum albumin scintigraphy. Radiology 2001; 219: 86-90 

39 Maconi G, Molteni P, Manzionna G, Parente F, Bianchi Porro 

G. Ultrasonographic features of long-standing primary intestinal 

lymphangiectasia. Eur J Ultrasound 1998; 7: 195-198 

40 Mazzie JP, Maslin PI, Moy L, Price AP, Katz DS. Congenital 

intestinal lymphangiectasia: CT demonstration in a young 



child. Clin Imaging 2003; 27: 330-332 

41 Yang DM, Jung DH. Localized intestinal lymphangiectasia: 

CT findings. AJR Am J Roentgenol 2003; 180: 213-214 

42 Liu NF, Lu Q, Wang CG, Zhou JG. Magnetic resonance imaging 

as a new method to diagnose protein losing enteropathy. 

Lymphology 2008; 41: 111-115 

43 So Y, Chung JK, Seo JK, Ko JS, Kim JY, Lee DS, Lee MC. Different 

patterns of lymphoscintigraphic findings in patients 

with intestinal lymphangiectasia. Nucl Med Commun 2001; 

22: 1249-1254 

44 Freeman HJ. Tropheryma whipplei infection. World J Gastroenterol 

2009; 15: 2078-2080 

45 Chung HV, Ramji A, Davis JE, Chang S, Reid GD, Salh B, 

Freeman HJ, Yoshida EM. Abdominal pain as the initial and 

sole clinical presenting feature of systemic lupus erythematosus. 

Can J Gastroenterol 2003; 17: 111-113 

46 Broder S, Callihan TR, Jaffe ES, DeVita VT, Strober W, Bartter 

FC, Waldmann TA. Resolution of longstanding proteinlosing 

enteropathy in a patient with intestinal lymphangiectasia 

after treatment for malignant lymphoma. Gastroenterology 

1981; 80: 166-168 

47 Laharie D, Degenne V, Laharie H, Cazorla S, Belleannee G, 

Couzigou P, Amouretti M. Remission of protein-losing enteropathy 

after nodal lymphoma treatment in a patient with primary 

intestinal lymphangiectasia. Eur J Gastroenterol Hepatol 

2005; 17: 1417-1419 

48 Shpilberg O, Shimon I, Bujanover Y, Ben-Bassat I. Remission 

of malabsorption in congenital intestinal lymphangi- 


ectasia following chemotherapy for lymphoma. Leuk Lymphoma 

1993; 11: 147-148 

49 Bouhnik Y, Etienney I, Nemeth J, Thevenot T, Lavergne- 

Slove A, Matuchansky C. Very late onset small intestinal B 

cell lymphoma associated with primary intestinal lymphangiectasia 

and diffuse cutaneous warts. Gut 2000; 47: 296-300 

50 Jeffries GH, Chapman A, Sleisenger MH. Low-fat diet in intestinal 

lymphangiectasia. Its effect on albumin metabolism. 

N Engl J Med 1964; 270: 761-766 

51 Wen J, Tang Q, Wu J, Wang Y, Cai W. Primary intestinal 

lymphangiectasia: four case reports and a review of the literature. 

Dig Dis Sci 2010; 55: 3466-3472 

52 Aoyagi K, Iida M, Matsumoto T, Sakisaka S. Enteral nutrition 

as a primary therapy for intestinal lymphangiectasia: value of 

elemental diet and polymeric diet compared with total parenteral 

nutrition. Dig Dis Sci 2005; 50: 1467-1470 

53 MacLean JE, Cohen E, Weinstein M. Primary intestinal and 

thoracic lymphangiectasia: a response to antiplasmin therapy. 

Pediatrics 2002; 109: 1177-1180 

54 Klingenberg RD, Homann N, Ludwig D. Type I intestinal 

lymphangiectasia treated successfully with slow-release octreotide. 

Dig Dis Sci 2003; 48: 1506-1509 

55 Chen CP, Chao Y, Li CP, Lo WC, Wu CW, Tsay SH, Lee RC, 

Chang FY. Surgical resection of duodenal lymphangiectasia: 

a case report. World J Gastroenterol 2003; 9: 2880-2882 

56 Wen J, Tang Q, Wu J, Wang Y, Cai W. Primary intestinal 

lymphangiectasia: four case reports and a review of the literature. 

Dig Dis Sci 2010; 55: 3466-3472 

S- Editor Wang JL L- Editor Roemmele A E- Editor Ma WH 





doi:10.4251/wjgo.v3.i2.24 

BRIEF ARTICLE 

T(11;18)(q21;q21)-positive gastrointestinal MALT 

lymphomas are heterogeneous with respect to the VH gene 

mutation status 

Xavier Sagaert, Brigitte Maes, Vera Vanhentenrijk, Mathijs Baens, Eric Van Cutsem, Gert De Hertogh, 

Karel Geboes, Thomas Tousseyn 

Xavier Sagaert, Vera Vanhentenrijk, Gert De Hertogh, Karel 

Geboes, Thomas Tousseyn, Department of Morphology 

and Molecular Pathology, University Hospitals Leuven, 3000 

Leuven, Belgium 

Brigitte Maes, Department of Laboratory Medicine, Jessa Hospital, 

Hasselt, 3000 Leuven, Belgium 

Mathijs Baens, Department for Molecular and Developmental 

Genetics, Flanders Institute for Biotechnology (VIB), 3000 

Leuven, Belgium; 

Mathijs Baens, Department of Human Genetics, Catholic University 

of Leuven, 3000 Leuven, Belgium 

Eric Van Cutsem, Department of Digestive Oncology, University 

Hospitals Leuven, 3000 Leuven, Belgium 

Author contributions: Tousseyn T, Maes B, Vanhentenrijk V and 

Sagaert X performed the majority of the experiments and analysed 

the data; Maes B and Sagaert X designed the study and wrote the 

manuscript; Van Cutsem E provided the clinical data; De Hertogh 

G, Van Cutsem E and Geboes K edited the manuscript. 

Supported by A Grant of the “Belgian Cancer Association” and 

the “Fonds voor Wetenschappelijk Onderzoek Vlaanderen” 

Correspondence to: Xavier Sagaert, MD, PhD, Senior Clinical 

Investigator FWO, Department of Morphology and Molecular 

Pathology, University Hospitals Leuven, Minderbroederstraat 

12, 3000 Leuven, Belgium. xavier.sagaert@uzleuven.be 

Telephone: +32-16-341942 Fax: +32-16-336548 

Received: July 15, 2010 Revised: December 31, 2010 

Accepted: January 7, 2011 

Published online: February 15, 2011 

Abstract 

AIM: To investigate how t(11;18)(q21;q21)-positive 

gastrointestinal MALT lymphomas relate to other marginal 

zone lymphomas with respect to the somatic mutation 

pattern of the VH genes and the expression of the 

marker CD27. 

METHODS: The VH gene of 7 t(11;18)(q21;q21)positive 

gastrointestinal MALT lymphomas was amplified 




by PCR using family specific VH primers and a consensus 

JH primer. PCR products were sequenced and mutation 

analysis of the CDR and the FR regions was performed. 

All cases were immunostained for CD27. 

RESULTS: One case showed unmutated VH genes 

while the others showed mutated VH genes with mutation 

frequencies ranging from 1.3 to 14.7% and with 

evidence of antigen selection in 2 cases. These data 

suggest that the translocation t(11;18)(q21;q21) can 

target either B-cells at different stages of differentiation 

or naive B-cells that retain the capacity to differentiate 

upon antigen stimulation. All cases but one 

displayed weak to strong CD27 expression which did 

not correlate with the VH gene mutation status. 

CONCLUSION: t(11;18)(q21;q21)-positive gastrointestinal 

MALT lymphomas are heterogeneous with 

respect to the VH mutation status and CD27 is not a 

marker of somatically mutated B-cells. 


Key words: Gastrointestinal MALT lymphoma; t(11;18) 

(q21;q21); VH mutation; Marginal zone; CD27 

Peer reviewer: Joseph T Tseng, Assistant Professor, Institute 

of Bioinformatics, College of Bioscience and Biotechnology, 

National Cheng-Kung University, No.1 University Rd, Tainan, 

701, Taiwan, China 

Sagaert X, Maes B, Vanhentenrijk V, Baens M, Van Cutsem 

E, De Hertogh G, Geboes K, Tousseyn T. T(11;18)(q21;q21)positive 

gastrointestinal MALT lymphomas are heterogeneous 

with respect to the VH gene mutation status. World J Gastrointest 

Oncol 2011; 3(2): 24-32 Available from: URL: http://www. 

wjgnet.com/1948-5204/full/v3/i2/24.htm DOI: http://dx.doi. 

org/10.4251/wjgo.v3.i2.24 



INTRODUCTION 

Extranodal marginal zone lymphoma or MALT lymphoma 

is listed as a separate disease entity in the World Health Organisation 

(WHO) classification of lymphoid tumors, and 

comprises 8% of all non-Hodgkin lymphomas [1] . These tumors 

typically arise at sites normally devoid of lymphoid tissue, 

which have accumulated lymphoid tissue in the context 

of long-standing antigenic stimulation resulting from causes 

such as chronic bacterial infection [Helicobacter pylori (H. pylori), 

Campylobacter jejuni, Chlamydia psittaci, Borrelia Burgdorferi], 

chronic viral infection (Hepatitis C) or autoimmune disease 

(Sjögren’s syndrome, Hashimoto thyroiditis) [2] . Several genetic 

aberrations have been identified in MALT lymphomas, 

some of which appear to be specific for, or at least closely 

related to, this type of lymphoma. As such, the chromosomal 

translocations t(11;18)(q21;q21), t(1;14)(p22;q32), 

t(14;18)(q32;q21), and t(3;14)(p13;q32) are known to occur 

with variable frequencies in MALT lymphomas, resulting 

in IGH-BCL10, IGH-MALT1, API2-MALT1 and IGH- 

FOXP1 rearrangements respectively 3-5 . The oncogenic activity 

of the 3 translocations t(1;14)(p22;q32), t(14;18)(q32;q21) 

and t(11;18)(q21;q21) is linked to the physiological role of 

the BCL10 and MALT1 proteins in the antigen receptormediated 

activation of NF-kB, which is the transcription 

factor of a number of survival- and proliferation-related 

genes in B cells [6,7] . The oncogenic role of the IGH-FOXP1 

fusion transcript is unknown. 

MALT lymphomas may be encountered at virtually any 

extranodal site of the human body, among which the stomach 

is the most frequently involved organ. In this particular 

location, the occurrence of MALT lymphomas is associated 

with H. pylori infection [8] . A high incidence (about 25%) of 

t(11;18)(q21;q21) is detected in gastric MALT lymphomas 

whereas this translocation is rarely found in MALT lymphomas 

outside the gastrointestinal tract (with the exception 

of pulmonary MALT lymphomas) [9-11] . Remarkably, 

the presence of t(11;18)(q21;q21) in MALT lymphomas 

correlates with the lack of any further genetic instability 

or chromosomal imbalance [12,13] . T(11;18)(q21;q21)positive 

gastric MALT lymphomas do not differ from their 

t(11;18)(q21;q21)-negative counterparts, with respect to morphology 

and immunophenotype [3] . However, several studies 

have revealed that t(11;18)(q21;q21)-positive gastric MALT 

lymphomas are more often resistant to H. pylori eradication 

treatment [11,14-16] . Nevertheless, complete lymphoma regression 

can still be obtained in 20% of these cases after H. pylori 

eradication [17] . In addition, for a decade, researchers believed 

that t(11;18)(q21;q21)-positive gastric MALT lymphomas 

rarely if ever evolve to a more aggressive diffuse large B-cell 

lymphoma (DLBCL) [11,14-16] , however, new data show that 

the t(11;18)(q21;q21) can be found in both gastric MALT 

lymphomas and gastric DLBCLs at approximately equivalent 

frequencies [18] . Although the presence of t(11;18)(q21;q21) 

may facilitate and/or confirm the diagnosis of a MALT 

lymphoma, current guidelines do not recommend a routine 

screening for the t(11;18)(q21;q21) once the diagnosis of a 

gastric MALT lymphoma has been established [19] . 

