(L.) C. Jeffrey from India using internal transcribed - Academic ...

African Journal of 

Biotechnology 

Volume10 Number 72 16 November, 2011 

ISSN 1684-5315

ABOUT AJB 

The African Journal of Biotechnology (AJB) is published bi-weekly (one volume per year) by Academic 

Journals. 

African Journal of Biotechnology (AJB) a new broad-based journal, is an open access journal that was founded 

on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial 

microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic 

engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and 

to disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed. 

Submission of Manuscript 

Submit manuscripts as e-mail attachment to the Editorial Office at: ajb@acadjournals.org. A manuscript 

number will be mailed to the corresponding author shortly after submission. 

The African Journal of Biotechnology will only accept manuscripts submitted as e-mail attachments. 

Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be 

given the last name of the first author.

Editors 

George Nkem Ude, Ph.D 

Plant Breeder & Molecular Biologist 

Department of Natural Sciences 

Crawford Building, Rm 003A 

Bowie State University 

14000 Jericho Park Road 

Bowie, MD 20715, USA 

N. John Tonukari, Ph.D 

Department of Biochemistry 

Delta State University 

PMB 1 

Abraka, Nigeria 

Prof. Dr. AE Aboulata 

Plant Path. Res. Inst., ARC, POBox 12619, Giza, 

Egypt 

30 D, El-Karama St., Alf Maskan, P.O. Box 1567, 

Ain Shams, Cairo, 

Egypt 

Dr. S.K Das 

Department of Applied Chemistry 

and Biotechnology, University of Fukui, 

Japan 

Prof. Okoh, A. I 

Applied and Environmental Microbiology Research 

Group (AEMREG), 

Department of Biochemistry and Microbiology, 

University of Fort Hare. 

P/Bag X1314 Alice 5700, 

South Africa 

Dr. Ismail TURKOGLU 

Department of Biology Education, 

Education Faculty, Fırat University, 

Elazığ, 

Turkey 

Prof T.K.Raja, PhD FRSC (UK) 

Department of Biotechnology 

PSG COLLEGE OF TECHNOLOGY (Autonomous) 

(Affiliated to Anna University) 

Coimbatore-641004, Tamilnadu, 

INDIA. 

Dr. George Edward Mamati 

Horticulture Department, 

Jomo Kenyatta University of Agriculture 

and Technology, 

P. O. Box 62000-00200, 

Nairobi, Kenya. 

Dr Helal Ragab Moussa 

Bahnay, Al-bagour, Menoufia, 

Egypt. 

Dr VIPUL GOHEL 

Flat No. 403, Alankar Apartment, Sector 56, Gurgaon- 

122 002, 

India. 

Dr. Sang-Han Lee 

Department of Food Science & Biotechnology, 

Kyungpook National University 

Daegu 702-701, 

Korea. 

Dr. Bhaskar Dutta 

DoD Biotechnology High Performance Computing 

Software Applications 

Institute (BHSAI) 

U.S. Army Medical Research and Materiel Command 

2405 Whittier Drive 

Frederick, MD 21702 

Dr. Muhammad Akram 

Faculty of Eastern Medicine and Surgery, 

Hamdard Al-Majeed College of Eastern Medicine, 

Hamdard University, 

Karachi. 

Dr. M.MURUGANANDAM 

Departtment of Biotechnology 

St. Michael College of Engineering & Technology, 

Kalayarkoil, 


Dr. Gökhan Aydin 

Suleyman Demirel University, 

Atabey Vocational School, 

Isparta-Türkiye, 

Dr. Rajib Roychowdhury 

Centre for Biotechnology (CBT), 

Visva Bharati, 

West-Bengal, 


Dr.YU JUNG KIM 

Department of Chemistry and Biochemistry 

California State University, San Bernardino 

5500 University Parkway 

San Bernardino, CA 92407

Editorial Board 

Dr. Takuji Ohyama 

Faculty of Agriculture, Niigata University 

Dr. Mehdi Vasfi Marandi 

University of Tehran 

Dr. FÜgen DURLU-ÖZKAYA 

Gazi Üniversity, Tourism Faculty, Dept. of 

Gastronomy and Culinary Art 

Dr. Reza Yari 

Islamic Azad University, Boroujerd Branch 

Dr. Zahra Tahmasebi Fard 

Roudehen branche, Islamic Azad University 

Dr. Tarnawski Sonia 

University of Neuchâtel – Laboratory of 

Microbiology 

Dr. Albert Magrí 

Giro Technological Centre 

Dr. Ping ZHENG 

Zhejiang University, Hangzhou, 

China. 

Prof. Pilar Morata 

University of Malaga 

Dr. Greg Spear 

Rush University Medical Center 

Dr. Mousavi Khaneghah 

College of Applied Science and 

Technology-Applied Food Science, Tehran, 

Iran. 

Prof. Pavel KALAC 

University of South Bohemia, 

Czech Republic. 

Dr. Kürsat KORKMAZ 

Ordu University, Faculty of Agriculture, 

Department of Soil Science and Plant nutrition 

Dr. Tugay AYAŞAN 

Çukurova Agricultural Research Institute, PK:01321, 

ADANA-TURKEY. 

Dr. Shuyang Yu 

Asistant research scientist, Department of 

Microbiology, University of Iowa 

Address: 51 newton road, 3-730B BSB 

bldg.Tel:+319-335-7982, Iowa City, IA, 52246, 

USA. 

Dr. Binxing Li 

E-mail: Binxing.Li@hsc.utah.edu 

Dr Hsiu-Chi Cheng 

National Cheng Kung University and Hospital. 

Dr. Kgomotso P. Sibeko 

University of Pretoria, 

South Africa. 

Dr. Jian Wu 

Harbin medical university , 

China.

Electronic submission of manuscripts is strongly 

encouraged, provided that the text, tables, and figures are 

included in a single Microsoft Word file (preferably in Arial 

font). 

The cover letter should include the corresponding author's 

full address and telephone/fax numbers and should be in 

an e-mail message sent to the Editor, with the file, whose 

name should begin with the first author's surname, as an 

attachment. 

Article Types 

Three types of manuscripts may be submitted: 

Regular articles: These should describe new and carefully 

confirmed findings, and experimental procedures should 

be given in sufficient detail for others to verify the work. 

The length of a full paper should be the minimum required 

to describe and interpret the work clearly. 

Short Communications: A Short Communication is suitable 

for recording the results of complete small investigations 

or giving details of new models or hypotheses, innovative 

methods, techniques or apparatus. The style of main 

sections need not conform to that of full-length papers. 

Short communications are 2 to 4 printed pages (about 6 to 

12 manuscript pages) in length. 

Minireview: Submissions of mini-reviews and perspectives 

covering topics of current interest are welcome and 

encouraged. Mini-reviews should be concise and no longer 

than 4-6 printed pages (about 12 to 18 manuscript pages). 

Mini-reviews are also peer-reviewed. 

Review Process 

Instructions for Author 

All manuscripts are reviewed by an editor and members of 

the Editorial Board or qualified outside reviewers. Authors 

cannot nominate reviewers. Only reviewers randomly 

selected from our database with specialization in the 

subject area will be contacted to evaluate the manuscripts. 

The process will be blind review. 

Decisions will be made as rapidly as possible, and the 

journal strives to return reviewers’ comments to authors as 

fast as possible. The editorial board will re-review 

manuscripts that are accepted pending revision. It is the 

goal of the AJB to publish manuscripts within weeks after 

submission. 

Regular articles 

All portions of the manuscript must be typed doublespaced 

and all pages numbered starting from the title 

page. 

The Title should be a brief phrase describing the 

contents of the paper. The Title Page should include the 

authors' full names and affiliations, the name of the 

corresponding author along with phone, fax and E-mail 

information. Present addresses of authors should 

appear as a footnote. 

The Abstract should be informative and completely selfexplanatory, 

briefly present the topic, state the scope of 

the experiments, indicate significant data, and point out 

major findings and conclusions. The Abstract should be 

100 to 200 words in length.. Complete sentences, active 

verbs, and the third person should be used, and the 

abstract should be written in the past tense. Standard 

nomenclature should be used and abbreviations should 

be avoided. No literature should be cited. 

Following the abstract, about 3 to 10 key words that will 

provide indexing references should be listed. 

A list of non-standard Abbreviations should be added. 

In general, non-standard abbreviations should be used 

only when the full term is very long and used often. 

Each abbreviation should be spelled out and introduced 

in parentheses the first time it is used in the text. Only 

recommended SI units should be used. Authors should 

use the solidus presentation (mg/ml). Standard 

abbreviations (such as ATP and DNA) need not be 

defined. 

The Introduction should provide a clear statement of 

the problem, the relevant literature on the subject, and 

the proposed approach or solution. It should be 

understandable to colleagues from a broad range of 

scientific disciplines. 

Materials and methods should be complete enough 

to allow experiments to be reproduced. However, only 

truly new procedures should be described in detail; 

previously published procedures should be cited, and 

important modifications of published procedures should 

be mentioned briefly. Capitalize trade names and 

include the manufacturer's name and address. 

Subheadings should be used. Methods in general use 

need not be described in detail.

Results should be presented with clarity and precision. 

The results should be written in the past tense when 

describing findings in the authors' experiments. 

Previously published findings should be written in the 

present tense. Results should be explained, but largely 

without referring to the literature. Discussion, 

speculation and detailed interpretation of data should 

not be included in the Results but should be put into the 

Discussion section. 

The Discussion should interpret the findings in view of 

the results obtained in this and in past studies on this 

topic. State the conclusions in a few sentences at the end 

of the paper. The Results and Discussion sections can 

include subheadings, and when appropriate, both 

sections can be combined. 

The Acknowledgments of people, grants, funds, etc 

should be brief. 

Tables should be kept to a minimum and be designed to 

be as simple as possible. Tables are to be typed doublespaced 

throughout, including headings and footnotes. 

Each table should be on a separate page, numbered 

consecutively in Arabic numerals and supplied with a 

heading and a legend. Tables should be self-explanatory 

without reference to the text. The details of the methods 

used in the experiments should preferably be described 

in the legend instead of in the text. The same data should 

not be presented in both table and graph form or 

repeated in the text. 

Figure legends should be typed in numerical order on a 

separate sheet. Graphics should be prepared using 

applications capable of generating high resolution GIF, 

TIFF, JPEG or Powerpoint before pasting in the Microsoft 

Word manuscript file. Tables should be prepared in 

Microsoft Word. Use Arabic numerals to designate 

figures and upper case letters for their parts (Figure 1). 

Begin each legend with a title and include sufficient 

description so that the figure is understandable without 

reading the text of the manuscript. Information given in 

legends should not be repeated in the text. 

References: In the text, a reference identified by means 

of an author‘s name should be followed by the date of 

the reference in parentheses. When there are more than 

two authors, only the first author‘s name should be 

mentioned, followed by ’et al‘. In the event that an 

author cited has had two or more works published during 

the same year, the reference, both in the text and in the 

reference list, should be identified by a lower case letter 

like ’a‘ and ’b‘ after the date to distinguish the works. 

Examples: 

Smith (2000), Blake et al. (2003), (Kelebeni, 1983), 

(Chandra and Singh,1992),(Chege, 1998; Steddy, 1987a,b; 

Gold, 1993,1995), (Kumasi et al., 2001) 

References should be listed at the end of the paper in 

alphabetical order. Articles in preparation or articles 

submitted for publication, unpublished observations, 

personal communications, etc. should not be included 

in the reference list but should only be mentioned in 

the article text (e.g., A. Kingori, University of Nairobi, 

Kenya, personal communication). Journal names are 

abbreviated according to Chemical Abstracts. Authors 

are fully responsible for the accuracy of the references. 

Examples: 

Diaz E, Prieto MA (2000). Bacterial promoters triggering 

biodegradation of aromatic pollutants. Curr. Opin. 

Biotech. 11: 467-475. 

Dorn E, Knackmuss HJ (1978). Chemical structure and 

biodegradability of halogenated aromatic compounds. 

Two catechol 1, 2 dioxygenases from a 3chlorobenzoate-grown 

Pseudomonad. Biochem. J. 174: 

73-84. 

Pitter P, Chudoba J (1990). Biodegradability of Organic 

Substances in 

the Aquatic Environment. CRC press, Boca Raton, 

Florida, USA. 

Alexander M (1965). Biodegradation: Problems of 

Molecular Recalcitrance 

and Microbial Fallibility. Adv. Appl. Microbiol. 7: 35-80. 

Boder ET, Wittrup KD (1997). Yeast surface display for 

screening combinatorial polypeptide libraries. Nat. 

Biotechnol. 15: 537-553. 

Short Communications 

Short Communications are limited to a maximum of 

two figures and one table. They should present a 

complete study that is more limited in scope than is 

found in full-length papers. The items of manuscript 

preparation listed above apply to Short 

Communications with the following differences: (1) 

Abstracts are limited to 100 words; (2) instead of a 

separate Materials and Methods section, experimental 

procedures may be incorporated into Figure Legends 

and Table footnotes; (3) Results and Discussion should 

be combined into a single section. 

Proofs and Reprints: Electronic proofs will be sent (email 

attachment) to the corresponding author as a PDF 

file. Page proofs are considered to be the final version 

of the manuscript. With the exception of typographical 

or minor clerical errors, no changes will be made in the 

manuscript at the proof stage.

Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of 

Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the 

handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that 

the editorial office waive some of the handling fee under special circumstances. 

Copyright: © 2012, Academic Journals. 

All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use 

but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary 

bibliographic citation, including author attribution, date and article title. 

Submission of a manuscript implies: that the work described has not been published before (except in the form of an 

abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if 

and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the 

publisher. 

Disclaimer of Warranties 

In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any 

kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or not 

advised of the possibility of damage, and on any theory of liability. 

This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not 

limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. 

Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. 

While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements 

appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and 

advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no 

warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or 

information in this publication or of any other publication to which it may be linked.

. 

African Journal of Biotechnology 

Table of Contents: Volume 10 Number 72 16 November, 2011 

International Journal of Medicine and Medical Sciences 

Review 

ences 

ARTICLES 

Establishing a biotech-agriculture for China 16113 

Zhang Zhengbin, Duan Ziyuan, Shao Hongbo, Chen Peng and Xu Ping 

Food processing optimization using evolutionary algorithms 16120 

Abimbola M Enitan and Josiah Adeyemo 

Research Articles 

GENETICS AND MOLECULAR BIOLOGY 

Maize defensin ZmDEF1 is involved in plant response to fungal 

phytopathogens 16128 

Baosheng Wang, Jingjuan Yu, Dengyun Zhu and Qian Zhao 

Karyotype studies on Tagetes erecta L. and Tagetes patula L. 16138 

Pin Zhang, Li Zeng, Yan-Xue Su, Xiao-Wen Gong and Xiao-Sha Wang 

Genetic diversity assessment of Diplocyclos palmatus (L.) C. Jeffrey 

from India using internal transcribed spacer (ITS) sequences of 

nuclear ribosomal DNA 16145 

M. Ajmal Ali, Fahad M. A. Al-Hemaid1, Joongku Lee, R. K. Choudhary, 

Naif A. Al-Harbi and Soo-Yong Kim 

Regeneration of plantlets under NaCl stress from NaN3 treated 

sugarcane explants 16152 

Ikram-ul-Haq, Salma Memon, Nazia Parveen Gill and Muhammad 

Tahir Rajput


ences 

PLANT AND AGRICULTURAL TECHNOLOGY 

ARTICLES 

Proteomic and transcriptomic analysis reveals evidence for the basis of 

salt sensitivity in Thai jasmine rice (Oryza sativa L. cv. KDML 105) 16157 

Wichuda Jankangram, Sompong Thammasirirak, Meriel G. Jones, James 

Hartwell and Piyada Theerakulpisut 

Genetic diversity and relationship analysis among accessions of 

Aegilops ssp. in Turkey using amplified fragment length 

polymorphism (AFLP) markers 16167 

Ilhan Kaya, Asude Çallak Kirişözü, Figen Yildirim Ersoy, Şahin Dere 

and Mahinur S. Akkaya 

Determination of total polyphenol content and antityrosinase capacity of 

mulberrymedicine (Morusnigra L.) extract 16175 

Wu Chun, Xu Li, Wang Yuancheng, Chen Hu and Huang Xianzhi. 

Somatic embryogenesis and bulblet regeneration in snakehead 

fritillary (Fritillaria meleagris L.) 16181 

Petrid Marija, Subotid Angelina, Jevremovid Slađana and Trifunovid 

Milana 

Meiotic behavior and pollen fertility of five species in the genusEpimedium) 16189 

Yu Jiang, Chunbang Ding, Haixia Yue and Ruiwu Yang 

ENVIRONMENTAL BIOTECHNOLOGY 

In vitro antifungal activity of 63 Iranian plant species against three 

different plant pathogenic fungi 16193 

Sohbat Bahraminejad, Saeed Abbasi and Mehdi Fazlali


ences 

ARTICLES 

Effects of different photoperiods and concentrations of phosphate on 

the growth of the cyanobacterium Cylindrospermopsis raciborskii 

(Woloszynska) 16202 

Sabahi asl Mitra, Nejatkhah Parisa, Ramezanpour Zohreh, Heidary Negin 

Uptake of cadmium from hydroponic solutions by willows (Salix spp.) 

seedlings 16209 

Yongqing Liu, Guang-Cai Chen, Jianfeng Zhang, Xiang Shi and Renmin 

Wang 

Relationship between abscisic acid (ABA) concentration and some 

Physiological traits in two wheat cultivars differing in post-anthesis 

drought-resistance 16219 

Saeed Saeedipour and Foad Moradi. 

Impacts of geo-physical factors and human disturbance on composition 

and diversity of roadside vegetation: A case study from Xishuangbanna 

National Nature Reserve of Southwest China 16228 

Dong Shikui, Li Jinpeng, Li Xiaoyan, Liu Shiliang, and Zhao Qinghe. 

Modeling spatial pattern of deforestation using GIS and logistic regression: 

A case study of northern Ilam forests, Ilam province, Iran 16236 

Saleh Arekhi 

Differential response to water deficit stress in alfalfa (Medicago 

sativa) cultivars: Growth, water relations, osmolyte accumulation 

and lipid peroxidation 16250 

Inès Slama, Selma Tayachi, Asma Jdey, Aida Rouached and Chedly 

Abdelly


ences 

INDUSTRIAL MICROBIOLOGY 

ARTICLES 

Cloning and characterization of a thermostable 2-deoxy-D-ribose-5-phosphate 

aldolase from Aciduliprofundum boonei 16260 

Xiaopu Yin, Qiuyan Wang, Shu-juan Zhao, Peng-fei Du, Kai-lin Xie, Peng Jin and 

Tian Xie 

Isolation and characterization of a bacterial cellulose-producing bacterium 

derived from the persimmon vinegar 16267 

Young-Jung Wee, Soo-Yeon Kim, Soon-Do Yoon and Hwa-Won Ryu 

Purification and characterization of an endo-1,4-β-glucanase fromBacillus 

cereus 16277 

Hong Yan, Yingjie Dai, Ying Zhang, Lilong Yan and Dan Liu. 

APPLIED BIOCHEMISTRY 

Chemical composition of Hirsutella beakdumountainsis, a potential substitute 

for Cordyceps sinensis 16286 

Rong Li, Yu Zhao and Xiaolu Jiang 

Phenolic composition and antioxidant capacity of Cherry laurel (Laurocerasus 

officinalis Roem.) sampled from Trabzon region, Turkey 16293 

Fatma Yaylaci Karahalil and Hüseyin Şahin 

Exhaust emissions and combustion performances of ethylene glycol 

monomethyl ether palm oil monoester as a novel biodiesel 16300 

Da-Yong Jiang, Yun Bai and He-jun Guo 

Optimization of biodiesel production from rice bran oil via immobilized lipase 

catalysises 16314 

Ying Xia Li, Jian Wei Yang, Feng Li Hui, Wei Wei Fan and Ying Yang


ences 

ARTICLES 

MEDICAL AND PHARMACEUTICAL BIOTECHNOLOGY 

Study on correlation between polymorphism of adiponectin receptor gene 

and essential hypertension of Xinjiang Uygur, Kazak and Han in China 16325 

Wang Zhong, Chen Shaoze, Wang Daowen, Wang Li, Zhai Zhihong, Duan 

Juncang, Zhang Wangqiang and Zhang Jingyu 

Mechanism of action of pefloxacin on surface morphology, DNA gyrase 

activity and dehydrogenase enzymes of Klebsiella aerogenes 16330 

Neeta N. Surve and Uttamkumar S. Bagde 

Cytotoxic constituents of Clausena excavata 16337 

N. W. Muhd Sharif, N. A. Mustahil, H. S. Mohd Noor, M. A. 

Sukari*, M. Rahmani, Y. H. Taufiq-Yap and G. C. L. Ee 

Antimicrobial activities of methanol and aqueous extracts of the stem 

of Bryophyllum pinnatum Kurz (Crassulaceae) 16342 

Nwadinigwe, Alfreda Ogochukwu 

Determining the relationship between the application of fixed appliances 

and periodontal conditions 16347 

Ahmad Sheibaninia, Mohammad Ali Saghiri, A. Showkatbakhsh, C. Sunitha, 

S. Sepasi, M. Mohamadi and N. Esfahanizadeh 

ENTOMOLOGY 

Use of pheromone-baited traps for monitoring Ips sexdentatus(Boerner) 

(Coleoptera: Curculionidae) in oriental spruce stands 16351 

Gonca Ece Ozcan, Mahmut Eroglu and Hazan Alkan Akinci


ences 

ARTICLES 

Distributional record of oak gall wasp (Hymenoptera: Cynipidae) species’ 

diversity in different regions of West-Azerbaijan, Iran 16361 

Abbas Hosseinzadeh 

Phosphine resistance in Rhyzopertha dominica (Fabricius) (Coleoptera: 

Bostrichidae) from different geographical populations in China 16367 

XuHong Song, PingPing Wang and HongYu Zhang 

Contribution to the knowledge of Gnaphosidae (Arachnida: Araneae) in Turkey 16374 

Adile Akpınar, Ismail Varol, Faruk Kutbay and Bilal Taşdemır 

PHARMACEUTICAL SCIENCES 

A new endophytic taxol- and baccatin III-producing fungus isolated from Taxus 

chinensis var. Mairei 16379 

Yechun Wang and Kexuan Tang 

ANIMAL SCIENCE 

Heart dysfunction and fibrosis in rat treated with myocardial ischemia and 

reperfusion 16387 

Cheng-Han Huang, Yi-Ming Huang, Yung-Sheng Tseng, Wei-Chi Lee, Jui-Te Wu, 

Zhi-Jia Zheng and Hsi-Tien Wu 

Cardiodepression as a possible mechanism of the hypotensive effects of the 

methylene chloride/methanol leaf extract of Brillantaisia nitensLindau 

(Acanthaceae) in rats 16393 

Orelien Sylvain Mtopi Bopda, Theophile Dimo, Ives Seukep Tonkep, Louis 

Zapfack, Desire Zeufiet Djomeni and Pierre Kamtchouing 

Influence of cross-breeding of native breed sows of Zlotnicka spotted with 

boars of Duroc and polish large white (PLW) breeds on the slaughter value 

fatteners 16402 

Karolina Szulc, Karol Borzuta, Dariusz Lisiak, Janusz T. Buczynski, Jerzy Strzelecki, 

Eugenia Grzeskowiak, Fabian Magda and Beata Lisiak

African Journal of Biotechnology Vol. 10(72), pp. 16113-16119, 16 November, 2011 

Available online at http://www.academicjournals.org/AJB 

DOI: 10.5897/AJB10.2366 

ISSN 1684–5315 © 2011 Academic Journals 

Review 

Establishing a biotech-modern-agriculture for China 

Zhang Zhengbin 1 *, Duan Ziyuan 2 Shao Hongbo 3,4 *, Chen Peng 3,5 and Xu Ping 1 

1 Center for Agricultural Resource Research, Institute of Genetics and Developmental Biology of Chinese Academy of 

Sciences (CAS), Shijiazhuang 050021, China. 

2 Bureau of Biology and Biotechnology, Chinese Academy of Sciences (CAS), Beijing 100864, China. 

3 The CAS/Shandong Provincial Key Laboratory of Coastal Environmental Processes, Yantai Institute of Costal Zone 

Research, Chinese Academy of Sciences (CAS), Yantai 264003, China. 

4 Institute for Life Sciences, Qingdao University of Science &Technology (QUST), Qingdao 266042, China. 

5 Graduate University of Chinese Academy of Sciences(CAS), Beijing 100049, China. 

Accepted 28 September, 2011 

China, with a large population and small amount of arable land, is a populous as well as a large 

agricultural country. In order to ensure food security, agricultural sustainable development and 

prosperity of agriculture economy, modern agriculture based on biotechnology combined with modern 

equipment must be developed. Only in that way can we achieve intensive management and establish a 

resource efficiently-utilized and environment-friendly society. According to the developing history, 

experience of biotechnology and modern agriculture both at home and abroad, we suggest that 

establishing a biotech-modern agriculture country should become a national development goal of 

China. 

Key words: Biotechnology, modern agriculture, agricultural modernization, national development goal. 

INTRODUCTION 

In the 21 st century, six crises are proposed to be the main 

challenges for the agriculture in China: food security, 

water and soil resources, energy, environmental pollution, 

rapid population growth and health, and climate change 

crisis. The 21 st century is the century of biotechnology, 

the counter measures and key to solve these problems is 

the development of biotechnology (Zhang, 2006; Zhang 

and Duan, 2010; Zhang et al, 2010). To overcome food 

security crisis, biotechnology industry including farming, 

cultivation, microbial engineering and food processing 

industry are supposed to be developed (Zhang, 2006; 

Zhang and Duan, 2010; Zhang et al, 2010, Wu, 2010a, 

b). While to overcome water and soil resources crisis, 

technology and industry of efficient utilization of biological 

resources such as biological water saving should be 

developed (Zhang, 2006, 2008; Zhang and Duan, 2010; 

Wu, 2010a, b). Also, to overcome energy crisis, development 

of bioenergy agriculture and biochemical 

engineering should be encouraged, especially in the field 

*Corresponding author. E-mail: zzb@sjziam.ac.cn, 

shaohongbochu@126.com 

of biofuel production from non-food crops (Zhang and Xu, 

2007). Furthermore, to overcome environmental pollution 

crisis, we should vigorously develop organic agriculture, 

ecological agriculture, green agriculture, low carbon agriculture, 

sustainable agriculture and biological agriculture. 

Also, in order to reduce pollution sources and eliminate 

previous environmental pollution, the government should 

give strong support to the development of biological 

pesticide, biological fertilizer, biological plastics, biological 

treatment and biological engineering industry (Shao et 

al., 2010; Ruan et al., 2010). In addition, to overcome 

rapid population growth and health crisis, green 

agriculture and ecological agriculture are the key points. 

Also, biomedicine and plant protection technology, by 

which we can reduce the hazards of various kinds of 

drugs and pesticides, must be on the developing list. 

More healthy foods, nutrition foods and functional foods 

are supposed to be produced (Zhang and Wang, 2010; 

Zhang, 2011). While to overcome climate changing crisis, 

seed project, biological cloning, transgenic technology 

and molecular marker- assisted breeding are greatly 

helpful (Ruan et al., 2010; Wang et al., 2010; Zhang et al, 

2011). Development of urban agriculture (sightseeing 

agriculture), facility agriculture, factory farming as well as

16114 Afr. J. Biotechnol. 

modern precise agriculture must be accelerated and only 

in that way the dependence of agriculture on climate can 

be reduced. Our goal is to achieve what we called “the 

independent agriculture”. 

THE DEVELOPMENT OF MODERN AGRICULTURE 

The construction and development of modern agriculture 

should be a process closely related to biotechnology 

combined with equipment technology. Biotechnology is 

considered as the foundation and core of modern 

agriculture, while equipment technology as the wings. 

With the development of productivity, they underwent the 

following two interactive development processes: 

Development of biotechnology: natural 

agriculture→inorganic agriculture→organic 

agriculture→ecological agriculture→green 

agriculture→resource efficiently utilized 

agriculture→circular agriculture→low-carbon 

agriculture→biotech agriculture→sustainable agriculture. 

For the development of equipment: human powered 

(animal powered) agriculture→mechanized 

agriculture→electrified agriculture (information 

agriculture)→urban agriculture (sightseeing 

agriculture)→facility agriculture→factory 

agriculture→modern precise agriculture. The combination 

of the aforementioned technologies forms modern agriculture. 

The future trend would be sustainable agriculture 

in order to achieve harmonious development between 

human and nature, and ultimately the coexistence of 

human and the earth. From the perspective of modern 

agricultural developing history home and abroad, we will 

find that modern agriculture went through a developing 

period from agricultural modernization (agricultural 

mechanization, electrification, chemization and irrigation 

as main feature) to modern agriculture (agricultural informatization, 

biologicalization, and management modernization 

as main feature). 

There are many different modern agriculture modes as 

a result of different natural economic and social 

conditions. American economist Vernon Ruttan proved 

the following law with empirical data: countries with more 

than 30 hm 2 land per capita are basically mechanical 

technology-oriented; countries with 3~30 hm 2 land per 

capita basically take the road of staggered biotechnologymechanical 

way; Countries with less than 3 hm 2 land per 

capita mainly are biotechnology-oriented (Jin et al., 

2009). As in China, land per capita is less than 0.1hm 2 , 

hence there is need for biotechnology-oriented modern 

agriculture in order to improve resource utilization 

efficiency. China, as a populous as well as a large 

agricultural country, must be developed into a modern 

country with modern agriculture. The United States (US) 

as an example of the modern agriculture mode in 

developed countries, has its agriculture based on 

biotechnology, which is fast developing. As a typical 

representative, planting of genetically modified crops (GM 

crops) with excellent properties including herbicide 

resistance, disease and insect resistance and nutrition 

function improvement is developing at an amazing rate. 

At the same time, new methods of simplified cultivation 

such as conservation tillage, water saving irrigation 

(sprinkler irrigation, drip irrigation etc.), and large-scale 

mechanization management are adopted and then 

combined with information agriculture and precise 

agriculture (Zhang et al., 2010). These factors together 

constitute an economical and efficient high-tech modern 

agriculture mode. Therefore, the developed American 

modern agriculture mode is not simply a “mechanized 

modern agriculture mode” which is generally believed, 

but a modern agriculture mode which is based on 

advanced biotechnology. However, this biotechnology is 

integrated with mechanical technology and information 

technology. 

Furthermore, the US has become the largest biotech 

crops (including GM crops) planting country in the world. 

In 2008, the planting area of GM crops in the US reached 

62.5 million hectares, accounting for 50% of the global 

total. The American seed multinationals monopolize 

agriculture and biological economy in many countries. 

For instance, the seed business of two American 

agriculture-related companies, Monsanto and DuPont, 

respectively accounted for 23 and 15% of the 

international market (Han, 2010). In the 2009 World’s 

Best 40 Company List, Monsanto was ranked eighth for 

its contribution in the agricultural field. The priority 

“threshold” for the selected companies is that sales in 

2008 reached at least ten billion US dollars and at least a 

quarter of its revenue came from overseas markets. 

Monsanto is the world’s largest seed company, ranked 

number one in the field of vegetables and fruits, number 

two in utilization of field crops and number three in 

agricultural chemistry. It is also the world’s largest 

transgenic seed company, owning 90% of the global GM 

crops. We can see from relevant information that the US 

government, including the US Department of Agriculture 

and other important departments, has close contact with 

the commercial and economic activities of both Monsanto 

and DuPont. This is not just purely commercial behavior 

of companies, but national or even worldwide resource 

war, economic war and food war. The former US 

Secretary of State Henry Kissinger, claimed in 1970 that 

“If you control oil, you control all of the countries, if you 

control food, you control all human”. This tells the 

intentions and strategies of American leaders and the US 

government to control the world, illustrating the extreme 

importance of controlling food. Therefore we need to rely 

on agricultural biotechnology and advanced varieties. 

Chinese soybean industry is defeated by American 

transgenic soybean in a very short term. An even more 

shocking fact is that “Xianyu 335”, a corn variety from 

American Pioneer company, has become the third-largest 

corn variety planted in China in just three year, and has

also became the first major cultivar in Northeast China. 

However, it is now difficult to buy for its high price. These 

two typical examples can fully explain the problem from 

which a lesson can be learnt. According to the reports of 

China Daily, on September 17th 2010, the agricultural 

trade office established by the US Department of 

Agriculture in the Northeastern center city Shenyang held 

its opening ceremony; it is the fifth office they set up in 

China after Beijing, Shanghai, Guangzhou and Chengdu. 

Until then, the strategic layout of US agricultural products 

has entered the core of China’s granary. Northeast China 

is the main producing area of soybean, corn and japonica 

rice, also one of the largest granaries. The establishment 

will no doubt strengthen their attempts to occupy Chinese 

agricultural market. Vice Minister of the US Department of 

Agriculture Jim Miller who was on his special trip for this 

ceremony did not hide their ambition to northeast China. 

He said: “Setting up the fifth trade office in Chinese 

mainland shows that US Department of Agriculture 

expanded to the center of Northeast China. As one world 

trade center of China, Shenyang will provide ample 

opportunity for US agricultural exports”. The US has 

started to gain a dominant position in the grain and seed 

market by virtue of its absolute technical advantages. 

Once its transgenic agricultural products were promoted 

of mass worldwide, grain seeds cultivated in other 

countries are likely to be quickly knocked out from the 

market, which would lay a solid foundation for the US to 

control the world’s food supply from the source (Wu et al., 

2010). 

It should be noted that a seed can change the world; on 

the contrary, a seed can defeat an industry, or even 

threaten a country’s food security. An agricultural (seed) 

company can also play games with the world’s 

agricultural economy and food security. Therefore, the 

development of agricultural biotechnology should not be 

underestimated; the development of biotech modern 

agriculture is unstoppable. In the current circumstances 

of economic crisis and food security challenges, we 

suggest that establishing a biotech modern agriculture 

country should become a national development goal of 

China. This is of great practical and historical significance 

for the national food and economic security. 

BIOTECHNOLOGY AS NATIONAL DEVELOPMENT 

GOAL AND COMPETITION STRATEGY IN MANY 

COUNTRIES 

As early as 1987, The US government convened a group 

of biotechnology researchers and national strategy 

researchers to study and published a book “Agricultural 

biotechnology is a national competition strategy” (Ray, 

2003). In 2003, American scientist Ray V. Herren 

published his new book “Introduction to Biotechnology: 

An Agricultural Revolution”, which was very popular in the 

international community and was reprinted by many 

Zhengbin et al. 16115 

publishing companies. The US government issued a 

series of development strategies and blue book reports 

such as “Biotechnology in the 21 st Century”. In order to 

ensure its leading position in biotechnology industry, highlevel 

coordination mechanism and industrial organization 

systems are established in the US. Each year, more than 

38 billion dollars are invested in biotechnology research 

and development (R & D), five bio-valleys and more than 

1400 biotechnology companies have been developed. To 

encourage the development of biomass energy in 

agriculture, the plan is that biomass fuels will replace 

10% of the fuel oil consumption by 2020, and 50% by 

2050 (Research Report of China, 2010). A special 

National Agricultural Biotechnology Council (NABC) was 

established in the US. Researching and consulting 

organizations of the US congress have paid long-term 

attention to biotechnology and its applications in 

agriculture. In 2010, two reports were issued, one is 

about the background and progress of agricultural 

biotechnology (Tadlock and Geoffrey, 2010), and the 

other is about the dispute of biotechnology between US 

and the European Union (EU) (Charles and Hanrahan, 

2010). Although the attitude of the EU towards GM crops 

is prudent, its member states are required to actively 

develop biomass energy and energy agriculture in order 

to alleviate the supply-demand contradiction and improve 

the environmental condition. According to the requirements 

of the EU, biomass fuels will account for 20% in 

the traditional fuel market by 2020 (Research Report of 

China, 2010). Turning from traditional agriculture to 

biological energy agriculture is an important direction 

during the agriculture transformation in developed 

countries. 

In 2005, “High Flyers Think Tank” of Australian 

Academy of Science published its proceedings “Biotechnology 

and the future of Australian agriculture”( High 

Flyers Think Tank, 2005). The goal of the report “development 

of biotechnology” issued by British government is to 

ensure its world’s second position in biotechnology field. 

In Japan, a new strategy called “Biological Industry as 

Foundation” was proposed and identified as a national 

goal. A new organization “Biotechnology Strategy 

Council” headed by the Prime Minister has also been set 

up. India is also seeking to become a great power of 

biotechnology, and has set up its special “Department of 

Biotechnology”. In addition, Singaporean government has 

drawn up a plan named “Entering the Top Ranks of 

Biotechnology in Five Years”. Singapore is expecting to 

become a bio-island (Research Report of China, 2010). 

After entering the 21 st century, South Korea has 

vigorously developed its biotechnology, which is regarded 

as a new engine of economic development. Its annual 

production value of biology industry has now entered the 

reached the advanced level in the world. It is predicted 

world top 15. In the field of fermentation technology, stem 

cell technology, somatic cloned cattle, AIDS DNA vaccine 

and herbicide-resistant crops, they all have currently


that in 2010, the total output value of biological industry in 

South Korea will reach 3.1 billion dollars, accounting for 

1.9% of the international market. These figures will 

respectively reach 7.5 billion and 2.0% in 2015, 11.6 

billion and 2.2% in 2020 (Yin and Li, 2010). 

The international agricultural organizations also attach 

great importance to agricultural biotechnology development 

and utilization. In an article published in “Science”, 

Ismail Serageldin, an expert of Consultative Group on 

International Agricultural Research, World Bank, pointed 

out that biotechnology will play an important role in food 

security in the 21stcentury (Ismail, 1999). In 2000, Food 

and Agriculture Organization (FAO) held an international 

conference on biotechnology in Japan and published 

their declaration on biotechnology, they also constructed 

a specialized biotechnology website. Similarly, International 

Council of Science (ICSU) published 

“Biotechnology and Sustainable Agriculture Report” as 

well (Persley et al., 2002). Since 1991, International 

Service for the Acquisition of Agri-biotech Applications 

(ISAAA) began to pay close attention to the potential of 

biotechnology applications in agricultural production and 

latest advances in agricultural biotechnology. They 

irregularly publish “Biotec crop update” and “Biofuels 

Supplement”. In their latest publications “14 Years of 

Biotech Agriculture” and “Global Biotech Crops Report 

2009”, where they specially mention that Chinese 

government has recently approved the cultivation of 

transgenic rice and corn. 

ESTABLISHING A BIOTECH MODERN 

AGRICULTURE: A NATIONAL DEVELOPMENT GOAL 

OF CHINA 

ISAAA point out that agricultural biotechnology, the 

second wave of global biotechnology development, is 

now entering a vigorous developing period with the arrival 

of this century (the first wave was biotechnology in 

medicine industry). Hence developing agricultural 

biotechnology in China is worth our deep consideration 

and scientific decision-making. Science and technology is 

the first productivity, so biotechnology must be the first 

productivity in agriculture. Great importance has been 

attached to biotechnology in China. A series of books 

“Report of the Biotechnology Industry Development in 

China” co-published by National Development and the 

Reform Committee together with Chinese Society of 

Biotechnology is now publishing the seventh book 

(National Development and the Reform Committee, 

2009). Comrade Deng Xiaoping once pointed out: “The 

future of agriculture will eventually depend on bioengineering 

technology and other sophisticated technologies.” 

Premier Wen Jiabao also mentioned in a 

government conference: “In order to solve the food 

problem, we must rely on scientific methods, including 

biotechnology and transgenic technology.” In 2006, four 

deputies to National People's Congress (NPC) put 

forward a suggestion about making a national strategy on 

biotechnology. Biotechnology was therefore proposed as 

a focal point of technology in “Long-term Scientific and 

Technological Development Planning Outline (2006 to 

2020)” of China. 

The biotechnology R & D level of China can get the 

leading position among developing countries, even is 

world-leading in some fields. China is now one of the few 

countries who can independently complete gene 

sequencing of main crops. In China, agricultural biotechnology 

has the smallest gap with that of developed 

countries among all high technologies. Seven plants have 

got the commercial production license until October, 

2009. The transgenic rice and corn cultivated in China 

can increase insect resistance of rice and nutritional 

value of feed corn, which can not only increase farmers’ 

income, create huge economic and social benefits, but 

also play a significant role in environmental protection 

(Han et al., 2010). The Chinese government has invested 

tens of millions of dollars in agricultural biotechnology. 

We have the world’s second largest research fund of 

biotechnology, preceded only by the US. The current 

agricultural biotechnology development is mainly in the 

field of biotech crops, particularly in China. Agricultural 

GDP includes the output value of animals, crops, 

vegetables and forestry. In developed countries, the 

output value of animal agriculture accounts for about 55% 

of the total agricultural GDP, even as high as 80 to 90% in 

some individual countries like Netherlands, Israel. 

However, this ratio is only 34% in China while that of 

crops is 46~47%. A higher GDP of animal agriculture than 

that of crops is an important symbol of modern agriculture 

(Long and Li, 2010). Therefore, while keeping the growth 

of crop agriculture, we are supposed to pay more 

attention to animal and microbe biotechnology at the 

same time. 

In the early age after liberation, Chairman Mao Zedong 

claimed that the fundamental way of agricultural modernization 

is agricultural mechanization. We believe it is an 

advanced theory on the social and economic conditions 

at that time. However, judging from the current development 

of modern agriculture and biotechnology both at 

home and abroad, we believe that in China, the fundamental 

way of agriculture is to develop modern 

agriculture with combined biotechnology and modern 

equipment technology. It is not simply or purely mechanized 

agriculture nor biotech agriculture. This should be the 

mode of modern agriculture with Chinese characteristics. 

Although the Chinese government attaches great 

importance to biotechnology and modern agriculture, 

there is no overall development strategy. Faced with so 

many new concepts of agriculture such as organic 

agriculture, ecological agriculture, green agriculture, 

biological agriculture; mechanized agriculture, facility 

agriculture, modern agriculture, etc, there is a need to 

sort out an overall idea of agricultural development and

form a modern agricultural system in China. After a longterm 

exploration, we believe that establishing a biotech 

modern agriculture country should become a national 

development goal. 

THE DEVELOPMENT OF BIOTECH AGRICULTURE 

During the past 30 years, modern agricultural 

development system has changed a lot as the concepts 

of biotechnology, agricultural biotechnology, biotech 

agriculture, modern agriculture, GM crops and biotech 

crop changed. According to the developing process of 

agriculture and biotechnology both home and abroad, we 

suggest the developing process of biotech modern 

agriculture country like this: 

Agriculture→Biotechnology→Biotech crops→Agricultural 

biotechnology→ Modern agriculture→ Biotech 

agriculture→ Biotech modern agriculture→ Biotech 

modern agriculture Country. In this developing process, 

biotechnology started with one or two techniques simply 

applied in agricultural production, and then large scaled 

applications in crops (such as virus-free tissue culture, 

rapid propagation technology, GM crops, molecular 

design breeding), and then universal applications in 

agriculture as agricultural biotechnology (including 

agricultural food processing, bioenergy agriculture), and 

then finally replaced conventional agriculture. 

Biotechnology is one aspect of modern agriculture, but 

the proportion varies in different stages of modern 

agriculture development. Recently, ISAAA noted that 

agricultural biotechnology does not mean only GM crops, 

but also include traditional breeding, tissue culture, 

micropropagation, molecular breeding, marker-assisted 

selection, genetic engineering, molecular diagnostic 

tools, etc. (International Service for the Acquisition of 

Agri-biotech Applications, 2010). However, the current 

concentrated area is still GM crop breeding, the concept 

and application services of which are still somewhat 

limited. In fact, it also includes some other categories, 

such as biological breeding, biological energy, biological 

fertilizers, biological pesticides, biological control, 

biological treatment, biological engineering, biological 

refining, biological plastics, biological economy and so 

on. 

RESEARCH DIRECTIONS OF BIOTECH 

AGRICULTURE IN CHINA 

In the national forum on agricultural production of major 

grain producing areas on September 18th, Vice Premier 

Hui Liangyu pointed out that in recent years, faced with 

great challenges of natural disasters, the international 

financial crisis and the severe impact of abnormal fluctuations 

in international agricultural markets, food and 

agricultural development are put in a prominent position 


by the Party Central Committee and the State Council. In 

current and the coming period, the difficulties and 

challenges of agricultural development will keep growing, 

increasing pressure of keeping quantitative and structural 

balance of agricultural products supply will become more 

and more prominent. Hence, to improve food and 

agricultural producing capacity as the core, to speed up 

the progress of agricultural science and technology, to 

improve yields and optimize the product structure as the 

main direction, we must vigorously promote institutional 

innovation, accelerate the transformation of agricultural 

development, strive to build long-term mechanisms to 

promote steady agricultural development and increase 

income of farmers. Only then the basis of national food 

security can be strengthened (Hui, 2010). 

In 2009, with the recommendation and promotion of Lu 

Yongxiang, president of Chinese Academy of Sciences 

(CAS), “Integration and Development Center of Green 

Agricultural Technology, CAS” was set up. Based on the 

abundant strength of CAS in life sciences and 

biotechnology, this center will become an important 

transformation, integration and application platform of 

green agricultural biotechnology, its function includes 

technology incubation, technology integration, industrial 

demonstration and achievement transformation. Faced 

with the great challenges of national security, food 

security, ecological security, environmental security, this 

center will offer technological support to green agriculture 

and sustainable social development in China. Based on 

the comparative research on modern agriculture mode 

and biotechnology developing strategy abroad, and 

considering national condition of China, we can then put 

forward the Chinese theory system, technology system, 

policy system and developing strategy of modern 

agriculture. 

Moreover, goals of modern agriculture should include 

the following eight aspects: grain security, food quality 

security, biological security; environmental security; 

ecological security; energy security, economic security 

and social security. All of the aforementioned have to be 

based on biotech modern agriculture. We believe that to 

establish a biotech modern agriculture country, the 

priority development areas should include the following 

ones: 

(1) Anti-adversity farming (grain and economic crops) 

(2) Anti-adversity breeding industry (animal husbandry 

and fishery industry) 

(3) Microbial engineering (brewing and pharmacy 

industry) 

(4) Functional food engineering (refining process and 

artificial synthesis) 

(5) Frontier technology of biology (genomics, proteomics, 

metabolomics, gene networks, bioinformatics, 

biomedicine) 

(6) Biotechnology (biological cloning, transgenic 

technology, molecular breeding, enzyme engineering,


fermentation engineering, cell engineering) 

(7) Biological industry (biological fertilizer, biological 

pesticide, biological control, biological plastics, biological 

energy, biological pharmacy, biochemical engineering, 

bio-refining) 

(8) Land security and efficient utilization 

(9) Water security and efficient utilization 

(10) Environmental security and efficient utilization 

(11) Ecological security and conservation 

(12) Research on climate changes and agricultural 

disaster resistance 

(13) Agricultural economy and subsidy policy 

CONCLUSION 

Life sciences and biotechnology is one of the main areas 

which will fundamentally shape the human development 

in the 21 st century. It will change the traditional development 

mode, build green and renewable industry system, 

and significantly improve human health. China has a solid 

foundation and market space in this area, which is a 

great advantage for the development of biology industry. 

According to “the State Council decision on accelerating 

the development of new strategic industries” released on 

Chinese government website on October 18th, 2010, 

China plans to take about 10 years to foster new pillar 

industries of national economy, including biotechnology. 

FengFei, Minister of Industrial Economics Research 

Department of Development Research Center in China, 

analyzed that compared to other industries, biology 

industry is of more far-reaching strategic significance. 

Biotechnology can relieve the resource and environment 

pressure, improve human health, and moreover, improve 

the capacity of sustainable development. In fact, the 

importance of biology industry has long been noticed by 

senior leaders. As early as 2004, Ding Shisun, vice 

chairman of NPC Standing Committee, sent a letter to the 

government and recommended biotechnology industry as 

a national strategy. WenJiabao replied to this letter and 

indicated that development of biotechnology industry 

should be an emphasis of national economic, social 

development and scientific progress, and should also be 

included in the medium and long term planning. 

In 2007, China firstly issued “the Eleventh Five-Year 

Plan for Biology Industry”, while in 2009, General Office 

of the State Council issued “Notice on the Issuance of a 

Number of Policies for Promoting the Development of 

Biotechnology Industry”. Also in the same year, China 

held the world’s first international biology economy 

conference in Tianjin. National biology industry bases are 

continuously established everywhere. Besides, as China 

Bio-industry Convention held every year fueling the 

development of biology, biology economy is now 

vigorously developing in China. Moreover, in the recently 

issued “Recommendations of the Twelfth Five-Year Plan 

for National Economy and Social Development”, the 

government pointed out that the construction of modern 

agriculture should be accelerated. China’s agriculture is 

increasingly restricted by natural resources. Improving 

agricultural output only by means of increasing 

investment of natural resources is becoming more and 

more difficult. The fundamental solution depends on 

agricultural modernization with Chinese characteristics, 

which means speeding up agricultural mode transformation, 

promoting development of agricultural science 

and technology, improving agricultural production 

capacity, anti-risk ability and market competitiveness. 

In such a development background and historical conditions, 

there is no doubt that biology industry is entering 

a period of rapid development. In China, the development 

of biotechnology has close links with the agricultural 

modernization, which determines that biotechnology will 

become an area of strategic importance. Thus, it is easily 

acceptable that establishing a biotech modern agriculture 

country should become a national development goal of 

China. 

ACKNOWLEDGEMENTS 

This work was jointly supported by the Major Specialized 

Project of Transgenic Breeding New Species 

(2009ZX08009-079B), 973 Project (2010CB951501), 

the Important Direction Project (KSCX2-EW-N-02) of 

CAS, Innovation and Agricultural Poverty-helping 

Project, One Hundred-Talent Plan of the Chinese 

Academy of Sciences (CAS) and Yantai Science and 

Technology Development Project (2011016). 

REFERENCES 

Charles E, Hanrahan (2010). Agricultural Biotechnology: The U.S.-EU 

Dispute. Congressional Research Service. 

Han GC (2010). Opportunities and challenges of agricultural 

biotechnology industry. China Rural Sci. Technol. 2: 37-40. 

High Flyers Think Tank (2005). Biotechnology and the future of 

Australian agriculture, Proceedings of the High Flyers Think Tank 

held at the Shine Dome. Canberra. 

Hui LY (2010). Speech at national forum on agricultural production of 

major grain producing areas.Yantai, China. 

International Service for the Acquisition of Agri-biotech Applications 

(2010). AgriculturalBiotechnology(ALot More than Just GM Crops). 

ISAAA SEAsiaCenter. 

Ismail S (1999). Biotechnology and Food Security in the 21st Century. 

Science, 5426: 387-389. 

Jin L, Wang YP, Liu LC, Liu XL (2009). Enlightenment of overseas 

successful experiencein modern agriculture development. World 

Agric. 5: 31-34. 

Long JZ, Li N (2010). Animal agriculture is expected to exceed crop 

agriculture in 15 years. Science Times. 

National Development and the Reform Committee, Chinese Society of 

Biotechnology (2009). Report of the Biotechnology Industry 

Development in China.Beijing: Chemical Industry Press. 

Persley GJ, Peacock J, Montagu MV (2002). Biotechnology and 

sustainable agriculture. ICSU. 

Ray VH (2003). Introduction to Biotechnology: An Agricultural 

Revolution. Delmar Cengage Learning. 

Research Report of China (2010). Development trends and counter

measures of global agricultural biotechnology industry. 

Ruan CJ, Xu XX, Shao HB, Jaleel CA (2010).Germplasm-regressioncombined 

(GRC) marker-traitassociation identification in plant 

breeding: a challengefor plant biotechnological breeding under soil 

water deficitconditions. Crit. Rev. Biotechnol. 30: 192-199. 

Shao HB, Chu LY, Ruan CJ, Li H, Guo DG, Li WX (2010).Understanding 

molecular mechanisms for improvingphytoremediation of heavy 

metal-contaminated soils. Crit. Rev. Biotechnol. 30: 23-30. 

Tadlock C, Geoffrey SB (2010). Agricultural Biotechnology: Background 

and Recent Issues. Congressional Research Service. 

Wang YB, Wu PT, Zhao XN, Li JL, Lv L, Shao HB (2010). The 

Optimization for Crop Planning and Some Advances forWater-Saving 

Crop Planning in the Semiarid Loess Plateauof China. J. Agron. Crop 

Sci. 1: 55-65. 

Wu PT (2010a). Strategic considerations for Chinese agricultural 

waterand food safety: Issues, challenges and suggestions. Afr. J. 

Biotechnol. 33: 5251-5261. 

Wu PT (2010b). The modern water-saving agricultural 

technology:Progress and focus. Afr. J. Biotechnol. 37: 6017-6026. 

Wu Y, Liu C (2010). US strategic layout of agricultural products 

enteredShenyang.China Daily. 

Yin JX, Li RG (2010). Three steps to promotebiotechnology industry in 

South Korea. Science Times. 

Zhang ZB (2006). Research and development on dryland and high 

water use efficiency agriculture in China. Science Press, Beijing. 

Zhang ZB (2010). Safety straegy of bio-water-saving.In the book: 

Outlines of water science. Edited by Tan JW ,etal, SciencePress, 

Beijing, 10: 921-929. 

Zhang ZB, Duan ZY (2009).Where is the way for increasing the ablity of 

grain security in China. Bull. Chinese Acad. Sci. 6: 610-616. 

Zhang ZB, Duan ZY (2010). Water and food security and Modern 

Agricultural Development in China. Science Press, Beijing. 


Zhang ZB, Duan ZY, Chen ZB, Xu P, Li GQ (2010). Food Security of 

China: The Past, Present and Future. Plant Omics, 3(6): 183-189. 

Zhang ZB, Shao HB, XuP, Chu LY, Lu ZHa, Tian JY (2007). On 

evolution and perspectives of bio-watersaving, Colloids Surfaces B: 

Biointerfaces, 55(1): 1-9. 

Zhang ZB, ShaoHB, Xu P, Hu MY, Song WY, Hu XJ (2009). Focus on 

Agricultural Biotechnology: Outlook and Applications of Biological 

Water-saving Theories and Practices in the Semi-arid and Arid Areas. 

Afr. J. Biotechnol., 8(12): 2779-2789. 

Zhang ZB, Wang DS (2010). Suggestion for speeding up the 

construction of technical stands systerm of green agriculture and 

green food in China. Bull. Chinese Acad. Sci. 3: 288-297. 

Zhang ZB, Wang DS, Chen ZB, Sun CF, Xu P (2011). Three big jumps 

from red revolution to black revolution then to green revolution in 

China in one hundredyears. Chin. J. Eco-Agriculture, (19)1: 187-192. 

Zhang ZB, Xu P (2007). Discussion on developing bioenergy. China 

Energy, 8: 13-16. 

Zhang ZB, Xu P (2007). Governance of Water and Food Security in 

China-with reference to farming in Northwest areas.In the book: Food 

and Water Security. Edited by: U. Aswathanarayana, Publishers: 

Taylor & Francis (U.K.), Nov 1, pp. 243-254. 

Zhang ZB, Xu P (2008). Water and food security in China. Chinese 

Journal of Eco-Agriculture, 16(5): 1305-1310. 

Zhang ZB, Xu P, Shao HB, Liu MJ, Fu ZY (2010). Advances and 

prospects: Biotechnologically improving cropwater use efficiency. Crit. 

Rev. Biotechnol. 10.3109/07388551.2010.531004 Published online.



DOI: 10.5897/AJB11.410 


Review 

Food processing optimization using evolutionary 

algorithms 

Abimbola M Enitan 1 * and Josiah Adeyemo 2 

1 Department of Biotechnology and Food Technology, Durban University of Technology, P.O Box 1334, 

Durban, 4000, South Africa. 

2 Department of Civil Engineering and Surveying, Durban University of Technology, 

P.O Box 1334, Durban, 4000, South Africa. 

Accepted 12 October, 2011 

Evolutionary algorithms are widely used in single and multi-objective optimization. They are easy to use 

and provide solution(s) in one simulation run. They are used in food processing industries for decision 

making. Food processing presents constrained and unconstrained optimization problems. This paper 

reviews the development of evolutionary algorithm techniques as used in the food processing 

industries. Some evolutionary algorithms like genetic algorithm, differential evolution, artificial neural 

networks and fuzzy logic were studied with reference to their applications in food processing. Several 

processes involved in food processing which include thermal processing, food quality, process design, 

drying, fermentation and hydrogenation processes are discussed with reference to evolutionary 

optimization techniques. We compared the performances of different types of evolutionary algorithm 

techniques and suggested further areas of application of the techniques in food processing 

optimization. 

Key words: Evolutionary algorithms, optimization, food processing, multi-objective, constrained and 

unconstrained. 

INTRODUCTION 

Evolutionary algorithms (EAs) are computational-based 

biological-inspired optimization algorithms. They are 

stochastic searching methods, commonly used for 

solving non-differentiable, non-continuous and multimodal 

optimization problems based on Darwin’s natural 

selection principle. They imitate the process of natural 

evolution and are becoming important optimization tools 

for finding the global optimum solutions in several real 

world applications. EAs operate on a population of 

potential solutions, applying the principle of survival of the 

fittest to produce successful and better solution by means 

of evolutionary resembling operations (selection, reproduction 

and mutation), which are applied on individuals in 

a population (Ronen et al., 2002). EAs are widely used 

for single and multi-objective optimization in food 

processing. Modern day food processing involves a lot of 

*Corresponding author. E-mail: enitanabimbola@gmail.com. 

Tel: +27313732895. Fax: +27313732816. 

decision making resulting in many objective functions and 

constraints. EAs can generate Pareto optimal solutions 

for these models. 

Most manufacturing industries are in a continuous effort 

to increase their profits and reduce their production costs 

due to the strong competition that exists among them. 

Food processing as an aspect of biotechnology is 

recently facing remarkable challenges revolving around 

maximizing profit in a dynamic and an uncertain 

environment, while satisfying a variety of constraints such 

as quality of final product, financial, environmental, safety 

and human constraints. In response to such challenges, 

food industries are trying to improve process operations 

by using better technology. Processing optimization 

includes a performance evaluation function, control 

variables, constraints and a mathematical model (Evans, 

1982). 

Capitalizing on newly available technologies, the food 

industries have recently started using sophisticated 

technologies to improve, monitor, optimize and control 

food processing parameters such as moisture content,

temperature, concentration of microorganisms and 

nutrients (Rodríguez-Fernández et al., 2007). These 

techniques use expert knowledge to achieve a superior 

performance. In a situation where problem specific 

technique is not applicable due to unknown system 

parameters, the multiple local minima, or non-differentiable 

evolutionary algorithms (EAs) have the potential 

to overcome these limitations (Price, 1999), by using 

mathematical model based techniques to make decisions 

about optimal production scenarios. In standard practice, 

simulation of multiple future production scenarios using 

numerical model in solving a related optimization problem 

in food processing have been discussed (Boillereaux et 

al., 2003; Mariani et al., 2008). 

Many real-world problems have multiple often competing 

objectives. The optimization of food processing 

operations may not be an easy task due to complexities 

and variations in the raw materials (Vradis and Floros, 

1994). EAs as a class of direct search algorithms have 

proved to be an important tool for difficult search and 

optimization problems and have received increased 

interest during the last decade due to the ease way of 

handling multiple objective problems. A constrained 

optimization problem or an unconstrained multi-objective 

problem may in principle be two different ways to pose 

the same underlying problem and can be solved by EAs 

(Karaboga, 2004; Saputelli et al., 2004). EAs are of 

interest to finding solution to real world problems because 

they are proving robust in delivering global optimal 

solutions which help in resolving limitations encountered 

in traditional methods. Among the optimization techniques 

that have been applied to solving complex 

problems, which includes; linear programming (LP), nonlinear 

programme (NLP), dynamic programming (DP), 

stochastic dynamic programming (SPD) and heuristic 

programming such as genetic algorithm (GA), differential 

evolution (DE), shuffled complex evolution, fuzzy logic 

(FL), simulated annealing (SA), ant colony optimization 

(ACO), particle swarm optimization(PSO) and artificial 

neural networks (ANNs) (Sarker and Ray, 2009; 

Adeyemo, 2011; Matijasevic et al., 2010; Kennedy and 

Eberhart, 1995). 

DESCRIPTION OF SOME EVOLUTIONARY 

ALGORITHMS 

GAs are evolutionary search and optimization algorithms 

based on the mechanics of natural genetics and natural 

selection. They mimic natural evolution to making a 

search process in which solution is encoded as a string of 

binary digits. However, new GAs that use real numbers 

for encoding are now common. Genetic operators, such 

as selection, mutation and crossover are used to 

generate new solutions until a stopping criterion is 

satisfied (Babu and Munawar, 2007; Mohebbi et al., 

2008). GA has been successfully used in science and 

Enitan and Adeyemo 16121 

engineering application to reach near-optimum solutions 

to a variety of problems (Gen and Cheng, 1996) since its 

introduction by Holland (1975). GA requires long process- 

sing time for a near-optimum solution to evolve. 

In an attempt to reduce the processing time and 

improve the quality of solutions, differential evolution (DE) 

was introduced by Storn and Price (Storn and Price, 

1995). DE is a population based algorithm like genetic 

algorithm using similar operators; crossover, mutation 

and selection for optimization problems. Unlike conventional 

GA that uses a binary coding for representing 

problem parameters, DE algorithm represents each 

variable in the chromosome by a real number. The 

principal difference between GA and DE is that GA relies 

on crossover, a mechanism of probabilistic and useful 

exchange of information among solutions to locate better 

solutions, while evolutionary strategies use mutation as 

the primary search mechanism (Godfrey and Babu, 

2004). DE selection process and its mutation scheme 

make DE self-adaptive. DE uses non-uniform crossover 

and tournament selection operators to create new 

solution strings. All solutions in DE have the same 

chance of being selected as parents without dependence 

on their fitness value. DE employs a greedy selection 

process (Karaboga, 2004). Some advantages of DE 

include its robustness, simple structure, ease of use, 

speed, quite selective in nonlinear constraint optimization 

including penalty functions, easily adaptable for integer 

and discrete optimization, and usefulness in optimizing 

multi-modal search spaces (Abbass et al., 2001; Strens 

and Moore, 2002). DE algorithm is a stochastic 

optimization method, which minimizes an objective 

function that can model the problem's objectives while 

incorporating constraints. It can be used for optimizing 

functions with real variables and many local optima 

(Pierreval et al., 2003). The performance of DE algorithm 

to that of some other well-known versions of genetic 

algorithm was compared and the simulation results 

showed that the convergence speed of DE is significantly 

better than genetic algorithms (Abbass et al., 2001; 

Strens and Moore, 2002; Karaboga, 2004). 

An artificial neural network (ANN) is a collection of 

interconnecting computational elements which simulates 

like neurons in biological systems. ANNs allow researchers 

to build mathematical models of neurons and 

mimic neural behaviour of complex real systems in a 

relatively simple manner. ANNs are trained in an efficient 

way and a model is developed to deal with the system’s 

intrinsic nonlinearities. It has the ability of relating the 

input and output parameters without any prior knowledge 

of the relationship between them (Chen and 

Ramaswamy, 2002; Goni et al., 2008). ANNs may be 

used to estimate or predict process behaviour without the 

need of a mathematical model, or a prediction equation 

associated to the physical problem (Ramesh et al., 1996). 

The complexity of the problem determines the number of 

neurons in a model. ANNs are widely used in pattern


recognition and pattern classification, diagnosis and 

control as well as function approximation and optimization 

(Bose and Liang, 1996). 

The introduction of fuzzy set theory by Zadeh (1975) to 

deal with problems in which a source of vagueness is 

involved has been reported. Fuzzy modeling is a powerful 

method, taking advantages of both scientific and heuristic 

modelling approaches. Fuzzy modelling utilizes the past 

data and expert knowledge convincingly than conventional 

methods. Fuzzy logic (FL) mimics human control 

logic. It can be built into anything from small, hand-held 

products to large computerized process control systems. 

It uses an imprecise but very descriptive language as a 

human operator to deal with input data (Huang et al., 

2010). Although, the ability of fuzzy systems to solve 

different problems with various applications has been 

established, and an increasing interest in augmenting 

them with learning capabilities by soft-computing 

methods such as genetic fuzzy systems is developing 

(Liao et al., 2001). 

APPLICATION OF EVOLUTIONARY ALGORITHMS IN 

FOOD PROCESSING 

A good food processing model will combine the laws of 

heat, mass and momentum transfer with prediction 

equations for the physical properties of food, quality and 

safety kinetic models to reflect how the relevant state 

variables change with time and position when the food 

load is subjected to different processing conditions 

(Tijskens et al., 2001; Wang and Sun, 2003). Moreover, 

shortage and surplus of goods can lead to loss of income 

for many companies due to the short shelf-life of their 

products. Therefore, optimization techniques are necessary 

in food processing to incorporate the economic 

values for the processing and marketing of food. 

There is a need to maintain high product quality 

considering the uncertainties and fluctuations in 

consumer demands. This made food companies to be 

more concerned in improving very important parts of food 

processing operations. For example, an improved 

technique for drying, wetting, heating, cooling and 

freezing of foods are necessary (Doganis et al., 2006). 

Hence, model-based optimization is of extreme importance 

in modern food processing. Computer aidedengineering 

have significantly helped during the last 

decades in optimal control problems of food processing. 

Thermal processing function is an important food 

preservation method to inactivate bacterial spores of 

public health significance as well as food spoilage 

microorganisms in sealed containers of food, using heat 

treatments at temperatures well above the ambient 

boiling point of water in pressurized steam retorts 

(autoclaves) that are not detrimental to food quality and 

underutilize plant capacity (Simpson et al., 2003; 

Holdsworth and Simpson, 2007; Abakarov et al., 2009). 

The ability of GA to solve multi-objective problems 

makes them valuable tools for application in food 

processing systems. The various applications of GAs are 

computer-aided molecular design (Shunmugam et al., 

2000), optimal design of xylitol synthesis reactor (Baishan 

et al., 2003), on-line optimization of culture temperature 

for yeast fermentation (Yüzgeç et al., 2009), optimization 

of ethanol production (Rivera et al., 2006; Guo et al., 

2010) synthesis and optimization of non-ideal distillation 

system (Fraga and Senos, 1996) and estimation of heat 

transfer parameters in trickle bed reactors (González- 

Sáiz et al., 2008). Some other applications of genetic 

algorithm include determining the thermal deterioration of 

vitamin C in bioproduct processing such as 

concentration, drying and sterilization, semi-real-time 

optimization and control of fed-batch fermentation system 

(Koc et al., 1999; Maria et al., 2000; Zuo and Wu, 2000). 

Optimization of process variables using genetic 

algorithm during single screw extrusion cooking of a fish 

and rice flour blend was investigated by Shankar and 

Bandyopadhyay (2004). The objective was to optimize 

the process variables for each and all extrudate 

properties during cooking of a fish and rice flour blend. 

Second-degree regression equations were developed by 

response surfaces methodology (RSM) for screw speed, 

expansion ratio, water solubility index, bulk density, 

hardness, barrel temperature, feed moisture content and 

fish content as process variables, and optimized using 

genetic algorithm. The results showed that under 

individual optimum process conditions, minimum bulk 

density and maximum water solubility index required high 

fish content of 41 to 45% and medium moisture content 

of about 40%, respectively and maximum expansion ratio 

and minimum hardness required a low fish content of 5% 

and feed moisture contents of 60 and 40%, respectively. 

Under common optimum process conditions, all four 

extrudate properties were optimized at a high fish content 

of 41 to 45% and medium moisture content of 40%. The 

study concluded that the common optimum process 

conditions predicted the properties of the end product 

more closely than the individual optimum conditions 

determined for each extrudate property. 

The efficiency of a nonlinear predictive control genetic 

algorithm was developed by Yuzgec et al. (2006) to 

determine the optimal drying profile for a biomass drying 

process by using a model of a batch fluidized bed drying 

process of the baker’s yeast that had been developed by 

Yüzgeç et al. (2004). The objective of this work was to 

develop a control procedure for a nonlinear drying 

process in order to increase the quality of product at the 

end of the process, decrease the energy consumption 

during drying and reduce the cost of the process. The 

simulation results showed that the performance of the 

drying process is an important factor in the food industry 

to enhance the manufacturing quality and decrease the 

energy consumption. The drying time and sometimes, the 

cost of the process can be reduced. Similar works that

incorporate genetic algorithm-based optimization for the 

predictive control have been reported in the literature 

(Quirijns et al., 2000; Na et al., 2002; Potocnik and 

Grabec, 2002; Haber et al., 2004). Mankar et al. (2002) 

studied an on-line optimization control of bulk 

polymerization of methyl methacrylate using GA to 

compute temperature in real time for a period of 2 min. 

Artificial neural networks (ANNs) and genetic algorithm 

(GA) mimic different aspects of biological information 

processing for data modelling and media optimization. 

The evaluation of ANN supported GA for optimization 

problems in food science, environmental biotechnology, 

and bioprocess engineering have been well established 

(Baishan et al., 2003). ANN–GA based approach was 

used for simultaneous maximization of biomass and 

conversion of pentafluoroacetophenon with 

Synechococcus PCC 7942 (Franco-Lara et al., 2006) and 

optimization of fermentation medium for the production of 

xylitol from Candida mogii (Baishan et al., 2003; Desai et 

al., 2006). A hybrid methodology comprising the Plackett- 

Burman (PB) design method, ANN based modelling and 

GA was developed to enhance the optimization of media 

and inoculums volume for the exopolysaccharides 

production by Lactobacillus plantarum isolated from the 

fermented Eleusine coracan. PB was used to identify the 

most three influential media components. ANN was 

generated for approximating the non-linear relationship 

between the fermentation operating variables and the 

yield. Then the input parameters of ANN model was 

optimized using the GA based process optimization to 

obtain the maximum exopolysaccharides yield in the 

batch fermentation (Desai et al., 2006). The optimization 

of hydantoinase production from Agrobacterium 

radiobacter, production of lipase from a mixed culture and 

glucansucrase production from Leuconostoc dextranicum 

NRRL B-1146 by ANN–GA model using RSM based 

data was carried out by Nagata and Chu (2003), Haider 

et al. (2008) and Singh et al. (2008) respectively. 

Optimization results as shown in the literature, review the 

effectiveness of using hybrid algorithms. 

Kovarova-Kovar et al. (2000) studied the optimization 

of fed-batch process for the riboflavin production. Later, 

thermal inactivation of glucoamylase and optimization of 

catalytic reaction of pancreas lipase was studied by 

Bryjak et al. (2004), Manohar and Divakar (2005), 

respectively. Chen and Ramaswamy (2002) developed 

an algorithm that combines the mathematical model with 

the optimization of variable retort temperature thermal 

processing for conduction-heated foods using ANNs-GA 

hybrid. A year later, Morimoto et al. (2003) presented the 

dynamic optimization of a heat treatment for minimizing 

water losses in tomatoes during storage. An artificial 

neural network and genetic algorithm were used to 

determine the optimal processing conditions for spraydried 

whole milk powder processing by Koc et al. (2007). 

The researchers developed a general regression neural 

network model to predict the responses of lactose 


crystallinity and free fat content from the processor screw 

speed, process temperature, milk powder feed rate and 

lecithin addition rate during the evaluation of fitness 

function of a genetic algorithm optimization using 

response surfaces experimental design methodology. 

The genetic algorithm was used to determine both the 

individual and common optimal operating conditions for 

the whole milk powder process. It was demonstrated that 

the optimal conditions for spray-dried whole milk powder 

processing variables to produce maximum free fat 

content, maximum lactose crystallinity and minimum 

average particle size by using genetic algorithms and 

neural networks are obtainable. Izadifar and Jahromi 

(2007) used the experimental data set from a vegetable 

oil pilot plant reactor to develop a neural network model 

for a vegetable oil hydrogenation process. The neural 

network was used as a predictor to evaluate a 

combination of reaction conditions during the genetic 

algorithm optimization for the minimum isomer and 

maximum cis-oleic acid. The same year, Erenturk and 

Erenturk (2007) studied the drying kinetics of carrot using 

genetic algorithm and ANNs hybridization. 

Applications of ANNs in food process modelling, control 

and quality evaluation of food products have been 

surfacing since 1990. Artificial neural networks have been 

applied in the twin-screw extrusion cooker control (Linko 

et al., 1992), prediction of dough rheological properties 

(Ruan et al., 1997) and meat quality prediction (Yan et 

al., 1998). More recently, ANNs have been receiving 

greater attention in drying technologies (Kaminski et al., 

1998; Sreekanth et al., 1998; Chen et al., 2000), 

fermentation (Aires-De-Sousa, 1996), food rheology 

(Ruan et al., 1995) and thermal processing (Sablani et 

al., 1997a, b). Other applications of ANNs in food 

processing report include baking (Cho and Kim, 1998) 

and post harvesting (Morimoto et al., 1997a, b), 

Boillereaux et al. (2003) determine the thermal 

properties of the gelatin gel during thawing using artificial 

neural networks. Mittal and Zhang (2000) developed a 

feed forward neural network to predict the freezing and 

thawing time of food products with simple regular shapes. 

In a similar study by Goni et al. (2008), they optimized the 

trial and error definition of the net parameters. The 

objective of their work was to develop and to validate 

three neural networks techniques; one for the prediction 

of freezing times, another one for the prediction of 

thawing times and a third one for both freezing and 

thawing times of foods of any shape and composition 

based exclusively on reported experimental data. The 

results showed that the developed ANNs were efficient 

for the estimation of freezing and thawing times of foods 

of all types, shapes, sizes and compositions and the 

developed genetic algorithm was also useful for 

improving the generalization ability of the neural 

networks. 

Rodríguez-Fernández et al. (2007) proposed an 

integrated two-step identification model for air-drying of


food. Structural identifiability analysis for model methods 

was carried out to improve the efficiency and robustness 

of model parameters. Drying of tomato using artificial 

neural network modelling was presented by 

Movagharnejad and Nikzad (2007). It was reported that 

the ANN model describes the drying behaviour of tomato 

more accurately than empirical correlations. 

Considerable work on the variable retort tempera-tures 

(VRT) to improve the quality of canned food and 

significantly reduce processing times in comparison to 

traditional constant retort temperature (CRT) processing 

has been reported in the literature (Teixeira et al., 1969, 

1975; Babu and Chaurasia, 2003; Banga et al., 2003). 

Chen and Ramaswamy (2002) searched the optimal 

variable retort temperature (VRT) thermal processing 

using coupled neural networks and genetic algorithm 

model for heated foods to identify optimal processing 

conditions that will reduce surface cook value and the 

process time to maximize the final nutrient retention of a 

conduction-heated canned food. 

Olmos et al. (2002) studied the compromise between 

the final product quality and total process drying time of 

rice. Erdogdu and Balaban (2003) studied the 

optimization of thermal processing of canned foods using 

several objective functions. On the other hand, very little 

attempts have been made to solve the multi-objective 

optimization problem of nutrient destruction by the action 

of heat during the thermal sterilization of foods, although 

it is generally accepted that microbiological safety must 

be the primary objective but foods are sometimes overprocessed 

especially canned foods (Fryer and Robbins, 

2005). To this effect, Sendín et al. (2006) and (2010) 

recently proposed and successfully applied novel multicriteria 

optimization method to the thermal processing of 

foods, where the minimization of total process time and 

the maximization of the retention of several nutrients and 

quality factors were simultaneous considered. The new 

strategy has proved to be efficient and robust when 

applied to the non-linear dynamic model considered. 

Ainscough and Aronson (1999) compared ANNs to linear 

regression for studying the same effects on yogurt. ANNs 

have been applied successfully to problems concerning 

sales of food products (peanut butter and ketchup), such 

as predicting the impact of promotional activities and 

consumer choice on the sales volumes at retail store 

(Doganis et al., 2006). They were found to perform better 

than linear models. 

Since the development of differential evolution (DE) 

algorithm, it has been successfully applied to solve 

several optimization problems of chemical and biological 

processes (Chiou and Wang, 2001; Lu and Wang, 2001; 

Cheng and Wang, 2004; Liu and Wang, 2010). Other 

applications include; the fuzzy-decision making problems 

of fuel ethanol production (Wang et al., 1998), 

fermentation process (Chiou and Wang, 1999; Wang and 

Cheng 2001), other engineering applications by Babu 

and Angira, 2002; Babu and Jehan, 2003; Babu, 2004, 

2007; Angira and Babu, 2006). These studies concluded 

that DE takes less computational time to converge 

compared to the existing techniques without 

compromising the accuracy of the parameters being 

estimated. 

Sarimveis and Bafas (2003) proposed fuzzy model 

predictive control of non-linear processes using GA. 

Peroni et al. (2005) improved the simulation-based 

approximate dynamic programming method for optimal 

control of a fed-batch process and the optimal feed rate 

profile under varying initial conditions by a simulatedbased 

control strategy. A recurrent neurofuzzy network 

based modeling and optimal control for a fed-batch 

process was presented by Zhang (2005). Perrot et al. 

(1998) combined fuzzy and genetic methods for optimal 

control of the microfiltration of sugar products. In this 

study, validation of the controller was carried out through 

simulation using a neural network model of the process 

and parameters of fuzzy controller were optimized off-line 

by GA. Petermeier et al. (2002) proposed a hybrid 

structure for modeling of the fouling process in a tubular 

heat exchanger for the dairy industry based on a 

combination of expert knowledge and parameterized 

equations in a fuzzy model. The ability of a fuzzy 

inference system to modeling and simulation of the cross 

ultra-filtration process of milk and to predict permeate flux 

and total hydraulic resistance under different hydrodynamics 

parameters and operating time was studied by 

Sargolzaei et al. (2008). 

The optimization of multiproduct batch plants design 

problem for protein production using fuzzy multiobjective 

algorithm concepts was carried out by Dietz et al. (2008). 

The developed model provided a set of scenarios that 

constituted a very promising framework for taking 

imprecision into account in new product development 

stage and in making decision. Kiranoudis and Markatos 

(2000) considered the multi-objective design of food 

dryers using a static mathematical model. The authors 

minimized simultaneously an economic measure and the 

colour deviation of the final product. A similar work was 

presented by Koc et al. (1999). Fuzzy logic was used in 

the real–time control of a spray–drying of whole milk 

powder processing. The objective was to increase the 

free fat content of the whole milk product and consistent 

colour. The algorithm used controlled the process at the 

desired power consumption and provided whole milk 

products with the desired colour values within 3.0 unit 

deviations. Also, the free fat content was over 95%, and 

lactose was in crystalline form in the final dry milk 

product. 

CONCLUSION 

This paper reviews the computational-based optimization 

technique algorithms that are becoming promising global 

optimization tools for major real world applications in

finding global optimum solutions to food technology 

problems. New hybrid optimizers have been successfully 

developed to solve various constrained and unconstrained 

multi-objective optimization problems for modern food 

processing optimization. The paper reviewed some of the 

successful applications of optimization algorithms in the 

food processing industry. The successful applications of 

EAs suggested that EAs will have increasing and 

encouraging impact for solving real world problems in the 

manufacturing industry in the future. Therefore, to 

increase the ability of EAs for solving food processing 

problems, further research interest to exploit the 

abundant expert knowledge and deal with high dimensionality 

common to real world problems are needed. 

The final quality and marketing of food products 

depend on their thermal treatment history. Due to this 

fact, application of new techniques for food treatment 

processes especially for the optimal treatment policies for 

the control of food products and processes regarding 

microbiological safety and final quality of food is very 

important. Therefore, fundamental research on the 

design, modelling, simulation and evaluation of different 

thermal food process scenarios and heating strategies is 

crucial. Recent interests are directed towards the 

simultaneous estimation of the thermal conductivity and 

heat capacity by means of single or dual heat probe 

methods to measure the temperature response in the 

food products. 

REFERENCES 

Abakarov A, Sushkov Y, Almonacid S, Simpson R (2009). Thermal 

processing optimization through a modified adaptive random search. 

J. Food Eng. 93(2): 200-209. 

Abbass HA, Sarker R, Newton C (2001). PDE: A pareto-frontier 

differential evolution approach for multi-objective optimization 

problems. Proceedings. In Proc. congress on Evolutionary 

Computation. Pp. 971-978. 

Adeyemo JA (2011). Reservoir Operation using Multi-objective 

Evolutionary Algorithms- A Review. Asian J. Sci. Res. (1): 16-27. 

Ainscough TL, Aronson JE (1999). An empirical investigation and 

comparison of neural networks and regression for scanner data 

analysis. J. Retail. Consumer Services, 6(4): 205-217. 

Aires-De-Sousa J (1996). Verifying wine origin: A neural network 

approach." American J. Ecol. Viticulture, 47(4): 410-414. 

Angira R, Babu BV (2006). Optimization of process synthesis and 

design problems: A modified differential evolution approach. Chem. 

Eng. Sci. 61: 4707-4721. 

Babu BV (2004). Process Plant Simulation. Oxford University Press, 

New Delhi, India 

Babu BV (2007). Improved differential evolution for single- and 

multiobjective optimization: MDE, MODE, NSDE, and MNSDE. In: 

Deb K, Chakroborty P, Iyengar, NGR, Gupta SK (Eds.). Advances in 

Computational Optimization and its Applications. Universities Press, 

Hyderabad, pp. 24-30. 

Babu BV Angira R (2002). A differential evolution approach for global 

optimization of MINLP problems. In: Proceedings of Fourth Asia- 

Pacific Conference on Simulated Evolution and Learning (SEAL’02), 

November 18–22, 2002, Singapore, 1033(2): 880-884. 

Babu BV, Chaurasia AS (2003). "Optimization of pyrolysis of biomass 

using differential evolution approach." In: Proceeding of fourth Asia- 

Pacific conference on computational intelligence. Robotics and 

autonomous systems (CIRAS). Singapore. December, pp. 15-18. 


Babu BV, Jehan MML (2003). "Differential evolution for multiobjective 

optimization." In: Proceedings of 2003 Congress on Evolutionary 

Computation (CEC-2003), December 8-12, 2003, Canberra, 

Australia. pp. 2696-2703. 

Babu BV, Munawar SA (2007). "Differential evolution strategies for 

optimal design of shell-and-tube heat exchangers." Chem. Eng. Sci. 

62: 3720-3739. 

Baishan F, Hongwen C, Xiaolan X, Ning W, Zongding H (2003). Using 

genetic algorithms coupling neural networks in a study of xylitol 

production: medium optimisation. Process Biochem. 38(7): 979-985. 

Banga JR, Balsa-Canto E, Moles CG, Alonso AA (2003). Improving 

food processing using modern optimization methods. Trends in Food 

Sci. Technol. 14(4): 131-144. 

Boillereaux L, Cadet D, Le Bail A (2003). Thermal properties estimation 

during thawing via real-time neural network learning. J. Food Eng. 

57(1): 17-23. 

Bose NK, Liang P (1996). Neural Network Fundamentals with Graphs. 

Algorithms and Applications. McGraw-Hill series in electrical and 

computer engineering, NY, USA. 

Bryjak J, Ciesielski K, Zbicinski I (2004). Modelling of glucoamylase 

thermal inactivation in the presence of starch by artificial neural 

network. J. Biotechnol. 114: 117-185. 

Chen CR, Ramaswamy HS (2002). Modeling and optimization of 

variable retort temperature (VRT) thermal processing using coupled 

neural networks and genetic algorithms. J. Food Eng. 53(3): 209-220. 

Chen CR, Ramaswamy HS, Alli I (2000). Neural network based 

optimization of quality of osmo-convective dried blue berries. In 

FOOD SIM’ 2000, First International Conference on Simulation in 

Food and Bio Industries: pp. 33-35. 

Cheng HC, Wang FS (2004). Parameter Estimation of Differential- 

Algebraic Systems Using Accessible Measurement. J. Chem. Eng. 

Jpn., 37: 1390. 

Chiou JP, Wang FS (1999). Hybrid method of evolutionary algorithms 

for static and dynamic optimization problems with application to a fedbatch 

fermentation process. Computers Chem. Eng. 23(9): 1277- 

1291. 

Chiou JP, Wang FS (2001). ‘Estimation of Monod Parameters by Hybrid 

Differential Evolution. Bioprocess Biosyst. Eng. 24: 109. 

Cho SI, Kim SC (1998). Neural network modeling and fuzzy control of 

baking process. ASAE paper: 3548-3561. St. Joseph, MI: ASAE. 

Desai KM, Akolkar SK, Badhe YP, Tambe SS, Lele SS (2006). 

Optimization of fermentation media for exopolysaccharide production 

from Lactobacillus plantarum using artificial intelligence-based 

techniques. Process Biochem. 41(8): 1842-1848. 

Dietz A, Aguilar-Lasserre A, Azzaro-Pantel C, Pibouleau L, Domenech 

S (2008). A fuzzy multiobjective algorithm for multiproduct batch 

plant: Application to protein production. Computers Chem. Eng. 32(1- 

2): 292-306. 

Doganis P, Alexandridis A, Patrinos P, Sarimveis H (2006). Time series 

sales forecasting for short shelf-life food products based on artificial 

neural networks and evolutionary computing. J. Food Eng. 75(2): 

196-204. 

Erdogdu F, Balaban MO (2003). Complex method for nonlinear 

constrained multicriteria (multi-objective function) optimization of 

thermal processing. J. Food Process Eng. 26: 357-375. 

Erenturk S, Erenturk K (2007). Comparison of genetic algorithm and 

neural network approaches for the drying process of carrot. J. Food 

Eng. 78: 905–912. 

Evans LB (1982). Optimization theory and its application in food 

processing. Food Technol. 6: 88-93. 

Fraga ES, Senos MTR (1996). Synthesis and optimization of a nonideal 

distillation system using a parallel genetic algorithm. Computers 

Chem. Eng. 20: 79-84. 

Franco-Lara E, Link H, Weuster-Botz D (2006). Evaluation of artificial 

neural networks for modeling and optimization of medium 

composition with a genetic algorithm. Process Biochem. 41: 2200- 

2206. 

Fryer P, Robbins P (2005). Heat transfer in food processing: ensuring 

product quality and safety. Appl. Thermal Eng., 25: 2499-2510. 

Gen M, Cheng R (1996). Genetic Algorithms and Engineering Design. 

Wiley, New York. 

Godfrey CO, Babu BV (2004). New Optimization Techniques in


Engineering, Springer-Verlag, Heidelberg, Germany. 

Goni SM, Oddone S, Segura JA, Mascheroni RH, Salvadori VO (2008). 

Prediction of foods freezing and thawing times: Artificial neural 

networks and genetic algorithm approach. J. Food Eng. 84(1): 164- 

178. 

González-Sáiz, JM, Pizarro C, Garrido-Vidal D (2008). Modelling gasliquid 

and liquid-gas transfers in vinegar production by genetic 

algorithms. J. Food Eng. 87(1): 136-147. 

Guo Y, Xu J, Zhang Y, Xu H, Yuan Z, Li D (2010). Medium optimization 

for ethanol production with Clostridium autoethanogenum with carbon 

monoxide as sole carbon source. Bioresour. Technol. 101(22): 8784- 

8789. 

Haber R, Schmitz U, Bars R (2004). Optimal choice of horizons for 

predictive control by using genetic algorithms. Chin. J. Comput. Phys. 

28: 53-58. 

Haider MA, Pakshirajan K, Singh A, Chaudhry S (2008). Artificial neural 

network and genetic algorithm approach to optimize media 

constituents for enhancing lipase production by a soil microorganism. 

Appl. Biochem. Biotechnol. 144: 225–235. 

Holdsworth SD, Simpson R (2007). Thermal processing of packaged 

foods. 2nd edition. Springer, New York, USA: 412. 

Holland JH (1975). Adaptation in Natural and Artificial Systems. 

University of Michigan Press, Ann Arbe, MI. 

Huang Y, Lan Y, Thomson SJ,Fang A, Hoffmann WC, Lacey RE (2010). 

Development of soft computing and applications in agricultural and 

biological engineering. Computers and Electronics Agric. 71(2): 107- 

127. 

Izadifar M, Jahromi MZ (2007). Application of genetic algorithm for 

optimization of vegetable oil hydrogenation process. J. Food Eng. 

78(1): 1-8. 

Kaminski WP, Strumillo P, Romczak E (1998). Neurocomputing 

approaches to modeling of drying process dynamics. Drying Technol. 

16(6): 967-992. 

Karaboga D (2004). A Simple and Global Optimization Algorithm for 

Engineering Problems: Differential Evolution Algorithm. Turk. J. Elec. 

Eng. 12(1): 53-60. 

Kennedy J, Eberhart RC (1995). Particle swarm optimization. Proc. 

1995 IEEE Int. Conf. on Neural Networks (Perth, Australia) pp. 1942- 

1948. 

Kiranoudis CT, Markatos NC (2000). Pareto design of conveyor-belt 

dryers. J. Food Eng. 46: 145-155. 

Koc AB, Heinemann PH, Ziegler GR (1999). Determining the optimal 

conditions for spray dried whole milk powder process using genetic 

algorithms with neural networks, in An ASAE Meeting Presentation, 

July 18–21 paper no. 993133. 

Koc AB, Heinemann PH, Ziegler GR (2007). Optimization of Whole Milk 

Powder Processing Variables with Neural Networks and Genetic 

Algorithms. Food Bioproducts Processing, 85(4): 336-343. 

Kovarova-Kovar K, Gehlen S, Kunze A, Keller T, Von Daniken R, Kolb 

M, VanLoon APGM (2000). Application of model-predictive control 

based on artificial neural networks to optimize the fed-batch process 

for riboflavin production. J. Biotechnol. 79: 39-52. 

Liao CT, Tzeng WJ, Wang FS (2001). Mixed-Integer Hybrid Differential 

Evolution for Synthesis of Chemical Processes, J. Chinese Institute 

Chem. Eng. 32: 491. 

Linko P, Uemura K, Eerikainen T (1992). Application of neural network 

models in fuzzy extrusion control. Trans. Chem. Eng. 70(3): 131-137. 

Liu P-K, Wang FS (2010). Hybrid differential evolution including 

geometric mean mutation for optimization of biochemical systems. J. 

Taiwan Institute Chem. Eng. 41: 65-72. 

Lu JC, Wang FS (2001). Optimization of Low Pressure Chemical Vapor 

Deposition Reactors Using Hybrid Differential Evolution, Can. J. 

Chem. Eng. 79: p. 246. 

Mankar RB, Saraf DN, Gupta SK (2002). On-line optimizing control of 

bulk polymerization of methyl methacrylate: Some experimental 

results for heater failure. J. Appl. Polym. Sci. 85: 2350-2360. 

Manohar B, Divakar S (2005). An artificial neural network analysis of 

porcine pancreas lipase catalysed esterification of anthranilic acid 

with methanol. Process Biochem. 40: 3372-3376. 

Maria JN, Dolors MG, Luis P (2000). Parameter estimation with genetic 

algorithm in control fed-batch reactors. Chem. Eng Proc. 41(4): 303- 

309. 

Mariani VC, Barbosa de Lima AG, Coelho LS (2008). Apparent thermal 

diffusivity estimation of the banana during drying using inverse 

method. J. Food Eng. 85(4): 569-579. 

Matijasevic L, Dejanovic I, Spoja D (2010). A water network 

optimization using MATLAB--A case study. Resour. Conserv. 

Recycling, 54(12): 1362-1367. 

Mittal GS, Zhang J (2000). Prediction of freezing time for food products 

using a neural network. Food Res. Int. 33: 557-562. 

Mohebbi M, Barouei J, Akbarzadeh-T MR, Rowhanimanesh AR, Habibi- 

Najafi MB, Yavarmanesh MM (2008). Modeling and optimization of 

viscosity in enzyme-modified cheese by fuzzy logic and genetic 

algorithm. Computers Electronics Agric. 62(2): 260-265. 

Morimoto T, Baerdemaeker JD, Hashimoto Y (1997a). An intelligent 

approach for optimal control of fruit-storage process using neural 

networks and genetic algorithms. Computers Electronics Agric. 18: 

205-224. 

Morimoto T, Purwanto W, Suzuki J, Hashimoto Y (1997b). Optimization 

of heat treatment for fruit during storage using neural networks and 

genetic algorithms. Computers Electronics Agric. 19: 87-101. 

Morimoto T, Tu K, Hashimoto Y (2003). Dynamic optimization using 

neural networks and genetic algorithms for tomato cool storage to 

minimize water loss. Trans. ASAE, 46: 1151-1159. 

Movagharnejad K, Nikzad M (2007). Modeling of tomato drying using 

artificial neural network. Computers Electronics Agric. 59(1-2): 78-85. 

Na JG, Chang YK, Chung BH, Lim HC (2002). Adaptive optimization of 

fed-batch culture of yeast by using genetic algorithms. Bioprocess 

Eng. 24: 299-308 

Nagata Y, Chu KH (2003). Optimization of a fermentation medium using 

neural networks and genetic algorithms. Biotechnol. Lett. 25: 1837- 

1842. 

Olmos A, Trelea IC, Courtois F, Bonazzi C, Trystram G (2002). 

Dynamic optimal control of batch rice drying process. Drying Technol. 

20(7): 1313-1345. 

Peroni CV, Kaisare NS, Lee J(2005). Optimal control of fed-batch 

bioreactor using simulation-based approximate dynamic 

programming. IEEE Trans. Control Syst. Technol. 13(5): 786-90. 

Perrot N, Me L, Trystram G, Trichard JM, Decloux M (1998). Optimal 

control of the microfiltration of sugar product using a controller 

combining fuzzy and genetic approaches. Fuzzy Sets Syst. 94(3): 

309–322. 

Petermeier H, Benningm R, Delgado A, Kulozik U, Hinrichis J, Becker T 

(2002). Hybrid model of the fouling process in tubular heat 

exchangers for the dairy industry. J. Food Eng. 55(1): 9-17. 

Potocnik P, Grabec I (2002). Nonlinear model predictive control of a 

cutting process. Neurocomputing, 43: 107-126. 

Price K (1999). "New Ideas in Optimization." McGraw-Hill Publishing 

Company. pp. 77-106. 

Quirijns EJ, van Willigenburg LG, van Boxtel AJB, van Straten G (2000). 

The significance of modeling spatial distributions of quality in optimal 

control of drying processes. J. A. Benelux Quart. Automatic Control. 

41: 56-64. 

Ramesh MN, Kumar MA, Rao PNS (1996). Application of artificial 

neural networks to investigate the drying of cooked rice. J. Food 

Process Eng. 19: 321–329. 

Rivera EC, Costa AC, Atala DIP, Maugeri F, Maciel MRW, Filho RM 

(2006). Evaluation of optimization techniques for parameter 

estimation: Application to ethanol fermentation considering the effect 

of temperature. Process Biochem. 41(7): 1682-1687. 

Rodriguez Fernandez M, Balsa-Canto, E, Egea JA, Banga JR (2007). 

Identifiability and robust parameter estimation in food process 

modeling: Application to a drying model. J. Food Eng. 83(3): 374-383. 

Ronen M, Shabtai Y, Guterman H (2002). "Optimization of feeding 

profile for a fed-batch bioreactor by an evolutionary algorithm. J. 

Biotechnol. 97: 253–263. 

Ruan R, Almaer S, Zhang J (1995). Prediction of dough rheological 

properties using neural networks. Cereal Chem. 72(3): 308-311. 

Ruan R, Almaer S, Zou C, Chen PL (1997). 1997 Spectrum analyses of 

mixing power curves for neural network prediction of dough 

rheological properties. Trans. ASAE, 40(3): 677-681. 

Sablani SS, Ramaswamy HS, Sreekanth S, Prasher SO (1997a). 

Neural network modeling of heat transfer to liquid particle mixtures in

cans subjected to end-over-end processing. Food Res. Int. 30(2): 105- 

116. 

Sablani SS, Ramaswamy HS, Sreekanth S, Prasher SO (1997b). A 

neural network approach for thermal processing application. J. Food 

Processing Preserv. 19(4): 283-301. 

Saputelli L, Nikolaou M, Economides MJ (2004). Real-Time Reservoir 

Management: A Multi-Scale Adaptive Optimization and Control 

Approach. 

Sargolzaei J, Khoshnoodi M, Seghatoleslami N, Mousavi M (2008). 

Fuzzy inference system to modeling of cross flow milk ultrafiltration. 

Appl. Soft Computing, 8(1): 456-465. 

Sarimveis H, Bafas G (2003). Fuzzy model predictive control of nonlinear 

processes using genetic algorithms. Fuzzy Sets Syst. 139: 59– 

80. 

Sarker R, Ray T (2009). An improved evolutionary algorithm for solving 

multi-objective crop planning models. Comp. Elect. Agric. 68: 191- 

199. 

Sendín J-OH, Otero-Muras I, Alonso AA, Banga JR (2006). Improved 

optimization methods for the multiobjective design of bioprocesses. 

Industrial Eng. Chem. Res. 45: 8594-8603. 

Sendín JOH, Alonso AA, Banga JR (2010). Efficient and robust multiobjective 

optimization of food processing: A novel approach with 

application to thermal sterilization. J. Food Eng. 98(3): 317-324. 

Shankar TJ, Bandyopadhyay S (2004). Optimization of Extrusion 

Process Variables Using a Genetic Algorithm. Food Bioproducts 

Processing, 82(2): 143-150. 

Shunmugam MS, Reddy SVB, Narendran AA (2000). Selection of 

optimal conditions in multi-pass face-milling using a genetic 

algorithm. International J. Machine Tools Manufacture, 40: 401-414. 

Simpson R, Almonacid S, Teixeira A (2003). Optimization criteria for 

batch retort battery design and operation in food canning-plants. J. 

Food Process Eng. 25(6): 515–538. 

Singh A, Majumder A, Goyal A (2008). Artificial intelligence based 

optimization of exocellular glucansucrase production from 

Leuconostoc dextranicum NRRL B-1146. Bioresour. Technol. 99(17): 

8201-8206. 

Sreekanth S, Ramaswamy HS, Sablani S (1998). Prediction of 

psychrometric parameters using neural networks. Drying Technol. 

16(3–5): 825–837. 

Storn R, Price K (1995). Differential evolution: a simple and efficient 

adaptive scheme for global optimization over continuous spaces. 

Technical Report TR-95-012, International Computer Science 

Institute, Berkeley, USA. 

Strens M, Moore A (2002). Policy Search using Paired Comparisons. J. 

Machine Learning Res. 3: 921-950. 

Teixeira AA, Dixon JR, Zahradnik JW, Zinsmeister GE (1969). 

Computer optimization of nutrient retention in thermal processing of 

conduction heated foods. Food Technol. 23(6): 137-142. 


Teixeria AA, Zinsmeister GE, Zahradnik JW (1975). Computer 

simulation of variable retort control and container geometry as a 

possible means of improving thiamine retention in thermallyprocessed 

foods. J. Food Sci. 40(3): 656–659. 

Tijskens LMM, Hertog M, Nicolai BM (2001). Food process modeling. 

Cambridge/Boca Raton: Woodhead Pub. Lim./CRC Press LLC. 

Vradis IG, Floros JD (1994). Genetic algorithms and fuzzy theory for 

optimization and control of food processes. Proceedings of the 8th 

International Flavor Conference, Cos, Greece: pp. 2169-2182. 

Wang FS, Cheng MW (1999). Simultaneous optimization of feeding rate 

and operation parameters for fed-batch fermentation processes. 

Biotechnol. Progress, 15(5): 949-952. 

Wang FS, Su TL, Jang HJ (2001). Hybrid Differential Evolution for 

Problems of Kinetic Parameter Estimation and Dynamic Optimization 

of an Ethanol Fermentation Process. Ind. Eng. Chem. Res. 40: 2876. 

Wang LJ, Sun DW (2003). Recent developments in numerical modelling 

of heating and cooling processes in the food industry–A review. 

Trends in Food Sci. Technol. 14(10): 408-423. 

Yan D, Huang Y, Lacey RE (1998). Assessment of principal component 

neural networks for extraction of electrographic textural features in 

meat attribute prediction, presented at the 1998 ASAE Annual 

International Meeting, Paper No: 983018 ASAE, 2950 Niles Road, St 

Joseph, MI 49085–9659, USA. 

Yuzgec U, Becerikli Y, Turker M (2006). Nonlinear predictive control of 

a drying process using genetic algorithms. ISA Trans. 45(4): 589-602. 

Yüzgeç U, Türker M, Becerikli Y (2004). Modeling of batch fluidized bed 

drying of baker yeast for cylindrical granules. IEEE Conference on 

Mechatronics, ICM 2004, Istanbul, Turkey: pp. 7-12. 

Yüzgeç U, Türker M, Hocalar A (2009). On-line evolutionary 

optimization of an industrial fed-batch yeast fermentation process. 

ISA Trans. 48(1): 79-92. 

Zadeh LA (1975). The concept of a linguistic variable and its application 

to approximate reasoning. Information Sci. 8: p. 199. 

Zhang J (2005). Modeling and optimal control of batch processes using 

recurrent neuro-fuzzy networks. IEEE Trans. Fuzzy Syst. 13(4): 417- 

27. 

Zuo K, Wu WT (2000). Semi-real-time optimization and control of a fedbatch 

fermentation system. Comput Chem. Eng 24(2–7): 1105-1109.



