Treatment with atorvastatin partially protects the rat heart from ...

Treatment with atorvastatin partially protects the rat
heart from harmful catecholamine effects
Ariane Schmechel 1 , Michael Grimm 1 , Ali El-Armouche 1 , Grit Höppner 1 , Alexander P. Schwoerer 2 ,
Heimo Ehmke 2 , and Thomas Eschenhagen 1 *
1 Department of Experimental and Clinical Pharmacology, University Medical Center Hamburg-Eppendorf, Martinistr. 52,
20246 Hamburg, Germany; and 2 Department of Vegetative Physiology and Pathophysiology, University Medical Center
Hamburg-Eppendorf, Hamburg, Germany
Received 17 March 2008; revised 18 December 2008; accepted 23 December 2008; online publish-ahead-of-print 9 January 2009
Time for primary review: 24 days
KEYWORDS
Atorvastatin;
Heart;
b-adrenergic signalling;
Isoprenaline;
Desensitization;
G-proteins
1. Introduction
Cardiovascular Research (2009) 82, 100–106
doi:10.1093/cvr/cvp005
Heart failure is accompanied by chronic activation of the
sympathetic nervous system, the magnitude of which is
inversely correlated with survival. 1 Norepinephrine acutely
augments cardiac contractile function, but chronically
induces adverse effects such as apoptosis, hypertrophy,
and energy depletion. It also leads to downregulation of
b1-adrenergic receptors (b 1-AR) and causes desensitization
to further stimulation, which is generally viewed as a beneficial,
protective response. 2–4
Statins inhibit HMG CoA (3-hydroxy-3-methylglutarylcoenzym-A)
reductase, the key enzyme in the cholesterol
synthesis pathway, which catalyzes the conversion of
HMG CoA to mevalonate. In consequence, statins not only
inhibit the synthesis of cholesterol, but also the formation
of isoprenoids. The latter serve as lipid attachments of key
signalling molecules including monomeric GTPases of the
* Corresponding author. Tel: þ49 40 74105 2180; fax: þ49 40 74105 4876.
E-mail address: t.eschenhagen@uke.uni-hamburg.de
Aims Atorvastatin blunts the response of cardiomyocytes to catecholamines by reducing isoprenylation
of Gg subunits. We examined whether atorvastatin exerts similar effects in vivo and protects the rat
heart from harmful effects of catecholamines.
Methods and results Rats were treated with atorvastatin (1 or 10 mg/kg day) or H2O for 14 days per
gavage. All three animal groups were subjected to restraint stress on day 10 and to infusions of isoprenaline
(ISO; 1 mg/kg day) or NaCl via minipumps for the last 4 days. Heart rate was measured by telemetry,
left ventricular atrial natriuretic peptide (ANP) transcript levels by RT–PCR, and left atrial
contractile function in organ baths. Heart rate was similar in all six study groups. In animals pretreated
with water, infusion of ISO induced an increase in heart-to-body weight ratio (HW/BW) by
20%, an increase in ANP mRNA by 350%, and a reduction in the inotropic effect of isoprenaline in
left atrium by 50%. In animals pre-treated with high-dose atorvastatin, the effects of ISO on HW/
BW, ANP, and left atrial force were 40, 50, and 40% smaller, respectively. Low dose atorvastatin
had similar, albeit smaller effects. Atorvastatin treatment of NaCl-infused rats had only marginal
effects. In cardiac homogenates from atorvastatin-treated rats (both NaCl- and ISO-infused), Gg and
Ga s were partially translocated from the membrane to the cytosol.
Conclusion In the rat heart, treatment with atorvastatin results in translocation of cardiac membrane
Gg and Gas to the cytosol. This mechanism might contribute to protecting the heart from harm induced
by chronic isoprenaline infusion without affecting heart rate.
Published on behalf of the European Society of Cardiology. All rights reserved. & The Author 2009.
For permissions please email: journals.permissions@oxfordjournals.org.