The immunoglobulin heavy chain (IgH) locus on chromosome 

14 contains an estimated 100 to 150 variable (VH) genes, 

Sagaert X et al . VH gene mutation status in gastrointestinal MALT lymphomas 

30 diversity (D) genes, and six junctional (JH) gene segments. 

During the maturation of a normal B cell, the unique combination 

of single germline VH, D, and JH gene fragments gives 

rise to a functional VH-D-JH unit [20] . Added diversity occurs 

through the junctional insertion of nucleotides at the boundaries 

of these fragments and through somatic hypermutation, 

where the nucleotide sequences of the germline fragments are 

altered. Because somatic hypermutation of Ig VH genes appears 

to be restricted to B cells proliferating within the microenvironment 

of the germinal, somatically mutated V-regions 

are a hallmark of germinal B cells and their descendants [21] . 

The positive or negative selective pressure of somatic hypermutation 

in B cell malignancies can pinpoint the developmental 

stage of the neoplastic cells [22] . Therefore, through positive 

selective pressure, somatic hypermutations have been found in 

post-germinal centre B cell lymphomas such as follicular lymphoma 

[23] , but not (or to a much lesser extent) in pregerminal 

B cell lymphomas, such as mantle cell lymphoma [24] . Lymphomas 

arising from the marginal zone (e.g. extranodal, nodal 

and splenic marginal zone lymphomas) seem to carry either 

unmutated, slightly mutated or highly mutated VH genes, either 

with or without evidence of antigen selection [25-40] . These 

findings indicate that MALT lymphomas are heterogeneous 

with respect to the B cell differentiation stage at which clonal 

expansion occurs (being either a naive, early or late memory 

cell) and that direct antigen stimulation may be involved in the 

development or growth of the lymphoma. 

The presence of somatic hypermutations in B cells has 

been associated, not only with post-germinal centre status, 

but also with CD27 expression. CD27 is a type I glycoprotein 

that is member of the tumor necrosis factor (TNF) 

receptor family, with unique cysteine-rich motifs. It is considered 

to be a marker for memory B cells based on the 

following observations: (a) circulating IgM + /IgD + /CD27 + 

B cells contain somatic VH gene mutations in contrast 

to peripheral IgM + /IgD + /CD27 - B cells [41,42] ; (b) immunoglobulin 

class switching is more frequent among CD27positive 

than CD27-negative B cells [43] ; (c) upon activation, 

CD27-positive B cells secrete antibodies more efficiently 

than CD27-negative B cells [44] ; (d) cord blood B cells do not 

express CD27, while the percentage of CD27-positive B 

cells in blood increases with age [45] ; and (e) in the presence 

of stimuli such as IL-10, SAC plus IL-2 and IL4, prompt 

differentiation into plasma cells occurs in CD27-positive B 

cells but not in CD27-negative B cells [42,46] . CD27 expression 

has not been investigated yet in lymphomas that are 

considered to arise from somatically mutated B cells. 

Here, we investigated how the t(11;18)(q21;q21)positive 

gastrointestinal MALT lymphoma subtype relates 

to other marginal zone lymphomas with respect to the 

somatic mutation pattern of the VH genes and analyzed 

7 t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas. 

In addition, these 7 cases were stained for CD27 

to correlate expression of this protein with the somatic 

mutation pattern of the VH genes. 

MATERIALS AND METHODS 

Cases 

For this study, the number of representative cases documented 



A 

Table 3 Primer sequences 

Primer Sequence 

VH1-FR1 5’CCTCAGTGAAGTCTCCTGCAAGG 3’ 

VH2-FR1 5’TCCTGCGCTGGTGAAAGCCACACA 3’ 

VH3-FR1 5’GGTCCCTGAGACTCTCCTGTGCA 3’ 

VH4-FR1 5’TCGGAGACCCTGTCCCTCACCTGCA 3’ 

VH5-FR1 5’GAAAAAGCCCGGGGAGTCTCTGGA 3’ 

VH6-FR1 5’CCTGTGCCATCTCCGGGGACAGTG 3’ 

JH 5’ACCTGAGGAGACGGTGACC 3’ 

IgH FR3 5’CTGTCGACACGGCCGTGTATTACTG 3’ 

400 bp 

300 bp 

B 

120 bp 

MM VH1 VH2 VH3 VH4 VH5 VH6 

1 2 3 4 5 6 MM 

Figure 1 Gel electrophoresis of PCR products from case 1, obtained with 6 

primer sets amplifying the FR1-JH region (A) and the FR3-JH region (B). Experiments 

were performed in duplicate. For all amplifications, the reverse primer 

was JH. A: The forward primers used are indicated on the gel. The agarose gel 

shows predominant bands with primer sets VH3-JH and VH5-JH; B: Polyacrylamide 

gel showing FR3-JH amplicons of the same length starting from the VH3-JH PCR 

product (lanes 1, 2) and from the initial DNA sample (lanes 5, 6). No monoclonal 

FR3-JH product was obtained starting from the VH5-JH PCR product (lanes 3, 4). 

These results indicate that the lymphoma cells use a VH3 family gene and that the 

product obtained with the VH5-JH set is an unspecific product. 

CDR3 region. The obtained products were electrophoresed 

on an 8% polyacrylamide gel and visualised with ethidiumbromide. 

By comparing the lengths of the PCR products, it 

was established which product of the initial PCR was amplified 

from the monoclonally rearranged IgH gene. 

Sequencing of PCR products and sequencing analysis 

Sequencing was performed in both directions with the same 

oligonucleotides used in the PCR amplifications. The nucleotide 

sequences of the amplification products representative 

of the IgH rearrangements were compared with the 

VBASE directory (VBASE Sequence Directory, I.M.; Tomlinson, 

MRC Centre for Protein Engineering, Cambridge, 

UK; URL: www.mrc-cpe.cam.ac.uk/imt-doc) [47] using the 

DNAPLOT analysis software. A diversity (D) germline segment 

was assigned to the longest stretches with the highest 

nucleotide homology with a minimum of six successive 

matches or seven matches interrupted by one mismatch. 

Somatic mutation analysis 

Mutations in the variable region were identified by compar- 


Table 4 Immunohistochemical staining data 

Case CD20 CD3 CD5 CD10 CD23 CD27 IgM IgD Igκ/Igλ 

1 + - - - - - + -/+ Igκ 

2 + - - - - + + - Igλ 

3 + - - - - ++ + - Igκ 

4 + - - - - + + - Igκ 

5 + - - - - ++ + - Igλ 

6 + - - - - ++ + - Igκ 

7 + - - - - ++ + -/+ Igκ 

ing the nucleotide sequence of each case with the closest 

germline VH sequence. Two nucleotide exchanges in one 

codon resulting in a replacement (R) mutation, was considered 

as a single mutation. Mutations at the FR1 primer site 

and at the joining site of the VH segment were not regarded 

as mutations. The number of expected R mutations in 

the complementary determining region (CDR) or framework 

region (FR) was calculated using the formula: Exp R 

(CDR or FR) = n × (CDR Rf or Fr Rf) × (CDRrel or FRrel); 

where n is the total number of observed mutations, 

CDRrel or FRrel is the relative size of CDRs or FRs and 

Rf is the inherent replacement frequency to CDRs or FRs 

sequences. The Rf value was calculated for the amplified region 

(excluding primer site) of each VH germline gene used 

by our cases, according to Chang and Casali [48] . According 

to the binomial distribution model, the probability that excess 

or scarcity of R mutations in CDRs or FRs occurred 

on the basis of chance alone was calculated using the formula: 

p = {n!/[k! (n - k)!]} × q k × (1 - q) n-k ; where k is the 

number of observed mutations in the CDRs or FRs and q 

is the probability that an R mutation will localise to CDRs 

or FRs (q = CDRrel × CDR Rf or FR rel × FR Rf) 48 . 

RESULTS 

Morphology and immunohistochemistry 

All 7 gastrointestinal MALT lymphomas demonstrated a 

similar monomorphic morphology, being a proliferation 

predominantly composed of centrocyte-like cells mixed 

with a small number of lymphocyte-like cells and large 

activated B-cells. The results of the immunohistostainings 

are summarized in Table 4. Of interest, in all but 

one cases, weak to strong CD27 expression was present. 

PCR amplification of the rearranged IgH gene 

A predominant band was obtained in cases 2, 3, 6 and 7. 

Cases 1, 4 and 5 revealed two similarly dominant bands 

but PCR of the CDR3 region allowed identification the 

VH family involved (Figure 1). PCR analysis thus revealed 

the use of VH3 family, VH4 family and VH1 family genes in 

case 4, 2 and 1 respectively (Table 5). The corresponding 

PCR products were used for sequencing. 

Sequence analysis 

All VDJ rearrangements were in frame and none contained 

a stop codon, indicating that all were productive. 

Results are summarised in Table 5. 

Of the 4 cases using a VH3 family gene, 2 (cases 1 




Table 5 Usage of the rearranged VH, DH and JH gene segments and VH mutation analysis of gastric MALT-type lymphoma, characterised 

by the presence or absence of the API2-MALT1 fusion abnormality 

Case API2-MALT1 Germline VH Identity (%) Obs R/S CDR Obs R/S FR Exp R/S CDR Exp R/S FR pCDR pFR DH JH 

Locus Name 

1 + VH3-30 DP-49 92.4 4/2 5/4 3/1 8/3 0.217 0.062 DH3-10 JH3 

2 + VH3 HHG4 97.7 1/2 0/1 1/0 2/1 0.421 - NI JH4 

3 + VH1-69 DP-10 85.3 11/3 11/4 7/2 15/5 0.030 0.040 DH1-1 JH5 

4 + VH4-34 DP-63 98.7 0/0 1/2 1/0 2/1 - 0.352 NI JH6 

5 + VH4-39 DP-79 98.6 0/0 0/3 1/0 2/1 - - NI JH4 

6 1 

+ VH3-33 DP-50 100 0/0 0/0 - - - - DH1-20 JH6 

7 + VH3-30 DP-49 95.1 5/0 2/2 2/1 5/2 0.030 0.048 DH3-10 JH4 

1 Results obtained on the diagnostic intestinal biopsy as well as on a gastric biopsy after 54 mo follow-up; VH genes: Immunoglobulin heavy chain variable gene; 

R: Replacement mutation; S: Silent mutation; CDR: Complementarity determining regions; FR: Framework regions; Obs R/S CDR and Obs R/S FR: Number of 

the observed R and S mutations in the CDR and FR, respectively; Exp R/S CDR and Exp R/S FR: Number of expected R and S mutations in the CDR and FR, 

respectively; pCDR and pFR: Probability that excess or scarcity of the R mutations in the VH gene CDR or FR resulted from chance only; P values < 0.05 were 

considered statistical significant; NI: Not identified. VH sequences were compared with germline VH sequences included in the VBASE sequence directory. 

and 7) used a VH gene most closely related to the VH3-30 

(DP-49) germline gene with a nucleotide similarity of 92.4 

and 95.1%, respectively. Other VH3 family germline genes 

were the VH3-33 (DP-50) gene (case 6) and the HHG4 

gene (case 2) with identities of 100 and 97.7% respectively. 

In the one case using a VH1 family gene (case 3), the VH 

segment was closely related to the same germline gene, being 

the VH1-69 (DP-10) gene with 85.3% homology. The 2 

VH4 family genes identified showed the highest homology 

to the VH4-34 (DP-63) (case 4, 98.7% homology) and the 

VH4-39 (DP-79) (case 5, 98.6% homology) germline genes. 

DH segments and JH segments were assigned in respectively 

4 and 7 of 7 cases. A preferential use of the JH4 segment 

was observed (3 times). Both cases with involvement 

of the VH3-30 germline gene (cases 1 and 7), used the 

same DH segment (DH3-10) but different JH segments (JH3 

and JH4 respectively). 

The follow-up gastric sample (taken at 54 mo followup) 

of case 6 revealed the same VDJ rearrangement as 

obtained from the diagnostic sample. 

Mutation analysis 

In 6 of 7 cases, the VH segment showed single nucleotide 

substitutions with respect to the closest germline gene with 

identities ranging from 85.3% to 98.8% (Table 5). Some of 

these nucleotide differences may represent polymorphisms. 

However, sequence polymorphism among VH genes is generally 

low and the detected differences probably represent 

somatic mutations [7] . The VH segment used by the remaining 

case (case 6) was 100% identical to the assigned VH 

gene. Furthermore, in case 6, the VH gene amplified from 

the gastric follow-up sample did not show somatic mutations. 