DOI: 10.5897/AJB11.1456 


Full Length Research Paper 

Maize defensin ZmDEF1 is involved in plant response 

to fungal phytopathogens 

Baosheng Wang, Jingjuan Yu, Dengyun Zhu and Qian Zhao* 

State Key Laboratory of Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193, 

P. R. China. 


A seed-specific cDNA Zea mays defensin 1 (ZmDEF1), which encodes a novel plant defensin, was 

isolated from maize (Zea mays L. cv. NongDa108). ZmDEF1 contains a predicted signal peptide of 31 

amino acids at the N-terminus domain and a mature peptide of 49 amino acids with a calculated 

molecular mass of 5.4 kDa. Expression data demonstrated that this gene is expressed specially in 

immature and mature seeds. In contrast to defensins from other plant species, the expression of 

ZmDEF1 cannot be detected in seedlings, even under induction of methyl jasmonate (MeJA) and 

abscisic acid (ABA). The recombinant ZmDEF1 displays an inhibitive activity against the fungal 

pathogen, Phytophthora parasitica var. nicotianae. Ectopic expression of the ZmDEF1 gene under the 

control of the cauliflower mosaic virus (CaMV) 35S promoter conferred enhanced tolerance against P. 

parasitica in transgenic tobacco plants. 

Key words: Antifungal peptides, Phytophthora parasitica, plant defensin, seed specific, transgenic tobacco. 

INTRODUCTION 

Plant defensins are a family of cysteine-rich peptides with 

a specific three-dimensional structure stabilized by four 

intramolecular disulfide bonds (García-Olmedo et al., 

1998; Thomma et al., 2002). These small proteins are 

comprised 45 to 54 amino acids and found in many 

monocotyledonous and dicotyledonous plants (Meyer et 

al., 1996), including wheat (Koike et al., 2002), barley 

(Mendez et al., 1990), spinach (Segura et al., 1998), pea 

(Almeida et al., 2000), radish (Terras et al., 1992) and 

sunflower (Urdangarin et al., 2000). Plant defensins were 

isolated first from seeds (Thomma et al., 2002), but have 

also been identified in other tissues including leaves 

(Kragh et al., 1995), pods (Chiang and Hadwiger, 1991), 

tubers (Moreno et al., 1994), fruit (Aluru et al., 1999), 

roots (Sharma and Lönneborg, 1996), bark (Wisniewski 

et al., 2003) and floral tissues (Gu et al., 1992). Plant 

defensins can be divided into two major classes 

according to the structure of the precursor proteins 

*Corresponding author. E-mail: zhaoqian@cau.edu.cn. Tel: +86- 

10-62733333. Fax: +86-10-62732012. 

Abbreviations: MeJA, Methyl jasmonate; ABA, abscisic acid. 

predicted from cDNA clones (Lay et al., 2003). The 

precursor proteins of Class I are composed of an 

endoplasmic reticulum (ER) signal sequence and a 

mature defensin domain. The Class II defensins are 

having larger precursors with C-terminal prodomains of 

about 33 amino acids. To date, these Class II defensins 

have only been found in solanaceous species (Milligan et 

al., 1995; Brandstadter et al., 1996). 

Most plant defensins exhibit antifungal activity against 

various plant pathogens, especially a broad range of 

fungi (Broekaert et al., 1997; Osborn et al., 1995). It is 

generally accepted that plant defensins act at the level of 

the plasma membrane, similar to many other antimicrobial 

peptides. Radish seed antimicrobial protein 2 (Rs- 

AMP2) was shown to bind to the sphingolipid glucosylceramides 

of fungal membranes, causing inhibition of 

fungal growth by membrane permeabilization (Thevissen 

et al., 1996; Mello et al., 2011). However, the precise 

mechanism of protection for most defensins remains 

unclear. To date, plant defensins have been transformed 

into several plants to enhance resistance to agriculture 

pathogens. Constitutive expression of Medicago sativa 

defensin (alfAFP) in potato clearly enhanced resistance 

of potato plants to the fungus Verticillium dahliae (Gao et 

al., 2000). Transgenic tobacco constitutively expressing

the radish defensin Rs-AFP2 showed a sevenfold 

reduction in lesions of the untransformed plants upon 

infection with the fungal leaf pathogen Alternaria longipes 

(Terras et al., 1995). 

We report here on the isolation and characterization of 

ZmDEF1, which encodes a defensin from Zea mays. The 

recombinant ZmDEF1 protein, expressed in the yeast, 

showed in vitro antifungal activity, and ectopic expression 

of the ZmDEF1 gene in tobacco conferred enhanced 

tolerance against Phytophthora parasitica. These results 

indicate that ZmDEF1 is possibly involved in fungi 

resistance. 

MATERIALS AND METHODS 

Plant materials and fungal strains 

Z. mays L. cv. NongDa108 was provided by Professor Qi-Feng Xu, 

China Agriculture University. Nicotiana tabacum var. Xanthi nc. was 

used for transformation. Fungal strain P. parasitica var. nicotianae 

was provided by Professor Yi Shi, Tobacco Research Institute of 

Chinese Academy Agricultural Sciences. 

Cloning of the ZmDEF1 gene 

RNA was isolated from Z. mays seeds by TRIzol method according 

the instructions (Invitrogen, USA) and treated with DNase I enzyme 

(TaKaRa, Japan). A 50 µL reverse transcription reaction was 

prepared consisting of 2 µg total RNA, 1 × reverse transcription 

buffer, 1 mM oligo dT18 primer, 1 mM dNTP, 2 U RNasin and 2 U M- 

MLV. The reaction was incubated for 60 min at 42°C prior to PCR 

reactions. A sense primer, Def1 [5′-GATGGCKCYGTCTCGWCG- 

3′], and an antisense primer, Def2 [5′- 

ACTAGCAKAYCTTCTTGCAGA-3′] were designed based on 

nucleotide sequence of the Triticum aestivum defensin (GenBank 

accession number AB089942). Def1 and Def2 were used in PCR 

amplification with 1 μL cDNA reaction mixture earlier obtained as 

template. Amplification conditions were: 95°C pre-denaturation for 5 

min, 30 cycles: 95°C for 1 min, 51°C for 1 min and 72°C for 1 min, 

then 10 min at 72°C. The PCR products were recovered from 0.8% 

agarose gel. The purified fragment was cloned into pMD 18-T 

vector (TaKaRa, Japan), named p18T-ZmDEF and the nucleotide 

sequence of the cDNA insert was determined by sequencing 

(Sangon, China). 

Treatments of seedlings with MeJA and ABA 

Maize seeds were preconditioned in sterile distilled water for two 

days in darkness at 28°C and then grown in an artificial climate box 

under a white fluorescent lamp on a 16 h-light/8 h-dark cycle at 

27°C. Maize seedlings with three leaves were sprayed with 100μM 

MeJA (Sigma, USA) or H2O as control. For the ABA treatments, the 

seedlings were placed in flasks filled with distilled water (control) or 

100 μM ABA (Sigma, USA) for 6 h. ABA and MeJA were added as 

stock (100 mM to give a final concentration of 100 μM) in ethanol, 

and an equal amount of ethanol was added to a control sample. 

After treatments, the second fully expanded leaves were picked for 

total RNA extraction and RT-PCR. 

Expression of ZmDEF1 in Pichia pastoris 

The coding sequence of the ZmDEF1 mature peptide was obtained 

by PCR amplification with a forward primer D5 incorporating an 

Wang et al. 16129 

EcoRI site (5′-CGGAATTCATGAGGCACTGCCTGTCGCAGAG-3′) 

and a reverse primer D3 with a NotI site (5′- 

TAGCGGCCGCATCTCAGTGGTGG-3′). The amplified product was 

digested with EcoRI/NotI and ligated into EcoRI and NotI sites of 

the vector pPIC9K (Invitrogen USA). This expression plasmid was 

named pPIC9K-ZmD. The identity of the insert was verified by 

sequencing. The vector pPIC9K-ZmD was linearized with SacI and 

introduced into the P. pastoris strain GS115 according to the 

manufacturer’s instructions (Invitrogen, USA). P. pastoris cells 

containing ZmEDF1 were grown at 30°C for 16 h in 100 ml BMGY 

medium (2% Peptone, 1% yeast extract, 1.34% yeast nitrogen base 

without amino Acids (YNB), 0.5% Biotin, 1% glycerol and 100 mM 

potassium phosphate). The supernatant was removed by 

centrifugation at 10,000 × g for 5 min, and the pellet was resuspended 

in 1000ml BMMY (2% Peptone, 1% yeast extract, 

1.34% YNB, 0.5% Biotin, 0.5% Methanol and 100 mM potassium 

phosphate) medium, followed by shaking at 30°C for 120 h. 

Methanol was added to a final concentration of 0.5% and aliquots 

were collected for ZmDEF1 content analysis every 12 h. 

Tricine-SDS-PAGE and Western blot 

Crude protein was precipitated by adding acetone to a final 

concentration of 20%, then homogenized in 3% SDS, 1.5% 

mercaptoethanol, 30% glycerol, 0.01% coomassie blue G-250, 30 

mM Tris-HCl (pH 7.0), and heated at 100°C for 5 min. Twenty 

microliters of total protein were loaded into each lane and separated 

by tricine sodium dodecyl sulfate polyacrylamide gel electrophoresis. 

The electrophoresis was carried out according to the 

method of Schägger and Von Jagow (1987) and using a Bio-Rad 

Mini Electrophoresis system per the manufacturer’s instructions. 

After electrophoresis, the separated proteins were transferred onto 

nitrocellulose membranes using an Electro Trans-blot apparatus 

(Bio-Rad, USA). The nitrocellulose membranes were blocked for 30 

min in TBS (20 mM Tris-HCl, pH 7.5, 150 mM NaCl) with 5% BSA. 

The blots were incubated for 1 h with mouse anti-His Tag antibody 

in TBS containing 5% BSA, and then subsequently with alkalinephosphatase-conjugated 

goat anti-mouse IgG antibody (Promega, 

USA) for 1 h. The color reaction was performed on the blots using 

nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl 

phosphate (BCIP) in a buffer containing 0.1 M NaHCO3 and 1.0 mM 

MgCl2, pH 9.8. 

Purification of ZmDEF1 

A three day growth culture was harvested by centrifugation at 

14,000 × g for 30 min, the supernatant was collected and protein 

content precipitated by adding ammonium sulfate at a rate of 1 

g/min to 90% of saturation. The individual precipitated fractions 

were collected by centrifugation at 14,000 × g for 30 min and 

dissolved in 10 ml of PBS. The majority of ammonium sulfate was 

removed by dialyzation for 24 h. Purification of the fusion protein, 

tagged with hexa-His at the C-terminus, was carried out following 

the Ni-NTA purification system for proteins tagged with histidines 

(Invitrogen, USA). The fusion proteins were eluted by imidazolecontaining 

buffer and dialyzed against 100 mM phosphate buffer 

(pH 7.5), and then stored at -20°C until used for antifungal activity 

assay. 

In vitro antifungal activity assays 

P. parasitica var. nicotianae was cultured on potato dextrose agar 

(PDA) medium plates at 25°C for 8 days. The pathogen was then 

inoculated into millet medium and placed at 28°C for 20 days and 

the resulting mycelium was rinsed with sterile water and then


Figure 1. Nucleotide and deduced amino acid sequences of ZmDEF1 cDNA. The deduced amino acid sequence is shown below the 

cDNA sequence. The putative signal peptide is underlined. The putative translation initiation and stop codons are in bold. 

filtered with pledget. The spore suspensions were added into unset 

PDA medium and then a 5 mm disc was removed from the plate. 

Solution of the fusion ZmDEF1 was added into the 5 mm hole, with 

PBS used as a negative control. The plates were placed in the dark 

at 25°C for three days. 

Generation of tobacco lines expressing ZmDEF1 

Plasmid p18T-ZmDEF was digested with HincII and SacI and the 

insert was cloned into the pROK219. The CaMV 35S::ZmDEF1 

expression cassette was digested with HindIII and EcoRI and 

cloned into the pBI121 binary vector and sequenced. The LBA4404 

strain of Agrobacterium tumefaciens was used to transform tobacco 

using the leaf disk transformation method (Horsch et al., 1985). 

After regeneration on kanamycin selective medium, transformed 

tobacco lines were checked for the presence of the transgene by 

PCR. 

Northern analysis 

Total RNA was isolated from shoot tissue of tobacco using TRIzol 

reagent (Invitrogen, USA). 20 µg of total RNA was denatured and 

loaded into a 1.6% formaldehyde-agarose gel, then subsequently 

transferred onto a nylon membrane. Equal loading of the samples 

was confirmed by ethidium bromide staining. The membrane was 

hybridized to a 32 P-labeled probe in a hybridization solution 

containing 0.5 M Na2HPO4 pH 7.2, 1 mM EDTA, 1% BSA and 7% 

SDS at 65°C overnight. The template for the probe was a full-length 

245 bp ZmDEF1 cDNA. After hybridization, the filterate was washed 

twice with 2 × SSC (1 × SSC is 0.15 M NaCl, 15 mM sodium citrate) 

containing 0.1% SDS at 65°C for 20 min each, once with 0.2 × SSC 

containing 0.1% SDS at 65°C for 10 min, and then exposed to X-ray 

film at -70°C for 24 h. 

Detached leaf bioassay 

For the leaf bioassay, detached leaves from mature transgenic and 

control plants (transformed with an empty vector) were placed in 

Petri dishes containing wet filter papers. The leaves were wounded 

by gently pricking the abaxial side of the leaves several times with a 

sterile needle. Then 20 μL of fungal suspension was introduced to 

the wounded area and incubated at 28°C for 10 days. 

Infection of tobacco plants with blast fungus 

The seeds of T1 transgenic tobacco were germinated on MS 

medium containing 100 µg/ml kanamycin. The resistant plants were 

planted in pots containing plant growth medium and grown in the 

greenhouse at 25 to 28°C and relative humidity ranging from 30 to 

60% under natural daylight for approximately two months. Millet 

with P. parasitica was embedded near the tobacco roots in the pots. 

The inoculated plants were placed at 30°C with 100% relative 

humidity for 14 days. 

RESULTS 

Isolation and analysis of the ZmDEF1 gene 

The ZmDEF1 cDNA isolated from Z. mays was 245 bp in 

length, consisting of a single open reading frame. The 

ORF encodes a polypeptide of 80 amino acids consisting 

of a predicted signal peptide of 31 amino acids at the Nterminus 

domain and a mature peptide of 49 amino acids 

with a calculated molecular mass of 5.4 kDa and a pI of 

8.61. The nucleotide and predicted amino acid sequence 

of ZmDEF1 is shown in Figure 1. Several plant defensins 

of previous studies were compared with ZmDEF1 to 

confer the cleavage site between the signal peptide and 

mature ZmDEF1 (data not shown). The presence of the 

signal peptide in the primary translation product 

suggested that ZmDEF1 is destined to the cell wall or the 

vacuole, locations where many defense-related proteins 

are found. 

The alignment of ZmDEF1 with other plant defensins 

is shown in Figure 2. ZmDEF1 shares significant identity 

with Tad1 (63%), EGAD1 (59%) and SD2 (59%), but low 

identity with Nad1 (36%), alfAFP (35%), Rs-AFP2 (30%), 

Dm-AMP1 (28%) and Psd1 (26%). ZmDEF1 contained 

the well conserved eight cysteine residues, which play an 

important role in protein stabilization (Figure 2). Other 

conserved residues such as Ser8, an aromatic residue at 

position 11, Gly13, Glu29 and Gly34 were also found


Figure 2. Amino acid sequence alignment of mature plant defensins from several plants. Comparison of the 

deduced mature ZmDEF1 amino acid sequence with those of other plant defensins. Conserved residues are 

presented in black boxes, partially conserved residues in gray boxes, while the defensin consensus sequence is 

shown below the alignment. The disulfide bond connectivities are shown below the consensus sequence by 

connecting lines. The sequences were aligned using the CLUSTALW2 online 

(http://www.ebi.ac.uk/Tools/msa/clustalw2/). 

Figure 3. RT-PCR expression analysis of ZmDEF1 in different organs of Zea mays. The specific products of ZmDEF1 are detected 

in immature (IS) and mature seeds (MS), but not in roots (R), stems (S), leaves (L) and flowers (F). The tubulin gene exhibiting 

constitutive expression was used as a control. 

in the sequence (Figure 2). According to the analysis of 

sequence performed in this work, ZmDEF1 can be 

grouped with the Class I defensins. 

In addition, to analyze the ZmDEF1 expression 

pattern, RT-PCR was performed with total RNA samples 

extracted from different maize tissues. The data show 

that ZmDEF1 transcripts were only detected in immature 

and mature seeds, but not in roots, stems, leaves or 

flowers (Figure 3). Furthermore, the result that no 

ZmDEF1 transcripts could be detected in seedlings even 

under induction by MeJa and ABA (data not shown), 

indicates the ZmDEF1 may play a defensive role only 

during seed development. 

Expression of ZmDEF1 in P. pastoris 

In the P. pastoris expression system, a strain that 

contains multiple integrated copies of an expression 

cassette can sometimes yield more heterologous protein 

than single-copy strains (Cereghino and Cregg, 2000). 

For screening His + recombinants with multiple inserts, all 

the clones were incubated in 96 well microtiter plate for 

three times passage until they were all at the same cell 

density. The cultures were then spotted on YPD plates 

containing G418 at grads concentration (Figure 4). The 

recombinants that demonstrated resistance at 4.0 mg/ml 

G418 were analyzed for the presence of ZmDEF1 by 

PCR. Six recombinants were recovered from 224 

colonies obtained originally. 

Antifungal activity assays in vitro 

In order to study the antifungal activity of ZmDEF1, the 

Pichia Expression Kit (invitrogen, USA) was used. 

ZmDEF1 was produced as a fusion protein with a 6×His 

tag at C-terminal. The total size of the predicted fusion 

protein is 7.6 kDa. This roughly corresponds to the 

molecular size of the expressed ZmDEF1 detected by 

Western blot (Figure 5). The fusion protein expression in 

Pichia was detected every 12 h. The accumulation of


Figure 4. Screening for yeast recombinants containing multiple copies of ZmDEF1. The cultures were grown on YPD plates 

containing G418 at grads concentration. A to F shows the G418 final concentration at 0.25, 0.5, 1.0, 2.0, 3.0 and 4.0 mg/ml, 

respectively. 

Figure 5. Immunoblot detection of ZmDEF1 expression in P. pastoris. Detection of the fusion protein ZmDEF1 expressed in P. 

pastoris using the anti-His antibody. Denaturing Tricine-SDS-PAGE followed by immunoblotting was performed on the total protein 

extracts from 1 ml supernatant. P. pastoris/pPIC9K was used as a negative control. Pre-stained protein standards (MW) were 

included for estimation of the molecular mass (kDa). The accumulation of ZmDEF1 was detectable after 24 h induction, reaching a 

maximum after 60 h induction.

ZmDEF1 was detectable after 24 h, reaching a maximum 

after 60 h and maintained up to the 96 h. After 108 h, the 

level of ZmDEF1 expression was reduced (Figure 5). 

Thus, a three day growth culture was harvested and 

purified to yield the maximum concentration. The yield of 

the purified fusion protein was approximately 258 μg/ml 

of original culture. The purified fusion protein was used to 

test activity against P. parasitica. Compared to the 

controls, the expressed ZmDEF1 showed an activity 

against spores germination and hyphal growth of the 

fungal pathogen, P. parasitica (Figure 6). 

Ectopic expression of ZmDEF1 in tobacco confers 

resistance to P. parasitica 

Transgenic tobacco plants were generated via 

Agrobacterium-mediated transformation, using the neomycin 

phosphotransferase II gene (NPTII) as a selectable 

marker. Transgenic tobacco lines were randomly selected 

and screened by PCR, using primers specific to ZmDEF1 

gene. The ZmDEF1 transcript in seedlings of transgenic 

plants was detected by RNA gel blot. The results show 

that exogenous ZmDEF1 gene was expressed in all 

examined transgenic plants, and was particularly highly 

expressed in two lines, oxZmDEF1-1 and oxZmDEF1-8 

(Figure 7), while phenotypic abnormalities were not 

observed in any transgenic lines as compared to wild- 

Figure 6. Antifungal activity of ZmDEF1 on P. parasitica. The 

spores of P. parasitica were incubated on PDA plates with a crude 

extract of the fusion ZmDEF1 protein for 3 days. PBS was utilized 

as a negative control. Bar =1 cm. 


type. 

We also examined the effects of the overexpression of 

ZmDEF1 on resistance of the transgenic plants to the 

fungal pathogen, P. parasitica var. nicotianae. Disease 

resistance was evaluated on the T1 transgenic lines 

oxZmDEF1-1 and oxZmDEF1-8, as well as the control 

line, which transformed with an empty vector. Disease 

symptoms appeared on detached leaves of the control 

plants in the form of lesions 5 to 6 days after inoculation, 

and consequently lead to the appearance of yellowish 

necrotic lesions 10 days after inoculation. On the 

contrary, symptoms were not detected on leaves of 

transgenic lines (Figure 8). Subsequently, a whole plant 

assay was carried out. The disease symptoms started to 

appear on the control plants at 6 days after infection, but 

no symptoms were observed on the transgenic plants. By 

8 days after infection, the control plants had severe 

disease symptoms such as leaf wilting and stem rot, and 

eventually died within 14 days (Figure 9). However, both 

of the transgenic lines remained relatively healthy with 

only a slight yellowing of the bottom leaves that had 

contact with the infecting fungus. We also observed a 

difference in the severity of tissue damage between 

control and ZmDEF1 transgenic plants. The longitudinal 

section of stem showed that all the tissues of control 

plants, including epidermis, cortex and pith, were black 

and rotten, while the corresponding part of transgenic 

plants remained green (Figure 9I and J).


Figure 7. Northern blot analysis of ZmDEF1 in leaves of transgenic tobacco. Total RNA was hybridized with a radioactively 

labeled ZmDEF1 probe. 1, 8, 9, 12: transgenic tobacco lines oxZmDEF1-1, oxZmDEF1-8, oxZmDEF1-9 and oxZmDEF1-12. 

EV, regenerated plants transformed with plasmid pBI121. WT, wild type. 

Figure 8. Fungal resistance test of detached leaves of transgenic tobacco expressing ZmDEF1. The results were photographed 

ten days after inoculation with Phytophthora palmivora. EV, the T1 plants transformed with plasmid pBI121. 

DISCUSSION 

Plants have developed various defense mechanisms 

against pathogen attack. Defensins are one class of 

antimicrobial proteins that fight off the foreign pathogens 

(García-Olmedo et al., 1998). All plant defensins descryibed 

to date have a signal peptide marking the protein for 

extracellular secretion (Thomma et al., 2002). In the 

present study, we cloned a cDNA encoding a novel plant 

defensin ZmDEF1, from Z. mays germinated seeds. The 

predicted protein would have a 31 amino acid signal 

peptide (Figure 1). The mature peptide of ZmDEF1 

contains all the conserved residues reported for plant 

defensins (Lay and Anderson, 2005). Therefore, ZmDEF1 

is likely a novel member of defensins family. 

The majority of plants defensin genes are expressed in 

the seeds of various monocot and dicot species 

(Bohlmann, 1994; Broekaert et al., 1997). They have 

been shown to be present as part of normal development 

or maturation, perhaps as a static defense against 

pathogens (Thomma et al., 2002). Balandin et al. (2005) 

found that the transcripts of ZmESR-6 were restricted to 

the embryo surrounding region (ESR) of the kernel, but 

the protein accumulated in the placentochalaza-cells at 

the grain filling phase. The function of ZmESR-6 was 

thought to protect the germinating kernel from pathogens. 

Similar to ZmESR-6, the ZmDEF1 mRNA preferentially 

accumulates in immature and mature seeds (Figure 3), 

suggesting a defensive role in protecting kernels during 

seed development. Jasmonate has been shown to be an 

effective inducer of other defensins (Epple et al., 1997; 

Thomma et al., 1998). However, the expression of 

ZmDEF1 could not be induced in seedlings after treatment 

with ABA or MeJa (data not shown). This result is 

consistent with a specialized role of ZmDEF1. 

More also, we chose the methylotrophic yeast P. 

pastoris expression system to study the antifungal activity 

of ZmDEF1 in vitro. A major advantage of P. pastoris,


Figure 9. Tobacco plants challenged with Black Shank P. parasitica. Pictures were taken eight days after P. palmivora 

inoculation. a, c, e, g and i show transgenic plants, while b, d, f, h and j, show controls, the T1 plants transformed with 

plasmid pBI121. Compared with control, the transgenic tobacco plants were still green after pathogen infection. 

over bacterial expression systems, is that the yeast has 

the potential to perform many of the post-translational 

modifications typically associated with higher eukaryotes, 

such as the processing of signal sequences, folding, 

disulfide bridge formation, certain types of lipid addition 

and glycosylation (Cereghino and Cregg, 2000). Eight 

cysteine residues present in ZmDEF1 mature protein play 

an important role in protein stabilization by formation 

multiple disulfide bridges. P. pastoris is believed to be 

more effective in promoting disulfide bonding than the


Escherichia coli (Cregg et al., 1993). In our previous 

work, we found that the fusion ZmDEF1 expressed using 

a prokaryotic system showed no antifungal activity (data 

not shown) possibility due to improper folding of the 

recombinant protein. However, the recombinant ZmDEF1 

peptide created using the P. pastoris expression system 

exhibits an inhibitory activity on P. parasitica growth 

(Figure 6). 

Due to an alarming increase of resistance of 

microorganisms to classical antibiotics, the introduction 

and expression of antimicrobial peptides like plant 

defensins in crops is emerging as an intriguing 

biotechnological application for enhancing disease 

resistance (Punja, 2001; Osusky et al., 2000; Jha and 

Chattoo, 2010). In this work, a new plant defensin gene, 

ZmDEF1, was introduced into tobacco by Agrobacteriummediated 

transformation. Results indicate that 

constitutive expression of the ZmDEF1 gene under the 

control of the CaMV 35S promoter in tobacco results in 

enhanced resistance against P. parasitica (Figures 8 and 

9). Thus, the antifungal activity of the defensin ZmDEF1 

and its availability for genetic engineering should make it 

useful as gene source for engineering transgenic plants 

resistant against phytopathogenic fungi. 

ACKNOWLEDEGMENTS 

This work was supported by National Natural Science 

Foundation (Grant No. 31171258) and the projects (No. 

2008ZX08009-003 and 2008ZX08003-002) from the 

Ministry of Agriculture of China for Transgenic Research. 

REFERENCES 

Almeida MS, Cabral KM, Zingali RB, Kurtenbach E (2000). 

Characterization of Two Novel Defense Peptides from Pea (Pisum 

sativum) Seeds. Arch. Biochem. Biophys. 378: 278-286. 

Aluru M, Curry J, O’Connell MA (1999). Nucleotide sequence of a 

defensin or-thionin-like gene (accession no. AF128239) from 

habanera chili. Plant Physiol. 120: 633. 

Balandin M, Royo J, Gomez E, Muniz LM, Molina A, Hueros G (2005). A 

protective role for the embryo surrounding region of the maize 

endosperm, as evidenced by the characterization of ZmESR-6, a 

defensin gene specifically expressed in this region. Plant Mol. Biol. 

58: 269-282. 

Bohlmann H (1994). The role of thionins in plant protection. Crit. Rev. 

Plant. Sci. 13: 1-16. 

Brandstadter J, Rossbach C, Theres K (1996). Expression of genes for 

a defensin and a proteinase inhibitor in specific areas of the shoot 

apex and the developing flower in tomato. Mol. Gen. Genet. 252: 

146-154. 

Broekaert WF, Cammue BP, De Bolle MF, Thevissen K, De Samblanx 

GW, Osborn RW (1997). Antimicrobial Peptides from Plants. Crit. 

Rev. Plant. Sci. 16: 297-323. 

Cereghino JL, Cregg JM (2000). Heterologous protein expression in the 

methylotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 24: 45- 

66. 

Chiang CC, Hadwiger LA (1991). The Fusarium solani-induced 

expression of a pea gene family encoding high cysteine content 

proteins. Mol. Plant-Microbe. Interact. 4: 324-331. 

Cregg JM, Vedvick TS, Raschke WC (1993). Recent advances in the 

expression of foreign genes in Pichia pastoris. Biotechnology, 11: 

905-910. 

Epplea P, Apela K, Bohlmann H (1997). ESTs reveal a multigene family 

for plant defensins in Arabidopsis thaliana. FEBS Lett. 400: 168-172. 

Gao AG, Hakimi SM, Mittanck CA, Wu Y, Woerner BM, Stark DM, Shah 

DM, Liang JH, Rommens CM (2000). Fungal pathogen protection in 

potato by expression of a plant defensin peptide. Nat. Biotechnol. 18: 

1307-1310. 

García-Olmedo F, Molina A, Alamillo JM, Rodríguez-Palenzuéla P 

(1998). Plant defense peptides. Biopolymers, 47: 479-491. 

Gu Q, Kawata EE, Morse MJ, Wu HM, Cheung AY (1992). A flowerspecific 

cDNA encoding a novel thionin in tobacco. Mol. Gen. Genet. 

234: 89-96. 

Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT 

(1985). A Simple and General Method for Transferring Genes into 

Plants. Science, 22 : 1229-1231. 

Jha S, Chattoo BB (2010). Expression of a plant defensin in rice confers 

resistance to fungal phytopathogens. Trans. Res. 19: 373-384. 

Koike M, Okamoto T, Tsuda S, Imai R (2002). A novel plant defensin-like 

gene of winter wheat is specifically induced during cold acclimation. 

Biochem. Biophys. Res. Commun. 298: 46-53. 

Kragh KM, Nielsen JE, Nielsen KK, Dreboldt S, Mikkelsen JD (1995). 

Characterization and localization of new antifungal cysteine-rich 

proteins from Beta vulgaris. Mol. Plant-Microbe. Interact. 8: 424-434. 

Lay FT, Anderson MA (2005). Defensins – Components of the Innate 

Immune System in Plants. Curr. Protein Pept. Sci. 6: 85-101. 

Lay FT, Brugliera F, Anderson MA (2003). Isolation and properties of 

floral defensins from ornamental tobacco and petunia. Plant Physiol. 

131: 1283-1293. 

Mello EO, Ribeiro SF, Carvalho AO, Santos IS, Cunha MD, Santa- 

Catarina C, Gomes VM (2011). Antifungal activity of PvD1 defensin 

involves plasma membrane permeabilization, inhibition of medium 

acidification, and induction of ROS in fungi cells. Curr. Microbiol. 62: 

1209-1217. 

Mendez E, Moreno A, Colilla F, Pelaea F, Limas GG, Mendez R, Soriano 

F, Salinas M, Haro CD (1990). Primary structure and inhibition of 

protein synthesis in eukaryotic cell-free system of a novel thionin, 

gamma-hordothionin, from barley endosperm. Eur. J. Biochem. 194: 

533-539. 

Meyer B, Houlne G, Pozueta-Romero J, Shantz ML, Shantz R (1996). 

Fruit-specific expression of a defensin-type gene family in bell 

pepper. Plant Physiol. 112: 615–622. 

Milligan SB, Gasser CS (1995). Nature and regulation of pistilexpressed 

genes in tomato. Plant Mol. Biol. 28: 691-711. 

Moreno M, Segura A, García-Olmedo F (1994). Pseudothionin-St1, a 

potato peptide active against potato pathogens. Eur. J. Biochem. 223: 

135-139. 

Osborn RW, De Samblanx GW, Thevissen K, Goderis I, Torrekens S, 

Van Leuven F, Attenborough S, Rees SB, Broekaert WF (1995). 

Isolation and characterisation of plant defensins from seeds of 

Asteraceae, Fabaceae, Hippocastanaceae and Saxifragaceae. FEBS 

Lett. 368: 257-262. 

Osusky M, Zhou G, Osuska L, Hancock RE, Kay WW, Misra S (2000). 

Transgenic plants expressing cationic peptide chimeras exhibit 

broad-spectrum resistance to phytopathogens. Nat. Biotechnol. 18: 

1162–1166. 

Punja ZK (2001). Genetic engineering of plants to enhance resistance 

to fungal pathogens – a review of progress and future prospects. 

Can. J. Plant Pathol. 23: 216–235. 

Schägger H, Von Jagow G (1987). Tricine-sodium dodecyl sulfatepolyacrylamide 

gel electrophoresis for the separation of proteins in 

the range from 1 to 100 kDa. Anal. Biochem. 166: 368-379. 

Segura A, Moreno M, Molina A, García -Olmedo F (1998). Novel 

defensin subfamily from spinach (Spinacia oleracea). FEBS Lett. 435: 

159-162. 

Sharma P, Lönneborg A (1996). Isolation and characterization of a 

cDNA encoding a plant defensin-like protein from roots of Norway 

spruce. Plant Mol. Biol. 31: 707-712. 

Terras FR, Eggermont K, Kovaleva V, Raikhel NV, Osborn RW, Kester 

A, Rees SB, Torrekens S, Van Leuven F, Vanderleyden J, Cammue 

BP, Broekaert WF (1995). Small cysteine-rich antifungal proteins from 

radish: their role in host defense. Plant Cell 7: 573-588. 

Terras FR, Schoofs HM, De Bolle MF, Van Leuven F, Rees SB,

Vanderleyden J, Cammue BP, Broekaert WF (1992). Analysis of two 

novel classes of plant antifungal proteins from radish (Raphanus 

sativus L.) seeds. J. Biol. Chem. 267: 15301-15309. 

Thevissen K, Ghazi A, De Samblanx GW, Brownlee C, Osborn RW, 

Broekaert WF (1996). Fungal membrane responses induced by plant 

defensins and thionins. J. Biol. Chem. 271: 15018-15025. 

Thomma BP, Cammue BP, Thevissen K (2002). Plant defensins. Planta, 

216: 193–202. 

Thomma BP, Eggermont K, Penninckx IA, Mauch-Mani B, Vogelsang R, 

Cammue BP, Broekaert WF (1998). Separate jasmonate-dependent 

and salicylate-dependent defense-response pathways in Arabidopsis 

are essential for resistance to distinct microbial pathogens. Proc. 

Natl. Acad. Sci. USA. 95: 15107-15111. 


Urdangarin MC, Norero NS, Broekaert WF, De la CanaL (2000). A 

defensin gene expressed in sunflower inflorescence . Plant Physiol. 

Biochem. 38: 253-258. 

Wisniewski ME, Bassett CL, Artlip TS, Webb RP, Janisiewicz WJ, Norelli 

JL, Goldway M, Droby S (2003). Characterization of a defensin in 

bark and fruit tissues of peach and antimicrobial activity of a 

recombinant defensin in the yeast, Pichia pastoris. Physiol. Planta. 

119: 563-572.



DOI: 10.5897/AJB11.1994 



Karyotype studies on Tagetes erecta L. and Tagetes 

patula L. 

Pin Zhang, Li Zeng*, Yan-Xue Su, Xiao-Wen Gong and Xiao-Sha Wang 

School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai 200240, China. 


Karyotypes of nine Tagetes erecta L. accessions and three Tagetes patula L. accessions were studied. 

The chromosome numbers of T. erecta and T. patula were 2n=2x=24 and 2n=4x=48, respectively. The 

karyotype formulae of T. erecta L. ‘Scarletade’ and ‘Perfection Yellow’ are 2n=2x=24=4sm+20m; ‘9901AB’ 

and ‘Harvest’, 2n=2x=24=2sm+22m; ‘Taishan’, 2n=2x=24=14sm+10m; ‘Marvel’ and ‘Perfection Orange’, 

2n=2x=24=24m. The karyotype formulae of T. patula L.: ‘GoldenGate’ and ‘Janie’ are 

2n=4x=48=4sm+44m; ‘Little Hero’, 2n=4x=48=48m. 

Key words: Tagetes erecta L., Tagetes patula L., chromosome, karyotype. 

INTRODUCTION 

Tagetes erecta L. and Tagetes patula L. belonged to 

composites family. They originated from Central America, 

mainly distributed in western Mexico and southeastern 

Arizona (Robert, 1962). The genus Tagetes (Asteraceae) 

contains 56 species, of which only few species were 

currently cultivated as horticultural crops. Some 

companies, such as, Thompson and Morgan, Pan- 

American Seed and SluisGroot etc. cultivate new 

cultivars every year. Examples are, ‘Marvel’ line, ‘Taishan’ 

line of T. erecta L. and ‘Bonanza’ line, ‘Boy’ line of T. 

patula L. which have been widely used in the world. Most 

of the cultivars were produced in the traditional 

hybridization breeding way (Wang, 2003, 2009; Tian et 

al., 2007). Besides, some works also have been done on 

the breeding of transgenic marigold (Gregorio et al., 

1992; Charles et al., 2001). Nowadays, the species 

widely used throughout the world were T. erecta L., T. 

patula L. and T. tenuifolia (Soule, 1996). In China, T. 

erecta L. and T. patula L. were introduced and widely 

cultivated as important garden plants. In addition, the 

inflorescence of pigment T. erecta L. flowers were also 

ideal materials for extracting lutein. Therefore, it was very 

important to study Tagetes plant with their great 

economic value. 

The plant taxonomy was mainly based upon morpholo- 

*Corresponding author. E-mail: zljs@sjtu.edu.cn. Tel: 021- 

34206932. Fax: +86 34206943. 

gical, cytological, and molecular biological analysis, etc. 

As an important means of cytological analysis, 

chromosome karyotype analysis has been widely used in 

biological genetic variation, systematic evolution or 

relationship identification (Zheng et al., 2005; He et al., 

2005; He and Zhang, 2009). Up till now, there have been 

massive reports about chromosome karyotype analysis in 

Asteraceae plants (Kong, 2000; Yang, 2001; Xie and 

Zheng, 2003; Chen, 2008; Zhang et al., 2009). For 

instance, Li et al. (2007) studied the karyotype of fourteen 

cultivars of cut chrysanthemum, and Zhang et al., (2009) 

conducted a cytological study on the genus Syncalathium 

(Asteraceae-Lactuceae). But the karyotypes of Tagetes 

plants were rarely studied. In our paper, we widely 

collected Tagetes species and cultivar materials which 

were popular in China for a systematic study on their 

chromosome numbers and karyotypes, while related 

researches have not been reported. The objective of this 

study was to provide cytological information for 

systematic classification, breeding and germplasm 

resources study. 


This research studied on twelve accessions of genus Tagetes which 

were popular in the domestic market, including seven ornamental T. 

erecta cultivars, two pigment T. erecta cultivars (T. erecta L. 

‘Scarletade’ and ‘9901AB’), three T. patula cultivars (Table1). 

All karyotype observations were made from root tips. Seeds were 

germinated on wet filter paper in Petri dishes at 25°C. Fresh root

Table 1. The source of materials investigated. 

Cultivars Source 

T. erecta L. ‘Scarletade’ Inner Mongolia Bureau of Parks 

T. erecta L.‘9901AB’ Inner Mongolia Bureau of Parks 

T. erecta L. ‘Harvest’ Beijing Institute of Landscape and Garden 

T. erecta L. ‘Taishan’ Beijing Institute of Landscape and Garden 

T. erecta L. ‘Marval’ Beijing Institute of Landscape and Garden 

T. erecta L. ‘Perfection Yellow’ Beijing Institute of Landscape and Garden 

T. erecta L. ‘Perfection ‘Orange’ Beijing Institute of Landscape and Garden 

T. erecta L. ‘Inca Orange’ Beijing Institute of Landscape and Garden 

T. erecta L. ‘Inca Yellow’ Beijing Institute of Landscape and Garden 

T. patula L. ‘GoldenGate’ Beijing Institute of Landscape and Garden 

T. patula L. ‘Little Hero’ Beijing Institute of Landscape and Garden 

T .patula L. ‘Janie’ Beijing Institute of Landscape and Garden 

Table 2. Parameters of chromosomes of T.erecta and T.patula. 

Zhang et al. 16139 

Cultivar Karyotype formula A.A.R Lt/St Type Length type As.K(%) 

T. erecta L.‘Scarletade’ 2n=2x=4sm+20m 1.5 2.36 1B 2n=4L+8M2+6M1+6S 60.39 

T .erecta L.‘9901AB’ 2n=2x=2sm+22m 1.51 2.2 1B 2n=4L+8M2+8M1+4S 60.38 

T. erecta L. ‘Harvest’ 2n=2x=6sm+18m 1.66 2.34 1B 2n=4L+6M2+10M1+4S 62.7 

T. erecta L.‘Taishan’ 2n=2x=14sm+10m 1.74 2.5 2B 2n=6L+4M2+10M1+4S 64.02 

T. erecta L. ‘Marval’ 2n=2x=24m 1.48 2.37 1B 2n=4L+8M2+8M1+4S 59.92 

T. patula L. ‘GoldenGate’ 2n=4x=4sm+44m 1.56 2.62 1B 2n=12L+8M2+16M1+12S 61.34 

T .patula L.‘Little Hero’ 2n=4x=4sm+44m 1.45 2.8 1B 2n=12L+8M2+16M1+12S 59.67 

T. erecta L. ‘Inca Orange’ 2n=2x=2sm+22m 1.32 2.50 1B 2n=4L+8M2+8M1+4S 57.15 

T .erecta L. ‘Inca Yellow’ 2n=2x=24m 1.30 2.84 1B 2n=4L+4M2+12M1+2S 56.95 

T. patula L. ‘Janie’ 2n=4x=48m 1.46 2.64 1B 2n=12L+12M2+12M1+12S 59.7 

T. erecta L. ‘Perfection ‘Yellow’ 2n=2x=4sm+20m 1.31 3.35 1B 2n=6L+6M2+6M1+6S 56.85 

T .erecta L. ‘Perfection ‘Orange’ 2n=2x=24m 1.17 2.43 1B 2n=6L+8M2+6M1+4S 54.06 

A.A.R= Average arm ratio; Lt= Longest arm; St-Shortest arm; As.k(%)= Index of the karyotypic asymmetry. 

tips were cut approximately 1 cm long before pretreated in 0.002 

mol/L 8-hydroxyquinoline solution for 4 h; then, fixed with Carnoy I 

(glacial acetic acid : 70% ethanol = 1:3) for 20 h. After hydrolysis in 

1 mol/L HCl at 60°C for 8 -10 min, the root tips were rinsed in 

distilled water twice for approximately 20 min. Prior to observation, 

stained with phenol fuchsin solution for 30 min, and squashed for 

chromosome observation. Observations were made of somatic 

mitotic metaphase. At least thirty cells of each cultivar have been 

observed to ensure their chromosome number. Five cells’s 

chromosome parameters of each cultivar were surveyed and 

calculated according to Li et al. (1985); karyotype asymmetry (KA) 

was classified according to Arano (1963) and karyotype 

classification was according to Stebbins (1971). 

RESULTS 

Chromosome number of 2n=2x=24 was found among the 

T. erecta L. cultivars; T. patula L. cultivars have a 

chromosome number of 2n=4x=48. Satellite has not been 

found in the tested plants. Their detailed parameters and 

karyotype formulae are listed in Table 2. The 

chromosomes, karyograms and idiograms are shown in 

Figures 1, 2 and 3, respectively. Brief descriptions of the 

cytological features of each cultivar were as follows: 

T. erecta L. ‘Scarletade’ 

The karyotype formula of T. erecta L. ‘Scarletade’ was 

2n=2x=4sm+20m. The ratio of the longest to the shortest 

chromosome was 2.36, the KA was of type 1B, average 

arm ratio was 1.5 and the length type was 

2n=4L+8M2+6M1+6S. 

T. erecta L. ‘9901AB’ 

The karyotype formula of the T. erecta L. ‘9901AB’ was 


chromosome was 2.2, the length type was 

2n=4L+8M2+8M1+4S, average arm ratio was 1.51 and 

the KA was of type 1B.


Figure 1. Chromosomes of Tagetes erecta L. and Tagetes patula 

L. 1-5, 9-12. Chromosomes of T. erecta L. 1. ‘Scarletade’. 2. 

‘9901AB’. 3. ‘Harvest’. 4. ‘Taishan’. 5. ‘Marvel’. 9. ‘Perfection 

‘Yellow’. 10. ‘Perfection Orange’. 11. ‘Inca Orange’. 12. ‘Inca 

Yellow’. 6-8. Chromosomes of T.patula L. 6. ‘GoldenGate’. 7. 

‘Janie’. 8. ‘Little Hero’. 

T. erecta L. ‘Harvest’ 

The karyotype formula of T. erecta L. ‘Harvest’ was 


chromosome was 2.34, the length type was 


the KA was of type 1B. 

T. erecta L. ‘Taishan’ 

The karyotype formula of T. erecta L. ‘Taishan’ was 

2n=2x=14sm+10m; the ratio of the longest to the shortest 


arm ratio was 1.74 and length type 

was2n=6L+4M2+10M1+4S. 

T. erecta L. ‘Marval’ 

The karyotype formula of T. erecta L. ‘Marval’ was 

Figure 1. Contd. 

2n=2x=24m. The ratio of the longest to the shortest 


arm ratio was 1.48 and length type was 

2n=4L+8M2+8M1+4S. 

T. patula L. ‘GoldenGate’ 

The karyotype formula of T. patula L. ‘GoldenGate’ was 


chromosome was 2.62, 2n=12L+8M2+16M1+12S, 

average arm ratio was 1.56 and the KA was of type 1B. 

T. patula L. ‘Little Hero’ 

The karyotype formula of T. patula L. ‘Little Hero’ was 


chromosome was 2.8, length type was 

2n=12L+8M2+16M1+12S, average arm ratio was 1.45 

and the KA was of type 1B.

T. patula L. ‘Janie’ 

Figure 2. Karyograms of Tagetes erecta L. and Tagetes patula L. 1-5, 9-12. 

Karyograms of T.erecta L. 1. ‘Scarletade’. 2. ‘9901AB’. 3. ‘Harvest’. 4. ‘Taishan’. 5. 

‘Marvel’. 9. ‘Perfection ‘Yellow’. 10. ‘Perfection Orange’. 11. ‘Inca Orange’. 12. ‘Inca 

Yellow’. 6-8. Karyograms of T.patula L. 6. ‘GoldenGate’. 7. ‘Janie’. 8. ‘Little Hero’. 

The karyotype formula of T. patula L. ‘Janie’ was 




2n=12L+12M2+12M1+12S, average arm ratio was 1.46


Figure 3. Idiograms of Tagetes erecta L. and Tagetes patula L. 1-5, 9-12. Idiograms of T.erecta L. 1. 

‘Scarletade’. 2. ‘9901AB’. 3. ‘Harvest’. 4. ‘Taishan’. 5. ‘Marvel’. 9. ‘Perfection ‘Yellow’. 10. ‘Perfection 

Orange’. 11. ‘Inca Orange’. 12. ‘Inca Yellow’. 6-8. Idiograms of T.patula L. 6. ‘GoldenGate’. 7. ‘Janie’. 8. 

‘Little Hero’.

and the KA was of type 1B. 

T. erecta L. ‘Perfection Yellow’ 

The karyotype formula of T. erecta L. ‘Perfection ‘Yellow’ 

’was 2n=2x=4sm+20m. The ratio of the longest to the 

shortest chromosome was 3.35, length type was 



T. erecta L. ‘Perfection Orange’ 

The karyotype formula of T. erecta L. ‘Perfection ‘Orange’ 

’ was 2n=2x=24m. The ratio of the longest to the shortest 




T. erecta L. ‘Inca Orange’ 

The karyotype formula of T. erecta L. ‘Inca Orange’ was 





T. erecta L. ‘Inca Yellow’ 

The karyotype formula of T. erecta L. ‘Inca Yellow’ was 





DISCUSSION 

The main carrier of genetic substances was chromosome. 

The size, number and even morphology characters 

of chromosome were relatively stable in plants, 

alternation of generations are not easily affected by 

environmental conditions. Therefore, the karyotype and 

chromosome number could provide cytological 

information for the plant classification, phylogeny and 

relationship identification. 

Our results indicate that no satellite existed in the 

tested Tagetes plants, all with submetacente (sm) or 

metacenters (m). In the last several years, some efforts 

have been offered to karyotype analysis on a few Tagetes 

plants. Li et al. (2005) studied on the chromosome 

number of T. erecta ‘ACHY021’ ‘PBLY026’ and T. patula 

‘PBHO029’, the result was consistent with ours. Qi et al. 

(2008) only studied on karyotype type of T. erecta L. 


‘Little Hero’; their result 2B was different from ours 1B. 

Wang and Li (1987) have studied the chromosome 

number and karyotype formula about ten composites. In 

their paper, the karyotype formula of genus Tagetes was 

2n=24=6sm+16st(2SAT)+2t, which was different from 

ours. However, compared to theses reports, our research 

was more systematic. From a lot of work for a long time, 

we can ensure that T. erecta L. and T. patula L. had the 

same basic chromosome number twelve, and the 

chromosome numbers were different, T. erecta L. was 

diploid 2n=2x=24, T. patula L. was tetraploid 2n=4x=48. 

The difference between our result and others probably 

came from the experimental error, while the true causes 

still needed more researches to illustrate. 

Karyotype differences of nine T. erecta L.cultivars and 

three T. patula L. cultivars were mainly displayed in such 

aspects as average arm ratio, karyotype formula and 

index of the karyotypic asymmetry etc. For the T. erecta L 

cuiltivars, As.K% ranged from 54.06% to 64.02%, 

average arm ratio was from 1.17 to 1.74 and their primary 

karyotype types were 1B except for ‘Taishan’ was 2B. 

Metacentric chromosomes existed in the every tested 

cultivar, while submetacentric chromosomes did not. 

Among 12 pairs of chromosomes in ‘Taishan’, 7 pairs 

were submetacenter (sm). But, no pairs of submetacenter 

chromosomes was found in both T. erecta L ‘Marvel ‘and 

T. erecta L ‘Inca’. Likewise, within the T. patula L. 

cultivars, As.K% ranged from 59.67 to 61.34%, average 

arm ratio was from 1.45 to 1.56, with all karyotype types 

belong to 1B. Chromosome constitution was same as T. 

erecta L. and no submetacenter existed in ‘Jenie’. In 

recent years, the karyotypes studies have been not only 

on different species but also on different cultivars (Gao 

and Zhuang, 2009; Zhan et al., 2009, 2010; Wang et al., 

2010). In these reports, the karyotype differences between 

cultivars were also included. This difference maybe 

as a result from during long-term breeding process, the 

chromosomal hybridization occurred between different 

populations or individuals with different karyotypes. 

According to Levitzky, (1931) and Stebbins (1971), the 

basic trend of karyotype evolution was from symmetrical 

to asymmetrical for the angiosperm. Meanwhile, 

according to Arano (1963), when the As.k% was less than 

60%, karyotype symmetries were high. It could be 

deduced that genus Tagetes asymmetries were relatively 

low. Some cultivars have the same karyotype formula, so 

they may have a near genetic relationship. This result will 

provide basic cytological information for the breeding 

work on marigold. But the correct genetic relationship 

between these cultivars also needs to be researched 

combined with some other methods. Previous studies by 

Wang and Li (1987), Li et al. (2005) and Qi et al. (2008) 

got the same results in basic chromosome number of 

genus Tagetes plants steadily as twelve. The basic 

chromosome number was single and maybe support that 

the evolutionary process was relatively simple than those 

whose basic chromosome number were not single (He


and Zhang, 2009). However, more related molecular 

biotechnology researches such as gene sequencing and 

molecular markers were need to be carried out on more 

Tagetes plants. 


This study was supported by Mr. Man-Zhu BAO of 

Huazhong Agricultural University for providing materials 

and information. This study was supported by Shanghai 

natural foundation: Enhancing Lutein Content of Tagetes 

erecta L. via over-expressing of psy 

Genes(11ZR1418600). 

REFERENCES 

Arano H (1963). Cytological students in subfamily Carduoideae 

(Compositae) of Japan, IX. Botanical Magazine (Tokyo). 76: 32-39. 

Charles PM, Li T, Katherine WO (2001). Analysis of carotenoid 

biosynthetic gene expression during marigold petal development. 

Plant Mol. Biol. 45: 281-293. 

Chen FD, Zhao HB, Li C, Chen SM, Fang WM (2008). Advances in 

cytology and molecular cytogenetics of the genus Dendranthema. J. 

Nanjing Agricultural University, 31: 118-126. 

Gao HQ, Zhuang NS (2009). Karyotype Analysis of Two Varieties in 

Hevea brasiliensis. J. Wuhan Botanical Res. 27(5): 537-540. 

He XL, Zhang MJ (2009). Chromosome number and Karyotype of 7 

species from Seriphidium (compositae). Acta Bot. Boreal.-Occident. 

Sin 29: 1155-1161. 

He ZC, Li XD, Li JQ (2005). Meiotic observations on the pollen mother 

cells of Manglietia patungenswas, an endangered species. Acta 

Phytotaxonomica ica Sinica, 43: 526-532. 

Kong H (2000). A study on karyotype of Callwastephus chinenswas 

Nees, Guihaia. 20: 339-340. 

Levitzky GA (1931). The karyotype in systematics. Bull. Appl. Bot. 

Genet. Plant Breed, 27: 220-240. 

Li C, Chen FD, Zhao HB, Fang WM (2007). Karyomorphology of 

fourteen cultivars in cut chrysanthemum. Acta Horticulturae Sinica. 

34: 1235-1242. 

Li FR, Zhang JC, Xu JR, Zhou JH(2005). Studies on the cross-breeding 

of T. erecta L. × T. patula L. and the sterility of hybrid. J. Inner 

Mongolia Agricultural University, 26: 51-54. 

Li MX, Chen RY (1985). A suggestion on the standardization of 

Karyotype analysis in plants. J. Wuhan Botanical Res. 3: 297-302. 

Qi YC, Zhou GL, Gao Y (2008). Study on squash technique of root tip 

and analysis chromosome karyotype in T. patula. J. Hubei University 

for Nationalities (Natural Science Edition). 26: 261-265. 

Robert TN (1962). The Ethnobotany of Tagetes. Econ. Bot. 16: 317-325. 

Soule JA (1996). In: Janick(ed), Progress in new crops, ASHS Press, 

Arlington, VA. pp. 546-551. 

Stebbins GL (1971). Chromosomal evolution in higher plants. London: 

Edward Arnold. pp. 85-104. 

Tian HY, Wang P, Shen XQ (2007). Genetic Analysis and Botanical 

Character in Male Sterile W205AB Line of Marigold. Northern 

Horticulture, 2: 105-107. 

Wang AX, Feng DQ, Xing SY (2010). Analysis of Karyptype and 

Chromosome Number on Three Cyclamen Cultivars. Chinese Agric. 

Sci. Bull. 26(2): 193-195. 

Wang GY (2003). Technology on production of hybrid marigold seed in 

protected field. China Seed Industry, 10: 59-60. 

Wang P (2009). Selection and Application of a New Pigment Tagetes 

erecta 'Sesu 1'. Liaoning Agricultural Sci. 2: 74-75. 

Wang XL, Li MX (1987). The karyotype analysis of 10 Chrysanthemums 

species. J. Wuhan Botanical Res. 5: 111-120. 

Xie ZY, Zheng CM (2003). Cytological studies on 13 species of 

Compositae form Hainan, China. Acta Phytotaxonomica ica Sinica, 

41: 545-552. 

Yang DK (2001). The karyotype studies do Chentaurea cyanus and 

Coreopswas grandiflora. Journal of Shandong Normal University 

(Natural Science). 16: 75-78. 

Zhan T, Jian HY, Wang QG, Zhang H (2010). Study on Karyotype of 

Eleven Chinese Old Garden Roses. Southwest China J. Agric. Sci. 

23(5): 1656-1659. 

Zhan YF, Dang XM, Cao ZM (2009). Karyotype Analysis of Two 

Varieties Solanum melongena L. J. Plant Genet. Resour. 10(2): 283- 

285. 

Zhang JW, Nie ZL, Sun H (2009). Cytological study on the genus 

Syncalathium (Asteraceae Lactuceae), an endemic taxon to alpine 

scree of the Sino-Himalayas. J. Syst. Evol. 47(3): 226-230. 

Zheng M, Yu XS, Li Y, Wu H, Zhang SZ (2005). Karyotype analysis of 

14 species and 2 varieties in Aloe L. J. Wuhan Botanical Res. 23: 

535-540.



DOI: 10.5897/AJB10.2002 



Genetic diversity assessment of Diplocyclos palmatus 

(L.) C. Jeffrey from India using internal transcribed 

spacer (ITS) sequences of nuclear ribosomal DNA 

M. Ajmal Ali 1 *, Fahad M. A. Al-Hemaid 1 , Joongku Lee 2 , R. K. Choudhary 2 , Naif A. Al-Harbi 1,3 

and Soo-Yong Kim 2 

1 Department of Botany and Microbiology, College of Science, King Saud University, 

Riyadh- 11451, Saudi Arabia. 

2 International Biological Material Research Centre, Korea Research Institute of Bioscience 

and Biotechnology, Daejeon- 305-806, South Korea. 

3 Addiriyah Chair for Environmental Studies, College of Science, King Saud University, 

Riyadh 11451, Saudi Arabia 


Internal transcribed spacer (ITS) region of nuclear ribosomal DNA from 20 populations of Diplocyclos 

palmatus (L.) C. Jeffrey belonging to five different geographical locations (Bihar, Jharkhand, 

Maharashtra, Madhya Pradesh, and Tamil Nadu) of India were sequenced. Analysis of nucleotide 

sequences reveals polymorphism among the populations [π = 0.01482, θw = 0.01180 (0.00236) and total 

variance 3.260]. AMOVA was used to partition the genetic diversity and tested whether there is any 

hierarchy of ITS sequence variation among individuals. The genetic differentiation between the 

populations is high (ΦST = 0.591). The maximum likelihood tree reveals the evolution of D. palmatus 

under reproductive isolation and under different environmental conditions which may be most probably 

due to long distance distribution, and possibility of genetic exchange among the populations of D. 

palmatus distributed in Bihar and Jharkhnad. 

Key words: Diplocyclos palmatus (L.) C. Jeffrey, genetic diversity, internal transcribed spacer (ITS), nrDNA. 

INTRODUCTION 

Diplocyclos (Endl.) Post and Kuntze [Family 

Cucurbitaceae, Tribe Benincaseae (Schaefer and 

Renner, 2011)] is a small genus of four species; three 

[Diplocyclos leiocarpus (Hook. f.) C. Jeffrey, Diplocyclos 

schliebenii (Harms) C. Jeffrey, Diplocyclos tenuis C. 

Jeffrey] confined to tropical Africa and one [Diplocyclos 

palmatus (L.) C. Jeffrey] extends from tropical Africa to 

*Corresponding author. E-mail: majmalali@rediffmail.com. Tel: 

966-75834. Fax: 966-75833. 

Abbreviation: ITS, Internal transcribed spacer. 

Malaysia (www.tropicos.org). In India the genus 

Diplocyclos is only represented by D. palmatus (commonly 

known as Sivalingi or Pachguria) which is growing 

wild on bushes, trees and hedges. The plant is a weak 

stemmed, branched tendril climber; leaves simple, 

alternate, 5-lobed, hairy above, pale and smooth 

beneath; flowers yellow, small, unisexual, male in small 

fascicles and females solitary; fruits quite conspicuous in 

the field due to bunches of globose green with white 

striped (or become bright red with white striped when 

ripe), smooth with 1 to 2 small seeds. Medicinally it is 

useful for skin diseases, inflammations and general 

debility (Chakravarty, 1982; Kirtikar and Basu, 1975; Ali 

and Pandey, 2007).


The nuclear ribosomal transcription unit (NRTU) is 

comprised of 18S, 5.8S and 28S genes, two internal 

transcribed spacers (ITS-1 and ITS-2), and an intergenic 

spacer (IGS). After transcription, the NRTU is processed 

to produce mature rRNAs that are key components of 

cytoplasmic ribosomes. NRTU are found in hundreds to 

thousands of tandem copies and usually several NRTU 

clusters are present within plant genomes. The 

conserved regions (18S and 28S genes) of NRTU are 

used to infer phylogenetic relationships at higher 

taxonomy levels, whereas the more rapidly evolving 

segments (ITS and IGS) are used for studies at the genic 

or population levels (Soltis and Soltis, 1998; Alvarez and 

Wendel, 2003). For over a decade, sequences of internal 

transcribed spacers (ITS) of NRTUs have been widely 

used to infer phylogenetic relationships, genetic diversity 

and to unravel evolution in a wide range of complexes in 

plants (Alvarez and Wendel, 2003; Baldwin and Markos, 

1998; Baldwin et al., 1995; Hershkovitz et al., 1999; 

Kelch and Baldwin, 2003; Lee et al., 2002). Although, 

NRTUs are found in thousands of copies within a 

genome, intra-genomic diversity is generally low (Baldwin 

et al., 1995). This homogeneity among NRTUs is attributed 

to concerted evolution (Baldwin et al., 1995; 

Ainouche and Bayer, 1997), a process that acts through 

gene conversion and unequal crossing over. Despite the 

fact that homogenization is a norm among NRTUs in a 

genome, extensive intra-individual and intra-specific 

variation has been observed in various plant species 

(Campbell et al., 1997; Hughes et al., 2002). The 

accumulating evidence suggests that intra-individual 

variation of nuclear ribosomal ITS regions should not be 

considered as exceptional (Feliner et al., 2004). Because 

of the influence of concerted evolution, the occurrence of 

ancestral polymorphisms is not the most likely ultimate 

cause for intra-genomic variability in this marker. Instead, 

a more frequent origin is the merging of different ITS 

copies within the same genome as a consequence of 

gene flow. Once the two copies meet, the fate of the 

polymorphism depends on genetic, reproductive and 

population-level factors: Specifically, the number and 

location of ribosomal loci (on the same or different 

chromosomes), the occurrence of polyploidy and/or 

apomixes (Hershkovitz et al., 1999; Campbell et al., 

1997; Buckler et al., 1997), and the relative abundance of 

different ITS copies in the breeding populations (Feliner 

et al., 2004). 

D. palmatus shows morphological intermediate among 

the population. Because of its medicinal properties the 

plant is being over explored by the local people from the 

wild. An important prerequisite for development of an 

effective conservation strategy is the proper evaluation of 

the distribution and study at the level of genetic variation 

(Milligan et al., 1994). A perusal of literature reveals that 

phylogeny and classification of the family Cucurbitaceae 

have been the focus of several studies (Schaefer and 

Renner, 2011; Ali et al., 2009; Kocyan et al., 2007; Zhang 

et al., 2006; Jeffrey, 2005; Decker-Walters et al., 2004; 

Chung et al., 2003; Jobst et al., 1998); however, the 

information on population structure and genetic variation 

of D. palmatus is lacking. Hence, the main objectives of 

the present study were to utilize the nucleotide data of 

the ITS region to evaluate the degree of differentiation 

among the populations of D. palmatus from India. 


Plant materials 

Leaf samples of D. palmatus were collected from different 

geographical region of India. All the collected voucher specimens 

have been deposited in the Tilka Manhji Bhagalpur University 

Herbarium (BHAG), Bihar, India. For comparison, the sequence of 

closely related species Coccinia grandis (L.) Viogt. from our earlier 

study (Ali et al., 2009) was included in the analysis. 

DNA extraction 

Leaves were dried in silica gel prior to DNA extraction. Total 

genomic DNA was extracted by following the 2X CTAB method 

(Doyle and Doyle, 1987) or using the DNeasy Plant Mini kit 

(QIAGEN Inc., Crawley, West Sussex, UK). Total genomic DNA 

was extracted from similar amounts of silica dried tissue (~10 to 50 

mg dry mass) as well as from herbarium specimens following the 

cetyltrimethyl ammonium bromide (CTAB) procedure (Doyle and 

Doyle, 1987). After precipitation with isopropanol and subsequent 

centrifugation, the DNA pellet was washed with 70% ethanol, dried 

at 37°C, and resuspended in TRIS-EDTA (TE) buffer. 

Amplification of ITS region 

ITS sequences of nuclear ribosomal DNA were amplified using 

primers of White et al. (1990) ITS1F (5’-GTCCACTGAACCTT 

ATCATTTAG-3’) and ITS4R (5’-TCCTCCGCTTATTGATATGC-3’) 

via the polymerase chain reaction (PCR) using the AccuPower HF 

PCR PreMix (Bioneer, Daejeon, South Korea). One round of 

amplification consisting of denaturation at 94°C for 5 min followed 

by 40 cycles of denaturation at 94°C for 1 min, annealing at 49°C 

for 1 min and extension at 72°C for 1 min, with a final extension 

step of 72°C for 5 min. The PCR products were purified using 

SolGent PCR Purification Kit-Ultra (SolGent, Daejeon, South Korea) 

prior to sequencing. 

DNA Sequencing 

The purified fragments were directly sequenced using dye 

terminator chemistry following the manufacturer’s protocol. The 

sequencing reaction was performed in a 10 µl final volume with the 

BigDye Terminator cycle sequencing kit (Perkin-Elmer, Applied 

Biosystems). Cycle sequencing was conducted using same primers 

used in amplification and BigDye vers. 3 reagents and an ABI 

PRISM 3100 DNA Analyzer (Perkin-Elmer, Applied Biosystems). 

Cycling conditions included an initial denaturing set at 94°C for 5 

min, followed by 30 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C 

for 4 min. Sequenced product was precipitated with 17 µl of

Table 1. Sampling location of Diplocyclos palmatus and GenBank accession number. 

Population Population code/ Voucher GenBank accession number 

Dp bgp1 GQ183041 

Dp bgp2 JN834058 


Bihar 


Dp kis1 JN834061 



Jharkhand 

Maharashtra 

Madhya Pradesh 

Tamil Nadu 

deionized sterile water, 3 µl of 3 M NaOAc, and 70 µl of 95% EtOH. 

Polyacrylamide gel electrophoresis was conducted with Long 

Ranger Single packs (FMC BioProducts) and an ABI 3100 

automated DNA sequencer (Perkin-Elmer, Applied Biosystems). 

Each sample was sequenced in the sense and antisense direction. 

The sequences were analyzed with ABI sequence navigator 

software (Perkin-Elmer/Applied Biosystems). The sequencing was 

done through commercial service of Macrogen Inc. (South Korea). 

The sequences were analyzed with ABI Sequence Navigator 

software (Perkin-Elmer/Applied Biosystems). Nucleotide sequences 

of both DNA strands were obtained and compared the forward and 

reverse sequence to ensure accuracy. 

Data analysis 

Sequence alignment 

Sequence alignments were performed using ClustalX version 1.81 

(Thompson et al., 1997). Sequence alignments were subsequently 

adjusted manually using BioEdit (Hall, 1999). Insertion-deletions 

(Indels) were scored as single characters when we had confidence 

in positional homology. The boundaries between the ITS1, 5.8S, 

and ITS2 were determined by comparisons with earlier published 

sequences (Jobst et al., 1998). Gaps were treated as missing data 

in phylogenetic analyses. All sequences generated in the present 

study were deposited in GenBank and GenBank accession 

numbers are included in Table 1. 

Dp pkr1 JN834064 



Dp klp1 JN834067 



Dp bhp1 JN834070 



Dp tn1 JN834073 

Dp tn2 JN834074 

Dp tn3 JN834075 

Dp tn4 JN834076 

Sequence diversity 

Ali et al. 16147 

Nucleotide polymorphism, as measured by θw (Watterson, 1975) 

and diversity, as measured by π (Nei, 1978) were calculated using 

DnaSP v4.5 (Rozas and Rozas, 1999). Analysis of molecular 

variance (AMOVA) was performed using GenAlEx 6.1 (Peakall and 

Smouse, 2006) to assess genotypic variations across all the 

populations studied. This analysis, apart from partitioning of total 

genetic variation into within-group and among-group variation 

components, also provided a measure of intergroup genetic 

distance as proportion of the total variation residing between 

populations. The significance of the analysis was tested using 999 

random permutations. 

Phylogenetic analyses 

The phylogenetic analysis of aligned sequences was performed by 

maximum likelihood (ML) using MEGA5 (Tamura et al., 2007). 

Phylogenetic analysis inferred using the maximum likelihood 

method was based on the Tamura-Nei model (Tamura and Nei, 

1993). Initial tree(s) for the heuristic search were obtained 

automatically as follows. When the number of common sites was < 

100 or less than one fourth of the total number of sites, the 

maximum parsimony method was used; otherwise BIONJ method 

with MCL distance matrix was used. Substitution pattern and rates 

were estimated under the Kimura (1980) 2-parameter model 

(Kimura, 1980). For estimating ML values, a user-specified topology 

was used. Substitution pattern and rates were estimated under the


Table 2. Maximum composite likelihood estimate of the pattern of nucleotide substitution. 

Nucleotide A T C G 

A - 5.53 10.45 9.77 

T 5.42 - 16.04 8.23 

C 5.42 8.48 - 8.23 

G 6.44 5.53 10.45 - 

Each entry shows the probability of substitution from one base (row) to another base (column) 

(Tamura et al., 2004). Rates of different transitional substitutions are shown in bold and those 

of transversional substitutions are shown in italics. 

Tamura and Nei, (1993) model (+Gamma) (Tamura and Nei, 1993). 

A discrete gamma distribution was used to model evolutionary rate 

differences among sites (5 categories, [+G]). 

RESULTS AND DISCUSSION 

Nucleotide sequences and intraspecific divergence 

The amplified region of ITS1-5.8S-ITS2 in D. palmatus 

was found 599 base pairs (bp) [ITS1- 216, 5.8S- 164, 

ITS2- 219]. Outgroup spacer lengths were 593 bp. Data 

matrix has a total number of 606 characters of which 

invariable sites were 534 bp, variable sites were 52 (total 

number of mutations were 53), singleton variable sites 

were 28 and parsimony informative sites were 24. 

Insertions and deletions (indels) were necessary to align 

the sequences. The substitution probabilities are given in 

Table 2. The nucleotide frequencies were 0.183 (A), 

0.187 (T/U), 0.353 (C), and 0.278 (G). The transition/ 

transversion rate ratios were k1 = 1.187 (purines) and k2 

= 1.534 (pyrimidines). The overall transition/ transversion 

bias (R) was found 0.874. 

The absence of other variable regions in the nuclear 

DNA of plants that could provide useful markers at both 

intra-family (Baldwin and Markos, 1998) and intragenomic 

level differentiation (Feliner et al., 2004), makes 

ITS ostensibly the best marker for phylogenetic studies. 

Polymorphism was observed among the populations [π 

Figure 1. Percentage of ITS variance within and among population 

of Diplocyclos palmatus 

= 0.01482, θw = 0.01180 (0.00236) and total variance 

3.260]. Variability within the nuclear ribosomal 

transcription unit (NRTU) usually depends upon number 

of gene copies, rates of mutation, concerted evolution, 

number and chromosomal location of NRTU clusters, and 

proportion of sexual and asexual reproduction (Dover et 

al., 1993). Polymorphism may arise when concerted 

evolution is not fast enough to homogenize repeats in 

face of high rates of mutation (Appels and Honeycutt, 

1986) or by loss of sexual recombination (Campbell et al., 

1997). 

AMOVA was used to partition the genetic diversity of D. 

palmatus and tested whether there is any hierarchy of 

ITS sequence variation among individuals (Figures 1 and 

2 and Table 3). The genetic differentiation between the 

populations is high (ΦST = 0.591). {(Nei, 1978) classified 

GST > 0.15 as high, ΦST and GST both denote fixation 

index and are comparable)}. 

Phylogenetic reconstruction 

Phylogenetic analysis inferred using the maximum 

likelihood method based on the Tamura-Nei model 

(Tamura and Nei, 1993) resulted into the ML tree with the 

highest log likelihood (-1102.8302) is shown in Figure 3. 

Substitution pattern and rates estimated under the 

Kimura (1980) 2-parameter model (Kimura, 1980) shows 

the nucleotide frequencies A = 20.63%, T/U = 16.65%, C

Figure 2. Frequency distribution of random PhiPT vs observed PhiPT among population of Diplocyclos 

palmatus 

Table 3. Hierarchical analysis of molecular variance (AMOVA) within/among D. palmatus populations. 


Source of variation d.f. SSD Estimated variance Total variance (%) ΦST p-value 

Among population 4 4.233 0.233 59 

Within population 15 2.417 0.161 41 

0.591 0.198 

Total 19 6.650 0.394 

d.f.: Degrees of freedom; SSD: Sum of squared deviations; ΦST: Fixation index; p-value: The probability of having a more extreme 

variance component than the observed. 

Figure 3. Evolutionary relationships of Diplocyclos palmatus inferred using ML method implemented in MEGA5. The 

percentage of trees in which the associated taxa clustered together is shown next to the branches. Numbers on the branches 

indicate bootstrap support under 100 bootstrap replicates. 

= 35.04%, and G = 27.67%. The maximum Log likelihood 

for the computation of estimating ML values was - 

336.940. The estimated value of the shape parameter for 

the discrete gamma distribution was 200.0. Substitution 

pattern and rates estimated under the Tamura and Nei, 

(1993) model (+Gamma) (Tamura and Nei, 1993) reveals 

mean evolutionary rates 0.90, 0.96, 1.00, 1.04, 1.10 

substitutions per site. The nucleotide frequencies was A = 

20.63%, T/U = 16.65%, C = 35.04%, and G = 27.67%. 

The maximum Log likelihood for this computation was –


336.941. 

The maximum likelihood tree reveals that all the 

sampled population of D. palmatus grouped together in a 

single clade (100% bootstrap support). The ML tree 

shows that the populations of different geographic 

location sampled in the present study grouped according 

to their geographic locations. It was interesting to note 

that population collected from the geographic location of 

Jharkhand nested within the clade of Bihar. This indicates 

that the possibility of genetic exchange among the 

populations distributed in Bihar and Jharkhnad which 

might have evolved under reproductive isolation and 

under different environmental conditions. 


Post Doctoral Fellowship from Korea Research Institute 

of Biosciences and Biotechnology (KRIBB), Daejeon, 

South Korea to MAA and SYK is thankfully acknowledged. 

This work was supported partially by Addiriyah Chair for 

Environmental Studies, King Saud University, Saudi 

Arabia. 

REFERENCES 

Ali MA, Pandey AK (2007). Cucurbitaceae of eastern Bihar, Plant 

Systematics Research Centre (TMBU) Publication, Bhagalpur, India. 

Ali MA, Pandey AK, Lee J (2009). Relationships among subfamily 

Cucurbitoideae (Family Cucurbitaceae) from India inferred from ITS 

sequences of nrDNA. Phytomorphology, 59(3&4): 127-140. 

Ainouche ML, Bayer RJ (1997). On the origins of the tetraploid Bromus 

species (section Bromus, Poaceae): insights from the internal 

transcribed spacer sequences of nuclear ribosomal DNA. Genome, 

40: 730-743. 

Alvarez I, Wendel JF (2003) Ribosomal ITS sequences and plant 

phylogenetic inference. Mol. Phylo. Evol. 29: 417-434. 

Appels R, Honeycutt RL (1986). rDNA: Evolution over a billion years. In: 

DNA systematics edited by S Dutton (CRC Press, Boca Raton, FL, 

USA), pp. 81-135. 

Baldwin BG, Markos S (1998). Phylogenetic utility of the external 

transcribed spacer (ETS) of 18S-26S rDNA: Congruence of ETS and 

ITS trees of Calycadenia (Compositae). Mol. Phylo. Evol. 10: 449- 

463. 

Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF, Campbell 

CS, Donoghue MJ (1995). The ITS region of nuclear ribosomal DNA: 

a valuable source of evidence on angiosperm phylogeny. Ann. Miss. 

Bot. Gard. 82: 247–277. 

Buckler ES, Ippolito A, Holtsford TP (1997). The evolution of ribosomal 

DNA: divergent paralogues and phylogenetic implications. Genetic, 

145: 821-832. 

Campbell CS, Wojciechowski MF, Baldwin BG, Alice LA, Donoghue MJ 

(1997). Persistent nuclear ribosomal DNA sequence polymorphism in 

the Amelanchier agamic complex (Rosaceae). Mol. Biol. Evol. 14: 81- 

90. 

Chakravarty HL (1982). Fascicles of Flora of India Fascicle II 

Cucurbitaceae. Botanical Survey of India, Calcutta, India. 

Chung SM, Deena S, Walters D, Staub JE (2003). Genetic relationships 

within the Cucurbitaceae assessed by consensus chloroplast simple 

sequence repeat (cc SSR) marker. Can. J. Bot. 81: 814-832. 

Decker-Walter DS, Chung S, Staub JE (2004). Plastid sequence 

evolution: a new pattern of nucleotide substitutions in the 

Cucurbitaceae. J. Mol. Evol. 58: 606-614. 

Dover GA, Linares AR, Bowen T, Hancock JM (1993). Detection and 

quantification of concerted evolution and molecular drive. Methods 

Enzymol. 224: 525-541. 

Doyle JJ, Doyle JL (1987). A rapid DNA isolation procedure for small 

quantities of fresh leaf tissue. Phytochem. Bull. pp. 1911-1915. 

Feliner GN, Larena BG, Aguilar JF (2004). Fine scale geographic 

structure, intra-individual polymorphism and recombination in nuclear 

ribosomal internal transcribed spacers in Armeria (Plumbaginaceae). 

Ann. Bot. 93: 189-200. 

Hall TA (1999). BioEdit: a user-friendly biological sequence alignment 

editor and analysis program for Windows 95/98/NT. Nucleic Acid 

Symp. Ser. 41: 95-98. 

Hershkovitz MA, Zimmer EA, Hahn WJ (1999). Ribosomal DNA 

sequences and angiosperm systematics. In: Hollingsworth PM, 

Bateman RM, Gornall RJ (eds.) Molecular Systematics and Plant 

Evolution, Taylor & Francis: London, UK, pp. 268-326. 

Hughes CE, Bailey CD, Harris SA (2002). Divergent and reticulate 

species relationships in Leucaena (Fabaceae) inferred from multiple 

data sources: Insights into polyploid origins and nrDNA polymorphism. 

Am. J. Bot. 89: 1057-1073. 

Jeffrey C (2005). A new system of Cucurbitaceae. Bot. Zhurn. 90: 332– 

335. 

Jobst J, King K, Hemleben V (1998). Molecular evolution of the internal 

transcribed spacers (ITS1 and ITS2) and phylogenetic relationships 

among the species of the family Cucurbitaceae. Mol. Phylo. Evol. 9: 

204-219. 

Kimura M (1980). A simple method for estimating evolutionary rate of 

base substitutions through comparative studies of nucleotide 

sequences. J. Mol. Evol. 16: 111-120. 

Kelch DG, Baldwin BG (2003). Phylogeny and ecological radiation of 

New World thistles (Cirsium, Cardueae-Compositae) based on ITS 

and ETS rDNA sequence data. Mol. Ecol., 12: 141-151. 

Kirtikar K, Basu BD (1975). Indian Medicinal Plants. Vol II, pp. 1106- 

1115. Bisehn Singh Mahendra Pal Singh, Dehra Dun, India (Rep. 

ed.). 

Kocyan A, Zhang LB, Schaefer H, Renner SS (2007). A multi-locus 

chloroplast phylogeny for the Cucurbitaceae and its implications for 

character evolution and classification. Mol. Phylo. Evol. 44:553–577. 

Lee JY, Mummenho VK, Bowman JL (2002). Allopolyploidization and 

evolution of species with reduced floral structures in Lepidium L. 

(Brassicaceae). Proc. Natl. Acad. Sci. USA 99: 16835-16840. 

Milligan, BG, Leebens-Mack J, Strand AE (1994). Conservation 

genetics: beyond the maintenance of marker diversity. Mol. Ecol. 3: 

423-435. 

Nei M (1978). Estimation of average heterozygosity and genetic 

distance from a small number of individuals. Genetic, 89: 583-590. 

Peakall R, Smouse PE (2006). GENALEX 6: Genetic analysis in Excel, 

population genetic software for teaching and research. Mol. Ecol. 

Notes, 6: 288-295. 

Rozas J, Rozas R (1999). DnaSP version 3: an integrated program for 

molecular population genetics and molecular evolution analysis. 

Bioinfor. 15:174-175. 

Schaefer H, Renner SS (2011) Phylogenetic relationships in the order 

Cucurbitales and a new classification of the gourd family 

(Cucurbitaceae). Taxon 60(1): 122-138. 

Soltis D, Soltis P (1998). Choosing an approach and an appropriate 

gene for phylogenetic analysis. In: Soltis D, Soltis P, Doyle J (eds.) 

Molecular Systematics of Plants II. DNA Sequencing, Kluwer 

Academic Publishers: Boston, MA, USA, pp. 1-42. 

Tamura K, Nei M (1993). Estimation of the number of nucleotide 

substitutions in the control region of mitochondrial DNA in humans 

and chimpanzees. Mol. Biol. Evol. 10: 512-526. 

Tamura, K., Nei, M. & Kumar, S. 2004. Prospects for inferring very large 

phylogenies by using the neighbor-joining method. Proceedings 

National Academy of Sciences (USA) 101: 11030-11035. 

Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular 

Evolutionary Genetics Analysis (MEGA) software version 4. Mol. Biol. 

Evol. 24: 1596-1599. 

Thompson, JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins GD 

(1997). The ClustalX windows interface: flexible strategies for

Multiple sequence alignment aided by quality analysis tools. Nucleic 

Acid Res. 24: 4876-4882. 

Watterson GA (1975). On the number of segregating sites in genetical 

models without recombination. Theor. Pop. Biol. 7: 256-276. 

White TJ, Bruns T, Lee S, Taylor J (1990). Amplifcation and direct 

sequencing of fungal ribosomal RNA genes for phylogenetics. In: 

PCR Protocols: A Guide to Methods and Applications, Innis M, 

Gelfand D, Sninsky J, White T (eds.). Academic Press, San Diego, 

CA, USA. pp. 315-322. 


Zhang LB, Mark PS, Alexander K, Renner SS (2006). Phylogeny of the 

Cucurbitales based on DNA sequences of nine loci from three 

genomes: Implications for morphological and sexual system evolution. 

Mol. Phylo. Evol. 39: 305–322.



DOI: 10.5897/AJB11.553 



Regeneration of plantlets under NaCl stress from NaN3 

treated sugarcane explants 

Ikram-ul-Haq 1 *, Salma Memon 1 , Nazia Parveen Gill 2 and Muhammad Tahir Rajput 3 

1 Institute of Biotechnology and Genetic Engineering (IBGE), University of Sindh, 76080, Jamshoro, Pakistan. 

2 Department of Statistics, University of Sindh, 76080, Jamshoro, Pakistan. 

3 Institute of Plant Sciences, University of Sindh, 76080, Jamshoro, Pakistan. 


In this experiment, mutation induction in explants using NaN3 and subsequently, callus growth and 

plant regeneration under NaCl stressed conditions was assessed in some sugarcane (Saccharum 

officinarum L.) cultivars (Thatta-10, CPF-237 and SPHS-19). Immature bases of leaf tips were cultured 

on MS2n (MS salts, 3.0 mg L -1 ; 2,4-D, 0.5% NaN3) for 6 days then sub-cultured on MS2 (MS salts, 3.0 mg L - 

1 2,4-D), MS2a (MS2, 25 mol m -3 NaCl), MS2b (MS2, 50 mol m -3 NaCl) and MS2c (MS2, 75 mol m -3 NaCl) media 

in dark condition. After 6 weeks, callus growth was observed to be significantly higher (72.34 ± 3.70%) 

in CPF-237 in the control (MS2), and lowest (57.66 ± 4.34%) in SPHS-19 in MS2d culture. Somatic embryos 

were induced in proliferated calluses on MS3 (MS salts, 0.5 mg L -1 ; BAP, 0.4 mg L -1 ; kin, 0.3 g L -1 ; casein 

hydrolysate, 3% sucrose) medium under dark condition for 2 weeks. These calluses were sub-cultured 

on MS4 (MS, 0.3 mg L -1 ; BAP, 0.2 mg L -1 ; kin, 3% glucose), MS4a (MS4, 25 mol m -3 NaCl), MS4b (MS4, 50 

mol m -3 NaCl) and MS4c (MS4, 75 mol m -3 NaCl) media. Maximum of 8.41 ± 0.36 plantlets callus -1 were 

regenerated in MS4 (control) culture of Thatta-10, and 4.94 ± 0.05 plantlets of CPF-237 in 25 mol m -3 NaCl 

stressed plant regeneration (MS4a) medium. Plant regeneration on MS4b (2.21 ± 0.17 plantlets callus -1 ) 

was observed in CPF-237 only. Regenerated plantlets were rooted and considered as salt tolerant in 

comparison to its parent cultivars. 

Key words: Kinetin, somatic embryos, regenerated plantlets, Saccharum officinarum. 

INTRODUCTION 

Today, about 65% sugar is contributed by sugarcane 

(Saccharum spp.) of the world (Alam et al., 1995). It is a 

cash as well as domestic food source. Unfortunately, a 

number of disease and abiotic factors such as cold, 

drought and salinity have been reducing its vegetative 

production significantly. Improvement of this crop against 

these stresses has gained great importance. Sugarcane 

is heterozygous crop naturally. In vitro selection is 

important for superior somaclones. It is a supplementary 

tool for the development of stress resistant plants through 

*Corresponding author. E-mail: rao.ikram@yahoo.com. Tel: 

+92-345-2914291. 

Abbreviations: MS, Murashige and Skoog basal salts; NaN3, 

sodium azide; 2,4-D, 2,4-dichlorophenoxyaceticacid; kin, 

kinetin; BAP, benzyleaminopurine; NaCl, sodium chloride; F 

Wt, fresh weight; D Wt, dry weight. 

traditional breeding (Dix, 1993; Ashraf, 1994). 

Among aseptic plant cultures, plant regeneration 

through callus development and somatic embryogenesis 

has got initial prime step for manipulation of crops by 

using modern biotechnological techniques (Saharan et 

al., 2004). This technique is also important to exploit the 

induced as well as existed somaclonal variations among 

the cultured explants or multiplied calluses (Islam et al., 

2011). Aseptic plant cell selection of relative salt tolerant 

genotypes or cell lines is possible and it has been 

reported in many plant species (Alvarez et al., 2003; 

Gandonou et al., 2005; Lutts et al., 1999; Haq et al., 

2011). In vitro plant regeneration has always remained an 

excellent tool for diagnosis of correlation for plant 

morphogenesis against salt stress. 

Sodium azide is an important and most powerful 

chemical mutagen for crop plants. It affects plant 

physiology significantly and decreases cyanide resistant 

plant respiration among the callus cultures (Wen and

Liang, 1995). It is a well known prominent mutagenic in 

several plants and animals (Grant and Salamone, 1994). 

Sodium azide is functionally mutagenic chemical in 

various organisms, but not in Drosophila (Kamra and 

Gallopudi, 1979; Arenaz et al., 1989) and Arabidopsis. 

Actually, mutagenicity in living systems is mediated 

through biosynthesis of organic metabolite of azide compound 

(Owais and Kleinhofs, 1988). This metabolite 

creates point mutation in DNA when entering into the 

nucleus (Gichner and Veleminsky, 1977). 

Aseptic plant regeneration has been an incremental 

tool for mutation induction, while totipotency of a single 

cell is a useful work for the establishment of pure form of 

species. It can facilitate the development of several numbers 

of its new genotypes (Mandal et al., 2000; Barakat 

et al., 2010; Al-Qurainy and Khan, 2010). Similarly, 

indirect plant regeneration in sugarcane has been 

established for some local sugarcane cultivars by Haq et 

al. (2011). This protocol could be utilized successfully for 

the improvement of sugarcane through in-vitro 

mutagenesis to develop more selected and unique 

relevant traits of this crop. 

The aim of the present study was to induce mutation in 

initial explants of sugarcane (Saccharum officinarum L.) 

cultivars, after which they are subjected to callus growth 

and then subsequent plant regeneration under different 

saline stressed cultures. Cell lines are selected on the 

basis of growth behaviors under NaCl stressed conditions. 

Regenerated plantlets under NaCl stressed conditions 

may be involved in inducing salt tolerance. 

Developed plantlets may be resistant sources against 

saline stressed culture conditions. 


Explants sterilization and NaN3 treatment 

Immature bases of leaf tips (0.8 to 1.2 cm) were excised. These tips 

were sterilized by washing with 90% ethanol for 2 min. They were 

stirred in 30% commercially available Robin Bleach ® (5.25% v/v 

NaOCl) for 30 min. Sterilized explants were treated with 0.5% NaN3 

for 6-days that was supplied in callusing medium (MS2). The pH of 

medium was adjusted to 4.6 to 4.7. 

Callus induction and its proliferation 

After the treatment of NaN3, explants were sub-cultured on NaN3 

free medium, MS2 [MS basal salts (Murashige and Skoog, 1962); 

vitamins B 5 complex (Gamborg et al., 1968); 2% sucrose and 

solidified with 8% agar medium supplemented with 3.0 mg L -1 2,4dichlorophenoxy 

acetic acid (MS2). 

Somatic embryogenesis and plant regeneration 

For somatic embryo induction, well proliferated calluses (>6-weeks 

old) on MS2 medium were sub-cultured on MS3 medium 

supplemented with kin (0.4 mg L -1 ), BAP (0.5 mg L -1 ) and casein 

hydrolysate (0.3 g L -1 )] in dark conditions. After 3-weeks, culture 

was sub-cultured on MS4 (0.3 mg L -1 BAP, 0.2 mg L -1 kin, 3% 

Ikram-ul-Haq et al. 16153 

glucose) medium for plant regeneration under dark conditions. 

When plant regeneration started, cultures were shifted to light 

conditions for further development. 

Application of NaCl treatments 

Four levels of salt (NaCl) stress were maintained at callusing stage 

that is MS2 (control), MS2a (MS2, 25 mol m -3 NaCl), MS2b (MS2, 50 

mol m -3 NaCl) and MS2c (MS2, 75 mol m -3 NaCl). Cultures were 

incubated under dark conditions for 6-weeks. At plant regeneration 

stage, calluses from MS2, MS2a, MS2b and MS2c were sub-cultured 

on MS4, MS4a (MS4, 25 mol m -3 NaCl) and MS4b (MS4, 50 mol m -3 

NaCl) and MS4c (MS4, 75 mol m -3 NaCl) media after somatic 

embryo induction (MS3) for 6-weeks also. 

Determination of morphological attributes 

The 6-weeks old calluses multiplied under NaCl stressed conditions 

were fragmented into small pieces and weighed at an interval of 6weeks. 

Callus proliferation rate was calculated by applying the 

formula below: 

Callus proliferation (%): 

Callus Final Wt − Callus 

Callus 

Final 

Wt 

Initial 

Wt 

x 100 

These fragmented calluses were dried after taking F Wt weight at 

72°c for three days, and then D Wt was determined by electric 

balance. The relative water contents (RWC) were calculated 

(Robinson and Neil, 1985; Conroy et al., 1988). 

After 12-weeks of plant regeneration culture, the number of 

regenerated plantlets callus -1 and their heights was measured. 

The pH of plant nutrient medium was adjusted (5.7-5.8) before 

sterilization. The cultures for callus growth and somatic embryo 

induction were incubated under dark conditions, while plant 

regeneration was also done under dark condition for initial 6-weeks; 

16 

it was transferred to h day and light conditions (light intensity 15 

8 

µmol m -2 s -1 ) at 25ºC±1. 

Data analysis 

Cultures for each treatment were maintained and comprised 7 

replicates. Data significance of treatment was computed with 

COSTAT computer package (CoHort software, Berkeley, USA). 


The In-vitro culture based on mutational breeding is an 

important conventional method for crop improvement. 

This method is based on alterations of nucleotide 

sequence of DNA within a gene through exposure of 

vegetative or reproductive parts to physical as well as 

chemical mutagens. In vitro cultures are controlled 

phenomena that allow better treatment of mutagen and 

further vitrified tissues become easily permeable to 

mutagen (Ziv, 1991). The NaN3 is water soluble that 

dissociates into hydrozoic ions. Its ionization capacity is 

very high, when dissolved in phosphate buffer at low pH 

(3.2), almost 19 times more than at pH 6.0. It penetrates 

through cell membrane and interacts with genome to


Figure 1. A schematic 

representation of aspetic plant 

regeneration of sugarcane cultivars 

from NaN3 treated explants under 

different levels of NaCl stresses. 

create mutation (Kleinhofs et al., 1974). 

In general, normal plant regeneration in sugarcane 

through somatic embryogenesis is obtained within 20weeks. 

During this study, mutagenic plantlets were 

regenerated, when 0.8-1.20 sized meristematic bases of 

young leaves were treated with 0.5% NaN3 on callus 

induction medium as well as multiplication medium 

(MS2n) for 6-days (Figure 1). They were washed with 

liquid callusing medium and again sub-cultured on 

mutagen free callusing medium (MS2). They were also 

cultured on NaCl stressed callus growth media such as 

MS2a, MSb2 and MS2c. After 6-weeks of culture, calluses 

were excised from the explants and their F Wt was taken. 

These calluses were sub-cultured again on their 

respective medium for further multiplication (Figure 2) for 

6-weeks under dark conditions. Final F Wt of calluses 

from each treatment was measured again. Maximum 

callus proliferation (72.34±3.70%) rate was observed on 

MS2 culture of CPF-237, while lower 7.48±0.85% in 

SPHS-19 significantly (Table 1). After final F Wt, calluses 

were dried, and then D Wt was taken. Relative water 

contents were also observed among the calluses that 

were higher in Thatta-10 (75.32 ± 3.37), but lower in NaCl 

stressed cultures significantly (Table 1). The continuous 

callus cultures on NaCl stressed medium causes 

induction of some characteristics such as to stop growth, 

abnormality or resistance in callus against salt stresses 

(Haq et al., 2011; Htwe et al., 2011). 

Apparently, well proliferated calluses in callusing 

control (MS2) as well as NaCl stressed cultures were subcultured 

on somatic embryogenesis medium (MS3) for 

three weeks separately. After somatic embryo induction, 

calluses were sub-cultured on plant regeneration medium 

(MS4) as well as on NaCl stressed plant regeneration 

medium on the basis of their respective already 

developed medium (control and salt stressed). Maximum 

plant regeneration was observed in control (MS4) plant 

regeneration cultures of each cultivar. Plant regeneration 

efficiency was decreased with the increase in NaCl 

stress. No plant regeneration was observed in MS4c in all 

cultivars. Similarly, plant regeneration was not observed 

on MS4b cultures of Thatta-10 and SPHS-19, while 

2.21±0.17 plantlets callus -1 was regenerated in CPF-237 

sugarcane cultivar (Table 1, Figure 3). Plant height of the 

regenerated plantlets of CPF-237 was less than other 

cultivars on each of control as well as NaCl stressed 

cultures. 

Meanwhile, NaN3 remained a potential mutagen under 

in vitro that induces biochemical mutant regeneration 

(Hibberd et al., 1982; Bhagwat and Duncan, 1998). 

Although, this mutagen causes gene alterations or 

mutations at gene level, it also causes chromosomal 

aberration mostly (El-Den, 1993; Del Campo et al., 1999). 

Morphologically, immediate effects of NaN3 on cultured 

meristematic cells appear to be blocked in callus 

induction or its proliferation. This is because of 

blackening action of genome separation and its 

multiplication at S-phased during cell cycle. Further, it is 

reported that some induced mutant biochemical causes 

inhibition of respiratory chains as well as electron chain 

(Johnsen et al., 2002). Through multidisciplinary actions 

of NaN3, it is impossible to detect its action in explants. 

In this study, mutagenic plantlets were mostly abnormal, 

while abnormal plantlets were removed and normal 

plantlets were allowed to grow in NaCl stressed plant 

regeneration medium. These regenerated plantlets in 

CPF-237 were expected to be salt tolerant in comparison 

to plantlets regenerated in control (MS4) medium in open 

air soil conditions. 

ACKNOWLEDGEMENT 

The authors are thankful to the Pakistan Agriculture 

Research Council (PARC), Islamabad, Pakistan for 

providing funds under ALP research program to carry out 

this present research work.

Figure 2. Callusing in sugarcane (Saccharum officinarum L.) cv., 

CPF-237 after mutagen (NaN3) treatment for 6-days on different 

NaCl stresses. a: Callusing on MS nutrient medium with 0 mM NaCl 

(MS2); b: Callus proliferation on MS nutrient medium with 25 mM 

NaCl (MS2a); c: Culture on 50mM NaCl (MS2b); d: On 75mM NaCl 

culture (MS2c). 

Ikram-ul-Haq et al. 16155 

Table 1. Some callus growth and plant regeneration related parameters of 6-days NaN3 stressed sugarcane cultivars 

cultured on different NaCl stressed nutrient media. 

Name of cultivars Medium Thatta-10 CPF-237 SPHS-19 

Sub-cultures of NaN3 treated explants on different NaCl stressed cultures 

a. Callus proliferation (%) MS2 67.18±3.26 72.34±3.70 57.66±4.34 

*** MS2a 49.07±3.93 38.33±3.69 38.57±1.50 

MS2b 42.27±2.16 17.03±2.32 20.48±1.09 

MS2c 28.61±3.62 34.15±1.08 7.48±0.85 

b. Relative water contents (%) MS2 75.32±3.37 74.08±2.33 75.16±3.14 

** MS2a 71.44±2.69 63.37±2.69 64.97±3.44 

MS2b 58.69±3.06 52.14±2.12 54.60±3.40 

MS2c 49.45±4.17 56.93±2.15 48.47±2.04 

Number of regenerated plantlets callus -1 on NaCl stressed cultures and their heights 

a. No. of plantlets callus -1 MS4 8.41±0.36 6.25±0.13 6.95±0.05 

MS4a 1.33±0.24 4.94±0.05 0.92±0.09 

MS4b - 2.21±0.17 - 

MS4c - - - 

b. Plant heights (cm) MS4 4.61±0.03 4.02±0.25 4.05±0.05 

MS4a 1.66±0.34 3.25±0.11 2.02±0.03 

MS4b - 2.10±0.05 - 

MS4c - - -


REFERENCES 

Figure 3. Plant regeneration in sugarcane (Saccharum officinarum L.) cv., 

CPF-237 under different NaCl stresses. a: Shoot multiplication on MS nutrient 

medium with 0 mM NaCl (MS4); b: Plant multiplication on MS nutrient medium 

with 25 mM NaCl (MS4a); & c: Culture on 50mM NaCl stressed culture (MS4b). 

Alam MZ, Haider SA, Islam R, Joarder OJ (1995). High frequency in 

vitro plant regeneration in sugarcane. Sugarcane 6: 20-21. 

Al-Qurainy F, Khan S (2010). Mutational approach for enhancement of 

artemisinin in Artemisia annua. J. Med. Plants Res. 4(17): 1714- 

1726. 

Alvarez I, Tomaro, LM, Benavides PM (2003). Changes in polyamines, 

proline and ethylene in sunflower calluses treated with NaCl. Plant 

Cell Tiss. Org. Cult. pp. 1-9. 

Arenaz P, Hallberg L, Mancillas F, Gutierrez G, Garcia S (1989). 

Sodium azide mutagenesis in mammals; inability of mammalian cells 

to convert azide to mutagenic intermediate. Mutation Res.277: 63-67. 

Ashraf M (1994). Breeding for salinity tolerance in plants. Crit. Rev. 

Plant Sci. 13: 17- 42. 

Barakat MN, Rania S. Fattah A, Badr M, El-Torky MG (2010). In vitro 

mutagenesis and identification of new variants via RAPD markers for 

improving Chrysanthemum morifolium. Afr. J. Agric. Res. 5(8): 748- 

757. 

Bhagwat B, Duncan EJ (1998). Mutation breeding of banana cv 

Highgate (Musa spp., AAA Group) for tolerance to Fusarium 

oxysporum f.sp. cubense using chemical mutagens. Sci. Hort. 73: 11- 

22. 

Conroy JP, Virgona JM, Smillie RM, Barlow EW (1988). Influence of 

drought acclimation and CO2 enrichment on osmotic adjustment and 

chlorophyll a fluorescence of sunflower during drought. Plant Physiol. 

86: 1108-1115. 

Del Campo G, Antonio R, Coletto O (1999). Induction of chromosomal 

aberrations during replication phase (S) by Sodium azide in root 

meristems of Allium cepa L. Ciencia (Maracaibo) 7(2): 118-125. 

Dix PJ (1993). The role of mutant cell lines in studies on environmental 

stress tolerance: an assessment. Plant J. 3: 309-313. 

El-Den JB (1993). Development of a new barley line by induced 

mutation. Rachis 12(½): 8-10. 

Gamborg OL, Miller RA, Ojima K (1968). Nutrient requirement 

suspension cultures of soybean root cells. Exp. Cell Res. 50: 151- 

158. 

Gandonou CH, Abrina J, Idaomar M, Skali Senhaji N (2005). Response 

of sugarcane (Saccharum sp) varieties to embryogenic callus 

induction and in vitro salt stress. Afr. J. Biotechnol. 4(4): 350-354. 

Gichner T, Veleminsky J (1977). The very low mutagenic activity of 

sodium azide in Arabidopsis thaliana. Biol. Plant. 19: 153-155. 

Grant WF, Salamone MF (1994). Comparative mutagenicity of 

chemicals selected for test in the international program on chemical 

safety collaborative study on plant systems for the detection of 

environmental mutagens. Mutation Res. 310: 187-209. 