Rho and Ras families. Reduced isoprenylation is assumed
to account for most of the cholesterol-independent effects
of statins. 5
We have recently shown that atorvastatin reduces isoprenylation
of heterotrimeric G protein g-subunits in neonatal
rat cardiac myocytes. This effect was accompanied by a
reduction in total Gas, cAMP generation, and contractile
response to isoprenaline as tested in engineered heart
tissue and was seen without a decrease in b-AR density. 6
The effect of atorvastatin was cholesterol-independent
and reversed by geranylgeranylpyrophosphate. Given the
eminent role of the b1-AR/cAMP/PKA pathway in regulating
heart function, this effect of statins could be clinically
meaningful. The present study examined two questions. (i)
Does pre-treatment of normal rats with atorvastatin affect
the in vivo heart rate under normal or stressed conditions
or the inotropic response of isolated heart preparations to
isoprenaline? (ii) Does pre-treatment with atorvastatin
affect the detrimental effects of chronic catecholaminergic
stimulation on the heart?

Anti-adrenergic effect of atorvastatin 101
2. Methods
2.1 Animals and experimental design
A total of 90 male Wistar rats (Charles River Laboratories) were maintained
with water and food ad libidum at constant humidity and
temperature with a light/dark cycle of 12 h. They were hold in separate
cages. The animals (150–200 g) were randomized into six
groups (n ¼ 15 each) to receive 1 or 10 mg/kg day atorvastatin
(Sortisw, Pfizer) or water per gavage. For the last 4 days, rats were
additionally treated with isoprenaline (1 mg/kg day) or vehicle
(2 mM HCl in isotonic NaCl) via osmotic minipumps (model 2002,
Alzet, Durect) implanted subcutaneously in the neck under isofluorane
(0.5–2%) anaesthesia. After 14 days, animals were sacrificed by
carbon dioxide inhalation and cervical dislocation. The time of treatment
was chosen with regard to the half-life of atorvastatin (18 h in
humans) and the aim to get stable conditions before start of the isoprenaline/NaCl
infusion (assumed steady state after 5 half-life,
security factor of 3). The investigation conforms to the Guide for
the Care and Use of Laboratory Animals published by the US National
Institutes of Health (NIH Publication No. 85-23, revised 1996).
2.2 Ambulatory ECG recordings
ECG transmitters (PhysioTel CA-F40, DataSciences) were implanted
under general anaesthesia (isoflourane). The negative lead was
placed subcutaneously in the area of the right shoulder and the positive
lead left of the xiphoid space caudal the rib cage approximating
an Einthoven Lead II configuration. All rats were allowed to recover
for 7 days before the drug regiment was started. Data were acquired
using Dataquest A.R.T. (v 3.01, DataSciences). For evaluation of the
circadian rhythm, the average heart rate of 1 min was recorded
every 5 min resulting in 12 data points per hour. After implantation
of ECG transmitters, rats were individually housed in cages placed
on a telemetric receiver (RPC1, DataSciences) in a temperaturecontrolled
room (22 + 18C).
2.3 Restraint stress test
Rats were subjected to a restraint stress test for 60 min 7 following
10 days of treatment with atorvastatin or water. Animals were
placed in a plexiglass tube (6 cm diameter) with holes for fresh air
supply. The length of the tubes was adjusted by plastic plugs such
that the animals were unable to move/turn around. Heart rate
was recorded continuously and averaged for each minute. Baseline
heart rate was recorded for a period of 10 min immediately
before the confinement. Following the restraint test, animals
were transferred to their cage for recovery.