The nucleotide sequences of the VH genes and comparison 

to the germline sequences for cases 1 and 7, both 

using the DP-49 germline, are illustrated in Figure 2. 

The distribution of replacement (R) and silent (S) somatic 

mutations in each VH sequence was analysed according 

to Chang and Casali (Table 5). The P values indicating 

whether excess or scarcity of the R mutations in the CDR or 

FR resulted from chance alone were considered statistically 

significant if below 0.05. For cases 3 and 7, a preferential 

clustering of R mutations in the CDR regions was observed 

(P values respectively 0.03 and 0.03) as well as a significantly 

lower number of R mutations than expected in the FR regions 

(P values respectively 0.040 and 0.048). This somatic 

mutation pattern is indicative for positive antigen selection as 

well as negative selection against R mutations within the FR 

regions to preserve the structure of the immunoglobulin. No 

significant clustering of R mutations was observed for the 

remaining cases with somatic VH mutations (cases 1, 2 and 4). 

DISCUSSION 

This is the first study analysing the VH mutation status in a 

series of gastrointestinal MALT lymphomas characterised 

by t(11;18)(q21;q21). One of the investigated cases (case 

6) showed unmutated VH genes while the others showed 

mutated VH genes with mutation frequencies ranging from 

1.3 to 14.7%. Two of the cases with mutated VH gene (cases 

3 and 7) showed evidence of both positive and negative 

antigen-driven selection with clustering of replacement 

mutations within the CDR regions and a lower incidence 

of replacement mutations than expected in the FR regions. 

The latter was also observed in a further mutated case (case 

1: statistical significance not reached), without evidence 

for positive selective pressure, and is consistent with a selection 

to preserve immunoglobulin structure. Three VH 

mutated cases (case 2, 4, 5) showed only few differences 

from the corresponding germline genes, not indicative of 

antigen mediated selection. The presence of a low number 

of somatic VH mutations without evidence of antigen selection 

may indicate an origin from an early memory B cell 

which had not yet undergone multiple rounds of antigen 

selection in the germinal centre [49] . 

These data show that t(11;18)(q21;q21)-positive gastrointestinal 

MALT lymphomas may harbour unmutated, slightly 

or highly mutated VH genes, indicating that they are composed 

either of naive B cells or of early or late memory B 

cells. The fact that at least part of the cases were composed 

of memory B cells, shows evidence of antigen selection that 

may have taken place at the onset of the lymphomatous 

process. This heterogeneity within t(11;18)(q21;q21)-positive 



gastrointestinal MALT lymphomas is consistent with that 

reported in similar studies on both gastric and non-gastric 

MALT lymphomas in which data on the presence of 

t(11;18)(q21;q21) was not available [26,27,30,32-36,38-40] . In addition, 

analysis of the VH mutation status in 2 t(11;18)(q21;q21)negative 

MALT lymphomas (data not shown) revealed a 

mutation frequency of 0% and 4.5% respectively, indicating 

that, similar to what is observed in t(11;18)(q21;q21)-positive 

MALT lymphomas, t(11;18)(q21;q21)-negative MALT lymphomas 

can be derived from both naïve and memory B 

cells. Thus, the presence or absence of the API2-MALT1 

fusion transcript is not related to a particular B cell stage 

from which the MALT lymphoma originates. Our results 

are also in line with studies analysing the composition of 

the reactive marginal zone, which is thought to represent 

the normal counterpart of marginal zone cell lymphomas. 

Indeed, mutation analysis of the rearranged VH genes of 

reactive marginal zone B cells indicated that the marginal 

zone is composed of a heterogeneous B cell population, 

with naive as well as memory B cells [50,51] . A subpopulation 

of memory B cells present in the normal marginal zone 

shows a characteristic pattern of somatic mutations indicative 

of antigen selection and therefore probably participates 

in the T cell dependent immune reaction [52,53] . It is of interest 

that 3 distinct pathways for recruitment of B cells in the 

marginal zone have been demonstrated in animal models: 

(a) maturation of virgin recirculating B cells, a process that 

occurs in the absence of T cells and does not require B cell 

proliferation; (b) colonisation by memory B cells generated 

in the germinal centres; (c) recruitment of both virgin and 

memory marginal zone B cells into antibody responses [54] . 

Our results also show that t(11;18)(q21;q21)-positive 


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 

DP-49 CAG GTG CAG CTG GTG GAG TCT GGG GGA GGC GTG GTC CAG CCT GGG AGG TCC CTG AGA CTC TCC 

Case 1 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ...... ... 

Case 7 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ...... ... 

________________ CDR1 _______________ 

22 23 24 25 26 27 28 29 30 31 31a 31b 32 33 34 35 36 37 38 39 40 

DP-49 TGT GCA GCC TCT GGA TTC ACC TTC AGT AGC ... ... TAT GGC ATG CAC TGG GTC CGC CAG GCT 

Case 1 ... ... --- --- --- --- -T- --- --- --T ... ... --- --- --- --- --- --- --- --- --- 

Case 7 ... ... --- --- --- --- G-- --- --- ---... ... --- --- --- --- --- --- --- --- --- 

______________________________________________________CDR2______ 

41 42 43 44 45 46 47 48 49 50 51 52 52a 52b 52c 53 54 55 56 57 58 

DP-49 CCA GGC AAG GGG CTG GAG TGG GTG GCA GTT ATA TCA TAT ... ... GAT GGA AGT AAT AAA TAC 

Case 1 --- --- --- --- --- --- --- --T -GT C-G --- --- --- ... ... --C --- --- G-- -G - A -- 

Case 7 --- --G --- --- --- --- --- --- --- C-- G -- --- --- ... ... --- -CC -A - --A --- --- 

____________________________________ 

59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 

DP-49 TAT GCA GAC TCC GTG AAG GGC CGA TTC ACC ATC TCC AGA GAC AAT TCC AAG AAC ACG CTG TAT 

Case 1 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --C -C - 

Case 7 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- 

80 81 82 82a 82b 82c 83 84 85 86 87 88 89 90 91 92 93 94 

DP-49 CTG CAA ATG AAC AGC CTG AGA GCT GAG GAC ACG GCT GTG TAT TAC TGT GCG AAA 

Case 1 --- G-- G-- --- --- --- --- --- --A --- --- --- --- --- --- --C --- --- 

Case 7 --- --- --- --- --- --- --- C-C --- --- --- --- --A --- --- --- --- --- 

Figure 2 Mutation analysis of the DP-49 gene used in cases 1 and 7, compared to the germline DP-49 gene sequence. CDR regions are indicated. Dashes 

indicate sequence similarity. Replacement mutations are shown in bold. 

gastrointestinal MALT lymphomas predominantly rearrange 

VH3 family and to a lesser extent VH4 and VH1 family 

genes, in cases 4, 2 and 1 respectively. This is similar to 

what was previously observed in several studies on MALT 

lymphoma [27,30,32-35,39] and one study on nodal marginal 

zone lymphoma [28] . In addition, it was found that the two 

t(11;18)(q21;q21)-negative gastric MALT lymphomas rearranged 

VH3 and VH1 family genes respectively (data not 

shown). The restricted use of VH genes further suggests that 

antigen stimulation may play a role in MALT lymphomagenesis. 

Interestingly, one particular VH gene was represented 

twice, i.e.the VH3-30 (DP-49) gene in cases 1 and 7. In both 

cases, the VH3-30 gene was joined with the D3-10 gene and 

the mutation pattern was indicative for antigen selection. The 

VH3-30 gene seems to be frequently involved in auto-antibody 

production [38,55] . Therefore, our results support the idea 

that at least some t(11;18)(q21;q21)-positive gastric MALT 

lymphomas may result from the transformation of autoreactive 

B cell clones. This is in line with the observation that 

gastric MALT lymphoma cells produce immunoglobulins 

that do recognise various autoantigens [55] . Also, antibodies to 

gastric epithelial cells are commonly present in serum samples 

from patients with H. pylori gastritis, and an anti-idiotype 

antibody to immunoglobulins of a gastric MALT lymphoma 

cross-reacts specifically with reactive B cells in H. pylori gastritis 

[56,57] . Another VH gene, VH1-69 (DP-10), was also found in 

two gastric MALT lymphoma cases, one a t(11;18)(q21;q21)positive 

case (case 3) and the other a t(11;18)(q21;q21)negative 

case (data not shown). The VH1-69 gene was 

reported to be used frequently in nodal marginal zone lymphomas, 

with a similar mutation pattern as observed in our 

study, and also in salivary gland MALT lymphomas [26,36] . This 




indicates that nodal marginal zone lymphomas and MALT 

lymphomas, occurring at different anatomic sites and either 

with or without the t(11;18)(q21;q21), may be derived from 

B cells that are driven by similar antigen epitopes. Moreover, 

Marasca et al. observed an association between the use of 

the VH1-69 gene in a series of nodal marginal zone lymphomas 

and the occurrence of Hepatitis C virus infection. 

Unfortunately, the Hepatitis C virus infection status of our 2 

cases using VH1-69 gene was not known. 

In view of the reported association between CD27 expression 

in B cells and the presence of somatic hypermutations, 

we stained all 7 MALT lymphomas for CD27 and correlated 

these immunohistochemical data with the VH gene 

mutation status. No specific correlation between CD27 expression 

and the mutation status of the VH gene was found, 

as strong CD27 expression did occur in the one case (case 

6) with an intact germline VH gene, while there was a lack of 

CD27 expression in the one case (case 1) that displayed the 

second most diversified VH gene. This observation is in line 

with data on mice models that questioned whether CD27 

is a marker of memory B cells, since CD27 expression did 

occur in somatically unmutated B cells and CD27 deficiency 

did not affect somatic diversification in a CD27 knockout 

mice model [58] . As such, our study does not support the hypothesis 

that CD27 is a general marker of somatically mutated 

B cells and further emphasises that the only definitive 

marker of memory B cells thus far identified is the presence 

of somatically mutated immunoglobulins. However, our 

data on CD27 expression should be interpreted with caution 

as the precise role of (loss of) CD27 expression in (marginal 

zone) lymphomas remains to be investigated. 

Apart from the evidence for antigen selection of the 

lymphomatous cells, others have found that ongoing mutation 

(i.e. intraclonal variation) of the VH genes indicating 

that continuing antigen stimulation may play a role in the 

clonal expansion of the MALT lymphoma B cells [30,32,34,35,38] . 

Our approach using direct sequencing of DNA extracted 

from whole tissue sections does not allow the identification 

of subclones within a lymphomatous proliferation. Nevertheless, 

from case 6, we were able to analyse DNA from 

the diagnostic sample as well as DNA from a gastric biopsy 

taken 54 months later. Case 6 was a t(11;18)(q21;q21)positive 

MALT lymphoma diagnosed with large masses 

in the upper intestine, extending into the stomach. This 

patient showed evidence of minimal residual disease at 

all time points of his follow-up, as shown by the detection 

of the API2-MALT1 fusion transcripts and of the 

reciprocal genomic fusion. The latter is confirmed by the 

results of the present study, demonstrating the presence of 

lymphoma cells in the stomach harbouring the same VDJ 

rearrangement as used by the initial intestinal lymphoma 

cells, 4.5 years after the original diagnosis. Moreover, the VH 

gene was unmutated in both samples. The lack of VH somatic 

mutations in the diagnostic as well as in the follow-up 

sample, indicates that this t(11;18)(q21;q21)-positive MALT 

lymphoma is composed of naive B cells that have not yet 

gone through the germinal centre reaction and, therefore, 

tumor growth seems not to be stimulated by a T cell dependent 

antigen response. As shown in Table 1, this case 

was characterised by relapse in the stomach after one year, 

with stable disease thereafter (despite intensive therapy). 

Remarkably, in some B cell non-Hodgkin lymphomas, the 

lack of somatic mutations has been linked to an unfavourable 

clinical outcome. As such, patients with chronic lymphocytic 

leukaemia or mantle cell lymphoma whose tumors 

have mutated VH genes have a better prognosis than those 

with intact germline VH genes [59-61] . 