Haq I, Memon S, Parveen N, Yasin G, Muhammad A (2011). Relative 

salt tolerant plants regenerated on nacl stressed cultures of 

sugarcane. J. Life Sci. (Accepted). 

Hibberd KA, Green CE (1982). Inheritance and expression of Lysine 

plus Threonine resistance selected in maize tissue culture. PNAS. 

79: 559-563. 

Htwe NN, Maziah M, Ling HC, Zaman FO and Zain AM (2011). 

Responses of some selected Malaysian rice genotypes to callus 

induction under in vitro salt stress. Afr. J. Biotechnol. 10(3): 350-362. 

Islam KMN, Misbahuzzaman K, Majumder AK and Chakrabarty M 

(2011). Efficiency of different coagulants combination for the 

treatment of tannery effluents: A case study of Bangladesh. Afr. J. 

Environ. Sci. Tech. 5(6): 409-419. 

Johnsen AR, Bendixen K, Karlson U (2002). Detection of microbial 

growth on polycyclic aromatic hydrocarbons in microtiter plates by 

using the respiration indicator WST-1. Appl. Env. Microbiol. 68(6): 

2683-2689. 

Kamra OP, Gallopudi B (1979). Mutagenic effects of sodium azide in 

Drosophila melanogaster. Mutation Res. 25: 381-384. 

Kleinhofs A, Sander C, Nilan RA, Konzak CF (1974). Azide 

mutagenicity-mechanism and nature of mutants produced. - In 

Polyploidy and Inducrtl Mutations in Plant Breeding. Proc. mcvting 

Bari, FAOIIAEA, 0ct. 1972, IAEA, Vienna, p. 195-199. 

Lutts S, Bouharmont J, Kinet JM (1999). Physiological characteristics of 

salt-resistant rice (Oryza sativa L.) somaclone. Aust. J. Bot. 47: 835- 

849 

Mandal AKA, Chakrabarty D, Datta S (2000). In vitro isolation of solid 

novel flower colour mutants from induced chimeric ray florets of 

chrysanthemum. Euphytica 114: 9-12. 

Murashige T, Skoog FA (1962). Revised medium for rapid growth and 

bioassays with tobacco tissue cultures. Physiol. Plant. 154: 73-479. 

Owais WM, Kleinhofs A (1988). Metabolic activation of the mutagen 

azide in biological systems. Mutation Res. 197: 313-323. 

Robinson JC, Neil DJ (1985). Comparative morphology, phenology and 

production potential of banana cultivars ‘Dwarf Cavendish’ and 

‘Williams’ in the Eastern Transvaal Lowveld. Sci. Hortic. 25: 149-161. 

Saharan V, Yadav RC, Yadav RN, Chapagain BP (2004). High 

frequency plant regeneration from desiccated calli of indica rice 

(Oryza Sativa L.). Afr. J. Biotechnol. 3(5): 256-259. 

Wen JG, Liang HG (1995). Effect of KCN and NaN3 pretreatment on 

the cyanide resistant respiration in tobacco callus. Acta Bot. Sin. 

37:711-717. 

Ziv M (1991). Vitrification: Morphological and physiological disorders of 

in vitro plants. In: Mocropropagation: Technology and Application, pp 

45-69. (Eds.): PC Debergh and RH Zimmerman). Dordrecht: Kliwer.



DOI: 10.5897/AJB11.1559 



Proteomic and transcriptomic analysis reveals 

evidence for the basis of salt sensitivity in Thai jasmine 

rice (Oryza sativa L. cv. KDML 105) 

Wichuda Jankangram 1 , Sompong Thammasirirak 2 , Meriel G. Jones 3 , James Hartwell 3 and 

Piyada Theerakulpisut 1 * 

1 Genomics and Proteomics Research Group for Improvement of Salt-tolerant Rice, Department of Biology, Faculty of 

Science, Khon Kaen University, Khon Kaen 40002, Thailand. 

2 Department of Biochemistry, Faculty of Science, Khon Kaen University, Khon Kaen 40002, Thailand. 

3 School of Biological Sciences, Biosciences Building, Crown Street,University of Liverpool, Liverpool, UK. 


The fragrant Thai jasmine rice cultivar, Khao Dawk Mali 105 (KDML 105), is an economically important 

cultivar with valuable flavour characteristics, however, it is very sensitive to salinity. To investigate 

whether genetic characters for salt-tolerance are present, proteomes from the leaf lamina of KDML 105 

and a contrasting salt tolerant cultivar (Pokkali) were compared under saline conditions. Ten differential 

proteins were identified, mainly representing gene products involved in photosynthesis, carbon 

assimilation and the oxidative stress response. The mRNA transcripts for these proteins were then 

monitored in both cultivars using semi-quantitative reverse transcription-polymerase chain reaction 

(RT-PCR). For Pokkali, the up-regulation of nine identified salt-induced proteins was related to the 

increase in abundance of the respective mRNA transcripts. In contrast, although mRNA transcripts 

encoding all ten identified proteins could be detected in KDML 105, only three differential proteins 

spots were detected in the proteomic analysis. This indicates that although KDML 105 contains 

elevated transcript level of genes needed for salt tolerance, the posttranscriptional mechanisms 

controlling protein expression levels were not as efficient as in Pokkali, indicating targets for future 

genetic improvement. 

Key words: Salt stress, fragrant rice, Oryza sativa L., Khao Dawk Mali 105 (KDML 105), proteomics, semiquantitative 

RT-PCR. 

INTRODUCTION 

Salt-affected soils in arid and semi-arid regions are a 

major factor adversely affecting rice growth and 

productivity worldwide. This area is likely to increase as a 

result of increasing irrigation, land clearance, shortage of 

rainfall and rising temperatures due to global warming 

(Yeo, 1999). Excess soil solution Na + imposes root 

*Corresponding author. E-mail: piythe@kku.ac.th. Tel: 6643 

342908 or 089 6231777. Fax: 6643 364169. 

osmotic stress, and this in turn limits the root’s ability to 

extract water from the soil. Several complementary 

biochemical and physiological adaptations are generally 

necessary to establish salt tolerance. These include salt 

exclusion at the root level, compartmentalization of toxic 

ions from the intracellular to whole-plant levels, responsive 

stomata, synthesis of compatible solutes, adjustment 

in photosynthetic apparatus, alteration of membrane 

integrity and efficient detoxification of reactive oxygen 

species (Parida and Das, 2005). Rice plants are relatively 

sensitive to soil salinity, but salinity tolerance varies


tremendously among varieties providing opportunities to 

improve crop salt-stress tolerance through genetic means 

(Flowers and Yeo, 1981; Mohammadi-Nejad et al., 2008; 

Cha-um et al., 2010). Salt-tolerant rice varieties such as 

Pokkali have been found to be superior in agronomic 

characters such as yield, survival, plant height, and 

physiological traits such as ion exclusion (Heenan et al., 

1988; Noble and Rogers, 1992), anti-oxidative systems 

(Vaidyanathan et al., 2003) and membrane stability 

(Singh et al., 2007). 

Proteomics has been used to identify proteins affected 

by salinity in several cultivars of rice. Previously identified 

salt stress-responsive proteins include ones involved in 

major metabolic processes including photosynthetic 

carbon dioxide assimilation and photorespiration, photosynthetic 

oxygen evolution and stress-responsive proteins 

(Kim et al., 2005; Parker et al., 2006). DNA microarrays 

have also been applied to monitor changes in the steadystate 

abundance of salt-stress regulated transcripts 

(Kawasaki et al., 2001; Rabbani et al., 2003). These 

studies have identified large numbers of differentially 

expressed genes. A recent comparative transcriptomic 

analysis of two contrasting rice cultivars (salt-tolerant 

Pokkali and salt-sensitive IR64) found a set of genes 

representing the signal, relay and response classes of 

salt-regulated genes proposed to confer higher salt 

tolerance to Pokkali (Kumari et al., 2009). 

Several salt sensitive varieties of rice are economically 

important because of its characteristics other than yield. 

These include the culinary qualities associated with grain 

flavour and texture. Thai jasmine rice (also known as 

Thai fragrant or Hom Mali rice) is sold at a premium price 

because of its superior cooking and sensory qualities, 

including fragrance. Thai national authenticity regulations 

confine jasmine rice to two cultivars. One of these is 

Khao Dawk Mali 105 (KDML 105) that was introduced in 

1958 and continues to be grown extensively despite its 

low yields and stress-sensitivity (Fitzgerald et al., 2009). 

The highest quality KDML 105 is produced in the 

Northeast region of Thailand where high productivity is 

obstructed by infertile, saline soil and unstable rainfall 

(Yoshihashi et al., 2002). Compared to the coastal, salttolerant 

Indian cultivar Pokkali, KDML 105 seedlings are 

sensitive to salt stress as indicated by a greater reduction 

in plant dry weight, higher Na + /K + and higher electrolyte 

leakage (Theerakulpisut et al., 2005). Improvements to 

the growth performance of KDML 105 in saline laboratory 

media have been demonstrated after providing the 

protective metabolite glycinebetaine (Cha-um et al., 

2006) but this is not practical in the field. 

A key challenge is to identify genes that control traits 

associated with physiological and agronomical parameters 

leading to higher salt tolerance while retaining 

grain quality, with the goal to accelerate both conventional 

and molecular breeding of cultivars with desirable 

culinary qualities that will grow in saline soil. One ques- 

tion is whether salt sensitive varieties already contain 

some of these genes but do not regulate them appropriately 

with respect to salinity. We have identified that 

although genes for a series of transcripts and proteins 

that increase in Pokkali seedling leaves when grown in 

saline conditions are also present in KDML 105, the 

levels of most proteins do not increase. This suggests 

that in KDML 105, salt sensitivity may lie in signaling and 

regulation of the response. 


Plant materials 

The rice seeds of cultivars KDML 105 and Pokkali were provided by 

Pathumthani Rice Research Institute, Thailand. Seeds were 

surface-sterilized by soaking in 1.5% (w/v) calcium hypochlorite for 

30 min, thoroughly washed and germinated in distilled water. The 

uniformly germinated seeds were transferred to a plastic grid placed 

over a 6-L container filled with distilled water. After five days, when 

the seedlings were well-established, distilled water was replaced by 

nutrient solution (Yoshida et al., 1976) that was renewed every 

week. When the seedlings were 21-days-old, the nutrient solution 

was changed to Yoshida solution supplemented with 120 mM NaCl 

and after a further seven days, the third leaves were harvested, 

frozen in liquid nitrogen and stored at -80°C until further use. The 

experiments were performed in triplicate to obtain three 

independent samples of rice seedlings for protein and RNA 

analysis. 

Protein extraction and two-dimensional electrophoresis (2DE) 

The leaves were ground in liquid nitrogen and suspended in 50 mM 

sodium acetate of pH 5.0. The homogenate was centrifuged at 

14,400 g for 10 min. The supernatant was transferred to a new tube 

and 50% trichloroacetic acid was added to a final concentration of 

10% and the mixture was allowed to precipitate on ice for 30 min. 

Each sample was then centrifuged at 14,400 g for 10 min to obtain 

a protein pellet. After the pellet was washed with 100 µl ice-cold 

ethanol and resuspended in 100 µl lysis solution (8 M urea, 4% 

CHAPS, 40 mM Tris-base), the protein concentration was 

determined (Bradford, 1976). The protein samples were then 

diluted into the rehydration buffer (7 M urea, 2 M thiourea, 2% (w/v) 

CHAPS, 2 mM DTT, 0.8% (w/v) IPG buffer and 0.2% bromophenol 

blue), and allowed to rehydrate for at least 1 h on ice. Samples (100 

µg) were then loaded onto immobilized pH gradient (IPG) strips (7 

cm, pH 4 to 7, pH 3 to 10, GE Healthcare, Sweden), and isoelectric 

focusing (IEF) was conducted (IPGphor TM Isoelectric Focusing 

System, GE Healthcare, Sweden). IEF was performed at 400, 1000 

and 2000 V for 1, 12 and 1 h, respectively. After the IEF run, the 

IPG strip was then equilibrated in equilibration buffer [62.5 mM Tris- 

HCl Ph 6.8, 2.5% sodium dodecyl sulfate (SDS), 10% (v/v) glycerol 

and 5% (v/v) 2-mercaptoethanol] for two periods of 15 min each. 

The second dimension SDS electrophoresis was performed in 

12.5% polyacrylamide gels (Hoefer SE600, GE Healthcare, USA). 

The gels were stained with 0.1% colloidal Coomassie Brilliant Blue 

(CBB) G-250. The relative molecular mass of each protein was 

determined using standard markers (Amersham Bioscience, USA) 

and the isoelectric point (pI) by the migration of the protein spots on 

the IPG strip. The positions of individual proteins on the gels were 

evaluated automatically with 2-Dimension software (SineGene, 

USA).

Table 1. Primers sequences for RT-PCR analysis and their product size. 

Jankangram et al. 16159 

Primer name Forward primer Reverse primer 

Product 

size (bp) 

23 kDa polypeptide PSII (PSII-23) CCAGGAAGTTTGTCGAGAGC GAAACACACACGCACACACA 162 

Rubisco large subunit (Rubisco) GCTGCGGAATCTTCTACTGG GTAGAGCGCGTAAGGCTTTG 229 

Rubisco activase (RCA) TGTGGAGAACATTGGCAAGA CGCAGAACCGTAGAAGGAAC 223 

Putative oxygen evolving complex protein 

(OEC18) 

Fructose-bisphosphate aldolase, chloroplast 

precursor, putative, expressed (FBA) 

Sedoheptulose-1,7-bisphosphatase precursor 

(SBP) 

GCCAAGCCAGTAAAGCAAAG TGAAGTCGACGCACATTCTC 181 

GGGCGGAGACCTTCTTCTAC GTTCATCGCGTTCAGGTTCT 236 

CTCTTGATGGGTCCAGCATT ACATGCTGCCATTTTCCTTC 214 

40 kDa thylakoid lumen PPIase (TLP40) GGCACTGAGTAATGGGAGGA GCTTTGGAGCTACTGCATCC 152 

Phosphoglycolate phosphatase (PGP) CGATTTCCCCAAAGACAAGA ACCCTGGATTCTCACGAATG 242 

2-Cys peroxiredoxin BAS1, (Prx) TGAGACCATGAGGACCCTTC GATCAGACGAGCACACGGTA 244 

Thioredoxin Type H (Trx) TGCCGACCTTCCTATTCATC TCGCATGATATTCGAGGACA 240 

salT (salT) GGAATATGCCATTGGTCCAT GTCTTGCAGTGGAATGCTGA 214 

Ubiquitin 5 (UBQ5) ACCACTTCGACCGCCACTACT ACGCCTAAGCCTGCTGGTT 69 

Gel scanning and computer analysis 

The CBB-stained gels were scanned using a Cannon scanner 

(SineGene, USA) at a resolution of 600 dpi. Image editing, spot 

detection and protein quantification were carried out with 2- 

Dimension software (SineGene, USA). The gel scanning protocol 

was first subjected to background subtraction and smoothed to 

produce a synthetic gel image. The different gel patterns were 

compared, some spots were manually edited and matched to each 

other and then the quantities of matched spots were determined. 

The amount of a protein spot was expressed as the volume, 

defined as the sum of the intensities of all the pixels that made up 

the spot. The spot volumes were normalized as percentage of the 

total volume in all of the spots present in the gel. 

Mass spectrometry and database search 

The protein spots were excised from the polyacrylamide gels, 

digested with trypsin and subjected to MALDI-TOF-MS analysis at 

the Bio Service Unit at the National Science and Technology 

Development Agency (Bangkok, Thailand). The generations of 

peak lists of peptide mass fingerprints from raw MS data were 

conducted by Mascot software (Matrix Science, London, UK, 

www.matrixscience.com). The acquired peak lists were analyzed by 

searching NCBI database with the Mascot software. 

RNA extraction and RT-PCR assay of gene transcripts 

RNA was isolated from leaf tissue previously frozen and ground in 

liquid nitrogen using the RNeasy plant mini kit (Qiagen, USA) 

according to the manufacturer’s instructions. The quality and 

quantity of the isolated RNA was determined using denaturing 

formaldehyde-MOPS agarose gels and spectrophotometric analysis 

of the absorbance at 260 nm. cDNA was synthesized from one 

microgram of DNAse I–treated total RNA using the QuantiTect 

Reverse Transcription kit (Qiagen, USA) according to the 

manufacturer’s protocol. The cDNA products were used as 

templates for PCR amplification of gene transcripts as described in 

Boxall et al. (2005). The following conditions were used for the PCR 

reactions: pre-denaturation at 94°C (1 min) followed by 20 to 35 

cycles consisting of 30 s at 95°C (denaturing), 30 s at 55°C 

(annealing), 1 min at 72°C (extension) and a final extension for 7 

min at 72°C. 12 pairs of forward and reverse primers were used 

(Table 1). The primers were designed from the nucleotide 

sequences of genes encoding ten proteins identified in this study, 

one house-keeping gene, ubiquitin5 (UBQ5) (Jain et al., 2006) and 

a previously reported salt-regulated gene (salT) (Claes et al., 1990) 

using Primer3 (http://frodo.wi.mit.edu/primer3/). The PCR products 

from RT-PCR amplifications were separated on 3% (w/v) agarose 

gels and stained with ethidium bromide. The specificity of the 

primers was confirmed from the size of the PCR band and through 

cloning (Topo TA, Invitrogen) and sequencing the PCR products


(The Genome Analysis Centre, Norwich, UK) to obtain the 

anticipated sequence. Photographic documentation was performed 

using a gel documentation system (GENEFLASH, Syngene Bioimaging). 

For quantitation of relative band intensities, the pixel 

intensities of the RT-PCR products were analyzed using 

Metamorph software (Molecular Devices, USA) and normalized 

relative to the abundance of the UBQ5 loading control. 

RESULTS 

Protein expression in leaves 

Representative 2DE profiles of leaf proteins from control 

and salt-stress seedlings of KDML 105 and Pokkali are 

shown in Figures 1 and 2, respectively. The total number 

of well-separated and reproducible CBB-stained protein 

spots was lower in KDML 105 (200) than Pokkali (350), 

but matched reproducibly among triplicate gels. From the 

difference map generated by the 2-Dimension software, 

more than 100 protein spots showed different intensities 

between the control and salt-treated conditions. Proteins 

differing by at least 3-fold in average intensity between 

the control and the salt-treated group were recorded and 

confirmed by visual inspection of the stained gels. For KDML 

105, salinity treatment induced 25 differential protein spots, 

16 up-regulated and nine down-regulated while in 

Pokkali, 32 differential spots were detected of which 25 

and seven were up-regulated and down-regulated, respectively.A 

total of 24 differential protein spots (7 from 

KDML 105 and 17 from Pokkali, indicated by arrows in 

Figures 1 and 2) were excised from three replicate gels 

and analyzed. Of these, 12 spots matched the known 

proteins with significant (P ≤ 0.05) scores (Table 2). The 

number of matched peptides ranged from 4 to 13, and 

percent sequence coverage from 19 to 51%. 

All identifications showed a good correlation of 

theoretical and experimental pI and molecular weight 

(MW). Three salt-induced proteins (number 1 to 3) 

(Figure 1) were identified in KDML 105, while nine 

proteins (number 4 to 12) (Figure 2) were more abundant 

following NaCl stress in Pokkali. For the remaining 12 

spots, no significant matches were found due to either a 

mixture or a limited amount of protein recovered from the 

gels. 

The majority of the proteins identified as increased in 

the salt stressed rice seedlings were associated with a 

function in photosynthesis, oxygen evolution and the 

Calvin cycle; others were involved in photorespiration and 

antioxidant defense systems. In KDML 105, the two that 

increased in amount were identified as the 23 kDa 

polypeptide of photosystem II (PSII-23) and Rubisco 

activase (RCA). The third, which decreased following 

salt-stress, was identified as ribulose bisphosphate 

carboxylase/oxygenase large subunit (Rubisco). The nine 

proteins identified in Pokkali were Rubisco, PSII-23, 

putative oxygen evolving complex protein (OEC18), 

fructose-bisphosphate aldolase chloroplast precursor 

(FBA), sedoheptulose 1,7-bisphosphatase precursor 

(SBP), 40 kDa thylakoid lumen PPIase (TLP40), phosphoglycolate 

phosphatase (PGP), 2-cys peroxiredoxin 

chloroplast precursor protein (Prx) and thioredoxin type H 

(Trx). 

Effects of salt stress on gene expression in rice 

leaves 

The mRNA encoding the ten proteins identified by proteomics, 

plus two additional control genes (salt-regulated 

gene, salT and the house-keeping gene ubiquitin5, 

UBQ5), was amplified using RT-PCR. Transcripts of all 

12 genes were detected in both cultivars (Figure 3). In 

KDML 105, the relative abundance of FBA, SBP, TLP40, 

PGP, Trx and RCA mRNA increased in the saline 

conditions, while the amounts of PSII-23, OEC18, Prx 

and Rubisco remained the same as in the control (Figure 

3a). In Pokkali, the abundance of all transcripts but 

Rubisco increased (Figure 3b), consistent with the 

corresponding proteins. Transcripts of the positive control 

gene salT were salt-induced in both varieties but more so 

in KDML 105 while the abundance of transcripts 

encoding the control house-keeping gene UBQ5 differed 

little between control and salt-stressed tissues (Figure 

3c). 

DISCUSSION 

Salt-stressed rice leaf proteome 

We compared the salt-responsive proteomes from the 

leaf lamina of two contrasting rice varieties. The majority 

of proteins identified at increased levels in the saline 

growth medium in the salt-tolerant cultivar Pokkali were 

those related to photosynthesis, photorespiration and 

defense against oxidative stress. Of the three that could 

be identified in KDML 105, the levels of two (PSII-23, 

RCA) increased in saline conditions while the level of 

Rubisco was dramatically decreased (spot number 2) 

(Figure 1) in contrast to the substantially increased level 

in Pokkali (spot number 11) (Figure 2). The reduction in 

Rubisco under salt stress directly affects photosynthetic 

efficiency and growth of salt-sensitive rice genotypes 

(Singh et al., 2007). The up-regulation of proteins 

involved in photosynthesis (PSII-23, OEC18, Rubisco, 

FBA and SBP; Figure 2) in the tolerant genotype Pokkali 

points to a higher adaptive ability to adjust the efficiency 

of its photosynthetic machinery in response to salt stress 

(Cha-um et al., 2010). 

Similarly, the increased phosphoglycolate phosphatase 

(spot number 9, Figure 2), which is the first enzyme in the 

photorespiratory pathway in Pokkali may indicate

(a) (b) 

(c) (d) 


Figure 1. 2DE-PAGE analysis of proteins extracted from leaves of rice cv. KDML 105. 100 µg of proteins 

from control plants was loaded on IPG strips with a linear gradient of (a) pH 3 to 10 and (c) pH 4 to 7. 100 

µg of proteins from salt-stressed plants was loaded on IPG strips with a linear gradient of (b) pH 3 to10 

and (d) pH 4 to 7. The second dimensional separation was performed using a 12.5% polyacrylamide gel 

stained with CBB. Proteins showing differential amount between the control and salt-stressed conditions 

are shown in circles, while those excised for peptide mass fingerprint analysis are indicated by arrows 

4 

and those identified are numbered. 

stimulation of photorespiration as an electron sink to help 

minimize reactive oxygen species (ROS) production 

provoked by the increased photosynthetic flux. The low 

internal CO2 concentration in salt-stressed leaves due to 

a response of stomata closure, can lead to enhanced 

rates of photorespiration (Rajmane and Karage, 1986; 

Fedina et al., 1994). This is an important mechanism for 

energy dissipation in order to prevent photoinhibition 

occurring through damage to chloroplast components 

(Osmond et al., 1997) as well as generating glycine for 

the synthesis of glutathione, a component of the oxidative 

stress response system (Noctor et al., 1999). 

Salt stress imposed on rice plants is known to induce a 

secondary oxidative stress (Demiral and Türkan 2005; 

Kim et al., 2005; Parker et al., 2006). The increased 

levels of proteins involved in defense against oxidative 

stress (for example, Prx and Trx) in Pokkali (spot number 

10 and 12) (Figure 2) are likely to contribute to more 

efficient ROS detoxification and thus reduce cellular 

damage (Vaidyanathan et al., 2003; Dooki et al., 2006).


(a) (b) 

(c) (d) 

Figure 2. 2DE - PAGE analysis of proteins extracted from leaves of rice cv. Pokkali. 100 µg of 

proteins from control plants was loaded on IPG strips with a linear gradient of (a) pH 3 to 10 and 

(c) pH 4 to 7. 100 µg of proteins from salt-stressed plants was loaded on IPG strips with a linear 

gradient of (b) pH 3 to 10 and (d) pH 4 to 7. The second dimensional separation was performed 

using a 12.5% polyacrylamide gel stained with CBB. Proteins showing differential amount 

between the control and salt-stressed conditions are shown in circles, while those excised for 

peptide mass fingerprint analysis are indicated by arrows and those identified are numbered. 

The increase in TLP40 protein, a cyclophilin with a 

proposed role in maintenance of the photosynthetic 

complexes (Peltier et al., 2002) may also contribute to 

maintenance of metabolic activities. This is consistent 

with the visual observation of more pronounced leafyellowing 

in the salt-sensitive KDML 105 plants. 

Earlier proteomic analyses of the salt-stress response 

in the rice leaf lamina have reported changes in the 

abundance of proteins with functions similar to those 

found in this study. Comparing 2DE profiles of rice leaves 

(cv. Nipponbare; moderately salt-tolerant), Kim et al. 

(2005) detected 55 differentially-expressed CBB-stained 

spots, of which 47 were increased over the control. They 

were able to identify 33, most of which were involved in 

major metabolic processes related to photosynthetic 

carbon assimilation and photorespiration. Our study has 

also identified an increased level of several of these in 

Pokkali (Rubisco, FBA, PGP, SBP) as well as proteins of 

the photosystem II complex (PSII-23, OEC18) while only 

the PSII-23 protein and RCA were detected at elevated 

levels under saline conditions in KDML 105. Considering 

the central role of all these enzymes in carbon 

metabolism and energy transduction, their increased 

abundance in Pokkali under salt stress in our study most


Table 2. Identification of salt responsive proteins in the leaves of rice seedlings cv. KDML 105 (spot 1 to 3) and cv. Pokkali (spot 4 to 12) through MALDI - TOF MS. 

Spot 

number 

Matched protein Score 

Measured 

MW/pI 

Predicted 

MW/pI 

Sequence 

coverage (%) 

Matched 

peptide 

Intensity 

ratio 

Accession 

number 

1 

23 kDa polypeptide 

photosystem II (PSII-23) 

81 26.89/6.41 27.09/8.66 45 10 +4 NP - 001058863 

2 

Rubisco large subunit 

(Rubisco) 

67 62.30/6.66 53.44/6.04 25 13 -7 ABA96140 

3 Rubisco activase (RCA) 90 27.12/4.22 21.73/4.78 39 7 +5 AAK31173 

4 

5 

6 

7 

8 

9 

10 

11 

23 kDa polypeptide of 

photosystem II 

(PSII-23) 

putative oxygen evolving 

complex protein (OEC18) 

Putative fructosebisphosphate 

aldolase, 

chloroplast precursor 

(FBA) 

Sedoheptulose-1,7bisphosphatase 

precursor 

(SBP) 

40 kDa thylakoid lumen 

PPIase (TLP40) 

Phosphoglycolate 

phosphatase (PGP) 

2-Cys peroxiredoxin 

BAS1, 

chloroplast precursor 

(Prx) 

Rubisco large subunit 

(Rubisco) 

67 26.36/7.18 27.17/9.06 32 8 +4 AAB82135 

104 19.82/8.24 19.77/7.88 35 6 +3 AAM93722 

90 43.6/5.64 41.80/6.07 31 9 +6 

96 45.61/5.10 42.73/5.83 22 8 +4 

ABA91631 

AAO22558 

93 47.21/4.68 46.79/4.82 19 7 +5 NP - 001061695 

81 38.10/5.15 39.81/6.22 25 8 +9 CAH67343 

62 27.23/4.80 28.30/5.67 21 4 +5 NP - 001047050 

100 25.06/4.90 25.73/6.23 30 7 +7 ABB47308 

12 Thioredoxin Type H (Trx) 98 14.10/5.21 14.06/4.92 51 6 +5 1WMJ - A


(c) (c) cc 

(a) KDML 105 

(b) Pokkali 

Figure 3. Comparison of relative transcript abundance for genes identified via 2DE-PAGE in leaves from (A) 

KDML 105 and (B) Pokkali under salt-stress for 7 days (shaded) and control (open). The histogram shows 

mean relative transcript abundance from three biological replicates (+/- standard error) normalized to UBQ5. 

Representative semi-quantitative RT-PCR results are shown beneath (C) for salt stressed (s) and control (c) 

samples. 

likely reflects altered patterns of carbon flux that may not 

be achieved successfully by KDML 105. The fact that we 

could not detect a similar elevation of most of these 

proteins in KDML 105, and indeed observed a reduction 

in Rubisco in saline conditions, may indicate why it is so 

sensitive to salt stress. We therefore further compared

the levels of mRNA transcripts for the proteins to 

determine whether there were also differences between 

the cultivars at this level of gene expression. 

Relationship between changes in the level of 

transcripts and proteins 

In KDML 105, the levels of several transcripts were 

unaltered in saline growth conditions (PSII-23, OEC18, 

Prx, Rubisco) while levels of the remainder increased. 

This contrasts with the proteins of KDML 105 identified in 

our study. Levels of RCA strongly increased at both 

mRNA and protein level in saline conditions, whereas 

PSII-23 was clearly up-regulated at the protein level but 

its mRNA abundance was unchanged. The level of 

Rubisco transcript was unaltered by salinity even though 

the amount of protein decreased. In salt-stressed KDML 

105, an increase in the relative transcript abundance was 

obtained for several genes (FBA, SBP, Trx) where the 

protein products were not detected. In Pokkali, the 

corresponding mRNA transcripts encoding all nine upregulated 

proteins were increased. The level of transcripts 

of RCA, where the protein was not detected, also 

increased under saline conditions. Similarly, in both 

KDML 105 and Pokkali, the levels of the control saltregulated 

transcript SalT increased. This lack of 

correlation has been reported by Malakshah et al. (2007) 

in which they found no concordance between the 

changes in levels of transcripts and proteins of three saltresponsive 

genes (remorin, HIR and 14-3-3 protein) in 

rice roots. The elevated transcript abundance for 

important photosynthetic and protective genes in even 

unstressed Pokkali leaves may provide this salt-tolerant 

rice variety with better innate adaptation to salt stress 

compared to the sensitive KDML 105. A similar observation 

was found in a recent comparative transcriptome 

map of salinity stress response between Pokkali and 

IR64, a salt-sensitive cultivar (Kumari et al., 2009). These 

genes included functions in signaling (such as calmodulin 

binding protein and the zinc finger transcription factor, 

OSAP1), ion transport (including the vacuolar H + -ATPase 

and a voltage-dependent anion channel), protective 

proteins (such as late embryogenesis abundant proteins 

and glutathione-S-transferase II) and proteins with roles 

in photosynthesis (Rubisco small subunit). 

In conclusion, elevated levels of proteins involved in 

photosynthesis, photorespiration and the oxidative stress 

detoxification system play important roles in conferring 

tolerance to salt stress in the rice cultivar Pokkali by 

providing more efficient metabolic readjustment, thus 

leading to higher photosynthetic efficiency and hence a 

better growth performance. In the economically important 

but salt sensitive variety KDML 105, transcripts of some 

genes examples are FBA, SBP, TLP40, PGP, Trx and 

RCA; were up-regulated upon salt stress and increase in 


only two proteins could be detected (PSII-23, RCA). In 

addition, levels of the major leaf protein Rubisco 

decreased in KDML 105, an observation that is frequently 

observed after tissue damage. This provides evidence 

that although KDML 105 expresses genes for several 

proteins needed for salt tolerance, it is unable to induce 

these stress-responsive processes at both transcriptional 

and post-transcriptional levels as effectively as Pokkali. 

With this information, the challenge is how to under-stand 

the regulatory basis for these differences. Improve-ments 

to salinity tolerance in economically important cultivars 

like KDML 105 will require a comprehensive and 

integrated knowledge of the transcriptomic, proteomic 

and metabolomic responses to salt. Such large scale 

functional genomics studies should allow the key 

regulators of salt-tolerance to be elucidated and thus 

facilitate attempts to either breed or engineer these traits 

into salt-sensitive cultivars like KDML 105. 


This work was supported by a Ph. D. scholarship from 

the Thailand Commission on Higher Education to the first 

author and a Khon Kaen University Research Grant to 

the corresponding author. 

REFERENCES 

Boxall SF, Foster JM, Bohnert HJ, Cushman JC, Nimmo HG, 

Hartwell J (2005). Conservation and divergence of circadian clock 

operation in a stress-inducible crassulacean acid metabolism species 

reveals clock compensation against stress. Plant Physiol. 137: 969- 

982. 

Bradford MM (1976). A rapid and sensitive method for the quantitation 

of microgram quantities of protein utilizing the principle of protein-dye 

binding. Anal. Biochem. 72: 248-254. 

Cha-um S, Supaibulwatana K, Kirdmanee C (2006). Water relation, 

photosynthetic ability and growth of Thai Jasmine rice (Oryza sativa 

L. ssp. indica cv. KDML 105) to salt stress by application of 

exogenous glycinebetaine and choline. J. Agron. Crop Sci. 192: 25- 

36. 

Cha-um S, Ashraf M, Kirdmanee C (2010) Screening upland rice (Oryza 

sativa L. ssp. indica) genotypes for salt-tolerance using multivariate 

cluster analysis. Afr. J. Biotechnol. 9: 4731-4740. 

Claes B, Dekeyser R, Villarroel R, den Bulcke M, Bauw G, Montagu M, 

Caplan A (1990). Characterization of a rice gene showing organspecific 

expression in response to salt stress and drought. Plant Cell, 

2: 19-27. 

Demiral T, Türkan I (2005). Comparative lipid peroxidation, antioxidant 

defense systems and proline content in roots of two rice cultivars 

differing in salt tolerance. Environ. Exp. Bot. 53: 247–257. 

Dooki AD, Mayer-Posner FJ, Askari H, Zaiee A, Salekdeh GH (2006). 

Proteomic responses of rice young panicles to salinity. Proteomics, 6: 

6498-6507. 

Fedina IS, Tsonev TD, Guleva EI (1994). ABA as a modulator of the 

response of Pisum sativum to salt stress. Plant Physiol. 143: 245- 

249. 

Fitzgerald MA, McCouch SR, Hall RD (2009). Not just a grain of rice: 

the quest for quality. Trends Plant Sci. 14: 133-139.

Flowers TJ, Yeo AR (1981). Variability in the resistance of sodium 

chloride salinity within rice (Oryza sativa L.) varieties. New Phytol. 88: 

363-373. 


Heenan DP, Lewin LG, McCaffery DW (1988). Salinity tolerance in rice 

varieties at different growth stages. Aust. J. Exp. 28: 343-349. 

Jain M, Nijhawan A, Tyagi AK, Khurana JP (2006). Validation of 

housekeeping genes as internal control for studying gene expression 

in rice by quantitative real-time PCR. Biochem. Biophys. Res. 

Commun. 345: 646–651. 

Kawasaki S, Borchert C, Deyholos M, Wang H, Brazille S, Kawai K, 

Galbraith D, Hans JB (2001). Gene expression profiles during the 

initial phase of salt stress in rice. Plant Cell, 13: 889-905. 

Kim DW, Rakwal R, Agrawal GK, Jung YH, Shibato J, Jwa N-S, 

Iwahashi Y, Iwahashi H, Kim DH, Shim I-S, Usui K (2005). A 

hydroponic rice seedling culture model system for investigation 

proteome of salt stress in rice leaf. Electrophoresis, 26: 4521-4539. 

Kumari S, Sabharwal VP, Kushwaha HR, Sopory SK, Singla-Pareek SL, 

Pareek A (2009). Transcriptome map for seedling stage specific 

salinity stress response indicates a specific set of genes as candidate 

for saline tolerance in Oryza sativa L., Funct. Integr. Genom. 9: 109- 

123. 

Malakshah SN, Rezaei MH, Heidari M, Salekheh GH (2007) Proteomics 

reveals new salt responsive proteins associated with rice plasma 

membrane. Biosci. Biotechnol. Biochem. 71: 2144-2154. 

Mohammadi-Nejad G, Arzani A, Rezai AM, Singh RK, Gregorio GB 

(2008) Assessment of rice genotypes for salt tolerance using 

microsatellite markers associated with the saltol QTL. Afr. J. 


Noble CL, Rogers ME (1992). Arguments for the use of physiological 

criteria for improving the salt tolerance in crops. Plant Soil, 146: 99- 

107. 

Noctor G, Arisi ACM, Jouanin L, Foyer CH (1999). Photorespiratory 

glycine enhances glutathione accumulation in both the chloroplastic 

and cytosolic compartments. J. Exp. Bot. 50: 1157-1167. 

Osmond CB, Badger M, Maxwell K, Björkman O, Leegood RC (1997). 

Too many photons: photorespiration, photoinhibition and 

photooxidation. Trends. Plant Sci. 2: 119-121. 

Parida AK, Das AB (2005). Salinity tolerance and salinity effects on 

plants: a review. Ecotox. Environ. Saf. 60: 324-349. 

Parker R, Flowers TJ, Moore AL, Harpham NVJ (2006). An accurate 

and reproducible method for proteome profiling of the effects of salt 

stress in the rice leaf lamina. J. Exp. Bot. 57: 1109-1118. 

Peltier JB, Emanuelsson O, Kalume DE, Ytterberg J, Friso G, Rudella 

A, Liberles DA, Söderberg L, Roepstorff P, von Heijne G, van Wijk KJ 

(2002) Central functions of the luminal and peripheral thylakoid 

proteome of Arabidopsis determined by experimentation and 

genome-wide prediction. Plant Cell, 14: 211-236. 

Rabbani MA, Maruyama K, Abe H, Khan AA, Katsura K, Ito Y, 

Yoshiwara K, Seki M, Shinosaki K, Yamaguchi-Shinozaki K (2003). 

Monitoring expression profiles of rice genes under cold, drought, and 

high salinity stresses and abscisic acid application using cDNA 

microarray and RNA gel blot analyses. Plant Physiol. 133: 1755- 

1767. 

Rajmane NA, Karage BA (1986). Photosynthesis and photorespiration 

in winged bean (Psophocarpus tetragonobolus L.) grown under saline 

condition. Photosynthetica, 20: 139-145. 

Singh MP, Singh DK, Rai M (2007). Assessment of growth, 

physiological and biochemical parameters and activities of 

antioxidative enzymes in salinity tolerant and sensitive Basmati rice 

varieties. J. Agron. Crop Sci. 193: 398-412. 

Theerakulpisut P, Bunnag S, Kong-ngern K (2005). Genetics diversity, 

salinity tolerance and physiology responses to NaCl of six rice (Oryza 

sativa L.) cultivars. Asian J. Plant Sci. 4: 562-573. 

Vaidyanathan H, Sivakumar P, Chakrabarty R, Thomas G (2003). 

Scavenging of reactive oxygen species in NaCl-stressed rice (Oryza 

sativa L.) – differential responses in salt-tolerant and sensitive 

varieties. Plant Sci. 165: 1411-1418. 

Yeo A (1999). Predicting the interaction between the effects of salinity 

and climate change on crop plants. Sci. Hort. 78: 159-174. 

Yoshida S, Forno DA, Cock JH, Gomez KA (1976). Laboratory Manual 

for Physiological Studies of Rice. The International Rice Research 

Institute, Manila, Philippines. 

Yoshihashi T, Huong NTT, Kabaki N (2002). Quality evaluation of Khao 

Dawk Mali 105, an aromatic rice variety of northeast Thailand. 

JIRCAS. Working Report No. 30.



DOI: 10.5897/AJB11.1749 



Genetic diversity and relationship analysis among 

accessions of Aegilops ssp. in Turkey using amplified 

fragment length polymorphism (AFLP) markers 

Ilhan Kaya 1,2 *, Asude Çallak Kirişözü 2 , Figen Yildirim Ersoy 3,2 , Şahin Dere 4,2 and Mahinur S. 

Akkaya 2 

1 Department of Agriculture, Plant Protection, Van Yuzuncuyil University, Van, TR-65080, Turkey. 

2 Department of Chemistry, Biochemistry and Biotechnology Programs, Middle East Technical University, 

Ankara, TR-06531, Turkey. 

3 Department of Biology, Uludag University, Gorukle, Bursa, TR-16059. Turkey. 

4 Department of Field Crops, Agricultural Faculty, Ordu University, Ordu, TR-52200, Turkey. 


Amplified fragment length polymorphism (AFLP) DNA markers were used to assess the genetic 

diversity and relationships between 55 accessions of genus Aegilops, including the species Aegilops 

triuncialis L. (UUCC), Aegilops geniculata Roth (MMUU), Aegilops cylindrica Host (CCDD) and Aegilops 

umbellulata Zhuk (UU). The samples were collected from Aegean region and East Anatolia, Turkey. 16 

AFLP selective primer combinations generated a total of 3200 polymorphic amplification products. 50 

Aegilops accessions were analyzed using the data analysis software, unweighted pair-group method 

arithmetic average (UPGMA) method and numerical taxonomy and multivariate analysis system 

(NTSYSpc-2.02k). The similarity index coefficients were calculated according to simple matching 

coefficient. Using 16 AFLP primer combinations, species from Aegean region and east Anatolia were 

clustered as four major groups. Aegilops species having U genome clustered together and A. cylindrica 

host was out grouped. 

Keywords: Aegilops cylindrica, Aegilops triuncialis, Aegilops umbellulata, Aegilops geniculata, amplified 

fragment length polymorphism (AFLP), Li-COR, genetic relationship, unweighted pair-group method arithmetic 

average (UPGMA), principle coordinate analysis. 

INTRODUCTION 

The wild species of Triticeae family, especially the genus 

Aegilops L. are valuable sources of genetic variation for 

wheat improvement since they possess the genetic 

background of all the cultivated wheat having still unidentified 

important characters such as resistance to 

different biotic and abiotic stresses (Rekika et al., 1998; 

Zaharieva et al., 2004). The genus Aegilops L. has been 

the most intensively studied group of grasses, especially 

since it is closely related to the cultivated wheat (van 

Slageren, 1994). Aegilops ssp. is thought to be a genetic 

reserve for the improvement of the wheat cultivars 

*Corresponding author. E-mail: ilhank@yyu.edu.tr. Tel: +90 533 

323 5449. Fax: +90 432 225 1104. 

(Damania, 1993). Aegilops spreads mainly in central Asia 

and Mediterranean region (van Slageren, 1994). Turkey 

is the center of diversity for this genus and it is rich in wild 

populations of tetraploid species: Aegilops triuncialis L. 

(UUCC), Aegilops geniculata Roth (MMUU), Aegilops 

cylindrica Host (CCDD) and diploid species: Aegilops 

umbellulata Zhuk. (UU). A. cylindrica and A. triuncialis 

are widely distributed in Turkey adding up to 15 species 

of Aegilops (Davis, 1985). Ecogeographic studies are 

necessary as they determine the genetic relationship and 

also guide conservation programs for the target plant 

species (Anikster and Noy-Meir, 1991). DNA-based 

molecular markers are particularly useful both for 

quantifying genetic diversity within plant species and for 

identifying and characterizing closely related genotypes 

(Jasieniuk and Maxwell, 2001). Molecular markers can


provide information needed to select genetically diverse 

parents for developing breeding and mapping populations, 

among which the AFLP markers have been 

successfully used to determine genetic diversity in many 

plant species (Sharma et al., 1996; Pillay and Myers, 

1999). 

AFLP markers are generated by selective amplification 

of a subset of restriction fragments from total genomic 

DNA (Vos et al., 1995; Mueller and Wolfenbarger 1999). 

The reproducibility, heritability, effectiveness and reliability 

of these amplified DNA products have substantial 

advantages when compared with other marker systems 

(Russell et al., 1997). The PCR-based AFLP markers are 

amenable to automation for high-throughput genotyping 

and, being anonymous, do not require any sequence 

information (Rouf Mian et al., 2002). AFLP fingerprinting 

is considerably informative, allowing the survey of 

variation in more than 50 co-amplified restriction fragments 

in each AFLP reaction (Incirli and Akkaya, 2001; 

Sudupak et al., 2004; Yildirim and Akkaya, 2006). Li-COR 

IR 2 automated DNA sequencers and associated software 

have been demonstrated to efficiently generate and 

analyze complex AFLP patterns of various genomes (Qui 

et al., 1999; Remington et al., 1999). We applied AFLP 

markers to characterize the genetic diversity and 

relationships among different populations of Aegilops in 

Turkey using Li-COR instrument. 


The materials of the study consist of A. cylindrica, A. geniculata, 

A.truncialis and A. umbellulata gathered from the Aegean and the 

Eastern Anatolia Regions in 2005. 50 individuals from a total of 11 

populations belonging to these plants were collected (Table 1). 

DNA isolation 

The seeds of Aegilops were germinated and DNA was isolated from 

the seedlings of two weeks old leaves starting with 200 mg young 

leaf tissue using a minor modified cetyl trimethyl ammonium 

bromide (CTAB) method. 

AFLP analysis 

AFLP analysis was carried out according to Vos et al. (1995) using 

fluorescently labeled primers and bands were detected using a Li- 

COR automated sequencer (model 4300). All the chemicals and 

enzymes apart from 10X reaction buffer and Taq DNA polymerase 

were present in the kit provided by Li-COR (IRDye Fluorescent 

AFLP Kit for Large Plant Genome Analysis). Genomic DNA (200 

ng) was double digested with 1.5 units each of EcoRI and MseI 

(MBI Fermentas) in a final volume of 20 µl and incubated at 37°C 

for 2 h. 7.5 and 75 pmols of adaptors EcoRI and MseI, respectively, 

were ligated to the resulting fragments (20 µl of the digestion mix) 

using 1 unit of T4 DNA ligase (Roche diagnostics GmbH) in a final 

volume of 25 µl buffer ligase 1X and incubated for 2 h at 25°C. The 

ligation mix was diluted 1/10 and 2.5 µl were added to the 

preamplification reaction containing AFLP Pre-amp primer mix, 1X 

PCR reaction buffer, 2.5 U Taq DNA polymerase (Roche 

diagnostics GmbH) in a final volume of 25 µl. Preamplification was 

performed in a PTC-100 MJ Research Inc. thermocycler as in the 

following steps: 2 min 95°C, 20 cycles of 30 s at 94°C, 1 min at 

56°C, 1 min at 72°C and 4 min at 72°C. The preamplification mix 

was diluted to 1/40 and 2 µl was added to the selective 

amplification reaction, containing 1 µM IRDye 700 labeled EcoRI 

primer A, 1 µM IRDye 800 labeled EcoRI primer B and 1 µM MseI + 

3 (Table 2), reaction buffer lX, 0.25 mM each dNTPs and 1 unit of 

Taq DNA polymerase in a final volume of 20 µl. Selective 

amplification was performed on a Stratagene Mx3005P Real Time 

Thermal Cycler as follows: 13 touchdown cycles (- 0.7°C per cycle) 

of 30 s at 94°C, 30 s at 65°C, l min at 72°C; 23 cycles of 30 s at 

94°C, 30 s at 56°C, 1 min at 72°C and 10 min at 72°C. A total of 16 

selective primer combinations were used. 

The PCR products were separated by electrophoresis in a 6.5% 

polyacrylamide gel using the Li-COR 4300 DNA Analyzer and 

analyzed using the Saga Generation Software. Genetic similarity 

and diversity analysis among 55 Aegilops varieties were performed 

using the data analysis software, UPGMA method and NTSYSpc- 

2.02k (Rholf, 1997). The similarity index coefficients were 

calculated according to simple matching (SM) coefficient (Rholf, 

1997). 

RESULTS 

Turkey is rich in tetraploid species: A. triuncialis L. 

(UUCC), A. geniculata Roth (MMUU), A. cylindrica Host 

(CCDD) and diploid species: A. umbellulata Zhuk. (UU). 

Thus, it is important to find the genetic diversity of these 

species in Turkey. 16 selective primer combinations 

resulted in 3200 polymorphic bands to measure the 

genetic diversity within 55 accessions of Aegilops genus. 

A dendrogram was generated from the data using the 

UPGMA and the program NTSYSpc 2.02k (Figure 1). 

Principle coordinate analysis of the data was also 

determined (Figures 2 and 3). 

The genetic diversity within the 55 accessions of A. 

triuncialis L. (UUCC), A. geniculata Roth (MMUU), A. 

cylindrica Host (CCDD) and A. umbellulata Zhuk were 

calculated using 16 selective primer combinations which 

resulted in 3200 polymorphic bands (UU). In the tree, the 

species sharing the U genome formed a main cluster and 

A. cylindrica which is intensely associated with A. 

squarrosa (DD), was clearly different from the other 

species, due to the influence of the presence of distant D 

genome. This genome has undergone less divergence 

than other diploid genomes during evolution and 

therefore appears to be less modified and is well 

separated within the Triticeae (Damania, 1993; Badaeva 

et al., 1996). 

AFLP based UPGMA dendrogram of Aegilops accessions 

is presented in Figure 1, in which there are four 

main clusters: A. cylindrica (Ac), A. triuncialis (At), A. 

umbellulata (Au) and A. geniculata (Ag). The closest 

genetic similarity between genotypes (0.980 simple 

matching coefficient) was determined between Ag9 and 

Ag10 genotypes. Other genetic similarity results are respectively 

as follows: the similarity between Au5 and Au6 

(0.958 simple matching coefficient), the similarity between 

At9 and At10 (0.948 simple matching coefficient), the

Table 1. The species of Aegilops L. collected from Turkey: sample numbers, locations, species and genomes. 

S/N Location (city) Coordinate Species Genome 

1 Uşak 38° 40.507N, 029° 18.648E, 928 m A. cylindrica CCDD 

2 Uşak 38°40.507N, 029° 18.648E, 928 m A. cylindrica CCDD 

3 Uşak 38°40.507N, 029° 18.648E, 928 m A. cylindrica CCDD 



6 Van 38° 33.794N, 043° 17.839E, 1672 m A. cylindrica CCDD 










16 Uşak 38° 40.507N, 029° 18.648E, 928 m A. triuncialis UUCC 



19 Uşak 38 v 40.507N, 029° 18.648E, 928 m A. triuncialis UUCC 


21 Van 38 v 25.543N, 043° 15.695E, 1664 m A. triuncialis UUCC 

22 Van 38° 25.543N, 043° 15.695E, 1664 m A. triuncialis UUCC 









31 Van 38 0 25.544N, 043° 15.697E, 1664 m A. umbellulata UU 

32 Van 38° 25.544N, 043° 15.697E, 1664m A. umbellulata UU 




36 Van 38 v 31.868N, 043° 20.808E, 1671m A. umbellulata UU 


38 Van 38 v 31.868N, 043 0 20.808E, 1671m A. umbellulata UU 



41 Uşak 38° 40.476N, 029° 16.412E, 902 m A. umbellulata UU 





46 Izmir 38° 31.229N, 026° 37.433E, 16 m A. geniculata MMUU 





51 Uşak 38° 40.620N, 029° 22.638E, 904 m A. geniculata MMUU 

Kaya et al. 16169


Table 1. Contd 





Table 2. MseI and IRDye 700 labeled EcoRI primers used in selective 

amplification reaction. 

Primer Flourescent label Sequence (5’-3’) 

M-CAA - GATGAGTCCTGAGTAACAA 

M-CAC - GATGAGTCCTGAGTAACAC 

M-CAG - GATGAGTCCTGAGTAACAG 

M-CAT - GATGAGTCCTGAGTAACAT 

M-CTA - GATGAGTCCTGAGTAACTA 

M-CTC - GATGAGTCCTGAGTAACTC 

M-CTG - GATGAGTCCTGAGTAACTG 

M-CTT - GATGAGTCCTGAGTAACTT 

E-AAC IRDye 700 GACTGCGTACCAATTCAAC 

E-AAG IRDye 700 GACTGCGTACCAATTCAAG 

E-ACA IRDye 700 GACTGCGTACCAATTCACA 

E-ACT IRDye 700 GACTGCGTACCAATTCACT 

E-ACC IRDye 800 GACTGCGTACCAATTCACC 

E-ACG IRDye 800 GACTGCGTACCAATTCACG 

E-AGC IRDye 800 GACTGCGTACCAATTCAGC 

E-AGG IRDye 800 GACTGCGTACCAATTCAGG 

similarities between Au3 and Au4, Ag7 and Ag9 (0.946 

simple matching coefficient). The least genetic similarity 

between genotypes was found between Au8 and Au9 

(0.800 simple matching coefficient). Christiansen et al. 

(2002) and Lage et al. (2003) showed similar results and 

generally followed the trend that increased geographical 

distance correlates with increased genetic distance. 

In the analysis of the dendrogram, with 2 and 3 

dimensional scaling; it was detected that the genotypes 

of Ag2, Ag5, Ag6, Au8 and Au9 had a different branching 

pattern from the one expected. Ac3, Ac13, At1, At2 and 

At15 had different branching patterns and positions from 

other genotypes. It was found that genotypes with high 

similarity (Ag6, Ag7, Ag9 and Ag10) and genotypes 

gathered from similar populations (Au5, Au6 and At9, 

At10) had the same branching pattern and positions in 

general (Figures 2 and 3). Since the genus Aegilops L. is 

a valuable source of genetic variation, the data presented 

here might have advantage in various studies in future. 

DISCUSSION 

Periodical genetic diversity assessments of all kinds of 

wild type plant species are very important for many 

reasons, but it is more crucial for the wild types of wheat 

since they are genome donors of cultivated wheat. Since 

the cultivated wheat has a very narrow genetic diversity, 

for crop improvement, we always need to investigate the 

traits hidden in the wild types or the ancestors of the 

wheat, so that we can maintain the sustainable agriculture 

to feed ever increasing human population. Thus, 

by continual diversity assessment in nature, we can 

maintain the most diverse species in gene banks for 

conservation and crop improvement purposes. The 

effects of environmental changes or climate fluctuations 

on the natural diversity can also be traced by continual 

analyses. This is especially the case for Aegilops species 

in Turkey since the land is the center of origin for these 

Aegilops species.

Coefficient 

Figure 1. AFLP-based UPGMA dendrogram of Aegilops accessions. 

Kaya et al. 16171 

Ac1 

Ac2 

Ac3 

Ac4 

Ac5 

Ac6 

Ac7 

Ac8 

Ac9 

Ac10 

Ac11 

Ac12 

Ac13 

Ac14 

Ac15 

At1 

At2 

At3 

At4 

At5 

At6 

At7 

At8 

At9 

At10 

At11 

At14 

At12 

At13 

At15 

Au1 

Au2 

Au3 

Au4 

Au5 

Au6 

Au7 

Au10 

Au9 

Au11 

Au12 

Au13 

Au14 

Au15 

Ag1 

Ag2 

Ag3 

Ag6 

Ag7 

Ag9 

Ag10 

Ag8 

Ag4 

Ag5 

Au8


Figure 2. 2D plot generated by principle coordinate analysis.

Figure 3. 3D plot of the principal coordinate analysis of the AFLP data generated by NTSYS. 

AFLP marker system to test the genetic diversity is one of 

mostly used marker system since, it is multi-locus, thus 

highly polymorphic, reproducible and high through-put 

instrumentation is available, such as Li-Cor. Thus, in this 

study, we preferred to perform analysis using AFLP 

highly polymorphic marker system. We believe the data 

presented here will be a tool for other wheat researchers. 

REFERENCES 

Anikster Y, Noy-Meir I (1991). The wild-wheat field laboratory at 

Ammiad. Isr. J. Bot. 40: 351-362. 

Badaeva ED, Friebe B, Gill BS (1996). Genome differentiation in 

Aegilops 2. physical mapping of 5S and 18S-26S ribosomal RNA 

gene families in diploid species. Genome, 39: 1150-1158. 

Christiansen MJ, Andersen SB, Ortiz R (2002). Diversity changes in an 

intensively bred wheat germplasm during the 20th century. Mol. 

Breed. 9: 1-11. 

Damania AB (1993). Biodiversity and wheat improvement. ICARDA, 

John Wiley and Sons Inc. New York. 

Davis PH (1985). Flora of Turkey. Edinburg at the University Press, 

22(9): p. 235. 

Incirli A, Akkaya MS (2001). Assessment of genetic relationships in 

durum wheat cultivars using AFLP markers. Genet. Resour. Crop 

Eviron. 48: 233-238. 

Jasieniuk M, Maxwell BD (2001). Plant diversity: new insights from 

Kaya et al. 16173 

molecular biology and genomics technologies. Weed Sci. 49: 257- 

265. 

Lage J, Warburton ML, Crossa J, Skovmand B, Andersen SB (2003). 

Assessment of genetic diversity in synthetic hexaploid wheats and 

their Triticum dicoccum and Aegilops tauschii parents using AFLPs 

and agronomic traits. Euphytica, 134: 305-317. 

Mueller UG, Wolfenbarger LL (1999). AFLP genotyping and 

fingerprinting. Trends Ecol. Evol. 14: 389-394. 

Pillay M, Myers GO (1999). Genetic diversity in cotton assessed by 

variation in ribosomal RNA genes and AFLP markers. Crop Sci. 39: 

1881-1886. 

Qui J, van Santen E, Tuzun S, Campos-Andrada M (1999). Genetic 

analysis of Lupinus luteus and L. cosentinii using fluorescence 

labelled AFLP primers. 9th Int. Lupin Conf. 

Rekika D, Zaharieva M, Stankova P, Xu X, Souyris I, Monneveux P 

(1998). Abiotic stress tolerance in Aegilops species. In: Nachit MM, 

Baum M, Porceddu E, Monneveux P, Picard E (eds.) Durum Res. 

Crop Evol. 42: 339-345. 

Rholf FJ (1997). NTSYS-Pc: Numerical Taxonomy and Multivariate 

Analysis System. Exeter Software, New York. 

Rouf Mian MA, Hopkins AA, Zwonitzer JC (2002). Determination of 

genetic diversity in tall fescue with AFLP markers. Crop Sci. 42: 944- 

950. 

Russell JR, Fuller JD, Macaulay M, Hatz BG, Jahoor A, Powell W, 

Waugh R (1997). Direct comparison of levels of genetic variation 

among barley accessions detected by RFLPs, AFLPs, SSRs and 

RAPDs. Theor. Appl. Genet. 95: 714-722. 

Sharma SK, Knox MR, Ellis THN (1996). AFLP analysis of the diversity 

and phylogeny of Lens and its comparison with RAPD analysis. 

Theor. Appl. Genet. 93: 751-758.


Sudupak MA, Akkaya MS, Kence A (2004). Genetic reletionships 

among perennial and annual Cicer species growing in Turkey 

assessed by AFLP fingerprinting. Theor. Appl. Genet. 108: 937-944. 

van Slageren MW (1994). Wild wheats: a monograph of Aegilops L. and 

Amblyopyrum (Jaub.&Spach) Eig. (Poaceae). Wageningen Agric. 

Univ. 

Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, 

Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M (1995). AFLP: a 

new technique for DNA fingerprinting. Nucleic Acids Res. 23: 4407- 

4414. 

Yildirim F, Akkaya MS (2006). DNA fingerprinting and genetic 

characterization of Anatolian Triticum sp. using AFLP markers. 

Genet. Resour. Crop Eviron. 53: 1033-1042. 

Zaharieva M, Prosperi JM, Monneveux P (2004). Ecological distribution 

and species diversity of Aegilops L. genus in Bulgaria. Biodivers. 

Conserv. 13: 2319-2337.



DOI: 10.5897/AJB11.1985 



Determination of total polyphenol content and 

antityrosinase capacity of mulberrymedicine 

(Morusnigra L.) extract 

Wu Chun, Xu Li*, Wang Yuancheng, Chen Hu and Huang Xianzhi 

College of Biotechnology, Southwest University, Chongqing 400716, China. 


Total polyphenol content and antityrosinase capacity of mulberry medicine extract were evaluated for 

its development and utilization. Total polyphenols were extracted from mulberry medicine with 70% 

alcohol solution. The content of total polyphenols was determined by ultraviolet spectrophotometer and 

the capacity of antityrosinase was evaluated by using the enzyme-linked immunosorbent assay(ELISA) 

method. Results show that the content of polyphenols was up to 8.668 mg/g and tyrosinase halfinhibitory 

concentration (IC50) was 12.12 mg/ml. Kinetic study indicated that the mechanism of 

tyrosinase inhibition was mixed type inhibition. 

Key words:Morusnigra L., extraction of medicine mulberry, polyphenols, tyrosinase. 

INTRODUCTION 

Tyrosinase (TYR) is widely distributed in human beings, 

animals, plants and microorganisms. It is the crucial 

enzyme which restricts the output of melanin (Fenoll et 

al., 2004). Not only does it have the activity of 

monophenol oxidase, but it also has the activity of 

diphenol oxidase(Gong et al., 2005; Shi et al., 2005). It 

catalyzes the following reactions: 

HO 

COOH 

NH 2 

TYR(Diphenol oxidase) 

TYR(Monophenol oxidase) 

O 

O 

HO 

HO 

COOH 

NH 2 

COOH 

Disorders of melanin pigmentation and melanoma can be 

attributed to the malfunction of tyrosinase. Tyrosinase 

existing in plants is the main cause of their enzymatic 

browning, while tyrosinase existing in insects plays an 

NH 2 

*Corresponding author. E-mail: mulberry@swu.edu.cn. 

Fax: 023-68250191. 

important role in their tanning process (Fenoll et al., 

2004; Kubo et al., 2003). By inhibiting the activity of 

tyrosinase, tyrosinase inhibitors can restraint the 

production of melanin; therefore, they have an extensive 

prospect in cosmetic,medicine and agriculture. In recent 

years, the tyrosinase inhibitors have been investigated 

extensively (Chang et al., 2011; Prasad et al., 2010; 

Behera et al., 2007; Rangkadilok et al., 2007). 

Polyphenols, possessing several phenolic hydroxyls, 

are excellent hydrogen or electron donors and have an 

amount of antioxidant activity. They can effectively 

remove superoxides and hydroxyl radicals (Bouaziz et 

al., 2009). Previous researches have already shown that 

polyphenols are effective tyrosinase inhibitors (Bouaziz et 

al., 2009; Jewell and Ebeler, 2001). Thus, polyphenols 

can be regarded as a kind of tyrosinase inhibitors.In 

addition to possessing good antioxidation and 

antityrosinase activity, polyphenols have some other 

functions. For example, the green and black tea 

polyphenols have the activity of anti-cervical cancer 

which is the second most common malignant neoplasm 

in women, in terms of both incidence and mortality rates 

worldwide (Singh et al., 2010). Red wine polyphenols 

cause growth inhibition and apoptosis in acute 

lymphoblastic leukaemia cells by inducing a redoxsensitive 

up-regulation of p73 and down-regulation of 

UHRF1 (Sharif et al., 2010).


Figure 1.Medicine mulberry. 

Mulberry medicine (Figure 1) is a half-domesticated 

plant. In plant taxonomy, it is black mulberry species 

(Morusnigra Linn). It was originated in Iran, and cultivated 

in Xinjiang Province in the 16th century. Mulberry 

medicine is the only black mulberry species which has 22 

haploid sets of chromosomes in a body cell. It is also a 

very precious officinal resource in nature. Mulberry 

medicine is a traditional Uyghur medicine in china and 

has the efficacy of anti-oxidation (Lqbal et al., 2010), 

delaying aging (Jiang, 2010), protecting liver and 

decreasing blood sugar level (Hemmati et al., 2010). The 

juice of mulberry medicine has a lot of active contents, 

including polyphenols, alkaloid, vitamin C, amino acids, 

polysaccharose etc(Ercisli et al., 2008, 2007, 2010; 

Koyuncu et al., 2004). These contents have the property 

of removing free radicals and are potent antioxidants. 

The objectives of this study were to determine the 

content of total polyphenols in mulberry medicine 

extraction, and investigate its inhibition effect on 

tyrosinase. 


Mature mulberry medicine (from The Germ Plasm Resource 

Garden of Institute of Sericulture of Xinjiang Province) was dried 

naturally and ground into powder. 

Ethanol, phosphoric acid, hydrogen peroxide, lithium sulfate, 

concentrated hydrochloric acid, natriumcarbonicumcalcinatum, 

sodium methoxide, gallic acid, sodium wolframate, sodium nitrite, 

aluminum nitrate, sodium hydroxide, rutin, monopotassium 

phosphate, potassium hydroxide and dopa (L-dopa) were of 

analytical pure grade and purchased from Taixin Reagent Company 

(Chongqing, China). Arbutin and mushrooms tyrosinase were of 

HPLC grade and obtained from Dingguo Reagent Company 

(Chongqing, China). 

Electronic balance was obtained from FA2004A, Shanghai 

Jingtian Electronics Co., Ltd; ultraviolet spectrophotometer, Xinshiji 

T6, Beijing Puxi General Co., Ltd; grinder, FFC-45D, LinyiDahua 

Machinery Works; ELIASA, BIO-RAD iMarkmicroplate Reader, 

Japan. 

Extraction of total polyphenols 

Twenty five grams of mulberry medicine powder was immersed in 

40 ml 70% ethanol solution for 4 h, and then filtered. The process 

was repeated twice and all of them were done under room 

temperature. The filtrate was added with 70% ethanol solution to 

100 ml. 

Determination of total polyphenols 

This was carried out according to the method of Bae and Suh 

(2007), with some modifications. In brief, 20 g of sodium wolframate 

and 5 g of sodium methoxide were placed in round bottomed flask 

and dissolved with 140 ml of distilled water.Then, 10 ml of 85% 

phosphoric acid and 20mL of concentrated hydrochloric acid were 

added and refluxed for 2 h at 100°C. We added 3 g lithium sulfate 

and 15 ml 30% hydrogen peroxide to the solution, and then boiled 

the solution until it became bright yellow(about 15 min). After that 

the solution was cooled and fixed to a constant volume of 250 ml, 

stored in a brown bottle and kept in dark place. 

Establishment of standard curve 

0.50 g of gallic acid standard sample was accurately weighed,

Determination of total polyphenols in sample 

0.01 ml of solution mentioned above was put in 10 ml centrifuge 

tube, added with 1 ml forint reagent, 3 ml 200 g/L sodium carbonate 

solution and 0.99 ml distilled water. After shaking up, it was placed 

under room temperature for 2 h. 70% ethanol was used as a blank. 

Absorbance was measured at 765 nm. 

Determination of antityrosinase activity 

The antityrosinase activity was investigated by the method of 

Shin(Shin et al., 1998), with some modifications. In brief, 50 μl of L- 

DOPA solution (3 mg/ml, dissolved in 0.1 mol/L phosphate buffer, 

pH 6.8) and 50μl of medicine mulberry medicine extract (dissolved 

in 70% ethanol) were placed in a 96-well microtiter plate, and then 

added to 50 μl of tyrosinase solution (100 u/ml, dissolved in 

0.1mol/L phosphate buffer, pH 6.8).The volume was adjusted to 

250 μl by adding 100μl PBS buffer solution (0.1 mol/L, pH 6.8). The 

solution was incubated at 37°C for 15 min and its absorbance was 

measured at 490 nm. PBS buffer solution was used as a blank. 

Percent of tyrosinase inhibitory activity was calculated using the 

following formula: 

I=[(A - B) - (C - D)]/(A - B) × 100% 

Where, A is the absorbance of the mixed solution without sample, 

50 μl 0.3% L-DOPA + 50 μl 70% alcohol + 100 μl PBS (pH 6.8) + 

50μl enzyme solution; B is the absorbance of the mixed solution 

without enzyme, 50 μl 0.3% L-DOPA + 50 μl 70% alcohol + 150 μl 

PBS (pH 6.8); C is the absorbance of the mixed solution with the 

sample, 50 μl 0.3% L-DOPA + 50 μl sample + 50 μl PBS (pH 6.8) + 

50 μl enzyme solution; D is the absorbance of the mixed solution 

without enzyme, 50μl 0.3% L-DOPA + 50 μl sample + 150 μl PBS 

(pH6.8). Half effective concentration (IC50) was obtained by using 

the logarithm concentration-enzyme inhibition ratio regression 

equation. 

Mechanism of antityrosinase activity 

The mechanism of antityrosinase activity was analysed according to 

the method of Zhang and Chen (Zhang et al., 2006; Chen et al., 

2002), with some modifications. In brief, L-DOPA (50 μl, 3 mg/ml, 

dissolved in 0.1 mol/L phosphate buffer, pH 6.8) was mixed with 

differentvolumes (10, 30, 50 and 70 μl) of tyrosinase solution (100 

u/ml, dissolved in 0.1 mol/L phosphate buffer, pH 6.8) in a 96-well 

microtiter plate, and then the differentvolumes (10, 30 and 50 μl) of 

extract were added. The volume was adjusted to 250 μl by adding 

PBS buffer solution. After that the solution was incubated at 37°C 

for 15 min and its absorbance was measured at 490nm by ELIASA. 

PBS buffer solution was used as a blank. 

Determination of inhibitory pattern 

The inhibitory pattern of anti-tyrosinase was determined according 

to the method of Zhang and Chen (Zhang et al., 2006; Chen et al., 

2002), with some modifications. In brief, tyrosinase solution (50μL, 

100u/mL dissolved in 0.1mol/L phosphate buffer, pH 6.8) was 

mixed with differentvolumes (10 μl, 30, 50 and 70 μl) of L-DOPA (50 

μl, 3 mg/μl, dissolved in 0.1mol/L phosphate buffer, pH 6.8) in a 96well 

microtiter plate, and then the differentvolumes (10, 30 and 50 

μl) of extract were added. The volume was adjusted to 250 μl by 

adding PBS buffer solution. After that the solution was incubated at 

37°Cfor 15 min and its absorbance was measured at 490nm by 

ELIASA. PBS buffer solution was used as a blank. Samples 

inhibition type was determined by graphs constructed, using Line 

weaver-Burk double reciprocal. 

RESULTS 

Determination of total polyphenol content 

Chun et al. 16177 

The concentration of gallic acid standard solution had a 

linear relation with its absorbance within concentration 

range of 0.005 to 0.1 mg/ml. The corresponding equation 

of linear regression was y = 0.0486x - 0.0015 R² = 

0.9994. Total polyphenol content was calculated according 

to standard curve and the result is shown in Table 1. 

As illustrated in Table 1, the content of total polyphenolsin 

mulberry medicine wasup to 8.668mg/g. 

Multipledetermination coefficient of variation was 0.022, 

which indicated the result was reliable. 

Determination of anti-tyrosinase activity 

Using effector concentration as abscissa, inhibition ratio 

as ordinate, we constructed fitted curve by Origin8 

analysis software, and showed the result in Figure 2. As 

illustrated in Figure 2, relative inhibition ratio increased 

dramatically with the increase of extract concentration in 

low concentration range (0 to 0.02 mg/ml). In high 

concentration range (>0.02 mg/ml), the inhibition ratio 

increased much slower. Half inhibition concentration of 

extract on tyrosine (IC50) was approximately 12.12 mg/ml. 

Mechanism of anti-tyrosinase activity 

Different concentrations of mulberry medicine extract 

were added to enzyme activity determination system. A 

group of straight lines coming across the coordinate 

origin were obtained in the enzyme activity of the enzyme 

concentration plot (Figure 3). Withthe increase of extract 

concentration, the slope of the straight line became lower 

and lower, which meant the inhibition of mulberry 

medicine extract on tyrosinase was reversible inhibition. 

Its inhibition on tyrosinase was not achieved by reducing 

the enzyme’s catalysis ability but by reducing the amount 

of enzyme. 

Determination of inhibitory pattern 

The concentration of tyrosinase was fixed in the activity 

measurement system, and then concentration gradient of 

L-DOPA was set. We investigated the impact of different 

concentrations of mulberry medicine extract on 

tyrosinase activity, and constructed a group of hyperbolic 

curves by using the initial enzyme reaction rate on 

substrate concentration plot (Figure 4). As shown in 

Figure 4, the enzymatic reaction follows Michaelis’ 

(Michaelis-Menten) kinetic equation. To study the


Table 1.The content of polyphenols in mulberry fruit. 

Parameter 

Parallel experiment Average 

1 2 3 4 5 value 

Standard 

deviation 

Coefficient of 

differentiation 

Content (mg/g) 8.664 8.949 8.723 8.424 8.580 8.668 0.193 2.2% 

Inhibition ratio (%) 

Enzyme act i vi t y ( OD/ mi n) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

-10 

-0.005 0.000 0.005 0.010 0.015 0.020 0.025 0.030 0.035 0.040 0.045 

C (g/ml) 

Inhibition ratio (%) 

CubicFit of Inhibition ratio 

Figure 2.Effect of water extract from medicine mulberry on the activity of tyrosinase. 

1. 2 

1 

0. 8 

0. 6 

0. 4 

0. 2 

0 

[ I ] =8. 929mg/ mL 

[ I ] =26. 786mg/ mL 

[ I ] =44. 643mg/ mL 

0 20 40 60 80 

Enzyme concent r at i on ( u/ mL) 

Figure 3.Inhibitory mechanism of ethanolic extract from medicine mulberry on tyrosinase. 

[I] Denotes the concentration of inhibitor (the ethanolic extract from medicine mulberry).

Enzyme act i vi t y( OD/ mi n) 

Reci pr ocal of enzyme 

act i vi t y( 1/ ( OD/ mi n) ) 

0. 25 

0. 2 

0. 15 

0. 1 

0. 05 

0 

0 2 4 6 

Subst r at e concent r at i on( c) 

Figure 4.The relationship between enzyme activity and substrate concentration. [I] Denotes the 

concentration of inhibitor (the ethanolic extract from Morusnigra L). 

12 

10 

0 

-2 -1 0 1 2 

Reci pr ocal of subst r at e concent r at i on( 1/ c) 

Figure 5. Lineweaver-Burk plots for inhibition of the ethanol extract of medicine mulberry on 

tyrosinase.[I]denotes the concentration of inhibitor (the ethanolic extract from medicine 

mulberry). 

inhibition type, Lineweaver-Burk double-reciprocal plots 

was used. The results are shown in Figure 5. The doublereciprocal 

plots yield a family line with different slopes 

and different intercepts, and they intersect one another in 

the second quadrant. This behavior indicatesthat 

mulberry medicine extract can bind, not only with free 

enzyme, but also with the enzyme-substrate complex, 

which shows its inhibition mechanism was mixed type. 

8 

6 

4 

2 

DISCUSSION 

[ I ] =8. 929mg/ mL 

[ I ] =26. 786mg/ mL 

[ I ] =44. 643mg/ mL 

[ I ] =8. 929mg/ mL 

[ I ] =26. 786mg/ mL 

[ I ] =44. 643mg/ mL 

Chun et al. 16179 

In this study, we found that the total polyphenols content 

in the dried sample of mulberry medicine was 8.668 

mg/g. It is a little lower than black mulberry fruits grown in 

East Anatolia Region of Turkey, in which the total 

phenolic content was 1422 mg gallic acid 

equivalents/100g fresh matter (Ercisli et al., 2007).


Polyphenols are potent antioxidants and can clear away 

free radicals effectively (Isabelle et al., 2008; Segev et 

al., 2010). The content of polyphenols in the ethanolwater 

extract of mulberry medicine is up to 8.668mg/g. 

Therefore, it explains why mulberry medicine has been 

used as a traditional medicine for so long. 

The ethanol extract of mulberry medicine was an 

efficient inhibitor of tyrosinase, its IC50 was 12.12 mg/ml, 

and its inhibition type was mixed type inhibition. Walker 

and Wilson (1975) suggested the existence of two distinct 

sites on the enzyme: one site for the binding of the 

substrate and another site, adjacent, for binding the 

inhibitor. Some inhibitors can bind not only with the free 

enzyme but also with the enzyme-substrate complex. So 

mixed type inhibition of the ethanol extract of mulberry 

medicine may be due to various substances it contains. 

The antityrosinase activityof mulberry medicine indicates 

that it can be used in cosmetics, treatment of skin 

disease and retain freshness of fruits and vegetables etc. 

It will also provide us with insight into finding new, 

efficient and safe tyrosinase inhibitors. This study is the 

first report on total polyphenols content and 

antityrosinase activity of mulberry medicine. Further 

investigation is required to purify phenolic compounds 

from mulberry medicine which have antityrosinase 

activity. 


This work was supported by the Doctor Fund Project of 

Ministry of Education of China (Grant no. 

20090182120018) and Special Fund of Modern 

Agriculture Construction of China (Grant no. nycytx-27gw504). 

REFERENCES 

Bouaziz M, Dhouib A, Loukil S, Boukhris M, Sayadi S(2009). 

Polyphenols content, antioxidant and antimicrobial activities of 

extracts of some wild plants collected from the south of Tunisia. Afr. J. 

Biotechnol. 8: 7017-7027. 

Bae SH, Suh HJ (2007). Antioxidant activities of five different mulberry 

cultivars in Korea. Lwt-Food. Sci. Technol. 40: 955-962. 

Chang LW, Juang LJ, Wang BS, Wang MY, Tai HM, Hung WJ, Chen YJ, 

Huang MH (2011).Antioxidant and antityrosinase activity of mulberry 

(Morus alba L.) twigs and root bark. Food. Chem. Toxicol. 49(4): 785- 

790. 

Chen QX, Kubo I (2002). Kinetics of mushroom tyrosinase inhibition by 

quercetin. J. Agric.Food. Chem. 50(14): 4108-4112. 

Fenoll LG, Penalver MJ, Rodriguez-Lopez JN, Varon R, Garcia- 

Canovas F, Tudela J (2004). Tyrosinase kinetics: discrimination 

between two models to explain the oxidation mechanism of 

monophenol and diphenol substrates. Int. J. Biochem. Cell Biol. 36: 

235-246. 

Gong SZ, Cheng JA, Yang ZR (2005). Inhibitory effect of ferulic acid on 

oxidation of L-DOPA catalyzed by mushroom tyrosinase. Chin. J. 

Chem. Eng. 13: 771-775. 

Isabelle M, Lee BL, Ong CN, Liu X, Huang D (2008). Peroxyl radical 

scavenging capacity, polyphenolics, and lipophilic antioxidant profiles 

of mulberry fruits cultivated in southern China. J. Agric. Food. Chem. 

56: 9410-9416. 

Jewell WT, Ebeler SE (2001). Tyrosinase biosensor for the 

measurement of wine polyphenolics. Am. J. Enol. Viticult. 52: 219- 

222. 

Kubo I, Chen QX, Nihei KI (2003). Molecular design of antibrowning 

agents:antioxidative tyrosinase inhibitors. Food. Chem. 81:241-247. 

Prasad KN, Yang B, John S, Yu C, Zhao M, Xue S, Jiang Y (2010). 

Enhanced antioxidant and antityrosinase activities of longan fruit 

pericarp by ultra-high-pressure-assisted extraction. J. Pharmaceut. 

Biomed. 51: 471-477. 

Segev A, Badani H, Kapulnik Y, Shomer I, Oren-Shamir M, Galili S 

(2010). Determination of polyphenols, flavonoids, and antioxidant 

capacity in colored chickpea (Cicer arietinum L.). J. Food. Sci. 75: 

S115-S119. 

Singh M, Tyagi S, Bhui K, Prasad S, Shukla Y (2010). Regulation of cell 

growth through cell cycle arrest and apoptosis in HPV 16 positive 

human cervical cancer cells by tea polyhenols. Invest. New Drugs, 

28(3): 216-224. 

Sharif T, Auger C, Alhosin M, Ebel C, Achour M, Nelly ES, Fuhrmann G, 

Bronner C, Valerie SK (2010). Red wine polyhenols cause growth 

inhibition and apoptosis in acute lymphoblastic leukaemia cells by 

inducing a redox-sensitive up-regulation of p73 and down-regulation 

of UHRF-1.Eur. J. Cancer, 46(5): 983-994. 

Shi Y, Chen QX, Wang Q, Song KK, Qiu L (2005). Inhibitory effects of 

cinnamic acid and its derivatives on the diphenolase activity of 

mushroom(Agaticus bisporus) tyrosinase. Food. Chem. 9: 707-712 

Shin NH, Ryu SY, Choi EJ, Kang SH, Chang IM, Min KR., Kim Y (1998). 

Oxyresveratrol as the potent inhibitor on dopa oxidase activity of 

mushroom tyrosinase. Biochem. Biophys.Res. Commun. 243: 801- 

803. 

Walker JRL, Wilson EL (1975). Studies on the enzymatic browning of 

apples. Inhibition of apple o-diphenol oxidase by phenplics acid. J. 

Sci. Food. Agr. 26:1825–1831. 

Zhang JP, Chen QX, Song KK, Xie JJ (2006). Inhibitory effects of 

salicylic acid family compounds on the diphenolase activity of 

mushroom tyrosinase. Food. chem. 95: 579-584.

African Journal of Biotechnology Vol. 10 (72), pp. 16181-16188, 16 November, 2011 


DOI: 10.5897/AJB09.807 



Somatic embryogenesis and bulblet regeneration in 

snakehead fritillary (Fritillaria meleagris L.) 

Petrić Marija, Subotić Angelina*, Jevremović Slađana and Trifunović Milana 

Department of Plant Physiology, Institute for Biological Research, “Siniša Stanković”, University of Belgrade, Bulevar 

despota Stefana 142, 11060 Belgrade, Serbia. 

Accepted 27 December, 2010 

Induction of in vitro morphogenesis of mature zygotic embryos of Fritillaria meleagris L. was 

investigated. Somatic embryogenesis and whole plant regeneration were achieved. Isolated zygotic 

embryos were cultured on MS medium that contained 3% sucrose, 0.7% agar, 250.0 mg/l casein 

hydrolysate, 250.0 mg/l L-proline, 80 mg/l adenine sulfate and 1.0 mg/l 2,4-dichlorophenoxyacetic acid 

(2,4-D) or thidiazuron (TDZ). Embryogenic callus was derived from mature zygotic embryos after 4 

weeks on TDZ containing medium. Somatic embryos at the early stages of development arose from the 

surface of the embryogenic callus. Multiplication of somatic embryos, formation of bulblets and shoot 

development were observed on the same medium. Scale sections prepared from the formed bulblets 

were cultured on MS media supplemented with 2,4-D (0.1 to 10.0 mg/l) and TDZ (0.05 to 2.0 mg/l). 

Somatic embryos and bulblets were frequently produced from the scale sections. This is a successful 

report of plant regeneration through somatic embryogenesis for this very important medicinal and 

horticultural plant. Histological observation revealed that plants of F. meleagris L. were regenerated via 

somatic embryogenesis. 

Key words: Bulbous plant, medicinal plant, snakehead fritillary, somatic embryos. 

INTRODUCTION 

Fritillaria species used as garden plants is well established 

and more recently it has become popular as cut 

flower for interior decorations and other floral arrangement. 

Fritillaria meleagris L., with the common name 

snakehead fritillary, is a well known horticultural plant 

belonging to the Lilliaceae family. Also, the bulbs of 

various species of the genus Fritillaria have been used as 

anti-tissuve and expectorant herbs used in traditional 

Chinese medicine for more than 2000 years (Li et al., 

2000, 2001). Propagation of this plant through conventional 

methods via bulbs cuttings is limited due to a low 

survival rate. Bulb development is very slow (general 4 

years of growth from initial seedling to maturity). Therefore, 

there is an urgent need to look for alternative means 

of propagation, which could ensure large-scale production 

of plants to fulfill the growing demands. In vitro propa- 

*Corresponding author. E-mail: subotic.angelina@gmail.com. 

Tel: + 381 11 20 78 425. Fax: + 381 11 27 61 433. 

gation is a feasible alternative for the rapid multiplication 

and maintenance of germplasm. In vitro propagation 

ensures the production of true-to-type plants in limited 

time and space. The propagation from elite mature plants 

is preferred for this purpose as they are selected on past 

performances. Tissue culture studies in Fritillaria were 

initiated as early a 1977 (Sun et al., 1977). Since then, an 

increasing number of reports about in vitro regeneration 

protocols applied to the genus have been published for a 

number of Fritillaria species (Sun and Wang, 1991; 

Kukulezanka et al., 1989; Gao et al., 1999; Paek, 1994; 

1996; Paek and Murthy, 2002; Özcan et al., 2007). 

Somatic embryogenesis is a multistep regeneration pathway 

starting with formation proembryogenic cell masses, 

followed by somatic embryo formation, germination and 

plant regeneration (Komamine et al., 2005). There are 

two paths of somatic embryogenesis; direct and indirect, 

and both can be undergone by many species (Quiroz- 

Figueroa et al., 2006). The use of plant growth regulators 

is useful in most species. 2,4-dichlorophenoxyacetic acid 

(2,4-D) such as auxin and thidiazuron (TDZ) such as


cytokinin are especially significant in promoting somatic 

embryogenesis (Jiménez, 2005). Sometimes somatic 

embryos are recognized only by their external shape and 

morphology, although histological study is necessary to 

confirm the identification of different developmental 

phases (Yeung, 1999). Somatic embryogenesis has 

already been used as a method for conserving and safeguarding 

overexploited and endangered plant species 

(Nadeem, 2000). Making use of in vitro culture can provide 

enough plant material to reinforce wild populations when 

appropriate. The choice of explants for establishment of 

in vitro culture is largely dictated by the method to be 

adopted for in vitro propagation. The ability of mature 

zygotic embryos to produce somatic embryos on induction 

medium clearly indicates that zygotic embryos are 

suitable materials for in vitro regeneration of Fritillaria 

species. Previous literature showed in vitro plant regeneration 

from bulb scales of Fritillaria species. The results 

from this study can be compared with commonly used 

bulbs as explants for in vitro regeneration. This is important 

for several reasons: bulbs are usually contaminated 

by pathogens; they have limited number scales and the 

use of bulbs could result in the destruction of Fritillaria 

natural populations (Witomska and Lukazewska, 1997). 

Induction of somatic embryogenesis in F. meleagris L. 

has not yet been reported. The first report of the induction 

of somatic embryogenesis in the genus was for F. 

imperialis (Mohammadani-Dehcheshmeh et al., 2007). 

The authors reported the induction of indirect somatic 

embryogenesis from the petal explants. 

In this study, the induction of somatic embryogenesis 

and plant regeneration in callus cultures derived from 

mature zygotic embryos of F. meleagris L was investigated. 

Also, the effect of growth regulators and light condition 

on somatic embryos and bulblets formation from 

bulb scales was investigated. Up till now, no precise histological 

analysis of the different stages of development 

has been performed during the in vitro morphogenesis of 

F. meleagris L. A histological view of the developmental 

stages of somatic embryogenesis of F. meleagris L is 

presented in this study. 


Embryogenic callus induction from mature zygotic embryos 

Seeds of F. meleagris L. were washed with running water for 1 h 

and then surface sterilized in 20% bleach solution (sodium 

hypochlorite) for 20 min. After sterilization, seeds were washed with 

sterile deionised water 3 times for 5 min. Mature embryos were 

isolated aseptically and were used as explants for embryogenic 

callus induction. All media were adjusted to pH 5.8 with 1 N NaOH 

and autoclaved at 121°C with 1.4 kg/cm 2 for 25 min. All cultures 

were maintained at 24 ± 2°C under fluorescent light of 40 μmol m - 

2 s -1 16 h light / 8 h dark photoperiod. The basal medium (BM) consisted 

of MS medium (Murashige and Skoog, 1962), 30 g/l sucrose, 

250 mg/l casein hydrolysate, 250 mg/l L-proline, 80 mg/l adenine 

sulfate and was solidified with 7 g/l agar. Isolated mature zygotic 

embryos were cultured 4 weeks on three induction media: 

hormones free BM, BM with 2,4-D 1.0 mg/ l and BM with TDZ 1.0 

mg/l. Formed callus were cultivated on same media. Bulblet formation 

was observed on BM supplemented with TDZ 1.0 mg/l. 

Somatic embryos and bulblets formation from bulblet scale 

sections 

Bulbs formed on BM supplemented with TDZ 1.0 mg/l were cut on 4 

scale sections and cultured on BM that contained different 

concentrations of 2,4-D in mg/l (0.1, 0.5, 1.0, 2.0, 5.0 10.0) and 

TDZ (0.05, 0.1, 0.2, 0.5, 1.0 and 2.0). Hormone free medium (BM) 

was used as control. Cultures were incubated for 4 weeks on light 

and dark conditions at 24 ± 2°C. After 4 weeks on induction media, 

the number of somatic embryos was measured per the number of 

embyogenic callus. Each experiment consisted of 10 explants per 

culture vessel and three replicate vessels per treatment. The 

experiments were repeated at least three times. Statistical analysis 

was performed using StatGrafics software version 4.2 (STSC Inc., 

Rockville, Marylend, USA). Data were subjected to analysis of 

variance (ANOVA) and comparisons between the mean values of 

treatments were made by the least significant difference (LSD) test 

calculated at the confidence level of P≤ 0.05. For bulblet formation, 

4 weeks after initiation of culture, percentage of bulblet formation 

was measured by dividing the number of explants producing 

bulblets per number of cultured explants. 

Rooting and acclimation 

Regenerated bulbs were cultured on BM without growth regulators 

for 9 weeks at 4°C. The cultures were incubated for the same time 

on light conditions at 24 ± 2°C and were used as control. Rooted 

bulbs were transferred into soil, covered with glasses and moved to 

the greenhouse. This experiment involved 80 to 100 bulbs with 

three replications. After 2 weeks in the growth chamber, the 

regenerants were gradually exposed to reduced relative humidity by 

progressively removing the glass cover over a period of three 

weeks. Plantlets survived the acclimatization and grew slow and 

well. 

Histological study 

Ontogeny of somatic embryo development from mature zygotic 

embryos was studied histologycally. Embryogenic callus and 

somatic embryos were fixed in a solution of formalin, alcohol and 

acetic acid (FAA), 100 ml of which contains 5.4 ml formalin (37 %), 

65.5 ml ethanol (96%), 5 ml glacial acetic acid and 24 ml distilled 

water (Jensen, 1962). Parts of the explants with different developmental 

structures were cut and embedded in Histowax (Sweden). 

At the beginning of this process, the samples were dehydrated in 2h 

steps through a graded series of ethanol (50, 70, 96 and 100%). 

The samples were then embedded in Histowax (Histolab, Sweden) 

for 72 h at 58°C. Slices (5 μm) were cut at room temperature using 

rotary microtome (Reichert-Vienna) equipped with type 819 

microtome blades (Leica, Germany). Slices were stretched on a 

drop of distilled water and mounted on slides. They were stained 

with haematoxyline (Jensen 1962). Sections were mounted in DPX 

before microscopic examination (Leica, Leitz DMRB, Germany). 

RESULTS 

Embryogenic callus induction from mature zygotic 

embryos 

The BM containing 1 mgl -1 TDZ and hormone free medium

were the most efficient for inducing yellow-white and 

compact embryogenic callus (Figure 1 a). Embryogenic 

callus produced embryos on the induction medium itself 

(Figure 1 b). Embryogenic callus with embryos were used 

for further maturation experiments. Multiplication of 

somatic embryos and bulblet formation of F. meleagris L. 

were also achieved on BM containing TDZ 1 mgl -1 (Figure 

1c and d). In the investigation, 2,4-D had no effects on 

embryogenic callus formation as well as somatic embryo 

and bulbs development (data not shown). 

Somatic embryos and bulblets formation from bulblet 

sections 

In this work, regeneration from in vitro bulblet sections of 

F. meleagris L was also investigated. Formation of 

somatic embryos and bulblets from sections was 

analyzed under continuous dark and under 16 h light / 8 h 

dark cycle at 24 ± 2°C. In the case of F. meleagris L., 

bulblet sections responded well to 16 h light / 8 h dark 

growth conditions when compared to continuous dark 

regime and also produced more somatic embryos bulblets. 

The BM medium without growth regulators induced 

a few somatic embryos and about two bulblets per 

explant. The number of developed somatic embryos was 

higher in cultures grown on BM supplemented with TDZ 

(Table 1, Figure 1 e, f and g) than on BM with 2,4-D on 

both treatments (light/dark). The highest number of 

somatic embryos was noticed on BM supplemented with 

TDZ (0.2 mgl -1 ) under light condition and with TDZ (0.1 

mgl -1 ) under dark condition. The number of somatic 

embryos was concentration dependent and increased 

until the concentration of TDZ was 0.2 and 0.1 mgl -1 

under light/dark, respectively. The number of formed 

somatic embryos constantly decreased on higher concentrations 

of TDZ. The highest number of somatic 

embryos on BM with 2,4-D was observed in 1 mg l -1 

under light and dark conditions (Table 2). The number of 

somatic embryos was also concentration dependent and 

decreased on higher concentrations of 2,4-D. Generally, 

the number of formed bulblets was significantly smaller 

than the number of formed somatic embryos on the same 

media. The BM supplemented with TDZ was superior in 

the induction of bulblets under light (14.93%) and dark 

(3.6%) conditions. The maximum number (2.76) of bulblets 

was observed on BM supplemented with TDZ (0.05 

mgl -1 ) under light condition and maximum number (2.1) of 

bulblets under darkness condition was observed on BM 

with TDZ (0.5 mgl -1 ). The number of bulblets formed on 

BM supplemented with 2,4-D was small under light 

condition (4.12%) as under darkness condition (2.32%). 

Acclimation 

The results indicated that cold treatment was suitable for 

Marija et al. 16183 

overcoming the dormancy and rooting of the harvested 

bulblets and with this treatment, 60.45% of bulblets 

sprouted in ex vitro transplantation. The average number 

of roots per bulb was 2 and the average length of root 

was 8.49 mm (Figures 1h and i). Rooted plantlets from 

each treatment were acclimatized in greenhouse conditions 

(Figure 1j). 

Histological analysis of somatic embryos 

development 

After three weeks of somatic embryogenesis induction on 

BM medium with TDZ 1 mg/l, a proliferate burst in the 

epidermal and subepidermal layers and the beginning of 

cellular segregation was seen (Figure 2a). The intensive 

periclinal division of these cells led to the formation of 

distinct cell groups which could be interpreted as early 

stages in embryogenesis. These were present in groups 

of 6 to 8 isodiametric meristematic cells with prominent 

nuclei and dense cytoplasm (Figure 2b). Cell divisions 

then progressively became asynchronous and lost 

periclinal orientation, thus produced compact, smoothsurfaced 

and meristematic masses clearly delimited by a 

protoderm (Figure 2c). Such nodular structures were also 

formed deeply within the bulb or primary explant (Figure 

2d). Further development of these proembryo structures 

led to the formation of globular somatic embryo at the 

surface of explant as shown in Figure 2e. All 

developmental stages on the explant in the same time 

indicated asynchronous development of somatic embryos. 

Well-organized globular shaped structures developed 

further through the characteristic heart-shaped stage to 

form a cotyledonary stage embryo (Figures 2f and g). 

The embryo had a shoot primordial enclosed within a pair 

of cotyledons and a distinct root primordium (Figure 2g). 

Moreover, this advanced stage or developed somatic 

embryos showed a contained provascular strand. The 

developing somatic embryos had no detectable vascular 

connection with primary explants. The cotyledonary node 

region programmed for shoot organogenesis showed 

development of a shoot primordium with a well-defined 

dome shaped apical meristem (Figure 2h). 

DISCUSSION 

The bulbous plants reproduced vegetatively and the 

process of multiplication was very low. Beside the 

advantages of efficient propagation, somatic embryogenesis 

has several basic applications to biotechnology 

of this plant including F. meleagris L. In this study, 

morphogenic responses obtained from mature zygotic 

embryos and bulblet scale explants of F.meleagris L. of 

known ornamental and medicinal value are of interest 

considering the potential of tissue culture for the 

improvement of plant conservation methods. Somatic


Figure 1. Differentiation of somatic embryos and bulblets of F.meleagris L. (A) Embryogenic callus 

induced on the BM containing 1.0 mgl -1 TDZ from mature zygotic embryos (bar = 0.5 mm); B, formation of 

somatic embryos on embryogenic callus (bar = 0.5 mm); C and D, somatic embryos and bulblets 

multiplication on medium with 1.0 TDZ mgl -1 (bar = 0.8 mm); E, Somatic embryos on bulb section on BM 

with: 0.1 mgl -1 TDZ under light condition (bar = 0.5 mm); F; with 0.1 mg l -1 TDZ under dark condition (bar 

= 0.5 mm); G, bulblets on bulb section on BM with 0.5 mgl -1 TDZ under dark condition (bar = 0.5 mm); H 

rooted bulb after 9 weeks cold treatment (bar = 1 cm); I, rooted plant on BM medium without hormone (bar 

= 1 cm); J, potted in vitro plantlets in greenhouse condition (bar = 1 cm); EC, embryogenic callus; SE, 

somatic embryo; B, bulblet.


Table 1. The effect of different concentrations of 2,4-D (mg l -1 )on somatic embryos induction for in vitro bulblet sections of F. 

meleagris L. 

Growth 

condition 

Concentration of 2,4-D (mg l -1 ) 

0 0.1 0.5 1.0 2.0 5.0 10.0 

Light 4.95±0.65 a 5.07±0.53 bc 4.66±0.43 bc 5.36±0.66 c 3.77±0.37 ab 2.46±0.25 a 2.38±0.28 a 

Darkness 4.62±0.59 a 3.95±0.39 b 3.8±0.31 b 4.21±0.44 b 2.77±0.22 a 3.54±0.27 ab 3.32±0.37 ab 

Values shown are means of 3 replicates of 32 explants each. Values represent mean SE. Means followed by the same letters within 

columns are not significantly different according to LSD test at p ≤ 0.05 probability level. 

Table 2. The effect of different concentration of TDZ (mg l -1 ) on somatic embryos induction for in vitro bulblet sections of F. meleagris 

L. 

Growth 

condition 

Concentration of TDZ (mg l -1 ) 

0 0.05 0.1 0.2 0.5 1.0 2.0 

Light 4.95±0.65 a 5.96±0.64 b 6.07±0.62 b 7.31±0.95 b 6.33±0.73 b 4.11±0.36 a 4.01±0.35 a 

Darkness 4.62±0.59 a 3.0±0.31 a 6.55±0.78 c 6.11±0.57 c 5.44±0.57 bc 4.22±0.37 ab 3.20±0.31 a 

Values shown are means of 3 replicates of 32 explants each. Values represent mean SE. Means followed by the same letters within columns 

are not significantly different according to LSD test at p ≤ 0.05 probability level. 

embryogenesis represents a simple and very efficient 

alternative means of regenerating large number of 

monocotyledonous geophytes such as saffron (Ahuja et 

al., 1994), Narcissus (Sage et al., 2000) and Lilium (Kim 

et al., 2003). 

Explant source is one of the most important factors in 

the induction of morphogenetic response of in vitro cultures, 

especially in monocots where cells diffentiate early 

and quickly and so lose their morphogenetic potential 

(Krishnaraj and Vasil, 1995). Only parts of the plant that 

are close to meristematic tissue in vivo can respond to in 

vitro treatments. Zygotic embryos are frequently used as 

explants for initiating embryogenic culture and physiological 

conditions of the explants play an important role in 

the induction process. These highly regenerative organs 

can be an alternative source for in vitro propagation of 

rare species such as F. meleagris L. The type and 

concentration of plant growth regulators in the culture 

medium play an important role in induction and development 

of somatic embryos. The induction of somatic 

embryogenesis using only 2,4-D as a growth regulator 

has been observed in many monocotyledons species 

such as Allium aflatunense (Subotić et al., 2006), Allium 

sativum (Luciani et al., 2006) and rice (Meneses et al., 

2005). Cytokinins are known to enhance plant differentiation 

and are mostly used in the regeneration medium in 

plant tissue culture. Thidiazuron is able to induce diverse 

morphogenic responses, ranging from tissue proliferation 

to adventitious shoot and somatic embryo formation. Of 

all the plant growth regulators used, embryo axes of 

Allium magnum cultured on the media that contained only 

TDZ (1.0 to 2.0 mgl -1 ) and IAA (0.25 to 2.0 mg l -1 ) 

produced green-yellowish and friable embryogenic calli 

(Xie and Hong, 2001). Apart from its cytokinin-like 

activity, TDZ has been suggested to be a modulator of 

the endogenous auxin level. Of interest in this contest is 

the modulation of endogenous auxin by TDZ (Hutchinson 

et al., 1996), since the induction of somatic embryogenesis 

is commonly associated with auxins (Visser et 

al., 1992). Previous in vitro culture studies of Fritillaria 

thunbergii showed that addition of growth regulators to 

the medium enhanced the effect on bulblet regeneration 

(Sun et al., 1977; Seon et al., 1999). In F. melegris L., 

typically bulbous plant somatic embryos led to formation 

of bulblets. Similar morphogenic pathways using petal 

explants was reported previously for F. imperialis 

(Mohammadi-Dehceshmen et al., 2007). 

