Etude de la portabilité de marqueurs microsatellites issus d'EST de ...

More documents

Recommendations

Info

Tab 1-1. World wheat production (million tonnes) Fig1-1. Wheat production worldwide compared with the area sown to wheat from 1961 to 2000.
1. Hexaploid wheat Chapter I: Bibliography - 3 - Bibliography – Hexaploid wheat Small grain cereals offer the decisive advantage of constituting supplies that can be stored as grains, which have a high nutritional value due to their starch as well as protein contents. In addition, they can be easily transformed by cooking under numerous forms. First archeological evidences of cereal harvests date about 10,000 years ago and were found in the Middle-East, in the “Fertile Crescent” (Feldman, 1976) where einkorn (T. boeoticum) and wild durum species (T. dicoccoides) were subjected to gathering. Among the cereals, bread wheat (Triticum aestivum L.) occupies arguably the most important place. It appeared in the same region about 8,000 years ago and was one of the first domesticated crops. Then it was dispersed all over the world from Greece and Europe and has served as staple food for the major civilizations in Europe, West Asia and North Africa. At the present time, wheat remains the most important food source for humans and one of the most important merchandise for economical exchanges. 1.1 Economical importance of wheat Wheat is grown as a commercial crop in 120 countries on an area of 217 million hectares in 2004 (FAO source) which represents about one third of the total cereal-cultivated areas. Wheat is also the most productive among the cereals and the combined harvests in 2004 were 627 million metric tonnes. The major producers in 2004 were China, European Union (25 countries), India, U.S.A., Russian Federation, Canada and Australia. The world wheat production in 2005 is expected to be 612 million tonnes, 15 million tonnes lower than the record in 2004 but still well above than the average of the past five years (Tab. 1-1) (FAO; http://www.fao.org/). Improvement of cultural practices and genetic breeding since the beginning of the 20 th century largely contributed to increase the world yields from 0.9 t/ha in 1900 to 2.9 t/ha in 2004. For example, since the early 1960s there has been little increase in the area sown with wheat, but over the same period, yields have increased almost 3-fold (Fig. 1-1). However, yields remain very different among the countries and if they can reach a mean of 7.8 t/ha in the Netherlands, they are only of 0.34 t/ha in Somalia. Wheat also takes the first place in the international agricultural trade of cereal productions.
Page 1: UNIVERSITE BLAISE PASCAL N o D.U. 1
Page 5: Remerciements Cette thèse a été
Page 9: Table of content Introduction……
Page 13: Chapter II: Materials and Methods
Page 17: 3.1 Main results……………….
Page 21: Introduction - 1 - Introduction Sin
Page 25: BIBLIOGRAPHY
Page 29 and 30: - 4 - Bibliography - Hexaploid whea
Page 31: - 5 - Bibliography - Hexaploid whea
Page 34 and 35: Fig 1-7: Examples of different type
Page 37: - 8 - Bibliography - Simple Sequenc
Page 40 and 41: Tab 1-2: Various types of microsate
Page 43: - 11 - Bibliography - Simple Sequen
Page 47 and 48: - 13 - Bibliography - Simple Sequen
Page 65: 3 Organization of genetic resources
Page 68 and 69: Tab 1-4: Number of accession availa
Page 71: 3.4 Evaluation of genetic resources
Page 75: Bibliography - Organization of gene
Page 79:
sequence. Bibliography - Organizati
Page 83 and 84:
Bibliography - Organization of gene
Page 85 and 86:
Page 87:
Page 91:
- 35 - Aims of the thesis 1 because
Page 95 and 96:
Chapter II: Material and Methods 1
Page 97:
1.3 Aneuploid lines - 37 - Material
Page 101 and 102:
- 39 - Material and Methods http://
Page 103 and 104:
- 40 - Material and Methods accordi
Page 105:
- 41 - Material and Methods 96-well
Page 109:
1 e -10 , 1 e -25 , 1 e -50 and 1 e
Page 113 and 114:
RESULTS & DISCUSSION
Page 115 and 116:
Results and discussion - Characteri
Page 117 and 118:
1.2 Amplification and polymorphism
Page 119 and 120:
1.3 Genetic mapping of the EST-SSRs
Page 121 and 122:
Page 123:
Page 127:
- 51 - Results and Discussion - Tra
Page 131:
Page 135:
Page 139:
Page 143:
Page 147:
Page 151:
Results and Discussion - Grass spec
Page 155:
Introduction Results and Discussion
Page 159 and 160:
Page 161 and 162:
Page 163:
Page 167:
Page 171:
References Results and Discussion -
Page 175:
Page 179:
Results and Discussion -Transferabi
Page 182 and 183:
Table 3-3: Chromosomal assignment o
Page 184 and 185:
Table 3-4: Distribution of rice EST
Page 187:
Results and Discussion -Transferabi
Page 191:
- 83 - Results and Discussion - Phy
Page 195:
Page 199:
Page 203:
Page 207:
Page 211:
Page 215 and 216:
Page 217 and 218:
Page 219 and 220:
Page 221 and 222:
Page 223 and 224:
Page 225 and 226:
- 100 - Results and Discussion - Ph
Page 227:
- 101 - Results and Discussion - Ph
Page 231:
1. Analysis of the wheat ESTs 1.1 M
Page 235:
- 104 - General Conclusion T. durum
Page 239:
- 106 - General Conclusion rice chr
Page 243:
REFERENCES
Page 247:
wheat. Aust. J. Agric. Res. 52: 124
Page 251:
genebank maintenance. Theor Appl Ge
Page 255:
- 113 - References Gale MD, Miller
Page 259:
- 115 - References Jaaska V (1980)
Page 263:
- 117 - References Lilienfeld FA, K
Page 267:
- 119 - References Nieto-Lopez RM,
Page 271:
aestivum). Genet Res Crop Evol 49:
Page 275:
- 123 - References Bernard S, Berna
Page 279:
- 125 - References (1979) Molecular
Page 283:
ANNEXES
Page 287:
Annex 1 Fifteen international agric
Page 291:
Annex 2 List of the accessions used
Page 295:
T. monococcum polonicum Ae. speltoi
Page 299:
�� List of EST-S
Page 303:
cfe59 CAGTGGGTGTACTGGGTCG CATGGTGAT
Page 307:
cfe188 ATCTTCGTAGCATTGGCAGG GCAAAGA
Page 311:
�� Result of amp
Page 315:
cfe57 GGC 16 182 114,130,135 + C -
Page 319:
cfe184 CGG 4 100 115 + C + + + + -
Page 323:
�� Genetic map i
Page 327:
ITMI CTCS Xfba88 Xfba300 Xgsy333 Xc
Page 331:
Xfbb1 Xfbb332 XksuF8 XksuG12 XksuE3
Page 335:
Xcfe179 Xpsr167 Xmwg652 XksuH4 Xcdo
Page 339:
�� Protocol & Pr
Page 343:
- 2 - Annex 6 After complete re-sus
Page 347:
- EDTA 50mM - NaCl 500mM � Phenol
Page 351:
Abstract Despite recent progress in
show all

Etude de la portabilité de marqueurs microsatellites issus d'EST de ...

Create successful ePaper yourself

Delete template?

Save as template?