Etude de la portabilité de marqueurs microsatellites issus d'EST de ...

More documents

Recommendations

Info

Figure 1-9. Model of SSR mutation by recombination The open rectangles represent individual repeat units. (A) Homologous recombination between misaligned arrays of 10 repeats results in one DNA molecule with a repeated tract one repeat unit longer than the original tract and one molecule that is one repeat unit shorter than the original tract. (B) A double strand break occurs within the repeated tract. This break is followed by exonuclease degradation that exposes complementary single-stranded regions. Hybridization of these regions followed by DNA synthesis and religation results in a reduction in repeat units. Alternatively, the broken ends could invade an array on another DNA molecule leading to an expansion in the tract.
- 15 - Bibliography – Simple Sequence Repeats recombination model shown in Fig1-9A, simple repeats located on different DNA molecules pair in a misaligned configuration and a crossover occurs, resulting in arrays with reciprocal additions and deletions. Other recombination models in which the additions or deletions are not reciprocal are also possible (Fig1-9B). There is little evidence that recombination would also contribute to microsatellite mutation. Genomic SSR distributions are associated with sites of recombination, most probably as a consequence of repetitive sequences being involved in recombination rather than being a consequence of it (Treco and Arnheim 1986; Majewski and Ott 2000) 2.5.2.3 Interaction between replication slippage and recombination Other possible SSR mutation model was proposed by Li et al. (2002). When studying SSR diversity in wild emmer wheat, they found a strong interaction between mean repeat length and SSR locus distance from centromere. This interaction has an effect on the number of alleles and variance in repeat size at SSR loci. SSR mutation might thus be the result from the possible influence of replication slippage during recombination-dependent DNA repair. In fact, strand exchange between two homologous chromosomes should create a four-stranded configuration, called a Holliday structure, associated with mismatched (heteroduplex) DNA region. These regions undergo replication-dependent correction. Hence, a slippage mechanism may also work in recombination tracts involving SSR arrays (Gendral et al. 2000; Li et al 2002) 2.5.3 Polymorphism of g-SSRs Numerous studies demonstrated that g-SSRs show a high level of polymorphism compared to other types of molecular markers. Kölliker et al. (2001) reported that SSR markers developed from white clover were highly polymorphic, 88% detecting polymorphism across seven genotypes with an average allele number of 4.8. In maize, PIC values ranged between 0.06 and 0.91 with a mean of 0.62 (Smith et al. 1997) which was similar to what is mentioned for RFLPs (Senior and Heun 1993). In barley, it was demonstrated that even if SSRs show lower diversity index compared to AFLP (0.521 and 0.937 respectively), they reveal a high number of allele at each locus making them very effective to study genetic relationships (Russell et al. 1997). In cultivated spelt wheat, Bertin et al. (2001) found that the mean PIC value was 0.64 while in common wheat; it was assessed to be 0.71. Even if lower PIC value (0.57) are also reported for common wheat (Stachel et al. 2000), this is twice higher than what is revealed by RFLPs (Chao et al. 1989; Cadalen et al.
Page 1: UNIVERSITE BLAISE PASCAL N o D.U. 1
Page 5: Remerciements Cette thèse a été
Page 9: Table of content Introduction……
Page 13: Chapter II: Materials and Methods
Page 17: 3.1 Main results……………….