2.4 Quantitative RT–PCR (qRT–PCR)
Total RNA was prepared from left ventricles and quantitative RT–
PCR (qRT–PCR) was done essentially as described previously. 8
Probes were designed to cross exon/intron boundaries of the atrial
natriuretic peptide (ANP) gene (GAPDH forward AACTCCCTCAA-
GATTGTCAGCAA, reverse CAGTCTTCTGAGTGGCAGTGATG, probe AT
GGACTGTGGTCATGAGCCCTTCCA; ANP forward CTGGGACCCCTCC
GATAGAT, reverse TCGGTACCGGAAGCTGTTG, probe TAGTCCGCTC
TGGGCTCCAATCCT). GAPDH transcript levels were identical in the
study groups and were used to normalize for differences in RNA
quantity and RT-efficiency. Standard curves were performed in triplicate
with serially diluted cDNA (100 pg–100 ng) to determine
PCR efficiency. Quantification was performed by the standard
curve and 2-DDCt method. 9
2.5 Force measurement in isolated left atria
Experiments were performed on isolated, electrically stimulated left
atria, as previously described, 10 in parallel (one animal per group per
day) and in varying order. Left atria were chosen as an easily accessible,
stable cardiac muscle preparation. Briefly, the heart was
quickly removed under carbon dioxide narcosis after cervical dislocation,
rinsed in Tyrode’s solution, carefully stripped from buffer
between paper towels, and weighed to determine heart-to-body
weight ratio. During preparation of left atria, the heart was kept in
continuously oxygenated (95% O2, 5%CO2, 378C, pH 7.4) modified
Tyrode’s solution containing 119.8 mM NaCl, 5.4 mM KCl, 1.8 mM
CaCl2, 1.05 mM MgCl2, 0.42 mM NaH2PO4, 22.6 mM NaHCO3,
0.05 mM Na 2EDTA, 0.5 mM ascorbic acid, and 5 mM glucose. The
atria were individually mounted vertically in a glass tissue bath
(25 mL bath volume) and attached to an isometric force transducer
(Ingenieurbüro Jäckel). Muscles were electrically stimulated (rectangular,
1 Hz, 5 ms, 80–100 mA) directly after mounting, equilibrated
for about 10–45 min and, after exchange of Tyrode’s
solution, stretched stepwise to L max. Force was measured under
cumulative increases in extracellular calcium (1.8–7.2 mM) and isoprenaline
(0.001–3 mM) in the presence of 1.8 mM calcium.
2.6 Radioligand binding experiments
Total b-AR density was determined in crude membrane fraction as
previously described. 6 One hundred microgram protein per assay
was incubated with 3 nM of the non-specific b1/b2 antagonist
3 H-CGP 12177 (4-[3-tertiarybutylamino-2-hydroxypropoxy]-benzimidazole-2-on)
for 90 min at room temperature. Non-specific binding
was determined with 10 mM of the non-selective b-AR antagonist
nadolol.
2.7 Subcellular fractionation and western blot
Frozen left ventricle (100–150 mg) was powdered and homogenized
in 1.5 mL homogenization buffer (20 mM Tris–HCl pH 7.4, 1 mM
EDTA, 1x complete w ) using a Qiagen TissueLyser. The supernatant
of the low spin centrifugation step (15 min, 48C, 2000 rpm) was subjected
to ultracentrifugation (1 h, 48C, 34000 rpm). The resulting
pellet (particulate fraction) was resuspended in 60 mL homogenization
buffer with 1% Triton-X 100, the supernatant was termed cytosolic
fraction. Protein concentrations were determined by Bradford
assay. For SDS–PAGE analysis, 100 mg protein was loaded onto the
gel to determine Gg3, Gg7, and Gas, and 40 mg for the detection of
Gb. Equal amounts of denatured protein were subjected to SDS–
PAGE on a 10% polyacrylamide gel (Gas and Gb) or to gels with polyacrylamid
concentrations of 10% in the top half and 17% in the bottom
half (Gg3 and Gg7). The following antibodies were used: anti-Gas
polyclonal antibody (1:400, Santa Cruz), anti-Gb (1:500, Santa
Cruz), anti-Gg 3 and anti-Gg 7 (1:300, Santa Cruz), and horseradish
peroxidase-conjugated secondary antibodies (1:10.000, Sigma). All
antibodies were diluted in 5% fat-free milk powder in TBST
(140 mM NaCl, 10 mM Tris, 1% Tween 20). Bands were visualized by
enhanced chemiluminescence (for Gas and Gb SuperSignal West
Pico Substrate and for Gg 3/7 SuperSignal West Dura, Pierce).
2.8 Statistical analysis
Data were calculated as mean + SEM. Unpaired Student’s t-tests
(two-sided) were used to compare means between two independent
groups or samples. Paired t-test (two-sided) was used to compare
values in rats before and after treatment. Concentration response
curves were analysed by F-test. Differences in heart rate were analysed
using one-way ANOVA followed by Bonferroni’s post hoc test.
A P-value ,0.05 was considered significant.
3. Results
3.1 Atorvastatin had no effect on heart rate
Heart rate ranged between 380 and 450 bpm under unrestrained
conditions and showed a clear day–night rhythm.