As all cases analysed in this study showed the presence 

of the t(11;18)(q21;q21), we may speculate on the stage 

of B cell differentiation at which this genetic abnormality 

is acquired. Several possibilities can be considered. Firstly, 

our results may indicate that the t(11;18)(q21;q21) can be 

acquired at different stages of B cell differentiation.However, 

the hypothesis that the t(11;18)(q21;q21) may confer 

a transforming potential to the preceding antigen mediated 

lymphoid proliferation, is supported only by some of the 

cases, i.e. those with mutated VH genes and evidence of 

antigen selection. Secondly, it may be hypothesised that 

the acquisition of the t(11;18)(q21;q21) occurs at a naive B 

cell stage in all cases, representing the primary proliferation 

stimulus, and that somatic VH mutations are acquired after 

the malignant transformation induced by the API2-MALT1 

fusion transcript. An additional pathogenic role of antigen 

stimulation at the origin and/or expansion of the lymphoma, 

acting synergistic with the API2-MLT fusion protein 

cannot be excluded. The evidence for (auto-)antigen selection 

that we found in some of the cases may be supportive 

of this latter suggestion. However, this hypothesis seems 

to conflict with the fact that H. pylori reactive T-cells have 

been shown to drive gastric MALT lymphoma cells, regardless 

of the presence or absence of the t(11;18)(q21;q21) [62] . 

Alternatively, the acquisition of somatic VH mutations in an 

t(11;18)(q21;q21)-positive MALT lymphoma might represent 

an epiphenomenon without important significance. 


The authors thank Miet Vanherck for excellent technical 

assistance. 

COMMENTS 

Background 

MALT lymphomas are tumors that arise from the marginal zone compartment 

of the B-follicle at extranodal sites. Gastric MALT lymphoma accounts for 5% 

of all gastric neoplasia and at least 50% of all gastric lymphomas, making it the 

most frequent lymphoma of the gastrointestinal tract. Its pathogenesis is clearly 

linked with Helicobacter pylori (H. pylori) gastritis and 25% of all gastric MALT 

lymphomas display the translocation t(11;18)(q21;q21). 

Research frontiers 

The t(11;18)(q21;q21) results in the expression of the aberrant API2-MALT1 fusion 

protein. Presence of API2-MALT1 in gastric MALT lymphomas is associated with 

resistance to H. pylori eradication therapy and with the absence of any further genetic 

instability or chromosomal imbalances. In this study, the authors investigate 

how t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas relate to other 

marginal zone lymphomas with respect to the somatic mutation pattern of the VH 

genes and the expression of the marker CD27. 

Innovations and breakthroughs 

Reports show that both gastric and non-gastric MALT lymphomas harbour unmutated, 

slightly or highly mutated VH genes, indicating that they are composed either 

of naive B cells or of early or late memory B cells. This is the first study analysing 

the VH mutation status in a series of gastrointestinal MALT lymphomas in correlation 

with the t(11;18)(q21;q21). It was found that the presence or absence of the 



API2-MALT1 fusion transcript is not related to a particular B cell stage from which 

the MALT lymphoma originates. In addition, we provide evidence that CD27 is not 

a marker of somatically mutated B-cells, contrary to what is generally believed. 

Applications 

By understanding at what B-cell stage the t(11;18)(q21;q21) is acquired, this study 

may contribute to a better understanding of the pathogenesis of gastrointestinal 

MALT lymphomas in general and may be of importance to therapeutic strategies that 

target the API2-MALT1 fusion transcript and/or interfere with the NF-kB pathway. 

Terminology 

API2 and MALT1 are proteins that play a key role in the antigen receptor-mediated 

activation of NF-kB, which is the transcription factor of a number of survival- 

and proliferation-related genes in B cells. Not surprisingly, the formation 

of an aberrant fusion protein API2-MALT1 will deregulate the NF-kB pathway 

and result in uncontrolled B-cell proliferation and thus (gastrointestinal MALT) 

lymphomagenesis. 

Peer review 

In this work, the author reported the association between the VH gene mutation 

and T(11;18)(q21;q21)-positive gastric MALT lymphomas. And they suggest 

that this translocation will target different stage of B-cells. Their observation is 

interesting, however, the clinical sample size is somewhat small. 

REFERENCES 

1 Jaffe ES, Harris N, Stein H, Vardiman J. World Health Organisation 

Classification of Tumours: Pathology and Genetics: 

Tumours of Haemopoietic and Lymphoid Tissues. Lyon, 

France: IAR Press; 2008 

2 Suarez F, Lortholary O, Hermine O, Lecuit M. Infectionassociated 

lymphomas derived from marginal zone B cells: a 

model of antigen-driven lymphoproliferation. Blood 2006; 107: 

3034-3044 

3 Baens M, Maes B, Steyls A, Geboes K, Marynen P, De Wolf- 

Peeters C. The product of the t(11;18), an API2-MLT fusion, 

marks nearly half of gastric MALT type lymphomas without 

large cell proliferation. Am J Pathol 2000; 156: 1433-1439 

4 Streubel B, Lamprecht A, Dierlamm J, Cerroni L, Stolte M, 

Ott G, Raderer M, Chott A. T(14;18)(q32;q21) involving IGH 

and MALT1 is a frequent chromosomal aberration in MALT 

lymphoma. Blood 2003; 101: 2335-2339 

5 Wlodarska I, Veyt E, De Paepe P, Vandenberghe P, Nooijen P, 

Theate I, Michaux L, Sagaert X, Marynen P, Hagemeijer A, De 

Wolf-Peeters C. FOXP1, a gene highly expressed in a subset 

of diffuse large B-cell lymphoma, is recurrently targeted by 

genomic aberrations. Leukemia 2005; 19: 1299-1305 

6 Ruland J, Duncan GS, Wakeham A, Mak TW. Differential requirement 

for Malt1 in T and B cell antigen receptor signaling. 

Immunity 2003; 19: 749-758 

7 Ruefli-Brasse AA, French DM, Dixit VM. Regulation of NFkappaB-dependent 

lymphocyte activation and development 

by paracaspase. Science 2003; 302: 1581-1584 

8 Isaacson PG, Du MQ. MALT lymphoma: from morphology 

to molecules. Nat Rev Cancer 2004; 4: 644-653 

9 Sagaert X, Laurent M, Baens M, Wlodarska I, De Wolf-Peeters 

C. MALT1 and BCL10 aberrations in MALT lymphomas and 

their effect on the expression of BCL10 in the tumour cells. 

Mod Pathol 2006; 19: 225-232 

10 Streubel B, Simonitsch-Klupp I, Müllauer L, Lamprecht A, 

Huber D, Siebert R, Stolte M, Trautinger F, Lukas J, Püspök A, 

Formanek M, Assanasen T, Müller-Hermelink HK, Cerroni L, 

Raderer M, Chott A. Variable frequencies of MALT lymphoma-associated 

genetic aberrations in MALT lymphomas of 

different sites. Leukemia 2004; 18: 1722-1726 

11 Ye H, Liu H, Attygalle A, Wotherspoon AC, Nicholson AG, 

Charlotte F, Leblond V, Speight P, Goodlad J, Lavergne-Slove 

A, Martin-Subero JI, Siebert R, Dogan A, Isaacson PG, Du MQ. 

Variable frequencies of t(11;18)(q21;q21) in MALT lymphomas 

of different sites: significant association with CagA strains of H 

pylori in gastric MALT lymphoma. Blood 2003; 102: 1012-1018 

12 Starostik P, Patzner J, Greiner A, Schwarz S, Kalla J, Ott G, 

Müller-Hermelink HK. Gastric marginal zone B-cell lym- 


phomas of MALT type develop along 2 distinct pathogenetic 

pathways. Blood 2002; 99: 3-9 

13 Müller-Hermelink HK. Genetic and molecular genetic studies 

in the diagnosis of B-cell lymphomas: marginal zone lymphomas. 

Hum Pathol 2003; 34: 336-340 

14 Alpen B, Neubauer A, Dierlamm J, Marynen P, Thiede C, 

Bayerdörfer E, Stolte M. Translocation t(11;18) absent in early 

gastric marginal zone B-cell lymphoma of MALT type responding 

to eradication of Helicobacter pylori infection. Blood 

2000; 95: 4014-4015 

15 Liu H, Ruskon-Fourmestraux A, Lavergne-Slove A, Ye H, Molina 

T, Bouhnik Y, Hamoudi RA, Diss TC, Dogan A, Megraud F, 

Rambaud JC, Du MQ, Isaacson PG. Resistance of t(11;18) positive 

gastric mucosa-associated lymphoid tissue lymphoma to 

Helicobacter pylori eradication therapy. Lancet 2001; 357: 39-40 

16 Sugiyama T, Asaka M, Nakamura T, Nakamura S, Yonezumi 

S, Seto M. API2-MALT1 chimeric transcript is a predictive 

marker for the responsiveness of H. pylori eradication treatment 

in low-grade gastric MALT lymphoma. Gastroenterology 

2001; 120: 1884-1885 

17 Zullo A, Hassan C, Cristofari F, Andriani A, De Francesco 

V, Ierardi E, Tomao S, Stolte M, Morini S, Vaira D. Effects of 

Helicobacter pylori eradication on early stage gastric mucosaassociated 

lymphoid tissue lymphoma. Clin Gastroenterol 

Hepatol 2010; 8: 105-110 

18 Toracchio S, Ota H, de Jong D, Wotherspoon A, Rugge 

M, Graham DY, Samani A, El-Zimaity HM. Translocation 

t(11;18)(q21;q21) in gastric B-cell lymphomas. Cancer Sci 2009; 

100: 881-887 

19 Fischbach W, Malfertheiner P, Hoffmann JC, Bolten W, Bornschein 

J, Götze O, Höhne W, Kist M, Koletzko S, Labenz J, 

Layer P, Miehlke S, Morgner A, Peitz U, Preiss JC, Prinz C, 

Rosien U, Schmidt WE, Schwarzer A, Suerbaum S, Timmer 

A, Treiber G, Vieth M. [S3-guideline "Helicobacter pylori and 

gastroduodenal ulcer disease"]. Z Gastroenterol 2009; 47: 68-102 

20 Sagaert X, De Wolf-Peeters C. Classification of B-cells according 

to their differentiation status, their micro-anatomical localisation 

and their developmental lineage. Immunol Lett 2003; 

90: 179-186 

21 Küppers R, Zhao M, Hansmann ML, Rajewsky K. Tracing 

B cell development in human germinal centres by molecular 

analysis of single cells picked from histological sections. 

EMBO J 1993; 12: 4955-4967 

22 Küppers R, Klein U, Hansmann ML, Rajewsky K. Cellular 

origin of human B-cell lymphomas. N Engl J Med 1999; 341: 

1520-1529 

23 Bahler DW, Levy R. Clonal evolution of a follicular lymphoma: 

evidence for antigen selection. Proc Natl Acad Sci USA 

1992; 89: 6770-6774 

24 Hummel M, Tamaru J, Kalvelage B, Stein H. Mantle cell (previously 

centrocytic) lymphomas express VH genes with no or 

very little somatic mutations like the physiologic cells of the 

follicle mantle. Blood 1994; 84: 403-407 

25 Algara P, Mateo MS, Sanchez-Beato M, Mollejo M, Navas IC, 

Romero L, Solé F, Salido M, Florensa L, Martínez P, Campo E, 

Piris MA. Analysis of the IgV(H) somatic mutations in splenic 

marginal zone lymphoma defines a group of unmutated cases 

with frequent 7q deletion and adverse clinical course. Blood 

2002; 99: 1299-1304 

26 Bahler DW, Miklos JA, Swerdlow SH. Ongoing Ig gene hypermutation 

in salivary gland mucosa-associated lymphoid 

tissue-type lymphomas. Blood 1997; 89: 3335-3344 

27 Bahler DW, Kim BK, Gao A, Swerdlow SH. Analysis of immunoglobulin 

V genes suggests cutaneous marginal zone 

B-cell lymphomas recognise similar antigens. Br J Haematol 

2006; 132: 571-575 

28 Camacho FI, Algara P, Mollejo M, García JF, Montalbán C, 

Martínez N, Sánchez-Beato M, Piris MA. Nodal marginal zone 

lymphoma: a heterogeneous tumor: a comprehensive analysis 

of a series of 27 cases. Am J Surg Pathol 2003; 27: 762-771 

29 Conconi A, Bertoni F, Pedrinis E, Motta T, Roggero E, Luminari 

S, Capella C, Bonato M, Cavalli F, Zucca E. Nodal mar- 




ginal zone B-cell lymphomas may arise from different subsets 

of marginal zone B lymphocytes. Blood 2001; 98: 781-786 

30 Coupland SE, Foss HD, Anagnostopoulos I, Hummel M, 

Stein H. Immunoglobulin VH gene expression among extranodal 

marginal zone B-cell lymphomas of the ocular adnexa. 

