Selección asistida por marcadores moleculares

More documents

Recommendations

Info

Fuente: CIAT, La biotecnología en el salón de clases.
Use of Pi5(t) markers in marker-assisted selection to screen for cultivars with resistance to Magna<strong>por</strong>the grisea Yi et al. 2004 Theor Appl Genet (2004). 109: 978-985
Page 1 and 2: Introducción al mejoramiento de pl
Page 3 and 4: Selección Asistida por Marcadores
Page 5 and 6: Aplicaciones de los marcadores mole
Page 7 and 8: Marcadores moleculares como huellas
Page 9 and 10: ¿ADN ADN es la abreviatura del ác
Page 11 and 12: James Watson y Francis Crick, 1953
Page 13 and 14: A = Adenina T = Timina C = Citosina
Page 15 and 16: AGAGCTACGTATCGTTCGATCGACTAGCTAGCTAG
Page 17 and 18: Gen deseable Lo primero Informació
Page 19 and 20: Gen deseable Resistencia a Enfermed
Page 21 and 22: R-genes 1. Permite a las plantas de
Page 23 and 24: Endonucleasas de restricción
Page 25 and 26: ...TTGCAACTGACGTACGTA... Hibridaci
Page 27 and 28: PCR Amplificación IN VITRO de secu
Page 29 and 30: 1ª FASE: Desnaturalización 94°C
Page 31 and 32: 3ª FASE: Extensión 72°C CICLO 1
Page 33 and 34: 3ª FASE: Extensión 72°C CICLO 1
Page 35 and 36: Microsatélites Repeticiones en tá
Page 37 and 38: Sequence-Tagged Microsatellite Site
Page 39 and 40: Fuente: CIAT, La biotecnología en
Page 45: Diversidad genética de 48 variedad
Page 49 and 50: Marker Forward primer (5′→3′)
Page 51 and 52: Fig. 2a-c DNA gel-blot analysis of
Page 53 and 54: IRBLsh-B Pish − − − IRBLta-K1
Page 55 and 56: Ingeniería Genética: NUEVOS ALIME
Page 57 and 58: Retos del futuro ¿Podrá Nicaragua

Selección asistida por marcadores moleculares

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?