No differences were observed between the six groups
(measured at day 9, Figure 1A). Under stress induced by

102
restraint, heart rate quickly rose from 380 to 500 bpm in
all groups without apparent differences (Figure 1B).
Figure 1C and D displays the heart rate of animals receiving
NaCl (Figure 1C) or ISO (Figure 1D) via minipumps. Since
heart rate at days 12, 13 and 14 was similar for each
animal, it was averaged over these 3 days. Compared with
NaCl, infusion of ISO caused a marked increase in heart
rate at day time (resting period: ISO 450 bpm, NaCl
375 bpm) and a smaller increase at night (activity
period: ISO 500 bpm, NaCl 440 bpm). Pre-treatment
with atorvastatin did not affect the heart rate response to
ISO (Figure 1D). Animals pre-treated with atorvastatin and
infused with NaCl showed a slightly lower maximum heart
rate during the activity period than water-pre-treated
ones (Figure 1C). Such difference would be compatible
with the expected anti-adrenergic effect of atorvastatin.
However, a further series of experiments (atorvastatin high
dose vs. water, n ¼ 6 each) did not reveal any consistent
effect on heart rate of unrestrained animals of atorvastatin
(data not shown), suggesting that the small difference
occurred by chance or was related to pump implantation.
3.2 Atorvastatin attenuated hypertrophic effects
of ISO infusions
Chronic infusion of ISO in water-pre-treated rats caused an
increase in heart-to-body weight ratio by 19% compared
with vehicle (Figure 2A). Atorvastatin pre-treatment
reduced this hypertrophic effect to 14% (low dose, 226%,
n.s.) and 11% (high dose, 242%, P , 0.05 vs. water),
respectively. Atorvastatin alone did not alter heart-to-body
weight ratio. Chronic ISO infusion increased the transcript
A. Schmechel et al.
Figure 1 Telemetric measurement of heart rate. (A) Twenty-four hour heart rate measurement on day 9 of atorvastatin therapy. Heart rate was determined
every 5 min and averaged over 1 h for each individual animal. Shown are means of the means per hour for all animals (n ¼ 8) in the respective group. (B)
Heart rate during heterologous restraint on day 10. Data points represent mean heart rate of 1 min averaged over all animals (n ¼ 8) in the respective
groups. (C and D) Heart rate during day 12–14 following the implantation of NaCl- or isoprenaline (ISO)-filled minipumps. Data points represent mean heart
rate of each hour averaged over all animals in the respective groups (n ¼ 4) over the 3 days. SEM was omitted for reasons of clarity and was below 5%.
levels of ANP in the left ventricle 4.5-fold. The low and
the high dose of atorvastatin reduced the increase to 2.3-
(263%) and 2.8-fold (249%), respectively (Figure 2B).
3.3 Atorvastatin had minor effects on contractile
force in left atria
Force of contraction under basal and cumulatively increasing
concentrations of extracellular Ca 2þ did not differ
between the six groups (Figure 3A and B) and was therefore
used to normalize the force of contraction under increasing
isoprenaline concentrations (Figure 3C and D). According to
our previous data in neonatal rat heart cells, we had
expected that atorvastatin treatment would reduce the inotropic
effect of b-AR stimulation. Indeed, the positive inotropic
effect of isoprenaline was lower in atria from rats
pre-treated with atorvastatin at high dose (Figure 3C).
However, the difference was rather minor ( 10%) and did
not apply to the low dose group. EC 50 values were identical
in the three groups ( 20 nM; data not shown).
3.4 Atorvastatin attenuated the desensitizing
effect of ISO infusions
Chronic infusion of ISO induces subsensitivity of the heart to
further b-AR stimulation, but generally does not affect the
response to Ca 2þ . 11 Indeed, the 4 day infusion of ISO
resulted in almost 50% reduction of the positive inotropic
response in the group pre-treated with water (compare
Figure 3C and D) without significant differences in the
Ca 2þ response (compare Figure 3A and B). The EC 50 values
were four-fold higher in the ISO treated groups ( 80 vs.