Invest Ophthalmol Vis Sci 1999; 40: 555-562 

31 Craig VJ, Arnold I, Gerke C, Huynh MQ, Wündisch T, Neubauer 

A, Renner C, Falkow S, Müller A. Gastric MALT lymphoma 

B cells express polyreactive, somatically mutated immunoglobulins. 

Blood 2010; 115: 581-591 

32 Du M, Diss TC, Xu C, Peng H, Isaacson PG, Pan L. Ongoing 

mutation in MALT lymphoma immunoglobulin gene suggests 

that antigen stimulation plays a role in the clonal expansion. 

Leukemia 1996; 10: 1190-1197 

33 Du MQ, Xu CF, Diss TC, Peng HZ, Wotherspoon AC, Isaacson 

PG, Pan LX. Intestinal dissemination of gastric mucosa-associated 

lymphoid tissue lymphoma. Blood 1996; 88: 4445-4451 

34 Hara Y, Nakamura N, Kuze T, Hashimoto Y, Sasaki Y, Shirakawa 

A, Furuta M, Yago K, Kato K, Abe M. Immunoglobulin 

heavy chain gene analysis of ocular adnexal extranodal 

marginal zone B-cell lymphoma. Invest Ophthalmol Vis Sci 

2001; 42: 2450-2457 

35 Kurosu K, Yumoto N, Furukawa M, Kuriyama T, Mikata A. 

Low-grade pulmonary mucosa-associated lymphoid tissue 

lymphoma with or without intraclonal variation. Am J Respir 

Crit Care Med 1998; 158: 1613-1619 

36 Marasca R, Vaccari P, Luppi M, Zucchini P, Castelli I, Barozzi 

P, Cuoghi A, Torelli G. Immunoglobulin gene mutations and 

frequent use of VH1-69 and VH4-34 segments in hepatitis C 

virus-positive and hepatitis C virus-negative nodal marginal 

zone B-cell lymphoma. Am J Pathol 2001; 159: 253-261 

37 Miranda RN, Cousar JB, Hammer RD, Collins RD, Vnencak- 

Jones CL. Somatic mutation analysis of IgH variable regions 

reveals that tumor cells of most parafollicular (monocytoid) 

B-cell lymphoma, splenic marginal zone B-cell lymphoma, 

and some hairy cell leukemia are composed of memory B 

lymphocytes. Hum Pathol 1999; 30: 306-312 

38 Qin Y, Greiner A, Trunk MJ, Schmausser B, Ott MM, Müller- 

Hermelink HK. Somatic hypermutation in low-grade mucosaassociated 

lymphoid tissue-type B-cell lymphoma. Blood 1995; 

86: 3528-3534 

39 Tierens A, Delabie J, Pittaluga S, Driessen A, DeWolf-Peeters 

C. Mutation analysis of the rearranged immunoglobulin heavy 

chain genes of marginal zone cell lymphomas indicates an origin 

from different marginal zone B lymphocyte subsets. Blood 

1998; 91: 2381-2386 

40 Traverse-Glehen A, Davi F, Ben Simon E, Callet-Bauchu E, 

Felman P, Baseggio L, Gazzo S, Thieblemont C, Charlot C, 

Coiffier B, Berger F, Salles G. Analysis of VH genes in marginal 

zone lymphoma reveals marked heterogeneity between 

splenic and nodal tumors and suggests the existence of clonal 

selection. Haematologica 2005; 90: 470-478 

41 Klein U, Rajewsky K, Küppers R. Human immunoglobulin 

(Ig)M+IgD+ peripheral blood B cells expressing the CD27 cell 

surface antigen carry somatically mutated variable region 

genes: CD27 as a general marker for somatically mutated 

(memory) B cells. J Exp Med 1998; 188: 1679-1689 

42 Tangye SG, Liu YJ, Aversa G, Phillips JH, de Vries JE. Identification 

of functional human splenic memory B cells by expression 

of CD148 and CD27. J Exp Med 1998; 188: 1691-1703 

43 Maurer D, Holter W, Majdic O, Fischer GF, Knapp W. CD27 

expression by a distinct subpopulation of human B lymphocytes. 

Eur J Immunol 1990; 20: 2679-2684 

44 Maurer D, Fischer GF, Fae I, Majdic O, Stuhlmeier K, Von 

Jeney N, Holter W, Knapp W. IgM and IgG but not cytokine 

secretion is restricted to the CD27+ B lymphocyte subset. J Immunol 

1992; 148: 3700-3705 

45 Agematsu K, Nagumo H, Yang FC, Nakazawa T, Fukushima 

K, Ito S, Sugita K, Mori T, Kobata T, Morimoto C, Komiyama A. 

B cell subpopulations separated by CD27 and crucial collabo- 

ration of CD27+ B cells and helper T cells in immunoglobulin 

production. Eur J Immunol 1997; 27: 2073-2079 

46 Agematsu K, Nagumo H, Oguchi Y, Nakazawa T, Fukushima 

K, Yasui K, Ito S, Kobata T, Morimoto C, Komiyama A. Generation 

of plasma cells from peripheral blood memory B cells: 

synergistic effect of interleukin-10 and CD27/CD70 interaction. 

Blood 1998; 91: 173-180 

47 Cook GP, Tomlinson IM. The human immunoglobulin VH 

repertoire. Immunol Today 1995; 16: 237-242 

48 Chang B, Casali P. The CDR1 sequences of a major proportion 

of human germline Ig VH genes are inherently susceptible to 

amino acid replacement. Immunol Today 1994; 15: 367-373 

49 Kepler TB, Perelson AS. Cyclic re-entry of germinal center B 

cells and the efficiency of affinity maturation. Immunol Today 

1993; 14: 412-415 

50 Stein K, Hummel M, Korbjuhn P, Foss HD, Anagnostopoulos 

I, Marafioti T, Stein H. Monocytoid B cells are distinct from 

splenic marginal zone cells and commonly derive from unmutated 

naive B cells and less frequently from postgerminal 

center B cells by polyclonal transformation. Blood 1999; 94: 

2800-2808 

51 Tierens A, Delabie J, Michiels L, Vandenberghe P, De Wolf- 

Peeters C. Marginal-zone B cells in the human lymph node 

and spleen show somatic hypermutations and display clonal 

expansion. Blood 1999; 93: 226-234 

52 Dunn-Walters DK, Isaacson PG, Spencer J. Analysis of mutations 

in immunoglobulin heavy chain variable region genes of 

microdissected marginal zone (MGZ) B cells suggests that the 

MGZ of human spleen is a reservoir of memory B cells. J Exp 

Med 1995; 182: 559-566 

53 Dunn-Walters DK, Isaacson PG, Spencer J. Sequence analysis 

of rearranged IgVH genes from microdissected human Peyer's 

patch marginal zone B cells. Immunology 1996; 88: 618-624 

54 Morse HC 3rd, Kearney JF, Isaacson PG, Carroll M, Fredrickson 

TN, Jaffe ES. Cells of the marginal zone--origins, function 

and neoplasia. Leuk Res 2001; 25: 169-178 

55 Hussell T, Isaacson PG, Crabtree JE, Dogan A, Spencer J. Immunoglobulin 

specificity of low grade B cell gastrointestinal 

lymphoma of mucosa-associated lymphoid tissue (MALT) 

type. Am J Pathol 1993; 142: 285-292 

56 Greiner A, Marx A, Heesemann J, Leebmann J, Schmausser B, 

Müller-Hermelink HK. Idiotype identity in a MALT-type lymphoma 

and B cells in Helicobacter pylori associated chronic 

gastritis. Lab Invest 1994; 70: 572-578 

57 Negrini R, Savio A, Poiesi C, Appelmelk BJ, Buffoli F, Paterlini 

A, Cesari P, Graffeo M, Vaira D, Franzin G. Antigenic mimicry 

between Helicobacter pylori and gastric mucosa in the pathogenesis 

of body atrophic gastritis. Gastroenterology 1996; 111: 

655-665 

58 Xiao Y, Hendriks J, Langerak P, Jacobs H, Borst J. CD27 is acquired 

by primed B cells at the centroblast stage and promotes 

germinal center formation. J Immunol 2004; 172: 7432-7441 

59 Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL, 

Buchbinder A, Budman D, Dittmar K, Kolitz J, Lichtman SM, 

Schulman P, Vinciguerra VP, Rai KR, Ferrarini M, Chiorazzi N. 

Ig V gene mutation status and CD38 expression as novel prognostic 

indicators in chronic lymphocytic leukemia. Blood 1999; 

94: 1840-1847 

60 Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. 

Unmutated Ig V(H) genes are associated with a more aggressive 

form of chronic lymphocytic leukemia. Blood 1999; 94: 

1848-1854 

61 Kienle D, Kröber A, Katzenberger T, Ott G, Leupolt E, Barth 

TF, Möller P, Benner A, Habermann A, Müller-Hermelink 

HK, Bentz M, Lichter P, Dōhner H, Stilgenbauer S. VH mutation 

status and VDJ rearrangement structure in mantle cell 

lymphoma: correlation with genomic aberrations, clinical 

characteristics, and outcome. Blood 2003; 102: 3003-3009 

62 Du MQ, Isaccson PG. Gastric MALT lymphoma: from aetiology 

to treatment. Lancet Oncol 2002; 3: 97-104 

S- Editor Wang JL L- Editor Hughes D E- Editor Ma WH 






World J Gastrointest Oncol 2011 February 15; 3(2): I 




Acknowledgments to reviewers of World Journal of 

Gastrointestinal Oncology 

Many reviewers have contributed their expertise and time 

to the peer review, a critical process to ensure the quality 

of World Journal of Gastrointestinal Oncology. The editors 

and authors of the articles submitted to the journal are 

grateful to the following reviewers for evaluating the 

articles (including those published in this issue and those 

rejected for this issue) during the last editing time period. 

Shih-Hwa Chiou, MD, PhD, Associate Professor, Department 

of Medical Research and Education, Taipei Veterans 

General Hospital, No. 201, Sec. 2, ShihPai Road, Taipei 11217, 

Taiwan, China 

Stephen John Clarke, Professor, Department of Medicine, 

Concord Repatriation General Hospital, Concord, NSW 2139, 

Australia 

Mitsuhiro Fujishiro, MD, PhD, Department of Gastroenterology/Internal 

Medicine, Graduate School of Medicine, 

University of Tokyo, 731, Hongo, Bunkyoku, Tokyo 

1138655, Japan 

Michael Gnant, MD, Department of Surgery, Medical University 

of Vienna, Waehringer Guertel 1820, Vienna A1090, 

Austria 

Osamu Handa, MD, PhD, Assistant Professor, Department 

of Molecular Gastroenterology and Hepatology, Kyoto 

Prefectural University of Medicine, 465 Kajiicho, Kawaramachi 

Hirokoji, Kamigyo, Kyoto 6028566, Japan 

Eiso Hiyama, MD, PhD, Department of General Medicine, 

Hiroshima University Medical Hospital, Hiroshima University, 

123 Kasumi, Minamiku, Hiroshima, 7348551, Japan 

Simon Ng, Professor, Division of Colorectal Surgery, Department 

of Surgery, University of Hong Kong; Department of 

Surgery, Prince of Wales Hospital, Shatin, Room 64045, 4/F, 

Clinical Sciences Building, Hong Kong, China 

Sai Yi Pan, MD, Centre for Chronic Diseases Prevention and 

Control, Public Health Agency of Canada, 785 Carling Ave, 

7th Floor, A.L. 6807B, Ottawa, Ontario, K1A 0K9, Canada 

Lydia Inés Puricelli, PhD, Professor, Head of Molecular 

Experimental Oncology Section, Research Area, Institute of 

Oncology, University of Buenos Aires, Buenos Aires 1426, 

Argentina 

Juan Carlos Roa, Associate Professor, Director, Molecular 

pathology laboratory, Director of Postgrade and Research, 

School of Medicine, Universidad de La Frontera, Temuco 

4781176, Chile 

David W Townsend, Professor, Department of Medicine, 

University of Tennessee Medical Center, 1924 Alcoa Highway, 

Knoxville, TN 37920, United States 

Jan B Vermorken, MD, PhD, Professor, Department of 

Medical Oncology, Antwerp University Hospital, Wilrijkstraat 

10, 2650 Edegem, Belgium 

Xiao-Chun Xu, Associate Professor, Department of Clinical 

Cancer Prevention, The University of Texas M. D. Anderson 

Cancer Center, 1515 Holcombe Boulevard, Unit 1360, Houston, 

TX 77030, United States 

Zuo-Feng Zhang, PhD, Department of Epidemiology, 

UCLA School of Public Health, 71225 CHS, Box 951772, 650 

Charles E. Young Drive, South, Los Angeles, CA 900951772, 

United States 

WJGO|www.wjgnet.com I February 15, 2011|Volume 3|Issue 2|




Meetings 

Events Calendar 2011 

January 20-22, 2011 

Gastrointestinal Cancers Symposium 

2011, San Francisco, CA, 

United States 

January 27-28, 2011 

Falk Workshop, Liver and 

Immunology, Medical University, 

Regensburg, Germany 

February 17-20, 2011 

APASL 2011-The 21st Conference 

of the Asian Pacific Association for 

the Study of the Liver, Bangkok, 

Thailand 

February 21-21, 2011 

International Conference on 

Modern Cancer Management-Joint 

Symposium, Abuja, Nigeria, 

February 26-March 1, 2011 

Canadian Digestive Diseases Week, 

Westin Bayshore, Vancouver, British 

Columbia, Canada 

March 11-12, 2011 

First Integrative Care for the Future: 

