Algorithmes de prediction et de recherche de multi-structures d'ARN

10 Chapter 1. Background – RNAs, non-coding RNAs, and bioinformatics
ggggcuauagcucagcugggagagcgccugcuuugcacgcaggaggucugcgguucgaucccgcauagcuccacca
((((((( (((( )))) ((((( ))))) ((((( ))))))))))))
Figure 1.1: (1, top) Primary structure (sequence) of transfer RNA (tRNA) Ala (76 bases), annotated with
secondary structure. (2, left) Secondary structure (without pseudo-knots) “in cloverleaf”, seen as a planar graph.
(3, middle) Secondary structure with pseudo-knots (4, right) “Real” 3D structure in the cell in “L-shape”. The
global organization of tRNA’s structure is well conserved in all forms of life.
hairpin basepair stacking bulge internal loop multi-loop
Figure 1.2: Some elements of RNA secondary structures. In this thesis, basepair stacking, bulges and internal
loops will be gathered in the notion of “helices” (see Chapter 2).