20 nM). Thus, ISO infusion caused the expected

Anti-adrenergic effect of atorvastatin 103
Figure 2 Cardiac hypertrophy. (A) Heart-to-body weight ratio in rats treated
for 14 days with water or atorvastatin and, in addition, with a 4 day infusion
of NaCl or isoprenaline (ISO). (B) Transcript levels of atrial natriuretic peptide
(ANP) in left ventricular tissue of treated groups. The mean in the NaCl-H2O
group was set to 1. GAPDH expression was similar in all groups. Number in
columns is equal to number of animals studied.
desensitization in terms of efficacy and potency. Pretreatment
with atorvastatin partially prevented the ISOinduced
loss of inotropic response as indicated by a slightly
larger inotropic effect (Figure 3D, compare triangular to
spherical symbols). The maximal inotropic response to isoprenaline
was 24 and 32% higher in the low and high dose
atorvastatin-treated groups, respectively, than in the
water group. In other words, the desensitizing effect of
ISO amounted to 47% in the water, 30% in the low, and 28%
in the high dose group.
3.5 Atorvastatin did not affect total b-AR density,
but reduced membrane localization of G proteins
Infusion of ISO resulted in a reduction of total b-AR density
by 37% (36 + 8, n ¼ 13, vs. 56 + 8 fmol/mg protein in
NaCl/water, n ¼ 13). Atorvastatin pre-treatment alone did
not change b-AR density (50 + 8 fmol/mg protein in
NaCl/Ator low, n ¼ 13; 60 + 10 fmol/mg protein in
NaCl/Ator high, n ¼ 13) nor its downregulation by ISO
(36 + 6 fmol/mg protein in ISO/Ator low, n ¼ 13; 40 +
7 fmol/mg protein in ISO/Ator high, n ¼ 13). However,
atorvastatin pre-treatment was associated with a decrease
of the membrane content of Ga s (long and short form) by
4% (n.s.) and 37% at low and high doses, respectively
(Figure 4B). Accordingly, Ga s in the cytosolic fraction was
increased (Figure 4A). Neither high nor low dose atorvastatin
administration affected Gb distribution (Figure 4C and
D). Gg 3 was detectable in the membrane fraction with an
apparent weight of 10 kDa, but was undetectable in the
cytosolic fraction. Atorvastatin treatment dose-dependently
induced a reduction in Gg 3 membrane content by 24% and
50% in the low and high dose group, respectively
(Figure 4E). Similar changes were seen in animals treated
by atorvastatin and ISO infusion (Figure 4F). Ga i2 protein
levels were not affected by atorvastatin (data not shown).
4. Discussion
The present study aimed at evaluating potential antiadrenergic
effects of atorvastatin in rats. Oral treatment
with atorvastatin for 14 days induced partial drop-out of
Gg3 and Gas from cardiac membranes. This was associated
with a 10% reduction of the maximal inotropic effect of
b-AR stimulation in isolated left atria and partial prevention
of the desensitizing, hypertrophic, and ANP-increasing
effects of chronic ISO infusion.
The overall effect size was small. This may be related to
dosing of atorvastatin. Compared to other studies with atorvastatin
(using doses between 2 and 50 mg/kg day in rats),
the two doses of 1 and 10 mg/kg day can be considered as
low and moderate. Atorvastatin or water was given by daily
gavage, excluding problems of drug intake via the food.
Analysis of the lipid profile by HPLC revealed no differences
between the groups (data not shown). This is in accordance
with previous studies showing that atorvastatin delivered to
normal chow-fed rats did not affect plasma cholesterol and
lowered triglycerides only at 25 mg/day. 12 Similarly, rosuvastatin
at 20 mg/kg/day did not affect the lipid profile in
rats. 13 The maximal licensed dose of atorvastatin in patients
(80 mg/day 1 mg/kg day) achieves maximal plasma
levels of 0.3–0.5 mM in humans, 14,15 but only 0.03 mM in
rats. 15 Thus, the high dose atorvastatin used in our study
(10 mg/kg day) can be expected to achieve 0.3 mM, corresponding
to the normal high dose regiment in humans. Our
previous study in cultured cardiac myocytes showed that significant
desensitization started between 0.1 and 1 mM. 6
Thus, the moderate effect size seen in this study appears
realistic.