Bulblet scale explants are the most commonly used 

primary explants for in vitro propagation of Fritillaria 

species (Peak, 1996; Witomska, 2000). The results of 

usage of different concentrations of 2,4-D and TDZ in 

culture of bulblet scales of F. meleagris, did not only 

induce somatic embryogenesis, but also stimulated the 

formation of bulblet. Bulblets formation differed among 

the hormone concentrations in BM medium. The results 

indicated that a range of 0.05 to 0.5 mg l -1 TDZ was an 

optimal concentration for bulblets formation of F. melegris 

L. This was low when compared with the efficiencies 

reported for production of bulblets in culture of bulblets 

scale of F. thunbergii (Peak and Murthy, 2002). These 

authors established high frequency bulblets regeneration 

using various concentrations of cytokinis and NAA. To 

improve on the present results, many combinations of 

2,4-D and TDZ in BM medium will be tested. 

Light suppresses bulblet formation (Stimart and Ascher, 

1978) and the dark was more favorable for bulblet 

regeneration in Lillium (Niimi and Onozawa, 1979). A 

similar effect of light/dark regimes was noticed during the


Figure 2. Histological observation of somatic embryogenesis from bulbs culture of F. meleagris L. (a) Cross-section of 

bulb showing small clumps of densely stained cells in subepidermal layer (bar = 60 μm); (b) Initial periclinal divisions in 

superficial layers of explant (bar = 30 μm); (c) Section showing extrusion through the epidermis of proliferating 

meristematic masses (bar = 60 μm); (d) Proembryogenic stages containing approximately 40 cells (bar = 120 μm); (e) 

Somatic embryos at the globular stages (bar = 240 μm); (f) Heart-shaped embryo with procambial strands (bar = 240 

μm); (g) Cotiledonary embryo with a cotyledons, procambial strands and root meristem (bar = 240 μm); (h) 

Longitudinal section of somatic embryos with well developed apical meristem and leaf (bar = 120 μm); (i) Detail of 

apical meristem and well developed leaf (bar = 60 μm). 

growth of bulblet of Lillium longiflorum (Leshem et al., 

1982). In Hyacintus, effect of light or darkness on bulblet 

regeneration from flower buds was cultivar dependent 

(Kim et al., 1981). Light accelerated bulblet formation on 

all types of Fritillaria imperialis explant used (Witomska 

and Lukaszewska, 1997). Tissue cultures of fritillaries 

also need low temperature; callus and bulblets are normally 

induced at standard growth room temperature but 

in order to develop further growth of in vitro formed 

bulblets, they need 2 to 15°C of cold treatment (Peak, 

1996). Cold treatment (4°C) had great positive effect on 

breaking the dormancy that resulted in the increase in 

rooting and sprouting of F. meleagris bulblets formed in 

vitro. 

Structural analysis is an important step in the study of 

in vitro somatic embryogenesis (Yeung, 1999). The histology 

observations suggest that the first stage of development 

of somatic embryos was characterized by breaking

up of the meristematic masses. Active cell division in the 

superficial layers led to the formation of clusters that were 

composed of small isodiametric cells followed by the 

formation of epidermis. The stages of differentiation 

during somatic embryogenesis in F. melegris L. reported 

in this work are in agreement with observation previously 

reported in several geophytes as in the case of 

Narcissus (Sage et al., 2000) and Allium sativum (Fereol 

et al., 2000). 

Conclusion 

In vitro culture techniques are an important aid for the 

multiplication of plant species, which have limitations of 

conventional propagation. In this study, a protocol for 

somatic embryogenesis and bulblets regeneration of F. 

meleagris L. is envisaged as a means for germplasm 

conservation to ensure the survival of this endangered 

plant. This is an important step in for further studies of 

efficient regeneration from other sources of explants as 

well as genetic transformation in F. meleagris L. 


This research was financially supported by Serbian 

Ministry of Science and Technological Development- 

Project (No ON173015). 

REFERENCES 

Ahuja A, Koul A, Ram G, Kaul Bl (1994) Somatic embryogenesis and 

plant regeneration in saffron , Crocus sativus L. Indian J. Exp. Biol. 

32: 135-140. 

Fereol L, Chovelon V, Causse S, Michaux-Ferriere N, Kahane R (2002) 

Evidence of a somatic embryogenesis process for the plant 

regeneration in garlic (Allium sativum L.). Plant Cell Rep. 21: 197- 

203. 

Gao SL, Zhu DN, Cai ZH, Jiang Y and Xu DR (1999). Organ culture of a 

precious Chinese medicinal plant-Fritillaria unibracteata. Plant Cell 

Tissue Org. Cult. 59: 197-201. 

Hutchinson MJ, Murch SJ, Saxena PK (1996). Morphoregulatory role of 

TDZ: evidence of the involvement of endogenous auxin in TDZinduced 

somatic embryogenesis of geranium (Pelargonium × 

hortorum Bailey). J. Plant Phys. 149: 573-579. 

Jensen WA (1962). Botanical Histochemistry, Gauthier-Villars, San 

Francisco, CA, USA, 1-408. 

Jiménez VM (2005). Involvement of plant hormones and plant growth 

regulators on in vitro somatic embryogenesis. Plant Growth Regul. 

47: 91-110. 

Kim SK, Lee JS, Huang KH, Ahn BJ (2003). Utilization of 

embryogenesis cell cultures for the mass production of bulblets in 

Oriental and Easter Lilias. Acta Hortic. 625: 253-259. 

Kim YJ, Hasegawa PM and Bressan RA (1981). In vitro propagation of 

Hyacinthus. Hort. Sci. 16: 645-647. 

Komamine A, Murata N, Nomura K (2005). Mechanisms of somatic 

embryogenesis in carrot suspension cultures-morphology, 

physiology, biochemistry and molecular biology. In vitro Cell. Dev. 

Biol. Plant, 41: 6-10. 

Krishnaraj S, Vasil IK (1995). Somatic embrogenesis in herbaceous 

monocots. In: Thorpe TA (ed) In Vitro Embryogenesis in Plants, 

Kluwer Academic Publishers, Dordrecht, pp. 417-470. 


Kukulezanka K, Kromor K, Czastka B (1989). Propagation of Fritillaria 

meleagris L. through tissue culture. Acta Hortic. 251: 147-153. 

Leshem B, Lilien-Kipnis H, Steintiz B (1982). The effect of light and of 

explant orientation on the regeneration and subsequent growth of 

bulblets of Lillium longiflorum Thumb. Bulb scale sections cultured in 

vitro. Sci. Hortic. 17: 129-136. 

Li SL, Li P, Lin G, Chan SW, Ho YP (2000). Simultaneous determination 

of seven major isosteroidal alkaloids in bulb of Fritillaria by gas 

chromatography. J. Chromatogr. A 873: 221-228. 

Li SL, Lin G, Chan SW and Li P (2001). Determination of the major 

isosteroidal in bulbs of Fritillaria by high-performance liquid 

chromatography coupled with evaporative light scattering detection. 

J. Chromatogr. A 909: 207-214. 

Luciani GF, Mary AK, Pellegrini C and Curvetto NR (2006). Effects of 

explants and growth regulators in garlic callus formation and plant 

regeneration. Plant Cell Tissue Org. Cult. 87: 139-143. 

Meneses A, Flores D, Munoz M, Arrieta G and Espinoza AM (2005). 

Effect of 2, 4-D hydric and light on indica rice (Oryza sativa) somatic 

embryogenesis. Rev. Biol. Trop. 53: 3-4. 

Mohammadi-Dehcheshmeh M, Khalighi A, Naderi R, Ebrahimie E and 

Sardari M (2007). Indirect somatic embryogenesis from petal explant 

of endangered wild population of Fritillaria imperialis. Pak J. Biol. Sci. 

10: 1875-1879. 

Murashige T, Skoog F (1962). A revised medium for rapid growth and 

bioassays with tobacco tissue culture. Phys. Plant. 15: 473-497. 

Nadeem M, Palni LMS, Purohit AN, Pandey, H, Nandi SK (2000) 

Propagation and conservation of Podophyllum hexandrum Royle: an 

important medicinal herb. Biol. Conserv. 92: 121-129. 

Niimi Y, Onozawa T (1979). In vitro bulblet formation from leaf 

segments of lilies, especially Lillium rubellum Baker. Sci. Hortic. 11: 

379-389. 

Özcan S, Parmaksiz I, Mirici S, Çöçü S, Uranbey S, Ipek A, Sancak C, 

Sarihan E, Gürbüz B, Sevimay CS, Arslan N (2007). Efficient in vitro 

bulblet regeneration from immature embryos of endemic and 

endangered geophyte species in Sternbergia, Muscari and Fritillaria 

Genera. In: Xu Z, Li J, Xue Y, Yang W (Eds) Biotechnology and 

Sustainable Agriculture 2006 and Beyond, Springer, Berlin, Germany, 

pp. 381-383. 

Paek KY (1994). Micropropagation of Fritillaria thunbergii. Research 

report of Ministry of Science and Technology in Korea, pp. 1-123. 

Paek KY (1996). Several factors affecting bulblet regeneration from the 

culture of scale segment on none-bud in fritillary as medicinal 

bulbous plant. Acta Hortc. 440: 498-503. 

Paek KY, Murthy HN (2002). High frequency of bulblet regeneration 

bulb scale sections of Fritillaria thunbergii. Plant Cell Tissue Org. 

Cult. 68: 247-252. 

Quiroz-Figueroa F, Rojas-Herrera R, Galaz-Avalos RM, Layola,Vargas 

V (2006). Embryo production through somatic embryogenesis can be 

used to study cell differentiation in plants. Plant Cell Tissue Org. Cult. 

86: 285-301. 

Radojević Lj, Subotić A (1992). Plant regeneration of Iris setosa Pall. 

through somatic embryogenesis and organogenesis. J. Plant Physiol. 

139: 690-696. 

Sage OD, Lynn J, Hammatt N (2000). Somatic embryogenesis in 

Narcissus pseudonarcissus cvs. Golden Harvest and St. Keverne. 

Plant Sci. 150: 209-216. 

Seon JH, Paek KY, Gao WY, Park CH, Sung NS (1999). Factors 

affecting micropropagation of pathogen – free stocks in Fritillaria 

thunbergii. Acta 

Hortic. 502: 333-337. 

Stimart DP, Ascher PD (1978). Tissue culture of bulb scale section for 

sexual propagation of Lillium longiflorum Thumb. J. Am. Soc. Hort. 

Sci. 502: 180-184. 

Sun CS, Wang DY (1991). Fritillaria spp. (Fritillary): In vitro Culture and 

Regeneration of Plants. Biotechnology in Agriculture and Forestry, 

Vol. 15 Medicinal and Aromatic plants III (eds.) Bajaj YPS, Springer- 

Verlag Berlin Hiedelberg, pp. 258-269. 

Sun CS Chu CC, Wang DY (1977). Callus formation and organ 

formation in the tissue culture of Fritillaria thunbergii Miq. Acta Bot. 

Sin. 19: 161-162. (in Chinese with English summary). 

Visser C, Quereshi JA, Gill R, Saxena PK (1992). Morphoregulatory role 

of thidiazuron: substitution of auxin and cytokinin requirement for the


induction of somatic embryogenesis in geranium hypocotyl cultures. 

Plant Physiol. 99: 1704-1707. 

Witomska M Lukazewska AJ (1997). Bulblet regeneration in vitro from 

different explants of Fritillaria imperialis. Proc. Int. Symp. on Flower 

Bulbs. Eds. Lilien-Kipnis H, Halevy AH, Borochov A, Acta Hortic. 430: 

331-338. 

Witomska M (2000). Effect of temperature on the in vitro propagation 

Fritillaria imperialis. Zeszyty naukowe instytutu sadownictwa I 

kwiaciarstwa w skierniewicach 7: 343-348. 

Xie DY Hong Y (2001). Regeneration of Acacia magnum through 

somatic embryogenesis. Plant Cell Rep. 20: 34-40. 

Yeung EC (1999). The use of histology in the study of plant tissue 

culture systems-some practical comments. In Vitro Cell Dev. Biol. 

Plant, 35: 137-143.



DOI: 10.5897/AJB11.1822 



Meiotic behavior and pollen fertility of five species in 

the genus Epimedium 

Yu Jiang, Chunbang Ding*, Haixia Yue and Ruiwu Yang 

College of Biology and Science, Sichuan Agricultural University, Yaan 625014, China. 


Meiotic behavior and pollen fertility were analysed in five Epimedium species: Epimedium chlorandrum, 

Epimedium acuminatum, Epimedium davidii, Epimedium ecalcaratum and Epimedium pubescens. 

Chromosome numbers for five species were 2n = 2x = 12. All examined species displayed stable meiotic 

process and high pollen fertility (>76.67%). Meiotic abnormality partially affected pollen fertility. At 

metaphase I, the predominant chromosome configuration was 6II, and occasionally, 5II + 2I. A low 

frequency of meiotic abnormalities was recorded in five species. Chromosome bridges, laggards and 

micronuclei were the main abnormalities observed in Epimedium. “Diagonal bridge” was first found in E. 

chlorandrum due to the altered spindle axis. Polyad was only presented in E. davidii and might have 

resulted from abnormal cytokinesis. Pollen fertility was correlated with meiotic abnormality. 

Keywords: Epimedium, meiosis, chromosomal abnormality, pollen fertility. 

INTRODUCTION 

The genus Epimedium, with more than 60 species, is 

common in the Mediterranean region and the western 

Asia (Stearn, 2002). China is the center of genus diversity, 

and has approximately 52 taxa of Epimedium (Ying, 2002; 

Guo et al., 2008). The major bioactive components in 

Epimedium are flavonoids and more than 60 flavonoids 

have been identified (Wu et al., 2008; Chen et al., 2008). 

It is effective in strengthening kidneys, enhancing sexual 

performance, treating cardiovascular diseases and 

improving immunity (Kovačević et al., 2006; Xu et al., 

2007). 

Cytogenetics on the genus Epimedium has mainly been 

devoted to chromosome counts. The chromosome 

numbers have been determined for 18 species from 

China and 11 species from Japan (Sheng et al., 2010; 

Kuroki, 1970, 1967). In Epimedium, most species are 

diploid with 2n = 2x = 12, except E. yingjiangense with 2n 

= 4x =24 (Sheng et al., 2010). Meiotic analyses in the 

genus Epimedium are few and only available in hybrid 

populations (Sheng et al., 2011). Pollen fertility was high 

in hybrids (>76.10%) and meiotic abnormalities occurred 

*Corresponding author. E-mail: dcb@sicau.edu.cn. Tel: +86 835 

288 6170. Fax: +86 835 288 6136. 

in a minority, including chromosome bridges in anaphase 

I/anaphase II, laggards in anaphase I, irregular 

chromosome segregation in anaphase I/anaphase II and 

micronuclei in telophase II/telophase II (Sheng et al., 

2011). The regular meiosis ensures gamete viability and 

meiotic irregularities would generate sterile gamete and 

decrease the pollen viability (Pagliarini, 2000). Basic data 

on chromosome number, meiosis and pollen fertility 

estimations are important to study biodiversity, for 

germplasm characterization and for applications to plant 

breeding. 

This study presents the first reports on the meiotic 

behavior in pollen mother cells (PMCs) and pollen fertility 

of five species of Epimedium: Epimedium chlorandrum, 

Epimedium acuminatum, Epimedium davidii, Epimedium 

ecalcaratum and Epimedium pubescens. 


Five species examined in the present study are listed in Table 1. 

Voucher specimens have been preserved in the Herbarium of 

Sichuan Agricultural University (SAU). All plants were cultivated in 

the Botanical Experimental Area of the College of Biology and 

Science at SAU. 

Flower buds in the ideal stage for meiotic analysis were collected, 

fixed in acetic alcohol (1:3) for 24 h, transferred to 70% ethanol and


Table 1. Sample numbers, chromosome numbers, voucher and localities of Epimedium analysed. 

Species 

Number of plants 

observed 

Chromosome 

number (2n) 

Voucher Locality 

E. acuminatum 5 12 Yu E.M. 4106 Emei, Sichuan 

E. pubescens 5 12 Yu D.J. 2015 Dujiangyan, Sichuan 

E. chlorandrum 3 12 Yu Y.A. 1635 Baoxing, Yaan, Sichuan 

E. davidii 

E. ecalcaratum 

2 

1 

12 

12 

stored at 4°C. Slide preparations were made by the squash 

technique and stained with 1% propionic carmine. Almost 300 PMCs 

were analysed for each plant. 

Pollen grains were fixed in acetic alcohol (1:3) for 24 h at room 

temperature and stored in 70% alcohol at -18°C. Pollen fertility was 

estimated by examining the percentage of stained pollen grains with 

0.5% 2,3,5-triphenyltetrazolium chloride (TTC). At least, 300 pollen 

grains per plant were evaluated. Photomicrographs were taken with 

the Olympus microscope BX51. 

RESULTS 

A total of sixteen individuals belonging to five species of 

Epimedium were examined for meiotic behavior of PMCs. 

During the prophase I, the chromosomes condensed 

and then the homologous pairing was initiated. At 

diakinesis, 6 discrete bivalents linked by one or two 

chiasmata were visible. Rod and ring bivalents (Figure 1A 

and B) were dominant, while v-form bivalent (Figure 1B) 

was also observed. As meiosis proceeded into metaphase 

I, the highly condensed bivalents became aligned on the 

meiotic spindle and clustered in the equatorial plate of the 

cell. Frequent abnormality observed in metaphase I was 

precocious migrations or asynapsis with two univalents. In 

Epimedium, the predominant chromosome configuration 

was 6II and occasionally, 5II + 2I (Figure 1C). High 

irregularities were observed in anaphase I/telophase I. 

The percentage of bridge was the highest (26.67%) in E. 

chlorandrum (Figure 1D) and the lowest (3.33%) in E. 

ecalcaratum (Table 2). One or two laggard chromosomes 

(Figure 1E) were detected in E. chlorandrum, E. 

acuminatum and E. pubescens. Some micronuclei (Figure 

1F) were found in E. acuminatum and E. davidii at 

telophase I. The chromosomes despiralized, nucleoli and 

nuclear membranes reappeared and dyads were formed. 

In the second division, the chromosome recondesed at 

prophase II. Spindles at metaphase II mainly appeared 

paralleled (Figure 1G) and `T´ shaped (Figure 1H). At this 

point, cohesion at centromeres had broken down and 

sister chromatids separated at anaphase II. The chromo- 

some bridge was widely observed in anaphase II 

/telophase II. Unexpectedly, “diagonal bridge” was found 

in E. chlorandrum (Figure 1I). Cytokinesis generated 

Yu Y. A. 6101 

Yu Y.A.1401 

Baoxing, Yaan, Sichuan 

Baoxing, Yaan, Sichuan 

symmetric (Figure 1J) or tetrahedral (Figure 1K) tetrad 

containing haploid microspores. The minority of cells 

presented tetrahedral tetrad with micronuclei (Figure 1L). 

Polyad was observed frequently (16.00%) in E. davidii 

(Figure 1M). 

The pollen fertility in five species is listed in Table 2. 

Pollen fertility was about 80%; the highest was 90% in E. 

ecalcaratum and the lowest was 76.67% in E. davidii. 

DISCUSSION 

We have investigated the meiotic process of PMCs of five 

Epimedium species. Chromosome counts for 5 species 

indicate diploidy with 2n = 2x = 12, which is consistent 

with the previous reports (Sheng et al., 2010). 

The meiosis is basically normal with few abnormalities, 

involving univalents, chromosome bridges, unexpectedly 

“diagonal bridge”, laggards, micronuclei and polyploid. 

Univalents were observed at metaphase I in E. 

chlorandrum and E. davidii. Precocious migration of 

univalents may have resulted from precocious chiasma 

terminalization at diakinesis or metaphase I or from 

synaptic mutants (Bione et al., 2000). These meiotic 

abnormalities may produce micronuclei in telophase I and 

meiosis II. 

The most frequent abnormalities were bridges and 

laggards at anaphase I / II (Figure 1D, E and I). The 

highest percentage of bridges and laggards was observed 

in E. chlorandrum (26.67 and 5.00%). When cell division 

occurs, a broken chromosome with two centromeres is 

pulled to the opposite poles of the cell, forming a long 

chromosome bridge called chromatid bridge (Zhang et al., 

1997). Rothfels (1975) demonstrated that the bridge may 

originate from chiasma formation in heterozygous 

inversions. “Diagonal bridge” at anaphase II was caused 

by the altered spindle axis and reduced the pollen fertility 

(Zhang et al., 1997). The laggards observed in 

Epimedium may lead to micronucleus formation. The 

meiotic abnormalities found in interspecific hybrids and 

haploid plants accounted for low percentage of pollen 

fertility (Bione et al., 2000). 

Micronuclei and polyad with variable numbers of

Figure 1. (A) Diakinesis in E. chlorandrum, n = 6, with rod bivalent (black arrow) 

and ring bivalent (white arrow); (B) Diakinesis in E. ecalcaratum, n = 6, with 

v-form (white arrow) and ring bivalent (black arrow); (C) Metaphase I in E. davidii, 

with two univalents (arrow); (D) Anaphase I in E. chlorandrum, with bridge (arrow); 

(E) Anaphase I in E. chlorandrum, with laggards (arrow); (F) Telophase I in E. davidii, 

with micronulei (arrow); (G) Metaphase II in E. davidii, with micronuleus (arrow); (H) 

Metaphase II in E. chlorandrum, with spindles appearing in `T´ shape; (I) Metaphase 

II in E. chlorandrum, with “diagonal bridge” (arrow); (J) Symmetrical tetrad in E. 

pubescens; (K) Tetrahedral tetrad in E. acuminatum; (L) Tetrahedral tetrad with 

micronulei (arrow) in E. davidii; (M) Polyad in E. davidii. Scale bar = 5 μm. 

microspores were found in E. davidii (Figure 1F, G, L and 

M). The origin of polyad was diverse. In some species, 

micronuclei remained in the tetrad stage, affected the 

final product and formed ployads (Mendes-Bonato et al., 

Jiang et al. 16191 

2001). Caetano-Pereira and Pagliarini (2001) reported 

that polyad were produced as a result of abnormal 

cytokinesis during meiosis, which generated sterile pollen 

grains. In E. davidii, the percentage of PMCs with polyad


Table 2. Frequency of abnormal PMCs and pollen fertility in Epimedium. 

Taxon 

Number of 

investigated 

PMCs 

Number of PMCs with meiotic abnormality (%) 

Bridges Laggards Micronuclei Polyads 

Total meiotic 

abnormality (%) 

Number of pollen 

grains analysed 

Pollen 

Number of pollen 

grains stained 

Pollen 

fertility (%) 

E. acuminatum 300 6.67 2.00 2.33 0.00 11.00 300 246 82.00 

E. pubescens 300 7.00 1.67 0.00 0.00 8.67 300 262 87.30 

E. chlorandrum 300 26.67 5.00 0.00 0.00 31.67 300 242 80.67 

E. davidii 300 9.11 1.62 11.6 16.00 38.33 300 230 76.67 

E. ecalcaratum 300 3.33 0.00 0.00 0.00 3.33 300 270 90.00 

(16.00%) and micronuclei (11.60%) was the 

highest (Table 2). 

The meiotic abnormalities found in the 

Epimedium analyzed here have accounted for 

pollen sterility. These meiotic abnormalities hinder 

the normal cell division and partially affected the 

pollen fertility. In E. davidii, the percentage of cells 

with meiotic abnormality was the highest (38.33%), 

while pollen fertility was the lowest (76.67%). High 

meiotic stability ensures high pollen fertility. For 

Epimedium hybrids, PMCs meiosis revealed minor 

abnormal chromosomal behaviors and high pollen 

fertility (Sheng et al., 2011). Table 2 shows that E. 

ecalcaratum had a low frequency (3.33%) of 

meiotic abnormality, as a consequence, a high 

pollen fertility (90.00%). Generally, the meiosis in 

Epimedium was stable (76.67%). The data available suggested that 

pollen fertility was significantly correlated with 

meiotic abnormality. 

In this paper, we provided a basic outline of 

meiosis in the genus Epimedium. Based on the 

data obtained, the PMCs split into four 

microspores and the whole meiosis was basically 

normal. The high pollen fertility was related to low 

level of meitotic abnormalities. The present paper 

enriches the database of cytology and can be 

useful for breeding program hybridization. 

REFERENCES 

Bione NCP, Pagliarini MS, Toledo JFF (2000). Meiotic behavior 

of several Brazilian soybean varieties. Genet. Mol. Biol. 23: 

623-631. 

Caetano-Pereira CM, Pagliarini MS (2001). A new meiotic 

abnormality in Zea mays: multiple spindles associated with 

abnormal cytokinesis in both divisions. Genome, 44: 

865-871. 

Chen XJ, Ji H, Zhang QW, Tu PF, Wang YT, Guo BL, Li 

SP (2008). A rapid method for simultaneous determination of 

15 flavonoids in Epimedium using pressurized liquid 

extraction and ultra-performance liquid 

chromatography. J. Pharm. Biomed. Anal. 46: 226-235. 

Guo BL, Pei LK, Xiao PG (2008). Further research on 

taxonomic significance of flavonoids in Epimedium 

(Berberidaceae). J. Syst. Evol. 46: 874-885. 

Kovačević N, Čolić M, Backović A, Došlov-Kokoruš Z (2006). 

Immunomodulatory effects of the methanolic extract of 

Epimedium alpinum in vitro. Fitoterapia, 77: 561-567. 

Kuroki Y (1967). Chromosome study in seven species of 

Berberdaceae. Memoir Ehime Univer sity Sectction II, Series 

B, 5: 175-181. 

Kuroki Y (1970). Chromosome study in four species of 

Berberdaceae. Memoir Ehime University Sectction II, Series 

B, 6: 215-221. 

Mendes-Bonato AB, Pagliarini MS, Silva N, Valle CB (2001). 

Meiotic instability in invader plants of signal grass Brachiaria 

decumbens Stapf (Gramineae). Acta Scientiarum, 23: 

619-625. 

Pagliarini MS (2000). Meiotic behavior of economically 

important plant species: the relationship between fertility and 

male sterility. Genet. Mol. Biol. 23: 997-1002. 

Rothfels K, Nambiar R (1975). The origin of meiotic bridges 

by chiasma formation in heterozygous inversions in 

Prosimulium multidentatum (Diptera: Simuliidae). 

Chromosoma (Berl.) 52: 283-292. 

Sheng MY, Wang LJ, Tian XJ (2010). Karyomorphology of 

eighteen species of genus Epimedium (Berberidaceae) and 

its phylogenetic implications. Genet. Resour. Crop Evol. 57: 

1165-1176. 

Sheng MY, Chen QF, Wang Lj, Tian XJ (2011). Hybridization 

among Epimedium (Berberidaceae) species native to China. 

Sci. Hortic. 128: 342-351. 

Stearn WT (2002). The genus Epimedium and other 

herbaceous Berberidaceae. Timber Press, Portland 

Wu CS, Guo BL, Sheng YX, Zhang JL (2008). Simultaneous 

determination of seven flavonoids in Epimedium by liquid 

chromatographytandem mass spectrometry method. 

Chinese Chem. Lett. 19: 329-332. 

Xu YQ, Li ZZ, Wang Y, Huang HW (2007). Allozyme diversity 

and population genetic structure of three medicinal 

Epimediumspecies from Hubei. J. Genet. Genomics 34: 

56-71. 

Ying TS (2002). Petal evolution and distribution patterns of 

Epimedium L., (Berberidaceae). Acta Phytotax. Sin. 40: 

481-489. 

Zhang SZ, Pan KY, Zhang DM, Hong DY (1997). Observation 

on abnormal meiosis of pollen mother cells in Paeonia 

suffruticacosa subsp. spontacea. Acta. Bot. Sin. 39: 

397-404.



DOI: 10.5897/AJB11.1203 



In vitro antifungal activity of 63 Iranian plant species 

against three different plant pathogenic fungi 

Sohbat Bahraminejad 1 *, Saeed Abbasi 2 and Mehdi Fazlali 1 

1 Department of Agronomy and Plant Breeding, Campus of Agriculture and Natural Resources, Razi University, 

6715685438, Kermanshah, Iran. 

2 Department of Plant Protection, Campus of Agriculture and Natural Resources, Razi University, 6715685438, 

Kermanshah, Iran. 


Crude aqueous and methanolic extracts of 63 plant species belonging to 23 families collected from the 

west of Iran were screened for antifungal activity against three economically important 

phytopathogenic fungi, Cochliobolus sativus, Fusarium oxysporum and Rhizoctonia solani. Bioassay of 

extract was conducted by paper disc diffusion method on agar plate cultures with four replications. 21 

of the 63 (33%) plant species showed inhibitory activity against at least one of the fungi. 16 (25%), 10 

(16%) and 16 (25%) tested plant species inhibited the mycelial growth of R. solani, F. oxysporum and C. 

sativus, respectively. Centaurea behen, Lavandula sp., roots of Tribulus terrestris were the most active 

plant species against R. solani, F. oxysporum, and C. sativus, respectively. Extracts of Glycyrrhiza 

glabra, Rosmarinus officinalis, Avena sativa, Vaccaria pyramidata, Centaurea behen, Anagalis arvensis 

and T. terrestris exhibited a broad-spectrum of antifungal activity. According to these results, we 

conclude that the flora in the west of Iran can be regarded as a rich source of plants with antifungal 

activity. Therefore, further screening of other plant species, identifying active fractions or metabolites 

and in vivo application of active extracts are warranted. 

Key words: Antifungal activity, crude extract, Iranian plants, paper disc, phytopathogenic fungi. 

INTRODUCTION 

Crop losses due to plant diseases are estimated to be 

about 14% worldwide (Agrios, 2005) and 20% for major 

foods and cash crops (Oerke et al., 1994). Synthetic 

pesticides are the most effective method of the pest and 

disease control. In spite of hazardous impacts of 

chemical pesticide application including problems of 

public health, environmental pollution, toxic effect on nontarget 

organisms and causing resistance in pest and 

disease agents (Rai and Carpinella, 2006; Kagale et al., 

2004), it is believed that fungicides will remain essential 

for the control of plant diseases and it should be 

optimized under integrated pest management programs 

(Gullino et al., 2000). Integrated pest management (IPM) 

*Corresponding author. E-mail: sohbah72@hotmail.com. 

Tel/Fax: +98 8318323731. 

for conserving agro-ecosystem include the use of pestresistance 

cultivars, holding pests at tolerable levels and 

making use of natural products (Rai and Carpinella, 

2006). 

Regarding the problems created by synthetic pesticide 

application, environmentally safe methods are needed to 

replace chemical pesticides or reduce their consumption 

in ecosystem. Therefore, considerable search for 

biocides that are environmentally safe and easily 

biodegradable have been carried out during last two 

decades (Duke et al., 2003; Teggne et al., 2008). 

Investigation of plants containing natural antimicrobial 

metabolites for plant protection has been identified as a 

desirable method of disease control (Rai and Carpinella, 

2006; Kim et al., 2002). Given the effect of the plant 

species origin and genetic diversity on chemical 

composition, studies screening for novel antifungal 

compounds in plants from different part of the world are


needed. Hence, in this research, we screened plants 

from west of Iran. 

Iran is divided to 31 provinces including Kermanshah 

and Hamadan, with a vast range of climatic conditions 

located in the west of the country. Plant diversity is very 

rich in these two provinces; therefore, it is expected to 

find significant and distinct variation in secondary 

metabolites with antifungal activity. Iranian plants have 

been screened previously for antimicrobial activity 

(Sardari et al., 1998; Fazly Bazzaz et al., 1997; Fazly 

Bazzaz and Haririzadah, 2003; Shahidi Bonjar et al., 

2004), but with a focus on activity against agents of 

diseases in human. There have been no screening 

studies for activity of Iranian plants against the 

phytopathogenic fungi. 

In this study, three destructive phytopathogenic fungi, 

Cochliobolus sativus, Fusarium oxysporum and 

Rhizoctonia solani were considered to test the antifungal 

activity of plant species. All the fungi are phytopathogenic 

fungi at farm level. Regarding the importance of 

screening plant crude extracts as first step of the project 

and the importance of bioactive crude extracts as ecofriendly 

agents, collected plants from the west of Iran 

were screened against all three fungi. The objective of 

the research was, as a part of larger screening program, 

to assess the antifungal activity of extracts from 63 

randomly-collected plant species in Kermanshah and 

Hamadan. 


Plant material and fungi 

63 plant species from 23 families were collected from the various 

parts of the provinces of Kermanshah and Hamadan in Western 

Iran (Table 1). As a part of a wider screening program, plants were 

randomly collected to increase the chance of finding plants with 

bioactive extracts. The plants were identified by the Herbarium at 

Razi University, College of Agriculture and the scientific names 

were checked in the International Plant Names Index 

(http://www.ipni.org/ipni/plantnamesearchpage.do). Each sample 

was cleaned, air dried in the shade and ground to a fine powder 

with a coffee grinder. More also, three economically important 

phytopathogenic fungi, C. sativus (S. Ito and Kurib.), F. oxysporum 

Schlecht. and R. solani Kühn were provided by the Agriculture and 

Natural Resources Research Centre of Kermanshah and the Plant 

Pathology Laboratory, College of Agriculture, Razi University. 

Preparation of plant extracts 

The powdered plant materials were extracted at room temperature 

using water and methanol. Aqueous extraction was achieved by 

adding 100 ml distilled water to 5 g of plant powder and brought to 

boil. Once boiled, the suspension was allowed to stand for 4 h 

before being filtered. The extract was then concentrated using a 

rotary evaporator. A sample of extract at concentration of 100 

mg/ml was bioassayed as described in bioassay section. 

Methanolic extracts were also obtained as described by 

Bahraminejad et al. (2006). Briefly, 5 g ground sample was 

extracted with 100 ml methanol for 24 h by shaking on an orbital 

shaker at 300 rpm. Then 30 ml distilled water was added to 70 ml of 

the methanolic extract and lipids were removed with 100 ml nhexane 

mixed at 250 rpm for 2 h. Methanolic phase was 

concentrated using a rotary evaporator. Finally, the residues were 

dissolved in 45% methanol in distilled water and a sample of extract 

at a concentration of 100 mg/ml for bioassay was provided. 

Bioassay 

Fungal bioassay was performed as previously described 

(Bahraminejad et al., 2008) using the paper disc method to reveal 

any inhibitory effect of plant crude extracts. Each autoclaved filter 

paper disc (6 mm diameter) was loaded with 5 × 10 µL of the crude 

extract (equal to 5 mg/disc). The discs were dried between each 

application. Negative control discs were prepared with 5 × 10 µL of 

the appropriate solvent, sterile water or 45% methanol. Positive 

control discs at concentration of 1 mg/disc were prepared with 

mancozeb, carboxin thiram and benomyl against C. sativus, R. 

solani and F. oxysporum, respectively. Loaded paper discs were 

placed on the growth medium about 10 mm from the margin of the 

growing mycelia. Five millimeter in diameter plug of each fungus 

was transferred to potato dextrose agar (PDA) media and incubated 

at 25°C in the dark until mycelia reach to approximately 25 mm 

from the edge of the plate. After addition of the paper discs the 

plates were further incubated at 25°C and radius zone of inhibition 

(distance between the centre of the paper disc and margin of 

inhibited mycelia from three different directions) was recorded. 

Each plate was examined for any inhibitory effect every 2 h for fastgrowing 

fungus, R. solani and every 6 h for the other fungi. Four 

replicates plates were prepared for all extracts and controls and the 

experiment repeated twice. 

RESULTS 

Antifungal activities of the extracts are presented in Table 

1. Of the 63 species tested, 21 (33%) showed activity 

against at least one tested fungi. 16 of 63 plant species 

screened (25%) measurably inhibited the mycelial growth 

of R. solani, with the most active extracts being from the 

following (in order for decreasing effect): Centaurea 

behen, Xanthium strumarium (Figure 1a), Vaccaria 

pyramidata, Glycyrrhiza glabra, Oliveria decumbens, 

Sisymbrium sp., Avena sativa and Ferulago angulata, 

Extracts of 10 plants (16%) inhibited the growth of F. 

oxysporum, with the extracts of Lavandula sp., G. glabra, 

Anagallis arvensis (Figure 1b) and A. sativa giving the 

most marked activity. 16 of the extracts (25%) exhibited 

activity against C. sativus with the greatest response from 

extracts of Tribulus terrestris, Sorghum halepense, X. 

strumarium, G. Glabra (Figure 1c), V. pyramidata, A. 

arvensis (Figure 1d) and C. behen. For two of the fungi, 

R. solani and C. sativus, some plant extracts at 

concentration of 5 mg/disc gave similar inhibition to the 

fungicides applied at concentration of 1 mg/disc. Extracts 

of C. behen, X. strumarium, V. pyramidata, G. glabra, O. 

decumbens, Sisymbrium sp., A. sativa and F. angulata 

showed similar or even more inhibitory effect than 

carboxin thiram when tested against R. solani. Extracts of 

T. terrestris, S. halepense, X. strumarium and G. Glabra, 

inhibited the growth of C. sativus similar to mancozeb.

Figure 1. Inhibitory effect of plant extracts (5 mg/paper disc) of different 

plant pathogenic fungi on potato dextrose agar: a) Xanthium strumarium 

against Rhizoctonia solani, b) Anagallis arvensis against Fusarium 

oxysporum, c) Anagallis arvensis against Cochliobolus sativus, and d) 

Glycyrrhiza glabra against Cochliobolus sativus. 

None of the extracts showed inhibition similar to benomyl 

when tested against F. oxysporum (Tables 1 and 2). 

Data presented in Table 1 showed that the extracts of 

G. glabra, R. officinalis, A. sativa, V. pyramidata, C. 

behen, A. arvensis and T. terrestris exhibited broadspectrum 

antifungal activity, inhibiting all three fungi. In 

this research, two different solvents were used to elicit 

the antifungal compounds in plant species. The results of 

radius inhibition zone (Table 1) which may correlate to 

quality and quantity of antifungal compounds indicated 

that antifungal compounds in the most of the plant 

species with anti-Rhizoctonia, anti-Fusarium, and anti- 

Cochliobolus activity were extracted by methanol. 

DISCUSSION 

Results indicate the presence of antifungal compounds in 

the different extracts (Table 1), which was in agreement 

with the results reported by other researchers on different 

pathogens (Qasem and Abu-blan, 1996; Wuben et al., 

1996; Bahraminejad et al., 2008; Kostova and Dinchev, 

2005). The broad spectra of inhibitory effect of G. glabra, 

R. officinalis, A. sativa, V. pyramidata, C. behen, A. 

arvensis and T. terrestris indicated that these extracts are 

potent antifungal plants with possible potential for the 

Bahraminejad et al. 16195 

control of different fungal diseases in plants. Therefore, 

more research on the activity of them against the other 

plant pathogenic fungi would be of value. The broad 

antimicrobial activity of the plant species was shown to 

be related to the presence of saponins, alkaloids and 

tannins (Ndukwe et al., 2005). The antifungal activity of 

A. sativa and T. terrestris probably may be due to 

presence of saponins in their content (Crombie and 

Crombie, 1986; Wuben et al., 1996; Bahraminejad et al., 

2008; Kostova and Dinchev, 2005). The strong activity of 

R. officinalis as a broad active plant in this study was also 

documented by Aye and Matsumoto (2011). 

Furthermore, screening indicated that few numbers 

(16%) of studied plant species showed anti-Fusarium 

activity when compared to the other two fungi and all of 

the active extracts revealed less inhibitory effect than 

benomyl, thus indicating that this fungus shows more 

resistance to plant extracts. This kind of resistance in the 

fungus was previously discussed by Agrios (2005) who 

stated that Fusarium is a soil-inhabitant fungus and can 

adopt itself to lower level of toxic material. This may be 

the reason why we could not find plant extract with 

activity higher than benomyl. It has also been found that 

the methanolic extract of L. officinalis is the most active 

plant extract against F. oxysporum. This result was 

therefore in agreement with previous study showing the


Table 1. In vitro screening for antifungal activity (mean ± standard error, n = 4) of plant extracts at 5 mg/paper disc. Each mean was calculated 

from four replicates. 

Plant Family 

Part 

used 

Ixiolirion tataricum Hall (Pall.) Amaryllidaceae Total 

Artedia squamata L. Apiaceae Total 

Bupleurum kurdicum Boiss. Apiaceae Total 

Ferulago angulata Boiss. Apiaceae Flower 

Johrenia aromatica Rech.f. Apiaceae Shoot 

Oliveria decumbens Vent. Apiaceae Total 

Prangos ferulacea Lindl. Apiaceae Shoot 

Torilis sp. Apiaceae Total 

Carduus arabicus Jacq. Asteraceae Shoot 

Centaurea behen L. Asteraceae Total 

Crupina crupinastrum Vis. Asteraceae Total 

Cynara scolymus L. Asteraceae Fruit 

Echinops ritrodes Bunge Asteraceae Shoot 

Gundelia tournefortii L. Asteraceae Total 

Silybum marianum (L.) Gaertn. Asteraceae 

Leaf+ 

root 

Taraxacum sp. Asteraceae Shoot 

Xanthium strumarium L. Asteraceae Shoot 

Alyssum strigosum Soland Brassicaceae Total 

Conringia orientalis L. Brassicaceae Total 

Solvent Rhizoctonia 

Plant Pathogen 

Fusarium Cochliobolus 

solani oxysporum sativus 

W NI NI NI 

M 9.53 ± 0.3* NI 7.00 ± 0.5 

W NI NI NI 

M NI NI NI 

W 7.96 ± 0.3 WI WI 

M NI WI 7.00 ± 0.1 

W NI NI NI 

M 10.90 ± 0.6 NI 7.67 ± 0.9 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M 11.37 ± 0.6 NI NI 

W NI NI NI 

M NI NI NI 

W NI WI WI 

M WI NI NI 

W NI NI WI 

M NI NI NI 

W 9.67 ± 0.4 6.25 ± 0.8 7.75 ± 0.3 

M 15.25 ± 0.3 6.67 ± 0.6 9.29 ± 0.5 

W WI NI WI 

M WI NI NI 

W NI NI WI 

M WI NI 7.29 ± 0.5 

W NI NI NI 

M WI NI NI 

W NI NI NI 

M WI NI NI 

W NI NI ND 

M NI NI ND 

W WI NI WI 

M WI NI WI 

W WI WI WI 

M 12.58 ± 0.9 WI 13.46 ± 0.4 

W NI NI NI 

M WI NI NI 

W NI NI NI 

M WI NI NI

Table 1 cont. 

Goldbachia laevigata DC. Brassicaceae Total 

Isatis lusitanica L. Brassicaceae Total 

Matthiola arabica Boiss. Brassicaceae Total 

Nasturtium officinale W.T.Aiton Brassicaceae Total 

Neslia apiculata Fisch., C.A.Mey. 

& Avé-Lall. 

Brassicaceae Total 

Sameraria stylophora Boiss. Brassicaceae Total 

Sisymbrium sp. Brassicaceae Total 

Gypsophylla sp. Caryophyllaceae Shoot 

Vaccaria pyramidata Medik. Caryophyllaceae Total 

Capparis spinosa L. Capparidaceae Shoot 

Chrozophora tinctoria A. Juss. Euphorbiaceae Shoot 

Pisum sativum L. Fabaceae Total 

Glycyrrhiza glabra L. Fabaceae Shoot 

Scorpiurus muricatus L. Fabaceae Total 

Muscari neglectum Guss. ex Ten Hyacinthaceae Total 

Lallemantia sp. Lamiaceae Total 

Lamium amplexicaule L. Lamiaceae Total 

Lavandula officinalis Caix Lamiaceae Shoot 

Rosmarinus officinalis L. Lamiaceae Shoot 

Salvia sclarea L. Lamiaceae Shoot 


W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI NI NI 

W NI NI 6.00 ± 0.4 

M NI WI NI 

W NI NI NI 

M WI NI WI 

W NI WI NI 

M NI NI NI 

W NI NI NI 

M WI NI NI 

W NI NI NI 

M 11.33 ± 0.7 NI WI 

W NI NI NI 

M NI NI NI 

W 10.29 ± 0.3 6.25 ± 0.3 10.75 ± 0.5 

M 12.21 ± 0.9 WI 10.92 ± 0.3 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI AMI NI 

W NI NI NI 

M NI NI NI 

W 11.88 ± 0.1 7.83 ± 0.4 WI 

M 11.75 ± 0.1 10.83 ± 1 12.54 ± 0.1 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M 5.00 ± 0.3 NI NI 

W NI NI NI 

M NI NI WI 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M 6.34 ± 0.3 10.87 ± 0.5 NI 

W NI NI NI 

M 6.58 ± 0.2 9.00 ± 0.2 6.67 ± 0.5 

W NI NI NI 

M NI 6.54 ± 0.6 NI


Table 1 cont. 

Thymus kotschyanus Boiss. & 

Hohen. 

Lamiaceae Shoot 

Stachys lavandulifolia Vahl Lamiaceae Shoot 

Salvia multicalus Vahl. Lamiaceae Shoot 

Stachys inflate Benth Lamiaceae Shoot 

Gagea sp. Liliaceae Total 

Abutilon theophrasti Medik. Malvaceae Total 

Hibiscus trionum L. Malvaceae Shoot 

Olea europaea L. Oleaceae 

Fruit 

Leaf + 

Stem 

W NI NI NI 

M NI WI NI 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI NI NI 

W WI NI NI 

M WI NI NI 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M WI NI NI 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M ND ND ND 

W NI NI NI 

M NI NI WI 

Orobanche alba Rchb. Orobanchaceae Total 

W 

M 

NI 

NI 

NI 

NI 

NI 

NI 

Shoot W 11.13 ± 0.4 9.05 ± 0.5 NI 

M 10.54 ± 0.3 NI NI 

Avena sativa L. Poaceae 

Root 

W 

M 

NI 

6.63 ± 0.4 

NI 

8.21 ± 0.4 

NI 

6.09 ± 0.3 

Echinochloa crus-galli L. Poaceae Total 

Sorghum halepense (L.) Pers Poaceae 

Shoot 

Rhizome 

Root 

Phalaris sp. Poaceae Total 

Portulaca oleraceae L. Portulacaceae Shoot 

Anagallis arvensis L. Primulaceae Total 

Callipeltis cucullaria (L.) DC. Rubiaceae Total 

Haplophyllum perforatum (MB.) 

Kar. and Kir. 

Rutaceae Total 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI NI 6.42 ± 0.7 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI NI 13.96 ± 1 

W WI WI NI 

M NI NI WI 

W NI NI NI 

M WI WI NI 

W WI WI WI 

M 9.03 ± 0.3 9.3 ± 0.5 9.61 ± 0.9 

W NI NI NI 

M NI WI WI 

W NI NI 7.00 ± 0.4 

M 9.23 ± 0.5 WI 11.29 ± 0.6

Table 1 cont. 

Scrophularia striata Boiss. Scrophulariaceae Shoot 

Linaria chalepensis (L) . Mill. Scrophulariaceae Total 

Scrophularia striata Boiss. Scrophulariaceae Total 

Veronica anagallis-aquatica L. Scrophulariaceae Total 

Datura stramonium L. Solanaceae 

Shoot 

Root 

Hyoscyamus reticalatus L. Solanaceae Total 

Valerianella sp. Valerianaceae Total 

Tribulus terrestris L. Zygophyllaceae 

Shoot 

Root 


W WI NI NI 

M NI 5.75 ± 0.4 9.58 ± 0.3 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M WI NI NI 

W NI NI NI 

M NI NI NI 

W NI NI NI 

M NI NI NI 

W NI NI WI 

M WI NI WI 

W WI NI NI 

M NI NI NI 

W 8.13 ± 0.4 6.65 ± 0.4 8.67 ± 0.2 

M 9.04 ± 0.1 NI 4.75 ± 0.3 

W 8.92 ± 0.7 NI 12.17 ± 0.1 

M 6.24 ± 0.3 NI 17.63 ± 0.1 

*Mean of radius inhibition zone (mm) ± standard error; W, water; M, methanol; NI, no inhibition; WI, weak inhibition; AMI, Aerial mycelium 

inhibited; ND, not done. 

Table 2. Inhibitory effect of fungicides used as positive controls (mean ± standard error, n = 6) at 1 mg/ disc. 

Fungicide 

Plant Pathogen 

Rhizoctonia solani Fusarium oxysporum Cochliobolus sativus 

Mancozeb - - 12.22 ± 0.8 

Carboxin thiram 10.44 ± 0.4 - - 

Benomyl - 25.22 ± 0.5 - 

antifungal effect of L. officinalis against mycelial growth of 

F. oxysporum (Pawar and Thaker, 2007). In this study, X. 

strumarium with common name cocklebur (Asteraceae) 

also showed significant anti-R. solani and anti-C. sativus 

properties. The ant-Phytophthora drechsleri properties of 

cocklebur have been previously reported (Kim et al., 

2002; Koko, 2007; Yanar et al., 2011). Kim et al. (2002) 

extracted and purified an anti-P. drechsleri compound 

from X. strumarium. This compound was identified as a 

sesquiterpene lactone called deacetyl xanthumin. The 

results of the present work confirmed the presence of 

toxic substances of X. strumarium shown in previous


study. 

In this study, three of the seven plant species in 

Apiaceae, two of the eight plant species in Asteraceae, 

two of the nine plant species in Brassicaceae, three of 

the nine tested plant species in Lamiceae and three of 

four plant species in Poaceae showed antifungal activity. 

Although, the number of tested plant species in each 

family was not in high frequency, it can be concluded that 

inhibitory effect is not family dependent. This finding is in 

agreement with the results reported by Qasem and Abu- 

Blan (1996) on some other pathogens. However, the 

taxonomic distribution for phytoalexin production was well 

reviewed by Grayer (1994) and is not in agreement with 

the results of our study. He reported a high frequency of 

plant species of Fabaceae and low frequency of 

Rosaceae with antimicrobial activity. Differences in the 

toxicity of the extracts could be due to their solubility in 

water and methanol and results might be influenced by 

the solubility of the active substances in the solvent with 

higher solubility of the most active plant extracts in the 

water or methanol. Therefore, it can be concluded that 

different plants need different extracting solvent. The 

finding of this study supported the observation of Eloff 

(1998) who ranked extractants based on their ability to 

solubilize antimicrobial compounds from plants, 

biohazards and ease of removal of solvents from 

fractions. Eloff ranked methanol in second to methylene 

dichloride and superior to ethanol and water. However, 

application of the other solvents could be useful to extract 

more toxic metabolites from the plants reported in this 

work. 

As Chitwood (2002) stated, the results of these kind of 

research could help to develop new natural fungicide, 

chemically synthesized derivatives or to grow the plants 

with antifungal activity in a crop rotation program. These 

results will also help to find out the active metabolites in 

active plants and subsequently used in reverse genetic 

engineering from metabolites to genes. Regarding the 

allelopathic properties of oats (Avena sativa), oat can be 

grown in a crop rotation program to suppress and break 

the cycle of soil-borne plant pathogenic fungi (Schrickel, 

1986). Therefore, oat as a known crop plant in Iran could 

help to reduce the severity of soil borne diseases in 

wheat farms. These results and the acceptable 

percentage of the plants with antifungal activity (33% in 

this research) indicated that the flora in the west of Iran 

can be regarded as a rich source of plants with antifungal 

activity. These findings encouraged us to continue 

screening more plant species for antifungal agents. 

The results of this study may form the basis of further 

investigation on fractionation for finding active fractions, 

the effect of origin of growth on the quality and quantity of 

active compounds, the amount of bioactive compounds in 

different plant parts and finally in vivo application of the 

extracts. Therefore, further investigations are being 

conducted on X. strumarium, A. arvensis, and T. 

terrestris as they showed more durability of inhibition and 

wide range of effects against different fungi. 

REFERENCES 

Agrios G M (2005). Plant Pathology. 5th ed. Academic Press, New 

York, NY. 

Aye SS, Matsumoto M (2011). Effect of some plant extracts on 

Rhizoctonia spp. and Sclerotium hydrophilum. J. Med. Plant Res. 

5(16): 3751-3757 

Bahraminejad S, Asenntorfer R E, Riley IT, Schultz CJ (2008). Analysis 

of the antimicrobial activity of flavonoids and saponins isolated from 

the shoots oats (Avena sativa L.). J. Phytopathol. 156:1-7. 

Bahraminejad S, Asenntorfer RE, Riley IT, Zwer P, Schultz CJ, Schmidt 

O (2006). Genetic variation of flavonoid defense compound 

concentration in oat (Avena sativa L.) entries and testing of their 

biological activity. Proc Australasian Plant Breeding Conference, 

Christchurch, New Zealand 18-21 May 2006.pp. 1127-1132. 

Chitwood DJ (2002). Phytochemical based strategies for nematode 

control. Annu. Rev. Phytopathol. 40:221-49 

Crombie WML, Crombie L (1986) Distribution of avenacins A-1, A-2, B- 

1 and B-2 in oat Avena sativa roots their fungicidal activity towards 

take-all fungus Gaeumannomyces graminis. Phytochemistry, 25: 

2069-2074. 

Crombie WML, Crombie L, Green JB, Lucas JA (1986) Pathogenicity of 

take-all fungus to oat: its relationship to the concentration and 

detoxification of the four avenacins. Phytochemistry, 25: 2075-2083. 

Duke SO, Baerson AR, Dayan FE, Rimando AM, Scheffler BE, Tellez 

MR, Wedge DE, Schrader KK, Akey DH, Arthur FH, DeLucca AJ, 

Gibson DM, Harrison HF, Peterson JK, Gealy DR, Tworkoski T, 

Wilson CL, Morris JB (2003). United States department of 

Agriculture-Agricultural Research Service Research on natural 

products for pest management. Pest Manag. Sci. 59: 708-717 

Eloff, JN (1998). Which extractant should be used for the screening and 

isolation of antimicrobial components from plants? J. 

Ethnopharmacol. 60:1-8 

Fazly B B S, Haririzadeh G, Imami SA, Rashed MH (1997). Survey of 

Iranian plants for alkaloids, flavonoids, saponins, and tannins 

[Khorasan Province]. Int. J. Pharmacogn. 35 (1): 17-30 

Fazly B BS, Haririzadeh G (2003). Screening of Iranian plants for 

antimicrobial activity. Pharm. Biol. 41 (8): 573-583 

Grayer RJ, Harborne JB (1994).A survey of antifungal compounds from 

higher plants. Phytochemistry, 37(1):19-42 

Gullino ML, Leroux P, Smith CM (2000). Uses and Challenges of novel 

compounds for plant disease control. Crop Prot. 19:1-11 

Kagale S, Marimuthu T, Thayumanavan B, Nandakumar R, 

Samiyappan R (2004). Antimicrobial activity and Induction of 

systemic resistance in rice by leaf extract of Datura metel against 

Rhizoctonia solani and Xanthomonas oryzae pv. Oryzae. Physiol. 

Mol. Plant P. 65:91-100 

Kim DK, Shim CK, Bae DW, Kawk YS, Yang MS, Kim HK (2002). 

Identification and biological characteristics of an antifungal compound 

extracted from cocklebur (Xanthium strumarium) against 

Phythopthora drechsleri. Plant Pathol. J. 18: 5, 288-292. 

Koko WS (2007). Antimalarial activity of Xanthium brasilicum Vell. In 

vitro and toxicological approaches. Nat. Prod. 15: 1-10. 

Kostova I, Dinchev D (2005). Saponins in Tribulus terrestris– chemistry 

and bioactivity. Phytochem. Rev. 4: 111-137 

Ndukwe Kc, Okeke In, Lamikanra A, Adesina Sk, Aboderin O (2005). 

Antibacterial activity of aqueous extracts of selected chewing sticks. 

J.Contemp.Dent Pract. 6 (3): 86-94 

Oerke EC, Dehne HW, Schonbeck F, Weber A (1994). Crop protection 

and crop production. Elsevier, Amsterdam, 808 pp. 

Pawar VC, Thaker VS (2007). Evaluation of the anti-Fusarium 

oxysporum f.sp cicer and anti-Alternaria porri effects of some 

medicinal essential oils. World J. Microbiol. Biotechnol. 23:1099- 

1106. 

Qasem JR, Abu-Blan HA (1996). Fugicidal activity od some common 

weed extracts against different plant pathogen fungi. J. Phytopathol. 

144: 157-161. 

Rai M, Carpinella M (2006). Naturally Occurring Bioactive compounds. 

Elsevier, Amsterdam : 502. 

Sardari S, Amin G, Micetich GR, Daneshtalab M (1998). 

Phytopharmaceuticals. Part 1. Antifungal activity selected Iranian and 

Canadian plants. Pharm. Biol. 36 (3): 180-188.

Schrickel DJ (1986). Oats production, value and use. Pages 1-11 in: 

Oats:Chemistry and Technology. F. H. Webster, ed. American 

Association of Cereal Chemists, St. Paul, MN. 

Shahidi Bonjar GH, Aghighi S, Karimi Nik A (2004). Antibacterial and 

antifungal survey in plants used in indigenous herbal-medicine of 

south east regions of Iran. J. Biol. Sci. 4(3): 405-412. 


Yanar Y, Kadio I, Gökçe A, Demirta I, Gören N, Çam H, Whalon M 

(2011). In vitro antifungal activities of 26 plant extracts on mycelial 

growth of Phytophthora infestans (Mont.) de Bary. Afr. J. Biotechnol. 

10(14): 2625-2629.



DOI: 10.5897/AJB11.1406 



Effects of different photoperiods and concentrations of 

phosphate on the growth of the cyanobacterium 

Cylindrospermopsis raciborskii (Woloszynska) 

Sabahi asl Mitra , Nejatkhah Parisa 1 , Ramezanpour Zohreh 2 , Heidary Negin 1 

1 Islamic Azad University, North Tehran Branch, Faculty of Marine Science and Technology, Marine Biology Group, 

Tehran, Iran. 

2 International Sturgeon Research Institute, P.O Box: 41635-3464, Rasht, Iran. 


The freshwater cyanobacterium, Cylindrospermopsis raciborskii is potentially toxic and widely 

distributed in tropical and sub-tropical regions. This species is highly abundant throughout the Anzali 

Lagoon during the months of July and August. The effects of four different photoperiods (L/D 12:12, 

10:14, 14:10, 8:16) as well as three different concentrations of phosphate (2 fold, 3 fold and half of the 

main culture) on growth rates of C. raciborskii were studied. C. raciborskii, isolated from water samples 

collected from the Anzali Lagoon, was cultured in Zehnder 8 media (using Z8 without a nitrogen source) 

under light intensity of 3000 Lux at 252°C. A control group cultured with the main culture medium was 

also used. This experiment was carried out for 25 days. Inoculants and C. raciborskii cells were counted 

every other day throughout the experiment period using a Neubauer chamber and specific growth rates 

(SGR) and cell division rates (G) were estimated. The maximum growth rate (8x10 6 ± 5 cells ml -1 ) was 

observed at 12 L:12 D photoperiod followed by 14 L:10 D, 10 L:14 D and 8 L:16 D. The results obtained 

in the present study especially with 14 L:10 D and 12 L:12 D were in complete agreement with general 

growth pattern of C. raciborskii observed in warmer months with rather longer daytime in tropical and 

subtropical areas. The maximum growth rates were observed in the group treated with 2 fold PO4 

concentration. The strategy of growth in this species may depend on nitrogen fixation, when other 

algae were nitrogen limited and fast PO4 uptake even if very low concentration is available. 

Key words: Cyanobacteria, Cylindrospermopsis raciborskii, Anzali Lagoon, photoperiod, phosphate, growth 

rate. 

INTRODUCTION 

Dehiscence of Cyanobacteria produces dangerous 

poisons in native water which leads to serious problems 

worldwide. Besides, loss of many species in lakes, rivers, 

estuaries, oceans and storage water systems are among 

the crucial effects of this phenomenon (Wilson et al., 

1999). Physiological capacities of Cyanobacteria are 

highly dominant in competence with other phytoplankton 

species (Duval et al., 2005). Cylindrospermopsis 

*Corresponding author. E-mail: Mitra.sabahi2@gmail.com. 

Abbreviations: SGR, Specific growth rates; ANOVA, one-way 

analysis of variance. 

raciborskii belongs to Nostocaceae family and 

Oscillatoriales order from Cyanobacteria. 

C. raciborskii (Woloszynska, 1972) is kind of 

Cyanobacteria which can produce poison. C. raciborskii 

is identified by the presence of gas vacuoles and by the 

shape and dimensions of terminal heterocysts, vegetation 

cells and trichomes (Wilson et al., 1999). In this species, 

one or two heterocysts are observable at both ends of the 

trichome as a candle flame (Figure 1). Akinetes are 

normally oval form placed inactively near heterocysts and 

include spherical cells. Note that growth cell walls are 

covered by nuclear cells, including clear gas vacuoles 

(Hawkins et al., 1985). Recent studies have explored that 

this species has a permanent effect on mice and also 

infect and destroy liver tissue. Note t hat the produced

Figure 1.Cylindrospermopsis raciborskii sampled from Anzali Lagoon (x400). 

poison damage kidneys, adrenal glands, lungs and 

intestines. Probably, this complication occurs in humans 

and other mammalian (Hawkins et al., 1985). There are 

various factors that affect upon the combination and 

succession of phytoplankton and cyanobacteria including 

light, temperature, concentration of nutritional material, 

simulative and preventive material which influence upon 

growth and elective feeding (Ahelgern, 1977). 

Blooms of cyanobacteria threaten aquatic life. The 

cyanobacter C.raciborskii blooms lead to animal fatalities 

and human poisoning in various countries such as 

Iceland, 1999, Florida, 1997, Japan, 1999, Africa, 2004, 

and Australia, 1998-2001(Chapman and Schelske, 1997; 

Zakaria and Al-Shehri, 2004). In tropical regions, the 

algae growth is the same in all months of the year 

because of uniform environmental conditions. However, 

in temperate zones, seasonal change cause physicchemical 

changes and thus, in some months, high growth 

of blue-green algae creates blooms in water (Bernard et 

al., 2004). Many different researchers reported about 

daily periodical influence of light and darkness upon 

phytoplankton and freshwater species like Oscillatoria 

agardhii. These reports state the importance of light 

intensity and quality on the occurrence of phenomena in 

lakes and sea. Though, according to Foy et al. (1993), 

light duration is an effective factor on the growth of 

phytoplankton that has different effects upon every 

species of algae. Phosphate plays a basic role on growth 

in all plants. Thus, decline in phosphate during the growth 

season is a limiting factor for algal growth. Also, 

phosphate is critical element in controlling the growth of 

cyanobacteria. This study attempts to investigate the 

influence different phosphate concentrations (2 fold, 3 

fold and half of the main culture) on growth of C. 

raciborskii and estimate the optimum growth conditions in 

different photoperiods (L/D 12:12, 10:14, 14:10, 8:16). 


Mitra et al. 16203 

Sampling from the Anzali Lagoon was carried out in the month of 

August of 2007 using plankton net (25 μm).Isolation and 

preparation of pure cultures of algae was carried out at the Ecology 

Department of the international Sturgeon Research Institute. The 

algal cells were cultured in Z8 medium (without nitrogen resources) 

(Kotai, 1972). All treatments were run in three replicates. 

Four different photoperiods (8 L:16 D, 14 L:10 D, 12 L:12 D, and 10 

L:14 D) were considered. To examine the influence of different 

concentrations of phosphate (PO4), three various treatments were 

studied using 6.2 gl -1 (two-fold), 9.3 gl -1 (three-fold) and 1.53 gl -1 

(half the amount of Z8 batch culture) (without nitrogen resources). A 

control group 3.1 gl -1 of Z8 (main culture) was also used. One 

milliliter of pure culture cells were inoculated to each treatment 

using a syringe pipette. The cellular concentration after injection at 

t0 time for each replicate was 10 4 cells ml -1 . Finally, cultivated tubes 

were placed in culture shelves for 25 days. The culture room 

temperature was adjusted to 25±2°C. Sample counting was 

performed daily and three repetitions were done for every sample 

by Neubauer chambers. SGR (µ) and G were calculated by the 

equations (Fogg and Thake, 1987): 

µ=lnx1-lnx0 (t1-t0). 

G=ln2µ1 

Where, X0 is the mean cellular number at t0 time; X1 is the mean 

cellular number at t1 time; µ is the specific growth rate (d -1 ); G is the 

generation time (d) 

Data analysis was performed by one-way analysis of 

variance (ANOVA) and Duncan’s separator test associated with 

Excel (2003) and SPSS (16.0) statistical software. 

RESULTS 

Result of different photoperiods 

Statistical analysis of different photoperiods results show 

significant differences on algal growth (Figure 2).


Average cell number per ml 

100000000 

10000000 

1000000 

100000 

1 3 5 7 9 11 13 15 17 19 21 23 

Day 

Figure 2. Mean cell number of Cylindrospermopsis raciborskii under different photoperiods. 

Photoperiods 12 L:12 D and 14 L:10 D with mean cell 

numbers 8×10 6 ± 5cells ml -1 and 7×10 6 ± 4 cells ml -1 , 

respectively were higher than the other two 

treatments(P0.05) were detected for generation time of cellular 

division in day in the different groups studied. 

DISCUSSION 

In this study, the cells used in different treatments were 

selected from stationary phase of pure culture cells. Such 

cells reached to ultimate growth phase in initial 

environment and practically, they would be lost if were 

not transferred to new environment similar to their 

common conditions. Growth was observed after three 

days lag in all treatments (Figures 2 and 5). Lag (delay) 

time in phytoplankton response to suitable growth can 

influence bloom of phytoplankton in natural environments 

and experimental culture (Smith et al., 1992). Examination 

of lag time in initial growth of different treatments 

indicated that light does not influence upon lag phase. 

However, existence of lag time in growth phase is highly 

attributed to the age of pure culture cells (Fogg and Take, 

1987). 

According to obtained results, there is delay in duration 

of growth phase. In treatments under 10 L:14 D

Growth rate d -1 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0 

12:12 10:14 8:16 14:10 

Photoperiod 

Figure 3. Growth rate of Cylindrospermopsis raciborskii under different photoperiods (±SE) 

G (d) 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

12:12 10:14 8:16 14:10 

photoperiod 

Figure 4. Generation of cellular division of Cylindrospermopsis raciborskii under different 

photoperiods (±SE) 

photoperiod, delay in growth phase probably depends on 

young pure culture cells. With an increase in light time 

duration, the cellular concentration increases, whereas 

under this kind of light the growth rate is minimum as 

compared to that in other treatments. Also generation 

time of cellular division is short with increasing 

photoperiod. Hence, highest cellular division was 

recorded in treatments under 14 L:10 D and 12 L:12 D 

photoperiod. 


Increasing growth rates (µ) with increasing photoperiod 

was also observed. The influence of different 

photoperiods upon growth of C.raciborskii algae was 

studied by Shafik et al. (2001) and found that under 12 

L:12 D photoperiod, highest growth rates recorded were 

between (0.8 d -1 ) and (1 d -1 ). They also reported that 

photoperiods longer than 12 L:12 D reduced growth. 

These results are in agreement with those obtained from 

this study where reduced growth rates (µ) were recorded


Average cell number per ml 

10000000 

1000000 

100000 

1 3 5 7 9 11 13 15 17 19 21 23 25 

Day 

Figure 5. Mean cell numbers of Cylindrospermopsis raciborskii in different concentrations of phosphate 

Growth rate d -1 

/ 

0.3 

0.25 

0.2 

0.15 

0.1 

0.05 

0 

1.53 3.1 6.2 9.3 

Phosphate concentration(g/l) 

Figure 6. Growth rates of Cylindrospermopsis raciborskii in different concentration of 

phosphate (±SE). 

under the 14 L:10 D photoperiod. Continuous and high 

photoperiods such as 14 L:10 D, stimulate bio-production 

of Tillacoied and biosynthesis of chlorophyll in cells 

(Ibrahim, 1993). Increased synthesis of chlorophyll leads 

to increased photosynthesis and consequently results in 

increased production of photosynthesis in cell. 

If exposed to continuous light, there will not be enough 

time for consumption of these products. Investigations 

demonstrated that accumulation of materials obtained 

from photosynthesis such as glucose and carbohydrates 

can reduce photosynthesis intensity (Ibrahim, 1995). 

Thus, reducing photosynthesis will decrease cellular 

growth efficiency. In longer photoperiods, despite high 

cellular division speed and high cellular concentration, 

the cellular growth rate (µ) was low as compared to other 

3.1g/l 

6.2g/l 

9.3g/l 

1.53g/l 

photoperiods. On the other hand, shorter day length 

decreased growth rates of cyanobacteria and diatoms, 

and this decrease was greater in cyanobacteria (Foy and 

Gibson, 1993). 

Foy and Gibson (1993) observed that in comparison of 

cyanobacteria with Diatoms, there is severe reduction in 

growth process that resulted from photoperiod reduction. 

On this basis, minimum cellular concentration 

(accumulation) as well as SGR was observed in photo 

duration 8 L:16 D. 

Growth of most freshwater phytoplankton is regulated 

by the availability of phosphate Rhee (1980) and 

Thompson et al. (1994) suggested that under P limitation 

conditions, the growth is related to the P cell quota due 

mostly to a large storage capacity for P by these

G (d) 

0.45 

0.4 

0.35 

0.3 

0.25 

0.2 

0.15 

0.1 

1.53 3.1 6.2 9.3 

Phosphate concentration (gl -1 ) 

Figure 7. Generation of cellular division of Cylidrospermopsis raciborskii in different 

concentrations of phosphate (±SE) 

organisms. Phosphate storage in cyanoprokaryotes 

appears to be much larger than other species, and this 

capacity was reported to give them a competitive 

advantage over diatoms and chlorophytes (Shafink et al., 

2001). Highest mean cellular concentration recorded in 

the control group and in the group exposed to 6.2 gl -1 

phosphate indicates that limitation of phosphate even 

under desirable photo conditions reduces the rate of 

cellular chlorophyll, growth and photochemical capacity 

(Cullen and Maclnyre, 1998). 

Therefore, reducing or increasing the amount of 

phosphate in the environment resulted in the reduction of 

cellular division and cyanobacteria population. Desirable 

levels of phosphate in the culture environment and also 

increasing cellular division in this treatment could be the 

possible reason for increase in growth rate in the control 

group. Since cyanobacteria have high ability for 

absorption of phosphate even in case of the scarcity, 

reduction of environmental phosphate reduces 

photosynthesis rate and the effect of this reduced 

photosynthesis on cellular division and increased cellular 

division was significant. In the treatments exposed to 

(1.53 gl -1 ) phosphate, it appears that low concentration 

of phosphate in the initial stages of culture does not 

create limitation for growth process. Hence, cells absorb 

phosphate quickly and grow rapidly, however, as culture 

progresses further reduction in phosphate results in 

decreased cellular division and as well as reduction in 

mean cellular number. 

Previous investigations have demonstrated the 

relationship between phosphate intake and photoperiod. 

This explains increased cyanobactria growth during long 

days of the year (Litchman, 2003). It is evident from the 

results of the present study that in different treatments 

studied; C. raciborskii was compatible with photoperiod 


changes and different amounts of phosphate. Otherwise 

these algae would have to face a lot of problems in its 

natural life environment. In all treatments used in this 

study, cellular division and growth increase was observed. 

Ecological conditions are various ways 

which allow growth and dehiscence to occur in both 

tropical and sub-tropical regions. Tang and Vincent 

(2000) showed that growth and photosynthesis of pole 

cyanobacteria during day time depend on temperature. 

Finally, it was found that the growth of C. racibroskii 

algae is influenced by photo duration. The specific 

physiological traits possessed by this species explain its 

global distribution in various geographical regions. Three 

hypothesis may be considered in this regard; (1) 

colonies of this species are compatible with temperate 

climate and it may be suitable for advancement in the 

north latitude, (2) this species has wide range of 

tolerance from physiological perspective, (3) Climate 

changes resulting from global warming has resulted in 

greater dispersion and spreading of this species 

(Bernard and Dufour, 2004). 

This kind of cyanobacteria has high potential in storing 

phosphate and also it can be grown in various tropical 

lakes. Increased growth of C. raciborskii species in 

France-bech pool in France has been reported because 

of its compatibility and wide tolerance towards undissolved 

materials (Bernard and Dufour, 2004). On the 

other hand, Moisandr et al. (2002) reported that high 

salinity in estuary of Neuse Lake prevented the 

dominance of C. raciborskii species in that region. 

Reports about global dispersion of these algae indicate 

that C. raciborskii has high compatible ability and can 

also enter mid geographical latitudes. However, a global 

analysis of these results suggests that C. raciborskii has 

good adaptability, but poor ability to compete with micro


algae. This adaptability was demonstrated by the fact 

that C. raciborskii, which is described as a tropical 

cyanobacteria, is able to grow under different light and 

temperature conditions. In addition, C. raciborskii seems 

to be very tolerant of nutrient concentrations (Briand et 

al., 2001). This study probably shows that the growth 

strategy of cyanobacteria is under the effect of three 

factors: (1) Nitrogen fixation ability intermediate to 

existence of heterocysts when other algae groups face 

reduction in nitrate, (2) Ability of high phosphate 

absorption even when the amount of phosphate is low, 

(3) Growth ability lies in low light conditions and high 

temperature (Shafink et al., 2001). Thus, reduction and 

increasing of phosphate concentration in the 

environment is important as a preventive factor of 

growth. Eventually, it must be mentioned that colonies of 

C.raciborskii are different from the physiological and 

genetic perspectives. Hence, it must be emphasized that 

results from other studies indicate that special colony 

have considerable compatibility and other colonies show 

different behavior in this conditions. 


The authors wish to appreciate Mr. Parandavar, the 

Head of the Ecology Department as well as Mrs. Marjan 

Sadeghi and Uma Arshad of the Hydrology laboratory for 

their valuable assistance in executing this investigation. 

Authors also want to show their gratitude to Mr. Hamid 

Reza Pourali, the Head of Nutrition Section of the 

International Sturgeon Research Institute. 

REFERENCES 

Ahlegern G (1977). Growth of Oscillatoria agardhii in chemostate 

culture nitrogen and phosphorus reqirement. Oikos, 29: 209-224. 

Bernard C, Dufour PH (2004). Cylindrospermopsis raciborskii 

(Cyanobacteria) invasion at mid-latitudes: Selection, wide 

physiological tolerance, Phycol. Soc. Am. 40: 231-238. 

Briand JF, Robillot C, Quiblier-Lloberas C, Humbert JF (2001). 

Environmental context of Cylindrospermopsis raciborskii 

(Cyanobacteria) blooms in a shallow pond in france. Water Res. 

36(2002): 3183-3192. 

Chapman AD, Schelske CL (1997). Recent appearance of 

Cylindros-permopsis (Cyanobacteria) in five hypertrophic Florida 

Lakes. J. Phycol. 33: 191-195. 

Cullen JJ, Maclntyer JG (1998). Behavior,physiology and the niche of 

depth_regulating Phytoplankton in : Physiol. Ecol. Harmful Algal 

Blooms, (ed . DM Andrerson,AD Cembella , GM Hallegraff). 

Springer. Berlin. 41: 559-579. 

Duval E, Gragnon B, Varliner D (2005). Effects of two 

cyanotoxins,Microcystin-LR and Cylindrospermopsin,on Euglena 

gracilis, Earth. Environ. Sci. pp. 659-671. 

Fogg GE, Thake B (1987). Algal culture and phytoplankton ecology (3 rd 

edition), the University of Wisconsin press. 

Foy RH, Gibson CE (1993). The influence of irradiance photoperiod 

and temperature on thegrowth kinetics of three planktonic diatims. 

E. J. Phycol. 28: 203-212. 

Hawkins PR, Runngar MTC, Gackson ARB (1985). Several 

hepatotoxicity caused by the tropical, cyanobacterium 

Cylindrospermopsis raciborskii. Dept. Bot. James Cook University, 

Queensland 4811, Australia. 

Ibrahim ZH (1993). Photosynthesis: Botanic Physiology, Tehran 

University Publication. 4: p. 690. 

Ibrahim ZH (1995). Metabolism: Botanic Physiology, Tehran University 

Publication. 3: p. 514. 

Kotai J (1972).Instruction for preparation of modified nutrient solution 

Z8 for algae. Publication B-Norwegian institute for water research, 

Blindern, Oslo. 5: 11-69. 

Litchman E (2003). photosynthetic and growth responses of three 

freshwater algae to phosphorus limitation and day length, 

Limnological Research. Centre, EAWAG, kastanienbaum, 

Switzerland. 48: 2141-2148. 

Moisander PH, McClinton E, Paerl, HW (2002). Salinity effects on 

growth, photosynthetic parameters, and nitrogenase activity in 

estuarine planktonic cynobacteia. microb. Ecol. 43: 432-442. 

Rhee GY (1980). Continuous culture in phytoplankton ecology. in 

Droop MR, Janasch HW (Eds). Adv. Aquat. Microbiol. 2: 151-203. 

Shafik M, Herodek S, Presing M, Voros L (2001). Factors effecting 

growth and cell composition of cyanoprokaryote Cylindrospermopsis 

raciborskii. Algological Studies, 103: 75-93. 

Smith GJ, Zammerman RC, Alberte R (1992). Molecular and 

physiological responses of diatoms to variable levels of Irradiance 

and nitrogen availability growth of costatumin simulated up welling 

conditions., limnol. Oceanogr. 37(5): 989-107. 

Tang EPY, Vincent WF (2000). Effects of daylength and temperature 

on the growth and photosynthesis of an Arctic Cyanobacterium, 

Schizothrix calcicola (Oscillatoriaceae), J. Phycol. 35: 263-272. 

Thompson PA, Hee-mock OH, Ree GY (1994).Storage of phosphorus 

in nitrogen-fixing Anabaena flos-quae (Cyanophyceae). J. Phycol. 

30: 267-273. 

Wilson K, Mark SM, Baker P (1999). Molecular characterization of the 

toxic Cyanobacterium Cylindrospermopsis raciborskii and Design of 

a Species-Specific PCR. The Cooperative Research center for 

Water Quality and Treatment, Australian Water Quality Center. SA 

Water Corporation, Australia. 

Zakaria A, Al-Shehri MAM (2004). Cyanobacteria and their toxins in 

treated-water storage reservoirs in Abha city, Saudi Arabia.Dept. 

Biol. Sci. Faculty Sci. King Khalid University, Saudi Arabia.



DOI: 10.5897/AJB11.2027 



Uptake of cadmium from hydroponic solutions by 

willows (Salix spp.) seedlings 

Yongqing Liu 1,2 , Guang-Cai Chen 2 *, Jianfeng Zhang 2 , Xiang Shi 2 and Renmin Wang 1 * 

1 College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310029, Zhejiang, China. 

2 Research Institute of Subtropical Forestry, Chinese Academy of Forestry, Fuyang 311400, Zhejiang, China. 


Willow (Salix sp.) has large biomass production and high resistance to environmental stress. As an 

important multipurpose tree species in afforestation, it has been proved to be effective in the uptake 

and accumulation of metals from contaminated waters and soils. Suliu172 (Salix × jiangsuensis 'J172'), 

Hanliu (Salix matsudana), Weishanhu (Salix integra 'Weishanhu') and Yizhibi (S. integra 'Yizhibi') were 

chosen as model plants to evaluate their potential for uptake of cadmium from hydroponic culture and 

relative uptake mechanism. Cadmium uptake showed a linear increase in the short time course, and a 

nonlinear and slow increase in the long time course. After one week cultivation, cadmium accumulation 

in different parts of willows generally followed the order of root > stem > leaf. Cadmium influx in willow 

roots increased with the increase of cadmium concentration in hydroponic solutions. A modified 

Michaelis-Menten equation was employed to describe the concentration-dependent kinetics of cadmium 

uptake through the roots. Cadmium influx could be resolved into linear and saturable components 

under concentration–dependent kinetics. The saturable component followed Michaelis–Menten kinetics, 

which indicated that cadmium uptake across the plasma membrane was transporter–mediated. The 

uptake capacity (Vmax/Km) jointly decided by the Vmax and Km followed descending order of Hanliu > 

Weishanhu ≈ Yizhibi > Suliu172, indicating that their inherent potential of cadmium uptake reduced in 

turn. Low temperature and metabolic inhibitor inhibited the apparent uptake of cadmium in willow. Both 

active absorption and passive absorption occurred in the cadmium uptake by willow roots. 

Key words: Cadmium, willow, uptake kinetics. 

INTRODUCTION 

With the rapid development of mining, smelting, electroplating 

industries and agricultural activities such as the 

application of fertilizers and pesticides, cadmium pollution 

has become a severe and growing problem of concern 

(Taylor, 1997; Waalkes, 2000). Due to its harmful effects, 

the World Health Organization (WHO) has set a 

maximum limit concentration of 0.003 mg/L for cadmium 

in drinking water (WHO, 2008). Cadmium is a toxic metal 

without any known physiological function in plants and 

can be transferred efficiently from soil to plants. Cadmium 

in plant disrupts antioxidant enzyme system and causes 

metabolite modifications (Zhao, 2011; Zoghlami et al., 

2011). Moreover, special consideration should be paid 

*Corresponding author. E-mail: guangcaichen@sohu.com. Tel: 

+86 571 63105079. Fax: +86-571-63341304. 

to cadmium pollution in water-soil-plant systems because 

of its high mobility and low toxic concentrations in 

organisms (Moreno et al., 2000). Cadmium may pose a 

risk to human and animal health due to the transfer of a 

high level of cadmium from agricultural soils or aquatic 

system to the human food chain (Jackson and Alloway, 

1992). Therefore, cadmium is one of the most important 

metals to be considered in terms of food-chain 

contamination. 

Phytoremediation is a promising approach for in situ 

cleanup of contaminated sites. However, choosing a 

plant species that can remove metal ions from 

contaminated soil or water depends on three variables in 

the practice: plant growth, biomass and metal levels 

(Williams, 2002). Willow is an important multipurpose tree 

species in afforestation, which shows high resistance to 

salt and alkali, drought and water logging stress, and can 

grow well in all kinds of waters and soils. Willow has large


biomass production and is not directly associated with the 

food chain, which qualifies it for removing the soil 

pollutants gradually through short-rotation cultivation and 

harvesting periodically (Jaconette et al., 2005). Willow 

has remarkable capacity to concentrate elements including 

toxic heavy metals (Greger and Landberg, 1999; 

Dickinson and Pulford, 2005), especially cadmium 

(Berndes et al., 2004; Meers et al., 2007). Willow also 

has deep root system compared to grasses which can act 

as biological filter. These traits make it a potential ideal 

candidate for phytoremediation of cadmium contaminated 

waters and soils. Dickinson and Pulford, (2005) also 

reported that willow is a hyperaccumulator, and extracting 

cadmium with willow is an effective and low-cost 

phytoremediation method. Hence, it is necessary to 

understand the cadmium accumulation mechanism in 

order to assess the potential. 

Many researchers have focus on growth performance 

and cadmium uptake by willow adopting soil culture or 

field experiments, while kinetics of cadmium uptake by 

willow are rarely investigated. Willow’s cadmium uptake 

characteristics can be assessed rapidly using hydroponics 

or nutrient solutions culture (Watson et al., 2003). 

Furthermore, willow has high resistance to water logging 

stress, a primary evaluation of its phytoremediation ability 

towards water pollution by cadmium. The objective of this 

study was to examine whether willow is able to 

accumulate cadmium from hydroponic solutions. Hence, 

accumulation and uptake kinetics of cadmium by 

Suliu172 (Salix × jiangsuensis 'J172'), Hanliu (Salix 

matsudana), Weishanhu (Salix integra 'Weishanhu') and 

Yizhibi (S. integra 'Yizhibi') were investigated. The roles 

of bivalent cations, cation channel inhibitor (La and Cs), 

low temperature and metabolic inhibitor in the uptake of 

cadmium by Yizhibi and Suliu172 were also studied. 


Plant culture and pre-treatments 

Four species of willows, Suliu172 (Salix × jiangsuensis 'J172'), 

Hanliu (S. matsudana), Weishanhu (S.alix integra 'Weishanhu') and 

Yizhibi (S. integra 'Yizhibi'), were collected from a nursery in 

Hangzhou, Zhejiang Province, China. Culture vessel was a 40 × 20 

× 15 cm plastic box. One year old willow branches collected from 

the nursery were cut into about 10 cm length, then uniform and 

healthy cuttings were selected and cultivated in the basal nutrient 

solution containing (mg/L): KNO3, 510; Ca(NO3)2, 820; 

MgSO4·7H2O, 490; KH2PO4, 136; FeSO4, 0.6; H3BO3, 2.86; 

MnCl2·4H2O, 1.81; ZnSO4·7H2O, 0.22; (NH4)Mo7O24, 0.45; EDTA, 

0.744; CuSO4·5H2O, 0.08. The nutrient solution was aerated 

continuously and renewed every seven days. Nutrient solution pH 

was adjusted daily to 5.8 with 0.1 mol/L NaOH or HCl. Plants were 

grown under glasshouse conditions with natural light, day/night 

temperature of 26/20°C and day/night humidity of 70/85%. After four 

weeks of cultivation, the heights of willows seedlings were 0.8 to 1.5 

m high depending on different species, which were the applicable 

size for this study. 

Willow plants with uniform size for each species were selected 

and rinsed in deionized water, and then treated with a pre-treatment 

solution containing 2 mmol/L MES-TRIS (pH 5.8) and 0.5 mmol/L 

CaCl2 (Lasat et al., 1996). After 12 h pre-treatment, the plants were 

used for different experiments as subsequently described. All the 

experiments were carried out in vessels filled with an uptake 

solution identical to the pre-treatment solution. Cadmium was 

added as CdCl2·2.5H2O into the uptake solution 24 h before each 

experiment and stirred to ensure complete mixing. Before uptake 

experiment, 1 ml of uptake solution was collected and cadmium 

content was measured. 

Time-course dynamics of cadmium uptake and accumulation 

Willow roots were immersed in 400 ml uptake solution containing 2 

mmol/L MES-TRIS (pH 5.8), 0.5 mmol/L CaCl2, and 10 μM/L CdCl2, 

at each time interval (0 to 90 min for short term, and 2 to 72 h for 

long term time course experiments, respectively), willow was 

harvested and desorbed in ice-cold desorption solutions (2 

mmol/LMES-TRIS, and 5 mmol/L CaCl2, pH 5.8) for 15 min in order 

to remove most of the cadmium adsorbed on cell walls of roots 

(Lasat et al., 1996). After desorption, the plants were separated 

roots from shoots, the roots and shoots were oven-dried at 65°C for 

72 h, and weighed. Dried plant materials were ground using a mill. 

Plant materials were digested with HNO3/HClO4 (87/13, v/v) and the 

total concentrations of cadmium were determined using flame or 

graphite atomic absorption spectrometry (SOLAAR–M6, Thermo 

Fisher Scientific). For the long-term experiments, uptake solution 

was replaced every 8 h to keep the concentrations of cadmium in 

the uptake solutions unchanged. All treatments were performed in 

three replicates with two willow plants in each pot. 

Cadmium accumulation in roots, stems and leaves 

Four plants each were planted in 10 L plastic box containing 10 L 

solutions with low concentration (2 μmol/L CdCl2) and high 

concentration (100 μmol/L CdCl2) of cadmium for one week. The 

uptake solutions were replaced every two days. All treatments were 

performed in three replicates with four willow plants in each 10 L 

plastic box. After one week growth, willows were harvested and 

desorbed for 15 min, separated into roots, stems and leaves, and 

then oven-dried at 65°C for 72 h. Dried plant materials were ground 

and digested, and cadmium concentrations were determined using 

flame or graphite atomic absorption spectrometry. 

Concentration-dependent kinetics of cadmium uptake 

Willow was transferred to hydroponic pots containing 400 ml of 

uptake solution. Ten different concentrations of cadmium (0.25, 0.5, 

1, 2, 5, 10, 15, 30, 50 and 100 μmol/L) were used to study the influx 

kinetics of cadmium, and each treatment was replicated three times 

and each replicate had one pot with two willow plants. After 60 min 

of uptake, the plants were quickly rinsed with the pretreatment 

solution, and then desorbed in ice-cold desorption solutions (2 

mmol/LMES-TRIS, and 5 mmol/L CaCl2, pH 5.8) for 15 min. The 

plants were separated into roots and shoots, blotted dry with paper 

tissue, and dried at 65°C for 72 h. Cadmium concentrations were 

determined as previously described. 

Effects of Zn, Mg, Mn, Fe, Cu, La and Cs on cadmium influx 

To investigate the effects of metal cations and cation channel 

inhibitors on cadmium uptake, the experiment was conducted using 

Suliu172 and Yizhibi as model plants. The uptake solutions 

containing (μmol/L) 10 CdCl2, 10 CdCl2 +10 ZnCl2, 10 CdCl2 + 10 

MgCl2, 10 CdCl2 + 10 MnCl2, 10 CdCl2 + 10 FeCl2, 10 CdCl2 + 10

CuCl2 and 10 CdCl2 + 50 LaCl3, and 10 CdCl2 + 50 CsCl, 

respectively, were used. After 4 h of uptake, the willow plant roots 

were desorbed as previously described and then the roots and 

shoots were separated, oven-dried at 65°C for 72 h, and weighed 

for the determination of cadmium. All experiments were in three 

replicates for each treatment and each replicate had one pot with 

two willow plants. 

Effects of low temperature or metabolic inhibitors on cadmium 

uptake 

Plants were cultured in the uptake solution containing 2 mmol/L 

MES-TRIS (pH 5.8), 0.5 mmol/L CaCl2, and 10 mol/L CdCl2 for 

different treatments: control, 2,4-dinitrophenol (DNP) (100 mol/L), 

and 2°C. For the 2°C treatment, plants were transferred to ice-cold 

pre-treatment solution for 30 min prior to the uptake, and then the 

uptake containers were placed in an ice bath and shaded from light. 

At each time interval (0.5, 1, 2, 4, 8, 16 and 24 h), water loss 

caused by transpiration was measured by weighing and 

compensated by addition of deionized water. A 2.0 ml aliquot of the 

uptake solution was taken out from each pot for the determination 

of cadmium concentrations, and 2.0 ml of deionized water was then 

added to each pot. Total amounts of cadmium removed by 

sampling of the uptake solution were < 2% of the initial amounts of 

cadmium in each pot. After 24 h of treatment, plants were rinsed, 

separated into roots and shoots, blotted dry with tissue paper, then 

oven-dried and weighed. Cumulative uptake of cadmium by willows 

for each treatment was calculated from total cumulative depletion of 

cadmium in the uptake solution. All treatments were performed in 

three replicates with two willow plants in each pot. 

Statistical analysis 

All statistical analyses (ANOVA and LSD test for mean 

comparisons) were conducted with SPSS 16.0. Differences at p < 

0.05 were considered significant. Independent-samples T-tests 

were adopted to compare the metal cations treatments with control. 


Time–course dynamics of cadmium uptake and 

accumulation 

The uptake time is one of the most important factors 

affecting the uptake of heavy metals by plants. Uptake 

solutions of 10 μmol/L cadmium were chosen to study the 

short-term and long-term cadmium influx for four willow 

species, as willow could retain normal growth under the 

concentration of cadmium at 10 μmol/L in solution. The 

short- and long-term uptake periods were defined as 5 to 

90 min and 2 to 72 h, respectively (Figures 1 and 2). 

Figure 1 shows that the influx of cadmium in roots of 

willow was more or less linear within 90 min. The 

observation that linear, time-dependent cadmium 

accumulation intersected the y-axis above the origin in 

four willow species indicated that quite an amount of 

cadmium was not completely removed from roots with the 

desorption regime used in these experiments (Lu et al., 

2008). The slope of Suliu172 with the value of 0.006 

μmol/g root dry weight/min was the lowest among the 

Liu et al. 16211 

four cultivars. The slope k values of Hanliu, Yizhibi and 

Weishanhu showed no significant differences, which 

implied that the influx rates of the three willow species 

were almost alike during the short-term period within 90 

min. Moreover, after 90 min uptake, the cadmium 

concentration in the roots of Hanliu, Yizhibi and 

Weishanhu exhibited similar value, about 1.6 μmol/g root 

dry weight (DW), while Suliu172 was the lowest with the 

value of 1.1 μmol/g root dry weight. 

Furthermore, Figure 2 shows that the cadmium uptake 

gradually increased with increasing uptake time of 2 to 72 

h. After 72 h of uptake, the four willow species showed a 

significant difference in the cadmium uptake and 

accumulation (Figure 2). Also, after 72 h uptake of 

cadmium, the total cadmium accumulated in Hanliu was 

the highest (9.3 μmol/g root DW). The total cadmium 

accumulated in Suliu172 and Weishanhu were found to 

be 6.4 and 6.1 μmol/g root DW, respectively; and the total 

cadmium accumulated in Yizhibi was the lowest (5.2 

μmol/g root DW). The uptake rate became slower for all 

species at about 4 h for Hanliu and Weishanhu, while at 

about 8 h for Yizhibi and Suliu172. After the slower 

uptake rate period, they however returned to a high 

uptake rate. 

Cadmium accumulation in roots, stems and leaves 

The results of cadmium accumulation in willow roots, 

stems and leaves are given in Table 1. Cadmium content 

in different parts generally followed the order of root > 

stem > leaf. The result suggests that cadmium was 

mainly accumulated in willow roots. Cadmium content in 

roots showed a descending order of Hanliu > Suliu172 > 

Yizhibi > Weishanhu, which varied from 1.011 to 1.310 

μmol/g (2 μmol/L) and from 4.535 to 5.432 μmol/g (100 

μmol/L). Cadmium content in stems were not significantly 

different among the four willow species at solution of 

cadmium concentration of 2 μmol/L, while Suliu172 was 

significantly higher than Hanliu, Weishanhu and Yizhibi at 

100 μmol/L. Cadmium content in willow leaves of 

Suliu172 and Yizhibi were significantly higher than 

Weishanhu and Hanliu at 2 and 100 μmol/L. 

Willows have been shown to be promising for cadmium 

phytoextraction. Utmazian et al. (2007) reported that the 

cadmium concentrations in leaves varied between 11.9 

and 315 mg/kg (0.156 and 2.802 μmol/g), and the 

corresponding cadmium concentrations in roots between 

237 and 2610 mg/kg (2.108 and 23.219 μmol/g) among 

20 willow clones when they were exposed in 4.45 μmol/L 

cadmium solutions for four weeks. Cosio et al. (2006) 

reported that cadmium content were 39 mg/kg (0.347 

μmol/g) in leaves and 313 mg/kg (2.784 μmol/g) in roots 

at 3 μmol/L nutrient, which increased to 260 mg/kg (2.313 

μmol/g) in leaves and 798 mg/kg (7.099 μmol/g) in roots 

at 100 μmol/L for S. viminalis cultivated within six weeks 

in uptake solutions. Compared to the aforementioned


Total Cd influx(μmol g root DW -1 ) 


2.0 

1.8 

1.6 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

0 20 40 60 80 100 

2.0 

1.8 

1.6 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

C 

A 

Time(min) 

0.0 

0 20 40 60 80 100 

Time(min) 

R=0.986 

k=0.012 

R=0.975 

k=0.014 



2.0 

1.8 

1.6 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

0 20 40 60 80 

2.0 

1.8 

1.6 

1.4 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 

D 

B 

Time(min) 

R=0.997 

k=0.006 

0.0 

0 20 40 60 80 

Time(min) 

Figure 1. Short-term (5-90 min) cadmium influx of Yizhibi (A), Suliu172 (B), Hanliu (C) and Weishanhu (D). Data points and error bars 

represent means and SE, respectively. Error bars do not extend outside some symbols. DW, dry weight. 

results, cadmium accumulations of the four species in 

this experiment were relatively lower in general, which 

can be attributed to the shorter uptake time and different 

willow species. The variability in both cadmium accumulation 

and tolerance specificity exists between willow 

species (Hakmaoui et al., 2006; Utmazian et al., 2007). 

Concentration–dependent kinetics of cadmium 

uptake 

Figure 3 shows that the concentration-dependent 

cadmium influx kinetics of four willow species was 

characterized by smooth, non-saturating curves. The 

experimental curves could be graphically resolved into 

saturable and linear components by a modified Michaelis- 

Menten kinetics model: 

V = Vmax[C] / (Km + [C]) + k[C] 

Where, Vmax is the maximum influx rate of plant root cells, 

reflecting the inherent potential of uptake by plant roots 

(higher Vmax value indicates a higher inherent potential); 

Km is the characteristic constant which shows the 

relationship between plant cells and the elements 

R=0.990 

k=0.014 

absorption; a small Km indicates high affinity. The linear 

component represents cell-wall-bound cadmium that 

remained after desorption procedure. The saturable 

component of uptake probably indicates carrier-mediated 

transport across the root cell plasma membranes. Similar 

concentration-dependent kinetics has been reported for 

Zn (Lasat et al., 1996; Cohen et al., 1998; Hart et al., 

1998; Lombi et al., 2001). 

Analysis of the kinetic constants for cadmium uptake 

indicated that influx characteristics were different (Table 

2). The Vmax values of the four willow species varied 

between 2.31 to 11.67 μmol/g DW/h and followed the 

order of Hanliu > Weishanhu > Yizhibi > Suliu172, which 

indicated that their inherent potential of cadmium uptake 

reduced in turn. Uptake capacity of Hanliu was about four 

times that of Suliu172, and about two times that of 

Weishanhu and Yizhibi, while the uptake capacity of 

Weishanhu and Yizhibi's was similar. The Km value of the 

four willow species varied between 27.03 to 79.04 

μmol/L; the Km values of the four willow species at the 

same order of magnitude mean similar affinity. 

It is generally recognized that the uptake capacity of 

plants for ions from soils is also affected by the surface 

area and morphology of roots, rhizosphere pH, root 

exudates and other factors (Jones et al., 1996;



11 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

0 10 20 30 40 50 60 70 80 

11 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

A 

C 

Time (h) 

Time(h) 

0 

0 10 20 30 40 50 60 70 80 

Time (h) Time(h) 

Time (h) 



11 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 


0 

0 10 20 30 40 50 60 70 

11 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

B 

D 

Time (h) 

Ti me( h) 

0 

0 10 20 30 40 50 60 70 

Time(h) 

Figure 2. Long-term (2-72 h) cadmium influx of Yizhibi (A), Suliu172 (B), Hanliu (C) and Weishanhu (D). Data points and error bars repres ent 

means and SE, respectively. Error bars do not extend outside some symbols. DW, dry weight. 

Table 1. Cadmium accumulation (μmol/g) in roots, stems and leaves of the four willow species. 

Treatment Plant part Hanliu Weishanhu Yizhibi Suliu172 

Cadmium content 

(2 μmol/L) 

Cadmium content 

(100 μmol/L) 

Root 1.310 ± 0.034 a 1.011 ± 0.043 c 1.123 ± 0.004 b 1.127 ± 0.009 b 

Stem 0.016 ± 0.001 a 0.015 ± 0.000 ab 0.014 ± 0.000 b 0.016 ± 0.000 a 

Leaf 0.010 ± 0.000 b 0.012 ± 0.000 b 0.017 ± 0.001 a 0.016 ± 0.000 a 

Root 5.432 ± 0.105 a 4.535 ± 0.132 c 4.768 ± 0.159 bc 5.142 ± 0.203 ab 

Stem 0.799 ± 0.028 b 0.860 ± 0.020 b 0.846 ± 0.021 b 0.972 ± 0.015 a 

Leaf 0.019 ± 0.001 b 0.020 ± 0.000 b 0.026 ± 0.000 a 0.027 ± 0.001 a 

Different letters indicate significant differences between the means with P < 0.05 (mean ± SE). 

Krishnamurti et al., 1997). The accumulation of mineral 

elements in plants is not only related to the uptake ability 

of plant roots, but also affected by the transfer efficiency 

of mineral elements in plants (Clemens. 2006). The 

uptake capacity is jointly decided by the Vmax and Km, 

hence the Vmax/Km represents the absorption capacity of 

willow better. The Vmax/Km values (Table 2) indicated that 

the cadmium uptake capacity of willow followed Hanliu > 

Yizhibi > Weishanhu > Suliu172. The slopes of the linear 

components of Weishanhu and Yizhibi were also similar, 

but higher than that of Suliu172, while the slopes of the 

linear components of Hanliu were the lowest (Table 2).


Cd influx rate(μmol g root DW -1 h -1 ) 


10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

0 20 40 60 80 100 

C 

A 

Cd concentration(μmolL -1 ) 

0 20 40 60 80 100 




10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

B 

0 20 40 60 80 10 

D 


0 20 40 60 80 10 


Figure 3. Concentration-dependent cadmium influx kinetics in roots of Yizhibi (A), Suliu172 (B), Hanliu (C) and Weishanhu (D). Linear (dotted 

line) and saturable (open circles) components were derived from experimental data (filled circles) by mathematically resolving these curves 

using Origin 7.5. Data points and error bars represent means and SE, respectively. Error bars do not extend outside some symbols. DW, Dry 

weight. 

Table 2. Kinetic parameters for root cadmium influx of the four willow cultivars. 

Willow cultivar Vmax Km Vmax/Km k R 2 

Yizhibi 5.09 53.09 0.096 0.055 0.998 

Suliu172 2.31 27.03 0.085 0.039 0.998 

Hanliu 11.67 79.04 0.147 0.001 0.998 

Weishanhu 6.36 66.83 0.095 0.051 0.998 

R 2 , coefficient determination. 