Page 21: Introduction - 1 - Introduction Sin
Page 25 and 26: BIBLIOGRAPHY
Page 27 and 28: 1. Hexaploid wheat Chapter I: Bibli
Page 29 and 30: - 4 - Bibliography - Hexaploid whea
Page 31: - 5 - Bibliography - Hexaploid whea
Page 34 and 35: Fig 1-7: Examples of different type
Page 37: - 8 - Bibliography - Simple Sequenc
Page 40 and 41: Tab 1-2: Various types of microsate
Page 43: - 11 - Bibliography - Simple Sequen
Page 47 and 48: - 13 - Bibliography - Simple Sequen
Page 55 and 56: - 17 - Bibliography - Simple Sequen
Page 65: 3 Organization of genetic resources
Page 68 and 69: Tab 1-4: Number of accession availa
Page 71: 3.4 Evaluation of genetic resources
Page 75: Bibliography - Organization of gene
Page 79: sequence. Bibliography - Organizati
Page 83 and 84: Bibliography - Organization of gene
Page 85 and 86: Bibliography - Organization of gene
Page 87: Bibliography - Organization of gene
Page 91: - 35 - Aims of the thesis 1 because
Page 95 and 96: Chapter II: Material and Methods 1
Page 97: 1.3 Aneuploid lines - 37 - Material
Page 101 and 102:
- 39 - Material and Methods http://
Page 103 and 104:
- 40 - Material and Methods accordi
Page 105:
- 41 - Material and Methods 96-well
Page 109:
1 e -10 , 1 e -25 , 1 e -50 and 1 e
Page 113 and 114:
RESULTS & DISCUSSION
Page 115 and 116:
Results and discussion - Characteri
Page 117 and 118:
1.2 Amplification and polymorphism
Page 119 and 120:
1.3 Genetic mapping of the EST-SSRs
Page 121 and 122:
Page 123:
Page 127:
- 51 - Results and Discussion - Tra
Page 131:
Page 135:
Page 139:
Page 143:
Page 147:
Page 151:
Results and Discussion - Grass spec
Page 155:
Introduction Results and Discussion
Page 159 and 160:
Page 161 and 162:
Page 163:
Page 167:
Page 171:
References Results and Discussion -
Page 175:
Page 179:
Results and Discussion -Transferabi
Page 182 and 183:
Table 3-3: Chromosomal assignment o
Page 184 and 185:
Table 3-4: Distribution of rice EST
Page 187:
Results and Discussion -Transferabi
Page 191:
- 83 - Results and Discussion - Phy
Page 195:
Page 199:
Page 203:
Page 207:
Page 211:
Page 215 and 216:
Page 217 and 218:
Page 219 and 220:
Page 221 and 222:
Page 223 and 224:
Page 225 and 226:
- 100 - Results and Discussion - Ph
Page 227:
- 101 - Results and Discussion - Ph
Page 231:
1. Analysis of the wheat ESTs 1.1 M
Page 235:
- 104 - General Conclusion T. durum
Page 239:
- 106 - General Conclusion rice chr
Page 243:
REFERENCES
Page 247:
wheat. Aust. J. Agric. Res. 52: 124
Page 251:
genebank maintenance. Theor Appl Ge
Page 255:
- 113 - References Gale MD, Miller
Page 259:
- 115 - References Jaaska V (1980)
Page 263:
- 117 - References Lilienfeld FA, K
Page 267:
- 119 - References Nieto-Lopez RM,
Page 271:
aestivum). Genet Res Crop Evol 49:
Page 275:
- 123 - References Bernard S, Berna
Page 279:
- 125 - References (1979) Molecular
Page 283:
ANNEXES
Page 287:
Annex 1 Fifteen international agric
Page 291:
Annex 2 List of the accessions used
Page 295:
T. monococcum polonicum Ae. speltoi
Page 299:
�� List of EST-S
Page 303:
cfe59 CAGTGGGTGTACTGGGTCG CATGGTGAT
Page 307:
cfe188 ATCTTCGTAGCATTGGCAGG GCAAAGA
Page 311:
�� Result of amp
Page 315:
cfe57 GGC 16 182 114,130,135 + C -
Page 319:
cfe184 CGG 4 100 115 + C + + + + -
Page 323:
�� Genetic map i
Page 327:
ITMI CTCS Xfba88 Xfba300 Xgsy333 Xc
Page 331:
Xfbb1 Xfbb332 XksuF8 XksuG12 XksuE3
Page 335:
Xcfe179 Xpsr167 Xmwg652 XksuH4 Xcdo
Page 339:
�� Protocol & Pr
Page 343:
- 2 - Annex 6 After complete re-sus
Page 347:
- EDTA 50mM - NaCl 500mM � Phenol
Page 351:
Abstract Despite recent progress in
show all

Etude de la portabilité de marqueurs microsatellites issus d'EST de ...

Create successful ePaper yourself

Delete template?

Save as template?