The future of cancer care, Arnhem, 

The Netherlands 

http://www.integrativecareftfuture. 

org/ 

March 14-17, 2011 

British Society of Gastroenterology 

Annual Meeting 2011, Birmingham, 

England, United Kingdom 

March 24-25, 2011 

Advanced Cancer Course 

“International Clinical Trials 

Workshop”, Punta del Este, 

Uruguay 

April 6-7, 2011 

IBS-A Global Perspective, 

Milwaukee, WI, United States 

April 6-8, 2011 

Third Latin American Symposium 

on Gastrointestinal Oncology- 

Chilean Foundation for Oncology 

Development Joint Symposium, 

Vina Del Mar, Chile 

April 15-16, 2011 

Falk Symposium 177, Endoscopy 

Live Berlin 2011 Intestinal Disease 

Meeting, Maritim Hotel Berlin, 

Stauffenbergstr. 26, 10785 Berlin, 

Germany 

April 20-23, 2011 

9th International Gastric Cancer 

Congress, COEX, World Trade 

Center, Samseong-dong, Gangnamgu, 

Seoul 135-731, South Korea 

May 8-12, 2011 

ESTRO International Oncology 

Forum, London, United Kingdom 

May 19-22, 2011 

1st World Congress on Controversies 

in the Management of Viral Hepatitis 

(C-Hep), Palau de Congressos de 

Catalunya, Barcelona, Spain 

May 25–27, 2011 

9th CIMT Annual Meeting, 

Targeting Cancer, Road-Maps for 

Success, Mainz, Germany 


May 25-28, 2011 

4th Congress of the Gastroenterology 

Association of Bosnia and 

Herzegovina with international 

participation, Sarajevo, Bosnia and 

Herzegovina 

June 3-7, 2011 

2011 ASCO Annual Meeting, 

Chicago, IL, United States 

June 18-24, 2011 

13th Joint ECCO-AACR-EORTC- 

ESMO Workshop on “Methods in 

Clinical Cancer Research”, Flims, 

Switzerland 

June 22-25, 2011 

ESMO 13th World Congress on 

Gastrointestinal Cancer, Barcelona, 

Spain 

July 9-10, 2011 

Best of ASCO China, Hengzhou, 

China 

July 21-23, 2011 

ASCO-JSMO Joint Symposium, 

Yokohama, Japan 

August 25-28, 2011 

VII Peruvian Congress SPOM: 

Toward personalized Oncology- 

Endorsement, Lima, Peru 

World J Gastrointest Oncol 2011 February 15; 3(2): I 



September 2-3, 2011 

Falk Symposium 178, Diverticular 

Disease, A Fresh Approach to a 

Neglected Disease, Martinstr. 29-37, 

50667 Cologne, Germany 


ICE 2011-International Congress of 

Endoscopy, Los Angeles Convention 

Center, 1201 South Figueroa Street, 

Los Angeles, CA, United States 


2011 Gastrointestinal Oncology 

Conference, Sheraton Crystal City, 

Arlington, VA, United States 

September 30-October 1, 2011 

Falk Symposium 179, Revisiting 

IBD Management: Dogmas to be 

Challenged, Place Rogier 3, 1210 

Brussels, Belgium, Germany 

October 6-7, 2011 

IV InterAmerican Oncology 

Conference: Current Status and 

Future of Anti-Cancer Targeted 

Therapies, Buenos Aires, Argentina 

October 14-15, 2011 

New Trends in the Medical 

Treatment of Solid Malignancy- 

Romanian Society for Medical 

Oncology Joint Symposium, 

Bucharest, Romania 

October 27-29, 2011 

EORTC-NCI-ASCO Annual Meeting 

on Molecular Markers in Cancer, 

Brussels, Belgium 

November 11-12, 2011 

Falk Symposium 180, IBD 2011: 

Progress and Future for Lifelong 

Management, 1-12-33 Akasaka, 

Minato-ku, Tokyo 107-0052, Japan 

November 30-December 3, 2011 

8th International Cancer Conference 

“Entering the 21st Century for 

Cancer Control in Africa”-African 

Organization for Research and 

Training in Cancer Joint Symposium, 

Cairo, Egypt 





Instructions to authors 

GENERAL INFORMATION 

World Journal of Gastrointestinal Oncology (World J Gastrointest Oncol, 

WJGO, ISSN 1948-5204, DOI: 10.4251), is a monthly, open-access 

(OA), peer-reviewed journal supported by an editorial board of 404 

experts in gastrointestinal oncology from 41 countries. 

The biggest advantage of the OA model is that it provides free, 

full-text articles in PDF and other formats for experts and the public 

without registration, which eliminates the obstacle that traditional 

journals possess and usually delays the speed of the propagation 

and communication of scientific research results. The open access 

model has been proven to be a true approach that may achieve the 

ultimate goal of the journals, i.e. the maximization of the value to 

the readers, authors and society. 

Maximization of personal benefits 

The role of academic journals is to exhibit the scientific levels of 

a country, a university, a center, a department, and even a scientist, 

and build an important bridge for communication between scientists 

and the public. As we all know, the significance of the publication 

of scientific articles lies not only in disseminating and communicating 

innovative scientific achievements and academic views, as well 

as promoting the application of scientific achievements, but also in 

formally recognizing the "priority" and "copyright" of innovative 

achievements published, as well as evaluating research performance 

and academic levels. So, to realize these desired attributes of WJGO 

and create a well-recognized journal, the following four types of 

personal benefits should be maximized. The maximization of personal 

benefits refers to the pursuit of the maximum personal benefits 

in a well-considered optimal manner without violation of the 

laws, ethical rules and the benefits of others. (1) Maximization of 

the benefits of editorial board members: The primary task of editorial 

board members is to give a peer review of an unpublished scientific 

article via online office system to evaluate its innovativeness, 

scientific and practical values and determine whether it should be 

published or not. During peer review, editorial board members can 

also obtain cutting-edge information in that field at first hand. As 

leaders in their field, they have priority to be invited to write articles 

and publish commentary articles. We will put peer reviewers’ names 

and affiliations along with the article they reviewed in the journal to 

acknowledge their contribution; (2) Maximization of the benefits 

of authors: Since WJGO is an open-access journal, readers around 

the world can immediately download and read, free of charge, highquality, 

peer-reviewed articles from WJGO official website, thereby 

realizing the goals and significance of the communication between 

authors and peers as well as public reading; (3) Maximization of 

the benefits of readers: Readers can read or use, free of charge, 

high-quality peer-reviewed articles without any limits, and cite the 

arguments, viewpoints, concepts, theories, methods, results, conclusion 

or facts and data of pertinent literature so as to validate the 

innovativeness, scientific and practical values of their own research 

achievements, thus ensuring that their articles have novel arguments 

or viewpoints, solid evidence and correct conclusion; and (4) Maximization 

of the benefits of employees: It is an iron law that a firstclass 

journal is unable to exist without first-class editors, and only 

first-class editors can create a first-class academic journal. We insist 

on strengthening our team cultivation and construction so that every 

employee, in an open, fair and transparent environment, could 

contribute their wisdom to edit and publish high-quality articles, 

thereby realizing the maximization of the personal benefits of edi- 

World J Gastrointest Oncol 2011 February 15; 3(2): I-V 



torial board members, authors and readers, and yielding the greatest 

social and economic benefits. 

Aims and scope 

The major task of WJGO is to report rapidly the most recent 

advances in basic and clinical research on gastrointestinal oncology. 

The topics of WJGO cover the carcinogenesis, tumorigenesis, 

metastasis, diagnosis, prevention, prognosis, clinical manifestations, 

nutritional support, molecular mechanisms, and therapy of benign 

and malignant tumors of the digestive tract. This cover epidemiology, 

etiology, immunology, molecular oncology, cytology, pathology, 

genetics, genomics, proteomics, pharmacology, pharmacokinetics, 

nutrition, diagnosis and therapeutics. This journal will also provide 

extensive and timely review articles on oncology. 

Columns 

The columns in the issues of WJGO will include: (1) Editorial: To 

introduce and comment on major advances and developments 

in the field; (2) Frontier: To review representative achievements, 

comment on the state of current research, and propose directions 

for future research; (3) Topic Highlight: This column consists of 

three formats, including (A) 10 invited review articles on a hot 

topic, (B) a commentary on common issues of this hot topic, and 

(C) a commentary on the 10 individual articles; (4) Observation: 

To update the development of old and new questions, highlight 

unsolved problems, and provide strategies on how to solve the 

questions; (5) Guidelines for Basic Research: To provide guidelines 

for basic research; (6) Guidelines for Clinical Practice: To provide 

guidelines for clinical diagnosis and treatment; (7) Review: To 

review systemically progress and unresolved problems in the field, 

comment on the state of current research, and make suggestions 

for future work; (8) Original Articles: To report innovative and 

original findings in gastrointestinal oncology; (9) Brief Articles: To 

briefly report the novel and innovative findings in cardiology; (10) 

Case Report: To report a rare or typical case; (11) Letters to the 

Editor: To discuss and make reply to the contributions published 

in WJGO, or to introduce and comment on a controversial issue 

of general interest; (12) Book Reviews: To introduce and comment 

on quality monographs of gastrointestinal oncology; and (13) 

Guidelines: To introduce consensuses and guidelines reached by 

international and national academic authorities worldwide on the 

research in gastrointestinal oncology. 

Name of journal 


CSSN 


Indexing/abstracting 

PubMed Central, PubMed 

Published by 

Baishideng Publishing Group Co., Limited 

SPECIAL STATEMENT 

All articles published in this journal represent the viewpoints of the 

authors except where indicated otherwise. 

Biostatistical editing 

Statisital review is performed after peer review. We invite an expert 




in Biomedical Statistics from to evaluate the statistical method used 

in the paper, including t-test (group or paired comparisons), chisquared 

test, Ridit, probit, logit, regression (linear, curvilinear, or 

stepwise), correlation, analysis of variance, analysis of covariance, 

etc. The reviewing points include: (1) Statistical methods should 

be described when they are used to verify the results; (2) Whether 

the statistical techniques are suitable or correct; (3) Only homogeneous 

data can be averaged. Standard deviations are preferred to 

standard errors. Give the number of observations and subjects (n). 

Losses in observations, such as drop-outs from the study should be 

reported; (4) Values such as ED50, LD50, IC50 should have their 

95% confidence limits calculated and compared by weighted probit 

analysis (Bliss and Finney); and (5) The word ‘significantly’ should 

be replaced by its synonyms (if it indicates extent) or the P value (if 

it indicates statistical significance). 