Therefore, we could conclude that Hanliu’s cell wall had 

a relatively strong cadmium binding capacity, while 

Weishanhu and Yizhibi had similar but relatively lower 

capacity. The cadmium uptake ability of willows from 

hydroponic solutions depends on different willow species, 

size of willow seedlings and environmental conditions. 

Suliu172 is an interspecific hybrid and expresses well; 

fast-growing. Hanliu shows high resistance to salt and 

alkali drought but its water logging tolerance is not good. 

Yizhibi and Weishanhu are cultivars of S. integra and 

prefer adequate illumination. Particular physiological 

characteristics of willow species resulted in different 

cadmium uptake ability. The four weeks cultivation of 

willow seedlings partly reflected cadmium uptake ability 

of the four willow species. 

As the first barrier of metal ions across membrane into 

the cytoplasm, cell wall plays an important role in the 

process of resistance to metal ion toxicity (Nishzono, 

1987). Cell level reduces metal ion toxicity of plant roots 

in two ways: restriction of the metal from crossing the 

plasma membrane and detoxification of metal ions within 

the cell (Macfie et al., 2000; Hall, 2002). In other words, 

root uptake of divalent cations typically exhibits two 

phases: apoplastic binding and symplastic uptake (Hart 

et al., 1998; Zhao et al., 2002). To analyze cadmium 

influx into the symplast, apoplastic binding to reactive 

apoplastic sites of root cells must be taken into 

consideration and minimized by the desorption steps. 

According to Zhao et al. (2002), however, complete 

removal of apoplastically bound cadmium by desorption,

- 1 

- 

1 

Cd influx (µmolg root DW -1 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

A 

** 

** 

CK Zn Mg Mn Fe Cu La Cs 

* 

Cd influx (µmolg root DW -1 

- 

1 1 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

B 

CK Zn Mg Mn Fe Cu La Cs 

Figure 4. Effects of ZnCl2, MgCl2, MnCl2, FeCl2, CuCl2, LaCl3 and CsCl on cadmium uptake by the two cultivars 

of willow, Yizhibi (A), and Suliu172 (B). Error bars represent SE. Means marked with * indicate significant 

difference between control and treatments at P


Cd influx(μmol g root DW -1 ) 

0.5 

0.4 

0.3 

0.2 

0.1 

0.0 

0 5 10 15 20 25 

Time(h) 

ice-cold 

DNP 

control 

Figure 5. Cumulative uptake of cadmium by Yizhibi with treatments of control 

(triangles), ice-cold (squares), and+100 mol/L DNP (circles), as determined from the 

depletion of cadmium in the uptake solution. Data points and error bars represent 

means and SE, respectively. Error bars do not extend outside some symbols. DW, dry 

weight. 

suggesting that cadmium uptake by willow was probably 

regulated by Ca transporters or channels in root cell 

plasma membranes. For K ion channel inhibitor Cs, 

however, no significant inhibition of willow cadmium 

uptake was observed. 

Effects of low temperature or metabolic inhibitors on 

cadmium uptake 

Figure 5 exhibits the results of cadmium uptake of Yizhibi 

under low temperature and metabolic inhibitors (2, 4- 

DNP). Both treatments inhibited cadmium uptake of 

Yizhibi, and the inhibition effect of low temperature was 

more significant than that of DNP's. After 24 h of 

treatment at low temperature, cadmium uptake decreesed 

by 23% compared to that of the control, while 

metabolism inhibitor only decreased the cadmium influx 

by 6% compared with the control. At cold treatment, the 

process of cadmium uptake by willow had two phases: 

within 0 to 8 h, the cadmium uptake increased linearly 

with increasing uptake time; when the treatment time was 

longer than 8 h, the uptake process reached a saturation 

state. When the metabolic inhibitor, 2, 4-DNP, was 

supplied in the solution, the uptake rate gradually 

reduced until it leveled off after 16 h. The results 

observed here suggest that 2, 4-DNP not only inhibited 

the cadmium absorption, but also postponed the time of 

uptake rate to be saturated. 

Active symplastic translocation would be inhibited when 

roots are treated under cold condition or under the 

presence of metabolic inhibitors. Temperature had a 

close relationship with uptake process regulated by 

metabolism. At an appropriate growth temperature, all 

kinds of physiological metabolisms ran normally, while 

under low temperature, plant's metabolism slowed down 

and enzyme activity decreased, then plant growth was 

almost at a standstill, which had a negative influence on 

the cadmium active uptake. Through studying the impact 

of low temperature on cadmium uptake of Sedum alfredii, 

Lu et al. (2009) discovered that uptake of cadmium was 

significantly inhibited by low temperature treatment (4°C) 

in hyperaccumulating ecotype plants. In living cells, DNP 

acts as a proton ionophore, an agent that can shuttle 

protons (hydrogen ions) across biological membranes. It 

defeats the proton gradient across mitochondria and 

chloroplast membranes, collapsing the proton motive 

force that the cell uses to produce most of its ATP; hence, 

instead of producing ATP, the energy of the proton 

gradient is lost as heat. Sequentially, it restrains active 

absorption, and because the passive absorption of plants 

does not need energy, metabolic inhibitors have no 

impact on passive absorption. Figure 5 shows that the 

cadmium absorption of willow had the participation of

active transport. So, we could infer that active absorption 

took part in cadmium uptake by willow roots. 

Passive transport is the diffusion of substances across 

a membrane. This is a spontaneous process and cellular 

energy is neither expended nor related to metabolism. 

However, active absorption process depends on the 

energy that is produced by respiration, and has 

connection with metabolic activities (Wolterbeek et al., 

1988; Lu et al., 2009). Without removal of apoplastically 

bound cadmium by the desorption steps, cumulative 

uptake of cadmium by willows were calculated from total 

cumulative depletion of cadmium in the uptake solution in 

this experiment. Results reveal that cadmium uptake was 

only inhibited by 23% at low temperature treatment, while 

metabolism inhibitor only decreased the cadmium uptake 

influx by 6%. This illustrated two problems: first, active 

transport was an important way for cadmium absorption of 

willow, which was in accordance with conclusion of 

concentration-dependent kinetics experiment; secondly, 

root cell wall had bound a large number of cadmium, thus 

implying that the negative groups of cell wall had 

restricted cadmium ions by precipitation, adsorption and 

complexation in the process of passive absorption. 

Hence, the passive absorption was another important 

way to absorb cadmium for willow. 

Conclusion 

Cadmium accumulation by the four willow species 

increased when uptake time and initial cadmium 

concentration was increased. After one week cultivation, 

cadmium accumulation in different parts of willows 

generally followed the order of root > stem > leaf. Under 

hydroponics conditions, concentration-dependent cadmium 

influx could be resolved into linear and saturable 

components. The saturable component followed 

Michaelis-Menten kinetics, which indicated that cadmium 

uptake across the plasma membrane was transportermediated. 

In contrast, Hanliu had the highest cadmium 

uptake capacity, Weishanhu and Yizhibi had medium, 

while Suliu172 had the lowest. More also, time course 

dynamic results revealed that cadmium accumulation 

linearly increased during a short time course, but 

increased with prolong uptake time and became 

nonlinear, while a slow absorption rate phase were 

observed during a long time course. 

In addition, Zn and Cu decreased the cadmium uptake 

of Yizhibi significantly, while other cations had no 

significant effect. However, the cadmium influx into roots 

of Yizhibi was significantly suppressed by Ca channel 

inhibitor La, implying that Ca transporters or channels 

were responsible for the cadmium uptake of willow. 

Results also indicate that K ion channel inhibitor Cs had 

no obvious inhibition effect on the cadmium uptake of 

willow. Low temperature and metabolic inhibitor inhibited 

the apparent uptake of cadmium in willow via root 

cadmium active transport. Both active absorption and 


passive absorption took part in the cadmium uptake by 

willow roots. 


This work was supported by the Research Institute of 

Subtropical Forestry, Chinese Academy of Forestry (RISF 

6803) and Jiangsu Provincial Key Scientific and 

Technological Project (BE2009603 and BE2008636). We 

sincerely thank Professor Xiao–Quan SHAN, State Key 

Laboratory of Environmental Chemistry and 

Ecotoxicology, Research Center for Eco-Environmental 

Sciences, Chinese Academy of Sciences, for his 

comments on this paper. 

REFERENCES 

Berndes G, Fredrikson F, Borjesson P (2004). Cadmium accumulation 

and Salix-based phytoextraction on arable land in Sweden. Agr. 

Ecosyst. Environ. 103: 207-223. 

Clemens S (2006). Toxic metal accumulation, responses to exposure 

and mechanisms of tolerance in plants. Biochimie, 88: 1707-1719. 

Cohen CK, Fox TC, Garvin DF, Kochian LV (1998). The role of irondeficiency 

stress responses in stimulating heavy-metal transport in 

plants. Plant. Physiol. 116: 1063-1072. 

Cosio C, Vollenweider P, Keller C (2006). Localization and effects of 

cadmium in leaves of a cadmium-tolerant willow (Salix viminalis L.) I. 

Macrolocalization and phytotoxic effects of cadmium. Environ. Exp. 

Bot. 58: 64-74. 

Dickinson NM, Pulford ID (2005). Cadmium phytoextraetion using short 

rotation coppice Salix: the evidence trail. Environ. Int. 31(4): 609-613. 

Greger M, Landberg T (1999). Use of willow in phytoextraction. Int. J. 

Phytoremediat. 1(2): 115-123. 

Gurinot ML (2000). The ZIP family of metal transporters. Biochim. 

Biophys. Acta. 1465: 190-198. 

Hakmaoui A, Baron M, Ater M (2006). Environmental Biotechnology 

Screening Cu and Cd tolerance in Salix species from North Morocco. 

Afr. J. Biotechnol. 5(13): 1299-1302. 

Hall JL (2002). Cellular mechanisms for heavy metal detoxificationand 

tolerance. J. Environ. Bot. 53: 1-11. 

Hart JJ, Welch RM, Norvell WA, Sullivan LA, Kochian LV (1998). 

Characterization of cadmium binding, uptake, and translocation in 

intact seedlings of bread and durum wheat cultivars. Plant Physiol. 

116: 1413-1420. 

Jackson AP, Alloway BJ (1992). The transfer of cadmium from 

agricultural soils to the human food chain. In: Biogeochemistry of 

Trace Metals (Adriano DC, ed.). Lewis Publishers, Boca Raton, F L. 

pp. 109-158. 

Jaconette M, Isebrands JG, Theo V, Stig L (2005). Development of 

short-rotation willow coppice systems for environmental purposes in 

Sweden. Biomass. Bioenerg. 28(2): 219-228. 

Jones D, Darah P, Koehian L (1996). Critical evaluation of organic acid 

mediated iron dissolution in the rhizosphere and its potential role in 

root iron uptake. Plant. Soil, 180: 57-66. 

Krishamurti GSR, Cieslinski G, Huang PM, VanRees KCJ (1997). 

Kinetics of cadmium release from soils as influenced by organic 

acids: Implication in cadmium availability. J. Environ. Qual. 26: 271- 

277. 

Lasat MM, Baker AJM, Kochian LV (1996). Physiological 

characterization of root Zn 2+ absorption and translocation to shoots in 

Zn hyperaccumulator and nonaccumulator species of Thlaspi. Plant 

Physiol. 112: 1715-1722. 

Lasat MM, Pence NS, Garvin DF, Ebbs SD, Kochian LV (2000). 

Molecular physiology of zinc transport in the Zn hyperaccumulator 

Thlaspi caerulescens. J. Exp. Bot. 51: 71-79. 

Lombi E, Zhao FJ, McGrath SP, Young SD, Sacchi GA (2001).


Physiological evidence for a high-affinity cadmium transporter highly 

expressed in a Thlaspi caerulescens ecotype. New. Phytol. 149: 53- 

60. 

Lu LL, Tian SK, Yang XE, Wang XC, Brown P, Li TQ, Zhen LH (2008). 

Enhanced root-to-shoot translocation of cadmium in the 

hyperaccumulating ecotype of Sedum alfredii. J. Exp. Bot. 59(11): 

3203-3213. 

Macfie SM, Welbourn PM (2000). The cell wall as a barrier to uptake of 

metal ions in the unicellular green alga Chlamydomonas reinhardtii 

(Chlorophyceae). Arch. Environ. Con. Tox. 39: 413-419. 

Meers E, Vandecasteele B, Ruttens A, Vangronsveld J, Tack FMG 

(2007). Potential of five willow species (Salix spp.) for phytoextraction 

of heavy metals. Environ. Exp. Bot. 60: 57-68. 

Moreno CJ, Moral R, Perez EA, Perez MD (2000). Cadmium 

accumulation and distribution in cucumber plant. J. Plant. Nutr. 23: 

243-250. 

Nishzono H (1987). The role of the root cell wall in the heavy metal 

tolerance of Athyrium yokoscense. Plant. Soil. 101: 15-20. 

Pence NS, Larsen PB, Ebbs SD, Letham DLD, Lasat MM, Garvin DF, 

Eide D, Kochian LV (2000). The molecular physiology of heavy metal 

transport in the Zn/Cd hyperaccumulator Thlaspi caerulescens. Proc. 

Natl. Acad. Sci. USA. 97: 4956-4960. 

Taylor MD (1997). Accumulation of cadmium derived from fertilisers in 

New Zealand soils. Sci. Total. Environ. 208(1-2): 123-126. 

Tripathi RD, Rai UN, Gupta M, Yunus M, Chandra P (1995). Cadmium 

transport in submerged macrophyte Ceratophyllum demersum L. in 

presence of various metabolic inhibiters and calcium channel 

blockers. Chemosphere, 31: 3783-3791. 

Utmazian MND, Wieshammer G, Vega R, Wenzel WW (2007). 

Hydroponic screening for metal resistance and accumulation of 

cadmium and zinc in twenty clones of willows and poplars. Environ. 

Pollut. 148: 155-165 

Waalkes MP (2000). Cadmium carcinogenesis in review, J. Inorg. 

Biochem. 79: 241-244. 

Watson C, Pulford ID, Riddell-Black D (2003). Development of a 

hydroponic screening technique to assess heavy Metal resistance in 

willows (Salix). Int. J. Phytoremediat. 5(4): 333-349. 

Welch RM, Norvell WA (1999). Mechanisms of cadmium uptake, 

translocation and deposition in plants. In: Cadmium in soils and 

plants (McLaughlin, M.J., Singh, B.R., eds.). Kluwer Academic 

Publishers, Dordrecht, pp. 125-150. 

WHO (2008). Guidelines for Drinking Water Quality: Recommendations, 

vol. 1, 3rd ed., World Health Organisation, Geneva. 

Williams JB (2002). Phytoremediation in wetland ecosystems: progress, 

problems, and potential. Crit. Rev. Plant Sci. 21: 607-635. 

Wolterbeek HT, Meer AVD, Bruin MD (1988). The uptake and 

distribution of cadmium in tomato plants as affected by 

ethylenediaminetetraacetic acid and 2, 4-dinitrophenol. Environ. 

Pollut. 55(4): 301-315. 

Zhao FJ, Hamon RE, Lombi E, McLaughlin MJ, McGrath SP (2002). 

Characteristics of cadmium uptake in two contrasting ecotypes of the 

hyperaccumulator Thlaspi caerulescens. J. Exp. Bot. 53: 535-543. 

Zhao FJ, Jiang RF, Dunham SJ, McGrath SP (2006). Cadmium uptake, 

translocation and tolerance in the hyperaccumulator Arabidopsis 

halleri. New Phytol. 172: 646-654. 

Zhao Y (2011). Cadmium accumulation and antioxidative defenses in 

leaves of Triticum aestivum L. and Zea mays L. Afr. J. Biotechnol. 

10(15): 2936-2943, 

Zoghlami LB, Djebali W, Abbes Z, Hediji H, Maucourt M, Moing A, 

Brouquisse R, Chaïbi W (2011). Metabolite modifications in Solanum 

lycopersicum roots and leaves under cadmium stress. Afr. J. 

Biotechnol. 10(4): 567-579.



DOI: 10.5897/AJB11.2269 



Relationship between abscisic acid (ABA) 

concentration and some physiological traits in two 

wheat cultivars differing in post-anthesis droughtresistance 

Saeed Saeedipour 1 * and Foad Moradi 2 

1 Department of Agronomy, Shoushtar Branch, Islamic Azad University, Shoushtar, Iran. 

2 Agriculture Biotechnology Research Institute, Karaj, Iran. 


This work investigated the effects of endogenous abscisic acid (ABA) and physiologic parameters 

related to yield in two wheat cultivars (Triticum aestivum L.), Marvdasht and Zagros (sensitive and 

tolerant to terminal season drought, respectively) grown in pots under well watered and water-stressed 

starting from anthesis until maturity. All physiological parameters were affected by drought stress. 

Results show that water deficits enhanced the senescence by accelerating loss of leaf chlorophyll and 

soluble proteins and the loss was more in Marvdasht than Zagros. The net CO2 assimilation rate (PN) in 

flag leaves during water deficit displayed a strict correlation with the drought sensitivity of the 

genotypes and showed an early reduction in Marvdasht. Water stress resulted in a marked increase just 

in the ABA content of the drought-sensitive that led to reduced transport of sucrose into the grains and 

lowered the starch synthesis ability of grains, whereas, sucrose uptake and conversion by grains was 

stimulated by low ABA concentrations in Zagros. The effect of drought on grain yield was primarily due 

to the significant reduction in grain weight, particularly in drought-sensitive. The results indicate that 

grain filling processes under water restriction are limited by low substrate availability and reduced 

synthesis capacity of the sink. These results raised the possibility that water stress-induced elevated 

levels of endogenous ABA contribute to reduced grain growth. 

Key words: Abscisic acid, chlorophyll, flag leaves, grain yield, soluble proteins, soluble sugar, starch, wheat 

(Triticum aestivum L.). 

INTRODUCTION 

Reports on drought-induced reduction in seed yield of the 

crop are highly variable due to differences in the timing 

and intensity of the stress imposed and the genotypes 

used (Ramirez-Vallejo and Kelly, 1998). Drought stress 

decreases photosynthetic rate, thereby decreasing the 

amount of assimilates available for export to the sink 

organs (Kim et al., 2000). Plants grown under drought 

condition have a lower stomatal conductance in order to 

*Corresponding author. E-mail: saeeds79@gmail.com. 

Abbreviations: ABA, Abscisic acid; DAA, days after-anthesis; 

HI, harvest index; WW, well-watered; gs, stomatal conductance. 

conserve water. Consequently, CO2 fixation is reduced 

and photosynthetic rate decreases, resulting in less 

assimilate production for growth and yield of plants. 

Severe drought stress also inhibits the photosynthesis of 

plants by causing changes in chlorophyll content, by 

affecting chlorophyll components and by damaging the 

photosynthetic apparatus (IturbeOrmaetxe et al., 1998). 

Drought can also affect carbohydrate metabolism in 

plant reproductive organs (Liu et al., 2004). For example, 

Setter et al. (2001) found higher or at least similar levels 

of sucrose in maize ovaries between drought-stressed 

and well watered controls. These results imply that in 

addition to assimilate availability per se, the capacity for 

utilizing them in the reproductive structures may also be 

affected under drought stress. Thus, drought-induced


changes in carbohydrate status and metabolism in crop 

reproductive structures are crucial for successful fruit set. 

In addition to photosynthate supply, decrease in water 

potential and higher abscisic acid (ABA) accumulation in 

the reproductive structure of plants subjected to drought 

may also contribute to the loss of fruit or seed set (Liu et 

al., 2004). 

ABA also promoted dry matter accumulation in several 

organs and its level was strongly correlated with the 

growth rates of both fruits and seeds (Wang et al., 1998). 

Isogenic lines of wheat containing high levels of 

endogenous ABA appear to be better at osmoregulation 

and exhibit better growth and higher yields under water 

stress (Quarrie et al., 1999). This suggests that an 

appropriate level of ABA will be necessary for plants to 

grow successfully under stress conditions (Spollen et al., 

2000). 

Although, it has been widely speculated that ABA may 

be causally related to growth inhibition (Dodd and Davies, 

2005). 

In addition to the physiological and biochemical 

responses of plants to water stress, the information on 

the molecular mechanisms of drought stress adaptation 

could be useful for the genetic improvement of droughtresistant 

crops/genotypes. Among the stress induced 

proteins identified, are those implicated in the 

biosynthesis of osmolytes (Ishitani et al., 1995), in the 

uptake and compartmentation of ions (Lisse et al., 1996), 

in hydroxyl-radical scavenging (Ingram and Bartels, 

1996) and protection of cellular structure (Neslihan- 

Ozturk et al., 2002). Proteins that show significant down 

regulation under drought stress were observed for 

photosynthesis-related function (Neslihan-Ozturk et al., 

2002). Changes in protein patterns induced due to 

drought play a pivotal role in the adaptive response of 

plants to the stress (Riccardi et al., 1998). In line with 

these findings, drought stress initiated at different growth 

stages may induce quantitative and qualitative changes 

in wheat leaf proteins. 

The objective of this study was to investigate the 

differential effect of drought stress on seed ABA content 

and some physiological parameters and yield in two 

wheat (Triticum aestivum L.) genotypes differing in 

degree of drought resistance. 


Experimental procedure and design 

Based on preliminary experiments (Saeidi et al., 2006), two 

contrasting winter wheat cultivars (Triticum aestivum L.) Marvdasht 

and Zagros (drought susceptible and tolerant during grain filling, 

respectively were used in pot culture experiments during the 

growing season from 2009 to 2010 in the greenhouse of 

Agricultural Biotechnology Research Institute of Iran (48°20 N; 

31°41 E; 20 m above sea level). Pots with a diameter of 23 cm and 

height of 25 cm were each filled with 8 kg pot -1 sieved yellow drab 

soil mixed with 20 g pot -1 manure fertilizer and 3.3 g pot -1 

compound fertilizer (N:P:K = 9:8:8). The soil contained organic 

matter of 1.48%, total N of 0.12%, available N of 82.3 µg g -1 , 

available P2O5 of 30.9 µg g -1 , available K2O of 126.7 µg g -1 . Drought 

stress was imposed by withholding the amount of water applied in 

order to keep the soil moisture level at about 50% of the field 

capacity (FC). For non-stressed (control) treatments, the soil 

moisture was maintained field capacity until the plants were 

harvested. Fifteen seeds per pot were initially sown and later 

thinned to five at the third-leaf stage. The pots were weighed daily 

and watered to restore the appropriate moisture by adding a 

calculated amount of water. The experiment was 2 x 2 (two cultivars 

and two water regimes) factorial design with four treatment. Each of 

the treatment had four replications with three sub-samples, in a 

complete randomized block design. 

Physiological measurements 

The net photosynthetic rate (PN), stomatal conductance (gs) were 

measured with a portable photosynthesis system LI-6400 (LI-COR, 

Lincoln, USA) on the flag leaves on 7, 10, 15, 22 and 31 days after 

anthesis. Photosynthetically active radiation (PAR) of 300 µmol m -2 

s -1 was provided at each measurement by the 6400-02 light source. 

The fully expanded flag leaves on the stated dates were 

homogenized in ice cold 100% (v/v %) acetone (1.5 ml for 250-mg 

sample) and extracted for 24 h. Samples were centrifuged at 5,000 

g for 15 min at 4°C. The pellet was extracted again with 80% (v/v 

%) acetone (1.5 ml for 250 mg sample) for 24 h. After centrifugation 

(5,000 g, 15 min, 4°C), the supernatants were collected. The 

chlorophyll composition was measured with a double-beam 

spectrophotometer using the method of Lichtenthaler and Wellburn 

(1983). This method involves measurement of the light absorbed in 

the plant extract at 646.8 and 663.2 nm. Six leaves were used for 

each treatment. 

Chemical analysis 

For seed sugar, starch analyses, protein and ABA content of the 

seed samples which obtained at 7, 15 and 31 days after the 

commencement of drought stress were dried at 80°C for 48 h. 

Sugars 

300 mg ground plant material was weighed into a 50 ml volumetric 

flask and 30 ml of double-demineralised water was added. The 

material was then extracted by incubating in a shaking water bath 

at 60°C for 30 min. The flask was quickly cooled on ice, and filled 

up to the mark with double-demineralised water followed by 

filtration with (blue-band) filter paper (Faltenfilter 5951/2, Scheicher 

and Schüll Co., Dassel, Germany). Sugars were determined by 

using enzymatic test kits and absorbances of the solutions were 

read at 340 nm. 

Starch 

Starch determination was performed following enzymatic assay 

procedure using the starch determination kit from Boehringer 

(Mannheim, Germany). Homogenised ground seed samples of 300 

mg were weighed into Erlenmeyer flasks, and 20 ml of 

dimethylsulfoxide and 5 ml HCl (8 mol l -1 ) were added. The sealed 

flask was then incubated for 30 min at 60°C in a shaking water 

bath. The sample solutions were cooled quickly to room 

temperature and approximately 50 ml water was added. The pH 

was adjusted to 4-5 with sodium hydroxide (5 M) under vigorous 

shaking. The solution was then transferred to a 100 ml volumetric 

flask, rinsed with water, filled up to the mark with water and filtered

Saeedipour and Moradi 16221 

Figure 1. Changes in chlorophyll a and b content in control, (A) and (C) and water stress treatments, (B) and (D) 

in flag leaves during grain filling in two wheat cultivars (drought Sensitive cv. Marvdasht and drought Tolerant cv. 

Zagros). Vertical bars represent ± SE of the mean (n=4) Data are means ± SE of three independent samples. SE 

bars are not shown where they are smaller than symbols. 

using Falten filter 5951/2 (Scheicher and Schüll Co., Dassel, 

Germany). 

Protein content determination 

Leaf samples were ground in liquid nitrogen and the powder was 

dissolved in 1 ml of 50 mM HEPES-NaOH buffer pH 7.6 containing 

3 mM DTT. After centrifugation for 10 min at 13000 g, the protein 

concentration was measured using the method Sedmak and 

Grossberg (1977), using BSA as standard protein. This allowed all 

enzymatic activities to be expressed relative to the soluble protein 

concentration. 

ABA 

Metabolite extraction from freeze-dried grains (second and third 

kernel from each spikelet) or flag leaf of two wheat genotypes was 

performed. Extracts were passed through a Sep Pak C18-cartridge. 

Methanol was removed under reduced pressure and the aqueous 

residue was partitioned three times against ethyl acetate at pH 3.0. 

The ethyl acetate of the combined organic fractions was removed 

under reduced pressure. The newly obtained residue was taken up 

in TBS-buffer (Tris buffered saline; 150 mmol L -1 NaCl 1 mmolL -1 

MgCl2 and 50 mmol L -1 Tris at pH 7.8) and subjected to an 

immunological ABA assay (ELISA) as described earlier (Mertens et 

al., 1985). 

RESULTS 

Chlorophyll content 

In the well water and drought stress plants, relevant 

differences were recorded in the leaves (Chl) throughout 

the experiment (Figure 1A and 1C). Chl a and b contents 

decreased steadily in response to water deficit treatment 

and a significant change were found in the Chl a and b 

contents at 31 DAA between treatments (Figure 1B and


Figure 1. Changes in chlorophyll a and b content in control, (A) and (C) and water stress treatments, (B) 

and (D) in flag leaves during grain filling in two wheat cultivars (drought Sensitive cv. Marvdasht and 

drought Tolerant cv. Zagros). Vertical bars represent ± SE of the mean (n=4) Data are means ± SE of 

three independent samples. SE bars are not shown where they are smaller than symbols. 

1D). Irrespective to water regime, the lower Chl levels 

were measured in flag leaves of the drought-sensitive 

Marvdasht during 7 to 22 DAA. Drought stress imposed 

at anthesis contrast to control treatment led to the 

senescence process started earlier in plants of both 

cultivars (Figure 1B and 1D). 

Photosynthetic performance 

The net CO2 assimilation rate (PN) of both cultivars under 

well-watered (WW) condition was significantly higher than 

under water stress and the difference between cultivars 

became more pronounced under stress condition (Figure 

2C and 2D). The PN of flag leaf in both cultivars under 

WW treatment exhibited a more moderate decline with a 

similar changing pattern in both cultivars, however, 

Marvdasht had lower values in PN nearly 9 contrast to 14 

μmol m -2 s -1 CO2 at the end of the experiment. At the 

beginning of water stress, imposing the PN reduced by 67 

and 50% in Marvdasht and Zagros compared with those 

of the control treatments, respectively. These reduction 

remain constant in drought-tolerant while dropped to 75% 

at the end of the experiment in drought-sensitive cultivar 

(Figure 2D). Similar to PN, values of gs in WW treatment 

were significantly higher than under water stress (Figure 

2A and 2B). Stomatal conductance (gs) under water 

withholding was significantly lower than the respective 

controls at all stages sampling and the differences kept 

remain with development. The water stress resulted in 

evident reduction in gs at early stage (7 DAA). A 

substantial reduction in gs of both cultivars during 7 DAA 

was followed by a further slight reduction till to end of 

experiment. 

Leaf protein contents 

The amounts of soluble proteins decreased within the 

period of after anthesis in both treatments (Figure 3A and


Figure 3. Changes in soluble proteins and net ABA content in control, (A) and (C) and water stress treatments, (B) 

and (D) in flag leaves during grain filling in two wheat cultivars (drought Sensitive cv. Marvdasht and drought 

Tolerant cv. Zagros). Vertical bars represent ± SE of the mean (n=4) Data are means ± SE of three independent 

samples. 

3B), although, considerable differences were detected 

between treatments, as substantial reduction occurred in 

both cultivars under water stress compared with the WW 

treatment. Irrespective of treatment, Zagros revealed 

higher soluble proteins content than Marvdasht throughout 

all stages sampling. Reduction in soluble proteins 

under water stress was more remarkable than well 

watered treatment from day 10 onwards in Marvdasht, 

since this difference was not evident until 31 DAA in 

Zagros (Figure 3B). Opposite to other physiological 

parameter mentioned, the leaf ABA contents increased 

by water stress imposed in both cultivars, however, the 

increment was more pronounced in drought-tolerant than 

sensitive one during 15 DAA (Figure 3D). In comparison, 

ABA levels under stress regime was significantly more 

than respective to controls at all stages except for day 31, 

and the differences reached to maximum value by day 15 

and then underwent a rapid reduction during 15 to 31 

DAA. In addition, an obvious differences in absolute ABA 

concentration was observed between cultivars under WW 

treatment and the ABA level was markedly more during 

20 DAA in drought-tolerant than drought-sensitive cultivar 

(Figure 3C). 

Seed yield and yield components 

In both genotypes, drought stress imposed at anthesis 

stage resulted in significant seed yield reduction (Table 

1). Drought stress that lasted for 31days resulted in 45.6 

and 8.2% seed yield reductions in Marvdasht and Zagros, 

respectively. The effect of drought on seed yield was 

primarily due to the significant reduction in grain weight 

per plant (Table 1). It is noteworthy that water stress led 

to 10.4% numbers of grains reductions in Marvdasht, 

whereas had no effect on Zagros grain number (Table 1). 

A similar changing pattern was found for aerial biomass 

in both cultivars. Generally, harvest index (HI) decreased 

under water stress condition, although, the reduction was 

more in drought-sensitive (37%) than to drought-tolerant


Table 1. Effect of different water treatment, well watered (control), withholding water (stress) from anthesis till to maturity on the final number 

of kernel per spike, kernel weight per spike, the thousand-kernel weight, aerial biomass of plant and harvest index in two wheat cultivars. 

Cultivar Water-deficit 

treatment 

Number of 

grains per ear 

Grain yield 

per ear (g) 

1000 grain dry 

mass (g) 

Aerial biomass (g 

plant -1 ) 

Harvest 

Index (HI) 

Marvdasht WW 60.41 a 1.78 a 38.96 a 3.82 a 67.31 a 

WS 54.16 b 0.97 d 19.24c 2.59 b 42.33 c 

Zagros WW 48.37 c 1.43 b 33.44 b 2.51 b 64.76a 

WS 48.67bc 1.31 c 29.71b 2.62 b 56.81 b 

LSD (0.05) 

5.52 0.58 4.53 0.37 5.91 

Letters indicate statistical significance at p 0.05 within the same cultivar. 

(12%). 

Assimilate availability, starch synthesis and ABA 

accumulation 

Drought stress altered the sucrose concentration in the 

grains of the two wheat genotypes, as available sugar 

concentration was suppressed due to drought for 

Marvdasht but not for Zagros during 15 DAA (Figure 4B). 

The reduction in sucrose content of stressed grains 

became much pronounced (47% of control) at 15 DAA in 

drought-sensitive compared with those of the control 

whereas, a further slight elevation (3%) occurred during 

similar stage sampling in drought-tolerant compared with 

their respective controls (Figure 4B). Likewise, a rapid 

loss of sucrose began in stressed grains than in controls 

from day 15 onwards in Zagros and this event was 

simultaneous with mark starch accumulation during the 

same period (Figure 4B and 4D). A nearly linear pattern 

of starch accumulation was observed by stressed grains 

during all stage sampling in both cultivars (Figure 4D). 

However, a period of 16 days water stress (15 to 31 

DAA) caused a sharp enhanced in starch concentration 

per grain especially in drought-tolerant. A comparison 

between grain age under stress-watered conditions 

indicates a greater capacity (50 and 27%) of grains for 

starch synthesis at day 31 than at day 15 in Zagros and 

Marvdasht, respectively. A period of 8 days (7 to 15 DAA) 

water stress had no effect on the starch synthesis ability 

of the sink (Figure 4D). On a grain starch accumulation, 

differences between treatments were still not significant 

at day 15. However, at day 31 differences between 

treatments were apparent on this basis. The percentage 

conversion, as a proportion of total sucrose uptake, was 

considerably higher in stressed grains at day 31 in 

comparison with grains from control plants, implying that 

the conversion of sucrose taken up by the endosperm 

cells had been effectively raised by water stress. 

Under limited conditions, ABA content of both cultivars 

significantly enhanced in all stage sampling compared to 

their respective controls (Figures 4E and 4F). A pattern of 

grain ABA levels similar to that of control treatment was 

observed under stress conditions in both cultivars. The 

grain ABA content achieved a maximum value by day 15, 

and then undertakes a rapid reduction during the later 

stage of grain growth (15 to 31 DAA) (Figure 4F). 

Regardless of treatments; grain ABA concentration was 

more in drought-sensitive than drought-tolerant. In comparison, 

under water deficit, the grain ABA content in 

Marvdasht reached 1.8 fold of Zagros at the end of the 

experiment (Figure 4F). On the basis of our results, total 

sucrose conversion was stimulated by the lower ABA 

concentration in drought-tolerant in water stress 

treatment, but inhibited by higher ABA level in droughtsensitive; 

the higher ABA concentration in Marvdasht cv. 

caused the greater inhibition of sucrose conversion in 

grains (Figure 4B and 4F). Increase in Marvdasht grain 

ABA content caused a significant reduction in sucrose 

availability and starch accumulation when compared with 

their counterpart Zagros ABA concentration. 

DISCUSSION 

Varieties significantly differed in photosynthetic activities, 

and these differences could not only be expressed under 

the control condition but also became more obviously 

under water stress. In many experiments, it has been 

shown that photosynthesis decreases when gs decreases 

(example, Tenhunen et al., 1987; Nilsen and Orcutt, 

1996). Chaves and Oliviera (2004) concluded that gs only 

affect photosynthesis at severe drought stress. The 

decrease in photosynthesis in drought stressed plants 

can be attributed both to stomatal (stomatal closure) and 

non-stomatal (impairments of metabolic processes) 

factors. Under stress condition, Zagros showed higher 

photosynthesis and grain yield. At present, most 

researchers agree that the stomatal closure and the 

resulting CO2 deficit in the chloroplasts is the main cause 

of decreased photosynthesis under mild and moderate 

stresses (Flexas and Medrano, 2002). The study 

observation also showed that soluble proteins of the flag 

leaves declined with age in both cultivars under WW 

treatment, but water stress enhanced such a decline with 

a more extent in Marvdasht than Zagros, although,


Figure 4. Changes in sucrose, starch and ABA content in control, (A), (C) and (E) and water stress 

treatments, (B), and (D) and (F) in grains during grain filling in two wheat cultivars (drought Sensitive cv. 

Marvdasht and drought Tolerant cv. Zagros). Vertical bars represent ± SE of the mean (n=4) Data are means 

± SE of three independent samples. 

Marvdasht showed earlier reduction under stress 

treatment than Zagros cv (Figure 3). The changes in leaf 

protein corroborate with previous reports on the 

responses of plants to drought stress (Riccardi et al., 

1998; Salekdeh et al., 2002). 

Irrespective to treatments, drought-tolerant showed a 

higher chlorophyll content during 7 to 22 DAA, and the 

differences between cultivars can only be expressed 

under well water treatment and not evident under stress 

condition for Chl a. Similar changing pattern was 

observed for Chl b, although, the differences between 

cultivars was distinct under the water deficit. Decreased 

or unchanged chlorophyll level during drought stress has 

been reported in other species, depending on the 

duration and severity of drought (Kpyoarissis et al., 

1995). A decrease of total chlorophyll with drought stress 

implies a lowered capacity for light harvesting. Since the 

production of reactive oxygen species is mainly driven by 

excess energy absorption in the photosynthetic apparatus, 

this might be avoided by degrading the absorbing 

pigments (Herbinger et al., 2002). In addition, one must 

consider that the protective role of ABA over pigments 

may be related to stimulation of the nonphotochemical 

quenching imposed to increase the level of xanthophylls. 

Ivanov (1995) found that barley seedlings treated with 

ABA had markedly increased pigments levels, which play


an important role in maintaining the integrity of the 

photosynthetic membranes under situations of oxidative 

stress (Havaux, 1998; Munne´-Bosch and Alegre, 2002). 

In our experiments, the higher Zagros leaf ABA level 

promoted a greater concentration of chlorophylls and 

therefore yellowness was prevented. Consequently, ABA 

may promote (although indirectly) greater stability of the 

photosynthetic apparatus, allowing more photosynthesis 

and thus higher accumulation of dry matter in the 

harvested products (Thomas and Howarth, 2000). 

Varietal differences were found in terms of the level of 

sucrose available for metabolism in the grains under 

drought stress conditions (Figure 4B). In Marvdasht, 

drought initiated at early stage of grain filling (15 DAA) 

caused a marked reduction in seed sucrose concentration 

relative to the well-watered plants. On the 

contrary, seed sucrose concentrations for Zagros 

increased by about 3% as a consequence of the drought 

stress imposed during similar period. Sucrose metabolism 

is pivotal in seed development and is particularly 

susceptible to drought stress (Pinheiro et al., 2005). The 

decrease in seed sucrose concentration due to drought at 

all durations of stress in Marvdasht (Figure 4B), reflected 

the lower availability of the assimilate at source level. A 

direct relationship between sucrose availability and 

export rate at source level and the establishment of new 

sink organs has been shown for several crops (Setter et 

al., 2001; Liu et al., 2004). In line with these reports, we 

suppose that the higher decrease in sink size (number of 

endosperm cell) of the drought-sensitive genotype due to 

drought stress is partly attributed to reduced availability of 

the assimilate at source level (Ho, 1988). 

Although, a genotypic difference was evident for the 

length of the stress period at which the effects began to 

manifest, seed starch concentrations only for droughtsensitive 

wheat genotype was decreased under drought 

stress (Figure 4D). Drought induced decrease in seed 

starch accumulation was more consistent across the 

stress period considered for Marvdasht than for Zagros. 

In Marvdasht, drought stress at day 15 resulted in 39% 

less seed starch concentrations than the corresponding 

well-watered plants (Figure 4C and 4D). On the other 

hand, drought stress that lasted up to15 days did not 

affect seed starch accumulation of the drought-resistant 

genotype, Zagros. When the stress period was prolonged 

to 31 days, seed starch concentration of the genotype 

increased by ca. 28 and 100% relative to the WW 

treatment in drought-sensitive and drought-tolerant 

respectively (Figure 4D). In wheat endosperm, Jenner et 

al. (1991) found a relationship between the seed carbohydrates 

and the rate of storage starch accumulation was 

a function of the concentration of sucrose. Based on 

these relationships, it appears that shortage of assimilate 

(sucrose) could be one of the prime factors responsible 

for the reduced starch accumulation in the seeds of the 

drought-sensitive wheat genotype. On the basis of our 

previous study, the failure to set reproductive sinks under 

drought stress in Marvdasht addition to the decrease in 

sucrose concentration, attributed from the lower invertase 

activities in the reproductive structures. In the above 

context, we suppose that besides to sucrose availability, 

the capacity for utilizing the assimilate may have been 

differently affected in the two wheat genotypes under 

drought stress. The variation in sink may, therefore, partly 

explain the observed genotypic difference in the 

establishment and growth of reproductive structures 

under drought conditions. These results imply that apart 

from assimilate availability; drought stress may induce 

other factors that contribute to decreased seed starch 

synthesis. Limitations of sink activities due to the 

inhibition of the activities of key enzymes of sucrose 

metabolism, invertases and sucrose synthase (Weber et 

al., 2005), and starch synthesis (ADP-glucose pyro-phosphorylase 

and starch synthase) (Ho, 1988) have been 

cited as principal factors responsible for reduced starch 

synthesis under drought situations. 

As depicted in Figure 4, endogenous grain ABA levels 

increase with water stress in both genotypes. Relative to 

the corresponding WW treatments, drought stress 

increased sink grain ABA concentration of Marvdasht by 

ca. two-fold at early (7 DAA) and at late stage (31 DAA) 

of grain development compared with not evident 

differences for the drought-resistant genotype, Zagros 

(Figure 4F). We suppose that the differences in ABA 

accumulation due to drought relative to WW conditions 

(higher for Marvdasht compared with Zagros) may partly 

explain the differences found in grain abortion between 

the two wheat genotypes. Studies have shown that ABA 

accumulation in reproductive organs during early developmental 

inhibits cell division and subsequent abortion 

or failure to set seed (Wang et al., 1999). 

Overall, the results obtained from our study furnish 

valuable information regarding the relationship between 

ABA content and yield probably has an optimum ABA 

content which is likely to differ for each environment and 

crop. Below their optima, increases in ABA content might 

be reflected in higher yields, but too much ABA perhaps 

adversely affects grain filling and reduces yield (Quarrie, 

1991). The positive relationship between grain growth in 

vivo and grain ABA content is likely to be via the effect of 

ABA on stomatal aperture, enhancing water use 

efficiency (WUE) and leading to a better yield under field 

conditions. The negative response to ABA may reflect 

adverse effects on source activity (example, reducing 

current photosynthesis and accelerating senescence) 

and a decreased sink ability to attract and utilize available 

carbohydrates. Increased ABA levels under water stress 

conditions are likely to be above this optimum and thus 

negatively affect physiological processes including grain 

fill. 

Conclusion 

Drought stress significantly affected the growth and yield

of the two contrasting genotypes. The grain dry mass 

accumulation followed by numbers of grains per spike 

were the most affected yield components under drought 

stress. Compared with Marvdasht, Zagros had larger 

grain weight and higher harvest index under drought 

stress. Different grain sucrose concentration found 

between the contrasting watering regimes for both 

genotypes imply that sucrose availability as well as, the 

capacity for utilizing the assimilate affected under drought 

stress. The trend of seed starch accumulation of the 

genotypes due to the stress imposed maybe influenced 

by different grain ABA content. The decrease in seed 

starch accumulation of Marvdasht corresponded with 

marked increased in grain ABA level whereas the 

increased starch found for Zagros could be due to the 

stimulatory effect of appropriate sink ABA level activity 

factors accompany with sucrose availability. 


The corresponding author gratefully acknowledges the 

funding from the Islamic Azad University, Shoushtar 

branch through Grant. 

REFERENCES 

Chaves MM, Oliveira MM (2004). Mechanisms underlying plant 

resilience to water deficits: prospects for water-saving agriculture. J. 

Exp. Bot. 55: 2365-2384. 

Dodd IC, Davies WJ (2005). Hormones and the regulation of the water 

balance. In: Davies PJ (ed) Plant hormones: biosynthesis, signal 

transduction, action. Kluwer Academic Publishers, Dordrecht, pp. 

493-512 

Flexas J, Medrano H (2002). Drought-inhibition of photosynthesis in C-3 

plants: Stomatal and nonstomatal limitation revisited. Ann. Bot. 89: 

183-189. 

Havaux M (1998). Carotenoids as membrane stabilizers in chloroplasts. 

Trends Plant Sci. 3:147-151 

Herbinger K, Tausz M, Wonisch A, Soja G, Sorger A, Grill D (2002). 

Complex interactive effects of drought and ozone stress on the 

antioxidant defence systems of two wheat cultivars. Plant Physiol. 

Biochem. 40: 691-696. 

Ho LC (1988). Metabolism and compartmentation of imported sugars in 

sink organs in relation to sink strength. Ann. Rev. Plant Physiol. Mol 

Biol. 39: 355-378. 

Ingram J, Bartels D (1996). The molecular basis of dehydration 

tolerance in plants. Ann. Rev. Plant Physiol. Plant Mol. Biol. 47:377- 

403. 

Ishitani M, Nakamura T, Han SY, Takabe T (1995). Expression of the 

betaine aldehyde dehydrogenase gene in barley in response to 

osmotic stress and abscisic acid. Plant Mol. Bio. 27: 307-315. 

Iturbe Ormaetxe I, Escuredo PR, Arrese-Igor C, Becana M (1998). 

Oxidative damage in pea plants exposed to water deficit or paraquat. 

Plant Physiol. 116: 173–181. 

Ivanov A, Krol M, Maxwell D, Huner N (1995). Abscisic acid induced 

protection against photoinhibition of PSII correlates with enhanced 

activity of the xanthophylls cycle. FEBS Lett. 371: 61–64. 

Jenner CF, Uglade TD, Aspinall D (1991). The physiology of starch and 

protein deposition in the endosperm of wheat. Aust. J. Plant Physiol. 

18: 211-226. 

Kim JY, Mahé A, B rangeon J, Prioul JL (2000). A maize vacuolar 

invertase, IVR2, is induced by water stress. Organ/tissue specificity 

and diurnal modulation of expression. Plant Physiol. 124: 71-84. 

Kpyoarissis A, Petropoulou Y, Manetas Y (1995). Summer survival of 

leaves in a soft-leaved shrub (Phlomis fruticosa L., Labiatae) under 


Mediterranean field conditions: avoidance of photoinhibitory damage 

through decreased chlorophyll contents. J. Exp.Bot. 46: 1825–1831. 

Lichtenthaler HK, Wellburn AR (1983). Determination of carotenoids 

and chlorophyll a and b of leaf extracts in different solvents. Biochem. 

Soc. Trans. 11: 591-592. 

Lisse T, Bartels D, Kalbitzer HR, Jaenicke R (1996). The recombinant 

dehydrin-like desiccation stress protein from the resurrection plant 

Craterostigma plantagineum displays no defined three dimensional 

structure in its native state. Biol. Chem. 377: 555 -561. 

Liu F, Jensen CR, Andersen MN (2004). Drought stress effect on 

carbohydrateconcentration in soybean leaves and pods during early 

reproductive development: it simplication in altering pod set. Field 

Crops Res. 86(1): 1-13. 

Mertens RJ, Deus-Neumann B, Weiler EW (1985). Monoclonal 

antibodies for the detection and quantification of the endogenous 

plant growth regulator, abscisic acid. FEBS Lett. 160: 269-272. 

Munne-Bosch S, Alegre L (2002). The function of tocopherols and 

tocotrienols in plants. Crit Rev Plant Sci. 21:31-57. 

Neslihan-Ozturk Z, Talam´el V, Deyholos M, Michalowski CB, Galbraith 

DW, Gozukirmizi N, Tuberosa R, Bohnert HJ (2002). Monitoring 

large-scale changes in transcript abundance in drought- and 

saltstressed barley. Plant Mol. Biol. 48: 551-573. 

Nilsen ET, Orcutt DM (1996). The Physiology of Plants Under Stress. 

John Wiley & Sons, New York, pp. 322-361. 

Pinheiro C, Rodrigues AP, de Carvalho IS, Chaves MM, Ricardo CP 

(2005). Sugar metabolism in developing lupin seeds is affected by a 

short-term water deficit. J. Exp. Bot. 56(420): 2705-2712. 

Quarrie S, Stojanovic J, Pecic S (1999). Improving drought resistance in 

small-grained cereals: a case study, progress and prospects. Plant 

Growth Regul. 29: 1–21 

Quarrie SA (1991). Implications of genetic differences in ABA 

accumulation for crop production. In: Davies WJ and Jones HG (eds) 

Abscisic Acid. Physiology and Biochemistry. BIOS Scientific 

Publishers, pp. 227–244 

Ramirez-Vallejo P, Kelly JM (1998). Traits related to drought resistance 

in common bean. Euphytica, 99:127-136. 

Riccardi F, Gazeau P, de Vienne D, Zivy M (1998). Protein changes in 

response to progressive water deficit in maize. Quantitative variation 

and polypeptide identification. Plant Physiol. 117: 1253-1263. 

Saeidi M, Moradi F, Ahmadi A, Poostini K, Najafian G (2006). Effect of 

exogenous application of ABA and CK at different stages of grain 

development on some physiological aspects of source and sink 

relationship in two bread wheat cultivars. Iran. J. Crop Sci. 8: 268- 

282. 

Salekdeh GH, Siopongco J, Wade LJ, Ghareyazie B, Bennett J (2002). 

Proteomic analysis of rice leaves during drought stress and recovery. 

Proteomics, 2(9): 1131-45. 

Sedmak JJ, Grossberg SE (1977). A rapid, sensitive, and versatile 

assay for protein using Coomassie brillant blue G250. Ann. Biochem. 

79:544-552. 

Setter TL, Flannigan BA, Melkonian J (2001). Loss of kernel set due to 

water deficit and shade in maize: carbohydrate supplies, abscisic 

acid, and cytokinins. Crop Sci. 41:1530-1540. 

Spollen W, LeNoble M, Samuels T, Bernstein N, Sharp R (2000). 

Abscisic acid accumulation maintains maize primary root elongation 

at low water potentials by restricting ethylene production. Plant 

Physiol. 122: 967–976. 

Tenhunen JD, Pearcy RW, Lange OL (1987). Diurnal variations in leaf 

conductance and gas exchange in natural environments. In: Zeiger E, 

Farquhar GD, Cowan IR (Eds.), Stomatal Function. Stanford 

University Press, Stanford, California, pp. 323-351. 

Thomas B, Howarth C (2000). Five ways to stay green. J. Exp. Bot. 51: 

329–337. 

Wang RY, Yu ZW, Pan QM (1999). Changes of endogenous plant 

hormone contents during grain development in wheat. Acta Agron. 

Sinica, 25(3): 227-231 

Wang Z, Yang J, Zhu Q, Zhang Z, Lang Y, Wang X (1998). Reasons for 

poor grain filling in intersubspecific hybrid rice. Acta Agron Sinica, 

24:782-787. 

Weber H, Borisjuk L, Wobus U (2005). Molecular physiology of legume 

seed development. Ann. Rev. Plant Biol. 56: 253-279.



DOI: 10.5897/AJB11.1432 



Impacts of geo-physical factors and human disturbance 

on composition and diversity of roadside vegetation: A 

case study from Xishuangbanna National Nature 

Reserve of Southwest China 

Dong Shikui*, Li Jinpeng, Li Xiaoyan, Liu Shiliang and Zhao Qinghe. 

School of Environment, Beijing Normal University, Beijing, 100875, China. 


We examined vegetation-disturbance-environment relationships in the Xiaomengyang Section of 

Xishuangbanna Nature Reserve (XNR) using multivariate analysis to understand the impacts of 

geo-physical factors and human disturbance on vegetation along the highway corridor. We found that 

native forests were the best habitat for protected/endangered species and native species. The exotic 

plants Eupatorium odoratum and Eupatorium adenophora were found primarily in secondary forests and 

their presence was positively associated with altitude and soil potassium concentrations. The 

distribution of two protected plants, Phoebe nanmu and Pometia tomentosa, was negatively associated 

with road disturbance. Species richness was correlated with environmental factors but not related to 

historical land use and road disturbance. Understanding the complex effects of geo-physical factors and 

anthropogenic disturbance is important for developing and implementing conservation strategies for the 

protection and restoration of biological diversity and the integrity of roadside ecosystems. 

Key words: Vegetation composition, species diversity, gradient analysis, environmental controls, road 

construction, nature reserve. 

INTRODUCTION 

With rapid economic development and population growth 

in China, conservation efforts and environmental quality of 

many protected areas of the nation are threatened by a 

variety of human activities (Yang and Li, 2006). 

Agricultural production, resource exploitation, recreational 

activities and infrastructure development must be 

reconciled with the preservation of areas of high scenic 

and biological conservation value (Gen, 2001; Duan, 2005; 

Huang and Hu, 2007). Highway infrastructure develop- 

ment presents a particularly challenging balance between 

conservation and development (Song, 2004; Su and Li, 

2005). 

The Simao-Xiaomengyang (Sixiao) Highway, China’s 

section of Kunming-Bangkok international road, was 

recently developed (constructed in 2001 and opened in 

*Corresponding author. E-mail: dongshikui@sina.com. Tel: 

86-10-58802029. Fax: 86-10-58800397. 

2005) to connect the undeveloped southwest frontier of 

China to the highly developed north China as well as to 

neighboring countries in Southeast and South Asia. This 

road was planned to cut through the core zone of the 

Xiaomengyang Section of Xishuangbanna Nature 

Reserve (XNR), one of hotspots for tropical biodiversity in 

China and the world (Yang et al., 2006). To meet the 

national priority of development, the natural reserve 

management authority, China’s Forest Ministry, desig- 

nated part of the core zone of XNR as an experimental 

zone to accommodate the development of the Sixiao 

Highway (Song et al., 2005). 

Although, there has been an intense debate between 

environmentalists and development planners as to the 

program impacts of the Sixiao Highway on species and 

habitats in this area, there is little available evidence to 

support the arguments of either side due to limited 

site-specific research in this region. One of the objectives 

of the present study was to better understand how 

highway construction has impacted vegetation in the

Table 1. Environmental conditions of the sampling transects. 

Shikui et al. 16229 

Transect number Plot number Latitude Longitude Altitude (m) Slope Aspects Soil types Land use types 

1 1-3 N22º06' E100°54' 748-760 10 SW loam-clay old fields 

2 4-8 N22º10' E100°53' 790-844 27 W loam native forest 

3 9-12 N22º10' E100°53' 760-774 15 NE loam native forest 

4 13-15 N22º09' E100°52' 849-859 50 SW loam secondary forest 

5 16, 17 N22°08' E100°53' 897-925 20 N loam native forest 

6 18-20 N22°02' E100°53' 811-842 26 NE loam-clay native forest 

7 21-23 N22°08' E100°53' 817-937 15 SE loam-clay old fields 

8 24, 25 N22°10' E100°52' 769-773 10 NW loam-clay native forest 

XNR. 

We quantified vegetation patterns along an 18.5 km 

length of the highway, and examined the changes in the 

species composition along disturbance gradients that ran 

perpendicular from the highway into less disturbed 

habitats of the reserve. 

A simple method was applied needed to analyze and 

visualize the relationship between many species and 

many environmental variables (Ter Braak, 1987). 

Canonical correspondence analysis (CCA), a multivariate 

method, can provide a means to structure the data by 

separating systematic variation from noise (Gauch, 1982). 

Another objective of this study was to testify the feasibility 

of using the CCA and related multivariate analysis as a 

tool to infer the species-disturbance-environment 

relationship along roadside habitats in the protected area 

of XNR of Southwest China. 


Site description 

The study site is located in Wild Elephant Valley (22°07′ to 22°23′N, 

100°36′ to 101°18′E, and 590 to 1600 m a.s.l) of Yunnan Province, 

a hilly area in the subtropical to tropical zone of southwest China. 

Wild Elephant Valley is the central area of the Xiaomengyang 

Section of XNR, established in the 1950s, one of the earliest nature 

reserves established in China. The study area covers an 18.5 km 

length and 1 km wide section along the Sixiao Highway, which cuts 

through the newly defined experimental zone of the XNR. The area 

has a subtropical continental climate with a dry and monsoonal wet 

season. The annual average temperature is 20.8°C and annual 

precipitation is 1193.7 mm with most of the rain occurring from 

May to November. The soils are dominated by loam or loam-clay 

soils, which are fine textured, well drained, and have high organic 

matter content (Table 1). The seasonal rain forests are dominated 

by Antiaris toxicaria, Canarium album and Gironniera subaequalis, 

and are the target vegetation for protection in XNR as it was 

reported to be one of the most important ecosystems with the richest 

species diversity in the world (Wilson, 1988). The secondary forests 

and open fields exist along the roadside in some locations due to 

historical land use activities, including row-crop agriculture, rubber 

plantations, and selective and clear-cut timber harvests. 

Study design and treatment 

To assess the role of the various controls on the distribution and 

abundance of the vegetation in roadside habitats, we measured a 

suite of plot-level geo-physical factors and human disturbance 

factors at each site of the road. The geo-physical factors were 

classified into two types, that is, geographic location and soil 

characteristics. Geographic location data including longitude, 

latitude, altitude, slope and aspect, were recorded using a Garmin 

Global Position System (GPS) and compass. Soil characteristics 

data including soil type, moisture, pH, organic carbon content, total 

nitrogen, phosphorus and potassium concentration, were deter- 

mined using a Time Domain Reflectometry (TDR), pH meter and 

Elementar Vario analyzer (El Ltd., Germany), respectively. Two 

types of human disturbance, that is, past anthropogenic practices 

and recent road construction, were considered in the study. As the 

intensity and duration of past human disturbances were not well 

documented, the intensity of historical human practices (HHP) was 

expressed by the succession stage of the vegetation, that is, 

primary forests, secondary forests and old fields. The distance to the 

road (RD) was used as a measure of the disturbance associated 

with road construction as many studies have shown that disturbance 

to vegetation is correlated to the distance from the road (Parendes 

and Jones, 2000; Gelbard and Belnap, 2003; Flory and Clay, 2006). 

Field survey and data collection 

Field surveys were conducted in 2004 and 2005 during the middle of 

the dry season from November to January following the modified 

design from Flory and Clay (2006). Eight transects of 0.3 to 1.0 km 

in length and 20 m in width were located along the road by a 

distance determined by a random number table. Transects were at 

least 20 m apart and at least 50 m from forest openings such as 

creeks and fields. Transects were set perpendicular to the road and 

started at the edge of the vegetation along the road, which was 

either native or planted. The extent of the transect length was 

determined by the variation of vegetation structure. Along each 

transect, 10 10 m plots were arranged at 10, 50, 200, and 500 m 

from the road for a total of 25 plots (Table 1 and Figure 1). All plant 

species within each plot were identified and the species composition 

and numbers in each plot were quantified. 

Based on the data collected from the field survey, the species 

abundance and diversity were quantified. Species abundance was 

recorded as number of individuals of each plant. Species richness 

(Marglef index), diversity (Shannon-Weaver index) and evenness 

(Pielou index) were calculated following the formulas cited by Dong 

et al. (1997). 


Canonical correspondence analysis (CCA) was used to identify the 

ecological relationships between the vegetation and the


Figure 1. Locations of sample sites and arrays of sampling plots. 

environment along the roadside. In order to assure objectivity of the 

gradient analysis, the species abundance data were used for 

ordination. This analysis was performed using Software for 

Canonical Community Ordination (Version 4.5) recently developed 

by Ter Braak and Smilauer (2002). Multiple regression models were 

used to investigate the relationship between geographic factors 

(longitude, latitude, altitude, aspect, and slope), soil factors (type, 

pH, organic matter content, and nitrogen, phosphorus, and 

potassium concentration), historical human practices reflected by 

different land types (primary forest, secondary forest and old fields), 

road factors (distance to the road) and plant species richness, 

diversity and evenness, to determine what factors were most closely 

associated with the variation in species diversity. All analyses were 

performed using SPSS 12.0 (Huang et al., 2005). 

RESULTS 

A total of 216 vascular plants, including 72 tree species, 

75 shrub species, 58 herbaceous species and 11 vine 

species, representing 136 genera and 35 families were

Table 2. Canonical coefficients and intraset correlation coefficients derived from the species abundance data. 


Axis 1 2 3 4 

Eigenvalues 0.807 0.760 0.723 0.680 

Cumulative percentage variance of species data 6.9 13.4 19.6 25.4 

Cumulative percentage variance of species-environment relation 9.7 18.8 27.5 35.6 

Environmental 

Canonical coefficients Intraset correlation coefficients 

variables Axis 1 Axis 2 Axis 3 Axis 4 Axis 1 Axis 2 Axis 3 Axis 4 

RD -0.74 1.20 -0.92 -1.33 -0.17 0.67 0.11 -0.11 

LOG 0.29 -0.63 0.78 0.17 0.31 0.045 0.076 0.074 

LAT 0.14 -0.81 1.18 1.01 -0.20 -0.16 0.0621 -0.022 

ALT -0.94 0.75 0.17 -0.65 -0.41 -0.22 0.31 0.30 

SLP 0.21 -0.18 -0.11 1.11 -0.41 -0.13 -0.29 0.44 

ASP 0.62 -0.33 -0.53 1.00 -0.11 0.42 -0.13 0.31 

ST -0.58 0.52 -0.0073 -1.01 -0.54 0.34 -0.41 0.3229 

SM 0.24 -0.88 1.40 0.23 -0.14 0.444 0.54 -0.076 

SpH 0.30 -0.18 -0.21 1.25 -0.07 0.34 0.22 -0.042 

SOC -0.46 0.53 0.36 -1.23 0.12 0.053 0.47 -0.20 

STN 0.17 -0.79 0.51 1.97 -0.31 0.32 -0.0060 0.30 

SP 0.0091 0.47 -0.24 -0.86 -0.26 0.36 0.14 0.23 

SK 0.93 -0.61 -0.49 0.85 0.57 0.027 0.17 -0.037 

HHP 0.32 -0.32 -0.12 1.13 -0.35 -0.13 0.33 -0.026 

The abbreviations of environmental variables are: LOG, longitude; LAT, latitude; ALT, altitude; SLP, slope degree; ASP, slope aspect; ST, soil type; 

SM, soil moisture; SpH, soil PH; SOC, soil organic carbon; STN, soil total nitrogen; SP, soil phosphorus; SK, soil potassium; LUT, Historical human 

practices; RD, distance to road. 

collected and identified from the 25 plots. None of the 216 

species occurred in all 25 plots. Among these species, 1 

cultivated plant, Cassia siamea, was recorded in 2 plots, 

and 2 exotic plants, Eupatorium odoratum and 

Eupatorium adenophora, were identified in 11 plots and 1 

plot, respectively. Several endangered and protected 

species were sampled including the following: Cycas 

siamensis, a Grade I species in List of Wild Plants of 

National Priority Protection in China (LWPNPPC, initiated 

in 1999) and grade II species in List of Chinese Rare and 

Endangered Plants for Protection (LCREPP, initiated in 

1984) was recorded in 4 plots; Magnolia henryi, a Grade II 

species in LWPNPPC and Grade II species in LCREPP 

was recorded in 1 plot; Terminalia myriocarpa, a Grade II 

species in LWPNPPC and Grade III species in LCREPP 

was recorded in 1 plot; Gmelina arborea, a Grade II 

species in LCREPP was recorded in 2 plots; Phoebe 

nanmu, a Grade II species in LCREPP was recorded in 2 

plots; Pometia tomentosa, another Grade II species in 

LCREPP was recorded in 3 plots; Paramichelia baillonii, a 

Grade III species in LCREPP was recorded in 1 plot; 

Lagerstroimia intermedia, another Grade III species in 

LCREPP was recorded in 1 plot. 

Ordination of the vegetation 

The sign and relative magnitudes of the canonical co- 

efficients and of the intraset correlations indicate the 

relative importance of each environmental factor in 

predicting the species composition along the ordination 

axes. The first four axes of the CCA ordination all had 

relatively high eigenvalues (Table 2); however, they only 

explained 25.4% of the total sample variance in the 

species data and 35.6% of the species-environment 

relationships. All four axes had similar explanatory power. 

Axis I was defined primarily by soil type and soil K con- 

centrations; the second by road construction disturbance; 

the third by soil organic carbon, soil moisture and human 

disturbance; and the fourth by slope, altitude and soil N 

concentrations. 

It is clear from Figure 2 that historical land use (HHP), 

road construction (RD), and soil phosphorus (SP) were 

the most influential environmental factors affecting the 

vegetation composition along the roadside habitats in 

XNR as indicated by the length of these vectors. Altitude, 

slope, aspect and soil K concentrations were positively 

correlated with HHP. Soil moisture soil organic carbon, 

soil nitrogen, slope aspect, and soil type were all 

positively correlated with distance to the road. Only 

longitude and soil pH were positively associated with soil 

phosphorus concentrations. 

The species Imperata cylindrica, Solanum xantho- 

carpum, Hevea brasiliensis and Schizonepeta tenuifolia 

and to a lesser extent Digitaria ternata clustered together 

in the old fields reflected by their closeness to sample


0.8 

ALT 

-0.6 

Sid sze Pue mon 

Aca pen 21 Age con 

Tre tom 

Tit div 

Tet dub Thl dub 

Abe man Lag int 

SP 

Cas sia LOG 

Fic rac 

Gyr cre 

SK 

Bro pap 

ST 

Eup coe 

Ter myr 15 22 4 

Eup odo 17 Den str 

SpH 23 

7 

13 8 

6 

Str fim 18 5 ASP Pho nan 

16 

24 20 11 

14 

25 19 9 Gme arb 

Mag Hen 12 Cyc sia 

SLP Par bai 

RD 10 Pom tom 

SM LAT 

LUT 

STN 

SOC 

Ste uli 

Ver pat 

Sta obl 

Ecl pro 

Cyn dac Ana sin 

Hyd nep 

-0.6 1.0 

Figure 2. CCA ordination diagram with plant species (△), sample quadrates (●and number 1-25) and environmental 

variables (arrows) on the basis of species presence; first axis is horizontal, second axis is vertical. To avoid the crowd of 

the diagram, we only present the species with positions far from center and some important species (protected, exotic and 

Figure 2. CCA ordination diagram with plant species (△), sample quadrates (●and number 1- 

25) cultivated and species) environmental in the diagram variables using the abbreviations (arrows) as on follows the buted basis as follows: of species Abe man=Abelmoschus presence; manihot, first axis is 

Aca pen=Acacia pennata, Age con=Ageratum conyzoides, Ana sin=Anaphalis sinica, Bro pap=Broussonetia papyrifera, 

Cas sia=Cassia siamea, Cyc sia=Cycas siamensis, Cyn dac=Cynodon dactylon, Den str=Dendrocalamus strictus, Ecl 

pro=Eclipta prostrate, Eup coe=Eupatorium coelestinum, Eup odo=Eupatorium odoratum, Fic rac=Ficus racemosn, Gme 

arb=Gmelina arborea, Gyr cre=Gyrmra crepidioides, Hyd nep=Hydrocotyle nepalensis, Mag hen=Magnolia henryi, Par 

bai=Paramichelia baillonii, Pho nan=Phoebe nanmu, Pom tom=Pometia tomentosa, Pue mon= Pueraria montana, Sid 

sze= Side szechuensis, Sta obl= Stachys oblongifolia, Ste uli=Stellaria uliginosa, Str fim=Strophioblachia fimbricalys, Ter 

myr=Terminalia myriocarpa, Tet dub= Tetrastigma dubinum, Thl dub=Thladiantha dubia, Tit div= Tithonia diversifolia, Tre 

horizontal, second axis is vertical. To avoid the crowd of the diagram, we only present the 

species with positions far from center and some important species (protected, exotic and 

cultivated species) in the diagram using the abbreviations as follows buted as follows: Abe 

man=Abelmoschus manihot, Aca pen=Acacia pennata, Age con=Ageratum conyzoides, Ana 

sin=Anaphalis tom= Trema tomentosa, sinica, Ver pat=Vernonia Bro pap=Broussonetia patula. The abbreviations papyrifera, of environmental variables Cas sia=Cassia are present in Table siamea, 2. Cyc 

sia=Cycas siamensis, Cyn dac=Cynodon dactylon, Den str=Dendrocalamus strictus, Ecl 

pro=Eclipta prostrate, Eup coe=Eupatorium coelestinum, Eup odo=Eupatorium odoratum, 

points 23 on the graph, and their distributions were clearly abundance insofar as these can be explained by the 

controlled Fic by rac=Ficus RD. The species racemosn, Hydrocotyle Gme nepalensis, arb=Gmelina environmental arborea, Gyr factors cre=Gyrmra measured in crepidioides, this study. Nearly Hyd all 

Eclipta prostrate, nep=Hydrocotyle Cynodon dactylon nepalensis, and Anaphalis Mag hen=Magnolia sinica, endangered henryi, or protected Par bai=Paramichelia species sampled in baillonii, this study 

Stachys oblongifolia and Vernonia patula were clearly were found in native forest habitat (sample points 6, 8, 11, 

Pho nan=Phoebe nanmu, Pom tom=Pometia tomentosa, Pue mon= Pueraria montana, Sid 

separated from the other species and tightly clustered 16, 18, 20, and 25), except for P. baillonii was found in 

near the sze= SP environmental Side szechuensis, vector indicated Sta obl= that SP Stachys had a oblongifolia, secondary forest Ste (sample uli=Stellaria site 14). The distribution uliginosa, pattern Str 

strong influence fim=Strophioblachia on controlling the fimbricalys, distribution Ter of these myr=Terminalia of endangered myriocarpa, or protected species Tet dub= along Tetrastigma 

the gradient of 

species. The two exotic species, E. odoratum and E. the distance to road shows that Phoebe nanmu and 

dubinum, Thl dub=Thladiantha dubia, Tit div= Tithonia diversifolia, Tre tom= Trema 

adenophora, were most abundant in secondary forests as Pometia tomentosa were abundant in the sites near the 

indicated tomentosa, by their closeness Ver pat=Vernonia to sample points patula. 14 and 15, The abbreviations roadside and the of rest environmental were abundant in variables the sites far are from 

and were present influenced in Table positively 2. by HHP. 

the roadside. Two exotic species, E. odoratum and E. 

adenophora were more abundant in the plots of 

secondary forest, reflected by their closeness to sample 

Species abundance along environmental and points 14 and 15. The abundance of these two plants was 

disturbance gradients 

correlated positively with soil potassium and negatively 

with the distance to road. The cultivated species, C. 

The species points and sample points (plots) in Figure 3 siamea, was more abundant in the plot of old fields, 

jointly represent the dominant patterns of the species reflected by its location at the sample point 22. The 

2 

3 

1

1.0 

-0.8 

LUT 

SOC 

Imp cyl 23 

Sol xan 

Hev bra Sch ten 

RD 

Dig ter 

SN 

ST 

ASP 

SM 

25 

19 

Pho nan 

Hyp tri 

22 Jat cur 

Cas sia 

Mag Hen 24 Pom tom 

20 

16 9 SpH LOG 

Pho lan 6 5 10 

12 

17 

Gme arb 18 13 4 

Str fim 

7 

SLP 

SK Par bai Lag int 

LAT 14 11 

Eup odo Ter myr 

ALT 

15 

Eup coe 8 

Cyc sia 

SP 

Sta obl 

Ver pat 

-1.0 1.0 

3 

21 

2 


Hyd nep 

Ecl pro 

1 

Cyn dac 

Ana sin 

Figure 3. CCA ordination diagram with plant species (△), sample quadrates (●and number 1 to25) and environmental 

variables (arrows) on the basis of species abundance; first axis is horizontal, second axis is vertical. To avoid the crowd of the 

diagram, we only present the species with positions far from center and some important species (protected, exotic and 

cultivated species) in the diagram using the abbreviations as follows buted as follows: Ana sin=Anaphalis sinica, Cas 

sia=Cassia siamea, Cyc sia=Cycas siamensis, Cyn dac=Cynodon dactylon, Dig ter=Digitaria ternata, Ecl pro=Eclipta prostrate, 

Eup coe=Eupatorium coelestinum, Eup odo=Eupatorium odoratum, Gme arb=Gmelina arborea, Hey bra=Hevea brasiliensis, 

Hpy tri= Hypoestes triflora, Imp cyl=Imperata cylindrica, Jat cur= Jatropha curcas, Lag int=Lagerstroimia intermedia, Mag 

hen=Magnolia henryi, Par bai=Paramichelia baillonii, Pho lan=Phoebe lanceolata, Pho nan=Phoebe nanmu, Pom 

tom=Pometia tomentosa, Sch ten=Schizonepeta tenuifolia, Sol xan= Solanum xanthocarpum, Sta obl= Stachys oblongifolia, 

Str fim=Strophioblachia fimbricalys, Ter myr=Terminalia myriocarpa, Ver pat=Vernonia patula. The abbreviations of 

environmental variables are present in Table 2. 

abundance of this plant was positively associated with the 

distance to road, that is, closer to the road had more C. 

siamea. 

Relationship between plant diversity and 

environmental and disturbance factors 

It can be seen from Table 3 that species richness repre- 

sented by the Margalef index correlated negatively to 

longitude (p < 0.05) and slope aspect (p < 0.01), but 

positively to soil organic carbon (p < 0.05). There were no 

significant correlations between any of the measured 

environmental variables and species evenness as 

measured by the Pileou or species diversity estimated by 

the Shannon-Weaver index. 

DISCUSSION 

The present study examined the correlation between 

environmental factors, human disturbance and vegetation 

composition and plant diversity in different roadside 

habitats along international highway in a protected area, 

XNR in Southwestern China. Overall, the vegetation in the 

XNR has not been affected to a great extent by the 

construction of the road. Habitat types, geographic 

locations and soil factors were the key factors affecting 

the species vegetation compositions and plant diversity 

along the roadside habitats in XNR.


Table 3. Spearman correlations between species diversity and environmental variables. 

Environmental 

variable 

Margalef index 

Coefficient Sigificance 

Species diversity 

Shannon-Weaver index 

Coefficient Significance 

Pielou index 

Coefficient Significance 

RD 0.189 0.365 0.205 0. 326 0.03 0.886 

LOG -.399* 0.048 -0.028 0. 895 0.104 0.622 

LAT 0.197 0.346 -0.055 0. 796 -0.169 0.419 

ALT 0.092 0.66 -0.2 0. 338 -0.332 0.105 

SLP -0.043 0.837 0 1.00 -0.028 0.895 

ASP -.539** 0.01 -0.156 0.489 -0.08 0.722 

ST 0.033 0.876 0.011 0.958 -0.031 0.883 

SM 0.305 0.139 0.218 0.295 0.106 0.615 

SpH -0.187 0.371 -0.14 0.505 0.007 0.972 

SOC .456* 0.022 0.109 0.604 -0.095 0.651 

STN 0.382 0.06 0.083 0.692 -0.101 0.63 

SP -0.06 0.774 0.093 0.657 0.158 0.451 

SK 0.085 0.686 -0.091 0.665 -0.135 0.521 

HHP 0.244 0.241 -0.212 0.308 -0.321 0.118 

The abbreviations of variables are similar to Table 2; ** Correlation is significant at the 0.01 level (2-tailed); * Correlation is significant at the 0.05 

level (2-tailed). 

Species-sites relationship in CCA ordination diagram 

indicates that the habitat types strongly influenced the 

presence and abundance of key plant species. Native 

forest was the best habitat for most protected/endangered 

species and primitive species. This means that native 

forest should be the priority for roadside habitat protection 

in this area. Secondary forest, as habitats with high 

human interventions, may serve as source for invasion of 

exotic species into more pristine environments (Tyser and 

Worley, 1992; Hobbs, 2000). Higher light and bare soil 

exposure may have favored alien plant establishment 

(Parendes and Jones, 2000; Flory and Clay, 2006).This is 

why two alien plants, E. odoratum and E. adenophora 

were found abundant there. One protected species P. 

baillonii was also abundant in secondary forest. 

Restoration of secondary forest is necessary to facilitate 

the growth of protected species and to control the 

invasion of exotic species. Old fields was abounded 

rubber forest or farm land, on which C. siamea has been 

planted to form a highly appreciated fuelwood used by the 

local people due to quick regrowth of the branches of this 

plant. A better control of upperstorey timber cutting is 

required to maintain this land use type. 

Species-environment relationship in CCA ordination 

diagram indicates that altitude and soil potassium were 

most important factors affecting the presence of E. 

odoratum and E. adenophora and historical land use was 

one of the most influential factors that determines the 

abundance of these two alien plants. That is in agreement 

with other researchers’ reports that the distribution of alien 

species was highly related to land use patterns (Hobbs, 

2000; Sax and Brown, 2000) and our preliminary finding 

that E. adenophora (also named Ageratina adenophora) 

was more susceptible to total soil potassium (unpublished 

data). Better land use and reduced soil potassium may be 

the solutions to control the invasion of alien species. In 

present study, it was found that road disturbance played 

very important role in determining the distribution of two 

protected plants of P. nanmu and P. tomentosa. Higher 

abundance of these two protected species near roadside 

means that moderate disturbance derived from road 

construction and traffic may favor their survival and 

growth. This is a proof to support the view that the effects 

of roadwork on the vegetation and its environment were 

complex and sometimes positive (Forman and Alexander, 

1998). 

Although, previous researchers have noted the incre- 

mental effects of road developments (Forman and 

Alexander, 1998) and argued the loss of biological 

diversity (Southerland, 1995; Angold, 1997) and the 

fragmentation of natural habitats (Heilman et al., 2002; 

Spellerberg, 1998) resulted from road construction and 

traffic, the correlation analysis in this study showed that 

species richness was solely related significantly to some 

geographic and soil factors while not to land use and road 

disturbance. This may be mainly attributed to three 

reasons according to Sixiao Road Planning Report (Song 

et al., 2005; Zhuang, 2007): (1) the protective strategies 

including choosing the shortest route, evading key 

habitats and minimizing ecosystem damage were 

adopted during road planning period to reduce the 

potential negative effect of roadwork; (2) the construction 

projects of ecological protection including viaduct, and 

tunnels have been dramatically used during road 

construction to avoid the clearance of plant, fragmentation 

of habitat and alteration of hydrological flows and soil

condition; (3) the protective measures including enclosure 

of road system, bio-protection of slope and limitation of 

traffic were strictly implemented during road service 

period. 

The results of this study are important for several 

practical reasons. First, they identify the effects of 

environmental factors, land use and road disturbance, on 

the species composition and diversity along roadside 

habitats in the protected area of XNR. Hence, they are 

very meaningful for maintaining vegetation structure and 

distribution pattern in this protected area and other similar 

sites. Second, they reveal how key species (endangered 

species, exotic species and cultivated species) respond to 

environmental factors, land use and road disturbance. So, 

they give a good indication to better key species mana- 

gement (protect the endangered species, control exotic 

species and maintain cultivated species) and improve 

their environment. Third, they show the clear relationships 

between species, environment and sites (habitats). 

Therefore, they can provide a baseline to formulate the 

plans of roadside habitats protection or restoration. 

Indeed, the results appear to indicate understanding 

complex effects of environmental factors, land use and 

road disturbance is very important to develop and 

implement the strategies to protect or restore elements of 

biological diversity and integrity of roadside ecosystems. 


This research is supported by National Natural Science 

Foundation of China projects (50939001) and (30870466). 

The authors wish to express great thanks to reviewers 

and editors for their time and efforts. 

REFERENCES 

Angold PG (1997). The impact of a road upon adjacent heathland 

vegetation: effects on species composition. J. Appl. Ecol. 34: 409-417. 

Dong M, Wang YF, Kong FZ (1997). Survey and analysis methods for 

terrestrial biocommunity. China Standard Press, Beijing, China. 

Duan XX (2005). Study about the agricultural sustainable development 

in natural preservation zone. Sichuan Forest Explor. Des. 7(2): 21-24 

Forman RTT, Alexander LE (1998). Road and their major ecological 

effects. Annu. Rev. Ecol. Syst. 29: 207-231. 

Flory SL, Clay K (2006). Invasive shrub distribution varies with distance 

to roads and stand age in eastern deciduous forests in Indiana, USA. 

Plant Ecol. 184: 131-141. 

Gelbard JL, Belnap J (2003). Roads as conduits for exotic plant 

invasions in a semiarid landscape. Conserv Biol. 17: 420–432. 

Gen PX (2001). Ecotourism and the Building of Nature Reserves. Areal. 

Res. Dev. 20 (3): 79-87. 

Heilman GE, Stritthold .Jr. JR, Slosser NC, Dellasala DA (2002). Forest 

fragmentation of the conterminous United States: assessing forest 

intactness through road density and spatial characteristics. Bioscience, 

52: 411-422. 

Hobbs RJ (2000). Land use changes and invasions. in Mooney HA, 

Hobbs RJ (eds.). Invasive species in a changing world. Island Press, 

Washington, D.C. pp. 385-421. 


Huang T, Hu J (2007). Relationship between Construction of Nature 

Reserves and Community Development. Rural Econ. (5): 40-42. 

Huang H, Luo YF, Chen ZY (2005). SPSS 12.0 for windows: Statistic 

analysis. Beijing: People’s Posts and Telecommunications Publishing 

House. 

Parendes LA, Jones JA (2000). Role of light availability and dispersal in 

exotic plant invasion along roads and streams in the H. J. Andrews 

Experimental Forest, Oregon. Conserv. Biol. 14: 64-75. 

Sax DE, Brown JH (2000). The paradox of invasion. Global Ecol. 

Biogeogr. 9: 363-371. 

Song WX (2004). Influences of Expressway Construction and 

Environmental Protection of Natural Conservation Zone. J Henan U 

Sci Technol (Natural Science). 25(6): 58-61. 

Song FC, Tian WP, Zhao QQ, Fang R, Li GF (2005). Environment 

Impact and Engineering Measures for the Si-Xiao Expressway 

Construction in Tropical Rain Forest Area. J. Highway Transport Res. 

Dev. 22(9): 175-178. 

Southerland MT (1995). Conserving biological diversity in highway 

development projects. Environ. Prof. 17: 226-242. 

Spellerberg IF (1998). Ecological effects of roads and traffic: a literature 

review. Global Ecol. Biogeogr. Lett. 7: 317-333. 

Su FY, Li YK (2005). Highway Construction Influence to Natural 

Protection Area and Related Measures. Modern Transport Technol. 

2(3): 78-80. 

Ter Brakk CJF (1987). The analysis of vegetation-environment 

relationships by canonical correspondence analysis. Vegetation, 69: 

69-77. 

Ter Braak CJF, Smilauer P (2002). CANOCO reference manual and 

CanoDraw for windows user’s guide. Biometris, Wageningen 

University and Research Centre, Wageningen, the Netherlands. 

Tyser RW, Worley CA (1992). Alien flora in grassland adjacent to road 

and trail corridors in Glacier National Park, Montana (USA). Conserv. 

Biol. 6: 253-262. 

Wilson EO (ed.) (1988). Biodiversity. National Academy Press, 

Washington, D. C. 

Yang Q, Han L, Chen J, Bai ZL (2006). Strategy, protective status and 

value of tropical rain forestry in Xishuangbanna. J. Guangxi Agr. Biol. 

Sci. 25(4): 341-348. 

Yang RG, Li HM (2006). Study on the Environmental Deprivation in the 

Establishment of Chinese Natural Reserve System. China Population, 

Resour. Environ. 16(3): 23-27. 

Zhuang LY (2007). Principles of Road Design and Route Selection for 

Si-Xiao Highway Construction. J. China Foreign Highway, 27(1): 

11-16.



DOI: 10.5897/AJB11.1122 



Modeling spatial pattern of deforestation using GIS and 

logistic regression: A case study of northern Ilam 

forests, Ilam province, Iran 

Saleh Arekhi 

Department of Forest and Rangeland, University of Ilam, Ilam, Iran. E-mail: 

saleh148@yahoo.com Tel: 0098-918-843-0318. Fax: 0098-841-2227015. 

Accepted 25 July, 2011 

This study aimed to predict spatial distribution of deforestation and detects factors influencing forest 

degradation of Northern forests of Ilam province. For this purpose, effects of six factors including 

distance from road and settlement areas, forest fragmentation index, elevation, slope and distance from 

the forest edge on the forest deforestation were studied. In order to evaluate the changes in forest, 

images related to TM1988, ETM + 2001 and ETM + 2007 were processed and classified. There are two 

classes as, forest and non-forest in order to assess deforestation factors. The logistic regression 

method is used for modeling and estimating the spatial distribution of deforestation. The results show 

that about 19,294 ha from forest areas are deforested in the 19 years. Modeling results also indicate that 

more deforestation occurred in the fragmented forest cover and in the areas of proximity to forest/non 

forest edge. Furthermore, slope and distance from road and settlement areas had negative 

relationships with deforestation rates. Meanwhile, deforestation rate is decreased with increase in 

elevation. Finally, a simple spatial model is presented that is able to predict the location of 

deforestation by using logistic regression. The validation was also tested using ROC approach which 

was found to be 0.96. 

Key words: Deforestation modeling, remote sensing, logistic regression, Zagros forests, Ilam province, Ilam. 

INTRODUCTION 

Three well-known global changes are increasing carbon 

dioxide in the atmosphere, alterations in the biochemistry 

of the global nitrogen cycle and continuing land-use/landcover 

change(LU/LC) (Vitousek, 1994), which generates 

many environmental consequences globally and locally, 

such as the release of greenhouse gases, the loss of 

biodiversity and the sedimentation of lakes and streams 

(Walker, 2000). In particular, it is recognized as the major 

driver of the loss of biodiversity and ecosystem services 

(Haines-Young, 2009). The effects of land-use changes 

on biodiversity may be greater than climate change, biotic 

exchange, and elevated carbon dioxide concentration at 

the global scale (Sala, 2000). Deforestation is known as 

one of the most important elements in LU/LC. Globally, 

deforestation has been occurring at an alarming rate of 

13 million hectares per year (FAO, 2005). 

The Mediterranean area is one of the most significantly 

altered hotspots on Earth (Myers et al., 2000). It has 

been intensively affected by human activity for millennia 

(Covas and Blondel, 1998; Lavorel et al., 1998; Blondel 

and Aronson, 1999; Vallejo et al., 2005). As a result, only 

4.7% of its primary vegetation has remained unaltered 

(Falcucci et al., 2007). Agricultural lands, evergreen 

woodlands and maquis habitats that dominate the 

Mediterranean basin are the result of anthropogenic 

disturbances over centuries or even millennia (Blondel 

and Aronson, 1995; Blondel, 2006). 

Although, Iran has 14.4 million hectares of forestlands, 

it is still not safeguarding its natural heritage properly. A 

report by the United Nations‟ Food and Agriculture 

Organization (FAO), does not present a hopeful scenario 

for the Iranian environment. As an example, it reports that 

11.5% of the country‟s northern forests have been 

destroyed beyond recognition (http://earthtrends.wri.org). 

Its high deforestation rate has placed Iran among the top 

ten Asia and Pacific countries that destroy forests, with 

economic losses estimated at 6,800 billion rials 

(http://earthtrends.wri.org).

The Zagros region is located in the west of Iran running 

from northwest to southeast. Total forest area is about 

5.2 million hectares. Population pressure has led to 

encroachments on the forestland, for agricultural and 

garden use, collection of fuel wood, mining, human settlements, 

grazing, utilization of branches and leaves of oak 

trees for feeding domestic animals, etc. People have 

been forced to be highly dependent on these degraded 

forests and so the forests have been reduced quantitatively 

and qualitatively. Since 1965, natural regeneration 

has been severely reduced while pests and diseases 

have increased (Fattahi, 2003). 

Amini et al. (2009) carried out a study on deforestation 

modeling and correlation between deforestation and 

physiographic parameters, manmade settlements and 

roads parameters in the Zagros forests (Armerdeh 

forests, Baneh, Iran) using remote sensing and geographic 

information system (GIS). The result of forest 

change detection using forest maps of 1955 and 2002 

showed that 4853 ha of the forest area have been 

reduced and 953 ha increased in this period. The Spearman 

correlation test and logistic regression model were 

used to investigate correlation between changed forests 

and the mentioned parameters. The result showed that 

there is an inverse relationship between deforestation 

and distance from roads. Minimum and maximum 

deforestation were at north and east aspects, respecttively. 

The result of applying logistic regression model 

indicated that distance from road is more effective than 

other parameters on deforestation in the study area. 

Lambin (1994) and Mas et al. (2004) mention that 

deforestation models are motivated by the following 

potential benefits: 

1. To provide a better understanding of how driving 

factors govern deforestation, 

2. To generate future scenarios of deforestation rates, 

3. To predict the location of forest clearing and, 

4. To support the design of policy responses to 

deforestation. 

According to Kaimowitz and Angels (1998), one way to 

model deforestation is to make use of empirical models. 

Several studies have analyzed land-use change under 

these approaches (Mertens and Lambin, 2000; Pontius et 

al., 2004; Pontius and Spencer, 2005; Rogan et al., 2008 

and Schneider and Pontius, 2001). Logistic regression 

performs binomial logistic regression, in which the input 

dependent variable must be binary in nature, that is, it 

can have only two possible values (0 and 1). Such 

regression analysis is usually employed in estimating a 

model that describes the relationship between one or 

more continuous independent variable(s) to the binary 

dependent variable. Logistic regression analysis fits the 

data to a logistic curve instead of the line obtained by 

ordinary linear regression. In addition to the prediction, 

logistic regression is also a useful statistical technique 

that helps to understand the relation between the 

Arekhi 16237 

dependent variable (change) and independent variables 

(causes) (Mas et al., 2004). 

In the particular, case of deforestation, the spatial forest 

change is a categorically dependent variable, which 

results from the interaction of several explanatory variables. 

Logistic regression and GIS have been demonstrated 

as useful tools to analyze deforestation by many 

authors (Echeverria et al., 2008; Etter et al., 2006c; Loza, 

2004; Ludeke et al., 1990; McConnell et al., 2004; 

Rossiter and Loza, 2008 and Van Gils and Loza, 2006). 

Logistic regression analysis has the advantage of 

taking into account several independent explanatory 

variables for the prediction of a categorical variable (Van 

Den Eeckhaut et al., 2006). In this case, the dependent 

variable is either change or no change that has occurred 

in the forests areas. 

Landsat MSS, TM and ETM + data have been broadly 

employed in studies toward the determination of LU/LC 

since 1972, the starting year of Landsat program, mainly 

in forest and agriculture areas (Campbell, 2007). The rich 

archive and spectral resolution of satellite images are the 

most important reasons for their use. 

The aim of change detection process is to recognize 

LU/LC between two or more periods of time (Muttitanon 

and Tiipathi, 2005). There are many techniques 

developed in literature using post classification compareson, 

conventional image differentiation, image ratio, 

image regression and manual on-screen digitization of 

change principal components analysis and multi date 

image classification (Lu et al., 2005). A variety of studies 

have addressed that post-classification comparison was 

found to be the most accurate procedure and presented 

the advantage of indicating the nature of the changes 

(Mas, 1999; Yuan et al., 2005). In this study, change 

detection comparison technique (at the pixel level) (that 

is, maximum likelihood method) was applied to the LU/LC 

maps derived from satellite imagery. 

The main objective of this study was to analyze and 

predict processes of forest conversion in the Zagros 

forests in western Iran. In order to reach the goal, the 

following specific objectives were considered: 

1. To determine and quantify forest changes that 

occurred in the Zagros forests from 1988 to 2007. 

2. To identify and analyze the most significant 

explanatory variables that lead to forest conversion in the 

Zagros forests. 

3. To establish a predictive model based on logistic 

regression and its validation. 


Study area 

The study area is situated in the province of Ilam, west of Iran 

between 33°35´ and 33°43´ latitude and between 46°17´ and 

47°13´ longitude (Figure 1) and covers about 225,593 ha. The main 

species of these forests consists; Quercus brantii, Quercus


Figure 1. Location of study area. 

infectoria and Quercus libani, the dominant species is Q. brantii. It 

covers a diversity of elevation, slope, population and land-use, etc. 

Beside the undamaged natural environment in some parts, a major 

part of the area has been changed by agriculture and grazing 

activities (Fattahi, 2003). 

Land-cover maps 

Multi-temporal Landsat satellite images from April 01, 1988 (Path 

167, Row 37), March 20, 2001 and May 24, 2007, were obtained 

from the Global Land Cover Facility (http://www.landcover.org), 

University of Maryland. The dates of these three images are chosen 

to be as closely as possible in the same vegetation season. The 

resolutions of all images are adjusted from 28.5 ×28.5 m to 30 × 30 

m. All visible and infrared bands (except the thermal infrared band) 

were used for the purpose of classification. Remote sensing image 

processing is performed using IDRISI Andes 15.0. 

The 1:25,000 digital topographic maps of the national 

cartographic Center of Iran have been used for geo-referencing of 

earlier mentioned three images. A digital elevation model (DEM) 

generated from 20 m contour lines are used to create slope and 

elevation maps. Digital elevation model (DEM) is produced from the 

standard topographic maps with the scale of 1:25,000. DEM is 

created by using ArcGIS 9.2 GIS software. Road networks and 

human settlements are manually digitized using ArcGIS 9.2 at the 

same scale. Pixel dimensions of all maps are in 30×30 m 

resolution. 

Pre-processing 

Landsat 2007 image is geo-referenced (universal transver 

mercator-UTM (Zone 38N), WGS84) to the maps of DEM, road 

networks, and human settlements, with an RMS error of less than 5 

m by using nearest neighborhood resampling method. The other 

two Landsat images are then geo-referenced to the 2007 image 

(image to image registration), with an error of less than 10 m. The 

radiometric corrections and systematic errors are removed from the 

data set providers. 

The model discussed in this study follows four sequential steps: 

(1) Elaboration of maps of deforestation obtained by overlaying 

maps of forest-cover from more than one point in time, (2) 

quantification of the relationships between deforestation and the 

causes (3) statistical selection of the most significant explanatory 

variables, (4) prediction of future deforestation in a business-as-

usual way. 

METHODS 

Figure 2. Forest and non-forest map of 1988. 

IDRISI Andes 15.0 was used to determine deforestation rates using 

three different land-use/land-cover maps from 1988, 2001 and 

2007. The land-use/land-cover map of 1988 is produced by 

supervised maximum likelihood classification using training sites to 

identify forest, river, cropland, rangeland, barren land and 

settlement areas. The same methodology is applied to produce the 

land-use/land-cover maps of 2001 and 2007. Then, the classified 

land-use/land-cover maps are reclassified into two categories as 

forest and non-forest. Only forest areas are reclassified as "forest". 

While river, cropland, rangeland, barrenland and settlement areas 

are reclassified as "non-forest". The change from forest to nonforest 

is classified as deforestation. Finally, these maps are used to 

calculate the area of each land-use/land-cover type at each time 

period and to measure the deforestation rate from 1988 to 2007. 

Classification accuracy is evaluated by calculating overall accuracy 

and Kappa coefficient using an independent sample of 116 

ground control points (GCPs) obtained from field work. Areas of 

forest are calculated for the three dates and then annual rates of 

forest clearing are estimated. As a following step, images are overlaid 

in order to produce a digital map of deforestation that represents 

changes in forest cover. Therefore, the deforestation maps 

present only two classes: forest persistence (forest in both dates) 

and deforestation coded 0 and 1, respectively (Figures 5 and 6). 

The drivers 

Arekhi 16239 

The first step for deforestation modelling is to identify and collect 

information about factors that play a major role in the deforestation 

occurrence. An attempt is made to determine the relationship 

between deforestation, and environmental and socioeconomic 

factors, which are considered as priori elements that could 

influence deforestation such as distance from settlements, distance 

from roads, distance from forest edge, elevation, slope and forest 

fragmentation index. All these variables are integrated in a GIS and 

co-registered geometrically with the forest-cover-change map 

derived from the analysis of remote sensing images. Several spatial 

explanatory variables describing potential proximate causes of 

deforestation are generated as follow: 

1. Elevation: A digital elevation model (DEM) is constructed from 

the contour lines, where the lines are digitized at the 1:25,000 

scale, at intervals of 20 m. The resulting elevation map is binned 

with 200 m intervals. 

2. Slope: Slope is another important factor that is generated from 

elevation using ArcGIS 9.2. 

3. Distance from forest edge: It is calculated as a series of onepixel-wide 

buffers expanding from all interfaces between pixels 

classified as forest and non-forest. To remove the influence on this 

distance, calculations of isolated pixels are classified as forest or 

non-forest, and the land-cover map is first smoothed using a 3×3


pixel low pass filter. For this smoothing, the most frequently 

occurring class in the window is assigned to the central pixel of a 

moving window. 

4. Distance to the nearest road: This variable is calculated as a 

series of buffers of 100 m expanding from each road segment. Most 

of the roads in the study area are gravel roads with quality largely 

dependent on the maintenance efforts and it is highly variable in 

time. Each road is, therefore, treated as equally suitable for 

transport of goods and people. 

5. Distance to the nearest settlement: It is calculated as a series of 

buffers of 100 m, expanding from each center. Only the officially 

registered village, district and town centers are taken into account. 

The following procedure is used to obtain the variable distances for 

Steps 4 and 5. 

a. Road networks and human settlements shape files were 

imported. 

b. Raster files were created from each of the vector files. 

c. The Operator DISTANCE was applied. 

6. Forest fragmentation index: In this study, fragmentation index is 

estimated using Matheron method (Matheron, 1970). Matheron 

method, calculated in 3×3 pixels windows, is defined as: 

M 

N 

N 

F 

F 

* 

NF 

N 

Where, NF-NF is the number of boundaries between forest and nonforest 

pixels, Nf is the number of forest pixels and N is the total 

number of pixels. The numerator measures the number of pairs of 

adjacent pixels classified as forest and non-forest (that is, the 

length of the perimeter line of forest pixels) and the denominator 

normalizes this count by the size of the forest and entire area 

(Mertens and Lambin, 1997). 

Logistic regression model (LRM) 

Forest conversion is modelled and analyzed using logistic 

regression model (LRM) in IDRISI Andes 15.0. The purpose of 

modelling was (i) to assess the relative signification of six 

explanatory variables on forest change during the period 1988 to 

2007; and (ii) to predict probability of deforestation for future. 

LRM is a variation of ordinary regression which is used when the 

dependent (response) variable is a dichotomous variable. 

In this study, as mentioned before, the dependent variable is a 

binary presence or absence event, where 1= forest change and 0= 

no change, for the period 1988 to 2007. The logistic function gives 

the probability of forest change as a function of the explanatory 

variables. In other words, the probability of forest change for each 

pixel is a function of the values that the other variables have for the 

same pixel. According to Schneider and Pointius (2001) the 

function is a monotonic curvilinear response bounded between 0 

and 1, given by a logistic function of the form: 

(1) 

Where, p is the probability of forest loss in the cell, E(Y) the 

expected value of the binary dependent variable Y, β0 is a constant 

to be estimated, βi‟s are coefficients to be estimated for each 

independent variable Xi. The logistic function can be transformed 

into a linear response with the transformation: 

Hence: 

The transformation (Equation 2) from the curvilinear response 

(Equation 1) to a linear function (Equation 3) is called a logit or 

logistic transformation. The transformed function allows linear 

regression to estimate each βi. Since each of the observations is a 

pixel, the final result is a probability score (p) for each pixel. 

In LRM, the significance of the coefficients βi is tested with the 

Wald test, which is obtained by comparing the maximum likelihood 

estimate of every βi with its estimated standard error (Hosmer and 

Lemeshow, 1989; Eastman, 2006). It is the coefficient divided by its 

standard error. Thus, if the relative error is high, the Wald statistic is 

small. This gives an idea of the significance of each predictor: the 

greater the absolute value, the more significant. Note that the sign 

of the Wald statistic is the same as that of the coefficient, and thus 

gives the direction of the effect: increase or decrease in probability 

due to the predictor. 

Accordinge to Ayalew and Yamagishi (2004), in order to 

appropriately interpret the meanings of Equation 1, one has to use 

the coefficients as a power to the natural log(e). The result 

represents the odds ratio or the probability that an event will occur 

divided by the probability that it fails to do so. If the coefficient is 

positive, its transformation to log value will be greater than one, 

meaning that the event is more likely to occur. If it is negative, then 

the transformed log value will be less than one and the odds of the 

event occurring decrease. A coefficient of 0 has a transformed log 

value of 1, and it does not change the odds one way or the other. 

For a positive coefficient, the probability plotted against the values 

of an independent variable follows an S-shaped curve. A mirror 

image will be obtained for a negative coefficient (Ayalew et al., 

2005). 

Calibration of the Model 

To calibrate the LRM, the explanatory variables are incorporated in 

the IDRISI‟s LRM as independent variables. The forest change for 

the period 1988 to 2001 is incorporated as the dependent variable. 

The stepwise method is used to select the best set of predictor 

variables since the study considered 6 different predictor sets. 

Finally, Van Gils and Loza (2006) methodology is used to select the 

best-fitted model with the minimum amount of predictors measured 

by means of the Akaike Information Criterion (AIC) index. The 

smaller the AIC is, the better the fit of the model. The results are the 

regression equation of the best-fitted predictors set and a map of 

probability of deforestation. 