Treatment with atorvastatin was not associated with a significant
reduction in heart rate. This may seem at variance
to previous studies showing that statins lowered sympathetic
activity in patients with stable ischaemic heart
disease, 16 stroke-prone spontaneously hypertensive rats, 17
and rabbits with heart failure. 18 However, these data were
obtained in models with increased sympathetic drive,
whereas we tested atorvastatin in normal Wistar rats.
Statins may also increase cardiac parasympathetic responsiveness.
19 This mechanism is lipid-dependent and involves
increased expression of acetylcholine-activated potassium
channels and Ga i2. The fact that Ga i2 levels were unchanged
in the heart of atorvastatin-treated rats argues against the
involvement of this mechanism under our conditions. The
lack of heart rate effects suggests that the reduction in
functional Gg in cardiac membranes is either not relevant
for the regulation of beating rate or that Gg levels in the

104
Figure 3 Isometric force of contraction in isolated, electrically driven left atria. The respective 4 day infusion via minipump is indicated above [NaCl for (A) and
(C) and isoprenaline (ISO) for (B) and (D)]. Response to cumulative increases in extracellular [Ca 2þ ] in atria from NaCl- (A) and ISO- (B) treated animals. Effect of
atorvastatin pre-treatment on the positive inotropic effect of increasing concentrations of isoprenaline normalized to individual maximal Ca 2þ responses
(C and D).
sinoatrial node cells (in contrast to left ventricle) were not
affected by atorvastatin.
The effects of atorvastatin on isoprenaline-induced cardiac
hypertrophy and ANP were robust, amounting to a relative
reduction by 26–63%. Similarly, the reduction in the membrane
content of Gg3 and Gas amounted to 40–50% in the
high dose group, providing direct biochemical evidence for
an action of the drug on the heart. Fourteen different Gg isoforms
exist 20 of which g3, g5, g7,andg12 have been detected in
the heart. 21–23 We concentrated on Gg3 which is known to be
cardiac myocyte-specific. 21 Gg7 was detectable as well and
was also reduced in atorvastatin-treated rats (data not
shown). The g-subunit requires geranylgeranylation for membrane
anchorage and normal function. 24 On the basis of our
previous study in neonatal rat cardiac myocytes, 6 the
present data suggest that treatment with atorvastatin partially
depletes the pool of isoprenoid moieties needed for
geranylgeranylation in the cell and consequently results in a
decrease in Gg 3 (and Gg 7) membrane content. Since newly
synthesized palmitoylated Ga s requires fully processed Gbg
to be inserted into the plasma membrane correctly, 24 the
drop-out of Ga s from the membrane and the accumulation in
the cytosol are likely consequences of the reduced membrane
anchorage of Gg 3 and Gg 7. Unexpectedly, we did not observe a
change in Gb content, neither in the cytosolic nor in the particulate
fraction. Possibly, the amount of Gb in the membrane
and in the cytosol is too high to detect such slight effects generated
by atorvastatin. Alternatively, Gb-subunits are able to
A. Schmechel et al.
attach to the cell membrane independently of correctly modified
g-subunits. 25
It is interesting to note that atorvastatin treatment partially
protected the heart from the consequences of a prolonged
infusion of a moderate dose of isoprenaline (less
hypertrophy and ANP, slightly larger inotropic response to
isoprenaline) despite the lack of heart rate effects and
only very minor effects on b-AR responsiveness when given
alone. This could indicate that protection from the 4-day
ISO infusion represents an integrated effect over the
entire period which is easier to determine than acute inotropic
responses. Alternatively, the effects of atorvastatin on
ISO-induced hypertrophy and ANP are unrelated to the
effect on G proteins and due to other mechanisms, e.g.
effects on small G proteins. 26 The effect of atorvastatin on
G proteins was also more pronounced than the effect on
b-AR contractile responses. This could indicate a signalling
reserve, i.e. the phenomenon that a full inotropic b-AR
response in the rat heart requires only a fraction of receptors
to be occupied. 27 The present data would suggest that
such reserve also exists in terms of G proteins.
Do our findings have clinical implications? The effects
of atorvastatin alone on cardiac contractile responses to
isoprenaline were small and likely not meaningful. On
the other hand, the antihypertrophic effects seen under
continued high b-AR stimulation could add to the beneficial
cardiovascular profile of statins, particularly under
excessive catecholamine stimulation as in heart failure.