Conflict-of-interest statement 

In the interests of transparency and to help reviewers assess any potential 

bias, WJGO requires authors of all papers to declare any competing 

commercial, personal, political, intellectual, or religious interests 

in relation to the submitted work. Referees are also asked to indicate 

any potential conflict they might have reviewing a particular 

paper. Before submitting, authors are suggested to read “Uniform 

Requirements for Manuscripts Submitted to Biomedical Journals: 

Ethical Considerations in the Conduct and Reporting of Research: 

Conflicts of Interest” from International Committee of Medical 

Journal Editors (ICMJE), which is available at: http://www.icmje. 

org/ethical_4conflicts.html. 

Sample wording: [Name of individual] has received fees for serving 

as a speaker, a consultant and an advisory board member for [names 

of organizations], and has received research funding from [names of 

organization]. [Name of individual] is an employee of [name of organization]. 

[Name of individual] owns stocks and shares in [name of 

organization]. [Name of individual] owns patent [patent identification 

and brief description]. 

Statement of informed consent 

Manuscripts should contain a statement to the effect that all human 

studies have been reviewed by the appropriate ethics committee 

or it should be stated clearly in the text that all persons gave their 

informed consent prior to their inclusion in the study. Details that 

might disclose the identity of the subjects under study should be 

omitted. Authors should also draw attention to the Code of Ethics 

of the World Medical Association (Declaration of Helsinki, 1964, 

as revised in 2004). 

Statement of human and animal rights 

When reporting the results from experiments, authors should follow 

the highest standards and the trial should comform to Good 

Clinical Practice (for example, US Food and Drug Administration 

Good Clinical Practice in FDA-Regulated Clinical Trials; UK Medicines 

Research Council Guidelines for Good Clinical Practice in 

Clinical Trials) and/or the World Medical Association Declaration 

of Helsinki. Generally, we suggest authors follow the lead investigator’s 

national standard. If doubt exists whether the research was 

conducted in accordance with the above standards, the authors 

must explain the rationale for their approach and demonstrate that 

the institutional review body explicitly approved the doubtful aspects 

of the study. 

Before submitting, authors should make their study approved by 

the relevant research ethics committee or institutional review board. 

If human participants were involved, manuscripts must be accompanied 

by a statement that the experiments were undertaken with the 

understanding and appropriate informed consent of each. Any personal 

item or information will not be published without explicit consents 

from the involved patients. If experimental animals were used, 

the materials and methods (experimental procedures) section must 

clearly indicate that appropriate measures were taken to minimize 

pain or discomfort, and details of animal care should be provided. 

SUBMISSION OF MANUSCRIPTS 

Manuscripts should be typed in 1.5 line spacing and 12 pt. Book 

Antiqua with ample margins. Number all pages consecutively, and 

start each of the following sections on a new page: Title Page, Abstract, 

Introduction, Materials and Methods, Results, Discussion, 

Acknowledgements, References, Tables, Figures, and Figure Legends. 

Neither the editors nor the publisher are responsible for the 

opinions expressed by contributors. Manuscripts formally accepted 

for publication become the permanent property of Baishideng 

Publishing Group Co., Limited, and may not be reproduced by any 

means, in whole or in part, without the written permission of both 

the authors and the publisher. We reserve the right to copy-edit and 

put onto our website accepted manuscripts. Authors should follow 

the relevant guidelines for the care and use of laboratory animals 

of their institution or national animal welfare committee. For the 

sake of transparency in regard to the performance and reporting of 

clinical trials, we endorse the policy of the ICMJE to refuse to publish 

papers on clinical trial results if the trial was not recorded in a 

publicly-accessible registry at its outset. The only register now available, 

to our knowledge, is http://www.clinicaltrials.gov sponsored 

by the United States National Library of Medicine and we encourage 

all potential contributors to register with it. However, in the case 

that other registers become available you will be duly notified. A 

letter of recommendation from each author’s organization should 

be provided with the contributed article to ensure the privacy and 

secrecy of research is protected. 

Authors should retain one copy of the text, tables, photographs 

and illustrations because rejected manuscripts will not be returned 

to the author(s) and the editors will not be responsible for loss or 

damage to photographs and illustrations sustained during mailing. 

Online submissions 

Manuscripts should be submitted through the Online Submission 

System at: http://www.wjgnet.com/1948-5204office. Authors are 

highly recommended to consult the ONLINE INSTRUCTIONS 

TO AUTHORS (http://www.wjgnet.com/1948-5204/ 

g_info_20100312180518.htm) before attempting to submit online. For 

assistance, authors encountering problems with the Online Submission 

System may send an email describing the problem to wjgo@ 

wjgnet.com, or by telephone: +86-10-85381891. If you submit your 

manuscript online, do not make a postal contribution. Repeated 

online submission for the same manuscript is strictly prohibited. 

MANUSCRIPT PREPARATION 

All contributions should be written in English. All articles must be 

submitted using word-processing software. All submissions must be 

typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. 

Style should conform to our house format. Required information for 

each of the manuscript sections is as follows: 

Title page 

Title: Title should be less than 12 words. 

Running title: A short running title of less than 6 words should be 

provided. 

Authorship: Authorship credit should be in accordance with the 

standard proposed by International Committee of Medical Journal 

Editors, based on (1) substantial contributions to conception and 

design, acquisition of data, or analysis and interpretation of data; (2) 

drafting the article or revising it critically for important intellectual 

content; and (3) final approval of the version to be published. Authors 

should meet conditions 1, 2, and 3. 

Institution: Author names should be given first, then the complete 

name of institution, city, province and postcode. For example, Xu- 

Chen Zhang, Li-Xin Mei, Department of Pathology, Chengde 

Medical College, Chengde 067000, Hebei Province, China. One author 

may be represented from two institutions, for example, George 

Sgourakis, Department of General, Visceral, and Transplantation 

Surgery, Essen 45122, Germany; George Sgourakis, 2nd Surgical 

Department, Korgialenio-Benakio Red Cross Hospital, Athens 

15451, Greece 

WJGO|www.wjgnet.com II February 15, 2011|Volume 3|Issue 2|

Author contributions: The format of this section should be: 

Author contributions: Wang CL and Liang L contributed equally 

to this work; Wang CL, Liang L, Fu JF, Zou CC, Hong F and Wu 

XM designed the research; Wang CL, Zou CC, Hong F and Wu 

XM performed the research; Xue JZ and Lu JR contributed new 

reagents/analytic tools; Wang CL, Liang L and Fu JF analyzed the 

data; and Wang CL, Liang L and Fu JF wrote the paper. 

Supportive foundations: The complete name and number of 

supportive foundations should be provided, e.g. Supported by 

National Natural Science Foundation of China, No. 30224801 

Correspondence to: Only one corresponding address should 

be provided. Author names should be given first, then author 

title, affiliation, the complete name of institution, city, postcode, 

province, country, and email. All the letters in the email should be 

in lower case. A space interval should be inserted between country 

name and email address. For example, Montgomery Bissell, MD, 

Professor of Medicine, Chief, Liver Center, Gastroenterology 

Division, University of California, Box 0538, San Francisco, CA 

94143, United States. montgomery.bissell@ucsf.edu 

Telephone and fax: Telephone and fax should consist of +, 

country number, district number and telephone or fax number, e.g. 

Telephone: +86-10-85381891 Fax: +86-10-85381893 

Peer reviewers: All articles received are subject to peer review. 

Normally, three experts are invited for each article. Decision for 

acceptance is made only when at least two experts recommend 

an article for publication. Reviewers for accepted manuscripts are 

acknowledged in each manuscript, and reviewers of articles which 

were not accepted will be acknowledged at the end of each issue. 

To ensure the quality of the articles published in WJGO, reviewers 

of accepted manuscripts will be announced by publishing the 

name, title/position and institution of the reviewer in the footnote 

accompanying the printed article. For example, reviewers: Professor 

Jing-Yuan Fang, Shanghai Institute of Digestive Disease, Shanghai, 

Affiliated Renji Hospital, Medical Faculty, Shanghai Jiaotong 

University, Shanghai, China; Professor Xin-Wei Han, Department 

of Radiology, The First Affiliated Hospital, Zhengzhou University, 

Zhengzhou, Henan Province, China; and Professor Anren Kuang, 

Department of Nuclear Medicine, Huaxi Hospital, Sichuan 

University, Chengdu, Sichuan Province, China. 

Abstract 

There are unstructured abstracts (no more than 256 words) and 

structured abstracts (no more than 480). The specific requirements 

for structured abstracts are as follows: 

An informative, structured abstracts of no more than 480 words 

should accompany each manuscript. Abstracts for original contributions 

should be structured into the following sections. AIM (no 

more than 20 words): Only the purpose should be included. Please 

write the aim as the form of “To investigate/study/…; MATERI- 

ALS AND METHODS (no more than 140 words); RESULTS (no 

more than 294 words): You should present P values where appropriate 

and must provide relevant data to illustrate how they were obtained, 

e.g. 6.92 ± 3.86 vs 3.61 ± 1.67, P < 0.001; CONCLUSION (no 

more than 26 words). 

Key words 

Please list 5-10 key words, selected mainly from Index Medicus, 

which reflect the content of the study. 

Text 

For articles of these sections, original articles and brief articles, the 

main text should be structured into the following sections: INTRO- 

DUCTION, MATERIALS AND METHODS, RESULTS and 

DISCUSSION, and should include appropriate Figures and Tables. 

Data should be presented in the main text or in Figures and Tables, 

but not in both. The main text format of these sections, editorial, 

topic highlight, case report, letters to the editors, can be found at: 

http://www.wjgnet.com/1948-5204/g_info_list.htm. 


Illustrations 

Figures should be numbered as 1, 2, 3, etc., and mentioned clearly 

in the main text. Provide a brief title for each figure on a separate 

page. Detailed legends should not be provided under the 

figures. This part should be added into the text where the figures 

are applicable. Figures should be either Photoshop or Illustrator 

files (in tiff, eps, jpeg formats) at high-resolution. Examples 

can be found at: http://www.wjgnet.com/1007-9327/13/4520. 

pdf; http://www.wjgnet.com/1007-9327/13/4554.pdf; http:// 

www.wjgnet.com/1007-9327/13/4891.pdf; http://www. 

wjgnet.com/1007-9327/13/4986.pdf; http://www.wjgnet. 

com/1007-9327/13/4498.pdf. Keeping all elements compiled is 

necessary in line-art image. Scale bars should be used rather than 

magnification factors, with the length of the bar defined in the legend 

rather than on the bar itself. File names should identify the figure 

and panel. Avoid layering type directly over shaded or textured 

areas. Please use uniform legends for the same subjects. For example: 

Figure 1 Pathological changes in atrophic gastritis after treatment. 

A: ...; B: ...; C: ...; D: ...; E: ...; F: ...; G: …etc. It is our principle 

to publish high resolution-figures for the printed and E-versions. 

Tables 

Three-line tables should be numbered 1, 2, 3, etc., and mentioned 

clearly in the main text. Provide a brief title for each table. Detailed 

legends should not be included under tables, but rather added into 

the text where applicable. The information should complement, 

but not duplicate the text. Use one horizontal line under the title, a 

second under column heads, and a third below the Table, above any 

footnotes. Vertical and italic lines should be omitted. 

Notes in tables and illustrations 

Data that are not statistically significant should not be noted. a P < 

0.05, b P < 0.01 should be noted (P > 0.05 should not be noted). If 

there are other series of P values, c P < 0.05 and d P < 0.01 are used. 

A third series of P values can be expressed as e P < 0.05 and f P < 0.01. 

Other notes in tables or under illustrations should be expressed as 

1 F, 2 F, 3 F; or sometimes as other symbols with a superscript (Arabic 

numerals) in the upper left corner. In a multi-curve illustration, each 

curve should be labeled with ●, ○, ■, □, ▲, △, etc., in a certain 

sequence. 

Acknowledgments 

Brief acknowledgments of persons who have made genuine contributions 

to the manuscript and who endorse the data and conclusions 

should be included. Authors are responsible for obtaining 

written permission to use any copyrighted text and/or illustrations. 