Prediction of the model 

The prediction for forest change between the year 2001 and the 

year 2007 is performed using the obtained probabilities of 

deforestation for the year 2001. For the new prediction, the dynamic 

variables such as distance from forest edge, distance from roads 

and fragmentation index are changed as long as they were in the 

year 2001. The variables, distance from settlements, elevation and 

slope remained the same. The result is a new map of probability of 

forest change for the year 2007. 

(2) 

(3)

Model validation 


The observed forest change map of 2007 is used to assess the 

accuracy of probability of forest change with the relative operation 

characteristic (ROC) curve, which is an effective and widely used 

method for evaluating the discriminating power of a statistical model 

(Hu and Lo, 2007; Pontius and Schneider, 2001). Eastman (2006) 

also mentions that ROC can be used to determine how well a 

continuous surface predicts the locations given the distribution of a 

Boolean variable (in this study, forest change is the Boolean 

variable). A ROC curve is a graph of the true positive and false 

positives fractions. The ROC works for two or more land types. If a 

grid cell is simulated as change in a scenario, it is a „positive‟. 

Therefore, a „true-positive‟ is a cell which is categorized as change 

in both actual and the modeled scenario. Conversely, a „falsepositive‟ 

is a cell that is categorized as non-change in reality and as 

change in the modeled scenario. ROC plots the rate of truepositives 

on the vertical axis versus the rate of false-positives on 

the horizontal axis. If the sequence of the suitability values matches 

perfectly the sequence in which real land-cover change has 

occurred, then ROC equal to 1. As model performance improves, 

the curve moves towards the upper left corner and the area under 

ROC increases accordingly. 

RESULTS 

Accuracy assessment was performed for 1988, 2001 and 

2007 LU/LC maps (forest/non-forest). The overall 

Arekhi 16241 

accuracy of the classified maps for the years 1998, 2001 

and 2007 ranged from 83 to 87%, and Kappa indices 

varied from 0.71 and 0.73. Figures 2, 3 and 4 display the 

1988, 2001 and 2007 land-cover maps (forest/non-forest) 

created for the study area, respectively. These images 

are then overlaid in order to generate the digital forest 

change detection maps for two intervals; namely, 1988 to 

2001 and 2001 to 2007 (Figures 5 and 6). The results of 

forest change detection in the Zagros forests show that 

28.2% of primary forest has been lost from 1988 to 2007. 

This study selected the set predictor Step 6 as the best 

combination to be used in the prediction (Table 1). The 

selection procedure is performed as follows. According to 

Ayalew and Yamagishi (2005), a key starting point could 

be the model chi-square, whose value provides the usual 

significance test for logistic regression. It is a difference 

between −2lnL (L=likelihood) for the best-fitting model 

(predictor set) and −2lnL0 for the null hypothesis in which 

all the coefficients are set to 0. The value measures the 

improvement in fit that the independent variables brought 

into the regression. In this study, the high value chisquare 

(for the predictor set Step 6) indicates that the 

occurrence of forest change is far less likely under the 

null hypothesis (without the forest conversion influencing 

parameters) than the full regression model (where the



parameters are included). The goodness of fit is an 

alternative to Chi-square for assessing the significance of 

LRM. It is calculated based on the difference between the 

observed and the predicted values of the dependent 

variable. The smaller this statistic is, the better fit it 

indicates. Model step 6 has a value of 359,634, which is 

the smallest Goodness of fit statistic among the model 

sets. The pseudo R-square value, which can be 

calculated from 1− (ln L/ln L0), indicates how the logit 

model fits the dataset (Menard, 1995). Thus, pseudo Rsquare 

equal to 1 indicates a perfect fit, whereas 0 shows 

no relationship. When a pseudo R-square is greater than 

0.2, it shows a relatively good fit (Clark and Hosking, 

1986; Ayalew et al., 2005). The pseudo R-square of the 

Step 6 predictor set is 0.23. Under ROC, the Step 6 

predictor set obtained an accuracy of 0.96% and 

provided the smallest AIC index making it the best-fitted 

predictor set (Table 2). Regression equation best-fitted 

Step 6 predictor set. 

Linear probability (logit) =1.95 

-0.36* Distance from roads log 

-0.45* Distance from settlements log 

-0.31* Distance from forest edge log 

0.23* Fragmentation index 

-0.35* Slope 

-0.52* Elevation 

The relative contribution of the explanatory variables can 

be assessed using the corresponding coefficients in the 

LRM. According to Eastman (2006), the intercept can be 

thought of as the value for the dependent variable when 

each independent variable takes on a value of zero. The 

coefficients indicate the effects of each of the explanatory 

variables on the dependent variable. 

Figures 7 and 8 show the results of the calibration and

Figure 5. Cross 1988-2001. 

the prediction of the LRM. The color in the figures 

indicates the degree of probability of deforestation. Areas 

in dark blue show high probability for forest conversion, 

while, areas in other colors have decreasing probability 

for deforestation. Figure 9 illustrates the real change 

occurred for the period 2001 to 2007, areas in black are 

areas of changes. Figure 10 illustrates the ROC curve for 

the LRM. The Area under the ROC Curve is 0.961. 

DISCUSSION 

There may be many driving factors of forest conversion, 

and they may vary from place to place. In this case study, 

selected spatial variables comprise a considerable share 

of the factors driving forest changes. In particular, the 

accessibility variables seem to be more important than 

the topographical ones. Many of these factors have been 

found to be important in other areas. For example, 

Merten and Lambin (1997) identified proximity to road, 

Arekhi 16243 

town and forest/non-forest edge as important drivers of 

forest change in southern Cameroon. Elevation and 

proximity to road are highlighted as important factors of 

forest change in the lowlands of Sumatra, Indonesia 

(Linkie et al., 2004). Elevation, slope, proximity to road, 

settlement and proximity to forest/non-forest edge are the 

key factors of forest change in southeast Mexico (Mas et 

al., 2004). The modelling of forest conversion considered 

six explanatory variables: Distance from forest edge, 

distance from roads, distance from settlements, 

elevation, slope and fragmentation index. In the LRM 

analysis, six predictor sets are compared. The best fitted 

predictor set is a combination of all the variables 

incorporated into the model. For this combination, the 

AUC is 96% and the AIC index is the lowest for the tested 

predictor sets. 

Among continuous variables, distance from settlements 

is the best single predictor for forest change (1988 to 

2007), with a β value of -0.45. This means that the 

probability of forest change decreases in direct proportion


Figure 6. Cross 2001-2007. 

to the increase in distance from the borders. In other 

words, the model assigns higher values of probability of 

change to areas, which are closer to the forest borders. 

Distance from roads and distance from forest edge have 

the nearly same negative value (β= -0.36; β= -0.31). The 

model assigns the similar significance to these two 

variables. The negative value means that the probability 

of forest change decreases in direct proportion to the 

increase in distance from roads and forest edge. In other 


change to areas which are closer to roads and forest 

edge. Finally, forest change has positive relation with 

fragmentation index (β=+0.23). This means that 

fragmented forest is degraded more than protected area. 

Many studies have attributed road infrastructure to one 

main cause of deforestation. Geist and Lambin (2002) 

and Krutilla et al. (1995) argued that the construction of 

roads requires clearing of vegetation that leads to 

deforestation. Greater access to forests and markets will 

accelerate the deforestation. 

The variables, distance from settlements and distance 

from roads are significant factor for forest conversion in 

this study, as well as mentioned by other studies 

(Echeverria et al., 2008; Etter et al., 2006a, b; Geist and 

Lambin, 2001; Loza, 2004; Vanclay et al., 1999), In the 

particular case of the deforestation in the Zagros forests, 

it is believed that first people settle land reached beyond 

existing roads and then they develop roads to reach the 

already taken lands. However, this is difficult to verify with 

the data and the analysis provided by this study. 

Meanwhile, among categorical variables, elevation is 

the best single predictor for forest change (1988 to 2007), 

with a β value of -0.52. This means that the probability of 

forest change decreases in direct proportion to the 

increase in elevation from the lower elevations. In other 


change to areas, which are located in lower altitudes (in 

other words, more accessible areas). Finally, slope also 

has good negative association (β = -0.35) with forest 

change. It means with increase in slope, forest change 

decreases due to decreasing accessibility to that. The 

conversion. The topography of Loza‟s study area

Table 1. Coefficients of logistic regression using 6 sets of explanatory variables. 

Variable 

Set 1 Set 2 

Coefficient 

Set 3 Set 4 Set 5 Set 6 

Intercept 0.39 1.01 1.21 1.80 2.23 1.95 

Distance from roads -0.60 -0.52 -0.38 -0.29 -0.30 -0.36 

Distance from settlements -0.57 -0.43 -0.40 -0.41 -0.45 

Distance from forest edge -0.38 -0.31 -0.30 -0.31 

Fragmentation index 0.29 0.25 0.23 

Slope -0.44 -0.35 

Elevation -0.52 

Table 2. Other statistics of logistic regression using 6 sets of explanatory variables 

Arekhi 16245 

Statistic Set 1 Set 2 Set 3 Set 4 Set 5 Set 6 

Total number of pixel 2,507,925 2,507,925 2,507,925 2,507,925 2,507,925 2,507,925 

−2lnL (L=likelihood) 241,734 230,936 229,930 219,983 214,249 201,426 

−2ln L0 435,731 430,328 356,701 383,941 361,618 340,231 

Model chi square 51,928 53,765 55,321 570,551 589,318 59,601 

Goodness of fit 401,369 400,187 391,442 376,964 368,980 359,634 

Pseudo R-square 0.15 0.18 0.21 0.22 0.22 0.23 

AUC 0.76 0.79 0.83 0.87 0.91 0.96 

Odds ratio 4.21 4.37 4.41 4.46 4.30 5.05 

AIC 247,651 238,756 220,908 217,781 215,645 201,341 

Figure 7. Map of probabilities of deforestation obtained by LRM (calibration 2001).


Figure 8. Map of probabilities of deforestation obtained by LRM (Prediction 2007). 

presents mostly hills (lower altitude) and flat areas. 

The involvement of some variables such as land tenure 

status, and other socio-economic data (level of income, 

level of education), which have contributed to 

deforestation might be incorporated in the model. Zagros 

forests have threats such as the construction of a road 

across the area, population density and agroforestry. The 

aim of this research is to predict probabilities of forest 

conversion. However, areas of change (not only 

probabilities) can be predicted by incorporation of 

methods such as Markov chains, Geomod and cellular 

automata. While this study considered only two 

categories, “forest and disturbed forest”, further studies 

could model additional categories of land-cover. 

Conclusion 

The identification of the areas vulnerable to forest 

changes is fundamental in the Zagros forests and has 

important implications for biodiversity conservation in the 

region. One of the most important applications would be 

to relate the spatial patterns of forest changes to the 

spatial distribution of species. From a protected area 

management perspective, the prediction maps of forest 

change patterns can help protected area managers to 

identify places, where conservation and forest 

management efforts should be focused. At a larger scale, 

the prediction of forest change patterns can aid long-term 

sustainable forest management. Policy implication of the 

result model prediction is that the government should 

take more attention to the population problem and have 

to create non-agricultural sectors jobs in order to reduce 

pressure on forest, especially at district which will face 

serious deforestation. This study investigate the 

conversion of forest using remote sensing, GIS and 

logistic regression model in the Zagros forests of west of 

Iran. The LRM is parameterized to simulate the 

conversion of forest in the near future. It is shown that the 

utility of a combination of statistical modeling approach

Figure 9. Forest change year 2007(1=change; 0= No change). 

True Positive(%) 

120 

100 

80 

60 

40 

20 

0 

0 

3 

9 

21 

32 

44 

False Positive(%) 

Figure 10. Predictive performance assessment LRM (AUC/ROC). 

55 

66 

78 

89 

100 

AUC/ROC = 96% 

True positive(%) 

False positive(%) 

Arekhi 16247


and spatial analysis is necessary in order to analyze and 

predict deforestation. Distance from forest settlements, 

distance from roads, distance from forest edge, 

fragmentation index, elevation and slope are found to be 

the important variables in the model for explaining the 

pattern of deforestation observed in the Zagros forests. 

REFERENCES 

Amini MR, Shataee S, Moaieri MH, Ghazanfari H (2009). Deforestation 

modeling and investigation on related physiographic and human 

factors using satellite images and GIS (Case study: Armerdeh forests 

of Baneh), Iranian J. For. Poplar Res. 16(3): 432-443. 

Ayalew L, Yamagishi H (2004). The application of GIS-based logistic 

regression for landslide susceptibility mapping in the Kakuda-Yahiko 

Mountains; Central Jpn. Geomorphol. 65:15-31. 

Ayalew L, Yamagisehi H, Marui H, Kanno T (2005). Landslides in Sado 

Island of Japan: Part II. GIS-based susceptibility mapping with 

comparisons of results from two methods and verifications. 

Engineering Geol. 81: 432-445. 

Blondel J, Aronson J (1995). Biodiversity and ecosystem function in the 

Mediterranean basin: Human and nonhuman determinants. pp 43- 

119. In: Davis, G.W. & Richardson, D.M. (eds). 

Blondel J, Aronson J (1999). Biology and wildlife of the mediterranean 

region. Oxford Univ. Press:Oxford. 

Blondel J (2006). The design of Mediterranean landscapes: a millennial 

story of humans and ecological systems during the historic period. 

Hum. Ecol. 34: 713–729. 

Campbell JB (2007). Introduction to Remote Sensing, Fourth edition, 

The Guilford Press, New York, USA, 

Clark WA, Hosking PL (1986). Statistical Methods for Geographers, 

John Wiley and Sons, New York. p. 518 

Covas R, Blondel J (1998). Biogeography and history of the 

Mediterranean bird fauna. Ibis, Centre d„Ecologie Fonctionnelle et 

Evolutive. 140: 395–407. 

Eastman JR (2006). IDRISI 15 Andes. Guide to GIS and image 

processing Clark Univ. Worcester; MA 01610 - 1477 USA. 

Echeverria C, Coomes DA, Hall M, Newton AC (2008). Spatially explicit 

models to analyze forest loss and fragmentation between 1976 and 

2020 in southern Chile. Ecol. Modelling. 212: 439-449. 

Etter A,McAlpine C, Phinn S, Pullar D, Possingham H (2006a). 

Unplanned land clearing of Colombian rainforests: Spreading like 

disease? Landscape and Urban Planning. 77: 240-254. 

Etter A, McAlpine C, Pullar D, Possingham H (2006b). Modelling the 

conversion of Colombian lowland ecosystems since 1940: Drivers; 

patterns and rates. J. Environ. Manage. 79: 74-87. 

Etter A, McAlpine C, Wilson K, Phinn S, Possingham H (2006c). 

Regional patterns of agricultural land use and deforestation in 

Colombia. Agric. Ecosys. & Environ. 114: 369 386. 

Falcucci AL, Maiorano M, Boitani L (2007). Changes in landuse/landcover 

patterns in Italy and their implications for biodiversity 

conservation. Landscape Ecol. 22: 617–631. 

FAO (Food and Agriculture Organization of the United Nations) (2005). 

State of the World‟s forests. FAO, Rome. 

Fattahi M (2003). Forest management trends in the Zagross region of 

Iran.XII World forestry Congress, Quebec City. Canada, 1-5(0118- 

B1). 

Geist HJ, Lambin EF (2001). What drives tropical deforestation? A 

meta-analysis of proximate and underlying causes based on subnational 

case study evidence. LUCC Report Series No. 4. CIACO; 

Louvain-la-Neuve. 

Geist, HJ, Lambin EF (2002). Proximate causes and underlying driving 

force of tropical deforestation. Bioscience. 52(2): 143-150. 

Haines-Young R (2009). Land Use and Biodiversity Relationships, Land 

Use Policy. 26(1): 178- 186. 

Hosmer DW, Lemeshow S (1989). Applied Logistic Regression. New 

York: Wiley. 

Hu Z, Lo CP (2007). Modeling urban growth in Atlanta using logistic 

regression. Computers; Environ. Urban Systems. 31:667-688. 

Kaimowitz D, Angelsen A (1998). Economic Models of Tropical 

Deforestation; a review. Center for Int. Forest. Res. C1FOR. Bogor 

Indonesia. 

Krutilla K, William FH, Doug Barnes (1995). Periurban deforestation in 

developing countries. For. Ecol. Manage. 74(2): 181-195. 

Lambin EF (1994). Modelling deforestation processes; a review. EUR 

15744 EN; TREES series B: Res. Report No. 1. Joint Res. Centre, 

Inst. for Remote Sensing Appl. European Space Agency; 

Luxembourg; Office for Official Pub. European Community. P. 128. 

Lavorel S, Touzard B, Lebreton J-D, Clément B (1998). Identifying 

functional groups for response to disturbance in an abandoned 

pasture. Acta Oecol. 19: 227–240. 

Linkie M, Smith RJ, Leader-Williams N (2004). Mapping and predicting 

deforestation patterns in the lowlands of Sumatra. Biodivers. 

Conserv. 13: 1809-1818. 

Loza AV (2004). Spatial logistic model for tropical forest conversion : a 

case study of Carrasco province; 1986 - 2002; Bolivia. In: ITC; 

Enschede. p 74. 

Ludeke AK, Maggio RC, Reid LM (1990). An analysis of anthropogenic 

deforestation using logistic regression and GIS. J. Environ. Manage. 

31: 247-259. 

Mas JF (1999). Monitoring land-cover changes: a comparison of change 

detection techniques. Int. J. Remote Sensing. 20(1): 139–152. 

Mas JF, Puig H, Palacio JL, Lopez AS (2004). Modelling deforestation 

using GIS and artificial neural networks. Environ. Model. Software. 

19: 461-471. 

Matheron G (1970). The Theory of Regionalised Variables and its 

Applications. Les Cahiers du Centre de Morphologie Mathématique, 

Vol. 5, Ecole des Mines de Paris, Fontainebleau, P. 212. 

McConnell WJ, Sweeney SP, Mulley B (2004). Physical and social 

access to land: spatio temporal patterns of agricultural expansion in 

Madagascar. Agric. Ecosystems & Environ. 101:171-184. 

Menard Scott (1995). Applied Logistic Regression Analysis. Sage Pub. 

Series: Quantitative Appl. Social Sci. No. 106. 

Mertens B, Lambin EF (2000). Land-Cover-Change trajectories in 

Southern Cameroon. Annals of the Assoc. Am. Geographers. 90: 

467-494. 

Mertens B, Lambin EF (1997). Spatial modeling of tropical deforestation 

in southern Cameroon: spatial disaggregation of diverse 

deforestation processes. Appl. Geog. 17: 143-162. 

Muttitanon W, Tiıpathi NK, (2005). Land use/land cover changes in the 

coastal zone of Ban Don Bay, Thailand using Landsat 5 TM data. 

International J. Remote Sensing. 26 (11): 2311- 2323. 

Myers N, Mittermeier RA, Mittermeier CG (2000). Biodiversity hotspots 

for conservation priorities. Nature. 403: 853–858. 

Pontius RG, Schneider LC. (2001). Land-cover change model validation 

by an ROC method for the Ipswich watershed; Massachusetts; USA. 

Agric. Ecosystems & Environ. 85: 239-248. 

Pontius RG, Spencer J (2005). Uncertainty in extrapolations of 

predictive landchange models. Environment and Planning B-Planning 

& Design. 32: 211-23 

Pontius RG, Shusas E, McEachern M (2004). Detecting important 

categorical land changes while accounting for persistence. Agric. 

Ecosystems & Environ. 101: 251-268. 

Rogan J, Franklin J, Stow D, Miller J, Woodcock C, Roberts D (2008). 

Mapping land-cover modifications over large areas: A comparison of 

machine learning algorithms. Remote Sensing of Environ. 112: 2272- 

2283. 

Rossiter DG, Loza A (2008). Technical Note: Analyzing land cover 

change with logistic regression in R. Technical Report ITC; 

Enschede; NL. Version 2.01; 19-July- 2008. p. 69 First version April 

2004. 

Sala, OE, Chapin FS, Armesto JJ, Berlow R, Bloomfield J, Dirzo R, 

Huber- Sanwald E, Huenneke LF, Jackson RB, Kinzig A, Leemans R, 

Lodge D, Mooney HA, Oesterheld M, Poff NL, Sykes MT, Walker BH, 

Walker M, Wall DH (2000). Global biodiversity scenarios for the year 

2100. Science. 287: 1770–1774. 

Schneider LC, Pontius RG (2001). Modeling land-use change in the 

Ipswich watershed; Massachusetts; USA. Agriculture; Ecosystems & 

Environ. 85:83-94. 

Van Den Eeckhaut M, Vanwalleghem T, Poesen J, Govers G, 

Verstraeten G, Vandekerckhove L (2006). Prediction of landslide

susceptibility using rare events logistic regression: A case-study in 

the Flemish Ardennes. Belgium. Geomorphology. 76: 392-410. 

Van Gils H, Loza AV (2006). What drives conversion of tropical forest 

in Carrasco province, Bolivia. Ambio: j. human environ. 35: 81-85. 

Vanclay JK, Kaimowitz D, Puntodewo A, Mendez P (1999). Spatially 

explicit model of deforestation in Bolivia. Data Manage.d Modelling 

using Remote Sensing and GIS for Tropical For. Land Inventory. 

Rodeo; Jakarta. 82: 371-373. 

Vitousek PM (1994). Beyond global warming: ecology and global 

change. Ecology 1994. 75: 1861-1876. 

Walker BH, Walker M, Wall DH (2000). Global biodiversity scenarios for 

the year 2100. Science. 287: 1770-1774. 

Arekhi 16249 

Vallejo V.R, Aronson J, Pausas JG, Cortina J (2005). Restoration of 

Mediterranean woodlands. In an Andel J, Aronson J (Eds) 

Restoration Ecol. from a European Perspective. Blackwell Sci. 193- 

207. 

Yuan F, Sawaya KE, Loeffelholz BC, Bauer ME (2005). Land cover 

classification and change analysis of the Twin Cities (Minnesota) 

metropolitan areas by multitemporal Landsat remote sensing. 

Remote sensing of Environ. 98: 317-328.



DOI: 10.5897/AJB11.1202 



Differential response to water deficit stress in alfalfa 

(Medicago sativa) cultivars: Growth, water relations, 

osmolyte accumulation and lipid peroxidation 

Inès Slama, Selma Tayachi, Asma Jdey, Aida Rouached and Chedly Abdelly* 

Laboratoire des Plantes Extrêmophiles, BP 901, Centre de Biotechnologie, Technopole de Borj Cédria, Hammam-Lif 

2050, Tunisia. 

Accepted 5 August, 2011 

The present study was fixed as objective to compare the response to water deficit (33% of field 

capacity, FC) stress of eight cultivars of Medicago sativa, originating from the Mediterranean basin. 

Comparison was performed on some key parameters such as growth, relative water content, leaf water 

potential, MDA tissue content, electrolyte leakage and proline and soluble sugar tissue concentrations. 

In all cultivars, water deficit stress reduced the whole plant growth, increased the root/shoot DW ratio 

and led to a significant decrease in leaf relative water content and leaf water potential. In water-stressed 

plants and for the majority of cultivars, proline and soluble sugar concentrations increased 

significantly. The Tamantit cultivar originating from Algeria showed the better tolerance to water deficit 

stress. Some criteria are concomitant with this tolerance: (1) a high biomass production under stress 

conditions when compared to other cultivars (2) the root preferential development, (3) the better ability 

to accumulate proline and soluble sugars, and (4) the aptitude to protect its photosynthetic apparatus 

against the oxidative stress generated by the water deficit stress. Ecotipo Siciliano, originating from 

Italy was the most sensitive cultivar. The increase of proline and soluble sugars concentrations upon 

water deficit stress particularly in the most tolerant cultivar suggested their involvement in the osmotic 

adjustment. 

Key words: Medicago sativa, intraspecific variability, water deficit stress, osmotic adjustment, MDA. 

INTRODUCTION 

Environmental constraints such as drought, flooding, 

extreme temperature, salinity, heavy metals, photon 

irradiance and nutritional disturbances represent the most 

limiting factors for agricultural productivity and play a 

major role in the distribution of plant species across 

different types of environments (Ashraf, 2010). It has 

been estimated that two-thirds of the potential yield of 

major crops are usually lost due to adverse growing 

environments (Chaves et al., 2009). Water shortage is 

the major constraint affecting fodder production and yield 

stability in most arid and semi-arid regions (Shao et al., 

2009). The situation worsens by the fact that most 

climate change scenarios predict a worldwide increase in 

*Corresponding author. E-mail: chedly.abdelly@cbbc.rnrt.tn. 

Tel: (+216) 79 325 848. Fax: (+216) 79 325 638. 

arid areas. When faced with this climatic change and 

increasing water demand for agriculture, the selection of 

plants resistant to water deficit stress and particularly the 

identification of physiological proprieties used by 

Fabaceae species to cope with drought are of paramount 

importance (Erice et al., 2010; Sambatti and Caylor, 

2007). Improvement of plant drought resistance becomes 

urgent and should integrate conventional breeding and 

biotechnological approaches (Shao et al., 2006, 2009). 

Due to their capacity of symbiotic nitrogen fixation, 

leguminous plants, like Medicago sativa, are often used 

to improve soil organic fertility and nitrogen economy 

(Erice et al., 2010; Yousfi et al., 2010). Most leguminous 

trees and shrubs having deep roots and fix nitrogen are 

able to resist drought and can thrive on poor soils with 

little nutrients. 

Some plants have evolved various protective 

mechanisms allowing them to survive and grow in harsh

environments and respond to water deficit stress through 

multiple physiological, biochemical and molecular 

mechanisms (Anjum et al., 2011). Plant responses to 

water deficit stress generally vary with varieties, severity 

as well as with the duration of water shortage. Among 

these responses, osmotic adjustment (OA), which is 

defined as the lowering of osmotic potential in plant 

tissue due to net accumulation of organic and/or mineral 

solutes, is a key of plant osmo-tolerance (Yang et al., 

2011). Compatible solutes involved in OA may act as 

cytoplasmic osmolytes facilitating water uptake and 

retention but also serves as protection in plants suffering 

from oxidative stress by the detoxification of reactive 

oxygen species and stabilizer of macromolecules and 

cellular structures (Szabados and Savouré, 2010). These 

beneficial impacts have been reported for proline, 

glycinebetaine, soluble sugars and polyols. Common with 

other abiotic stresses, drought causes increased 

production of activated oxygen species (ROS) that 

inactivate enzymes and damage cellular components 

(Shao et al., 2007, 2008). Oxidative stress occurs when 

the defence capacity of plants is broken by the formation 

of free radicals. Malondialdehyde (MDA) is an end 

product of membrane lipid peroxidation; it has been used 

extensively as an indicator for free radical production and 

membrane injury under various abiotic stress conditions 

(Hermandez et al., 2001). An over-accumulation of 

proline in transgenic tobacco subjected to osmotic stress 

reduced free radicals levels, assessed by MDA 

production (Paranova et al., 2004). 

Since water availability is usually the main factor 

affecting productivity in dry regions, strategies aiming at 

improving sustainable use of water and plant drought 

tolerance are urgent (Erice et al., 2010). In this context, 

exploration of the variability in osmotic stress responses 

would permit not only to identify some tolerant varieties, 

but also to determine useful criteria for genetic 

improvement of osmotic stress tolerance. As part of this 

approach, the present study aimed to investigate the 

differential response of eight Medicago sativa cultivars 

originating from the Mediterranean basin to water deficit 

stress. 


Growth conditions 

Experiment was carried out on 8 M. sativa cultivars originating 

mainly from Mediterranean basin: Mamuntanas, Sardi 10, Ecotipo 

Siciliano (Italy), Ameristand 801S (USA), Gabes 2355 (Tunisia), 

Rich 2 (Marocco), Magali (French) and Tamantit (Algeria). Plants 

were cultivated in 25 L plastic pots (30 cm of depth). Every pot was 

filled with 25 kg of soil from the Centre of Biotechnology at the 

Technopark of Borj Cedria (CBBC) parcel. It is a limono-sandy soil 

containing 0.25, 0.95, 0.65 and 0.05 meq 100 g −1 of dry soil of Na + , 

K + , Ca 2+ ,Cl − , respectively and 0.24 and 0.45 g kg −1 of dry soil of 

P2O5 and total N, respectively. The pH and the electrical 

conductivity of the aqueous extract (1/10) were 6.65 and 0.05 

mmhos cm −1 , respectively. Culture was conducted in semi- 

Slama et al. 16251 

controlled conditions in greenhouse in CBBC. Seeds were sown at 

a rate of 8 seeds per pot. The obtained seedlings were subjected to 

a phase of one month pre-treatment during which soil was 

maintained at 100% field capacity (irrigation was carried out with 

tap water). At the end of this phase of pre-treatment, the plants of 

each cultivar were divided into two batches, control plants (100% 

FC) and of the stressed ones (33% FC). Regular weightings (every 

2 days) enabled to restore the moisture of soil at 100 or 33% FC. 

The plant weight was neglected. Experiments were carried-out in 

greenhouse with a 14 h photoperiod (photosynthetic photon flux 

density, PPFD: 1000 µmol m -2 s -1 ). Mean temperature and relative 

humidity were, respectively 30±5°C, 55±5% day and 16±2°C, 

90±5% night. At the end of one month of treatment, a final harvest 

was carried out and plants were separated into shoots and roots. 

Growth, water relation measurements and leaf water potential 

Fresh weights (FW) of plant samples (roots and shoots) were 

determined upon harvesting. Dry weight (DW) was obtained after 

oven drying the samples at 60°C until a constant weight was reached. 

Relative water content (RWC) was measured in the third 

youngest fully expanded leaf harvested in the morning. RWC were 

determined using the following equation (Schonfeld et al., 1988): 

RWC (%) = 100 × (FW − DW)/ TW – DW 

FW was determined within 2 h after harvest. Turgid weight (TW) 

was obtained after soaking leaves in distilled water in test tubes for 

12 h at room temperature (about 20°C), under low light condition of 

laboratory. After soaking, leaves were quickly and carefully blotted 

dry with tissue paper in preparation for determining turgid weight. 

Dry weight (DW) was obtained after oven drying at 60°C until a 

constant weight was reached. For Ψs, leaves were quickly 

collected, cut into small segments, then placed in Eppendorf tubes 

perforated with four small holes and immediately frozen in liquid 

nitrogen. After being encased individually in a second intact 

Eppendorf tube, they were allowed to thaw for 30 min and 

centrifuged at 15,000 × g for 15 min at 41°C (Martínez-Ballesta et 

al., 2004). The collected sap was analysed for Cs estimation. 

Osmolarity (C) was assessed with a vapour pressure osmometer 

(Wescor 5500) and converted from mosmoles kg -1 to MPa 

according to the Van’t Hoff equation: 

ψs= -R T M 

R is the universal gas constant, T is the temperature (K) and M is 

the osmolality 

Lipid peroxidation 

The extent of lipid peroxidation was assessed by determining the 

concentration of malondialdehyde (MDA) (Draper and Hadley, 

1990). Leaf material was homogenized in 0.1% (w/v) TCA solution. 

The homogenate was centrifuged at 15,000 × g for 10 min and 1 ml 

of the supernatant obtained was added to 4 ml 0.5% (w/v) TBA in 

20% (w/v) TCA. The mixture was incubated at 90°C for 30 min, and 

the reaction was stopped by placing the reaction tubes in an ice 

water bath. Samples were centrifuged at 10,000 × g for 5 min, and 

the absorbance of the supernatant was read at 532 nm. The value 

for non-specific absorption at 600 nm was subtracted. The 

concentration of MDA was calculated from the extinction coefficient 

155 mM –1 cm –1 . 

Electrolyte leakage 

The leaf and root samples (0.2 g) were placed in test tubes


containing 10 ml of double distilled water. The leaves were cut into 

discs of uniform size (5 mm length). The tubes were incubated in a 

water bath at 32°C for 2 h and the initial electrical conductivity of 

the medium (EC1) were measured. The samples were autoclaved 

at 121°C for 20 min to release all the electrolytes, cooled to 25°C 

and the final electrical conductivity (EC2) were measured. The 

electrolyte leakage (EL) was calculated by using the formula: 

EL = (EC1/ EC2)*100 (Dionisio-Sese and Tobita, 1998). 

Proline and soluble sugars determination 

Free proline was quantified spectrophotometrically using the 

method of Bates et al. (1973), while the soluble sugars were 

determined by the anthrone reagent method according to Yemm 

and Willis (1954). 

Proline was determined following the ninhydrin method, using Lproline 

as a standard. Leaf samples (100 mg FW) were 

homogenized in 1.5 ml of 3% (w/v) aqueous sulfosalicylic acid and 

centrifuged for 30 min at 14,000 g. To the supernatant (500 µl), 2 ml 

of acid ninhydrin and 2 ml of glacial acetic acid were added and the 

mixture was boiled for 1 h. After extraction with toluene, the free 

proline was quantified (λ = 520 nm) from the organic phase using 

an Anthelie Advanced 2, SECOMAN spectrophotometer. Proline in 

the test samples was calculated from a standard curve prepared 

against L-Proline (5 to 30 µg, from MERCK KGaA): 

y = 0.059x – 0.014, R 2 = 0.99. 

The content of total soluble carbohydrates in the studied samples 

was determined according to Mc Cready et al. (1950) and Staub 

(1963), using glucose as a standard. Twenty-five milligram (DW) 

leaf samples was homogenized with 5 ml methanol 80% and boiled 

while shaking at 70°C for 30 min. The homogenate was centrifuged 

for 15 min at 6,000 g. After decanting, the residue was 

resuspended in 5 ml of the extraction solution and centrifuged at 

6,000 g for 10 min. The supernatant was decanted and combined 

with the original extract. For measurement of total soluble 

carbohydrates, anthrone–sulfuric acid assay was used. An aliquot 

of 250 µl was added to 5 ml of anthrone– sulfuric acid solution. The 

mixture was shaken, heated in a boiling water-bath for 10 min and 

cooled at 4°C. The absorption was determined by spectrophotometry 

(Anthelie Advanced 2, SECOMAN) at 640 nm. A 

standard curve was prepared using different concentrations of 

glucose (0 to 100 µg, from MERCK KGaA). From the standard 

curve, the concentrations of soluble carbohydrates in the test 

samples were calculated (y = 0.0095x – 0.0299, R 2 = 0.979). 


Standard analysis of variance was done (AV1W procedure of 

MSUSTAT 4.12, Richard E. Lund, Montana State University (Lund, 

1989). 

RESULTS 

Growth 

As shown in Figure 1, under 100% FC, Sardi 10, Tamantit 

and Rich 2 are the most productive cultivars and 

Mamuntanas the less productive one. The other cultivars 

occupied the intermediate position. Under water deficit 

stress, biomass production was significantly decreased 

in all cultivars. However, a large variability was observed. 

Shoot DW was reduced by 55% in Tamantit and up to 

75% in Ecotipo Siciliano. This DW reduction was ranged 

between 64 and 70% in the other cultivars. It is important 

to note that upon water deficit stress, Tamantit, which 

showed the lowest DW reduction compared to its control, 

exhibited the highest biomass production under these 

conditions (2.5 fold biomass when compared to Ecotipo 

Siciliano). 

Relative water content and osmotic potential 

The analysis of the water relations (Figure 2A) showed 

that relative water content was ranged between 30 and 

40% for plants submitted to non limiting water supply and 

between 10 and 23% for water deficit stressed ones. 

Thus, a significant decrease was observed in RWC 

values in all cultivars when submitted to water deficit 

stress. Tamantit, Sardi 10 and Ameristand, preserved 

also the highest RWC values in their leaves, whereas 

Ecotipo Siciliano showed the lowest RWC values in 

leaves. 

Leaf osmotic potential decreased significantly in M. 

sativa cultivars subjected to water deficit stress (Figure 

2B). However, the difference between the values of this 

parameter in plants subjected to the water deficit stress 

compared to their respective control is more important in 

Tamantit (reduction by 70%) than in Magali, Ameristand 

and Sardi (53%) and particularly Ecotipo Siciliano (38%). 

Dry matter partitioning between organs 

The root /shoot ratio assessed on the basis of dry matter 

did not exceed 1.6 for well watered plants. However, it 

increased significantly in all the cultivars subjected to 

water deficit stress (Figure 3). A large variability was 

observed. Tamantit showed significantly the highest 

value of this ratio and Ecotipo Siciliano exhibited the 

lowest root /shoot ratio value. 

Proline accumulation 

Plants submitted to 100% FC accumulated proline 

(Figure 4) at low levels not exceeding 0.8 µmol g -1 FW 

and no significant differences were observed between 

cultivars upon appropriate water supply. The water deficit 

stress led to a significant increase in leaf proline 

concentrations in all cultivars except Mamuntanas 

cultivars (Figure 4). A large variability was also observed 

at this criterion level. 

The most tolerant cultivar identified on the basis of 

growth and water relation, Tamantit, is characterized by 

the highest proline concentrations, about 6 µmol g -1 FW. 

Indeed, this cultivar accumulates at least twice more 

proline that the sensitive one.

Carbohydrate content 

Figure 1. Changes in shoot dry matter production in eight cultivars of Medicago sativa 

during one month of treatment with appropriate water supply (open columns): 100% field 

capacity and 33% field capacity (dotted columns). Values are the means of ten replicates, 

vertical bars are SE. Values sharing a common latter are not significantly different at 

P


Figure 2. Changes in the leaf relative water content (A) and leaf osmotic potential (B) in eight 

cultivars of Medicago sativa during one month of treatment with appropriate water supply 

(open columns): 100% field capacity and 33% field capacity (dotted columns). Values are the 

means of ten replicates, vertical bars are SE. Values sharing a common latter are not 

significantly different at P

Figure 3. Changes in Root / Shoot DW ratio in eight cultivars of Medicago sativa during one 

month of treatment with appropriate water supply (open columns): 100% field capacity and 33% 

field capacity (dotted columns). Values are the means of ten replicates, vertical bars are SE. 

Values sharing a common latter are not significantly different at P


Figure 4. Changes in leaf proline concentrations in eight cultivars of Medicago sativa 

during one month of treatment with appropriate water supply (open columns): 100% 

field capacity and 33% field capacity (dotted columns). Values are the means of ten 

replicates, vertical bars are SE. Values sharing a common latter are not significantly 

different at P


Figure 6. Changes in leaf MDA (malondialdehyde) concentrations (A) and electrolyte leakage (B) 

in eight cultivars of Medicago sativa during one month of treatment with appropriate water supply 

(open columns): 100% field capacity and 33% field capacity (dotted columns). Values are the 

means of ten replicates, vertical bars are SE. Values sharing a common latter are not significantly 

different at P


relations, showed the highest concentrations in proline. In 

the same context, it has been observed that there is 

higher proline content in drought-tolerant Sorghum as 

well as in Phaseolus species than in sensitive ones 

(Türken et al., 2005; Zaifnejad et al., 1997). Vendruscolo 

et al. (2007) showed also that proline concentration 

reached a high value under water deficit stress in Durum 

plants. The PEG-induced water deficit stress increased 

proline accumulation in alfalfa particularly in osmotic 

tolerant accession (Yazdi) suggesting a positive 

correlation between proline accumulation and osmotic 

stress tolerance. Proline accumulation differs between 

cultivars adapted to certain growth conditions or regions, 

as well as within species more or less tolerant to drought 

(Heuer, 1994). In maize primary root, for example, the 

proline level increased as much as a hundred fold under 

a low water potential (Voetberg and Sharp, 1991). The 

free proline level also increased from 4 to 40 times in pea 

in response to water deficit stress (Francisco et al., 

1998). A positive correlation between proline accumulation 

and osmotic stress tolerance has been often 

established (Ashraf and foolad, 2007). The establishment 

of the kinetics of proline accumulation and enzyme (δ- 

OAT, PDH) activities showed that the increase of proline 

biosynthesis in plants subjected to water deficit was 

concomitant with a stimulation of the first enzyme and an 

inhibition of the second one (Slama et al., 2006). The 

accumulation of the proline is one of the adaptive 

responses frequently observed at the plants to limit the 

effects of drought. Proline accumulation under stress 

protects the cell by balancing the osmotic strength of 

cytosol with that of vacuole and external environment. In 

addition to its role as cytosolic osmotica, it may interact 

with cellular macromolecules such as enzymes and 

stabilize the structure and function of such macromolecules. 

Thus, this compound is often proposed as 

relevant tool for selection of plant species and varieties 

tolerant to the osmotic constraints (Ashraf and Foolad, 

2007). 

Water deficit stress induced the generation of reactive 

oxygen species (ROS) (Shao et al., 2005; Shao, 2008). It 

is now widely accepted that these cytotoxic ROS are 

responsible for various stress-induced damages to 

macromolecules mainly lipid membrane peroxidation 

which could be determined by measuring malondialdehyde 

(MDA). The high accumulation of MDA is 

often concomitant with water deficit stress sensitivity. The 

increase in lipid peroxidation observed in the leaves of 

Ecotipo sciciliano could be resulted from the ROS 

accumulation. The minor MDA variation observed in 

some Medicago cultivars suggests a better protection 

from oxidative damage. Electrolyte leakage following 

cellular membrane degradation indicated permeability 

degree and membrane stability (Prasil and Zambien, 

1998). The examination of the variation of electrolyte 

leakage variations showed that in spite of the high value 

of this parameter, Tamantit cultivar showed no significant 

differences when compared to control one. It is important 

to note that the cultivar showing the highest levels of 

proline is the least affected by the oxidative stress 

attributing an antioxidant feature to proline, suggesting 

ROS scavenging activity and proline acting as a singlet 

oxygen quencher (Szabados and savoué, 2009). 

In conclusion, variability in response to water deficit 

stress occurred among alfalfa seedlings. The root preferential 

development, the better ability to accumulate 

proline and soluble sugars, and the aptitude to protect 

photosynthetic apparatus against the oxidative stress are 

the main criteria that are associated with the relative 

tolerance of some cultivars. 

ACKNOWLEDGMENTS 

This work was supported by the Tunisian Ministry of 

Higher Education and Scientific Research 

(LR10CBBC02), by the Tunisian-French “Comité Mixte 

de Coopération Universitaire” (CMCU) network # 

08G0917 and by FP6 Project: Improvement of native 

perennial forage plants for sustainability of Mediterranean 

farming systems. 

REFERENCES 

Ashraf M (2010). Inducing drought tolerance in plants: Biotechnol. Adv. 

28: 169-183. 

Ashraf M, Foolad MR (2007). Roles of glycine betaine and proline in 

improving plant abiotic stress resistance. Environ. Exp. Bot. 59: 206– 

216. 

Anjum SA, Xie XY, Wang LC, Saleem MF, Man C, Lei W (2011). 

Morphological, physiological and biochemical responses of plants to 

drought stress. Afr. J. Agric. Res. 6(9): 2026-2032. 

Bates LS, Waldren RP, Teare ID (1973). Rapid determination of the free 

proline in water stress studies. Plant Soil, 39: 205–208. 

Cattivelli L, Rizza F, Badeck FW, Mazzucotelli E, Mastrangelo AM, 

Francia E, Marè C, Tondelli A, Stanca AM (2008). Drought tolerance 

improvement in crop plants: An integrated view from breeding to 

genomics. Field Crop Res. 105: 1–14. 

Chaves MM, Maroco JP, Pereora JS (2003). Understanding plant 

responses to drought-from genes to the whole plant. Funct. Plant 

Biol. 30: 239-264. 

Chaves MM, Flexas J, Pinheiro C (2009). Photosynthesis under drought 

and salt stress: regulation mechanisms from whole plant to cell. Ann. 

Bot. 103: 551-560 

Chaves MM, Zarrouk O, Fransisco R, Costa JM, Santos T, Regalado 

AP, Rodrigues ML, Lopes CM (2010). Grapevine under deficit 

irrigation: hints from physiological and molecular data. Ann. Bot. 105: 

661-676. 

Dionisio-Sese ML, Tobita S (1998). Antioxidant responses of rice 

seedlings to salinity stress. Plant Sci. 135: 1-9. 

Draper HH, Hadley M (1990). Malondialdehyde determination as index 

of lipid peroxidation. Method Enzymol. 186 : 421–431. 

El Jaafari S (1993). Contribution à l’étude des mécanismes 

biophysiques et biochimiques de résistance à la sécheresse chez le 

blé (Triticum aestivum L.). Doctorat de la Faculté des Sciences 

Agronomiques de Gembloux, Belgique, p. 214. 

Erice G, Louahlia S, Irigoyen JJ, Sanchez-Diaz M, Avice JC (2010). 

Biomass partitioning, morphology and water status of four alfalfa 

genotypes submitted to progressive drought and subsequent 

recovery. J. Plant Physiol. 167: 114–120. 

Francisco JS, Manzaranes M, De Andres EF, Tenorio JL, Ayerbe L 

(1998). Turgor maintenance, osmotic adjustment and soluble sugar 

and proline accumulation in 49 pea cultivars in response to water

stress. Field Crop Res. 59: 225-235. 

Hernández JA, Ferrer MA, Jiménez A, Barcelo AR, Sevilla F (2001). 

– 

Antioxidant systems and O2 /H2O2 production in the apoplast of pea 

leaves: its relation with salt-induced necrotic lesions in minor veins. 

Plant Physiol. 127: 817–831. 

Hoekstra FA, Golovina EA (1999). Membrane behaviour during 

dehydration: implications for desiccation tolerance. Russian J. Plant 

Physiol. 46: 295–306. 

Kameli A, Lösel DM (1995). Contribution of carbohydrates and solutes 

to osmotic adjustment in wheat leaves under water stress. J. Plant. 

Physiol. 145: 363-366. 

Martínez-Ballesta MC, Martínez V, Carvajal M (2004). Osmotic 

adjustment, water relations and gaz exchange in pepper plants grown 

under NaCl or KCl. Environ. Exp. Bot. 52: 161-174. 

Mohsenzadeh S, Malboodi MA, Razavi K, Farrahi-Aschtiani S (2006). 

Physiological and molecular responses of Aeluropus lagopoides 

(Poaceae) to water deficit. Environ. Exp. Bot. 56: 314-322. 

Moinuddin A, Fischer RA, Sayre KD, Reynolds MP (2005). Osmotic 

adjustment in wheat in relation to grain yield under water deficit 

environments. J. Agron. 97: 1062-1071. 

Nunes C, Sousa Araújo S, Da Silva JM, Fevereiro MPSF, Da Silva AB 

(2008). Physiological responses of the legume model Medicago 

truncatula cv. Jemalong to to water deficit. Environ. Exp. Bot. 63: 

289-296. 

Lund RE (1989). A user’s guide to Msustat Statistical Analysis Package. 

Microcomputer Version 4(12): 202. 

Parvanova D, Ivanov S, Konstantinova T, Karanov E, Atanassov A, 

Tsevetkov T, Alexieva V, Djilianov D (2004). transgenic tobacco 

plants accumulating osmolytes show reduced oxidative damage 

under freezing stress. Plant Physiol. Bioch. 42: 57-63. 

Pinheiro C, Chaves MM, Ricardo CP (2001). Alterations in carbon and 

nitrogen metabolism induced by water deficit in the stems and leaves 

of Lupinus albus L.. J. Exp. Bot. 52: 1063-1070. 

Prasil I, Zambien J (1998). The use of conductivity measurement 

method for assessing reezing injury. I. Influence of leakage time, 

segment number, size and shape in a sample on evaluation of the 

degree of injury. Environ. Exp. Bot. 40: 1-10. 

Safarnejad A, Collin HA, Bruce KD, McNeilly T (1996). Characterization 

of alfalfa (Medicago sativa L.) following In vitro selection for salt 

tolerance. Euphytica, 92: 55-61. 

Sambatti JBM, Caylor KK (2007). When is breeding for drought 

tolerance optimal if drought is random? New Physiologist. 175: 70-80. 

Schonfeld MA, Johnson RC, Carver BF, Mornhinweg DW (1988). Water 

relations in winter wheat as drought resistance indicator. Crop Sci. 

28: 526–531. 

Shao HB, Chen XY, Chu LY, Zhao XN, Wu G, Yuan YB, Zhao CX, Hu 

ZM (2006). Investigation on the relationship of proline with weat antidrought 

under soil water deficits. Colloids surface B. 53: 113-119. 

Shao HB, Liang ZS, Shao MA (2006). Osmotic regulation of 10 wheat 

(Triticum aestivum L.) genotypes at soil water deficits. Colloids Surf. 

B. 47: 132-139. 


Shao HB, Chu LY, Jaleel CA, Manivannan P, Panneerselvam R, Shao 

MA (2009). Understanding water deficit stress-induced changes in 

the basic metabolism of higher plants - biotechnologically and 

sustainably improving agriculture and the ecoenvironment in arid 

regions of the globe. Crit. Rev. Biotechnol. 29(2): 131-151. 

Shao HB, Chu LY, Wu G, Zhang JH, Lu ZH, Hu YC (2007). Changes of 

some anti-oxidative physiological indices under soil water deficits 

among 10 wheat (Triticum aestivum L.) genotypes at tillering stage, 

Colloids Surf. B. 54:143–149. 

Shao HB, Chu LY, Lu ZH, Kang CM (2008). Main antioxidants and 

redox signaling in higher plant cells. Int. J. Biol. Sci. 44: 12–18. 

Shao HB, Chu LY, Shao MA, Cheruth AJ, Mi HM (2008). Higher plant 

antioxidants and redox signalling under environmental stresses. C. R. 

Biologies. 331: 433-441. 

Slama I, Messedi D, Ghnaya T, Savouré A, Abdelly C (2006). Effects of 

water-deficit on growth and proline metabolism in Sesuvium 

portulacastrum. Environ. Exp. Bot. 56: 231–238. 

Slama I, Ghnaya T, Savouré A, Abdelly C (2008). Combined effects of 

long-term salinity and soil drying on growth, water relations, nutrient 

status and proline accumulation of Sesuvium portulacastrum, C. R. 

Biol. 331: 442–451. 

Szabados L, Savouré A (2010). Proline: a multifunctional amino acid. 

Trends Plant Sci, 15 (89- 15(2): 89-97. 

Türkan I, Bor M, Ozdemir F, Koca H (2005). Differential responses of 

lipid peroxidation and antioxidants in the leaves of drought-tolerant P. 

acutifolius Gray and drought-sensitive P. vulgaris L. subjected to 

polyethylene glycol mediated water stress. Plant Sci. 168: 223–231. 

Vendruscolo ECG, Schuster I, Pileggi M, Scapim CA, Molinari HBC, 

Marur CJ, Vieira LGE (2007). Stress-induced synthesis of proline 

confers tolerance to water deficit in transgenic wheat. J. Plant. 

Physiol. 164: 1367-1376. 

Voetberg GS, Sharp RE (1991). Growth of maize primaryroot at low 

water potential III. Role of increased proline deposition in osmotic 

adjustment. Plant. Physiol. 96: 1125-1230. 

Yang P, Zhang P, Li B, Hu T (2011). Effect of nodules on dehydration 

response in alfalfa (Medicago sativa L.). Environ. Exp. Bot. doi: 

10.1016/j.envexpbot.pp.05-012. 

Yemm EW, Willis J (1954). The estimation of carbohydrates in plant 

extracts by anthrone. J. Biochem. 57: 508–514. 

Yousfi N, Slama I, Ghnaya T, Savouré A, Abdelly C (2010). Effects of 

water deficit stress on growth, water relations and osmolytes 

accumulation in Medicago truncatula and M Laciniata populations. C. 

R. Biol. 333: 205–213. 

Zaifnejad M, Clark RB, Sullivan CY (1997). Aluminum and water stress 

effects on growth and proline of sorghum. J. Plant. Physiol. 150: 338- 

344.



DOI: 10.5897/AJB11.1897 



Cloning and characterization of a thermostable 2deoxy-D-ribose-5-phosphate 

aldolase from 

Aciduliprofundum boonei 

Xiaopu Yin, Qiuyan Wang, Shu-juan Zhao, Peng-fei Du, Kai-lin Xie, Peng Jin and Tian Xie* 

Center for Biomedicine and Health, Hangzhou Normal University, Hangzhou 310012, P. R. China. 


Analysis of the presumptive 2-deoxy-D-ribose 5-phosphate aldolase gene from Aciduliprofundum 

boonei revealed an open reading frame (ORF) encoding 222 amino acids, which was subcloned and 

then expressed in Escherichia coli. The recombinant DERA protein was purified to apparent 

homogeneity. The enzyme activity was optimal at pH 7.0 and 80C. For 2-deoxyribose-5-phosphate, the 

apparent Km was calculated to be 0.12 ± 0.01 mM. No loss of activity was observed after incubation at 

80C for 10 min. The enzyme was extremely stable over a wide range of pH levels. Moreover, the 

thermophilic enzyme also showed tolerance to acetaldehyde, which retained more than 70% activity 

after exposure for 4 h to 250 mM acetaldehyde at 25°C. 

Key words: 2-deoxy-D-ribose 5-phosphate aldolase (DERA), thermophiles, aldo condensation. 

INTRODUCTION 

Aldolases are used for stereospecific carbon-carbon 

bond formation, one of the most important transformations 

in industrial organic syntheses (Kim et al., 

2009). According to the chemical mechanism, aldolases 

are divided into two classes: Class I aldolases are 

cofactor-independent and catalyzes carbon-carbon bond 

cleavage via the formation of a Schiff base intermediate 

with the sugar; Class II aldolases are dependent on a 

divalent metal ion that acts as a Lewis acid and activates 

the donor substrate (Morse and Horecker, 1968; Rutter, 

1964; Siebers et al., 2001; Sauve and Sygusch, 2001). 

Deoxyribose 5-phosphate aldolase (DERA, EC 4.1.2.4), 

one of the class I aldolases, constitutes the only member 

of the acetaldehyde-dependent aldolase family and is a 

powerful tool to generate chiral centers in the 

acetaldehyde adducts, which is the unique side chains of 

statins (Jennewein et al., 2006). 

Although, DERAs from many microorganisms such 

*Corresponding author. E-mail: tianxie.hznu@gmail.com. Tel: 

+86-571-28865630. Fax: +86-571-28865630. 

Abbreviations: DERA, 2-Deoxy-D-ribose 5-phosphate 

aldolase; DRP, 2-deoxy-D-ribose- 5-phosphate; ORF, open 

reading frame. 

as Bacillus cereus, E. coli K12, Klebsiella pneumoniae, 

Lactobacillus plantarum, Salmonella typhimurium, 

Streptococcus mutans GS-5, Yersinia sp. EA015, 

Aeropyrum pernix, Pyrobaculum aerophilum and 

Thermotoga maritime, have been studied (Gijsen and 

Wong, 1994; Sgarrella et al., 1992; Horinouchi et al., 

2003; Pricer et al., 1960; Hoffee, 1968; Han et al., 2004; 

Kim et al., 2009; Sakuraba et al., 2003, 2007), it is 

generally limited by the poor resistance to a high 

concentration of aldehydes in industrial applications. 

Recently, enzymes isolated from microorganisms in 

extreme conditions have showed unique features. For 

example, they are extremely thermostable and usually 

resistant to chemical denaturants such as detergents, 

chaotropic agents and organic solvents (Burton et al., 

2002; Cowan, 1997; Egorova and Antranikian, 2005; 

Antranikian et al., 2005; Hao and Berry, 2004). Therefore, 

it’s a practical strategy to obtain new DERAs from 

thermophilic microorganisms for industrial applications. 

The hyperthermophilic A. boonei was isolated in 2006 

from deep-sea vent of the Pacific coast of South America 

(Reysenbach et al., 2006). The whole genome was 

sequenced, annotated and analyzed in 2008 

(Reysenbach and Flores, 2008). In this report, we cloned, 

expressed and characterized the DERA from thermophilic 

A. boonei. Purified recombinant DERA showed thermo-

stability and resistance to a high concentration of acetaldehydes 

which could be further used as the biocatalyst 

for industrial applications. 


The pET-303/CT-His vector was obtained from Novagen (Madison, 

WI, USA). The E. coli strain BL21-CodonPlus (DE3)-RIL was 

purchased from Stratagene (La Jolla, CA). 2-deoxy-D-ribose-5phosphate 

(DRP), triose-phosphate isomerase (TPI) and glycerol-3phosphate 

dehydrogenase (GPD) were purchased from Sigma (St. 

Louis, MO, USA). All other chemicals were of reagent grade. 

Gene cloning and multiple sequence alignment 

The nucleotide sequence encoding DERA from the thermophilic 

microorganism A. boonei was obtained from EMBL Nucleotide 

Sequence Database (http://www.ebi.ac.uk/embl/Access/). The DNA 

encoding full length DERA was synthesized by Sangon (China) and 

abbreviated as DERAAbo. The restriction sites of Xba I and Xho I 

were introduced at the 5' end and 3' end, respectively. 

The conserved residues in DERAAbo was identified by aligning the 

amino acid sequences of DERAs from representative thermophilic 

organisms A. pernix, P. aerophilum and T. maritime with 

CLUSTALX. The accession numbers of the sequences were as 

follows: A. boonei, B5IEU6; A. pernix, Q9Y948; P. aerophilum, 

Q8ZXK7 and T. maritima, Q9X1P5, which were obtained from 

UniProtKB /TrEMBL Database. 

Protein expression, purification and molecular mass 

determination 

The expression vector carrying desired DERA sequence was 

transformed into the E. coli strain BL21-CodonPlus (DE3)-RIL. The 

transformant in culture medium containing 100mg/L ampicillin was 

grown to OD600 = 0.8. Then IPTG was added to the final 

concentration of 1.0 mM. After induction at 37°C for 8.5 h in the 

conical flask, the bacteria were collected and lysed. The 

supernatant was incubated with Ni-NTA agarose (Qiagen, Hilden, 

Germany) for 1 h at 4°C, and the mixture was loaded onto a 

chromatography column. The column was washed with buffer 

containing 100 mM sodium phosphate (pH 7.5), 200 mM sodium 

chloride, and 10 mM imidazole. The His-tag DERA was eluted from 

the column with the same buffer containing 500 mM imidazole. The 

protein was dialyzed overnight against 20 mM sodium phosphate 

(pH 7.5) and concentrated with polyethylene glycol (PEG) 20000, 

then freeze-dried. Enzyme powders were stored at -20°C. The 

results were analyzed by 12% SDS-PAGE and the protein 

concentration was determined by the Bradford method with bovine 

serum albumin as the standard. 

The molecular mass of the purified enzyme was determined by 

analytical gel filtration on a Superdex 200 column (2.6 × 62 cm; 

Amersham Biosciences) and pre-equilibrated with 50mM Tris-HCl 

buffer (pH 8.0) containing 0.2 M NaCl. The molecular mass of 

DERA was compared with the retention time of four standard 

proteins including lysozyme (14 kDa), chymotrypsin (25 kDa), 

maltose binding protein (43 kDa) and bovine serum albumin (68 

kDa). 

Enzyme activity assay 

The DERA cleavage activity was measured by following the 

oxidation of NADH in a coupled assay converting glyceraldehyde-3- 

Yin et al. 16261 

phosphate, one of DRP cleavage products, to glycerol 3-phosphate 

by TPI and GDP. The DRP cleavage reaction was carried out at 

50°C for 5 min and then DERA was removed using a centrifugal 

filter device (Microcon YM-10; Millipore). Reduction was carried out 

at 25°C for 30 min. The reaction mixture in a total volume of 400 µl, 

contained 100 mM sodium acetate buffer (pH 5.5), 0.1 mM NADH, 

0.4 mM DRP, 11 U triose-phosphate isomerase, 4 U glycerol-3phosphate, 

and various concentrations of DERAAbo. The change in 

absorbance of NADH was monitored at 340 nm (ε = 6.22 mM -1 cm - 

1 ). 

The unit (U) activity was defined as the amount of DERA required to 

catalyze the cleavage of 1 μmol of DRP per minute. Kinetic 

properties of DERA were examined in 100 mM sodium acetate 

buffer (pH 5.5). Five concentrations of DRP, ranging from 0.04 to 

0.4 mM were used to determine reaction rates. The apparent 

Michaelis-Menten constant for DRP cleavage reactions was 

determined from the double reciprocal Lineweaver-Burk plots of the 

reaction rate. 

Effects of pH on enzyme activity and stability 

The buffers used to determine the effects of pH were sodium 

acetate (0.1 M, pH 3.0 to 6.0), imidazole-HCl (0.1 M, pH 6.0 to 7.5), 

triethanolamine-HCl (0.1 M, pH 7.5 to 8.5), glycine-NaOH (0.1 M, 

pH 8.5 to 11.0) and Na2HPO3-NaOH (0.1 M, pH 11.0 to 13.0). The 

optimum pH for DERA was determined by analysis of DRP 

cleavage in pH from 4.0 to 10.0. The effect of pH on enzyme 

stability was determined by comparing the relative activity of the 

enzyme (at 0.5 mg/ml) incubated in pH ranging from 2.0 to 13.0 at 

50°C for 30 min. 

Effects of temperature on enzyme activity and stability 

The optimum temperature of DERA was measured using the DRP 

cleavage assay with a slight modification. After the reaction mixture 

containing 100 mM sodium acetate buffer (pH 5.5), 0.4 mM DRP, 

and a known concentration of DERA was incubated in the range of 

30 to 100°C for 1 min, DERA was removed. The reduction reaction 

was then carried out at 25°C for 30 min in the presence of TPI and 

GPD and the decrease of NADH was monitored. To determine the 

effect of temperature on enzyme stability, DERA (0.5 mg/ml) was 

incubated for 10 min at different temperatures, and the residual 

activities were assayed. 

Effects of acetaldehyde on enzyme stability 

To examine the effect of acetaldehyde on enzyme stability, 0.5 

mg/ml DERA in 10 mM Tris-HCl (pH 7.0) containing 50, 150 and 

250 mM acetaldehyde, respectively was incubated at 25°C for 

various intervals. The acetaldehyde was removed from the enzyme 

solution using a centrifugal filter device (Microcon YM-10, Millipore). 

The resulting DERA was diluted to 0.2 mg/ml with 100 mM sodium 

acetate (pH 5.5) and the residual activity was analyzed. 


Cloning, expression and purification 

To over-express the PCR-amplified gene, the vector pET- 

303/CT-His was selected for the correct orientation of the 

oligonucleotide sequence and desired reading frame. The 

constructed plasmid pET-DERAAbo was confirmed by


Figure 1. SDS-PAGE analysis of recombinant DERA from A. boonei. (A) M, molecular weight maker; Lane 1, uninduced crude extract; lane 2, 

induced crude extract; lane 3, purified DERAAbo after Ni-NTA affinity chromatography. (B) Gel filtration analysis of recombinant DERA: molecular 

mass of DERA was compared with the values of retention time of lysozyme (14 kDa), chymotrypsin (25 kDa), maltose binding protein (43 kDa) 

and bovine serum albumin (68 kDa). 

DNA sequencing. Finally, the plasmid was used for the 

transformation of E. coli BL21-CodonPlus (DE3)-RIL. 

The recombinant protein with His-tag was purified to 

homogeneity using a Ni-NTA column. The molecular 

weight of the protein calculated from the deduced amino 

acid sequence was 26.6 kDa. The apparent size of the 

protein was in good agreement with the calculated 

molecular weight (Figure 1A). The native molecular mass 

of the enzyme determined by gel filtration is about 53 kDa 

(Figure 1B), which indicated that the enzyme consists of 

two subunits with identical molecular mass. The DERA 

from E. coli also has a dimer structure (Protein Data Bank 

code 1JCL) composed of two identical subunits, which is 

most common for DERA (Sakuraba et al., 2003). 

Multiple sequence alignment 

The DERAAbo protein was aligned with representative 

DERA proteins of thermophilic microorganisms, including 

A. pernix (Q9Y948), P. aerophilum (Q8ZXK7) and T. 

maritima (Q9X1P5), whose catalytic sites have been 

confirmed. It was found that the residue Lys127 of 

DERAAbo was highly conserved in the DERAs, which was 

essential in forming the Schiff-base with the aldehydic 

substrate. Furthermore, the residues Asp92 and Lys185 

were also highly conserved in DERAs (Figure 2), which 

were known to be important in proton relays (Sakuraba et 

al., 2007). 

Optimum pH and pH stability 

Optimum pH and pH stability of the purified recombinant 

DERAAbo were studied using DRP as a substrate. With 

the standard assay method, the highest activity was 

obtained at pH 7.0 and more than 75% activity remained 

between pH 6.5 and 7.5 (Figure 3A), which is similar with 

DERAs from P. aerophilum and T. maritima. The stability 

of the enzyme after incubation at various pH values is 

shown in Figure 3B. After heating at pH levels ranging 

from 4.0 to 11.0 for 30 min at 50°C, only a few loss of 

activity was found. DERAAbo was extremely stable over a 

wide range of pH levels, which suggested that it will be 

stable in industrial processes under different pH 

conditions. 

Optimum temperature and thermal stability 

The effect of temperature on enzyme activity at pH 7.0 is 

shown in Figure 4. The highest activity was observed at 

80°C. The activity sharply decreased below and above 

80°C. The thermal stability of DERA was determined after 

incubation at different temperatures. After heating at 

80C for 10 min, no loss of activity was observed for 

DERAAbo (Figure 4). Even after incubation at 90°C for 10

Yin et al. 16263 

Figure 2. Amino acid sequence alignment of DERAs from A. boonei (B5IEU6), A. pernix (Q9Y948), P. aerophilum (Q8ZXK7) and T. maritime 

(Q9X1P5). Gaps, indicated by dashes, were introduced into the sequences to maximize homology. Residues important for catalysis as 

discussed in the text are shown in triangles. 

min, the enzyme retained about 60% residual activity. 

These results show that DERAAbo is a remarkably thermal 

stable enzyme. 

Basic kinetic constants for DERAAbo 

Initial rate kinetics for the aldol cleavage reaction with 

DERAAbo was determined with various concentrations of 

DRP by fitting the data to the Michaelis-Menten equation. 

The apparent Km value of the enzyme was 0.12 ± 0.01 

mM, which is lower than that of E. coli DERA (Gijsen and 

Wong, 1994) and higher than those of T. maritima and P. 

aerophilum DERA (Sakuraba et al., 2003, 2007). 

Compared to the mesophilic DERA from Yersinia sp. with 

Km value of 9.1 mM, the reported thermophilic DERAs 

have significantly higher substrate affinity. 

Effects of acetaldehyde on enzyme stability 

DERAAbo retained more than 70% DRP cleavage activity 

after exposure for 4 h to 250 mM acetaldehyde at 25°C, 

and over 80% activity under the condition of 50/150 mM 

acetaldehyde (Figure 5). No further loss of activity was 

observed after 1 h as most of the acetaldehyde was 

converted to lactol. These results indicate that the 

enzyme was resistant to acetaldehyde of high 

concentration and that acetaldehyde could be used to 

obtain the side chain of statine with the enzymes. 

Thermophilic DERAs from P. aerophilum and T. maritime 

also showed a significant resistance to high concentration 

acetaldehyde, retaining high activity after exposure for 

hours to 300 mM acetaldehyde. In contrast, the 

mesophilic counterpart DERA from E. coli is almost 

completely inactivated after exposure to acetaldehyde for 

2 h under the same conditions (Sakuraba et al., 2007). 

The results supported the hypothesis that thermostable 

DERAs are promising candidates for industrial 

applications (Burton et al., 2002; Cowan, 1997; Egorova 

and Antranikian, 2005), as the key issue faced in statin 

synthesis is poor tolerance of DERA toward high 

concentrations of acetaldehyde substrate. 

In conclusion, we reported the cloning, expression and 

characterization of DERA from A. boonei. DERAAbo 

showed broad pH adaptability, remarkable thermostability 

and high stability to high concentrations of acetaldehyde. 

We expect that DERAAbo will be useful in manufacturing 

settings where high concentrations of acetaldehyde are 

necessary. Currently, we are investigating the use of 

DERAAbo in the synthesis of statin side chains and this 

data will be reported in due course. 


The work was supported by Major Science and 

Technology Project of Hangzhou (20092113A03), Normal 

Science Project of Zhejiang Province (2009C31086), 

National Natural Science Foundation of China 

(20906016, 20675022, 30900253, 21006018), Natural 

Science Foundation of Zhejiang Province (Y4080317),


Relative activity(%) 


A 

B 

100 

80 

60 

40 

20 

120 

100 

80 

60 

40 

20 

0 

0 

4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 

Figure 3. Optimum pH and pH stability of A. boonei DERA. (A) The optimum pH was performed at a 

variety of pH levels by determining cleavage of the DRP at 25°C. (B) The enzyme was incubated for 

30 min at 50°C in buffers of various pH levels, after which the remaining activity was assayed. 

pH 

0 2 4 6 8 10 12 14 

pH



100 

80 

60 

40 

20 

0 

30 40 50 60 70 80 90 100 

Temperature( C ) 

Figure 4. Effects of temperature on activity (●) and stability (■) of A. boonei DERA. Effect of 

temperature was determined using imidazole-HCl buffer (0.1 M, pH 7.0). Thermostability was 

determined after incubation for 10 min at the indicated temperatures in imidazole-HCl buffer (0.1 

M, pH 7.0). 

100 

80 

60 

40 

20 

0 

activity(%) 

activity(%) 

0 1 2 3 4 

Time (h) 

Figure 5. Effect of acetaldehyde on enzyme stability. The enzyme was incubated at 25°C in the 

presence of 50 mM(■),150 mM(▲) and 250 mM(●) acetaldehyde, respectively and the DRP 

cleavage activity was assayed at appropriate intervals. 

Yin et al. 16265


and Technology Research and Development Program for 

Institue of Hangzhou (20090331N03, 20101131N03). 

REFERENCES 

Antranikian G, Vorgias CE, Bertoldo C (2005). Extreme environments 

as a resource for microorganisms and novel biocatalysts. Adv. 

Biochem. Eng. Biotechnol. 96: 219-262. 

Burton SG, Cowan DA, Woodley JM (2002). The search for the ideal 

biocatalyst. Nat. Biotechnol. 20: 37-45. 

Cowan DA (1997). Thermophilic proteins: stability and function in 

aqueous and organic solvents. Comp. Biochem. Physiol. A Physiol. 

118: 429-438. 

Egorova K, Antranikian G (2005). Industrial relevance of thermophilic 

Archaea. Curr. Opin. Microbiol. 8: 649-655. 

Gijsen HJM, Wong CH (1994). Unprecedented Asymmetric Aldol 

Reactions with Three Aldehyde Substrates Catalyzed by 2- 

Deoxyribose-5-phosphate Aldolase. J. Am. Chem. Soc. 116: 8422- 

8423. 

Han TK, Zhu Z, Dao ML (2004). Identification, molecular cloning, and 

sequence analysis of a deoxyribose aldolase in Streptococcus 

mutants GS-5. Curr. Microbiol. 48: 230-236. 

Hao J, Berry A (2004). A thermostable variant of fructose bisphosphate 

aldolase constructed by directed evolution also shows increased 

stability in organic solvents. Protein Eng. Des. Sel. 17: 689-697. 

Hoffee PA (1968). 2-deoxyribose-5-phosphate aldolase of Salmonella 

typhimurium: purification and properties. Arch. Biochem. Biophys. 

126: 795-802. 

Horinouchi N, Ogawa J, Sakai T, Kawano T, Matsumoto S, Sasaki M, 

Mikami Y, Shimizu S (2003). Construction of deoxyriboaldolaseoverexpressing 

Escherichia coli and its application to 2-deoxyribose 

5-phosphate synthesis from glucose and acetaldehyde for 2'deoxyribonucleoside 

production. Appl. Environ. Microbiol. 69: 3791- 

3797. 

Jennewein S, Schürmann M, Wolberg M, Hilker I, Luiten R, Wubbolts 

M, Mink D (2006). Directed evolution of an industrial biocatalyst: 2deoxy-D-ribose 

5-phosphate aldolase. Biotechnol. J. 1(5): 537-548. 

Kim YM, Chang YH, Choi NS, Kim YO, Song JJ, Kim JS (2009). 

Cloning, expression, and characterization of a new deoxyribose 5phosphate 

aldolase from Yersinia sp. EA015. Protein Expres. Purif. 

68: 196-200. 

Morse DE, Horecker BL (1968). The mechanism of action of aldolases. 

Adv. Enzymol. Relat. Areas. Mol. Biol. 31: 125-181. 

Pricer WE Jr, Horecker BL (1960). Deoxyribose aldolase from 

Lactobacillus plantarum. J. Biol. Chem. 235: 1292-1298. 

Reysenbach AL, Flores GE (2008). Electron microscopy encounters 

with unusual thermophiles helps direct genomic analysis of 

Aciduliprofundum boonei. Geobiology, 6(3): 331-336. 

Reysenbach AL, Liu Y, Banta AB, Beveridge TJ, Kirshtein JD, Schouten 

S, Tivey MK, Von Damm K, Voytek MA (2006). Isolation of a 

ubiquitous obligate thermoacidophilic archaeon from deep-sea 

hydrothermal vents. Nature, 442: 444-447. 

Rutter WJ (1964). Evolution of aldolase. Fed. Proc. 23: 1248-1257. 

Sakuraba H, Tsuge H, Shimoya I, Kawakami R, Goda S, Kawarabayasi 

Y, Katunuma N, Ago H, Miyano M, Ohshima T (2003). The first crystal 

structure of archaeal aldolase. Unique tetrameric structure of 2deoxy-d-ribose-5-phosphate 

aldolase from the hyperthermophilic 

archaea Aeropyrum pernix. J. Biol. Chem. 278: 10799-10806. 

Sakuraba H, Yoneda K, Yoshihara K, Satoh K, Kawakami R, Uto Y, 

Tsuge H, Takahashi K, Hori H, Ohshima T (2007). Sequential aldol 

condensation catalyzed by hyperthermophilic 2-deoxy-d-ribose-5phosphate 

aldolase. Appl. Environ. Microbiol. 73: 7427-7434. 

Sauve V, Sygusch J (2001). Molecular cloning, expression, purification, 

and characterization of fructose-1, 6-bisphosphate aldolase from 

Thermus aquaticus. Protein Expres. Purif. 21: 293-302. 

Sgarrella F, Del Corso A, Tozzi MG, Camici M (1992). Deoxyribose 5phosphate 

aldolase of Bacillus cereus: purification and properties. 

Biochim. Biophys. Acta. 1118: 130-133. 

Siebers B, Brinkmann H, Dorr C, Tjaden B, Liliei H, Oost JVD, Verhees 

CH (2001). Archaeal fructose-1,6-bisphosphate aldolases constitute 

a new family of archaeal type class I aldolase. J. Biol. Chem. 271: 

28710-28718.



DOI: 10.5897/AJB11.2036 



Isolation and characterization of a bacterial celluloseproducing 

bacterium derived from 

the persimmon vinegar 

Young-Jung Wee 1 *, Soo-Yeon Kim 2 , Soon-Do Yoon 3 and Hwa-Won Ryu 2 * 

1 Department of Food Science and Technology, Yeungnam University, Gyeongsan, Gyeongbuk 712-749, Republic of 

Korea. 

2 School of Biological Sciences and Technology, Chonnam National University, Gwangju 500-757, Republic of Korea. 

3 Faculty of Applied Chemical Engineering, Chonnam National University, Gwangju 500-757, Republic of Korea. 


A novel cellulose-producing organism was isolated from the liquid part of a 3-year ripened persimmon 

vinegar, which belonged to the family of Acetobacteracea based on its morphological and physiological 

characteristics. The phylogenetic position of the isolated strain was most closely related to 

Gluconacetobacter intermedius TF2 T (99.929%), hence, it was specifically named as Gluconacetobacter 

sp. RKY5. Although the traditional bacterial cellulose (BC) production medium (Hestrin and Schramm 

medium) was used, the amount of BC produced under a static culture condition reached 5.0 g L -1 . The 

X-ray diffraction pattern and scanning electron micrograph of the BC produced revealed that it was 

composed of ribbon-shaped fibrils with the network structure and pure cellulose without any other 

impurities. 

Key words: Bacterial cellulose, Gluconacetobacter; 16S rRNA gene sequence analysis, phylogeny, persimmon 

vinegar. 

INTRODUCTION 

Bacterial cellulose (BC) is widely used in the traditional 

dessert ‘nata de coco’, a food product of the Philippines, 

and it was first confirmed as cellulose in 1886 (Keshk et 

al., 2006; Kuga and Brown, 1988). The BC, a biopolymer 

produced by several strains of acetic acid bacteria, has 

same chemical structure compared to plant-derived 

cellulose, which is a homogeneous polymer composed of 

β-1,4-glycosidic linkages between the glucose molecules 

(Ross et al., 1991; Watanabe et al., 1998). Paper and 

textile industries require a significant amount of the plantderived 

cellulose, which leads to a considerable demand 

on wood biomass (Vamdamme et al., 1998). Thus, the 

production of BC could be an interesting substitute for the 

plant-derived cellulose. The BC is distinguished from the 

plant-derived cellulose by its high degree of poly- 

*Corresponding author. E-mail: yjwee@ynu.ac.kr, 

hwryu@chonnamac.kr. Tel: +82-53-810-2951, +82-62-530- 

1842. Fax: +82-53-810-4662. 

merization, high purity, its high water-holding capacity 

and free from lignin and hemicellulose (Yoshinaga et al., 

1997; Shoda and Sugano, 2005; Son et al., 2003). In 

addition, BC has high polymer crystallinity and excellent 

physicochemical characteristics superior to the plantderived 

cellulose (Guhados et al., 2005), which makes 

the BC an ideal material for a wide variety of applications. 

There are many commercial applications of the BC such 

as audio headphone diaphragm, additives for food and 

paper products, and thickener for paint (Huang et al., 

2010; Iguchi et al., 2000; Ross et al., 1991; Vandamme et 

al., 1998; Yamanaka et al., 1989). Presently, the BC finds 

its potential applications in biomedical industries such as 

skin substitute for wound dressing, scaffold material for 

tissue engineering and tissue repair (Christner et al., 

1999; Czaja et al., 2006; Suehiro et al., 2007; Svensson 

et al., 2005). 

The BC was produced traditionally by acetic acid 

bacteria which were classified into four genera based on 

their 16S rRNA gene sequences. The four genera of 

acetic acid bacteria include Acetobacter, Acidomonas,


Gluconobacter, and Gluconacetobacter (Yamada et al., 

1997). Although the taxonomic classification of acetic acid 

bacteria is still a subject of controversy, the species of the 

genus Gluconacetobacter (formerly Acetobacter) is one 

of the most frequently characterized acetic acid bacteria 

for BC production (Yeo et al., 2004). Another minor BC 

producers include the genera Agrobacteria, Rhizobia, 

and Sarcina, but the acetic acid bacteria like the genus 

Gluconacetobacter have been mainly employed for BC 

production as they have superior BC production ability to 

other BC producers (Jung et al., 2005). Recently, the 

mass production of BC by Gluconacetobacter species 

has been extensively studied, but the current production 

cost of the BC remains too high to make it commercially 

available and the production titer of the BC reported so 

far is relatively low (Vandamme et al., 1998). 

The present study shows a novel BC-producing 

bacterium isolated from the Korean traditional persimmon 

vinegar, which has high ability to produce BC. The 

isolated strain was morphologically, physiologically or 

biochemically, and phylogenetically characterized. An 

attempt was also made to elucidate the properties of the 

BC produced by the isolated strain compared to the plantderived 

cellulose. 


Isolation of the bacterial cellulose producer 

The BC-producing bacteria were isolated according to the method 

described by Son et al. (2002). The parts of liquid and solid of the 

Korean traditional persimmon vinegar ripened for 1, 2 and 3 years 

were inoculated into Hestrin and Schramm (HS) medium (pH 6.0) 

which contained 20 g L -1 glucose, 5 g L -1 yeast extract, 5 g L -1 

peptone, 2.7 g L -1 Na2HPO4 and 1.15 g L -1 citric acid monohydrate 

(Hestrin and Schramm, 1954), and they were incubated statically at 

30°C. The culture broth in which a lot of pellicles were formed was 

transferred to the fresh HS medium, and it was incubated at 30°C 

for 1 week. The supernatant of culture broth which formed the 

highest amount of bacterial cellulose was selected. The resultant 

broth was then plated on MRS agar medium containing 10 g L -1 

peptone, 10 g L -1 beef extract, 5 g L -1 yeast extract, 20 g L -1 glucose, 

1 g L -1 polysorbate 80, 5 g L -1 ammonium citrate, 5 g L -1 sodium 

acetate, 0.1 g L -1 MgSO4, 0.1 g L -1 MnSO4, 2 g L -1 K2HPO4 and 20 g 

L -1 agar. Nine colonies were selected and inoculated to the HS 

medium. The most potent bacterial cellulose producer was selected 

and designated RKY5. 

Culture conditions and biochemical characteristics 

The isolated strain RKY5 was kept on 50% (v/v) glycerol at -70°C, 

and 1% of this stock was inoculated into 50 ml HS medium in a 

250-ml Erlenmeyer flask, which was incubated at 30°C and 150 

rpm for 48 h on a rotary shaker (KMC-8480SF; Vision Scientific Co., 

Daejeon, Korea). The culture flask was shaken vigorously to 

release the cells from the cellulose pellicles. The cell suspension 

was then filtered with the 12 layers of sterilized gauge, and 2% (v/v) 

of the filtrate was used as an inoculum for BC production. 

The biochemical characteristics of the isolated strain were 

determined according to the Bergey’s Manual of Systematic 

Bacteriology (De Ley et al., 1984). The ability of oxidation of 

ethanol, acetate, and lactate was investigated. The oxidation of 

ethanol into acetic acid was confirmed by observing the color 

change of Carr medium which was composed of 20 ml L -1 ethanol, 

30 g L -1 yeast extract, 0.022 g L -1 bromocresol green and 20 g L -1 

agar. A medium composed of sodium acetate or sodium lactate (2 g 

L -1 ), peptone (3 g L -1 ), bromothymol blue (0.02 g L -1 ) and agar (20 g 

L -1 ) was utilized to check the oxidation of lactate and acetate, as the 

color of the medium changes from yellow to green when lactate or 

acetate is oxidized. The isolated strain was cultured statically at 

30°C for 5 to 7 days in the GYC agar medium containing 5 g L -1 

glucose, 5 g L -1 yeast extract, 5 g L -1 CaCO3, and then the 

formation of water-soluble brown pigments was investigated. In 

order to evaluate ketogenesis from glycerol, the isolate strain was 

incubated at 30°C for 3 to 5 days in the YEG agar medium which 

contained 10 g L -1 yeast extract, 30 g L -1 glycerol and 20 g L -1 agar. 

The ketogenesis from glycerol can be confirmed by the addition of a 

few drops of Fehling’s solution to the medium, as the color of the 

medium changes to orange. 

PCR amplification and sequencing of 16S rRNA gene 

Two universal oligonucleotide primers, 27f (5’-AGAGTTTGAT 

CMTGGCTCAG-3’) and 1542r (5′-AGAAAGGAGGTGATCCAGCC- 

3′), were used for amplification of the 16S rRNA gene. The PCR 

amplifications were conducted in a reaction mixture containing 0.2 

mM dNTP, 0.4 µM each primer, 5 µl 10× PCR buffer, 1.5 mM MgCl2 

and 1 U Taq DNA polymerase. The amplified gene products were 

purified and subcloned into the plasmid pCR 2.1-TOPO (Invitrogen, 

Life Technologies, CA, USA) transformed into the competent cells, 

DH5α. The colorless transformants with the recombinant plasmids 

were selected using X-gal-containing medium and confirmed by 

their insert size. The restriction pattern of the cloned DNA 

sequencing of both DNA strands of clones was carried out 

according to the dideoxy chain termination method (Sanger et al., 

1977). DNA sequencing was conducted on an ABI PRISM 377 

automatic DNA sequencer (Perkin-Elmer, Boston, MA, USA). 

Phylogenetic analysis 

The 16S rRNA gene sequence of the isolated strain was aligned 

with the 16S rRNA gene sequences of Gluconacetobacter species 

and other related taxa using CLUSTAL X software (ver. 1.8). The 

sequences of the related taxa were obtained from the GeneBank 

database. The nucleotide sequences of the type strains were 

available under their accession numbers. The similarity values of 

the 16S rRNA gene sequences were calculated from the multiple 

alignments. The software package MEGA (ver. 5.0) was used to 

construct phylogenetic tree through the neighbor-joining method. 

The stability of the relationships was assessed by a bootstrap 

analysis of 1,000 data sets. 

Analytical methods 

The cell growth was determined by measuring the optical density at 

660 nm using a UV-1600 spectrophotometer (Shimadzu, Kyoto, 

Japan) after the culture broth was treated with 0.1% (v/v) cellulase 

(Celluclast; Novo Nordisk A/S, Denmark). The samples were 

incubated at 50°C with shaking at 200 rpm for 3 h to hydrolyze the 

BC completely. The dry cell weight (g L -1 ) was then calculated using 

a standard curve of the relationship between the optical density and 

dry cell weight. The gelatinous cellulose pellicle on the surface of 

the static culture was picked up with tweezers. After the BC was 

separated from the culture broth, the pellicles were washed with tap 

water to eliminate the medium components, and treated with 0.3 M 

NaOH at 80°C for 20 min to lyse the cells. The solution was then

Table 1. Isolation of BC producer from the persimmon vinegar. 

Sample (persimmon vinegar) 

Sampling part Ripen year 

Liquid 

Solid 

BC production 

1 +* 

2 ++** 

3 +++*** 

1 + 

2 + 

3 nd**** 

* 0.1 to 0.5 g L -1 ; ** 0.6 to 1.0 g L -1 ; *** 1.1 to 2.5 g L -1 ; **** not detected 

filtered to remove the dissolved materials, and the resultant filter 

cake was repeatedly washed with deionized water until the pH of 

the filtrate became neutral. The purified BC was dried at 80°C until 

a constant weight was obtained. The residual glucose concentration 

was determined quantitatively by the enzymatic reactions of 

glucose oxidase-peroxidase using a glucose reagent kit (Asan 

Pharmaceutical, Seoul, Korea). All analyses were carried out in 

triplicate and the mean values were presented. 

Furthermore, x-ray diffractograms were recorded using an X’Pert 

Pro multi-purpose X-ray diffractometer at 30 V and 25 mA to 

facilitate an indirect comparison of the BC with filter paper 

(Advantec, Dublin, CA, USA) as commercial plant-derived cellulose. 

Scans were performed over the 5-40° (2 ) range using step 0.1° in 

width. The samples were fixed with 2% (w/v) glutaraldehyde and 

0.5% (w/v) osmium tetroxide, which were dehydrated in a graded 

ethanol and then critical point-dried. The samples were coated with 

gold (JFC-1100, Jeol, Tokyo, Japan), which were then observed 

using a scanning electron microscope (JSM-5400, Jeol) at 20 kV. 

The morphological properties of the isolated strain were examined 

according to the Bergey’s Manual of Systematic Bacteriology (De 

Ley et al., 1984). 


Isolation of a bacterial cellulose producer from the 

persimmon vinegar 

The samples were picked from the liquid and solid parts 

of persimmon vinegar which was ripened for 1, 2 and 3 

years (Table 1). The BC pellicles were observed from five 

samples except 3-year ripened solid part of the 

persimmon vinegar. Nine colonies were obtained from the 

3-year ripened liquid part which resulted in the most 

thickness BC pellicle. The abundance of BC pellicle in the 

liquid part might be observed because the oxygen uptake 

rate in the liquid part of the persimmon vinegar should be 

more favorable than the solid part. Those isolates were 

examined for BC production using the HS medium, and 

the strain RKY5 was used in the subsequent studies as it 

showed the best BC productivity. 

Morphological and physiological characteristics of 

the isolated strain 

The isolated strain RKY5 was found to be Gram- 

Wee et al. 16269 

negative, non-spore forming and non-motile. The cells 

had rod shape measuring 0.6 to 0.8 × 1.0 to 2.0 µm and 

occurred singly, in pairs or in chains (Table 2). The 

colonies of the strain RKY5 cultured on GYC agar were 

pale white, smooth to rough, opaque and approximately 2 

to 3 mm in diameter. 

The isolated strain RKY5 was biochemically identified 

using an API 20E system (bioMérieux, France) according 

to the manufacturer’s instructions. The biochemical 

properties of the isolated strain RKY5 and the control 

strain Acetobacter xylinum are shown in Table 2. The 

strain RKY5 oxidized acetate and lactate into CO2 and 

H2O, but the oxidase test was negative. The strain RKY5 

exhibited positive reaction for catalase test and the 

formation of cellulose, but a negative reaction for the 

formation of brown pigment. It produced acid from the 

substrates such as glucose, mannitol, sucrose, 

amygdalin, and arabinose. A negative reaction was 

recorded for urease, indole, ONPG, gelatin liquefaction, 

H2S, lysine decarboxylase, arginine dehydrolase, acetoin 

production, and citrate utilization. A positive reaction was 

observed for over-oxidation of ethanol and ketogenesis 

from glycerol. Most biochemical tests showed similar 

results as in the control strain according to the Bergey’s 

Manual of Systematic Bacteriology (De Ley et al., 1984), 

which suggested that the isolated strain RKY5 should be 

classified into the group of acetic acid bacteria, 

Acetobacteracea. 

Phylogenetic analysis 

The 16S rRNA gene sequences of 1,406 nucleotides 

were determined for the isolated strain RKY5, which was 

deposited to GenBank as an accession number of 

HQ848659. The sequence was compared with several 

related taxa in the NCBI database, and the similarity 

index compared with the related taxa is shown in Table 3. 

G. intermedius TF2 T and G. oboediens DSM 11826 T 

showed the highest similarity (99.929 and 99.858%, 

respectively) to the isolated strain RKY5. Figure 1 shows 

the phylogenetic tree derived from the 16S rRNA gene 

sequences of 29 type-strains, which revealed that the


Table 2. Morphological and physiological characteristics of the isolated strain. 

Characteristic Acetobacter xylinum* 

Isolated strain 

Cell size (µm) 0.6 - 0.8 × 1.0 - 3.0 0.6 - 0.8 × 1.0 - 2.0 

Cell shape Ellipsoidal to rod Rod 

Arrangement of cells Singly, in pairs, in chains Singly, in pairs, in chains 

Motility -** - 

Gram staining - or variable - 

Catalase +*** + 

Urease - - 

Cytochrome oxidase - - 

ONPG ( -galactosidase) - - 

Gelatin liquefaction - - 

Arginine dehydrolase - - 

Lysine decarboxylase - - 

Indole production - - 

H2S production - - 

Acetoin production - - 

Citrate utilization - - 

Oxidation of: 

glucose + + 

mannitol + + 

inositol - - 

sorbitol - - 

rhamnose - - 

sucrose + + 

melibiose - - 

amygdalin + + 

arabinose + + 

Ketogenesis from glycerol + + 

Formation of cellulose + + 

Formation of brown pigment - - 

Overoxidation of ethanol + + 

Oxidation of: 

lactate + + 

acetate + + 

*Bergey’s Manual of Determinative Bacteriology (De Ley et al., 1984); ** negative; *** positive. 

strain RKY5 was a member of the genus 

Gluconacetobacter and most closely related to G. 

intermedius TF2 T and G. oboediens DSM 11826 T . As in 

the physiological characteristics, it was clear that the 

strain RKY5 was a member of the family 

Acetobacteracea and the genus Gluconacetobacter. 

Consequently, the isolated strain RKY5 was named as 

Gluconacetobacter sp. RKY5 for further studies, which 

was deposited to the Korean Collection for Type Cultures 

as KCTC 10683BP. 

Bacterial cellulose production by Gluconacetobacter 

sp. RKY5 

The production of BC by Gluconacetobacter sp. RKY5 

using the HS medium was carried out in a static culture 

condition and the result is presented in Figure 2. The

Table 3. Similarity analysis of the isolated strain compared with the related taxa. 


Strain Accession number Similarity (%) nt differences /compared 

Gluconacetobacter intermedius TF2 T Y14694 99.929 1/1406 

Gluconacetobacter oboediens DSM 11826 T AB205221 99.858 2/1406 

Gluconacetobacter swingsii DST GL01 T AY180960 99.573 6/1406 

Gluconacetobacter europaeus DSM 6160 T Z21936 99.573 6/1406 

Gluconacetobacter nataicola LMG 1536 T AB166743 99.573 6/1406 

Gluconacetobacter sucrofermentans LMG 18788 T AJ007698 99.502 7/1406 

Gluconacetobacter rhaeticus DST GL02 T AY180961 99.468 7/1316 

Gluconacetobacter xylinus NCIB 11664 T X75619 99.289 10/1406 

Gluconacetobacter saccharivorans LMG 1582 T AB166740 98.908 15/1374 

Gluconacetobacter entanii LTH4560 T AJ251110 98.649 19/1406 

Gluconacetobacter hansenii NCIMB 8746 T X75620 98.435 22/1406 

Gluconacetobacter liquefaciens IFO 12388 T X75617 97.013 42/1406 

Gluconacetobacter sacchari SRI 1794 T AF127407 96.864 44/1403 

Gluconacetobacter johannae CFN-Cf55 T AF111841 96.797 45/1405 

Gluconacetobacter azotocaptans CFN-Ca54 T AF192761 96.728 46/1406 

Ameyamaea chiangmaiensis AC04 T AB303366 96.515 49/1406 

Asaia spathodeae GB23-2 T AB511277 96.515 49/1406 

Asaia bogorensis 71 T AB025928 96.515 49/1406 

Tanticharoenia sakaeratensis NBRC 103193 T AB304087 96.444 50/1406 

Asaia siamensis S60-1 T AB035416 96.444 50/1406 

Asaia krungthepensis AA08 T AB102953 96.370 51/1405 

Swaminathania salitolerans PA51 T AF459454 96.296 52/1404 

Asaia lannensis BCC 15733 T AB286050 96.230 53/1406 

Acetobacter lovaniensis LMG 1617 T AJ419837 96.157 54/1405 

Acetobacter fabarum 985 T AM905849 96.157 54/1405 

Acetobacter estunensis LMG 1626 T AJ419838 96.085 55/1405 

Acetobacter syzygii 9H-2 T AB052712 96.014 56/1405 

Acetobacter ghanensis 430A T EF030713 96.014 56/1405 

Acidomonas methanolica LMG 1668 T X77468 95.590 62/1406 

T Type strain. 

stationary phase was observed after 5 days of cultivation 

and the dry cell weight reached a maximum value of 4.2 

g L -1 . The amount of BC produced increased with the cell 

growth, which suggested that the BC produced by 

Gluconacetobacter sp. RKY5 is a growth-associated 

product. The maximum amount of BC was 5.0 g L -1 after 

6 days of cultivation. As shown in Table 4, the amount of 

BC produced by Gluconacetobacter sp. RKY5 was 

relatively high when compared to that of the relevant 

studies (Hungund and Gupta, 2010a, b; Mikkelsen et al., 

2009; Park et al., 2003; Son et al., 2003; Zhou et al., 

2007). 

The glucose concentration in the HS medium sharply 

decreased for 6 days of cultivation, and then the cell 

growth became constant after 5 days of cultivation when 

most glucose was consumed. During the BC production, 

the pH of the HS medium decreased from 6.0 to 4.0, and 

then increased to 4.5 after 5 days of cultivation (data not 

shown). A similar result was reported in literatures, in 

which the decrease in medium pH could be elucidated 

based on glucose metabolism where some glucose was 

converted into gluconic acid by membrane-bound glucose 

dehydrogenase from the cells. The resultant 

gluconic acid lowers the medium pH (Krystynowicz et al., 

2002; Vandamme et al., 1998). At the end of BC 

production, the consumption of gluconic acid by the cells 

may increase the medium pH. 

The BC film produced by acetic acid bacteria in a static


Figure 1. Neighbor-joining phylogenetic tree deduced from the 16S rRNA gene sequences representing the position of the 

isolated strain and other related taxa. Numbers at nodes are percentage bootstrap values based on 1,000 replications. 

GeneBank accession numbers of the sequences are indicated in the parentheses. Bar indicates 5 nt substitution per 1,000 nt.

(g L -1 ) 

(day) 


Figure 2. Time course of BC production by the isolated Gluconacetobacter sp. RKY5 under a static culture condition 

at 30°C in 250 ml Erlenmeyer flask containing 50 ml of HS medium. 

Table 4. Comparison of BC production in the literatures cited. 

Microorganism Culture type Culture time BC yield (g L -1 ) Reference 

Gluconacetobacter sp. RKY5 Static 6 days 5.0 This work 

Enterobacter amnigenus GH-1 Static 14 days 4.1 Hungund and Gupta, 2010a 

Gluconacetobacter xylinus (NCIM 2526) Static 14 days 3.0 Hungund and Gupta, 2010b 

Gluconacetobacter xylinus (ATCC 53524) Static 4 days 3.8 Mikkelsen et al., 2009 

Gluconacetobacter hasenii PJK Static 2 days 0.4 Park et al., 2003 

Acetobacter sp. V6 Agitated 8 days 3.7 Son et al., 2003 

Acetobacter xylinum NUST4.1 Agitated 5 days 3.7 Zhou et al., 2007 

culture condition is typically located on the liquid surface, 

and its thickness grows with the cultivation time (Borzani 

and de Souza, 1995). The BC pellicle produced by 

Gluconacetobacter sp. RKY5 was similarly located on the 

surface of the culture broth, which became thicker with 

the elapsed culture time. A structure of BC can be 

represented as an ultrafine net built of entangled 

cellulose ribbons (Krystynowicz et al., 2002). Figure 3a 

shows the SEM photograph of the BC produced under a 

static culture condition. When compared with the 

structure of plant-derived cellulose, as shown in Figure 

3b, the BC had the network structure of ribbon-shaped 

fibrils, which is a critical factor that determines the unique 

properties of reticulated BC (Krystynowicz et al., 2002). 

The x-ray diffractogram of the BC produced by 

Gluconacetobacter sp. RKY5 revealed a typical cellulose 

pattern (Figure 4). Also, the X-ray diffractograms of the 

BC sample and filter paper demonstrate three characteristic 

peaks, and the X-ray diffractogram of the BC 

sample was quite similar to that of the filter paper made 

of highly-purified cellulose. Thus, the aforementioned 

SEM and X-ray diffraction pattern suggested that the BC 

produced by Gluconacetobacter sp. RKY5 should be 

pure cellulose and free of any other impurities. 

Conclusion 

A novel BC producer was isolated from the persimmon 

vinegar, and it was characterized on the basis of the 

(g L -1 )


Figure 3. Scanning electron micrograph of (a) BC produced by Gluconacetobacter sp. RKY5 

and (b) filter paper. The elliptical mass shown in (a) is the cells of Gluconacetobacter sp. RKY5 

embedded in the BC. 

morphological, biochemical, and genetic identifications. 

The isolated strain belonged to Acetobacteracea, and it 

was closely related to the genus Gluconacetobacter. 

Thus, this isolated strain was named as 

Gluconacetobacter sp. RKY5. The BC production by 

Gluconacetobacter sp. RKY5 exhibited a growthassociated 

pattern. The BC produced also had the 

distinguished network structure of ribbon-shaped fibrils 

like the structure of the BC produced by other microbial 

sources, and it was composed of pure cellulose without

Figure 4. X-Ray diffraction patterns obtained from filter paper and BC produced by Gluconacetobacter sp. RKY5. 

any other impurities. It is expected that 

Gluconacetobacter sp. RKY5 can be used in a variety of 

industrial applications related to the BC production. 


This research was supported by the Yeungnam University 

research grants in 2009. 

REFERENCES 

Borzani W, de Souza SJ (1995). Mechanism of the film thickness 

increasing during the bacterial production of cellulose on non-agitated 

liquid media. Biotechnol. Lett. 17: 1271-1272. 

Christner C, Wyrwa R, Marsch S, Kullertz G, Thiericke R, Grabley S, 

Schumann D, Fischer G (1999). Synthesis and cytotoxic evaluation of 

cycloheximide derivatives as potential inhibitors of FKBDP12 with 

neuroregenerative properties. J. Med. Chem. 42: 3615-3622. 

Czaja W, Krystynowicz A, Bielecki S, Brown RM (2006). Microbial 

cellulose–the natural power to heal wounds. Biomaterials, 27: 145- 

151. 

De Ley J, Gillis M, Swings J (1984). Family VI. Acetobacteraceae, in 

Bergey’s Manual of Systematic Bacteriology, ed by Krieg NR and Holt 

JG. Williams Wilkins, Baltimore, USA. 

Guhados G, Wan WK, Hutter JL (2005). Measurement of the elastic 

modulus of single bacterial cellulose fibers using atomic force 

microscopy. Lanmuir, 21: 6642–6646. 

Hestrin B, Schramm M (1954). Synthesis of cellulose by Acetobacter 

xylinum. 2. Preparation of freeze-dried cells capable of polymerizing 


glucose to cellulose. Biochem. J. 58: 345-352. 

Huang HC, Chen LC, Lin SB, Hsu CP, Chen HH (2010). In situ 

modification of bacterial cellulose network structure by adding 

interfering substances during fermentation. Bioresour. Technol. 101: 

6084-6091. 

Hungund BS, Gupta SG (2010a). Production of bacterial cellulose from 

Enterobacter amnigenus GH-1 isolated from rotten apple. World J. 

Microbiol. Biotechnol. 26: 1823-1828. 

Hungund BS, Gupta SG (2010b). Strain improvement of 

Gluconacetobacter xylinus NCIM 2526 for bacterial cellulose 

production. Afr. J. Biotechnol. 9: 5170-5172. 