Anti-adrenergic effect of atorvastatin 105
Figure 4 Cellular localization of G proteins. The long and short form of Gas (A and B) and Gb (C and D) were determined by western blot in cytosolic (A and C)
and particulate fractions (B and D) of left ventricles of rats treated for 14 days with water or atorvastatin and for 4 days with infusion of NaCl. b-actin was used as
loading control. (E and F) Gg 3 in particulate fractions of rats treated with NaCl (E) or ISO (F). Number in columns is equal to number of animals studied.
Statins increased parameters of pump function in nonischaemic
heart failure, 28 but did not reduce mortality in
older patients with systolic heart failure in the CORONA
study. 29 This argues against the idea that statins generally
exert beneficial effects in patients with heart failure. Of
note, 75% of patients in this study were on b-blockers which
likely obscures any anti-adrenergic effect of statins. In
conclusion, atorvastatin exerts a mild anti-adrenergic
effect in rats at a dose equivalent to the maximal licensed
dose in humans. This effect is most likely mediated by a
partial drop-out of Gg and Ga s from the membrane and can
be viewed as a potentially beneficial one. The relevance of
this finding remains open, particular in view of the widespread
use of b-blockers.

106
Acknowledgements
We thank Jörg Heeren, Hamburg, for determining the lipid profile in
plasma samples.
Conflict of interest: The study was supported by Pfizer, USA
(,20.000 E). The authors did not receive personal financial
compensation. Pfizer was neither involved in the design of
the study, nor in the generation or evaluation of the data.
Funding
This study was supported by the German Ministry for Education
and Research (BMBF 01Gi0205) and by Pfizer, USA
(,20.000 E).
References
1. Levine TB, Francis GS, Goldsmith SR, Simon AB, Cohn JN. Activity of the
sympathetic nervous system and rennin–angiotensin system assessed by
plasma hormone levels and their relation to hemodynamic abnormalities
in congestive heart failure. Am J Cardiol 1982;49:1659–1666.
2. Lohse MJ, Engelhardt S, Eschenhagen T. What is the role of
beta-adrenergic signaling in heart failure? Circ Res 2003;93:896–906.
3. El-Armouche A, Zolk O, Rau T, Eschenhagen T. Inhibitory G-proteins and
their role in desensitization of the adenylyl cyclase pathway in heart
failure. Cardiovasc Res 2003;60:478–487.
4. Bristow MR. beta-Adrenergic receptor blockade in chronic heart failure.
Circulation 2000;101:558–569.
5. Wang CY, Liu PY, Liao JK. Pleiotropic effects of statin therapy: molecular
mechanisms and clinical results. Trends Mol Med 2008;14:37–44.
6. Muhlhauser U, Zolk O, Rau T, Munzel F, Wieland T, Eschenhagen T. Atorvastatin
desensitizes beta-adrenergic signaling in cardiac myocytes via
reduced isoprenylation of G-protein gamma-subunits. FASEB J 2006;20:
785–787.
7. McDougall SJ, Paull JR, Widdop RE, Lawrence AJ. Restraint stress: differential
cardiovascular responses in Wistar-Kyoto and spontaneously hypertensive
rats. Hypertension 2000;35:126–129.
8. El-Armouche A, Singh J, Naito H, Wittkopper K, Didie M, Laatsch A et al.
Adenovirus-delivered short hairpin RNA targeting PKCalpha improves contractile
function in reconstituted heart tissue. J Mol Cell Cardiol 2007;
43:371–376.
9. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods
2001;25:402–408.
10. Grimm M, Gsell S, Mittmann C, Nose M, Scholz H, Weil J et al. Inactivation
of (Gialpha) proteins increases arrhythmogenic effects of
beta-adrenergic stimulation in the heart. J Mol Cell Cardiol 1998;30:
1917–1928.
11. Marsh JD, Barry WH, Smith TW. Desensitization to the inotropic effect of
isoproterenol in cultured ventricular cells. J Pharmacol Exp Ther 1982;
223:60–70.