REFERENCES 

Coding system 

The author should number the references in Arabic numerals 

according to the citation order in the text. Put reference numbers 

in square brackets in superscript at the end of citation content or 

after the cited author’s name. For citation content which is part of 

the narration, the coding number and square brackets should be 

typeset normally. For example, “Crohn’s disease (CD) is associated 

with increased intestinal permeability [1,2] ”. If references are cited 

directly in the text, they should be put together within the text, for 

example, “From references [19,22-24] , we know that...” 

When the authors write the references, please ensure that 

the order in text is the same as in the references section, and also 

ensure the spelling accuracy of the first author’s name. Do not list 

the same citation twice. 

PMID and DOI 

Pleased provide PubMed citation numbers to the reference list, 

e.g. PMID and DOI, which can be found at http://www.ncbi. 

nlm.nih.gov/sites/entrez?db=pubmed and http://www.crossref. 

org/SimpleTextQuery/, respectively. The numbers will be used in 

E-version of this journal. 

WJGO|www.wjgnet.com III February 15, 2011|Volume 3|Issue 2|


Style for journal references 

Authors: the name of the first author should be typed in boldfaced 

letters. The family name of all authors should be typed with 

the initial letter capitalized, followed by their abbreviated first 

and middle initials. (For example, Lian-Sheng Ma is abbreviated 

as Ma LS, Bo-Rong Pan as Pan BR). The title of the cited article 

and italicized journal title (journal title should be in its abbreviated 

form as shown in PubMed), publication date, volume number (in 

black), start page, and end page [PMID: 11819634 DOI: 10.3748/ 

wjg.13.5396]. 

Style for book references 

Authors: the name of the first author should be typed in bold-faced 

letters. The surname of all authors should be typed with the initial 

letter capitalized, followed by their abbreviated middle and first 

initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS, Bo- 

Rong Pan as Pan BR) Book title. Publication number. Publication 

place: Publication press, Year: start page and end page. 

Format 

Journals 

English journal article (list all authors and include the PMID where applicable) 

1 Jung EM, Clevert DA, Schreyer AG, Schmitt S, Rennert J, 

Kubale R, Feuerbach S, Jung F. Evaluation of quantitative contrast 

harmonic imaging to assess malignancy of liver tumors: 

A prospective controlled two-center study. World J Gastroenterol 

2007; 13: 6356-6364 [PMID: 18081224 DOI: 10.3748/wjg.13. 

6356] 

Chinese journal article (list all authors and include the PMID where applicable) 

2 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunologic 

effect of Jianpi Yishen decoction in treatment of Pixu-diarrhoea. 

Shijie Huaren Xiaohua Zazhi 1999; 7: 285-287 

In press 

3 Tian D, Araki H, Stahl E, Bergelson J, Kreitman M. Signature 

of balancing selection in Arabidopsis. Proc Natl Acad Sci USA 

2006; In press 

Organization as author 

4 Diabetes Prevention Program Research Group. Hypertension, 

insulin, and proinsulin in participants with impaired glucose 

tolerance. Hypertension 2002; 40: 679-686 [PMID: 12411462 

PMCID:2516377 DOI:10.1161/01.HYP.0000035706.28494. 

09] 

Both personal authors and an organization as author 

5 Vallancien G, Emberton M, Harving N, van Moorselaar RJ; 

Alf-One Study Group. Sexual dysfunction in 1, 274 European 

men suffering from lower urinary tract symptoms. J Urol 

2003; 169: 2257-2261 [PMID: 12771764 DOI:10.1097/01.ju. 

0000067940.76090.73] 

No author given 

6 21st century heart solution may have a sting in the tail. BMJ 

2002; 325: 184 [PMID: 12142303 DOI:10.1136/bmj.325. 

7357.184] 

Volume with supplement 

7 Geraud G, Spierings EL, Keywood C. Tolerability and safety 

of frovatriptan with short- and long-term use for treatment 

of migraine and in comparison with sumatriptan. Headache 

2002; 42 Suppl 2: S93-99 [PMID: 12028325 DOI:10.1046/ 

j.1526-4610.42.s2.7.x] 

Issue with no volume 

8 Banit DM, Kaufer H, Hartford JM. Intraoperative frozen 

section analysis in revision total joint arthroplasty. Clin Orthop 

Relat Res 2002; (401): 230-238 [PMID: 12151900 DOI:10.10 

97/00003086-200208000-00026] 

No volume or issue 

9 Outreach: Bringing HIV-positive individuals into care. HRSA 

Careaction 2002; 1-6 [PMID: 12154804] 

Books 

Personal author(s) 

10 Sherlock S, Dooley J. Diseases of the liver and billiary system. 

9th ed. Oxford: Blackwell Sci Pub, 1993: 258-296 

Chapter in a book (list all authors) 

11 Lam SK. Academic investigator’s perspectives of medical 

treatment for peptic ulcer. In: Swabb EA, Azabo S. Ulcer 

disease: investigation and basis for therapy. New York: Marcel 

Dekker, 1991: 431-450 

Author(s) and editor(s) 

12 Breedlove GK, Schorfheide AM. Adolescent pregnancy. 

2nd ed. Wieczorek RR, editor. White Plains (NY): March of 

Dimes Education Services, 2001: 20-34 

Conference proceedings 

13 Harnden P, Joffe JK, Jones WG, editors. Germ cell tumours V. 

Proceedings of the 5th Germ cell tumours Conference; 2001 

Sep 13-15; Leeds, UK. New York: Springer, 2002: 30-56 

Conference paper 

14 Christensen S, Oppacher F. An analysis of Koza's computational 

effort statistic for genetic programming. In: Foster JA, 

Lutton E, Miller J, Ryan C, Tettamanzi AG, editors. Genetic 

programming. EuroGP 2002: Proceedings of the 5th European 

Conference on Genetic Programming; 2002 Apr 3-5; 

Kinsdale, Ireland. Berlin: Springer, 2002: 182-191 

Electronic journal (list all authors) 

15 Morse SS. Factors in the emergence of infectious diseases. 

Emerg Infect Dis serial online, 1995-01-03, cited 1996-06-05; 

1(1): 24 screens. Available from: URL: http://www.cdc.gov/ 

ncidod/eid/index.htm 

Patent (list all authors) 

16 Pagedas AC, inventor; Ancel Surgical R&D Inc., assignee. 

Flexible endoscopic grasping and cutting device and positioning 

tool assembly. United States patent US 20020103498. 2002 Aug 

1 

Statistical data 

Write as mean ± SD or mean ± SE. 

Statistical expression 

Express t test as t (in italics), F test as F (in italics), chi square test as 

χ 2 (in Greek), related coefficient as r (in italics), degree of freedom 

as υ (in Greek), sample number as n (in italics), and probability as P (in 

italics). 

Units 

Use SI units. For example: body mass, m (B) = 78 kg; blood pressure, 

p (B) = 16.2/12.3 kPa; incubation time, t (incubation) = 96 h, 

blood glucose concentration, c (glucose) 6.4 ± 2.1 mmol/L; blood 

CEA mass concentration, p (CEA) = 8.6 24.5 mg/L; CO 2 volume 

fraction, 50 mL/L CO 2, not 5% CO 2; likewise for 40 g/L formaldehyde, 

not 10% formalin; and mass fraction, 8 ng/g, etc. Arabic 

numerals such as 23, 243, 641 should be read 23 243 641. 

The format for how to accurately write common units and 

quantums can be found at: http://www.wjgnet.com/1948-5204/ 

g_info_20100312183048.htm. 

Abbreviations 

Standard abbreviations should be defined in the abstract and on first 

mention in the text. In general, terms should not be abbreviated 

unless they are used repeatedly and the abbreviation is helpful to 

the reader. Permissible abbreviations are listed in Units, Symbols 

and Abbreviations: A Guide for Biological and Medical Editors and 

Authors (Ed. Baron DN, 1988) published by The Royal Society of 

Medicine, London. Certain commonly used abbreviations, such as 

DNA, RNA, HIV, LD50, PCR, HBV, ECG, WBC, RBC, CT, ESR, 

CSF, IgG, ELISA, PBS, ATP, EDTA, mAb, can be used directly 

without further explanation. 

Italics 

Quantities: t time or temperature, c concentration, A area, l length, 

m mass, V volume. 

Genotypes: gyrA, arg 1, c myc, c fos, etc. 

Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc. 

Biology: H. pylori, E coli, etc. 

WJGO|www.wjgnet.com IV February 15, 2011|Volume 3|Issue 2|

Examples for paper writing 

Editorial: http://www.wjgnet.com/1948-5204/ 

g_info_20100312180823.htm 

Frontier: http://www.wjgnet.com/1948-5204/ 

g_info_20100312181003.htm 

Topic highlight: http://www.wjgnet.com/1948-5204/ 

g_info_20100312181119.htm 

Observation: http://www.wjgnet.com/1948-5204/ 

g_info_20100312181227.htm 

Guidelines for basic research: http://www.wjgnet.com/1948-5204/ 

g_info_20100312181408.htm 

Guidelines for clinical practice: http://www.wjgnet. 

com/1948-5204/g_info_20100312181552.htm 

Review: http://www.wjgnet.com/1948-5204/ 

g_info_20100312181719.htm 

Original articles: http://www.wjgnet.com/1948-5204/ 

g_info_20100312181919.htm 

Brief articles: http://www.wjgnet.com/1948-5204/ 

g_info_20100312182057.htm 

Case report: http://www.wjgnet.com/1948-5204/ 

g_info_20100312182207.htm 

Letters to the editor: http://www.wjgnet.com/1948-5204/ 

g_info_20100312182320.htm 

Book reviews: http://www.wjgnet.com/1948-5204/ 

g_info_20100312182437.htm 

Guidelines: http://www.wjgnet.com/1948-5204/ 

g_info_20100312182544.htm 

SUBMISSION OF THE REVISED 

MANUSCRIPTS AFTER ACCEPTED 

Please revise your article according to the revision policies of WJGO. 

The revised version including manuscript and high-resolution image 

figures (if any) should be copied on a floppy or compact disk. The 

author should send the revised manuscript, along with printed highresolution 

color or black and white photos, copyright transfer letter, 

and responses to the reviewers by courier (such as EMS/DHL). 

Editorial Office 


Editorial Department: Room 903, Building D, 

Ocean International Center, 

No. 62 Dongsihuan Zhonglu, 

Chaoyang District, Beijing 100025, China 



Telephone: +86-10-85381891 

Fax: +86-10-85381893 


Language evaluation 

The language of a manuscript will be graded before it is sent for 

revision. (1) Grade A: priority publishing; (2) Grade B: minor language 

polishing; (3) Grade C: a great deal of language polishing 

needed; and (4) Grade D: rejected. Revised articles should reach 

Grade A or B. 

Copyright assignment form 

Please download a Copyright assignment form from http://www. 

wjgnet.com/1948-5204/g_info_20100312182928.htm. 

Responses to reviewers 

Please revise your article according to the comments/suggestions 

provided by the reviewers. The format for responses to the reviewers’ 

comments can be found at: http://www.wjgnet.com/1948-5204/ 

g_info_20100312182841.htm. 

Proof of financial support 

For paper supported by a foundation, authors should provide a 

copy of the document and serial number of the foundation. 

Links to documents related to the manuscript 

WJGO will be initiating a platform to promote dynamic interactions 

between the editors, peer reviewers, readers and authors. After a manuscript 

is published online, links to the PDF version of the submitted 

manuscript, the peer-reviewers’ report and the revised manuscript will 

be put on-line. Readers can make comments on the peer reviewer’s 

report, authors’ responses to peer reviewers, and the revised manuscript. 

We hope that authors will benefit from this feedback and be 

able to revise the manuscript accordingly in a timely manner. 

Science news releases 

Authors of accepted manuscripts are suggested to write a science 

news item to promote their articles. The news will be released rapidly 

at EurekAlert/AAAS (http://www.eurekalert.org). The title for 

news items should be less than 90 characters; the summary should 

be less than 75 words; and main body less than 500 words. Science 

news items should be lawful, ethical, and strictly based on your 

original content with an attractive title and interesting pictures. 

Publication fee 

Authors of accepted articles must pay a publication fee. 

EDITORIAL, TOPIC HIGHLIGHTS, BOOK REVIEWS and 

LETTERS TO THE EDITOR are published free of charge. 

WJGO|www.wjgnet.com V February 15, 2011|Volume 3|Issue 2|

2 - World Journal of Gastroenterology

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?