Iguchi M, Yamanaka S, Budhiono A (2000). Bacterial cellulose–a 

masterpiece of nature. J. Mater. Sci. 35: 261-270. 

Jung JY, Park JK, Chang HN (2005). Bacterial cellulose production by 

Gluconacetobacter hansenii in an agitated culture without living noncellulose 

producing cells. Enzyme Microb. Technol. 37: 347-354. 

Keshk SMAS, Razek TMA, Sameshima K (2006). Bacterial cellulose 

production from beet molasses. Afr. J. Biotechnol. 5: 1519-1523. 

Krystynowicz A, Czaja W, Wiktorowska-Jezierska A, Gonçalves- 

Miśkiewicz M, Turkiewicz M, Bielecki S (2002). Factors affecting the 

yield and properties of bacterial cellulose. J. Ind. Microbiol. 


Kuga S, Brown RM (1988). Silver labeling of the reducing ends of 

bacterial cellulose. Carbohydr. Res. 180: 345-350. 

Mikkelsen D, Flanagan BM, Dykes GA, Gidley MJ (2009). Influence of 

different carbon sources on bacterial cellulose production by 

Gluconacetobacter xylinus strain ATCC 53524. J. Appl. Microbiol. 

107: 576–583. 

Park JK, Park YH, Jung JY (2003). Production of bacterial cellulose by 

Gluconacetobacter hansenii PJK isolated from rotten apple. 

Biotechnol. Bioprocess Eng. 8: 83-88. 

Ross P, Mayer R, Benzimann M (1991). Cellulose biosynthesis and 

function in bacteria. Microbiol. Rev. 55: 35-59. 

Sanger F, Nicklen S, Coulson AR (1977). DNA sequencing with chain


terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. 

Shoda M, Sugano Y (2005). Recent advances in bacterial cellulose 

production. Biotechnol. Bioprocess Eng. 10: 1-8. 

Son C, Chung S, Lee J, Kim S (2002). Isolation and cultivation 

characteristics of Acetobacter xylinum KJ-1 producing bacterial 

cellulose in shaking culture. J. Microbiol. Biotechnol. 12: 722-728. 

Son HJ, Kim HG, Kim KK, Kim HS, Kim YG, Lee SJ (2003). Increased 

production of bacterial cellulose by Acetobacter sp. V6 in synthetic 

media under shaking culture conditions. Bioresour. Technol. 86: 215- 

219. 

Suehiro A, Kanemaru S, Umeda H, Amano Y, Omori K, Ito J (2007). 

Bacterial cellulose: a new biomaterial for mucosal regeneration of 

trachea. Tissue Eng. 13: 1642. 

Svensson A, Nicklasson E, Harrah T, Panilaitis B, Kaplan DL, Brittberg 

M, Gatenholm P (2005). Bacterial cellulose as a potential scaffold for 

tissue engineering of cartilage. Biomaterials 26: 419-431. 

Vandamme EJ, De Baets S, Vanbaelen A, Joris K, De Wulf D (1998). 

Improved production of bacterial cellulose and its application 

potential. Poly. Degrad. Stab. 59: 93-99. 

Watanabe K, Tabuchi M, Morinaga Y, Yoshinaga F (1998). Structural 

features and properties of bacterial cellulose produced in agitated 

culture. Cellulose 5: 187–200. 

Yamada Y, Hoshino K, Ishikawa T (1997). The phylogeny of acetic acid 

bacteria based on the partial sequences of 16S ribosomal RNA: the 

elevation of the subgenus Gluconacetobacter to the genetic level. 

Biosci. Biotechnol. Biochem. 61: 1244-1251. 

Yamanaka S, Watanabe K, Kitamura M, Iguchi M, Mitsuhashi S, Nishi Y, 

Uryr M (1989). The structure and mechanical properties of sheets 

prepared from bacterial cellulose. J. Mater. Sci. 24: 3141-3145. 

Yeo SH, Lee OS, Lee IS, Kim HS, Yu TS, Jeong YJ (2004). 

Gluconacetobacter persimmonis sp. nov., isolated from Korean 

traditional persimmon vinegar. J. Microbiol. Biotechnol. 14: 276-283. 

Yoshinaga F, Tonouchi N, Watanabe K (1997). Research progress in 

production of bacterial cellulose by aeration and agitation culture and 

its application as a new industrial material. Biosci. Biotechnol. 

Biochem. 61: 219-224. 

Zhou LL, Sun DP, Hu LY, Li YW, Yang JZ (2007). Effect of addition of 

sodium alginate on bacterial cellulose production by Acetobacter 

xylinum. J. Ind. Microbiol. Biotechnol. 34: 483-489.



DOI: 10.5897/AJB11.155 



Purification and characterization of an endo-1,4-βglucanase 

from Bacillus cereus 

Hong Yan 1 *, Yingjie Dai 2 *, Ying Zhang 2 , Lilong Yan 2 and Dan Liu 3 

1 College of Chemical and Environmental Engineering, Harbin University of Science and Technology; Key Laboratory 

of Green Chemical Technology of College of Heilongjiang Province, Harbin, 150080, People’s Republic of China. 

2 School of Resources Environment, Northeast Agricultural University, Harbin 150030, People’s Republic of China. 

3 Department of Life Science and Engineering, Harbin Institute of Technology, Harbin, 150001, People’s Republic of 

China. 

Accepted 24 June, 2011 

A cellulase produced by Bacillus cereus (B. cereus), isolated from the local soil, was purified to 

homogeneity from culture broth. The enzyme had a molecular mass of 51.3 kDa. The optimal cellulase 

activity was at pH 8 and at the temperature of 55°C. The enzyme was stable at 50°C in the pH range of 5 

to 9. The enzyme was stable up to 55°C above which stability decreased rapidly after incubation for 1 h. 

The enzyme showed the highest activity with carboxymethyl cellulose. Slight activity was also observed 

towards cellulose in the filter paper and xylan. For carboxymethyl cellulose, the cellulase had a Km of 

2.12 mg/ml and Vmax of 5.37 μg/ml·min. The activity of the enzyme was not influenced by Fe 2+ , Zn 2+ , urea, 

EDTA, Ca 2+ , Co 2+ , K + and Na + , but it was increased by 13% in the presence of Mn 2+ . Ba 2+ 2- 2+ 

, C2O4 , Mg and 

Cu 2+ caused a loss in the enzyme activity. The FT-IR spectrum of this carboxymethyl cellulase (CMCase) 

showed the characteristic cellulase peaks. Infrared spectrum of the amide I and II bands of the CMCase 

showed that secondary structure of the CMCase mainly consists of α-helix structures in solid phase. 

This enzyme (the cellulase produced by B. cereus) is of high value in the industry applications (such as 

laundry) in the future. 

Key words: Cellulase, Bacillus cereus, purification, characterization. 

INTRODUCTION 

Cellulose, an abundant and renewable energy resource, 

can be converted into useful products such as soluble 

sugars, alcohols and other industrially important chemicals 

by enzymatic degradation (Ryu and Mandels, 1980; 

Mandels, 1985). Cellulolytic microorganisms are found 

among extremely variegated taxonomic groups. Most 

belong to eubacteria and fungi, such as aerobic and 

anaerobic bacteria (Gilkes et al., 1991), white rot fungi 

(Uzcategui et al., 1991), soft rot fungi (Wood et al.,1988) 

and anaerobic fungi (Barichievic and Calza, 1990), 

however, anaerobic, cellulose-degrading protozoa have 

also been identified in the rumen (Coleman, 1978). 

*Corresponding author. E-mail: dai5188@hotmail.com. 

Tel/Fax: +86 451 5519 1170. 

#Both authors contributed equally to the work. 

Microorganisms capable of hydrolyzing this biopolymer 

secrete cellulase, include three types of enzymes, 

namely endo-1,4-β-D-glucanase [(1, 4)-β-D-glucan glucanohydrolase, 

EC3.2.1.4], exo-1,4-β-D-glucanase [(1, 4)β-D-glucan 

cellobiohydrolase, EC3.2.1.91] and βglucosidase 

[β-D-glucoside glucohydrolase, EC3.2.1.21] 

(Wood, 1985). 

Cellulases have attracted much attention because of 

their diverse practical applications and the need to 

understand the mechanisms of their hydrolysis of plant 

carbohydrate polymers (Bhat and Bhat, 1997). The major 

industrial applications of cellulases are in the textile 

industry for “bio-polishing” of fabrics and producing 

stonewashed look of denims, as well as in household 

laundry detergents for improving fabric softness and 

brightness (Cavaco-Paulo, 1998). Besides, they are used 

in animal feeds for improving the nutritional quality and 

digestibility, in the processing of fruit juices and in baking. 

De-inking of paper is yet another emerging application


(Tolan and Foody, 1999). An area where cellulases would 

have a central role is the bioconversion of renewable 

cellulosic biomass to commodity chemicals (Gilbert and 

Hazlewood, 1993; Lark et al., 1997; Gong et al., 1997; 

Gong et al., 1999; Himmel et al., 1999). The cellulases 

that are used for these industrial applications are 

generally from fungal sources (Tolan and Foody, 1999). 

Historically, Bacillus species are a rich source of 

industrial enzymes (Horikoshi and Alkaliphiles, 1999; 

Priest, 1977), but the study of Bacillus cellulase has, until 

recently, lagged behind that of fungal enzymes. This is 

largely due to the fact that most Bacillus cellulase 

hydrolyzes synthetic carboxymethyl cellulose (CMC), but 

barely hydrolyzes the crystalline form of cellulose. These 

Bacillus cellulases also include the alkaline cellulases, 

which has the potential to be used as laundry detergent 

additives. 

The main purpose of this study was to investigate the 

purification procedures and the properties of the cellulase 

produced by Bacillus cereus. The biochemical properties 

of the purified enzyme and its application in the industry 

for the cellulase produced by B. cereus were studied. 


Xylan (from beechwood), p-nitrophenyl-β-D-cellobioside (pNPC), pnitrophenyl-β-D-galactopyranoside 

(pNPG) and mannosan were 

purchased from Sigma (St. Louis, MO, USA). Filter paper was from 

Whatman (Kent, UK). Sephadex G-75 and protein MW marker was 

purchased from Pharmacia (Now Pfizer, NY, USA). D(-)-salicin was 

obtained from Aldrich (Milwaukee, MI, USA). Other chemicals used 

were of the purest grade commercially available. 

Microorganisms and culture conditions 

B. cereus was isolated from the local soil by the laboratory of Green 

Chemical Technology of College of Heilongjiang Province. The 

minimal medium contained (per liter): Na2HPO4 3.0 g, MgSO4·7H2O 

0.5 g, CaCl2 0.5 g, MnSO4·H2O 2.5 mg, ZnSO4 2.0 mg, CoCl2 3.0 

mg and FeSO4·7H2O 7.5 mg. Wheat bran (30 g/l) and bean cake 

(10 g/l) were add to supplement the minimal medium as the carbon 

source and nitrogen source for maximum cellulase production (unpublished 

data). The bacterium was grown in a 19 L stirred 

bioreactor (working volume was 10 L) at 30°C and pH 5 for 60 h. 

Oxygen concentration was kept at a minimum of 50% saturation by 

varying the agitation speed. 

Enzyme purification 

The culture broth (every time 200 ml) was centrifuged in a J2-21M 

centrifuge (Beckman, Palo Alto, CA) at 3000 rpm for 15 min at 4°C 

for 10 L culture broth. Ammonium sulfate was added to the 

supernatant at 90% saturation and the solution was stirred for 30 

min in an ice bath. The precipitate formed was collected by 

centrifugation (5000 rpm, 15 min) and dissolved in a small amount 

of distilled water. The solution was then dialyzed against the 

distilled water overnight and applied to a Sephadex G-75 column 

(80 × 1.6 cm) that had been pre-equilibrated with 0.02 M sodium 

acetate (NaAc) buffer (pH 4.8). The flow rate was 12 ml/h. The 

fractions showing CMCase activity were pooled and concentrated 

by ultrafiltration through a 10 kDa cut off membrane. This purifica- 

Tion procedure yielded one endoglucanase active fraction and its 

homogeneity was determined by SDS-PAGE and HPLC. 

Enzyme assay 

Endo-β-1,4-glucanase activity was assayed by incubating 1 ml of 

the isolated enzyme (suitably diluted) with 1 ml of 1% (W/V) 

carboxymethyl cellulose in NaAc buffer (0.02 M, pH 4.8) at 50°C for 

30 min (Ghose, 1987). The amount of reducing sugar produced was 

measured by the 3, 5-dinitrosalicylic (DNS) reagent method (Miller, 

1959). 

Hydrolytic activities of the enzyme towards salicin, mannan, 

xylan, p-nitrophenyl-β-D-cellobioside (pNPC) (Desphander, 1984) 

and p-nitrophenyl-β-D-galactopyranoside (pNPG) (Tilbeurog and 

Claeysseus, 1985), were determined by replacing carboxymethyl 

cellulose with 1% (W/V) of the respective substrate in the same 

buffer. 

To determine the enzyme activity towards the cellulose in filter 

paper (FPA), 50 mg Whatman No. 1 filter paper, 1 ml of 0.02 M 

NaAc buffer (pH 4.8) and 1 ml of the enzyme solution (suitably 

diluted) were mixed in a tube, which was incubated for 1 h at 50°C 

by the method of Eriksson et al. (1990). The reducing sugars 

produced during incubation were assayed with the same method as 

described. 

To determine the enzyme activity towards the cellulose in cotton, 

50 mg absorbent cotton, 1 ml of 0.02 M NaAc buffer (pH 4.8) and 1 

ml of the enzyme solution (suitably diluted) were mixed in a tube, 

which was incubated for 24 h at 50°C according to the method of 

Vallander and Eriksson (1985). The reducing sugars produced 

during incubation were assayed with the same method as 

described. 

The cellulase activity towards microcrystalline cellulose was 

assayed by incubating 1 ml of 2% (W/V) microcrystalline cellulose 

diluted in 0.02 M NaAc buffer at pH 4.8 with 1 ml of enzyme solution 

(suitably diluted) at 50°C for 2 h according to the method of 

Coudray et al. (1982). The samples were centrifuged at 5000 rpm 

for 10 min to remove the insoluble substrates. Reducing sugar in 

the supernatant was assayed with the DNS method. 

The protein concentration was examined by the Coomassie 

bright blue procedure (Bradford, 1976) using bovine serum albumin 

as the standard. One unit of enzyme activity is defined as the 

amounts of enzyme that liberated 1 μg of glucose in 1 min at 50°C, 

except for cotton; one unit of enzyme activity is defined as the 

amount of enzyme that liberated 1 μg of glucose in 1 h at 50°C. All 

the activity measurements were performed three times. 

Determination of purity and molecular weight 

The purity and molecular weight of the purified endoglucanase were 

determined by SDS-PAGE and gel filtration chromatography. Purity 

was assessed on an Agilent 1100 HPLC instrument with a multiple 

wavelength detector. Specifically, 5 µl was injected onto a ODS 

column (4.6 × 100 mm) and acetonitrile and water (70/30; V/V) 

were pre-mixed, degassed, filtered and used as the mobile phase 

at a flow rate of 1.0 ml/min. 

Effect of pH and temperature on the activity and stability of 

endoglucanase 

The enzyme activity was measured in the pH range of 3 to 12 with 

CMC as the substrate. The temperature effect was studied between 

35 and 80°C in 0.02 M NaAc buffer, pH 4.8 with CMC as the 

substrate. For stability measurements, the enzyme was incubated 

at different pH or temperature for a period of time before used in the 

activity assay.

Table 1. Summary of the purification steps of endoglucanase from B. cereus. 

Purification step 

Total protein 

(mg) 

Total activity 

(IU/ml) 

Specific activity 

(IU/mg) 

Purification 

fold 

Culture broth 181.73 6357.00 34.98 1.00 100.00 

Precipitation 42.52 3688.68 86.75 2.48 58.03 

SephadexG-75 7.93 1005.24 126.83 3.63 15.81 

66.2 kDa 

45.0 kDa 

35.0 kDa 

25.0 kDa 

Figure 1. SDS-PAGE of purified endoglucanase. 

Lane 1 and 2: purified sample. 

Effects of metals, surfactants and chelating agents 

Metals ions, surfactants and chelating agents (10 mM) were added 

to endoglucanase solutions and the remaining activity was 

measured in 0.02 M NaAc buffer (pH 4.8) at 50°C for 30 min with 

CMC as the substrate. 

FTIR spectrum of the endoglucanase 

Fourier-transform infrared spectra (FT-IR) were obtained with a 

Magna-IR 560 E.S.P spectrometer. The wave number scanning 

range was 4000 and 600 cm -1 . After homogenizing, KBr disks 

containing the freeze-dried enzyme were made for the IR 

measurement. 


Purification of endoglucanase 

Marker 1 2 

After cultivating B. cereus in a medium containing wheat 

bran and bean cake as the respective carbon source and 

nitrogen source for 60 h, the extracellular cellulase (FPA) 

was detected at 16.94 IU/ml in the culture broth. The 

typical purification steps of endoglucanase are 

Yan et al. 16279 

Yield 

(%) 

summarized in Table 1. The crude extract from the culture 

medium underwent one-step purification by gel filtration. 

The purified endoglucanase proteins showed a single 

band on SDS-PAGE and had a molecular mass of 51.3 

kDa (Figure 1), which is higher than that of the previously 

reported endoglucanases (23 to 43 kDa) produced by 

Bacillus sp. (Chan and Au, 1987; Ozaki and Ito, 1991; 

Hakamada et al., 2002; Kim and Pack, 1988), but it is 

lower than that produced by Bacillus pumilus 

(Christakopoulos et al., 1999). The purity of the purified 

enzyme was determined to be 92.83% by HPLC (Figure 

2). About 15.81% of the enzyme activity, with an overall 

purification of 3.63 fold, was recovered (Table 1). 

Substrate specificity 

The enzyme was active towards the hydrolysis of CMC, 

but not active in the hydrolysis of microcrystalline 

cellulose, cotton cellulose, mannan, pNPC and pNPG 

(Table 2). Using CMC as the substrate at concentrations 

of 2 to 10 mg/ml, Km and Vmax of the enzyme were 

determined through the Lineweaver-Burk double 

reciprocal plot of the initial reaction rates at different 

substrate concentrations. The cellulase from B. cereus 

exhibited a Km of 2.12 mg/ml for CMC at pH 4.8 and 

50°C. This value (2.12 mg/ml) is significantly higher than 

those reported earlier for other Bacillus endoglucanases 

(0.59 to 1.60 mg/ml) (Paul et al., 1999; Kim and Pack, 

1988; Sharma et al., 1990). The Vmax of the reaction was 

5.37 μg/ml·min. 

The purified enzyme exhibited low levels of activity 

towards filter paper and xylan, indicating that the enzyme 

has weak activity in the hydrolysis of crystalline cellulose 

and hemicellulose. The substrate specificities of various 

cellulases is important (Crispen et al., 2000), because it 

is now generally accepted that the synergism between 

different enzymes is required to achieve cellulose 

hydrolysis (Wood and Garcia-Campayo, 1990). Enzymes 

with overlapping specificities have been reported (Gilbert 

and Hazlewood, 1993). The ability to degrade crystalline 

cellulose is commonly regarded as the synonymous with 

exoglucanases (Beldman et al., 1985). It has been shown 

that the endoglucanases from Bacillus sp. and fungi 

exhibited filter paper hydrolyzing activity in addition to the 

CMCase activity, because these endoglucanases also 

had exoglucanase activity in the same molecule (Han et 

al., 1995; Kim, 1995). Among the endoglucanases from


Relative activity (%) 

100 

80 

60 

40 

20 

0 

Figure 2. HPLC chromatogram of the purified endoglucanase. 

Table 2. Activity of the cellulase from Bacillus cereus towards various 

substrates. 

Substrate Activity (IU/ml) 

Whatman filter paper 0.13 

Microcrystalline cellulose 0 

Cotton 0 

Xylan 0.05 

Mannosan 0 

Carboxymethyl cellulose 4.38 

p-Nitrophenyl- -D-cellobioside (pNPC) 0 

p-Nitrophenyl- -D-galactopyranoside (pNPG) 0 

Bacilli, such property characteristic has been found in 

endoglucanases with sizes varying from 35 to 82 kDa 

(Beldman et al., 1985; Han et al., 1995). Therefore, it is 

likely that the purified endoglucanase from B. cereus also 

has weak exoglucanase activity. 

Effect of pH on the activity and stability of the 

endoglucanase 

The isolated CMCase exhibited optimal activity in the pH 

range of 7 to 9. The highest activity of the CMCase was 

observed at pH 8 (Figure 3). The enzyme was stable 

2 3 4 5 6 7 8 9 10 11 12 

pH 

between pH 5 and 9 (Figure 4) and retained 83% activity 

at pH 9. The stability over a broad pH range seems to be 

one of the characteristics of many Bacillus endoglucanases 

(Christakopoulos et al., 1999; Crispen et al., 

2000; Hakamada et al., 2002). 

Effect of temperature on the activity and stability of 

endoglucanase 

The activities of the enzyme were determined at different 

temperatures in the range of 35 to 80°C at pH 4.8 by the 

method of Miller (1959). The optimal temperature of the

Relactive activity (%) 

Figure 3. Effect of pH on the activity of purified CMCase. Enzyme was incubated in 0.02 M 

buffer for 30 min at 50°C. The buffers used were citrate (pH 3.0 to 6.0), phosphate (pH 7.0 

to 8.0), borax-NaOH (pH 9.0), NaHCO3-NaOH (pH 10.0) and Na2HPO4-NaOH solution (pH 

11.0 to 12.0). The highest enzyme activity in various pH buffers was taken as 100%. 

Relative activity (%) 

100 

80 

60 

40 

20 

0 

100 

80 

60 

40 

20 

Figure 4. Effect of pH on the stability of purified CMCase. The enzyme was incubated in 0.02 

M buffer for 1 h at 30°C prior to measuring the residual endoglucanase activity under standard 

assay conditions. The buffers used were citrate (pH 3.0 to 6.0), phosphate (pH 7.0 to 8.0), 

borax-NaOH (pH 9.0), NaHCO3-NaOH (pH 10.0) and Na2HPO4-NaOH solution (pH 11.0 to 

12.0). The original activity without incubation in various pH buffers was taken as 100%. 

enzyme was 55°C (Figure 5). The enzyme was stable up 

to 55°C. A rapid decrease in stability was observed above 

55°C after incubation for 1 h (Figure 6) and the enzyme 

was almost completely inactive at 80°C. 

0 

2 3 4 5 6 7 8 9 10 11 12 

pH 

30 35 40 45 50 55 60 65 70 75 80 85 

Temperature (℃) 


Effect of metal ions and other reagents on the 

endoglucanase 

The purified enzyme and 10 mM metal ions and other


%T 

90 

80 

70 

60 

50 

40 

30 

20 

10 

0 

4000 


100 

80 

60 

40 

20 

0 

30 40 50 60 70 80 

Temperature(℃) 

Figure 5. Effect of temperature on the activity of purified CMCase. Enzyme activity was 

determined by incubating the enzyme in NaAc buffer (0.02 M, pH 4.8) containing 1% (W/V) 

carboxymethyl cellulose at respective temperature and assaying the reducing sugars 

released. The 100% enzyme activity was the maximum enzyme activity in NaAc buffer (0.02 

M, pH 4.8) between 35 and 80°C. 

3197 

3000 

Figure 6. Effect of temperature on the stability of purified CMCase. The enzyme was incubated in 0.02 M NaAc buffer (pH 4.8) at 

respective temperature for 30 min, prior to measuring the endoglucanase activity under standard assay conditions. The original 

activity without incubation in 0.02 M NaAc buffer (pH 4.8) at 50°C was taken as 100%. 

2000 

Wavenumber s ( cm- 1) 

1651 

1402 

1111 

1000 

618

Table 3. Effect of metal ions and other reagents on the 

activity of purified CMCase. 

Additive (10 mM) Residual activity (%) 

Original activity 100.00 

Fe 2+ 102.01 

Zn 2+ 100.67 

Urea 97.82 

SDS 94.97 

EDTA 101.84 

Mn 2+ 113.40 

Ba 2+ 60.97 

C2O4 2 - 62.98 

Mg 2+ 81.91 

Ca 2+ 97.82 

Cu 2+ 70.85 

Co 2+ 99.16 

K + 98.49 

Na + 97.82 

reagents were incubated at 50°C for 30 min and the 

residual endoglucanase activity was assayed with 

carboxymethyl cellulose as the substrate. As shown in 

Table 3, incubation with Fe 2+ , Zn 2+ , urea, EDTA, Ca 2+ , 

Co 2+ , K + and Na + did not affect the activity of the 

endoglucanase. Mn 2+ ions (113.40%) caused an increase 

in the activity, while SDS (94.97%) caused a slight 

decrease. However, Ba 2+ (60.94%), C2O4 

2- (62.98%), 

Mg 2+ (81.91%) and Cu 2+ (70.85%) caused significant 

losses in enzyme activity. The response of the activities 

of CH43 and HR68 enzyme to metal ions seemed to 

follow a pattern resembling other Bacillus endoglucanases, 

most metal ions such as K + , Na + , Mg 2+ , Cu 2+ , 

Ca 2+ , Ni 2+ , Zn 2+ and Fe 3+ did not influence the activity 

(Chan and Au, 1987). While Hg 2+ and Mn 2+ caused a 

decrease in the activity (Aa et al., 1994). The significant 

stability of the enzyme in the presence of surfactant 

(SDS) and chelating agent (EDTA) argues well for this 

endoglucanase to be used as an additive in laundry 

detergents. 

FT-IR spectrum of the endoglucanase 

The characteristic region of FT-IR spectrum, namely the 

4000 to 1330 cm -1 region (Figure 7), was analyzed. The 

CMCase showed a group of wide absorption peaks in the 


range of 3600 to 3000 cm -1 , which was attributed to both 

O-H stretching vibration and N-H asymmetric vibration. 

The width of the absorption peak is attributed to hydrogen 

bonding. The presence of this broad peak indicates that 

the CMCase exists as a complex of individual molecules 

associated by hydrogen bonds in the solid phase. The 

absorption peak of the CMCase near 1650 cm -1 

attributed to the amide band I and amide band II in the 

main amide chain, which are mainly caused by both N-H 

bending vibration in plane and C=O symmetric stretching 

vibration. The absorption peak near 1400 cm -1 is amide 

band III, which is attributed to both C-N stretching 

vibration and N-H bending vibration in plane. The FT-IR 

spectrum of CMCase shows characteristic cellulase 

peaks. The FT-IR spectroscopic data of the CMCase also 

showed peaks in the fingerprint region 1330 and 400 cm - 

1 -1 

. The absorption peak near 1100 cm is caused by 

skeleton stretching vibration of C-N of the amino acid 

residues with aliphatic carbon chains and the absorption 

peak near 600 cm -1 

is caused by O=C-N bending 

vibration in plane. Amide band I displayed the 

characteristic α-helix absorption at 1650 to 1660 cm -1 and 

characteristic β-sheet absorption at 1630 to 1640 cm -1 

have been reported (Li et al., 1998); amide band I 

displayed that characteristic α-helix absorption at 1653±4 

cm -1 have been reported (Elliot and Amobrose, 1950). 

The FT-IR spectrum of the CMCase reveals that the 

absorption peak at 1651 cm -1 is the characteristic α-helix 

peak, which is caused by both N-H bending vibration in 

plane and C=O symmetry stretching vibration. We found 

that the characteristic peak of β-sheet was not obvious in 

the IR spectrum of the CMCase. Infrared spectrum of the 

amide I and II bands of CMCase showed that the 

absorption peaks at 1630 to 1640 cm -1 were weak, 

indicating the lack of the characteristic β-sheet structure. 

Therefore, it is likely that secondary structure of the 

CMCase mainly consists of α-helixes in the solid phase 

(Figure 8). 

Conclusions 

The work presented a newly isolated B. cereus. Purification 

and characterization of an endo-1,4-β-glucanase 

from B. cereus were investigated. The optimal cellulase 

activity was at pH 8 and 55°C. The enzyme showed the 

highest activity with carboxymethyl cellulose. Slight 

activity was also observed towards cellulose in the filter 

paper and xylan. The applications of this enzyme in the 

industry (such as laundry) (the cellulase produced by B. 

cereus) are importance in future. 


This study was supported by General Program of 

Educational Commission of Heilongjiang Province of 

China (11531045). 

is


Absor bance 

16 

14 

12 

10 

8 

6 

4 

2 

0 

-2 

-4 

-6 

-8 

- 10 

- 12 

Figure 7. FT-IR spectrum of purified CMCase. 

mAU 

200 

175 

150 

125 

100 

75 

50 

25 

0 

Figure 8. Infrared spectrum showing the amide I and II bands of purified CMCase. 

3000 

0.617 

0.772 1.006 

2000 

Wavenumber s ( cm- 1) 

1. 1. 

0 0.5 1 1926 

1.5 2 2. 

8 8 

5 

1000 

mi

REFERENCES 

Aa K, Flengsrud R, Lindahl V, Tronsmo A (1994). Characterization of 

production and enzyme properties of an endo- β-1,4-glucanase from 

Bacillus Subtilis CK-2 isolated from compost soil. Antonie van 

Leeuwenhoek, 66: 319-326. 

Barichievic EB, Calza RE (1990). Supernatant protein and cellulose 

activities of the anaerobic ruminal fungus Neocallimastix frontalis EB 

188. Appl. Environ. Microbiol. 56: 43-48. 

Beldman G, Searle-van Leeuwen MF, Rombouts FM (1985). The 

cellulase of Trichoderma viride. Purification, characterization and 

comparison of all detectable endoglucanases, exoglucanases and βglucosidases. 

Eur. J. Biochem. 146: 301-308. 

Bhat MK, Bhat S (1997). Cellulose degrading enzymes and their 

potential industrial applications. Biotechnol. Adv. 15: 583-620. 

Bradford MM (1976). A rapid and sensitive method for the determination 

of microgram quantities of protein utilizing the principle of protein-dye 

bingding. Anal. Biochem. 72: 248-254. 

Cavaco-Paulo A (1998). Mechanism of cellulase action in textile 

processes. Carbohydr. Polym. 37: 273-277. 

Chan KY, Au KS (1987). Purification and properties of endo-1,4-βglucanase 

from Bacillus subtilis. J. Gen. Microbiol. 133: 2155-2162. 

Christakopoulos P, Hatzinikolaou DG, Fountoukidis G (1999). 

Purification and mode of action of an alkali-resistant endo-1,4-βglucanase 

from Bacillus pumilus. Arch. Biochem. Biophys., 1: 61-66. 

Coleman GS (1978). The metabolism of cellulose, glucose, and starch 

by the rumen biliate protozoa Eudiplodinium maggii. J. Gen. 

Microbiol. 107: 359-366. 

Coudray MR, Canevascini G, Meier H (1982). Characterization of a 

cellobiose dehydrogenase in the cellulolytic fugus Sporotrichum 

(Chrysosporium) thermophile. Biochem. J. 203: 217-284. 

Crispen M, Rajni HK, Remigio Z (2000). Purification and 

characterization of cellulases produced by two Bacillus strains. J. 


Desphander MV (1984). An assay for selective determination of endo- 

and exdo-β-1,4-glucanase. Anal. Biochem. 138: 481-487. 

Elliot A, Amobrose EJ (1950). Structure of synthetic polypeptides. 

Nature, 165: 921-922. 

Eriksson KEL, Blanchette RA, Ander P (1990). Microbial and Enzymatic 

degradation of wood and wood components. Springer-verlag. Berlin 

Heidelberg, p. 407. 

Ghose TK (1987). Measurement of cellulase activities. Pure Appl. 

Chem. 59: 257-268. 

Gilbert HJ, Hazlewood GP (1993). Bacterial cellulases and xylanases. J. 

Gen. Microbiol. 139: 187-194 

Gilkes NR, Kilburn DG, Miller Jr. RC (1991). Bacterial cellulases. 

Bioresour. Technol. 36: 21-35. 

Gong CS, Cao NJ, Tsao GT (1997). Biological production of 2,3butanediol 

from renewable biomass. Fuel chem. Biomass, 666: 280- 

293. 

Gong CS, Cao NJ, Tsao GT (1999). Ethanol production from renewable 

resources. Adv. Biochem. Eng. Biot. 65: 207-241. 

Hakamada Y, Endo K, Takizawa S (2002). Enzyme properties, 

crystallization, and deduced amino acid sequence of an alkaline 

endoglucanase from Bacillus circulans. Biochimica et Biophysica 

Acta (BBA) - General Subjects, 1570: 174-180. 

Han SJ, Yoo YJ, Kang HS (1995). Characterization of a bifunctional 

cellulase and its structural gene. J. Biol. Chem. 270: 26012-26019. 


Himmel ME, Ruth MF, Wyman CE (1999). Cellulase for commodity 

products from cellulosic biomass. Curr. Opin. Biotech. 10: 358-364. 

Horikoshi K, Alkaliphiles J (1999). Some applications of their products 

for biotechnology. Microb. Mol. Boil .R. 63: 735-750. 

Kim CH (1995). Characterization and substrate specificity of an endo-β- 

1,4-D-glucanase I (Avicelase I) from an extracellular multienzyme 

complex of Bacillus circulans. Appl. Environ. Microbiol. 61: 959-965. 

Kim H, Pack MY (1988). Endo-β-1,4-glucanase encoded by Bacillus 

subtilis gene cloned in Bacillus megaterium. Enzyme Microb. Tech. 

10: 347-351. 

Lark N, Xia YK, Qin CG (1997). Production of ethanol from recycled 

paper sludge using cellulase and yeast, Kluveromyces marxianus. 

Biomass Bioenerg. 12: 135-143. 

Li X, Lin W, Gao P (1998). Endoglucanase S, a novel endocellulase 

exhibiting exocellulase activity from a newly isolated Streptomyces 

sp. LX. J. Appl. Microbiol. 85: 347-356. 

Mandels M (1985). Application of cellulases. Biochem. Soc. 13: 414- 

416. 

Miller GL (1959). Use of the dinitrosalicylic acid reagent for the 

determination of reducing sugars. Anal. Chem. 31: 426-428. 

Ozaki K, Ito S (1991). Purification and properties of an acid endo-β-1,4glucanase 

from Bacillus sp. KSM-330. J. Gen. Microbiol. 137: 41-48. 

Paul C, Dimitris GH, George F (1999). Purification and mode of action 

of an alkali-resistant endo-1,4-β-glucanase from Bacillus pumilus. 

Arch. Biochem. Biophy. 364: 61-66. 

Priest FG (1977). Extracellular enzyme synthesis in the genus bacillus. 

Bacteriol. Rev. 41: 711-753. 

Ryu DDY, Mandels M (1980). Cellulase complex: Biosynthesis and 

applications. Enzyme Microb. Tech. 2: 91-102. 

Sharma P, Gupta JK, Vadehra DV (1990). Purification and properties of 

an endoglucanase from a Bacillus isolate. Enzyme Microb. Tech. 12: 

132-137. 

Tilbeurog H, Claeysseus M (1985). Detection and differentitation of 

cellulases using on molecular fluoregenec substrate. FEBS. Letters, 

187: 283-288. 

Tolan JS, Foody B (1999). Cellulase from submerged fermentation, Adv. 

Biochem. Eng. Biot. 65: 41-67. 

Uzcategui E, Ruiz A, Montesino R, Johansson G and Pettersson G 

(1991). The 1,4-β-D-glucan cellobiohydrolases from Phanerochaete 

chrysosporium. I. A system of synergistically acting enzymes 

homologous to Trichoderma reesei. J. Biotechnol. 19: 271-286. 

Vallander L, Eriksson KE (1985). Enzymic saccharification of pretreated 

wheat straw. Biotechnol. Bioeng. 27: 650-659. 

Wood TM (1985). Properties of cellulolytic enzyme system. Biochem. 

Soc. 13: 407-410. 

Wood TM, Garcia-Campayo V (1990). Enzymology of cellulose 

degradation. Biodegradation, 1: 147-161. 

Wood TM, Mccrae SI, Wilson CA (1988). Aerobic and anaerobic fungal 

cellulases, with special reference to their mode of attack on 

crystalline cellulose. FEMS. Symp. 43: 31-52.



DOI: 10.5897/AJB11.1605 



Chemical composition of Hirsutella 

beakdumountainsis, a potential substitute for 

Cordyceps sinensis 

Rong Li 1,2 , Yu Zhao 3 and Xiaolu Jiang 2 * 

1 Tsingtao Brewery Company Limited, Qingdao 266000, China. 

2 College of Food Science and Engineering, Ocean University of China, Qingdao 266003, China. 

3 College of Chemistry and Chemical Engineering, Ocean University of China, Qingdao 266003, China. 


A strain of Hirsutella beakdumountainsis parasitized on Antheraea pernyi pupa was isolated from the 

fruiting body. The objective of this work was to optimize the artificial cultivation condition for the 

fruiting bodies of H. beakdumountainsis and compare the compositions of natural fruiting bodies of 

Cordyceps sinensis (NFCS), mycelia from shake culture (SCHS) and the fruiting bodies from artificial 

cultivation (ACHS) of H. beakdumountainsis. The crude protein of NFCS accounted for 22.97%; 

obviously lower than those of SCHS (27.99%) and ACHS (31.89%). The contents of total and essential 

amino acids were in the following descending order: SCHS>ACHS>NFCS, respectively. The total 

content of five nucleosides in SCHS (16.82 mg/g) was significantly higher than those of NFCS (5.08 

mg/g) and ACHS (4.45 mg/g). The content of D-mannitol in NFCS, SCHS and ACHS was 8.9, 11.5 and 

10.2%, respectively. The above results suggest that H. beakdumountainsis can probably be used as a 

substitute for C. sinensis. 

Key words: Hirsutella beakdumountainsis, Cordyceps sinensis, protein, amino acid, nucleoside, D-mannitol. 

INTRODUCTION 

Cordyceps sinensis (Bark) Sacc. Link (Claviceptaceae) 

(Ascomycetes), one of the well-known traditional Chinese 

medicines, is an insect parasitizing fungus. This fungus 

lives primarily on the head of the larva of one particular 

species of moth, Hepialus armoricanus, but is also 

occasionally found growing on other moth species (Zhu 

et al., 1998). It is commonly used in China to replenish 

the kidney and soothe the lung for the treatment of 

fatigue, night sweating, hyposexualities, hyperglycemia, 

hyperlipidemia, asthemia after severe illness, respiratory 

disease, renal dysfunction and renal failure, arrhythmias 

and other heart disease, and liver disease 

(Pharmacopoeia of the People’s Republic of China,2005). 

Modern pharmacological studies revealed that it has a 

broad medicinal effect, and its function of immunity 

regulation plays an important role in antitumor effects and 

*Corresponding author. E-mail: rongli1011@gmail.com. Tel: 

+86 532 82032290. Fax: +86 532 82032389. 

organ transplantation (Ma et al., 2001; Shi, 2005). 

Furthermore, modern experimental methods in biochemistry 

have proved that C. sinensis consists of active 

constituents such as polysaccharides, mannitol, 

nucleosides, ergosterol, amino acids and trace elements 

(Cai et al., 2003; Kiho et al, 1999; Zhi et al., 1991). 

However, its usage has been limited during the past 

decades due to the high price and the difficulty of its 

supply. Therefore, the isolation of anamorph strain from 

C. sinensis is a trend of many scientists to achieve a 

large-scale production of mycelia by fermentation. 

Nevertheless, the major problem here is that there are 22 

hyphomyces from 13 genera that are associated with the 

anamorph of C. sinensis. A correct anamorphic isolate of 

it is thus of highest priority. On the basis of morphological 

and molecular evidence, Hirsutella sinensis (Liu et al., 

2004) is currently considered as the correct anamorph of 

C. sinensis (Jiang and Yao, 2002). Unfortunately, fewer 

studies have been done on the fermentation by H. 

sinensis. In addition, the production of fruiting bodies of 

C. sinensis in artificial culture has proved to be extremely

difficult and only feasible at laboratory scale. Successful 

cultivation for commercial purpose has not yet been 

achieved (Yin and Tang, 1995). 

A strain of H. beakdumountainsis parasitized on 

Antheraea pernyi pupa was collected in Baekdu 

Mountain, China. It was isolated from the fruiting body. 

The strain was identified by Prof. Jiang X.L. (Ocean 

University of China). The optimization fermentation 

condition for the mycelia of H. beakdumountainsis has 

already been achieved in the previous study (Rong et al., 

2010). After fermentation of the strain for four days, the 

mycelia biomass yield reached 10.06 g/L. Hence, the 

objective of the present research was to optimize the 

artificial cultivation condition for the fruiting bodies and 

analyze the chemical compositions of mycelia from shake 

culture (SCHS) and the fruiting body of artificial 

cultivation (ACHS), which were compared with that of the 

natural fruiting bodies of C. sinensis (NFCS) in order to 

find a new substitute of C. sinensis. 


Strain and samples 

The mycelia of H. beakdumountainsis were produced by shake 

culture. The fruiting bodies of the strain were produced by artificial 

cultivation. Samples before experiments, except by specific 

indication, were subjected to a dry oven at 60°C for 24 h. The 

natural fruiting bodies of C. sinensis (NFCS) were purchased in 

Tibet and identified. The materials were milled in a mortar and dried 

prior to analysis. 

Shake culture method 

The stock culture was maintained on potato dextrose agar (PDA) 

slants, which were incubated at 24°C for 15 day and then stored at 

4°C. Each 250 ml flask with 100 ml of liquid special media was 

inoculated with mycelia mat (ca. 10 cm 2 ) from a plate culture and 

incubated on a shaker at 180 rpm for seven days at 2°C. About 10 

ml of the seeding culture was transferred to a 500 ml flask with 200 

ml incubated on a shaker at 180 rpm for four days at 24°C. The 

culture medium contained sucrose (2.5%), yeast extract (0.5%), 

K2HPO4 (0.2%), and MgSO4 (0.05%). The initial pH was adjusted to 

5.5 before sterilization. The mycelia were collected by filtering 

mycelia through filter paper (Whatman No.1) and drying to a 

constant weight at 70°C overnight. All samples were stored at 4°C. 

Artificial cultivation method 

The process of producing H. beakdumountainsis fruiting bodies was 

the same as for other cultivated edible mushrooms. The method 

used was the cooked rice in bottle procedure, which was most 

widely adopted for commercial production (Zhang, 2005). The 

process can be divided into two major stages. The first step was 

preparing the seeding culture. The inoculation seeds were 

supported by the process of shake culture. Then, we prepared the 

rice medium as the second step. The rice medium included 30 g 

rice, the powder of A. pernyi pupa and 50 ml nutrient solution, which 

was composed of peptone (0.5%), sucrose (2%), K2HPO4 (0.15%), 

MgSO4 (0.05%) and vitamin B1 (0.001%). The entire medium was 

added to the bottles, sterilized at 120°C for 2 h, and cooled to room 

Li et al. 16287 

temperature. After inoculation of 10 ml of the seeding culture, the 

rice was incubated at 25°C for approximately one week until 

mycelia appeared at the surface of the rice. Then the bottles were 

arranged under light (500xl) and the fruiting bodies maturated for 

about 45 days. 

Analytical methods 

Protein analysis 

Protein was analyzed according to the Micro-Kjeldahl method 

(Micro-Kjeldahl apparatus 1030, Tecator Company, Sweden). 

Protein content was calculated using nitrogen factor (6.25). 

Amino acid analysis 

Amino acids were determined using an automatic amino acid 

analyzer (Beckman 6300, Beckman Instrument, Fullerton, CA) 

according to the method described by Moore and Stein (1963) and 

Danell and Eaker (1992). Hydrolysis of the samples was performed 

in the presence of 5.5 mol/L HCl at 120°C for 24 h under a nitrogen 

atmosphere. The hydrolysate was evaporated and the residue was 

redissolved in 1 ml 0.02 mol/L HCl. The sample was filtered through 

a 0.45 μm filter membrane prior to analysis. 

Nucleoside analysis 

Adenosine, guanosine, uridnine, cytidine and inosine used as 

reference substances, were purchased from Sigma. Accurate 

amounts of nucleosides were dissolved in mobile phase to give 

various concentrations for calibration. Samples were extracted by 

ultra-sonication with 70% aqueous EtOH for 30 min and filtered 

through a 0.45 μm filter membrane prior to analysis. Analysis was 

performed using high performance liquid chromatography (HPLC) 

Agilent 1100 with diode-array detection. A pre-packed RP column 

Waters Spherisorb ODS (4.6 × 250mm i.d., 5 μm) was used. 

Solvents that constituted the mobile phase were Water (A) and 

methanol (B). The elution conditions applied were: 0 to 15 min, 

linear gradient 5 to 20% B; 15 to 25 min, linear gradient 20 to 80% 

B; 25 to 30 min, linear gradient 80 to 5% B. The flow rate was 1 

ml/min, and the injection volume was 10 μl. The analytes were 

monitored at 254 nm. 

D-Mannitol analysis 

The content of mannitol in each sample was determined using 

colorimetric method (Li et al., 1999). In brief, for the contents of 

mannitol, 1 ml of the solution containing 0.4 mg of extract and 1 ml 

of 0.015 mol/L periodate potassium were mixed. After 10 min, 2 ml 

of 5.5 mmol/L rhamnose and 4 ml of fresh Nash reagent (1000 ml of 

2 mol/l ammonium acetate mixed with 2ml of acetic acid and 2 ml of 

acetyl acetone) were added to the mixture which was placed in a 

water bath at 53°C for 15 min. The absorbance was measured at a 

wavelength of 413 nm on a APL-752 spectrophotometer (Shanghai, 

China). A blank test was prepared by substituting distilled water for 

the extract solution. A standard curve was prepared using a 

mannitol standard. 1 ml of solution containing up to 50 mg/ml of 

mannitol was determined by the above method and the mannitol 

content of samples was calculated by the linear regression equation 

from the standard curve. 


The data was statistically analyzed according to Minitab 15.0 for


Fruiting bodies dry 

weight (g/bottle) 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

dry 

(g/bottle) 

0 

0 5 10 15 20 25 30 

Antheraea pernyi pupa powder(g/bottle) 

Figure 1. Effect of A pernyi pupa powder on the fruiting bodies growth. All points represent the mean 

± SD of triplicates. 

windows (Minitab Inc., USA). Significant differences between any 

two means were determined at the 0.05 level. 


Optimization of artificial cultivation condition 

It was reported that the content of A. pernyi pupa powder 

was the important factor for fruiting bodies production in 

C. militaris (Wang and Yang, 2006). As illustrated in 

Figure 1, the maximum yield of fruiting bodies was 2.78 

g/bottle, when we added 20 g A. pernyi pupa powder in 

the medium. Nevertheless, the yield of fruiting bodies 

decreased to 1.96 g/bottle, when the medium included 30 

g A. pernyi pupa powder. After 45 days cultured on the 

optimized condition, the fruiting bodies were matured, 

which were the same as the natural ones from the 

original sample in the morphology (Figures 2 and 3). 

The composition analysis 

Crude protein 

Crude protein contents in NFCS were significantly 

different from those of SCHS and ACHS. They were in 

the following descending order: ACHS> SCHS>NFCS. 

Crude protein contents of ACHS and SCHS were 31.89 

and 27.99%, respectively, higher than those of NFCS 

(22.97%). Previous papers reported that the content of 

crude protein in C. sinensis was in the range of 20.06 to 

33.00% (Hsu et al., 2002; Ji et al., 1999). The protein 

content is mainly due to different geographical origins. 

Amino acids 

Over 20% of amino acids can be found in Cordyceps, 

which should be responsible for the tonic and immunopotentiating 

activity of Cordyceps (Li et al., 2006). Amino 

acid content and composition in NFCS, ACHS and SCHS 

are presented in Table 1. There are statistically significant 

differences in the contents of total amino acids between 

NFCS and SCHS. The contents of the total and essential 

amino acids in SCHS were 28.18 g/100 g and 7.50 g/100 

g, respectively; highest among the three samples. As 

illustrated in the Figure 4, the compounds percentage of 

the total amino acids was similar in NFCS, SCHS and 

ACHS. The four principal amino acids were glutamic acid, 

arginine, aspartic acid and valine. However, their levels 

were different in NFCS, SCHS and ACHS as showed in 

Table 1; glutamic acid: 1.39, 5.85, 5.23(g/100 g); arginine: 

1.35, 4.35, 2.00(g/100 g), aspartic acid: 1.43, 2.40, 

2.13(g/100 g); valine: 1.05, 2.19, 1.66(g/100 g), 

respectively. Glutamine acid is the most abundant 

compound in ACHS and SCHS, representing 24 and 21% 

of total compounds (Figure 4). In addition, the level of 

total amino acids in the NFCS was about 12.99(g/100 g) 

in the study; lower than 16.4 to 18.1(g/100 g) as reported 

(Hsu et al., 2002). It is found that the content of amino 

acids in C. sinensis after hydrolysis is mostly 20 to 25%; 

the lowest being 5.53%, and the highest being 39.22% (Ji 

et al., 1999). 

Nucleosides 

Nucleosides are one of the major components in 

Cordyceps. Adenosine, inosine or cordycepin are used as

Figure 2. The matured fruiting bodies after artificial cultivation for 45 

days. 

Figure 3. The original sample collected in Baekdu Mountain, China. 

Li et al. 16289


% 

30 

25 

20 

15 

10 

5 

0 

Table 1. Amino acid composition of NFCS, SCHS and ACHS (g/100 g). 

Amino acid NFCS SCHS ACHS 

Aspartic acid 1.43 b 2.40 a 2.13 a 

Threonine 0.75 b 1.42 a 1.16 a 

Serine 0.75 b 1.48 a 1.43 a 

Glutamic acid 1.39 b 5.85 a 5.23 a 

Glycine 0.65 b 1.50 a 1.20 a 

Proline 0.45 b 0.86 a 0.70 a 

Alanine 0.81 b 1.39 a 1.43 a 

Valine 1.05 c 2.19 a 1.66 b 

Methionine 0.41 a 0.26 b 0.21 b 

Isoleucine 0.46 c 0.81 a 0.62 b 

Leucine 0.83 c 1.28 a 1.00 b 

Tyrosine 0.36 b 0.59 a 0.73 a 

Phenylalanine 0.58 a 0.61 a 0.54 b 

Lysine 0.94 a 0.93 a 0.97 a 

Histidine 0.78 b 2.26 a 0.80 b 

Argnine 1.35 c 4.35 a 2.00 b 

Total amino acid 12.99 b 28.18 a 21.81 a 

Total essential amino acid 5.20 c 7.50 a 6.16 b 

ACHS SCHS NFCS 

Asp Thr Ser Glu Gly Pro Ala Val Met Ile Leu Tyr Phe Lys His Arg 

Compound 

Compound 

Figure 4. Amino acid profiles of NFCS, SCHS and ACHS. Asp, aspartic acid; Thr, Threonine; Ser, Serine; Glu, Glutamic 

acid; Gly, Glycine; Pro, Proline; Ala, Alanine; Val, Valine; Met, Methionine; Ile, Isoleucine; Leu, Leucine; Tyr, Tyrosine; 

Phe, Phenylalanine; Lys, Lysine; His, Histidine; Arg, Argnine. 

indexing ingredients for quality control, which differentiate 

Cordyceps from different species and the counterfeit 

(Gong et al., 2004; Huang et al., 2003; Li et al., 2004). 

Indeed, nucleosides are involved in the regulation and 

modulation of various physiological processes in the 

central nervous system (CNS). Adenosine is known to

Table 2. Composition of the five nucleosides in NFCS, SCHS and ACHS (mg/g). 

Nucleoside NFCS SCHS ACHS 

Adenosine 0.98 c 5.78 a 1.68 b 

Guanosine 1.63 b 5.30 a 0.48 c 

Uridnine 1.85 b 4.95 a 2.30 b 

Inosine 0.63 a 0.45 a ND 

Thymine ND 0.34 ND 

Total 5.08 b 16.82 a 4.45 b 

ND= non-detectable. Means (n=3) with different letters in the same row are significantly 

different (PACHS>NFCS. Each 

of the five nucleosides contents in SCHS was significantly 

higher than those of NFCS and ACHS. ACHS contains 

less nucleoside than NFCS, especially inosine, which 

cannot be detected in ACHS. The content of mannitol in 

NFCS, SCHS and ACHS was 8.9, 11.5 and 10.2%, 

respectively but there were no statistical differences. Our 

findings suggest that H. beakdumountainsis can be 

regarded as a potential substitute of C. sinensis. 

Moreover, the method of shake culture of the strain 

seemed better than that of artificial culture based on the 

content of the active compounds. In addition, more 

attention will be placed on other active constituents such 

as polysaccharides in further research, and the 

identification of the strain is still in process. 

REFERENCES 

Benowitz LI, Goldberg DE, Irwin N (2002). Inosine stimulates axon 

growth in vitro and in the adult CNS. Prog. Brain Res. 137: 389-399. 

Cai ZJ, Yin DH, Huang TF, Chen SJ, Li QS (2003). Comparison of the


mannitol content in Cordyceps from different growing areas. China 

Pharm. 14: 505-506. 

Danell E, Eaker D (1992). Amino acid and total protein content of the 

edible mushroom Cantharellus cibarius (Fries). J. Sci. Food Agric. 60: 

333–337. 

Gong YX, Li SP, Li P, Liu JJ, Wang YT (2004). Simultaneous 

determination of six main nucleosides and bases in natural and 

cultured Cordyceps by capillary electrophoresis. J. Chromatogr. A. 

1055: 215–221. 

Hsu TH, Shao LH, Hsieh CY, Chang DM (2002). A comparison of the 

chemical composition and bioactive ingredients of the Chinese 

medicinal mushroom DongChongXiaCao, its counterfeit and mimic, 

and fermented mycelium of Cordyceps sinensis. Food Chem. 78: 

463–469. 

Huang LF, Liang YZ, Guo FQ, Zhou ZF, Cheng BM (2003). 

Simultaneous separation and determination of active components in 

Cordyceps sinensis and Cordyceps militaris by LC/ESI-MS. J. Pharm. 

Biomed. Anal. 33: 1155–1162. 

Ji S, Shi XL, Yi J (1999). Introduction of the research status in chemical 

constituents of Cordyceps. J. Fujian College Tradit. Chin. Med. 9: 46– 

47. 

Jiang P (1987). Pharmacology constituent and function of Cordyceps 

sinensis. J. Westnorthern Med. 2: 43-44. 

Jiang Y, Yao YJ (2002). Name related to Cordyceps sinensis anamorph. 

Mycotaxon, 84: 245-254. 

Kiho T, Ookubo K, Usui S, Ukai S, Hirano K (1999). Structural features 

and hypoglycemic activity of a polysaccharide (CS-F10) from the 

cultured mycelium of Cordyceps sinensis. Biol. Pharm. Bull. 22: 966- 

970. 

Li SP, Li P, Dong TTX, Tsim KWK (2001). Determination of nucleosides 

in natural Cordyceps sinensis and cultured Cordyceps mycelia by 

capillary electrophoresis. Electrophoresis, 22: 144-150. 

Li SP, Li P, Lai CM, Gong YX, Kan KKW, Dong TTX, Tsim KWK, Wang 

YT (2004). Simultaneous determination of ergosterol, nucleosides 

and their bases from natural and cultured Cordyceps by pressurized 

liquid extraction and high-performance liquid chromatography. J. 

Chromatogr. A. 1036: 239-243. 

Li SP, Yang FQ, Tsim KWK (2006). Quality control of Cordyceps 

sinensis, a valued traditional Chinese medicine. J. Pharm. Biomed. 

Anal. 41: 1571-1584. 

Li XQ, Bao TT, Wang Y (1999). Determination of mannitol in Cordyceps 

sinensis by colorimetric method. Chin Tradit. Herbal Drugs, 30: 19- 

21. 

Ma DY, Li P, Ji H, Hu ZY (2001). The development on the pharmacology 

of Cordyceps sinensis. J. Chin. Med. 24: 455-458. 

Moore S, Stein WH (1963). Chromatographic determination of amino 

acids by the use of automatic recording equipment. Methods in 

enzymology, New York, Acad. Press. pp. 815-860. 

Pharmacopoeia of the People’s Republic of China. (2005). The 

pharmacopoeia Commission of PRC (Ends.), Chemical Industry 

Publishing House, Beijing. 

Rong L, Jiang XL, Guan HS (2010). Optimization of mycelium biomass 

and exopolysaccharides production by Hirsutella sp. in submerged 

fermentation and evaluation of exopolysaccharides antibacterial 

activity. Afr. J. Biotechnol. 9: 195-202. 

Schmidt C, Bellingham MC, Richter DW (1995). Adenosinergic 

modulation of respiratory neurones and hypoxic responses in the 

anaesthetized cat. J. Physiol. 483: 769-781. 

Shi YX (2005). Update on researches of pharmacological effects of 

Cordyceps. China Pharm. 14: 72-74. 

Wang CX, Yang CW (2006). Research on the artificial cultivation of 

Cordyceps sinensis. Practical Pharmacy. Clin. Remedies, 9: 111-112. 

Xu DC (2006). The research development on Cordyceps sinensis. J. 

Fugal Res. 4: 60-64. 

Yin DH, Tang XM (1995). Progress of cultivation research of Cordyceps 

sinensis. Zhongguo Zhong Yao Za Zhi, 20: 707-709. 

Zhang HF (2005). Study on conditions of culture on fruiting body of 

Cordyceps militaris. J. Jilin Med. Colle. 26: 192-194. 

Zhi ZL, Wang LH, Dong SS (1991). Determination of 11 metal elements 

in Chinese traditional medicine by use of atomic absorption 

spectrophotometry. J. China Pharmaceutic. Univ. 22: 33-35. 

Zhu JS, Halpern GM, Johns K (1998). The scientific rediscovery of an 

ancient Chinese herbal medicine: Cordyceps sinensis: part I. J. 

Altern. Complem. Med. 4: 289-303.



DOI: 10.5897/AJB11.1929 



Phenolic composition and antioxidant capacity of 

Cherry laurel (Laurocerasus officinalis Roem.) sampled 

from Trabzon region, Turkey 

Fatma Yaylaci Karahalil 1 * and Hüseyin Şahin 2 

Department of Chemistry, Faculty of Sciences, Karadeniz Technical University, 61080, Trabzon, Turkey. 


In this study, we investigated 17 different phenolic constituents and total antioxidant properties of 

cherry laurel, Laurocerasus officinalis Roem (family Rosaceae), locally named karayemis or taflan, a 

summer fruit highly characteristic of the Black Sea region. Phenolic constituents were measured by 

reverse phase-high performance liquid chromatography (RP-HPLC). Total phenolic compounds, total 

flavonoids, ferric reducing /antioxidant power (FRAP), cupric ion reducing capacity (CUPRAC) and 2,2diphenly-1-picrylhydrazyl 

(DPPH) radical methods were used to evaluate the antioxidant capacity. The 

total phenolics and total flavonoids were found to be 1.094 g GAE/100 g DW and 0.080 g QUE/100 g DW, 

respectively. Chlorogenic acid was found, that is, the main phenolic component of the methanolic 

extract of the fruit. Gallic, protocatechuic acid, p-OH benzoic acid, chlorogenic acid, vanillic acid, pcoumaric 

acid, ferulic, syringic, cathechin and rutin were detected in the samples, while caffeic acid, 

benzoic acid, o-coumaric acid, abscisic acid, trans-cinnamic acid, epicathecin and quercetin were not 

detected. The results indicate that cherry laurel fruits proved to be a good source of antioxidant that 

might serve to protect humans from several diseases. 

Key words: Cherry laurel, phenolics, flavonoids, antioxidant. 

INTRODUCTION 

Laurocerasus officinalis Roem (family Rosaceae) berries 

named as cherry laurel is used for cough reducing, 

antispasmodic and in the making of tincture of iodine in 

the medical field (Anşin and Özkan, 1993). Cherry laurel 

is a summer fruit and is grown in the Black Sea region 

(Ayaz et al., 1995). L. officinalis is a wild fruits of the 

officinalis species in the Rosaceae family and Prunoideae 

subfamily. It is located in the eastern Black Sea region of 

Turkey, some of the Balkans, Northern Ireland, Western 

Europe, southern and western Caucasia, Iran, eastern 

*Correspondence author. E-mail: fkarahalil@hotmail.com or 

fyaylaci@ktu.edu.tr. Tel: +904623772487. Fax: 

+904623253196. 

Abbreviations: ROS, Reactive oxygen species; PPP, pentose 

phosphate; RP-HPLC, reverse phase-high performance liquid 

chromatography; FRAP, ferric reducing/antioxidant power; 

CUPRAC, cupric ion reducing capacity; DPPH, 2,2-diphenly-1picrylhydrazyl; 

TPC, total phenolic content. 

Marmara, and some Mediterranean countries and is 

widely consumed in the eastern Black Sea region. It is 

known for its unique taste and ethno-pharmacological 

uses including its diuretic and anti-diabetic properties and 

for the treatment of stomach ulcers, digestive system 

problems, bronchitis, eczemas, and hemorrhoids 

(Baytop, 2001). The fruit is mostly consumed as freshly 

or dried as well as in the form of jam, pulp, marmalade 

and drinks (Kolaylı et al., 2003). The fruits are believed to 

be a good ethno-remedy for strengthening the defense 

system in human metabolism. In fact, the edible parts of 

the fruits have studied in recently years. 

Phenolics are the largest class of plant secondary 

metabolites, which, in many cases, serve in plant defense 

mechanisms to counteract reactive oxygen species 

(ROS) in order to survive and prevent molecular damage 

and damage by microorganisms, insects, and herbivores 

(Kolaylı et al., 2003). They are natural antioxidant either 

possible beneficial effects on human health and primarily 

synthesized by pentose phosphate (PPP), shikimate and 

phenylpropanoid pathways (Randhir et al., 2004; Stratil


et al., 2007). 

Fruits contain various bioactive compounds with antioxidant 

activities, such as vitamins (A, C, and E), and 

phenolic compounds (phenolic acids, flavonoids, 

flavonols, anthocyanins, tannins and lignins) that possess 

antioxidant activities (Liyana-Pathirana et al., 2006). 

Antioxidants can inhibit or delay the oxidation of an 

oxidize substrate and retard the progress of many 

diseases as well as lipid oxidative rancid in foods (Gülçin 

et al., 2005). The number of antioxidant compounds 

synthesized by plants as secondary products, mainly 

phenolic agents, serving in plant defense mechanisms to 

counteract ROS, in order to survive (Kolaylı et al., 2003). 

The antioxidant activity of phenolics is related to a 

number of different mechanisms such as free radical 

scavenging, hydrogen donation, single electron transfer, 

single oxygen quenching, and metal ion chelating, and 

acting as a substrate for radicals such as hydroxyl, 

superoxide, and nitric oxide. To summarize antioxidant 

agents acts as reducing agents or H- atom donor (Al- 

Mamary et al., 2002; Liyana-Pathirana et al., 2006; 

Kolaylı et al., 2008). 

There are number of clinical and epidemiological 

studies suggesting that the antioxidant in plants are main 

factors for the observed efficacy of these foods in 

reducing the incidence of chronic diseases including 

cancer and heart disease. The antioxidant effects and 

free radical scavenging activity of phenolic has been 

substantially investigated and reported in the literature by 

several researches (Peterson and Dwyer, 1998; Gülçin, 

2010). In another preliminary study, Kolaylı et al. (2003) 

studied some physical, chemical properties and mineral 

composition, and radicals scavenging activities (DPPH, 

superoxide and hydroxyl) of the fruit that collected from 

Akçaabat, Trabzon. 

Although, there are a few studies evaluating antioxidant 

and compositional characteristics of cherry laurel varieties, 

the endemic fruits was not completely characterized 

(Alasalvar et al., 2005; Kolaylı et al., 2003). Therefore, 

the current study was designed to assess the phenolic 

composition including phenolic acids and flavonoids and 

in vitro biological activities, in terms of antioxidant 

capacity. 


The phenolic standards (purity> 99.0%) gallic acid, protocathechuic 

acid, p-hydroxybenzoic acid, vanillic acid, caffeic acid, chlorogenic 

acid, syringic acid, epicatechin, p-coumaric acid, ferulic acid, 

benzoic acid, o-coumaric acid, trans-cinnamic acid, abscisic acid, 

catechin, rutin, quercetin, propylparaben as internal standard (IS) 

and neocuproine (2,9-dimethly-1,10- phenanthroline) were obtained 

from Sigma-Aldrich (St. Louis, MO, USA) and Merck (Darmstadt, 

Germany), methanol, acetic acid, and acetonitrile from Merck 

(Darmstadt, Germany), Trolox (6- hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic 

acid), TPTZ (2, 4, 6-tripyridyl-s -triazine) and 

Folin-Ciocalteu’s phenol reagent from Fluka Chemie GmbH 

(Switzerland), polytetrafluoroethylene membranes (porosity 0.2 μm) 

for the filtration of the extracts were obtained from Sartorius 

(Goettingen, Germany). 

HPLC (Shimadzu LC-UV) analysis of phenolic compounds was 

performed on a reverse phase Zorbax Eclipse XDB-C18 column 

(4.6 x 150 mm, 5 µm), using a gradient program with two solvents 

system (A: 0.5% acetic acid in acetonitrile: water (1:1); B: 2% acetic 

acid in water) at a constant solvent flow rate of 1.2 mL/min. Injection 

volume was 20 µL. The signals were detected at 280 and 315 nm 

by UV-VIS detection. 

An ATI-Unicam UV-2 UV-Vis spectrophotometer (Cambridge, 

U.K.) was used in all absorbance measurements. All solutions were 

prepared with deionized water purified in an Elgacan C104 (Elga, 

England) filtration system. 

Samples 

Ripe fruits of cherry laurel (L. officinalis) were collected from Yomra, 

Trabzon, Turkey, after full ripening in August 2009 (Figure 1). They 

were kept in cool bags for transport to the biochemistry laboratory 

and the fruits were washed with distilled water and fruit seeds were 

removed then dried at 40°C for 5 days and stored at room bags at 

+4°C until tested. 

Extraction 

For antioxidant tests and HPLC assay, 20 g powdered of the fruit 

was homogenized using a blender and mixed with 150 mL of 

methanol on a magnetic stirrer for 3 h. The supernatant was 

removed by filtering through Whatman No.1 filter paper followed by 

centrifugation at 10 000 g for 10 min at 4°C. Then, the filtrate was 

concentrated in a rotary evaporator under reduced pressure at 

40°C and the residue was divided into two parts. One of the parts 

was used antioxidant tests and the other was prepared to HPLC 

analyses of phenolic compounds. For HPLC analyses, the residue 

was dissolved in distilled water and extracted 3 times with 20 mL of 

a mixture of cold ethyl acetate and diethyl ether 1:1 (V/V), by 

manually shaking. The organic phases were combined and solvents 

were removed with rotary evaporator. The final residue was 

redissolved in methanol and 100 µL samples taken from stock 

solution and final volume were completed to 1 mL for necessary 

dilution. 

Determination of individual phenolic compounds by high 

performance liquid chromatography (HPLC) 

HPLC (Shimadzu LC-UV) analysis of 17 phenolic compounds was 

performed on a reverse phase Zorbax Eclipse XDB-C18 column 

(4.6 x 150 mm, 5 µm), using a gradient program with two solvents 

system (A: 0.5% acetic acid in acetonitrile: water (1:1); B: 2% acetic 

acid in water) at a constant solvent flow rate of 1.2 mL/min. Injection 

volume was 20 µL. The signals were detected at 280 and 315 nm 

by UV-VIS detection. 

Determination of total phenolic compounds 

Total phenolic contents were determined by the Folin-Ciocalteau 

procedure (Slinkard and Singleton, 1977) using gallic acid as 

standard. Briefly, 0.1 mL of various concentrations of gallic acid and 

methanolic samples (1 mg/mL) were diluted with 5.0 mL distilled 

water. 0.5 mL of 0.2 N Folin-Ciocalteu reagents was added, and the 

contents were vortexed. After 3 min incubation, 1.5 mL of Na2CO3 

(2%) solution was added, and, after vortexing, the mixture was 

incubated for 2 h at 20°C with intermittent shaking. The absorbance 

was measured at 760 nm at the end of the incubation period. The 

concentration of total phenolic compounds was calculated as mg of

Figure 1. Location of collected cherry laurel berries. 

Karahalil and Şahin 16295 

Figure 2. HPLC profiles of methanolic phenolic compounds detected at 280 nm and propyl paraben was used an internal Standard. Zorbax 

Eclipse XDB-C18 column (4.6 x 150 mm, 5 µm), gradient eluent acetic acid/acetonitrile/water/, flow rate 1.2 mL/min. Peak identification: (1) 

gallic acid, (2) proto-catechuic acid, (3) p-OH benzoic acid, (4) catechin, (5) chlorogenic acid, (6) vanillic acid, (7) caffeic acid, (8) syringic 

acid, (9) epicatechin, (10) p-coumaric acid, (11) ferulic acid, (12) benzoic acid, (13) rutin, (14) o-coumaric acid, (15) cis, trans- abscisic acid, 

(16) trans-cinnamic acid, (17) quercetin, and (18) propyl paraben.


Table 1. HPLC analyses of phenolic 

constituents of the methanolic laurel cherry 

extracts from Black sea region of Turkey 

(mg/100 g dried mass). 

Phenolics Mass 

(mg/100g) 

Phenolic acids 

Gallic acid 0.02 0.01 

Protocatechuic acid 3.72 0.50 

p-Hydoxybenzoic 

acid 

8.34 0.42 

Chlorogenic acid 33.00 1.23 

Vanillic acid 7.69 0.45 

Syringic acid 1.30 0.15 

p-coumaric acid 2.55 0.60 

Ferulic acid 0.58 0.01 

Caffeic acid nd 

Benzoic acid nd 

o-coumaric acid nd 

Abscisic acid nd 

trans-cinnamic acid nd 

Flavonoids 

Catechin 3.40 0.12 

Rutin 0.10 0.02 

Quercetin nd 

Epicatechin nd 

nd: Not detected. 

gallic acid equivalents per g of 100 g of fresh weight (FW) samples, 

by using a standard graph. 

The total flavonoid contents of the methanolic sample were 

determined by the aluminum complexation method (Marcucci et al., 

1998). 0.5 mL samples solution mixed with 0.1 mL of 10 aluminum 

nitrate (Al(NO3)3 ,

HO 

OH 

Figure 3. Chlorogenic acid. 

O 

O 

C 

H 3 

OH 

OH 

OH 


Figure 4. A high-performance liquid chromatogram of methanolic laurel cherry extracts (UV-VIS detection at 280 nm and 315 nm). 

(1) gallic acid, (2) proto-catechuic acid, (3) p-OH benzoic acid, (4) catechin, (5) chlorogenic acid, (6) vanillic acid, (7) syringic acid, 

(8) p-coumaric acid, (9) rutin, (10) ferulic acid, (11) proply paraben.


Table 2. Antioxidant activities and total phenolic contents of the methanolic laurel cherry. 

Parameter 

Sample of 

Laurel cherry 

Total phenolic 

content 

(mgGAE/100 g DW) 

laurel (Ayaz et al., 1997). 

Total phenolic compounds (TPC) 

Total flavonoids 

content (mg 

QEs/100g DW) 

Ferric reducing/antioxidant 

capacity (FRAP) mM Fe(II) /100 

g DW 

Cupric reducing/antioxidant 

capacity (CUPRAC) mM Trolox 

/100 g DW 

1.094 0.06 0.080 0.002 28.55 2.31 24.5 3.46 

Total phenolic content (TPC) was determined in 

comparison with standard gallic acid and TPC of 

methanolic samples were found to be 1.094 0.06 mg 

GA/100 g dry weights (DW) of methanolic laurel cherry 

extract by using Folin-Ciocalteu method (Table 2). TPC of 

the fruits was found to be 10.4 mg/100 g water-soluble 

exracts (Kolaylı et al., 2003) and 454 mg/ 100 g fresh 

weight in methanolic extracts (Alasalvar et al., 2005). 

When compared, the previous studies about cherry laurel 

phenolic contents, methanolic extracts of the fruits was 

showed higher TPC. Plants and fruits phenolic are the 

largest class of plant secondary metabolites. They 

counteract reactive oxygen species in order to survive 

and prevent molecular damage by several harmful 

microorganisms, insects and herbivores (Kolaylı et al., 

2010). 

Total amount of flavonoid was determined in 

comparison with quercetin and the result expressed in 

terms of mg QEs/100g DW. Total flavonoid content of the 

methanolic laurel cherry extracts was found to be 0.080 

±0.002 mg Qes/100 g DW. The measured total flavonoid 

content constitutes 7.3 % of total phenolic contents. 

Shortly, the laurel cherry fruits content several phenolic 

substances such as phenolic acids, anthocyanidins and 

only 7.3% of the fractions are flavonoids. However, we 

measured four individual flavonoids such as catechin, 

rutin, quercetin and epicatechin, and catechin was the 

highest. Flavonoids are mostly present as glycosides in 

plants and during intestinal absorption; these glycosides 

are mostly hydrolyzed to their agylcones (Murota and 

Terao, 2003). 

Total antioxidant capacity 

FRAP and CUPRAC test were used for the measurement 

of total antioxidant capacity of the methanolic extracts of 

the samples. Both methods are based on electron 

transfer and are considered to be a good indicator for 

total antioxidant power because total reducing power is 

the some of the reducing powers of individual compounds 

presented in a sample (Tezcan et al., 2011). A total 

antioxidant activity of the sample is given in Table 2. The 

cherry laurel samples examined in this study 

demonstrated familiar reducing capacity compared to 

further work (Liyana-Pathirana et al., 2006). Similar to 

FRAP test, CUPRAC test confirmed total antioxidant 

capacity of the sample and obtained values of CUPRAC 

result was close to each other. 

In conclusion, we reported that more individual phenolic 

compounds have been studied, comprising 13 phenolic 

acids and 4 flavonoids than previous studies of L. 

officinalis. Apart from previous studies, we found some 

phenolic compounds such as ferulic acid, gallic acid and 

rutin in a small quantity. In addition, the methanolic 

extracts of the samples have antioxidant activity and 

therefore, cherry laurel fruit provide a valuable source of 

nutritional supplements and required further investigation 

with regard to its individual anthocyanin components. 

REFERENCES 

Alasalvar C, Al-Farsi M, Shahidi F (2005). Compositional characteristics 

and antioxidant components of cherry laurel varieties and pekmez. J. 

Food Sci. 70(1): 47-52. 

Al-Mamary M, Al-Meeri A, Al-Habori M (2002). Antioxidant activities and 

total phenolics of different types of honey, Nutr. Res. 22: 1041-1047. 

Anşin R, Özkan ZC (1993). Seedy plants (spermatopyta) woody taxon, 

Karadeniz Technical University Forestry Faculty, Issue No: 19, 

Trabzon. (in Turkish). 

Apak R, Güçlü K, Özyürek M, Karademir SE (2004). Novel total 

antioxidant capacity index for dietary polyphenols and vitamins C and 

E, using their cupric ion reducing capability in the presence of 

neocuproine: CUPRAC Method. J. Agric. Food Chem. 52: 7970- 

7981. 

Ayaz FA, Kadioglu A, Reunanen M, Var M (1997). Phenolic acid and 

fatty acid composition in the fruits of Laurocerasus officinalis roem. 

and its cultivars. J. Food Comp. Anal. 10: 350-357. 

Ayaz FA, Reunanen M, Küçükislamoğlu M, Var M (1995). Seed fatty 

acid composition in wild form and cultivars of Lauorocerasus 

officinalis Roem. Pakistan J. Bot. 276(2): 305-308. 

Baytop T (2001). Therapy with medicinal plants in Turkey (past and 

present), 1st ed.; Istanbul University: Istanbul, Turkey, pp. 178-249. 

Benzie IFF, Straine JJ (1996). The ferric reducing ability of plasma 

(FRAP) as a measure of antioxidant power: The FRAP assay. Anal. 

Biochem. 239: 70-76. 

Gülçin İ (2010). Antioxidant properties of resveratrol: a structure–activity 

insight. Innovative Food Sci. Emerging Technol. 11: 210-218. 

Gülçin İ, Berashvili D, Gepdiremen A (2005). Antiradical and antioxidant 

activity of total anthocyanins from Perilla pankinensis Decne. J. 

Ethopharmacol. 101: 287-293. 

Kolayli S, Kara M, Tezcan F, Erim FB, Sahin H, Ulusoy E, Aliyazıcıoğlu 

R (2010). Comparative study of chemical and biochemical properties 

of different melon cultivars: Standard, hybrid, and grafted melons. J. 

Agric. Food Chem. 58: 9764-9769. 

Kolayli S, Aliyazıcıoğlu R, Ulusoy E, Karaoğlu Ş (2008). Antioxidant and 

antimicrobial activities of selected Turkish honeys. Hacettepe J. Biol. 

Chem. 36(2): 163-172.

Kolayli S, Küçük M, Duran C, Candan F, Dinçer B (2003). Chemical and 

antioxidant properties of Laurocerasus officinalis Roem. (cherry 

laurel) fruit grown in the black sea region. J. Agric. Food Chem. 51: 

7489-7494. 

Liyana-Pathirana CM, Shahidi F, Alasalvar C (2006). Antioxidant activity 

of cherry laurel fruit (Laurocerasus officinalis Roem.) and its 

concentrated juice. Food Chem. 99: 121-128. 

Marcucci MC, Woisky RG, Salatino A (1998). Use of aluminum chloride 

in the flavonoids quantification of propolis samples, Mensagem Doce, 

(in Portuguese). 46: 3-9. 

Murota K, Terao J (2003). Antioxidative flavonoid quercetin: Implication 

of its intestinal absorption and metabolism. Arch. Biochem. Biophys. 

417: 12-17. 

Peterson J, Dwyer J (1998). Flavonoids: Dietary occurrence and 

biochemical activity. Nutr. Res. 12: 1995-2018. 

Randhir R, Tong LY, Shetty K (2004). Stimulation of phenolics, 

antioxidant and antimicrobial activities in dark germinated mung bean 

sprouts in response to peptide and phytochemical elicitors. Process 

Biochem. 39: 637-646. 


Stratil P, Klejdus B, Kuba V (2007). Determination of phenolic 

compounds and their antioxidant activity in fruits and cereals. 

Talanta, 71: 1741-1751. 

Slinkard K, Singleton VL (1977). Total phenol analysis: Automation and 

comparison with manual methods. Am. J. Enol. Viticult. 28: 49-55. 

Tezcan F, Kolaylı S, Sahin H, Ulusoy E, Erim BF (2011). Evaluation of 

organic acid, saccharide composition and antioxidant properties of 

some authentic Turkish honeys. J. Food Nutr. Res. 50: 33-40.



DOI: 10.5897/AJB11.138 



Exhaust emissions and combustion performances of 

ethylene glycol monomethyl ether palm oil monoester 

as a novel biodiesel 

Da-Yong Jiang* 1 , Yun Bai 1 and He-jun Guo 2 

1 Research Institute of Communication, the Engineering University of CAPF, Xi’an Shaanxi, 710086, P R China. 

2 Xi’an Research Institute of high Technology, 503 staff room, Xi'an, Shaanxi, 710025, P.R. China. 


A novel biodiesel named ethylene glycol monomethyl ether palm oil monoester was developed. This 

fuel owns one more ester group than the traditional biodiesel. The fuel was synthesized and structurally 

identified through FT-IR, P1PH NMR analyses and GPC. Engine test results showed that when a tested 

diesel engine was fueled with this biodiesel in the place of 0# diesel fuel, engine-out smoke emissions 

decreased by 69.0 to 89.3%, and nitric oxide (NOx) also lessened significantly, but unburned 

hydrocarbon (HC) and carbon monoxide (CO) emissions generally do not change noticeably compared 

with pure diesel fuel. In the area of combustion performances, both engine in-cylinder pressure and its 

changing rate with crankshaft angle were increased to some extent for ethylene glycol monomethyl 

ether palm oil monoester because of the higher cetane number and shorter ignition delay. Due to 

certain amount of oxygen contained in the new biodiesel resulting in the low calorific value, the engine 

thermal efficiency dropped by 14.4% at record level when fueled with the biodiesel, which needs to be 

improved in the future. 

Key words: Biodiesel, ethylene glycol monomethyl ether palm oil monoester, engine-out emissions, 

combustion. 

INTRODUCTION 

In recent years, growing awareness of the complete 

depletion of petroleum oil in the near future and serious 

atmospheric pollution caused by automobile industry has 

inspired much research for clean alternative fuels to 

substitute for fossil fuels (Crooles, 2006; Pugazhvadivu 

and Jeyachandran, 2005; Kaplan et al., 2006). One of the 

most promising alternative energy sources is biodiesel. 

Biodiesel contains significantly less sulfur and nitrogen, 

which makes the fuel more environment-friendly than 

petroleum fuels. Because it is renewable and available 

worldwide, it has a bright future for practical application. 

A traditional biodiesel was used to be the methyl ester 

*Corresponding author. E-mail: wanghe717@163.com. 

Abbreviations: NOx, Nitric oxide; HC, hydrocarbon; CO, 

carbon monoxide, FT-IR; P1PH NMR; GPC, BMEP. 

of vegetable oil, which is prepared through transesterification 

of vegetable oils with alcohol. Many studies 

show that such biodiesel, containing certain amount of 

oxygen, can lead to remarkable reduction in diesel 

engine exhaust emissions (Usta et al., 2005; Lapuerta et 

al., 2005; Cetinkaya and Karaosmanoglu, 2007). Thus, it 

has been called a green fuel for diesel engine. However, 

since there is only one ester group (two oxygen atoms 

existing in each monoester molecule), the oxygen content 

in traditional biodiesel is at a comparatively lower level, 

so the reduction in emissions is not just as significant as 

anticipated when diesel engine burns it or its mixture with 

diesel fuel. Experiments have shown that the reduction 

rate in engine-out smoke emissions is correlated with the 

content of oxygen of the fuel. 

Therefore, to enhance the effect of traditional biodiesel 

in reducing engine-out smoke formation, the introduction 

of other ether group into its molecule was attempted. As

Table 1. Specification of the used chemicals. 


Chemical Density (kg/m 3 ) Boiling point (°C) Molecular weight Standard 

Palm Oil 917 ~ 944 - - Primes state 

Ethylene glycol monomethyl ether 965.0 134 76.10 Analytically pure 

Ethanol absolute 789 ~ 791 78 46.07 Analytically pure 

Potassa 950 - 23.5 Chemically pure 

(–OH) Absorption peak in the region of 3200~3600 cm -1 indicating that there was little fatty acid and ethanol in the treated palm oil (Figure 

1). 

Figure 1. infrared spectrogram of palm oil after treatment. 

is well known, palm oil comes from oil palm which is one 

of the plants with the highest rates of oil productivity, and 

it can be divided into RBD PO and RBD PKO extensively 

used for food. Hence, a novel biodiesel, ethylene glycol 

monomethyl ether palm oil monoester has been 

synthesized in this paper, which was also studied on the 

performance in reducing engine-out exhaust emissions 

and combustion. 


Preparation of palm oil monoester 

The new palm oil monoester was synthesized with a commercially 

refined palm oil and ethylene glycol monomethyl ether as reactants 

(Table 1). Initially, the selected palm oil was treated through 

extraction with ethanol as solvent at a temperature of 90°C to 

remove tiny amount of organic fatty acid of about 0.35 mg KOH/g in 

it, and was then purified under vacuum condition. FT-IR analysis 

justified that there was no vibration (Figure 1). 

The subsequent transesterification reaction was carried out in a 

flask with the acid-free palm oil of 600 ml and ethylene glycol 

monomethyl ether of 210 ml at a temperature of 80°C using 0.6% 

Wavelength (cm -1 ) 

KOH as catalyst. Upon completion of the reaction which lasted for 

approximately 0.5 h, the crude product was first neutralized with 

diluted HCl solution and then separated from the water phase. 

Subsequently, it was purified in a vacuum to remove ethylene glycol 

monomethyl ether left over in the ester phase after 12 h. Finally, it 

was dried using CaCl2 agent, and the yield of palm oil monoester in 

laboratory can was close to 85%. 

Structure analysis 

The chemical structure analysis of the new palm oil monoester was 

conducted with FT-IR, P 1P H NMR and GPC analytical techniques 

(Davies and Henrissat, 1995; Yuan et al., 2008). The test conditions 

were also confirmed (Table 4 and Figure 3). 

FT-IR analysis was performed on an EQUINOX55 FT-IR 

spectrometer whose sample cell is KBr crystal. A superconducting 

NMR spectrometer of INOVA type made by VARIAN Company was 

employed to accomplish P 1P H NMR analysis. CDClB3B was selected 

as a solvent, and TMC as a standard reference. The spectrometer 

operating frequency was 400 MHz. The Gel permeation 

chromatography (GPC) 515-2410 system came from American 

Water Company including 515 HPLC pump, 717 auto sample, 2410 

refractive index detector, millennium 32 and styragel 

(HR2_HR3_HR4E). The experimental condition involved THF as


Table 2. Specification of DI diesel engine utilized. 

Parameter Magnitude Parameter Magnitude 

Bore 100 mm Rated speed 2300 rpm 

Stroke 115 mm Rated power 11 kw 

Connecting rod length 190 cm Combustion chamber ω shape 

Displacement 0.903 L Compression ratio 18 

For comparison study, 0# diesel fuel meeting China national technical specification was utilized and named B0. In the mean 

time, it was mixed with the palm oil monoester (B100) in a volume proportion of 3:1(B50) and 1:1(B25) to investigate the effect of 

the mixtures on engine-out exhaust emissions and combustion performances. 

Figure 2. IR spectrum of palm oil monoester. 

mobile phase, velocity of 1 ml/min and temperature detector below 

40°C. 

Engine test 

A single cylinder, four-stroke, water-cooled, DI diesel engine was 

adapted to complete determination of exhaust emissions and 

combustion performances. The technical parameters of the engine 

are tabulated in Table 2. An AVL DiSmoke 4000 smoke opacity 

indicator was used to record smoke intensity in extinction coefficient, 

and an on-line exhaust emission analyzer was utilized to examine 

CO, HC and NOx emitted. An angle calibration apparatus and a 

pressure transducer of Kistler type were used to pick up crankshaft 

angle and in-cylinder pressure. A CS22000 data gathering and 

analyzing system was utilized to process data. 

The engine tests were carried out under the following conditions: 

Ambient temperature of 23°C, humidity of 86%, and engine watercooling 

temperature of 95°C. In the experiment, when the engine 

Wavelength (cm -1 ) 

approached a stable operation at a fixed steady state, all kinds of 

determinations were made according to certain well-defined 

procedures. 


Chemical structure 

Figure 2 and Table 3 list the main absorption frequencies 

displayed in IR spectrum obtained for the new palm oil 

monoester. No absorption peaks above 3100 cm -1 was 

found, implying that there is no hydroxyl group (-OH) in 

the synthesized product. Hence, it was easily confirmed 

that the product is an ester involving ether group. 

GPC can help to detect simultaneously the content of 

diglycerides, triglycerides, glycerol and fatty acid methyl

Figure 3. P 1P H NMR wave spectrogram of palm oil monoester. 

Table 3. FT-IR spectrum data of palm oil monoester. 

Frequency (cm -1 ) Group attribution Vibration type Strength 

2924.52 -CHB3B, -CHB2B BasB s 

2853.79 -CHB3B, -CHB2B BsB s 

1743.96 C=O s 

1462.60 -CHB2B m 

1378.26 -CHB3B m 

1166.77 C-O-C BasB m 

1119.05 C-O-C BsB m 

722.31 (CH2)n (n>4) - w 


Figure 3 and Table 4 illustrates P 1P H NMR data gained for the palm oil monoester. Chemical shift 5.342 ppm belongs to the 

protons attached to C=C group in the molecules, while chemical shift 4.226, 3.591 and 3.391 ppm, respectively belonged to 

the protons existing in the group -COOCH2CH2OCH3 in the order from the left to the right. More peaks occurring in the 

ester in the process of transesterification reaction with a 

refractive index detector. Table 5 illustrates that the main 

component of palm oil is fatty acid glycerin ester whose 

number average molecular weight mainly distributes in 

1426 or so, which is consistent with the known 

composition of palm oil. After transesterification, the peak 

of fatty acid ester (Mw 1426) almost disappeared, which 

meant that fatty acid glycerides have been transformed 

into fatty acid ether ester (biodiesel) thoroughly, while the 

peak of number average molecular weight of 566 has 

correspondingly appeared. 

Exhaust emissions 

Two types of engine operation modes running at 1600 

and 2200 rpm, respectively were selected to study the 

changes of exhaust emissions under different partial 

brake mean effective pressures (BMEP). Figure 4 

displays the effects of the new palm oil monoester on


Table 4. P 1P H NMR data of palm oil monoester. 

Chemical shift (ppm) Proton peak splitting Coupling constant (Hz) Peak area/proton number 

5.342 Triplet 6.4 1.281/- 

4.226 Triplet 3.6 1.81/2 

3.591 Triplet 3.6 2.00/2 

3.391 Singlet - 2.98/3 

(a) n=1 6 00 r pm 

(b) n = 2 2 00 rpm 

Figure 4. Effect of the palm oil monoester on smoke emissions. 

were burnt. However, in two load conditions, HC emissions 

increased with the oxygen content of fuel. The likely 

reason was attributed to the lower heating value of 

biodiesel. When biodiesel is mixed with diesel, the 

decreased ignition delay of mixture results in the 

reduction of heat in combustion process, so the temperature 

of gas starts to drop more suddenly, which 


makes the quenching layer thickening in chamber. 

Because fuel in quenching layer is difficult to vapor, there 

is increasingly unburned HC not participating in combustion 

as the quenching layer is thickened. When 

unburned HC is more than the decreased part of HC due 

to the extra oxygen from oxygenated fuels, HC emissions 

begin to increase.


Combustion performances 

(a) n = 1600 rpm 

(b) n = 2200 rpm 

Figure 5. Effect of the palm oil monoester on CO emissions. 

Figure 8 displays the test results of in-cylinder pressure 

when the tested diesel engine burnt B0, B25, B50, and 

B100 at 1600 rpm (0.49 MPa) and 2200 rpm (0.63 MPa). 

Pressure was not noticeably enhanced from the pressure 

biodiesel with the high oxygen content having more 

premixed combustion than diesel, which meant that the 

heat released was so concentrated that the maximum 

cylinder pressure rises. The in-cylinder peak pressure 

was raised about 0.3 MPa when burning B100 compared 

to B0 at 1600 r/min. Similar to the maximum explosion 

pressure at 2200 r/min, it was also clearly seen that the 

pressure was increased by 0.2 MPa when B100 is burnt 

in the place of B0. 

Moreover, Figure 9 exhibits the change rates of engine 

in-cylinder pressure with the crank angle at 1600 and 

2200 rpm respectively. From the two figures, it can be 

easily observed that in-cylinder pressure change rate was 

close under the engine running modes 1600 rpm, BMEP 

of 0.49 MPa and 2200 rpm, BMEP of 0.63 MPa when the 

diesel engine combusted four diesels. The two figures

(a) n = 1600 rpm 

(b) n = 2200 rpm 

Figure 6. Effect of the palm oil monoester on NOx emissions. 

also distinctly revealed that the ignition point of the new 

biodiesel and its mixture became shorter than that of 

diesel fuel. This meant that the new biodiesel indeed 

began to burn earlier than diesel fuel. Also, since the 

ignition point is mainly affected by the nature of the 

temperature and fuel, biodiesel's cetane number is higher 

than diesel with CN45 to 50 currently in China, so it owns 

good fire performance. Coupled with the temperature 

increased under high load, the vaporization of biodiesel 

was accelerated, so that premixed combustion also 


increased to make the ignition advance. The two aspects 

decided that ignition delay of biodiesel is less than the 

ordinary diesel in the conditions of high load. 

Furthermore, Figure 10 demonstrates the heat release 

rates of the diesel engine when it was fueled with the 

biodiesel, diesel fuel and their mixture. The heat release 

rate increased when the biodiesel replaced the reference 

diesel fuel during the experiment under two modes. Only 

at the mode 1600 rpm and BMEP of 0.49 MPa, was no 

change observed in the heat release rate. This indicated


(a) n = 1600 rpm 

(b) n = 2200 rpm 

Figure 7. Effect of the palm oil monoester on HC emissions. 

that the combustion velocity of the new palm oil 

monoester in diesel engine combustion chamber is much 

higher than diesel fuel as aforementioned. The reason is 

supposed to be that the oxygen contained in the new 

biodiesel is able to accelerate the engine combustion. 

The curves in the two figures also clearly showed that the 

new biodiesel indeed began to burn earlier than diesel 

fuel as earlier mentioned. This implies that the cetane

(a) n = 1 6 00 r pm , BMEP = 0. 49 MPa 

( b ) n = 22 00 r pm , BMEP = 0. 63 MPa 

Figure 8. Diesel engine in-cylinder pressure when burning different fuels. 

number of the new biodiesel is higher than that of diesel 

fuel. The reason why the new biodiesel has higher cetane 

number must be that the ether group introduced was 

more easily oxidized and released more heat at a given 

time to raise the temperature to accelerate fuel oxidation. 

The cetane number of the new biodiesel is being further 

determined in the laboratory. 


Finally, Figure 11 demonstrates the decreased engine 

thermal efficiency when the biodiesel and its blend with 

diesel fuel, respectively replaced the reference diesel fuel 

in the experiment. Result indicates that it decreased as 

the oxygen content of biodiesel fuel increases. A 

significant decrease by 0.62~1.11%, 3.28~5.82% and 

3.83~8.91% in engine thermal efficiency was also


(a) n = 1600 rpm, BMEP=0.49 MPa 

(b) n = 2200 rpm, BMEP=0.63 MPa 

Figure 9. Diesel engine in-cylinder pressure changing rate when burning 

different fuels. 

observed when the tested engine burnt B25, B50 and 

B100 in place of B0 at 1600 rpm. The similar result of 

1.47~6.19%, 4.85~10.84% and 5.64~14.4% was also 

attained at 2200 rpm. The reason is that the new 

biodiesel contains a certain amount of oxygen which can 

promote the more complete combustion of the biodiesel 

than diesel fuel. This may be due to the lower heat value 

of biodiesel, which causes local hypoxia in the 

combustion process. 

Conclusion 

A novel biodiesel named ethylene glycol monomethyl

(a) n = 1600 rpm, BMEP=0.49 MPa 

(b) n = 2200 rpm, BMEP=0.63 MPa 

Figure 10. Diesel engine heat release rate when burning different fuels. 

ether palm oil monoester, containing moreoxygen than 

traditional biodiesel has been prepared and structurally 

identified by three different technologies. When diesel 

engine was fueled with this palm oil monoester and its 

mixture with diesel fuel in the proportion of 1:1 or 1:3 by 

volume, due to certain amount of oxygen contained in 

them, engine-out exhaust emissions such as smoke, NOx 


was substantially reduced under partial load modes, but 

CO, HC emissions did not change significantly in general, 

but were rather raised under certain load. 

The combustion of the new palm oil monoester can 

lead to a little higher heat release rate than diesel fuel, 

and both engine in-cylinder pressure and its changing 

rate with crankshaft angle increase to some extent


(a) n = 1 6 00 r p m 

(b) n = 2 2 00 r p m 

Figure 11. Engine brake thermal efficiency when burning different fuels. 

because of its higher cetane number and shorter ignition 

delay than diesel fuel. Utilization of the new biodiesel can 

remarkably improve engine brake thermal efficiency, 

since palm oil monoester is ignited earlier during diesel 

engine operation. 


This research was supported by the National Natural 

Science Foundation of China (Grant no. 50976125). 

REFERENCES 

Crooles R (2006). New Findings on Combustion Behavior of 

Oxygenated Synthetic Diesel Fuels. Biomass Bioenergy, 30(4): 461- 

468. 

Cetinkaya M, Karaosmanoglu F (2007). The Effect of Oxygenated Fuels 

on Emissions from a Modern Heavy-Duty Diesel Engine. Energy 

Fuels, 19(8): 645-652. 

Davies G, Henrissat B (1995). Structures and mechanisms of glycosyl

hydrolases. Structure, 3(8):853-859. 

Kaplan G, Arslan R, Surmen A (2006). Modeling the Effects of 

Oxygenated Fuels and Split Injections on DI Diesel Engine 

Performance and Emission. Energy Sources, 28(10): 751-755. 

Lapuerta M, Armas O, Ballesteros R (2005). Oxygenated Fuels for 

Particulate Emissions Reduction in Heavy Duty DI Diesel Engines 

with Common Rail Fuel Injection. Fernandez Fuel, 84(2):773-780. 

Pugazhvadivu M, Jeyachandran K (2005). Experimental Studies of the 

Impact of CETANERTM on Diesel Combustion and Emission. 

Renewable Energy, 30(12): 2189-2202. 


Usta N, Ozturk E, Conkur E (2005). Emission Characteristics of a 

Navistar 7.3 L Turbo diesel Fueled with Blends of Oxygenates and 

Diesel. Energy Conversion Manage. 46(6):741-755. 

Yuan T, Yang P, Wang Y, Meng K, Luo H, Zhang W, Wu N, Fan Y, Yao 

B (2008). Heterologous expression of a gene encoding a 

thermostable beta-galactosidase from Alicyclobacillus acidocaldarius. 

Biotechnol Lett. 30(2): 343-348.



DOI: 10.5897/AJB11.2338 



Optimization of biodiesel production from rice bran oil 

via immobilized lipase catalysis 

Ying Xia Li 1 *, Jian Wei Yang 1 , Feng Li Hui 1 , Wei Wei Fan 1 and Ying Yang 1 

1 School of Life Science and Technology, Nanyang Normal University, Nanyang 473061, China. 

2 School of Life science, Wuhan University of Science and Technology Zhongnan Brach, Wuhan 430223, China. 


The lipase-catalyzed transesterification of rice bran oil and methanol for biodiesel production in hexane 

was investigated. The effects of different hexane weight ratio, methanol molar ratio, reaction 

temperature and immobilized lipase dosage on the total conversion were systematically analyzed by 

response surface methodology (RSM). RSM analysis showed good correspondence between 

experimental and predicted values. The optimal condition was 4.058 molar ratio of methanol to oil, 

temperature 42.295°C, 6.86% immobilized lipase and 0.624 hexane based on rice bran oil weight. 

Moreover, gas chromatography mass spectrometry showed that biodiesel was mainly composed of the 

methyl esters of hexadecanoic, 9,12-octadecadienoic and 9-octadecadienoic acid. The fourier transform 

infrared spectrum of biodiesel also showed the characteristic bands of C=O, O-C-O, C=C and –(CH2)n-. 

Key words: Rice bran oil, biodiesel, response surface methodology, gas chromatography mass spectrometry, 

fourier transform infrared spectrum. 

INTRODUCTION 

Biodiesel (fatty acid methyl esters) is a processed fuel 

mainly derived from vegetable oils, animal fats and waste 

oil. It can replace a significant percentage of petroleum 

diesel in compression ignition diesel engines due to the 

similarity of its properties to those of petroleum light oil 

(Joshi et al., 2008; Fukuda et al., 2001). Biodiesel have 

received considerable attention in recent years as a 

renewable, non-toxic and biodegradable fuel. Currently, 

biodiesel is produced from vegetable oils in Europe and 

North America, and from waste edible oil in Japan and 

China (Lara Pizarro and Park, 2003; Wang et al., 2007). 

Biodiesel from no-edible vegetable oils has emerged as a 

viable alternative source. Rice bran is a byproduct of rice 

process with about 16% fat content. The output of rice 

bran is about 9 million tons in China every year; therefore 

rice bran oil may be a source of biodiesel. 

Biodiesel is usually produced through transesterification 

with alkali catalysts because of high conversion 

rate. However, the alkali process has several drawbacks 

including energy intensiveness, difficulty of glycerol 

recovery, removal of the alkaline catalyst from the product 

*Corresponding author. E-mail: liyx108@ 163.com. 

and treatment of the highly alkaline wastewater (Shimada 

et al., 1999). Utilization of lipase as catalyst for biodiesel 

production has a higher potential compared with acid or 

alkaline as catalyst because the lipase- catalyzed 

process for synthesizing biodiesel can be carried out 

under mild conditions without producing soap, and the 

purification of fatty acid methyl esters is simple to 

accomplish (Lee et al., 2006; Jeon and Yeom, 2010; 

Nelson et al., 1996). However, this method has not been 

used in industrial production of biodiesel due to the 

relatively high price and short operational life. Immobilized 

lipases have generally been used to alter the 

properties of an enzyme by improving its operational 

stability and obtain reusable enzyme derivatives enabling 

the recycling of the enzyme, which reduces the operational 

costs and makes lipase-catalyzed reactions more 

attractive. A suitable reaction medium can also preserve 

both the catalytic activity and the stability of the enzyme 

in the synthetic process (Wyss et al., 2006). 

In this study, a response surface analysis for biodiesel 

production from rice bran oil with immobilized lipase was 

investigated. Methanol substrate molar ratio, enzyme 

amount, hexane amount and reaction temperature were 

four important parameters examined. In addition, the 

properties of biodiesel were also analyzed by infrared

Table 1. Independent variables and their levels for central composite design. 