A. Schmechel et al.
12. Krause BR, Newton RS. Lipid-lowering activity of atorvastatin and lovastatin
in rodent species: triglyceride-lowering in rats correlates with efficacy
in LDL animal models. Atherosclerosis 1995;117:237–244.
13. Kim S, Kim CH, Vaziri ND. Upregulation of hepatic LDL receptor-related
protein in nephrotic syndrome: response to statin therapy. Am J Physiol
Endocrinol Metab 2005;288:E813–E817.
14. Cilla DD Jr, Whitfield LR, Gibson DM, Sedman AJ, Posvar EL. Multiple-dose
pharmacokinetics, pharmacodynamics, and safety of atorvastatin, an
inhibitor of HMG-CoA reductase, in healthy subjects. Clin Pharmacol
Ther 1996;60:687–695.
15. Stern RH, Yang BB, Hounslow NJ, MacMahon M, Abel RB, Olson SC. Pharmacodynamics
and pharmacokinetic–pharmacodynamic relationships of
atorvastatin, an HMG-CoA reductase inhibitor. J Clin Pharmacol 2000;
40:616–623.
16. Szramka M, Harriss L, Ninnio D, Windebank E, Brack J, Skiba M et al. The
effect of rapid lipid lowering with atorvastatin on autonomic parameters
in patients with coronary artery disease. Int J Cardiol 2007;117:287–291.
17. Kishi T, Hirooka Y, Shimokawa H, Takeshita A, Sunagawa K. Atorvastatin
reduces oxidative stress in the rostral ventrolateral medulla of strokeprone
spontaneously hypertensive rats. Clin Exp Hypertens 2008;30:
3–11.
18. Pliquett RU, Cornish KG, Peuler JD, Zucker IH. Simvastatin normalizes
autonomic neural control in experimental heart failure. Circulation
2003;107:2493–2498.
19. Welzig CM, Shin DG, Park HJ, Kim YJ, Saul JP, Galper JB. Lipid lowering by
pravastatin increases parasympathetic modulation of heart rate:
Galpha(i2), a possible molecular marker for parasympathetic responsiveness.
Circulation 2003;108:2743–2746.
20. Albert PR, Robillard L. G protein specificity: traffic direction required.
Cell Signal 2002;14:407–418.
21. Hansen CA, Schroering AG, Robishaw JD. Subunit expression of signal
transducing G proteins in cardiac tissue: implications for phospholipase
C-beta regulation. J Mol Cell Cardiol 1995;27:471–484.
22. Morishita R, Nakayama H, Isobe T, Matsuda T, Hashimoto Y, Okano T et al.
Primary structure of a gamma subunit of G protein, gamma 12, and its
phosphorylation by protein kinase C. J Biol Chem 1995;270:29469–29475.
23. Cali JJ, Balcueva EA, Rybalkin I, Robishaw JD. Selective tissue distribution
of G protein gamma subunits, including a new form of the
gamma subunits identified by cDNA cloning. J Biol Chem 1992;267:
24023–24027.
24. Evanko DS, Thiyagarajan MM, Siderovski DP, Wedegaertner PB. Gbeta
gamma isoforms selectively rescue plasma membrane localization and
palmitoylation of mutant Galphas and Galphaq. J Biol Chem 2001;276:
23945–23953.
25. Muntz KH, Sternweis PC, Gilman AG, Mumby SM. Influence of gamma
subunit prenylation on association of guanine nucleotide-binding regulatory
proteins with membranes. Mol Biol Cell 1992;3:49–61.
26. Liao JK, Laufs U. Pleiotropic effects of statins. Annu Rev Pharmacol
Toxicol 2005;45:89–118.
27. Brodde OE, Bruck H, Leineweber K. Cardiac adrenoceptors: physiological
and pathophysiological relevance. J Pharmacol Sci 2006;100:323–337.
28. Sola S, Mir MQ, Lerakis S, Tandon N, Khan BV. Atorvastatin improves left
ventricular systolic function and serum markers of inflammation in nonischemic
heart failure. J Am Coll Cardiol 2006;47:332–337.
29. Kjekshus J, Apetrei E, Barrios V, Bohm M, Cleland JG, Cornel JH et al.
Rosuvastatin in older patients with systolic heart failure. N Engl J Med
2007;357:2248–2261.