- Page 1: UNIVERSITE BLAISE PASCAL N o D.U. 1
- Page 5: Remerciements Cette thèse a été
- Page 9: Table of content Introduction……
- Page 13: Chapter II: Materials and Methods
- Page 17: 3.1 Main results……………….
- Page 21: Introduction - 1 - Introduction Sin
- Page 25: BIBLIOGRAPHY
- Page 29 and 30: - 4 - Bibliography - Hexaploid whea
- Page 31: - 5 - Bibliography - Hexaploid whea
- Page 34 and 35: Fig 1-7: Examples of different type
- Page 37: - 8 - Bibliography - Simple Sequenc
- Page 40 and 41: Tab 1-2: Various types of microsate
- Page 43: - 11 - Bibliography - Simple Sequen
- Page 47 and 48: - 13 - Bibliography - Simple Sequen
- Page 49 and 50: - 14 - Bibliography - Simple Sequen
- Page 51: - 15 - Bibliography - Simple Sequen
- Page 55 and 56: - 17 - Bibliography - Simple Sequen
- Page 57: - 18 - Bibliography - Simple Sequen
- Page 61: - 20 - Bibliography - Simple Sequen
- Page 65: 3 Organization of genetic resources
- Page 68 and 69: Tab 1-4: Number of accession availa
- Page 71: 3.4 Evaluation of genetic resources
- Page 75: Bibliography - Organization of gene
- Page 79:
sequence. Bibliography - Organizati
- Page 83 and 84:
Bibliography - Organization of gene
- Page 85 and 86:
Bibliography - Organization of gene
- Page 87:
Bibliography - Organization of gene
- Page 91:
- 35 - Aims of the thesis 1 because
- Page 95 and 96:
Chapter II: Material and Methods 1
- Page 97:
1.3 Aneuploid lines - 37 - Material
- Page 101 and 102:
- 39 - Material and Methods http://
- Page 103 and 104:
- 40 - Material and Methods accordi
- Page 105:
- 41 - Material and Methods 96-well
- Page 109:
1 e -10 , 1 e -25 , 1 e -50 and 1 e
- Page 113 and 114:
RESULTS & DISCUSSION
- Page 115 and 116:
Results and discussion - Characteri
- Page 117 and 118:
1.2 Amplification and polymorphism
- Page 119 and 120:
1.3 Genetic mapping of the EST-SSRs
- Page 121 and 122:
Results and discussion - Characteri
- Page 123:
Results and discussion - Characteri
- Page 127:
- 51 - Results and Discussion - Tra
- Page 131:
- 53 - Results and Discussion - Tra
- Page 135:
- 55 - Results and Discussion - Tra
- Page 139:
- 57 - Results and Discussion - Tra
- Page 143:
- 59 - Results and Discussion - Tra
- Page 147:
- 61 - Results and Discussion - Tra
- Page 151:
Results and Discussion - Grass spec
- Page 155:
Introduction Results and Discussion
- Page 159 and 160:
Results and Discussion - Grass spec
- Page 161 and 162:
Results and Discussion - Grass spec
- Page 163:
Results and Discussion - Grass spec
- Page 167:
Results and Discussion - Grass spec
- Page 171:
References Results and Discussion -
- Page 175:
Results and Discussion - Grass spec
- Page 179:
Results and Discussion -Transferabi
- Page 182 and 183:
Table 3-3: Chromosomal assignment o
- Page 184 and 185:
Table 3-4: Distribution of rice EST
- Page 187:
Results and Discussion -Transferabi
- Page 191:
- 83 - Results and Discussion - Phy
- Page 195:
- 85 - Results and Discussion - Phy
- Page 199:
- 87 - Results and Discussion - Phy
- Page 203:
- 89 - Results and Discussion - Phy
- Page 207:
- 91 - Results and Discussion - Phy
- Page 211:
- 93 - Results and Discussion - Phy
- Page 215 and 216:
- 95 - Results and Discussion - Phy
- Page 217 and 218:
- 96 - Results and Discussion - Phy
- Page 219 and 220:
- 97 - Results and Discussion - Phy
- Page 221 and 222:
- 98 - Results and Discussion - Phy
- Page 223 and 224:
- 99 - Results and Discussion - Phy
- Page 225 and 226:
- 100 - Results and Discussion - Ph
- Page 227:
- 101 - Results and Discussion - Ph
- Page 231:
1. Analysis of the wheat ESTs 1.1 M
- Page 235:
- 104 - General Conclusion T. durum
- Page 239:
- 106 - General Conclusion rice chr
- Page 243:
REFERENCES
- Page 247:
wheat. Aust. J. Agric. Res. 52: 124
- Page 251:
genebank maintenance. Theor Appl Ge
- Page 255:
- 113 - References Gale MD, Miller
- Page 259:
- 115 - References Jaaska V (1980)
- Page 263:
- 117 - References Lilienfeld FA, K
- Page 267:
- 119 - References Nieto-Lopez RM,
- Page 271:
aestivum). Genet Res Crop Evol 49:
- Page 275:
- 123 - References Bernard S, Berna
- Page 279:
- 125 - References (1979) Molecular
- Page 283:
ANNEXES
- Page 287:
Annex 1 Fifteen international agric
- Page 291:
Annex 2 List of the accessions used
- Page 295:
T. monococcum polonicum Ae. speltoi
- Page 299:
������� List of EST-S
- Page 303:
cfe59 CAGTGGGTGTACTGGGTCG CATGGTGAT
- Page 307:
cfe188 ATCTTCGTAGCATTGGCAGG GCAAAGA
- Page 311:
������� Result of amp
- Page 315:
cfe57 GGC 16 182 114,130,135 + C -
- Page 319:
cfe184 CGG 4 100 115 + C + + + + -
- Page 323:
������� Genetic map i
- Page 327:
ITMI CTCS Xfba88 Xfba300 Xgsy333 Xc
- Page 331:
Xfbb1 Xfbb332 XksuF8 XksuG12 XksuE3
- Page 335:
Xcfe179 Xpsr167 Xmwg652 XksuH4 Xcdo
- Page 339:
������� Protocol & Pr
- Page 343:
- 2 - Annex 6 After complete re-sus
- Page 347:
- EDTA 50mM - NaCl 500mM � Phenol
- Page 351:
Abstract Despite recent progress in