Independent variable Code 

-1 

Variable level 

0 +1 

Methanol molar ratio X1 2 4 6 

Enzyme amount (%) X2 3 6 9 

hexane weight ratio X3 0.3 0.6 0.9 

Reaction temperature(°C) X4 30 40 50 

spectra and GC- linked mass spectrometry (GC-MS). 


Rice bran oil was obtained locally with average molecular weight 

867.90 g/mol. Lipase was from Candida rugosa. Silica was 

purchased from Aldrich without further purification. All other 

chemicals were obtained commercially and of analytical grade. 

Immobilization of lipase 

Five grams of silica was mixed with 3% methanesulfonic acid 

aqueous solution 102°C for 4 h with constant mixing. The silica was 

then washed with distilled water, dried with vacuum drier and then 

mixed with 3-chloropropyltrimethoxysilane and acetone at 80°C for 

6 h. White precipitate was collected by filtration, washed with water 

and dried at room temperature in air. Finally, the product was 

calcined in air at 500°C for 5 h in a tube furnace to remove the 

organic templates. The treated silica was then suspended in 20 ml 

of 1 mM phosphate buffer solution (pH = 7). 2 ml of glutaraldehyde 

(25% v/v) was added to this solution, followed by incubation at 

room temperature for 2 h to activate the silica which was then 

washed with distilled water and dried at 60°C for 2 h. Furthermore, 

50 mg activated silica and 50mg lipase were added to 25 ml 

phosphate buffer (pH = 7.0) and stirred by a magnetic stirrer at 4°C 

for 6 h. The supernatant was separated from solid material by 

centrifugation, and the solid material was washed with phosphate 

buffer, and then dried overnight at room temperature. 

Apparatus and experimental procedure 

The transesterification reactions were carried out in shaking flasks 

and heated to the reaction temperature on a reciprocal shaker. A 

standard reaction mixture consisted of oil, hexane, methanol and 

immobilized lipase. The methanol was added every 12 h. Finally, 

100 μL of samples were taken after 48 h and centrifuged to obtain 

the upper layer for gas chromatographic analysis. 

Experimental design 

A box-Behnken design was employed to study the response Y, 

namely methyl conversion. The independent variables were X1, X2, 

and X3 representing methanol substrate molar ratio, enzyme 

amount and reaction temperature, respectively. The settings for the 

independent variables were as follows (low/ high value): methanol 

molar ratio 2:1, 4:1, 6:1), enzyme concentration (3, 6 and 9%), 

hexane weight ratio (0.3, 0.6 and 0.9) and reaction temperature (30, 

40, 50°C). Each variable to be optimized was coded at three levels 

-1, 0 and +1. The experimental design is shown in Table 1. In order 

to avoid bias, 27 runs were performed in random order. 

As for the optimization for methyl ester conversion, the 

Li et al. 16315 

responses were analyzed using SPSS 16.0 and Matlab R 2009b 

software. A quadratic polynomial regression model was assumed 

for predicting response. The model proposed for each response of 

Y was; 

Y=A0+ A1X1+ A2X2+ A3X3+ A4X4+ A5X1X2+ A6X1X3+ A7X1X4+ A8X2X3+ 

A9X2X4+ A10X3X4+ A11X1 2 + A12X2 2 + A12X3 2 + A14X4 2 (1) 

Where, Y is the fatty acid methyl ester (FAME) conversion 

percentage; A0 is constant; A1, A2, A3 and A4 are linear coefficients; 

A5, A6, A7, A8, A9 and A10 are cross-product coefficients; A11, A12, A13 

and A14 are quadratic coefficients. In addition, the fitness of the 

model was evaluated by the coefficient of determination (R) and the 

analysis of variance (ANOVA). Quadratic polynomial equations 

were attained by holding one of the independent variances at a 

constant value and changing the level of the other variables. 

Estimation of fatty acid methyl ester 

The fatty acid methyl ester content in the reaction mixture was 

analyzed on GC-14B gas chromatograph equipped with FFAP 

capillary column (0.32 mm × 25 m) and FID detector. The column 

temperature was kept at 150°C for 0.5 min, raised to 250°C at 15°C 

/min and maintained at this temperature for 10 min. The 

temperatures of the injector and detector were set at 245 and 

250°C, respectively. Nitrogen at 70 ml/min was used as the carrier 

gas. Pentadecanoic acid (C15:0, Sigma) methyl ester at 2 mg/ml 

was used as the internal standard. The conversion of biodiesel was 

calculated as the percentage by weight of fatty acid methyl esters 

formed divided by the weight of feed stock initially taken for the 

reaction. 

Composition analysis of biodiesel 

The composition of biodiesel from rice bran oil was analysed by 

Thermo trace GC-MS (DSQII) equipped with a Varian VF-5ms 

column. The temperature of ion source was 250°C and the 

scanning range was from 45 to 450. 

Fourier transform infrared analysis 

The infrared absorption spectra of the samples were obtained in a 

fourier transform infrared spectrometer (NICOLET 5700, Thermo 

Electron Corporation) using KBr tablets in the range of 4000- 400 

cm -1 . 


RSM model fitting 

The major objective of this study was the development


Table 2. Central composite design and experiment data. 

Run X1 X2 X3 X4 True model (%) RSM model (%) Error (%) 

1 -1 -1 0 0 47.4 46.66 1.56 

2 -1 1 0 0 55.74 53.84 3.41 

3 1 -1 0 0 45.68 47.30 3.55 

4 1 1 0 0 60.86 61.32 0.75 

5 0 0 -1 -1 71.93 71.35 0.81 

6 0 0 -1 1 67.93 67.98 0.07 

7 0 0 1 -1 70.86 70.47 0.06 

8 0 0 1 1 72.17 72.41 0.33 

9 -1 0 0 -1 53.74 55.58 3.42 

10 -1 0 0 1 54.37 54.34 0.06 

11 1 0 0 -1 57.58 59.11 2.66 

12 1 0 0 1 59.27 58.91 0.61 

13 0 -1 -1 0 66.09 65.95 0.21 

14 0 -1 1 0 54.1 55.15 1.94 

15 0 1 -1 0 63.45 63.98 0.74 

16 0 1 1 0 76.61 78.32 2.23 

17 -1 0 -1 0 46.34 45.1 2.68 

18 -1 0 1 0 53.37 50.71 4.98 

19 1 0 -1 0 56.45 52.99 6.13 

20 1 0 1 0 55.8 50.93 8.73 

21 0 -1 0 -1 71.44 68.68 3.86 

22 0 -1 0 1 70.15 66.53 5.16 

23 0 1 0 -1 80.4 77.84 3.18 

24 0 1 0 1 82.03 78.57 4.22 

25 0 0 0 0 89.35 89.21 0.15 

26 0 0 0 0 89.65 89.21 0.49 

27 0 0 0 0 91.02 89.21 1.99 

Table 3. Analysis of variance (ANOVA) for the fitted quadratic polynomial model. 

Model Sum of squares df Mean square F 

Regression 4538.989 14 324.213 45.720 

Residual 85.096 12 7.091 

Total 4624.085 26 

R 2 = 0.982, Adj R 2 = 0.960; **significant at 1% level. 

and evaluation of a statistical approach to optimize the 

lipase-catalyzed process. The statistical combination of 

the independent variables in coded and natural values 

along with the predicted and experimental response is 

presented in Table 2. The statistical significance of this 

model was evaluated by the F-test (Table 3), which 

indicated that this regression is statistically significant at 

99% probability level. The coefficient of determination 

(R 2 ) was 0.982, indicating that the model can explain 

982% of the variability. The regression coefficients and 

the corresponding significance are presented in Table 4. 

From the significance of each model term, it could be 

concluded that the regression coefficients of X1, X2 X3, X4, 

2 2 2 2 

X2X3, X1 , X2 , X3 and X4 had significant effect on the 

methyl ester yield. 

Furthermore, the experimental results (Table 2) of this 

analysis were used to develop a linear equation which 

showed the relationships between degree of conversion, 

molar ratio of methanol to oil, reaction temperature, 

hexane and catalyst concentration. By considering the 

coded values, the following expression was presented as 

follows: 

Y = -174.942 + 53.543X1 + 9.479X2 + 127.56X3 + 4.143X4 

+ 0.285X1X2 - 3.198X1X3 + 0.013X1X4 + 6.986X2X3 + 

2 2 2 

0.024X2X4 + 0.442X3X4 - 6.605X1 - 1.167X2 - 142.839X3

2 

- 0.058X4 

(2) 

The regression Equation (2) was solved by MATLAB 7.0 

software. It was indicated that the optimum parameters 

were 4.058 molar ratio of methanol to oil, temperature 

42.295°C, 6.86% immobilized lipase and 0.624 hexane 

weight based on rice bran oil weight. Many parameters 

can influence the performance of methyl ester conversion 

from rice bran oil. Equation 2 indicated that methyl ester 

conversion had a complex relationship with independent 

variables that encompass both first and second-order 

polynomials. The best way of expressing the effect of any 

parameter on the methyl ester yield within the experimental 

parameters under investigated was to generate 

response surface plots of the equation (Figures 1 to 3) as 

a function of the interactions of any two of the variables 

by holding the other one at middle value. From the shape 

of contour plots, the significance of the mutual 

interactions between the independent variables could be 

estimated. An elliptical prole of the contour plots indicates 

remarkable interaction between the independent 

variables. Figures 1 to 3 show similar relationships with 

respect to the effects of each variable. The response 

obtained were convex nature suggesting that there were 

well-defined optimum operating conditions. 

Contour plot and response surface curve indicating 

predicted response surface of methyl ester conversion 

percentage as a function of methanol molar ratio and 

enzyme amount is presented in Figure 1. It was shown 

that the methyl ester yield was sensitive to the methanol 

molar ratio and enzyme amount. An increase in methyl 

ester yield was observed with the increase of methanol 

molar ratio and enzyme amount at first. However, the 

trend was reversed when the methanol molar ratio a 

certain value. The molar ratio of ethanol to oil is one of 

Table 4. Results of regression analysis of a full second-order 

polynomial model. 

Term Coefficient estimated Significance 

Intercept -174.942 0.000 

X1 53.543 0.000 

X2 9.479 0.004 

X3 127.56 0.000 

X4 4.143 0.002 

X1X2 0.285 0.223 

X1X3 -3.198 0.175 

X1X4 0.013 0.846 

X2X3 6.986 0.000 

X2X4 0.024 0.594 

X3X4 0.442 0.338 

X1 2 -6.605 0.000 

X2 2 -1.167 0.000 

X3 2 -142.839 0.000 

X4 2 -0.058 0.000 

Li et al. 16317 

the most important variables affecting ester conversion. 

Stoichiometric ratio for methanol to oil is 3:1, while the 

molar ratio higher than theoretical value would be needed 

to drive the reaction to completion in practice 

(Tippayawong et al., 2005). From the results, the highest 

conversion was obtained at the 4.058: 1 molar ratio. 

Higher methanol concentrations were found to cause 

irreversible denaturation of the lipase. This may be due to 

the fact that methanol is insoluble in the oil at high concentration, 

which made proteins unstable and deprived 

“indispensable water” of enzyme (Qin et al., 2008). Also, 

methyl ester decreased with excessive enzyme amount 

due to decrease of enzyme activity caused by lipase 

aggregation (Masaru et al., 2001; Balaraman and 

Soundar, 2005). The elliptical profile of the contour plot 

suggested that the interaction between the methanol 

molar ratio and enzyme amount was strong. 

Interaction of methanol molar ratio and temperature on 

methyl ester conversion is shown in Figure 2. Influence of 

methanol molar ratio and temperature on production of 

methyl ester indicated significant variation both above 

and below the optimum values. Reaction temperature 

also had significant effect on the activity and stability of 

the lipase. Relative higher temperature can activate the 

substrate molecules, reduce the viscosity of reaction and 

lead to a higher conversion. However, too high temperature 

may lead to lipase denaturation and the loss of 

solvent through evaporation (Tippayawong et al., 2005). 

Response surface curve and contour plot showing 

predicted response surface of methyl ester conversion as 

a function of hexane content and methanol molar ratio 

was revealed (Figure 3). An increase in methyl ester yield 

was observed with the increasing of hexane, and 0.624 

hexane weight ratio to oil was the optimal amount for this 

reaction. This might be caused by the improved solubility


Figure 1. Response surface curve (A) and contour plot (B) showing predicted response surface of 

methyl ester conversion as a function of methanol molar ratio and enzyme amount (temperature = 

42.295°C, hexane weight ratio = 0.624). 

of methanol and glycerol in the reaction medium, 

therefore lipase can maintain high catalytic activity. The 

ME yield decreased gradually by further increasing the 

amount of hexane due to the dilution of reactants as more 

hexane present in the reaction (Zheng et al., 2009). 

Qualitative analysis of FAME 

Chromatogram of biodiesel from rice bran oil (Figure 4) 

showed that there were seven fatty acid methyl esters 

analyzed with MS (data not show). The composition of

Figure 2. Response surface curve (A) and contour plot (B) showing predicted response 

surface of methyl ester conversion as a function of methanol molar ratio and temperature 

(immobilized lipase = 6.86%, hexane weight ratio = 0.624). 

the biodiesel analyzed by GC-MS suggested that there 

were three main fatty acid methyl esters including 

hexadecanoic acid methyl ester (C17H34O2), 9,12- 

octadecadienoic acid methyl ester (C19H34O2) and 9octadecadienoic 

acid methyl ester (C19H36O2). These 

components made up more than 90% of the total 

biodiesel. Some minor methyl esters were also detected 

and shown in Table 5. Polyunsaturated fatty acids with 

Li et al. 16319 

four or more double bonds, which are susceptible to 

oxidation during storage, thus reduced the acceptability 

for production of biodiesel (Chisti, 2007). The GC-MS 

study demonstrated that the biodiesel from rice bran oil 

contains mainly saturated and mono-unsaturated fatty 

acids (~68% of the total fatty acyl methyl esters), which 

advocated its high oxidative stability. Thus, rice bran oil 

could be considered as a potential organism for biodiesel


production. 

Fourier transform Infrared Spectroscopy 

Figure 3. Response surface curve (A) and contour plot (B) showing predicted response 

surface of FAME conversion as a function of methanol molar ratio and hexane weight 

ratio (immobilized lipase = 6.86%, temperature = 42.295°C). 

The fourier transform infrared spectrum of rice bran oil is 

shown in Figure 5(A). The absorption bands at 2925.4 

and 2855.3 cm -1 was attributed to –CH2- group and the 

band at 1745 cm -1 to the carbonyl group. The band at 

1163.4 cm -1 was ascribed to C-O-C from the ester 

functional group and at 709.9 cm -1 related to the -(CH2)n- 

sequence of aliphatic chains of fatty acids. In addition, 

Figure 5B displayed the fourier transform infrared 

spectrum of biodiesel from the rice bran oil. The spectrum 

presented a band at 3007.3 cm -1 ascribed to the H-C= 

group and the strong band at 1743.4 cm -1 to the ester

Li et al. 16321 

Figure 4. (A) Gas chromatography spectrum of FAME, mass spectra of (B) hexadecanoic acid methyl ester, (C), 12-octadecadienoic acid methyl ester, and (D) 9octadecadienoic 

acid methyl ester. 

.


Figure 4. Continued. 

.

Table 5. The retention times and content of each fatty acid methyl ester in biodiesel 

Fatty acid methyl ester content (%) Retention time (min) Content (%) 

Methyl tetradecanoate (C15H30O2) 5.44 0.37 

Hexadecanoic acid methyl ester (C17H34O2) 6.73 21.39 

9,12-Octadecadienoic acid methyl ester (C19H34O2) 8.18 32.15 

9-Octadecadienoic acid methyl ester (C19H36O2) 8.25 42.39 

Octadecadienoic acid methyl ester (C19H38O2) 8.45 2.45 

11-Eicosenoic acid methyl ester (C21H40O2) 10.26 0.46 

Eicosenoic acid methyl ester (C21H42O2) 10.53 0.79 

Figure 5. Fourier transform infrared spectroscopy rice bran oil (A) and biodiesel (B) 

Li et al. 16323


C=O axial deformation and two medium bands at 110.6 

and 1190.3 cm -1 related to C-O bond. 

Conclusion 

In this study, hexane was used as the reaction medium 

for the preparation of biodiesel production through the 

immobilized lipase-catalyzed transesterification of rice 

bran oil and methanol. By considering the coded values, 

the regression expression was presented as; 

Y= -174.942 + 53.543X1 + 9.479X2 + 127.56X3 + 4.143X4 

+ 0.285X1X2 - 3.198X1X3 + 0.013X1X4 + 6.986X2X3 + 

2 2 2 

0.024X2X4 + 0.442X3X4 - 6.605X1 - 1.167X2 - 142.839X3 

- 0.058X4 2 

The optimal conditions was 4.058 molar ratio of methanol 

to oil, temperature 42.295°C, 6.86% immobilized lipase 

and 0.624 hexane based on rice bran oil weight by RSM 

analysis. Moreover, GC-MS showed that biodiesel was 

mainly composited of the methyl esters of hexadecanoic, 

9,12-octadecadienoic and 9-octadecadienoic acid. 

Furthermore, the infrared spectrum of biodiesel showed 

the characteristic bands of C=O, O-C-O, C=C and – 

(CH2)n-. 


This work was financially supported by research start-up 

costs of highlevel personnel of the Nanyang Normal 

University (ZX 2011003). 

REFERENCES 

Balaraman M, Soundar D (2005). An articial neural network analysis of 

porcine pancreas lipase catalysed esterication of anthranilic acid with 

methanol. Process. Biochem. 40: 3372-3376. 

Chisti Y (2007). Biodiesel from microalgae. Biotechnol. Adv. 25: 294- 

306. 

Fukuda H, Kondo A, Noda H (2001). Biodiesel fuel production by 

transesterification of oils. J. Biosci. Bioeng. 92: 405-416. 

Jeon DJ, Yeom SH (2010). Two-step bioprocess employing whole cell 

and enzyme for economical biodiesel production. Korean J. Chem. 

Eng. 27(5): 1555-1559. 

Joshi HC, Toler J, Walker T (2008). Optimization of cotton seed oil 

ethanolysis to produce biodiesel high in gossypol content. J. Am. Oil. 

Chem. Soc. 85: 357-363. 

Lara Pizarro AV, Park EY (2003). Lipase-catalyzed production of 

biodiesel fuel from vegetable oils contained in waste activated 

bleaching earth. Proc. Biochem. 38: 1077-1082. 

Lee DH, kim JM, Shin HY, Kang SW, Kim SW (2006). Biodiesel 

production using a mixture of immobilized Rhizopus oryzae and 

Candida rugosa lipases. Biotechnol. Bioprocess, E. 11: 522-525. 

Masaru K, Taichi S, Akihiko K, Hideki F (2001). Effect of methanol and 

water contents on production of biodieselfuel from plant oil catalyzed 

by various lipases in a solvent free system. J. Biosci. Bioeng. 91(1): 

12-15. 

Nelson LA, Foglia TA, Marmer WN (1996). Lipase catalyzed production 

of biodiesel. J. Am. Oil. Chem. Soc. 73: 1191-1195. 

Qin HE, Xu Y, Teng Y, Wang D (2008). Biodiesel production catalyzed 

by whole-cell lipase from Rhizopus chinensis. Chin. J. Catal. 29(1): 

41-46. 

Shimada Y, Watanabe Y, Samukawa T, Sugihara A, Noda H, Fukuda H, 

Tominaga Y (1999). Conversion of vegetable oil to biodiesel using 

immobilized Candida antarctica lipase. J. Am. Oil. Chem. Soc. 76(7): 

789-794. 

Tippayawong N, Kongjareon E, Jompakdee W (2005). Ethanolysis of 

soybean oil into biodiesel: process optimization via central composite 

design. J. Mech. Sci. Technol. 19(10): 1902-1909. 

Wang Y, Ou SY, Liu PZ, Zhang ZS (2007). Preparation of biodiesel from 

waste cooking oil via two-step catalyzed process. Energ. Convers. 

Manage. 48: 184-188. 

Wyss A, von Stockar U, Marison IW (2006). A novel reactive 

perstraction system based on liquid-core microcapsules applied to 

lipase-catalyzed biotransformations. Biotechnol. Bioeng. 93(1): 28- 

39. 

Zheng Y, Quan J, Ning X, Zhu LM, Jian B, He ZY (2009). Lipasecatalyzed 

transesterification of soybean oil for biodiesel production in 

tert-amyl alcohol. World. J. Microbiol. Biotechnol. 25: 41-46.



DOI: 10.5897/AJB11.1600 



Study on correlation between polymorphism of 

adiponectin receptor gene and essential hypertension 

of Xinjiang Uygur, Kazak and Han in China 

Wang Zhong 1 *, Chen Shaoze 1 , Wang Daowen 2 , Wang Li 1 , Zhai Zhihong 1 , Duan Juncang 1 , 

Zhang Wangqiang 1 and Zhang Jingyu 3 

1 The Second Division of Cardiology, First Affiliated Hospital of Shihezi University School of Medicine, Xinjiang, Shihezi, 

832008, China. 

2 The Department of Cardiology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, 

Hubei, Wuhan, 430030, China. 

3 Department of Epidemiology, Shihezi University School of Medicine, Xinjiang, Shihezi 8320002, China. 


Studies have shown that adiponectin receptors expression was positively correlated with insulin 

sensitivity and insulin resistance was closely related with incidence and development of hypertension. 

The aim of this study was to examine the correlation between the polymorphism of two adiponectin 

receptor allelic genes, rs12045862T/C and rs7539542G/C, and essential hypertension of Xinjiang Uygur, 

Kazak and Han in 309 cases of patients with essential hypertension in Xinjiang Uygur, 264 cases of 

patients with essential hypertension in Kazak and 368 cases of patients with essential hypertension in 

Han. The control group selected 300 cases of normal Uygur, 275 cases of normal Kazak and 349 cases of 

normal Han. The TaqMan probe was used to test the polymorphism of adiponectin receptor gene in two 

alleles, rs12045862T/C and rs7539542G/C. The gene polymorphism of adiponectin receptor gene 

rs12045862T/C in essential hypertension group of Xinjiang Uygur, Kazak and Han had no significant 

difference compared with the control group (P>0.05). While the gene polymorphism of adiponectin 

receptor gene rs7539542G/C in essential hypertension group of Xinjiang Uygur, Kazak and Han had no 

significant difference compared with the control group (P>0.05). In conclusion, the gene polymorphism 

of adiponectin receptor gene rs12045862T/C and rs7539542G/C were not significantly associated with 

essential hypertension in Xinjiang Uygur, Kazak and Han, which was the same in the three ethnic 

groups. 

Key words: Adiponectin receptor, gene polymorphism, essential hypertension. 

INTRODUCTION 

Essential hypertension (EH) is a long-term interaction 

result of the genetic factors and environmental factors, 

and its etiology and pathogenesis is very complex 

(Williams, 1991). EH is a multiple gene disease (Lifton, 

1996), and the genetic factors take on 30 to 50% in the 

rate of occurrence in the EH. Studies have indicated that 

*Corresponding author. E-mail: wangzshz@163.com. Tel: 

86-993-2859226 or 86-13899525766. 

the incidence of this disease has obvious tendency of 

familial aggregation and the genetic factors determine 

individual susceptibility to high blood pressure. Hence, the 

studies on hypertension susceptibility genes are more and 

more attended. Study found that insulin resistance was 

closely related with incidence and development of 

hypertension, and was an independent risk factor for 

cardiovascular disease. At least half of patients with 

essential hypertension exhibit insulin resistance. 

Adiponectin receptors (ADIPOR) were cloned in 2003 

and the expression of adiponectin receptors is closely


Table 1. Sequences of probes and primers. 

rs ID Primer (5'→3') Probe (5'→3') Allele 

rs12045862 

rs7539542 

F 5'-CTCCTTTGCCCCTCTCCAG-3' 

R 5'-AGAACCCCTACTCTAAAAAGATGTGG-3' 

F 5'-CAAATAATCAAGACCATACATGTGAAATCT-3' 

R 5'-AAAGAAACCTGCTATCATTGCTATGTATC-3' 

F, Forward primer; R, reverse primer; FAM, HEX, fluorescence dyes. 

related with insulin resistance (Bluher M et al., 2006). 

Studies (Civitarese et al., 2004) have shown that 

adiponectin receptors expression was positively corre- 

lated with insulin sensitivity. Adiponectin receptor gene 

variants were also correlated with obesity and insulin 

resistance (Stefan et al., 2005; Siitonen et al., 2006). The 

adiponectin receptors were perhaps significantly related 

to blood pressure through insulin resistance and obesity. 

Some studies have shown that adiponectin receptor 1 

(ADIPOR1) and adiponectin receptor gene 2 (ADIPOR2) 

gene polymorphisms have correlation with fasting insulin 

levels in 2-h postprandial insulin levels and body mass 

index. 

Therefore, based on the relevant pathophysiological 

mechanisms in type 2 diabetes and hypertension, we 

hypothesized that adiponectin receptor gene poly- 

morphism may have some relevance with hypertension, 

and designed a case-control study. In Xinjiang Uygur, 

Kazak and Han populations, adiponectin receptor 1 

(ADIPOR1) gene and adiponectin receptor 2 (ADIPOR2) 

genes of the two allele’s rs12045862T/C and 

rs7539542G/C were detected and the correlation between 

adiponectin receptor gene polymorphism and essential 

hypertension in Xinjiang Uygur, Kazak and Han were 

investigated. 


Three hundred and nine cases of patients with essential 

hypertension in Xinjiang Uygur, 264 cases of patients with essential 

hypertension in Kazak and 368 cases of patients with essential 

hypertension in Han were selected from May to December in 2008 

for Xinjiang Uygur epidemiological investigation, while the control 

group selected 300 cases of normal Uygur, 275 cases of normal 

Kazak and 349 cases of normal Han. Diagnosis of essential 

hypertension met the prevention and treatment guide of 

hypertension in China in 2004. The patients with essential 

hypertension had no complications with clinical symptoms, did not 

take any blood pressure medicine before 2 weeks epidemiological 

survey and maintained relative stability between diet and body 

weight. After taking history, physical examination and relevant 

biochemical tests, patients with serious liver and kidney dysfunction, 

secondary hypertension, diabetes, stroke, unstable angina, 

myocardial infarction, two levels of cardiac function or more, 

pregnancy, lactation or long-term use of contraceptive drugs were 

exempted. All subjects were informed of the details and possible 

5' FAM-CTCATCCTTCCCCCAA-MGB 3' 

5' HEX-CTCATCCCTCCCCCA-MGB 3' 

5' FAM-TGCCAAGTGTCTTCTGT-MGB 3' 

5' HEX-TGCCAAGTCTCTTCTGT-MGB 3' 

hazards, and signed informed consent. 

DNA extraction and genotyping 

The peripheral venous blood of patients and populations in control 

group were collected after fasting for 12 to 14 h using EDTA-Na 

anticoagulation. After centrifugation with 3000 rev / min (rpm) for 15 

min, within 30 min the plasma was kept at -80°C in a refrigerator. 

The human genomic DNA extraction kit produced by the Japanese 

FUJIFILM was used. The genomic DNA of all the samples were 

extracted in strict accordance with the instructions provided. DNA 

concentration of TE solution from extracted DNA samples was 

measured by DNA / RNA quantitative machine, then concentration 

was diluted to 10 ng/μL, and saved in -80°C refrigerator for use. Two 

loci of fluorescent probes and PCR primers were designed and 

provided by Shanghai Jikang Biotechnology Co. Ltd. All fluorescent 

probes were TaqMan MGB probe, containing MGB modified gene, 

the 5' end labeled with reporter fluorescent group and 3' end labeled 

with non-fluorescent quenching moiety (primers and probe 

sequences in Table 1). 

PCR amplification system, reaction conditions and analysis of 

genotype 

Two loci of the PCR amplification system were as follows: the total 

reaction volume was 5 μL, including 1 × Universal Mastermix (ABI), 

two probes with a final concentration of 0.2 μmol/L, upstream and 

downstream primers with the final concentration of 1 μmol/L, and 

genomic DNA with final concentration of 1 ng/μL. Reaction 

conditions: 50°C for 2 min, 95°C denaturation for 10 min, then 95°C 

for 15 s, 60°C for 1 min for 50 cycles. ABI 7900HT thermal cycler 

was applied for amplification. Automatic sequence detection system 

software 2.1 (confidence interval set to 95%) was used to 

distinguish between the types of alleles. A total of 10% of all 

genotypes were repeated in independent PCRs to check for 

consistency and to ensure intraplate and interplate genotype quality 

control. No genotyping discrepancies were detected between the 

repeated samples. In addition, all the DNA samples for cases and 

controls were run in the same batches. 


Statistical analysis was finished by SPSS13.0 software. 

Measurement data with normal distribution are presented as mean ± 

standard error. The genotype equilibrium degrees were consistent 

with Hardy-Weinberg, and the genotype and allele frequencies 

between case groups and control groups were compared using 

Chi-square (χ2) test. Count data between groups were compared 

T 

C 

G 

C

Table 2. Baseline characteristics of three ethnic samples. 

Zhong et al. 16327 

Kazak Uygur Han 

Characteristic Control Hypertension Control Hypertension Control Hypertension 

(n = 275) (n = 264) (n = 300) (n = 309) (n = 349) (n = 368) 

Age (years) 51.6 ± 12.5 50.0 ± 11.4 53.9 ± 9.7 54.2 ± 8.8 48.1 ± 9.9 47.1 ± 10.7 

Men (%) 45.1 46.6 52.1 51.7 50.7 49.8 

BMI (kg/m 2 ) 23.5 ± 3.4 27.6 ± 3.9* 27.4 ± 4.4 27.6 ± 4.8 22.56 ± 3.6 25.28 ± 2.91* 

SBP (mm Hg) 118 ± 11 151 ± 15* 123 ± 9 154 ± 17* 118.6 ± 11.8 148.9 ± 13.1* 

DBP (mm Hg) 73 ± 9 96 ± 12* 76 ± 6 95 ± 3* 78.1 ± 7.1 97.9 ± 10.2* 

BMI indicate body mass index; SBP, systolic blood pressure; DBP diastolic blood pressure; yrs years. Continuous variables are given as mean ± SD, 

*P


Table 3. Association between rs12045862 variants and EH. 

n (%) n (%) n (%) 

Adjusted ORs (95% CI) 

Mm +mm vs MM 

Control 

EH 

349 

368 

0.403 

0.409 

0.860 130 

130 

157 

175 

62 

63 

0.786 

1.0 (ref) 

0.414 to 0.432 

SNP Ethnicity Population N MAF Pallelic MM Mm mm Pdominant 

rs12045862 

Han 

Uygur 

Kazak 

Control 300 0.453 0.995 90 148 62 

1.0 (ref) 

0.879 

EH 309 0.455 89 159 61 0.484 to 0.503 

Control 275 0.480 0.880 70 146 59 

1.0 (ref) 

0.960 

EH 264 0.473 68 142 54 0.421 to 0.441 

SNP, Single nucleotide polymorphism; N, number of subject; MAF, minor allele frequency; Pallele, value of allele was determined by a two-sided 2 

test. EH essential hypertension; ref, reference; M: major allele, m: minor allele. Pdominant value and adjusted odds ratio (95% confidence interval) 

were computed with multivariate logistic regression analysis by adjusting for gender, age and body mass index. 

Table 4. Association between rs7539542 variants and EH. 

n (%) n (%) n (%) 

Adjusted ORs (95% CI) 

Mm + mm vs MM 

Control 

EH 

349 

368 

0.371 

0.378 

0.654 137 

152 

165 

156 

47 

61 

0.318 

1.0 (ref) 

0.318 to 0.336 

SNP Ethnicity Population N MAF Pallelic MM Mm mm Pdominant 

rs7539542 

Han 

Uygur 

Kazak 

Control 300 0.435 0.804 95 149 56 

1.0 (ref) 

0.230 

EH 309 0.382 116 142 47 0.222 to 0.238 

Control 275 0.418 0.830 89 142 44 

1.0 (ref) 

0.969 

EH 264 0.411 88 135 41 0.970 to 0.976 

SNP, Single nucleotide polymorphism; N, number of subject; MAF, minor allele frequency; Pallele, value of allele was determined by a two-sided 

2 test. EH essential hypertension; ref, reference; M: major allele, m: minor allele. Pdominant value and adjusted odds ratio (95% confidence 

interval) were computed with multivariate logistic regression analysis by adjusting for gender, age and body mass index. 

variety of genetic and environmental factors lead to high 

blood pressure, and the genes involved in blood pressure 

regulation have ethnic and regional specificity. Kazak and 

Uygur characteristics of the incidence of hypertension are 

not the same. Kazakh is one of the five highest incidences 

of hypertension ethnic groups, with hypertension pre- 

valence rate of 17.36%, while the prevalence rate of 

Uygur was only 10.33%, which is lower than the average 

level in national prevalence rate of hypertension in all 

ethnic groups. In Kazak, hypertension not only has high 

incidence but also the early onset, the increase degree of 

blood pressure was severe, and familial aggregation is 

also higher than the Uighur. Meanwhile the life 

environmental factors of the two national groups are very 

different, such as the Kazak are herdsmen but Uyghur are 

farmers; Kazaks live in the Tianshan mountains with the 

colder climate of residence, but Uighur live far away from 

the oasis of Tianshan mountains and hence the climate is 

relatively hot; the meat and salt intake in Kazakh were 

higher than in Uygur, while the intake of fruits and 

vegetables less than the Uighur. The differences of 

incidence characteristics of two ethnic in hypertension 

suggests that hypertension of the two nations may exist in 

different pathogenic mechanisms. 

In this study, Xinjiang Uygur, Kazak and Han popu- 

lations had as research subjects, 309 cases of patients 

with essential hypertension in Xinjiang Uygur, 264 cases 

of patients with essential hypertension in Kazak and 368 

cases of patients with essential hypertension in Han, 

while the control group selected 300 cases of normal 

Uygur, 275 cases of normal Kazak and 349 cases of 

normal Han. The TaqMan probe was used to test the 

gene polymorphism in two allele’s rs12045862T/C and 

rs7539542G/C of adiponectin receptor1 and adiponectin 

receptor2. Our results show that the gene polymorphism 

of adiponectin receptor gene rs12045862T/C in essential 

hypertension group of Xinjiang Uygur, Kazak and Han 

had no significant difference compared with the control 

group. The gene polymorphism of adiponectin receptor 

gene rs7539542G/C in essential hypertension group of

Xinjiang Uygur, Kazak and Han had no significant 

difference compared with the control group. This 

conclusion is consistent in the three ethnic groups. This 

may be because adiponectin receptors had correlation 

with essential hypertension only indirectly through insulin 

resistance, or polymorphisms sites selected in this study 

did not significantly affect the gene function of adiponectin 

receptor, and also, the selected single SNP site for 

correlation analysis may not be very good coverage of all 

the variations of the gene. On the other hand, each of 

hypertension-related genes may have small role in the 

pathogenesis of hypertension, since different 

hypertension-related genes may combine to significantly 

increase blood pressure. 

Therefore, many variations of hypertension candidate 

genes and their interaction are the current research 

strategy. In subsequent studies, we still need to increase 

the sample size, select prospective study design and 

choose more polymorphisms covering the entire gene 

region of study. In summary, hypertension is a polygenic 

and multifactorial genetic disease, and the issues on 

many related genes in the major and minor genes, as well 

as the complexity of the interactions between genes and 

the environment, need to be further explored. 

REFERENCES 

Blüher M, Bullen Jr. JW, Lee JH, Kralisch S, Fasshauer M, Klöting N, 

Niebauer J, Schön MR, Williams CJ, Mantzoros CS (2006). 

Circulating adiponectin and expression of adiponectin receptors in 

human skeletal muscle: associations with metabolic parameters and 

insulin resistance and regulation by physical training. J. Clin. 

Endocrinal. Metab. 91: 2310–2316. 

Civitarese AE, Jenkinson CP, Richardson D, Bajaj M, Cusi K, Kashyap S, 

Berria R, Belfort R, DeFronzo RA, Mandarino LJ, Ravussin E (2004). 

Adiponectin receptors gene expression and insulin sensitivity in 

non-diabetic Mexican American with or without a family history of 

Type 2 diabetes. Diabetologia, 47: 816-820. 

Fasshauer M, Paschke R, Stumvoll M (2004). Adiponectin, obesity, and 

cardiovascular disease. Biochimie, 86: 779-784. 

Guo X, Saad MF, Langefeld CD, Williams AH, Cui J, Taylor KD, Norris 

JM, Jinagouda S, Darwin CH, Mitchell BD, Bergman RN, Sutton B, 

Chen YD, Wagenknecht LE, Bowden DW, Rotter JI (2006). 

Genome-wide linkage of plasma adiponectin reveals a major locus on 

chromosome 3q distinct from the adiponectin structural gene: the 

IRAS Family Study. Diabetes, 55: 1723–1730. 

Zhong et al. 16329 

Hulver MW, Saleh O, MacDonald KG, Pories WJ, Barakat HA (2004). 

Ethnic differences in adiponectin levels. Metabolism, 53 : 1-3. 

Hu C, Jia WP, Zhang R, Wang CR, Fang QC, Ma XJ, Lu JX, Xu J, Xiang 

KS (2007). Relationship between adiponectin receptor 1 gene 

-3881T/C variant and glucose metabolism in the Chinese. Zhonghua 

Yi Xue Yi Chuan Xue Za Zhi. 24: 27-30. 

Iwashima Y, Katsuya T, Ishikawa K, Ouchi N, Ohishi M, Sugimoto K, Fu 

Y, Motone M, Yamamoto K, Matsuo A, Ohashi K, Kihara S, Funahashi 

T, Rakugi H, Matsuzawa Y, Ogihara T (2004). Hypoadiponectinemia 

is an independent risk factor for hypertension. Hypertension, 43: 

1318-1323. 

Kantartzis K, Fritsche A, Machicao F, Häring HU, Stefan N (2006).The 

-8503 G/A polymorphism of the adiponectin receptor 1 gene are 

associated with insulin sensitivity dependent on adiposity. Diabetes 

Care, 29: p. 464. 

Lifton RP (1996). Molecular genetics of human blood reassure variation. 

Science, 27: 2676-2680. 

Stefan N, Machicao F, Staiger H, Machann J, Schick F, Tschritter O, 

Spieth C, Weigert C, Fritsche A, Stumvoll M, Häring HU (2005). 

Polymorphisms in the gene encoding adiponectin receptor 1 are 

associated with insulin resistance and high liver fat. Diabetologia, 48: 

2282-2291. 

Siitonen N, Pulkkinen L, Mager U, Lindström J, Eriksson JG, Valle TT, 

Hämäläinen H, Ilanne-Parikka P, Keinänen-Kiukaanniemi S, 

Tuomilehto J, Laakso M, Uusitupa M (2006). Association of sequence 

variations in the gene encoding adiponectin receptor 1 (ADIPOR1) 

with body size and insulin levels: the Finnish Diabetes Prevention 

Study. Diabetologia. 49: 1795-1805. 

Williams RR (1991). Are there interaction and relations between genetic 

and environmental factors predisposing to a high blood pressure. 

Hypertension, 18(1): I 29-137. 

Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama 

T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, 

Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, 

Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, 

Kadowaki T(2003). Cloning of adiponectin receptors that mediate 

antidiabetic metabolic effects. Nature, 423: 762-769.



DOI: 10.5897/AJB11.2071 



Mechanism of action of pefloxacin on surface 

morphology, DNA gyrase activity and dehydrogenase 

enzymes of Klebsiella aerogenes 

Neeta N. Surve and Uttamkumar S. Bagde 

Department of Life Sciences, Applied Microbiology Laboratory, University of Mumbai, Vidyanagari, Santacruz (E), 

Mumbai 400098, India. 


The aim of the present study was to investigate susceptibility of Klebsiella aerogenes towards 

pefloxacin. The MIC determined by broth dilution method and Hi-Comb method was 0.1 µg/ml. 

Morphological alterations on the cell surface of the K. aerogenes was shown by scanning electron 

microscopy (SEM) after the treatment with pefloxacin. It was observed that the site of pefloxacin action 

was intracellular and it caused surface alterations. The present investigation also showed the effect of 

Quinolone pefloxacin on DNA gyrase activity of K. aerogenes. DNA gyrase was purified by affinity 

chromatography and inhibition of pefloxacin on supercoiling activity of DNA gyrase was studied. 

Emphasis was also given on the inhibition effect of pefloxacin on dehydrogenase activity of K. 

aerogenes. 

Key words: Pefloxacin, Klebsiella aerogenes, scanning electron microscopy (SEM), deoxyribonucleic acid 

(DNA) gyrase, dehydrogenases, Hi-Comb method, minimum inhibitory concentration (MIC). 

INTRODUCTION 

Klebsiella spp. is opportunistic pathogen, which primarily 

attack immunocompromised individuals who are 

hospitalized and suffer from severe underlying diseases 

such as diabetes mellitus or chronic pulmonary obstruction. 

Klebsiella accounts for 6 to 17% of all nosocomial 

urinary tract infections (UTI) and shows an even higher 

incidence in specific groups of patients at risk, for 

example, patients with neuropathic bladders or with 

diabetes mellitus (Bennett et al., 1995; Lye et al., 1992). 

Since nalidixic acid and its first analogs, pipemidic acid 

and oxolinic acid, were found to have good activity 

against Gram-negative bacteria involved in UTI, the 

quinolone class has been intensively studied and many 

new active products have been synthesized (Albrecht, 

1977; Domagala et al., 1986). They are characterized by 

*Corresponding author. E-mail: bagdeu@yahoo.com. Tel: 

9821681672. 

Abbreviations: SEM, Scanning electron microscope; UTI, 

urinary tract infections; MIC, minimum inhibitory concentration. 

broad spectrum activity with oral efficacy. These agents 

have been shown to be specific inhibitors of the A subunit 

of the bacterial topoisomerase deoxyribonucleic acid 

(DNA) gyrase, the Gyr B protein being inhibited by 

coumermycin A1 and novobiocin (Gellert et al., 1976; 

Hooper et al., 1982). 

DNA gyrase are topoisomerases catalyze the supercoiling 

of relaxed closed circular DNA coupled to the 

hydrolysis of Adenosine triphosphate, ATP (Wang and 

Liu, 1979). Quinolone antimicrobial agents form a 

complex with gyrase and DNA that blocks replication fork 

movement (Drlica, 1984; Drlica et al., 1980). To understand 

in vivo mechanism of pefloxacin, we examined the 

contribution of enzyme inhibition to drug action against K. 

aerogenes. 

In this report, sensitivity of Klebsiella aerogenes against 

quinolone pefloxacin was studied by broth dilution 

method and Hi-Comb method (Hi-media) and MIC was 

determined. Morphological alterations on the cell surface 

of K. aerogenes were studied after treatment with 

pefloxacin by scanning electron microscope (SEM). 

Emphasis was also given on inhibition of dehydro- 

genases enzymes of organism by the antibiotic.


Bacterial strain, culture media and drug 

K. aerogenes NCIM 2239 was obtained from the National Collection 

of Industrial Microorganisms (NCIM), Pune, India. Bacterial strain 

was grown at 37°C in nutrient broth medium (Hi-media, India) and 

maintained at 5°C. Culture medium was autoclaved at 121°C for 20 

min, and the organism was subcultured in nutrient broth and 

nutrient agar plates and after 24 h incubation used as an inoculum. 

Drug pefloxacin was obtained from Sigma chemicals (U.S.A.) in the 

form of pefloxacin mesylate dihydrate. 

Determination of minimum inhibitory concentration (MIC) 

Sensitivity of pefloxacin against K. aerogenes was studied by 

determining Minimum inhibitory concentration (MIC) by broth 

dilution method and by Hi-Comb method (Hi-media, India). In Broth 

dilution method, different concentrations of antibacterial agents 

were prepared. Inoculums were adjusted to 0.5 Macfarland turbidity 

standards and an aliquot of 0.1 ml of inoculums was added to each 

tube of dilution. The tubes were incubated at 37°C overnight. MIC 

was read visually following 24 h of incubation and was defined as 

the lowest concentration that produced no visible turbidity (NCCLS, 

2001). 

In Hi-Comb method, at least 4 to 5 well isolated colonies of same 

morphological type from agar plate were touched with a wire loop 

and growth was transferred to tube containing 5 ml of broth. 

Turbidity was compared with 0.5 Macfarland standards and 

adjusted with sterile saline or broth if required. Organism was 

spread on agar plates by spread plate method and Hi-Comb strip 

was placed on medium in sterile condition. Plate was incubated for 

24 h at 37°C and zone of inhibition was observed. According to Hi- 

Comb MIC test, MIC value is the value at which the zone converges 

on the comb-like projections of the strips and not at the handle and 

zone of inhibition below the lowest concentration is to be 

considered (CLSI, 2008). 

Effect of pefloxacin on morphology of K. aerogenes 

Surface morphology was studied by SEM on Quanta 200 ESEM 

system (Icon Analytical Equipment Pvt. Ltd., India), after 

determining the MIC. Specified concentration of Pefloxacin (0.1 

µg/ml) was added to culture in the logarithmic phase of growth (12 

h culture) at 37°C. After different incubation time period 3, 6 and 24 

h with pefloxacin, SEM was performed. Treated and untreated cells 

after incubation were washed by centrifugation in 0.9% NaCl and 

fixed in 2% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.2) and 

images were taken by SEM (Klainer and Perkins, 1974). 

Effect of pefloxacin on dehydrogenases activity 

According to the procedure followed by Guha and Mookerjee 

(1978), the effect of pefloxacin on inhibition of dehydrogenase 

enzymes activity of K. aerogenes was studied. Cells grown for 48 h 

at 37°C were used as samples. According to the procedure, 

chloramphenicol was added to disrupt cell wall and MIC 

concentration of pefloxacin was added. 0.005 M substrates of TCA 

cycle, α-Ketoglutaric acid, succinic acid, isocitric acid and glutamic 

acid was added to each tube. 0.5 M Potassium phosphate buffer at 

pH 7.0, 0.3M MgCl2 and Triphenyl Tetrazolium Chloride solutions (9 

mg/ml) were finally added and OD values of the control tubes were 

measured and percentage inhibition of the activity of enzymes was 

calculated. 

Surve and Bagde 16331 

Effect of pefloxacin on DNA gyrase of K. aerogenes 

DNA gyrase was purified from K. aerogenes by affinity chromatography 

(Tabary et al., 1987; Bjornsti and Osheroff, 1999). The 

work was carried out at National Institute of Research in 

Reproductive Health, Mumbai, India. K. aerogenes (40 g) was 

suspended in 40 ml of 100 mM Tris hydrochloride (pH 7.6) -20% 

sucrose. Dithiothreitol, EDTA, phenylmethylsulfonylfluoride were 

added to 2, 20 and 1 mM, respectively. 16 mg of lysozyme was 

added after 10 min in ice, and the mixture was frozen at -80°C after 

an additional 10 min, and thawed at 20°C; Brij 58, MgCl2 and KCl 

were then added to 0.1%, 5 mM and 750 mM respectively. The 

lysate was mixed by several inversions and centrifuged at 100,000 

× g for 3 h. Dialysis of supernatant was done against buffer A (20 

mM KCl, 5 mM MgCl2, 1 mM EDTA, 20 mM Tris hydrochloride, 10 

% glycerol [pH 7.8]). It was then loaded onto a 2 ml novobiocin- 

Sepharose column and washed with buffer A until the optical 

density at 280 nm was minimal, with 25 ml of 20 mM ATP in buffer 

A and finally with buffer A until there was no more A280. Elution of 

DNA gyrase was done with 5 M urea in buffer A. Fractions were 

dialyzed against buffer A without MgCl2 and glycerol, concentrated 

with polyethylene glycol 20,000, dialyzed against buffer A without 

MgCl2 but with 50% glycerol and stored at -20°C. Protein 

concentrations were estimated to be 400µg/ml by Folin Lowry 

method. The purity was checked by sodium dodecyl sulfate 

polyacrylamide gel electrophoresis and the specific activity was 2 × 

10 4 U/mg of protein. 

Relaxed pBR322 DNA (Topogen Inc., USA) and 1 U of gyrase 

were incubated in an 18 µl reaction mixture containing 25 mM KCl, 

20 mM N-2-hydroxyethylpiperazine-N 1 -2-ethanesulfonic acid 

(HEPES), 4 mM dithiothreitol, 1.7 mM spermidine, 1.7 mM ATP, 6 

mM magnesium acetate, 0.5 mM EDTA, 3% ethylene glycol and 2 

mM Tris hydrochloride (pH 8). Under these conditions DNA is totally 

supercoiled in 30 min at 37°C. The mixture was incubated for 30 

min at 37°C and the reaction was stopped at 0°C by the addition of 

1µl of 1% sodium dodecyl sulfate and 2 µl of 0.4% bromophenol 

blue in 60% sucrose. The extent of supercoiling were determined 

by 1% agarose gel electrophoresis. 

1% agarose gel was made in EDTA (36 mM), Tris hydrochloride 

(pH 7.5) by using agarose. Samples applied to the gel and resolved 

at 70 V for 3 h. The gel was stained with ethidium bromide at room 

temperature and photographed under UV. 

RESULT 

MIC of K. aerogenes against pefloxacin determined by 

broth dilution method and Hi-Comb method was found to 

be 0.1 µg/ml. According to broth dilution method, 

inhibition in the growth was read visually and by Hi-Comb 

method, zone of inhibition was seen after 24 h incubation 

(Figure 1). 

In the present report, morphological changes induced 

by pefloxacin on K. aerogenes are shown in Figures 2 

and 3. Figure 2 shows images of control organism which 

were seen to be rod shaped bacilli. In Figure 3, changes 

on surface of cells were seen after different time interval 

of pefloxacin treatment; Figure 3a shows elongation and 

spheroplast formation after 3 h incubation time period; 

Figure 3b also shows elongation and spheroplast 

formation after 6 h incubation time period; Figure 3c 

shows pieces of bursted cells along with elongated and 

spheroplast cells. 

Cells of K. aerogenes were exposed to pefloxacin and


Figure 1. Determination of the MIC of Pefloxacin against K. aerogenes using Hi-Comb method. The clear 

area indicated the growth inhibition zone of the bacterium. 

Figure 2. K. aerogenes under the untreated condition is a rod-shaped bacilli.

Surve and Bagde 16333


Figure 3. K. aerogenes following treatment with Pefloxacin (0.1 µg/ml) at different incubation time period, a. exposed for 3 h, b. 

exposed for 6 h, c. exposed for 24 h. 

inhibition on the activity of dehydrogenases enzymes was 

studied. Inhibition percentage of dehydrogenases activity 

was glutamic 45%, succinic 48%, α-ketoglutaric 47% and 

isocitric dehydrogenases 45% (Table 1). Percentage 

inhibition of the activity of enzymes was calculated by 

comparing the O. D. values of the control tubes and the 

tubes containing pefloxacin. 

DNA gyrase was eluted by affinity chromatography and 

purity was checked by SDS PAGE. SDS-PAGE analysis 

revealed one band which corresponds to 100 kDa (Figure 

4). Finally, DNA supercoiling by DNA gyrase was studied 

in the presence and absence of pefloxacin (Figure 5). 

Lane a and c corresponds to the standards of Relaxed 

and supercoiled pBR322 DNA, respectively. Lane b 

corresponds to test containing pefloxacin, DNA gyrase 

and relaxed pBR322 DNA. According to the figure, 

pefloxacin inhibited DNA gyrase and relaxed DNA was 

not supercoiled. Lane d shows supercoiling activity of 

DNA gyrase in absence of Pefloxacin. 

DISCUSSION 

There has been a recent dramatic increase in information 

about the fluoroquinolones, a new class of potent orally 

absorbed antimicrobial agents. The first analog of this 

class of synthetic agents used clinically was nalidixic 

acid, a nonfluorinated agent which was released for 

treatment of urinary tract infections in 1962. In past 

decade, new fluoroquinolones, also called quinolones, 4quinolones, 

carboxyquinolones, or quinolone carboxylic 

acids, have been developed that include norfloxacin, 

ciprofloxacin, ofloxacin, pefloxacin, enoxacin and others. 

The principal bacterial target of the quinolones is 

deoxyribonucleic acid (DNA) gyrase (Crumplin et al., 

1984; Gellert et al., 1977; Hooper et al., 1987; Sugino et 

al.,1977), an essential bacterial enzyme (Drlica, 1984; 

Cozzarelli, 1980; Gellert, 1981). This enzyme is a 

member of the class of type II topoisomerases and is 

composed of two A subunits encoded by the gyr A gene

Figure 4. SDS-PAGE analysis of purified K. aerogenes DNA 

gyrase. Lanes a and b: Protein eluted before affinity 

chromatography of K. aerogenes. Lanes c and d: Protein eluted 

after affinity chromatography of K. aerogenes showing DNA 

gyrase (100kDa). 

Figure 5. Agarose gel electrophoresis of relaxed pBR322 

DNA, DNA gyrase and pefloxacin, showing supercoiling 

activity. Lane a: Control of Relaxed pBR322 DNA; lane b: 

Showing effect of pefloxacin on DNA gyrase inhibiting 

supercoiling activity; lane c: Control of Supercoiled pBR322 

DNA; lane d: DNA gyrase supercoiling activity without 

pefloxacin. 

Surve and Bagde 16335 

and two B subunits encoded by the gyr B gene. DNA 

gyrase has been most extensively studied in Escherichia 

Coli, but DNA gyrases have also been purified from 

Micrococcus luteus (Klevan and Wang, 1980; Liu and 

Wang, 1978), Bacillus subtilis (Orr and Staudenbauer, 

1982; Sugino and Bott, 1980), and Pseudomonas 

aeruginosa (Inoue et al., 1987; Miller and Scurlock, 

1983). 

Tabary et al. (1987) studied the effects of DNA gyrase 

inhibitors pefloxacin and five other quinolones on E. coli 

Topoisomerase I and Pan and Fisher (1999) studied the 

effects of fluoroquinolones on Streptococcus pneumoniae 

DNA gyrase and Topoisomerase IV. Pan et al. (2009) 

studied the effects of quinolones and Quinazolinedione 

PD 0305970 on DNA gyrase and Topoisomerase IV of 

Gram positive pathogens, including quinolone resistant 

isolates. Schultz et al. (1996) studied the structure and 

conformational changes of DNA topoisomerase II by 

electron microscopy. 

DNA gyrase catalyze the supercoiling activity of 

covalently closed circular DNA relaxed by topoisomerase 

I. Quinolones inhibit this activity at concentrations near 

MICs. In the present investigation, the same effect was 

studied on K. aerogenes by pefloxacin with the reference 

to the prior research done. DNA gyrase was purified by 

Sepharose-novobiocin affinity chromatography and the 

effect of pefloxacin was studied. Pefloxacin inhibited the 

DNA gyrase activity by inhibiting supercoiling of relaxed 

DNA. 

SEM data presented here are in substantial agreement 

with the previous reports of surface disruption of antibiotic 

treated with E. coli (Klainer and Perkins, 1972, 1974). 

The present study demonstrates that antimicrobial agent 

whose site of action is thought to be intracellular may 

cause morphological alterations which are similar to 

those induced by cell-wall active drugs. Surve and Bagde 

(2010b) studied the effects of methicillin on cell surface of 

Streptococcus agalactiae by SEM and reported similar 

results. 

The effect of pefloxacin was also studied on the activity 

of dehydrogenases enzymes activity of K. aerogenes. 

Inhibition of four dehydrogenases involved in the TCA 

cycle, glutamic, succinic, α-ketoglutaric and isocitric 

dehydrogenases was found when bacterial cells were 

exposed to pefloxacin. Due to this, the supply of energy rich 

compounds like ATP got considerably reduced, and 

thereby the synthesis of macromolecules like protein, 

DNA and RNA declined and subsequently the growth got 

ceased. Surve and Bagde (2009, 2010a, b) reported 

similar inhibition effects of silver, arsenic and methicillin 

On dehydrogenases activity of pathogenic microorganisms. 

Acknowledgement 

Deep sense of gratitude to Dr. Bandivadekar, Department 

of Biochemistry, National Institute of Research in


Reproductive Health, Mumbai, India, and his staff for 

support in the experiment. 

REFERENCES 

Albrecht R (1977). Development of antibacterial agents of the nalidixic 

acid type. Prog. Drug Res. 21: 9-104. 

Bennett CJ, Young MN, Darrington H (1995). Differences in urinary tract 

infection in male and female spinal cord injury patients on intermittent 

catheterization. Paraplegia, pp. 69-72. 

Bjornsti MA, Osheroff N (1999). DNA Topoisomerase Protocols. In 

Methods in Mol. Biology. Vol. 94, Human Press Inc. Totowa NJ. 

CLSI. Clinical and Laboratory Standards Institute (2008). Performance 

Standards for Antimicrobial Susceptibility Testing, CLSI 28(1). 

Cozzarelli NR (1980). DNA gyrase and supercoiling of DNA. Science, 

207: 953-960. 

Crumplin GC, Kenwright M, Hirst T (1984). Investigations into the 

mechanisms of action of the antibacterial agent norfloxacin. J. 

Antimicrob. Chemother. 13(Suppl B): 9-23. 

Domagala JM, Hanna LD, Heifetz CL, Hutt MP, Mich TF, Sanchez JP, 

Solomon M (1986). New structure-activity relationships of the 

quinolone antibacterials using target enzyme. The development and 

application of a DNA gyrase activity. J. Med. Chem. 29: 394-404. 

Drlica K (1984). Biology of bacterial deoxyribonucleic acid 

topoisomerases. Microbiol. Rev. 48: 273-289. 

Drlica K, Engle EC, Manes SH (1980). DNA gyrase on the bacterial 

chromosome: possibility of two levels of action. Proc. Natl. Acad. Sci. 

USA. 77: 6879-6883. 

Gellert M (1981). DNA topoisomerases. Annu. Rev. Biochem. 50: 879- 

910. 

Gellert M, Mizuuchi K, O’Dea MH, Itoh T, Tomizawa JI (1977). Nalidixic 

acid resistance: a second genetic character involved in DNA gyrase 

activity. Proc. Natl. Acad. Sci. USA. 74: 4772-4776. 

Gellert M, O’Dea MH, Itoh T, Tomizawa JI (1976). Novobiocin and 

coumermycin inhibit DNA supercoiling catalyzed by DNA gyrase. 

Proc. Natl. Acad. Sci. USA, 73: 4474-4478. 

Guha C, Mookerjee A (1978). Effect of Nickel on macromolecular 

synthesis in Escherichia coli K12. The Nucleus, 22(1): 45-47. 

Hooper DC, Wolfson JS, McHugh GL, Winters MB, Swartz MN (1982). 

Effects of novobiocin, coumerymycin A1, clorobiocin and their 

analogs of Escherichia coli DNA gyrase and bacterial growth. 

Antimicrob. Agents. Chemother. 22: 662-671. 

Hooper DC, Wolfson JS, Ng EY, Swartz MN (1987). Mechanisms of 

action and resistance to ciprofloxacin. Am. J. Med. 82(Suppl 4A): 12- 

20. 

Inoue Y, Sato K, Fujii T, Hirai K, Inoue M, Iyobe S, Mitsuhashi S (1987). 

Some properties of subunits of DNA gyrase from Pseudomonas 

aeruginosa PAQ1 and its nalidixic acid-resistant mutant. J. Bacteriol. 

169: 2322-2325. 

Klainer AS, Perkins RL (1972). Surface Manifestations of Antibiotic- 

Induced alterations in protein synthesis in bacterial cells. Antimicrob. 

Agents Chemother. 1(2): 164-170. 

Klainer AS, Perkins RL (1974). Effect of the inhibition of protein 

synthesis on Escherichia coli cell envelope. Antimicrob. Agents 

Chemother. 6(2): 216-224. 

Klevan L, Wang JC (1980). Deoxyribonucleic acid gyrasedeoxyribonucleic 

acid complex containing 140 base pairs of 

deoxyribonucleic acid and the α2β2 protein. Biochemistry, 19: 5229- 

5234. 

Liu LF, Wang JC (1978). Micrococcus luteus DNA gyrase: active 

components and a model for its supercoiling DNA. Proc. Natl. Acad. 

Sci. USA. 75: 2098-2102. 

Lye WC, Chan RKT, Lee EJC, Kumarasinghe G (1992). Urinary tract 

infections in patients with diabetes mellitus. J. Infect. 24: 169-174. 

Miller RV, Scurlock TR (1983). DNA gyrase (topoisomerase II) from 

Pseudomonas aeruginosa. Biochem. Biophys. Res. Commun. 110: 

694-700. 

NCCLS. National Committee for Clinical Laboratory Standards (2001). 

Methods for dilution antimicrobial susceptibility tests for bacteria that 

grow aerobically. Approved standard M7-A5, National Committee for 

Clinical Laboratory Standards, Wayne, Pa. vol. 20. 

Orr E, Staudenbauer WL (1982). Bacillus subtilis DNA gyrase: 

purification of subunits and reconstitution of supercoiling activity. J. 

Bacteriol. 151: 524-527. 

Pan XS, Fisher LM (1999). Streptococcus pneumoniae DNA gyrase and 

Topoisomerase IV: overexpression, purification and differential 

inhibition by fluoroquinolones. Antimicrob. Agents Chemother. 43(5): 

1129-1136. 

Pan XS, Gould KA, Fisher LM (2009). Probing the differential 

interactions of quinazolinedione PD 0305970 and quinolones with 

gyrase and topoisomerase IV. Antimicrob. Agents Chemother. 53(9): 

3822-3831. 

Schultz P, Olland S, Oudet P, Hancock R (1996). Structure and 

conformational changes of DNA topoisomerase II visualized by 

electron microscopy. Proc. Natl. Acad. Sci. USA. 93: 5936-5940. 

Sugino A, Bott KF (1980). Bacillus subtilis deoxyribonucleic acid gyrase. 

J. Bacteriol. 141: 1331-1339. 

Sugino A, Peebles CL, Krreuzer KN, Cozzarelli NR (1977). Mechanism 

of action of nalidixic acid: purification of Escherichia coli nalA gene 

product and its relationship to DNA gyrase and a novel nickingclosing 

enzyme. Proc. Natl. Acad. Sci. USA. 74: 4767-4771. 

Surve NN, Bagde US (2009). Silver toxicity in pathogenic 

Staphylococcus epidermidis and Klebsiella pneumoniae. Int. J. 

Integrative Biol. 7(3): 139-144. 

Surve NN, Bagde US (2010a). Arsenic toxicity in pathogenic 

Staphylococcus epidermidis and Klebsiella pneumoniae. Int. J. Biol. 

2(2): 213-221. 

Surve NN, Bagde US (2010b). Morphological alterations by methicillin 

on cell wall of Streptococcus agalactiae. Int. J. Integrative Biol. 11(1): 

26-29. 

Tabary X, Moreau N, Dureuil C, Le Goffic F (1987). Effect of DNA 

gyrase inhibitors pefloxacin, five other quinolones, Novobiocin and 

chlorobiocin on Escherichia coli Topoisomerase I. Antimicrob. Agents 

Chemother. 31(12): 1925-1928. 

Wang JC, Liu LF (1979). DNA topoisomerases: enzymes that catalyze 

the concerted breakage and rejoining of DNA backbone bonds, In J H 

Taylor (ed.), Molecular genetics, part 3. Academic Press, Inc., New 

York. pp. 65-88.



DOI: 10.5897/AJB11.2239 



Cytotoxic constituents of Clausena excavata 

N. W. Muhd Sharif, N. A. Mustahil, H. S. Mohd Noor, M. A. Sukari*, M. Rahmani, Y. H. Taufiq- 

Yap and G. C. L. Ee 

Department of Chemistry, Faculty of Science, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor Darul Ehsan, 

Malaysia. 


Phytochemical investigation on leaves, stem bark and roots of Malaysian Clausena excavata has led to 

the isolation and identification of limonoid compounds, clausenolide-1-methyl ether (1) and clausenarin 

(2), carbazole alkaloids, 3-formyl-2,7-dimethoxycarbazole (3) and clausine-K (4) together with 

coumarins, xanthyletin (5), dentatin (6) and nordentatin (7). Extracts of roots and isolated compounds 

(1), (2), (5) and (6) were subjected to cytotoxic screening against various cancer cell lines (HL-60, MCF- 

7, HeLa and HT-29). All roots extracts except methanol showed strong activity against HL-60 and MCF-7 

cancer cell lines with IC50 values ranging from 4 to 6 µg/ml. Dentatin (6) was found to be the most 

cytotoxic constituent against all cancer cell lines with IC50 values ranging from 5 to 10 µg/ml. 

Key words: Clausena excavata, carbazole alkaloids, limonoids, coumarins, cytotoxic. 

INTRODUCTION 

The Rutaceae family is one of the largest plant family 

with approximately 150 genera and 1,500 species 

(Jones, 1995), distributed largely in tropical and 

subtropical parts of the world. The Rutaceae family is 

known throughout the world for its citrus fruits such as 

oranges, lemons and grape fruit (Sharma, 1993). 

Essential oils obtained from the leaves and fruit peel of 

various species of Rutaceae family especially from the 

genus Clausena, Citrus and Murraya are popularly used 

in medicine and perfumery. Clausena excavata Burm.F. 

locally known as “Pokok Kemantu” (ghostly tree) or 

“Pokok Cemamar” (diarrhea tree) is one of Malaysian 

species of “ulam” with high anti-oxidant properties. The 

plant has been claimed to be a useful folk medicine in the 

treatment of various diseases such as cough, rhinitis, 

fever and stomach disorder. 

This plant has been reported to possess various 

biological activities such as anti-inflammatory, antiplatelet, 

antiplasmodic, antimicrobial, antinociceptive and 

anti-immunomodulatory (Wu et al., 1994). Previous 

phytochemical investigations have reported isolation of 

some carbazole alkaloids, coumarins and limonoids (Su 

et al., 2009; Taufiq et al., 2007; Ito et al., 1997; Wu et al., 

1997). In more recent study, several natural and 

*Corresponding author. E-mail: aspollah@science.upm.edu.my. 

synthesized analogues of pyranocoumarins obtained 

from this plant were found to be potent against hepatitis B 

virus and showed significant cytotoxicity against a panel 

of cancer cell lines (Su et al., 2009). In this paper, we 

reported the isolation and characterization of alkaloids, 

coumarins and limonoids from the plant, and the cytotoxic 

activity of the plant extracts and isolated compounds 

against different cancer cell lines (HL-60, MCF-7, HT-29 

and HeLa). The work reported here is the first on 

cytotoxic screening of roots extracts and isolated 

compounds, clausenolide-1-methyl ether (1) and 

clausenarin (2) from Malaysian C. excavata against 

various cancer cell lines. 


C. excavata Burm.F. was collected from Pendang, Kedah in 

December 2006. The plant was identified by Mr. Shamsul Khamis 

from Institute of Bioscience, Universiti Putra Malaysia. A voucher 

specimen of this plant was deposited in the herbarium of the 

institute. The plant materials were separated into leaves, stem bark 

and roots, air-dried and ground prior to use. 

Extraction and isolation 

Different parts of C. excavata were extracted successively with 

hexane, chloroform and methanol at room temperature. The 

extracts were evaporated to dryness under reduced pressure using


rotary evaporator to give crude extracts. Air-dried and ground 

leaves (778 g) yielded hexane (8.7 g), chloroform (11.9 g) and 

methanol (15.8 g) extracts, respectively while stem bark (780 g) 

yielded hexane (3.5 g), chloroform (35.1 g) and methanol (25.2 g) 

extracts, respectively. Similar procedures on roots of the plant (686 

g) yielded hexane (12.6 g), chloroform (35.1 g), acetone (11.0 g) 

and methanol (50.0 g) extracts, respectively. Each of these extracts 

was subjected to column chromatography over silica gel using a 

stepwise gradient elution system (hexane/ethyl acetate and ethyl 

acetate/methanol). Column chromatography separation of hexane 

extract of the leaves (6.7 g) yielded stigmasterol (35 mg), while its 

chloroform extract (9.9 g) yielded 3-formyl-2,7-dimethoxycarbazole 

(3, 20 mg). Similar column separation of hexane extract of stem 

bark (2 g) yielded stigmasterol (10 mg) and β-sitosterol (15 mg), 

while the chloroform extract (33.1 g) yielded also β-sitosterol (15 

mg), together with clausenarin (2, 30 mg), clausenolide-1-methyl 

ether (1, 15 mg) and clausine-K (4, 20 mg). In addition, clausenarin 

(2, 35 mg) was also obtained from the methanol extract (23.2 g). 

Meanwhile, column chromatography fractionation of hexane extract 

of the roots of the plant (10.6 g) yielded coumarins xanthyletin (5, 

36 mg) and dentatin (6,100 mg), while the chloroform extract 

yielded also dentatin (6, 50 mg) together with nordentatin (7, 10 

mg). 

Clausenolide-1-methyl ether (1) was isolated as colourless 

powder, C26H34O8, HR-FAB-MS: [M+H] + m/z 475.2322. m.p. 235 to 

237°C (Wu et al., 1993, m.p. 190-191°C). IR (KBr disc, νmax, cm -1 ): 

3502, 1724, 1680, 1160, 922. EIMS: 474 ([M] + , 2), 443 (15), 459 

(3), 351 (64), 319 (66), 277 (70), 217 (44), 95 (100), 69 (84), 55 

(51). 1 H and 13 C NMR spectral data are in a good agreement with 

the published data (Wu et al., 1993). 

Clausenarin (2) was isolated as colourless needle-shaped crystal, 

C26H32O9, m.p. 292 to 294°C (Ngadjui et al., 1989, m.p. 293-294°C). 

IR (KBr disc, νmax, cm -1 ): 3483, 1719, 1638, 1162, 875. EIMS: 488 

([M] + , 10), 474 (5), 445 (3), 365 (100), 289 (8), 277 (27), 133 (35), 

107 (34), 95 (64). 1 H and 13 C NMR spectral data are in good 

agreement with the published data (Ngadjui et al., 1989). 

3-Formyl-2,7-dimethoxycarbazole (3) was isolated as greenish 

needle, C15H13NO3, m.p 217-219°C (Peh, 2001, m.p. 217 to 219°C). 

IR (KBr disc, νmax, cm -1 ): 3438, 2924, 1664, 1158. EIMS: 255 ([M] + , 

100), 240 (43), 226 (6), 209 (20), 197 (11), 191 (3), 184 (17), 179 

(4), 169 (30), 161 (7), 153 (15), 147 (3), 141 (22). 1 H and 13 C NMR 

spectral data are in good agreement with the published data (Peh, 

2001). 

Clausine-K (4) was isolated as yellow needle-shaped crystal, 

C15H13NO4, m.p. 254 to 256°C (Wu et al., 1996, m.p. 250-256 ºC). 


100), 256 (28), 240 (16), 212 (15), 196 (15). 1 H and 13 C NMR 

spectral data are in a good agreement with the published data (Wu 

et al., 1996). 

Xanthyletin (5) was isolated as colourless needle-shaped crystal, 

C14H12O3, m.p. 119 to 121°C (Wu et al., 1997, m.p. 120 to 121°C). 


20), 213 (100), 185 (21), 128 (10), 115 (8), 91 (24), 51 (18). 1 H and 

13 C NMR spectral data are in good agreement with the published 

data (Wu et al., 1997). 

Dentatin (6) was isolated as colourless needle-shaped crystal, 

C20H22O4, m.p. 90 to 92°C (Xin et al., 2008, m.p. 91 to 92°C). IR 

(KBr disc, νmax, cm -1 ): 1681, 1592, 1460, 1168. EIMS: 326 ([M] + , 

20), 311 (100), 281 (17), 269 (3), 253 (8), 241 (3), 227 (5), 213 (3). 

1 H and 13 C NMR spectral data are in good agreement with the 

published data (Xin et al., 2008). 

Nordentatin (7) was isolated as colourless needle-shaped crystal, 

C19H20O4, m.p. 183 to 186°C (Wu and Furukawa, 1982, m.p. 178 to 

180°C). IR (KBr disc, νmax, cm -1 ): 3311, 1681, 1593, 1184. EIMS: 

312 ([M] + , 45), 297 (100), 283 (3), 269 (15), 255 (10), 241 (30). 1 H 

and 13 C NMR spectral data are in good agreement with the 

published data (Wu and Furukawa, 1982). 

Cytotoxic assay 

The crude extracts and selected pure compounds including 

clausenolide-1-methyl ether (1), clausenarin (2), xanthyletin (5) and 

dentatin (6) were screened for cytotoxic activity against HL-60 

(human promyelocytic leukemia), MCF-7 (human breast cancer), 

HT-29 (human colon cancer) and HeLa (human cervical cancer) 

cancer cell lines. The assay was carried out according to the 

methods previously described (Sukari et al., 2010). The cytotoxic 

index used was IC50, which is the concentration that gave 50% 

inhibition of the cell as compared to the untreated control. Extracts 

and pure compounds which exhibits cytotoxic index IC50 less than 

10 μg/ml were considered to have significant cytotoxic activity 

(Mackeen et al., 1997). 


Extraction and isolation work on different parts of 

Malaysian C. excavata have led to the identification and 

characterization of limonoid compounds, carbazole 

alkaloids and coumarins. Clausenolide-1-methyl ether 

(1), clausenarin (2) and carbazole alkaloid, clausine-K (4) 

were obtained from chloroform extract of stem bark of C. 

excavata. Clausenarin (2) was also gotten from 

fractionation of methanol extract of stem bark. Another 

carbazole alkaloid, 3-formyl-2,7-dimethoxycarbazole (3) 

was isolated from chloroform extract of the leaves. 

Besides, three coumarins identified as xanthyletin (5), 

dentatin (6) and nordentatin (7) were isolated from 

hexane and chloroform extracts of the plant. Figure 1 

shows the chemical structures of isolated compounds 

from different parts and various extracts of Malaysian C. 

excavata. The structures of the compounds were 

elucidated using spectroscopic methods and comparison 

of their spectral and physical data with the literature 

values. 

Clausenolide 1-methyl ether (1) has been reported only 

once and this is the first isolation of the compound from 

Malaysian species. The compound was obtained as 

colourless powder and the molecular formula was 

determined to be C26H34O8 by HR-FAB-MS at m/z 

475.2322 [M+H] + (calculated for C26H35O8 475.2332). The 

infrared spectrum showed a lactone carbonyl peak at 

1724 cm -1 and a ketone carbonyl at 1680 cm -1 , whereas 

low intensity peak at 922 cm -1 was due to β-substituted 

furan. Hydroxyl group displayed a strong absorption band 

at 3502 cm -1 . Its 1 H NMR spectrum was similar to 

clausenolide (Ngadjui et al., 1989), except the present of 

singlet at δ 3.23 due to methoxyl group attached to βsubstituted 

tetrahydrofuran ring. All the compounds (1) to 

(7) have been previously isolated from C. excavata 

collected from different Asian regions. However, out of

H 3CO 

H 3CO 

O 

HO 

O 

O 

(1) 

N 

H 

(3) R= CHO 

(4) R= COOH 

O 

O 

O 

R 

OCH 3 

OR 

O 

O O 

(6) R= CH3 

(7) R= H 

Figure 1. Structures of isolated compounds (1-7). 

seven constituents mentioned here, only clausenarin (2), 

3-formyl-2,7-dimethoxycarbazole (3) and clausine-K (4) 

has been isolated from another collection of Malaysian 

species reported by Peh (2001). In both cases, the plant 

materials were collected from different locations of Kedah 

in north Malaysia peninsula. Apparently, there are 

variations of chemical constituents obtained which might 

be due to different soil conditions. 

Extracts of roots together with isolated compounds, 

clausenolide-1-methyl ether (1), clausenarin (2), 

xanthyletin (5) and dentatin (6) were subjected to 

cytotoxic screening against various cancer cell lines (HL- 

60, MCF-7, HeLa and HT-29). The results are 

summarized in Table 1. Hexane, chloroform and acetone 

extracts exhibited strong activity against HL-60 and MCF- 

7 cancer cell lines with IC50 values ranging from 4 to 6 

μg/ml. The extracts also showed moderate to strong 

HO 

O 

HO 

O 

O 

O O O 

O 

(2) 

(5) 

O 

Muhd Sharif et al. 16339 

O 

effects against HT-29 and HeLa cancer cell lines, except 

non-active action of chloroform extract against HT-29 

cancer cell line. 

Dentatin (6) was the most cytotoxic compound against 

all cancer cell lines tested with IC50 values ranging from 5 

to 10 μg/ml as compared to coumarin and xanthyletin (5) 

which showed low to moderate activity against all cancer 

cell lines tested. However, limonoid compounds (1) and 

(2) showed insignificant cytotoxicity against all cancer cell 

lines tested with IC50 values more than 30 μg/ml, except 

for compound (1) which showed moderate activity against 

HL-60 and MCF-7 cancer cell lines. The cytotoxic activity 

of compounds (3), (4) and (7) were not carried out due to 

insufficient amount of the samples. Most of the crude 

extracts from roots part were more cytotoxic than the 

isolated compounds. These results suggest the 

synergistic effects shown by the isolated compounds 

O


Table 1. Cytotoxicity of roots extracts and compounds against various cancer cell lines. 

Plant part Extracts/pure compounds 

Roots 

Roots 

*IC50 (μg/ml) value 

HL-60 MCF-7 HT-29 HeLa 

Hexane 4.8±0.21 4.8±0.32 12.5±0.27 6.8±0.32 

Chloroform 5.8±0.12 5.5±0.21 >30 5.0±0.28 

Acetone 5.0±0.23 6.0±0.29 11.5±0.23 11.9±0.24 

Methanol 23.8±0.27 >30 >30 10.9±0.32 

Xanthyletin (5) 19.5±0.23 19.5±0.25 26.8±0.29 25.5±0.30 

Dentatin (6) 5.2±0.24 8.0±0.26 9.5±0.22 9.6±0.27 

Stem Clausenolide 1-methyl ether (1) 18.5±0.23 21.5±0.28 >30 >30 

Bark Clausenarin (2) >30 >30 >30 >30 

Standards 

Goniothalamin 

Tamoxifen 

5-Fluorouracil 

< 10 μg/ml = Strong activity, 10 to 20 μg/ml = moderate activity, 20 to 30 μg/ml= low activity. 

*Values are means ± standard deviation of triplicate analyses 

towards the cytotoxic properties of the crude extracts. 

Previous study on cytotoxic activity of Malaysian C. 

excavata have shown that the stem bark extract and 

isolated compound, 3-carbomethoxy-2-hydroxy-7methoxycarbazole 

(Clausine-TY) exhibit significant 

cytotoxicity against CEMss (human T4 lymphoblastoid) 

cancer cell line (Taufiq et al., 2007). On the other hand, 

the leaves extract of the plant was found to be not active. 

Xanthyletin (5) has been reported to show broad 

activity against a panel of cancer cell lines (Kawaii et al., 

2001; Yong et al., 2001; Lie et al., 2003; Pettit et al., 

2004; Anaya et al., 2005). Our results reveal that dentatin 

(6) showed strong activity against MCF-7 cancer cell line, 

while its analogue nordentatin (7) was reported to exhibit 

moderate activity against the same cancer cell (Su et al., 

2009). The replacement of hydroxyl group with methoxyl 

group at C-5 position has increased the cytotoxicity of 

these analogues against MCF-7 cell lines. Another 

investigation by Kawaii et al. (2001) reported that dentatin 

(6) has been implicated as a promising chemopreventive 

agent against several cancer cell lines. However, the 

compound demonstrated insignificant cytotoxic activity 

against other cancer cell lines tested (Sunthitikawinsakul 

et al., 2003; Songsiang et al., 2011). The work reported 

here is the first on cytotoxic screening of roots extracts 

and isolated compounds, clausenolide-1-methyl ether (1) 

and clausenarin (2) from Malaysian C. excavata against 

different cancer cell lines mentioned earlier. 


We thank The Ministry of Science, Technology and 

Innovation (MOSTI) for the Fundamental Research Grant 

1.5±0.20 3.0±0.20 1.5±0.30 1.2±0.21 

Scheme and Graduate Research Fellowship (UPM) given 

to one of the authors (N. W. Muhd Sharif). 

REFERENCES 

Anaya AL, Rubalcava MM, Ortega RC, Santana CG, Monterrubio PNS, 

Bautista BEH, Mata R (2005). Allelochemicals from Stauranthus 

perforatus, a Rutaceous tree of the Yucatan Peninsula, Mexico. 

Phytochemistry, 66: 487-494. 

Ito C, Katsuno S, Ohta H, Omura M, Kajiura I, Furukawa H. (1997). 

Constituents of Clausena excavata. Isolation and structural 

elucidation of new carbazole alkaloids. Chem. Pharm. Bull. 44: 48-52. 

Jones DT (1995). Rutaceae. In: The Flora of Sabah and Sarawak, ed. 

Seopadmo E and Wong KM, Kuala Lumpur: Ampang Press Sdn. 

Bhd. pp 351-401. 

Kawaii S, Tomono Y, Ogawa K, Sugiura M, Yano M, Yoshizawa Y, Ito 

C, Furukawa H (2001). Antiproliferative effect of isopentenylated 

coumarins on several cancer cell lines. Anticancer Res. 21(3B): 

1905-1911. 

Lie CL, Ling LY, Cheng JC (2003). Cytotoxic naphthoquinones and 

plumbagic acid glucosides from Plumbago zeylanica. 

Phytochemistry, 62: 619-622. 

Mackeen MM, Ali AM, El-Sharkawy SH, Manap MY, Salleh KM, Lajis 

NH, Kawazu K (1997). Antitumour and cytotoxic properties of some 

Malaysian traditional vegetables (ulam). Int. J. Pharmacog. 35: 174- 

178. 

Ngadjui BT, Ayafor JF, Sondengam BL, Connolly JD (1989). Limonoids 

from Clausena anisata. J. Nat. Prod. 52(4): 832-836. 

Peh TH (2001). Chemical Constituents and Biological Activities of 

Clausena excavata and Some Citrus Species (Rutaceae). M. Sc. 

Thesis. Universiti Putra Malaysia, Selangor, Malaysia. 

Pettit GR, Zhang Q, Pinilla V, Herald DL, Doubek DL, Duke JA. (2004). 

Isolation and Structure of Gustastatin from the Brazilian Nut Tree 

Gustavia hexapetala. J. Nat. Prod. 67: 983-985. 

Sharma OP (1993). Plant Taxonomy, New Delhi; Tata McGraw-Hill pp 

274-278: 291-294. 

Songsiang U, Thongthoom T, Boonyarat C, Yenjai C (2011). Claurailas 

A-D, Cytotoxic Carbazole Alkaloids from the Roots of Clausena 

harmandiana. J. Nat. Prod. 74: 208-212. 

Sunthitikawinsakul A, Kongkathip N, Kongkathip B, Phonnakhu S, Daly

JW, Spande TF, Nimit Y, Rochanaruangrai S (2003). Coumarins and 

Carbazoles from Clausena excavata Exhibited Antimycobacterial and 

Antifungal Activities. Planta Med. 69(2): 155-157. 

Su CR, Yeh SF, Liu CM, Damu AG, Kuo TH, Chiang PC, Bastow KF, 

Lee KH, Wu TS (2009). Anti-HBV and cytotoxic activities of 

pyranocoumarin derivatives. Bioorg. Med. Chem. 17: 6137-6143. 

Sukari MA, Tang SW, Neoh BK, Ee GCL , Rahmani M (2010). 

Antileukemic Activity and Chemical Constituents of Some 

Zingiberaceae Species. Asian. J. Chem. 22(10): 7891-7896. 

Taufiq-Yap YH, Peh TH, Ee GCL, Rahmani M, Sukari MA, Ali AM. A 

Muse R (2007). A new cytotoxic carbazole alkaloid from Clausena 

excavata. J. Nat. Prod. Res. 9: 310-313. 

Wu TS, Furukawa H (1982). Biological and Phytochemical Investigation 

of Clausena excavata. J. Nat. Prod. 45(6): 718-720. 

Wu TS, Huang SC, Lai JS (1993). Limonoids from the Stem Bark of 

Clausena excavata. J. Chin. Chem. Soc. 40(3): 319-320. 

Muhd Sharif et al. 16341 

Wu CC, Ko FN, Wu TS, Teng CM (1994). Antiplatelet effects of 

clausine-D isolated from Clausena excavata. Biochimica et 

Biophysica Acta 1201(1): 1-6. 

Wu TS, Huang SC, Wu PL, Teng CM (1996). Carbazole alkaloids from 

Clausena excavata and their biological activity. Phytochemistry, 

43(1): 133-140. 

Wu TS, Huang SL, Wu PL (1997). Pyrano- and furocarbazole alkaloids 

from the root bark of Clausena excavata. Heterocycles 45(5): 969- 

973. 

Xin ZQ, Lu JJ, Ke CQ, Hu CX, Lin LP, Ye Y (2008). Constituents from 

Clausena excavata. Chem. Pharm. Bull. 56: 827-830. 

Yong J, Cecil CS, John NS, Jiangang L, Chi-Tang Ho (2001). Cytotoxic 

Coumarins and Lignans from Extracts of the Northern Prickly Ash 

(Zanthoxylum americanum). Phytother. Res. 15: 441-443.



DOI: 10.5897/AJB11.1000 



Antimicrobial activities of methanol and aqueous 

extracts of the stem of Bryophyllum pinnatum Kurz 

(Crassulaceae) 

Nwadinigwe, Alfreda Ogochukwu 

Department of Botany, University of Nigeria, Nsukka, Enugu State, Nigeria. E-mail: alfreda.nwadinigwe@unn.edu.ng, 

fredanwad@yahoo.com. Tel: +234(0)8036867051. Fax: 042-770705. 


The stem of Bryophyllum pinnatum (Crassulaceae), used in ethnomedicine for the treatment of various 

diseases, was screened for secondary metabolites and antimicrobial activity on Salmonella typhi, 

Pseudomonas aeruginosa, Staphylococcus aureus, Bacillus subtilis, Candida albicans and Aspergillus 

niger. Phytochemical analysis showed the presence of alkaloids, glycosides, proteins, carbohydrates, 

saponins, steroids, tannins and terpenoids in both the methanol and aqueous extracts. The 

antimicrobial activity result showed that the methanol extract significantly (P < 0.01) demonstrated 

antibacterial action against B. subtilis and S. aureus at 100, 50 and 25 mg/ml concentrations, using the 

agar diffusion technique. The aqueous extract also significantly (P < 0.01) showed antibacterial action 

against S. typhi and B. subtilis at the same concentrations. Both extracts did not demonstrate any 

antimicrobial activity against P. aeruginosa, C. albicans and A. niger. S. aureus showed the lowest 

minimum inhibitory concentration (MIC) of 6.29 mg/ml in the methanol extract, while S. typhi showed 

the highest MIC of 9.98 mg/ml in the aqueous extract (significant at P < 0.01). The results validate the 

use of B. pinnatum stem in ethnomedicine. 

Key words: Antimicrobial, Bryophyllum stem extracts. 

INTRODUCTION 

The search for the therapeutic use of natural products is 

on the increase and this may be caused by the resistance 

of micro-organisms to many orthodox antibiotics. 

Bryophyllum pinnatum Kurz [syn. Bryophyllum calycinum, 

Kalanchoe pinnata Pers, common names: African – 

never – die, resurrection plant, life plant (Anonymous, 

2005), miracle leaf, air plant (Wikipedia, 2009), Family 

Crassulaceae] is an erect, perennial, fleshy herb with a 

height of 60 to 120 cm. It is branched from the base, with 

opposite, simple or trifoliolate, petiolate leaves. The 

glabrous, thick, fleshy leaf is about 10 cm long and 5 to 6 

cm broad, obovate to obovate – orbicular, coarsely 

crenate and sometimes bears bulbils in the axils. The 

drooping flowers occur in lax panicles with inflated, 

tubular, 4-lobed calyx that is about 3cm long. The calyx 

lobes are triangular and very acute with greenish yellow 

and purplish base. The tubular 4-lobed, gamopetalous 

corolla are contracted above the base and a little longer 

than the calyx. The corolla lobes are ovate – lanceolate, 

abruptly acute – acuminate and reddish purple at the 

upper part. Plantlets may grow along the notches of the 

leaf margins and can develop while still attached to the 

plant or when detached. The plant is native to 

Madagascar, introduced to and now naturalized in many 

parts of Tropical Africa, Asia and South America 

(Hutchinson and Dalziel, 1954). 

The plant can be used in treating high blood pressure, 

stroke, convulsion, pain, epilepsy, candidiasis, bladder 

infection and also as an anti-poison (Anonymous, 2005). 

In traditional medicine, B. pinnatum has been used to 

treat infections, rheumatism, inflammation, hypertension 

and kidney stones (Wikipedia, 2009). The pounded fresh

material is applied as a poultice for sprains, boils, 

abscess, eczema, infections, burns, carbuncle and 

erysipelas. Okwu and Josiah (2006) reported that the 

availability of ascorbic acid in B. pinnatum provides the 

biochemical basis for the ethnomedical use of the plant 

extract for the treatment and prevention of infections, cold 

and other diseases like prostrate cancer. Glycosides, 

steroids, flavonoids, bufadienolides, organic acids, 

alkaloids, tannins, phenolic compounds, gums, mucilages, 

lignin, etc., have been detected in the leaves of B. 

pinnatum (Marriage and Wilson, 1971; Kamboj and 

Saluja, 2010). Also, bryophillin A, B and C, a potent cytotoxic 

bufadienolide orthoacetate was found in the leaf 

extract (Yamagishi et al., 1989). Bryophillin C show 

insecticidal properties (Supratman et al., 2000). K. 

pinnata contains bufadienolide cardiac glycosides which 

can cause cardiac poisoning, particularly in grazing animals 

(McKenzie and Dunster, 1986; McKenzie et al., 

1987). Kalanchoe extracts also have immunosuppressive 

effects (Lans, 2006). 

The flavonoids, polyphenols, triterpenoids and other 

chemical constituents of the plant were speculated to 

account for the antinociceptive, anti-inflammatory, anti 

hypertensive and antidiabetic properties observed in the 

aqueous leaf extracts (Ojewole, 2005). Mudi and Ibrahim 

(2008) reported that the n-hexane fraction of B. pinnatum 

leaves showed antibacterial activity against 

Staphylococcus aureus, Klebsiella pneumoniae and 

Salmonella typhi, while the ethyl acetate soluble fraction 

showed mild activity against Escherichia coli, S. aureus 

and S. typhi. Broad spectrum antibacterial and antifungal 

activities were detected in the crude leaf extract of B. 

pinnatum (Aquil and Ahmad, 2003). The aqueous leaf 

extract of B. pinnatum had a neurosedative and muscle 

relaxant activities and produced a depressant action on 

the central nervous system of mice (Yemitan and 

Salahdeen, 2005). This depressant action was attributed 

to bufadienolide and other water soluble constituents in 

the extract (Salahdeen and Yemitan, 2006). Igwe and 

Akunyili (2005) reported that the aqueous leaf extract of 

B. pinnatum has a strong analgesic potency comparable 

in a time and dose – dependent manner to a non 

steroidal anti-inflammatory drug. 

Most of these investigations were centered on the leaf 

extract of B. pinnatum. However, not much work has 

been carried out on the stem of this highly medicinal 

plant. The objective of this work therefore was to investigate 

the antimicrobial activities of the stem of B. 

pinnatum. 


Collection of plant material and phytochemical screening 

The stem of B. pinnatum Kurz was collected at Nsukka, Enugu 

State and authenticated by Mr. A. Ozioko, a Taxonomist of the 

Bioresearch Development and Conservative Programme Centre in 

Nsukka, Enugu State. A voucher specimen (U.N.H. No. 1/15) was 

Ogochukwu 16343 

deposited at the Herbarium in Botany Department, University of 

Nigeria, Nsukka, Nigeria. The stem was air dried and pulverized. 

300 g of the powdered stem was macerated separately with 1.5 L of 

methanol and 1.5 L of distilled water and both were concentrated to 

dryness with a vacuum pump. Phytochemical screening was carried 

out on the methanol and the aqueous extracts to determine the 

secondary metabolites content (Harborne, 1973; Trease and 

Evans, 1983). 

Test for antimicrobial activity 

Antimicrobial tests were carried out on the methanol and aqueous 

extracts using the agar diffusion method (Pelczar et al., 1993). 200 

mg of each extract was dissolved in 2 ml of dimethyl sulphoxide 

(DMSO) to obtain 100 mg/ml concentration. Further dilutions of the 

stock solution were made using a two-fold serial dilution technique, 

to give 50, 25, 12.5 and 6.25 mg/ml concentrations. This same 

dilution was carried out on gentamicin (as a reference drug) to 

obtain 100, 50, 25, 12.5 and 6.25 µg/ml, concentrations. Nutrient 

agar medium was used to test the following isolates: S. typhi, P. 

aeruginosa, S. aureus, B. subtilis, C. albicans and A. niger. These 

organisms were clinical isolates obtained from the University of 

Nigeria Medical Centre, Nsukka. They were identified at the 

Department of Microbiology, University of Nigeria, Nsukka. S. typhi, 

P. aeruginosa, S. aureus and B. subtilis were maintained on blood 

agar slants at 4°C before use, while C. albicans and A. niger (fungi) 

were preserved on Sabourand’s dextrose agar (Oxoid) slants at 

4°C, prior to use. 20 ml of sterile solidified Mueller-Hinton nutrient 

agar was poured into a sterile Petri dish and seeded with 0.1 ml of 

standardized broth culture of the test micro-organism (1.0 × 10 7 

cfu/ml). This was carried out for all the test micro-organisms. Five 

equidistant wells were made in each of the plates with a sterile 6.0 

mm diameter cork borer. Using a sterile dropper, 0.3 ml of each of 

100, 50, 25, 12.5 and 6.25 mg/ml concentration of the extracts were 

dispensed into each corresponding well, made in the plates. A well 

containing gentamicin was made in each of the plates seeded with 

the bacteria, while the plates seeded with fungi had ketoconazone 

in the well, as a reference drug. The plates were allowed to stand 

for 1 h for the prediffusion of the extract to occur. The plates with 

bacteria were incubated at 37°C for 24 h while those with fungi 

were incubated at 25°C for 48 h. They were observed and the 

presence of zones of inhibition around the wells were measured 

and taken as an indication of antimicrobial activity (Alade and Irobi, 

1993). The experiment was carried out in two replicates and the 

mean for each organism was determined. 

For the determination of MIC, methanol and aqueous extracts, as 

well as gentamicin (as a reference drug) were used on the 

susceptible micro-organisms. The agar diffusion method (Pelczar et 

al., 1993) was adopted. 200 mg of each extract was dissolved in 2 

ml of DMSO to obtain 100 mg/ml concentration. Two-fold serial 

dilution was made to obtain 50, 25, 12.5 and 6.25 mg/ml 

concentrations. The same two-fold dilutions of 100 µg/ml 

gentamicin were made to obtain 50, 25, 12.5 and 6.25 µg/ml 

concentrations. These concentrations were put into wells bored in 

the seeded agar plates containing the susceptible micro-organisms, 

as above. The experiment was carried out in two replicates. The 

agar plates were placed in an incubator at 37°C for 24 h, after 

which the mean diameter of the zone of inhibition was measured. 

The graph of the square of the inhibition zone diameter was plotted 

against log concentration for each micro-organism. A regression 

line was drawn through the points. From these graphs, the 

representative MIC values were determined as the antilogarithm of 

the intercept on the logarithm of concentration axis. Analysis of 

variance (ANOVA) was determined on the data obtained, while the 

multiple comparisons were carried out between treatment means 

using Duncan’s multiple range tests at P< 0.05 confidence level 

(Edafiogho, 2006).


RESULTS 

Table 1. Result of the phytochemical analyses of the methanol and aqueous extracts of 

Bryophyllum pinnatum stem. 

Test Methanol extract Aqueous extract 

Acidic compounds - - 

Alkaloids +++ ++ 

Carbohydrates +++ +++ 

Fats and Oil - - 

Flavonoids ++ - 

Glycosides +++ ++ 

Proteins ++++ +++ 

Resins ++ - 

Saponins + ++++ 

Steroids ++++ + 

Tannins + + 

Terpenoids ++++ + 

Reducing sugar +++ ++ 

-, Absent; + present in low concentration; ++ present in moderate concentration; +++ present in high 

concentration; ++++ present in very high concentration. 

The methanol stem extract revealed the presence of high 

concentrations of alkaloids, carbohydrates, glycosides, 

proteins, steroids, terpenoids and reducing sugar, while 

the aqueous extract showed carbohydrates, proteins and 

saponins in high concentration (Table 1). Acidic 

compounds, fats and oils were not detected in both 

extracts. The results of the antimicrobial activity showed 

that the methanol stem extract significantly (P< 0.01) 

demonstrated antibacterial activities against B. subtilis 

and S. aureus, while the aqueous stem extract 

significantly (P< 0.01) showed antibacterial activities 

against S. typhi and B. subtilis, both at a concentration of 

25 mg/ml and above (Table 2). Also, the methanol and 

the aqueous extracts showed the least antibacterial 

activities at a concentration of 12.5 mg/ml for S. aureus 

and B. subtilis, respectively. However, both extracts did 

not show any antimicrobial activity against P. aeruginosa, 

C. albicans and A. niger. For both extracts, 100 mg/ml 

was significantly (P< 0.01) the most effective against all 

the bacteria used. However, for the methanol extract, 

100 mg/ml was not significantly different from 50 mg/ml, 

as regards S. aureus. The lower the concentration, the 

lower the effectiveness to the extent that 6.25 mg/ml 

concentration exhibited no activity against any microorganism. 

Comparatively, gentamicin (the standard drug) 

showed significantly (P< 0.01) higher antibacterial 

activities against B. subtilis, S. aureus and S. typhi at a 

concentration of 12.5 µg/ml and above. 

For MIC, the antibacterial activities of the methanol 

extract were significantly (P< 0.01) different from those of 

the aqueous extract and gentamicin (Table 3). S. aureus 

showed the lowest MIC in the methanol extract, while S. 

typhi demonstrated the highest MIC in the aqueous 

extract. However, for gentamicin, the reverse was the 

case for MIC. The methanol extract inhibited B. subtilis 

more than the aqueous extract. These effects were 

significant at P

Ogochukwu 16345 

Table 2. Mean inhibitory zone diameter (mm) of different concentrations of methanol and aqueous extracts of Bryophyllum pinnatum stem and gentamicin on the test micro-organisms. 

Methanol extract Aqueous extract Gentamicin 

Micro-organism 

Concentration (mg/ml) Concentration (mg/ml) Concentration (µg/ml) 

100 50 25 12.5 6.25 100 50 25 12.5 6.25 100 50 25 12.5 6.25 

S. typhi - - - - - 18.0 ± 1.0a 14.0 ± 0.0i 9.5 ± 0.5o - - 29.5 ± 0.5b 28.0 ± 0.0j 21.0 ± 0.0p 17.5 ± 0.5k - 

B. subtilis 25.0 ± 0.0c 21.5 ±0.5g 20.0 ± 0.0q - - 24.0 ± 1.0c 20.5 ± 0.5g 15.5 ± 0.5t 13.0 ± 1.0t - 37.5 ± 0.5d 32.0 ± 0.0h 24.5 ± 0.5s 23.0 ± 0.0u - 

S. aureus 22.5 ± 0.5e 21.0 ± 0.0e 17.0 ± 1.0m 11.0 ± 1.0v - - - - - - 34.0 ± 0.5f 31.0 ± 0.0l 30.0 ± 0.0l 21.5 ± 0.5w - 

P. aeruginosa - - - - - - - - - - - - - - - 

C. albicans - - - - - - - - - - - - - - - 

A. niger - - - - - - - - - - - - - - - 

- , no activity. Values represent means ± standard error. Means followed by the same letter(s) within the same row and column are not significantly different. 

Table 3. Minimum inhibitory concentrations (MIC) of gentamicin, methanol and aqueous extracts of 

Bryophyllum pinnatum stem on the test micro-organisms. 

Micro-organism 

the leaf extracts they obtained from the traditional 

method. In this investigation, the methanol extract 

of the stem of B. pinnatum was more active than 

the aqueous extract. This is also similar to the 

work of Akinsulire et al. (2007) who reported that 

of all the extracts of B. pinnatum leaf, the 

methanol extract was the most active. Aquil and 

Ahmad (2003) reported that the ethanolic extract 

of B. pinnatum leaves had broad-spectrum 

antimicrobial activity. Ofokansi et al. (2005) 

reported that B. pinnatum leaf is effective in the 

treatment of typhoid fever and other bacterial 

infections, particularly those caused by S. aureus, 

E. coli, B. subtilis, P. aeruginosa, Klebsiella 

Methanol extract 

(mg/ml) 

Aqueous extract 

(mg/ml) 

Gentamicin 

(µg/ml) 

Salmonella typhi - 9.98 ± 0.01 c 5.25 ± 0.01 e 

Bacillus subtilis 8.42 ± 0.01 a 6.42 ± 0.1 d 5.83 ± 0.01 f 

Staphylococcus aureus 6.29 ± 0.01 b - 5.97 ± 0.01 g 

-, No activity. Values represent means ± standard error. Means followed by the same letter(s) within the same row 

and column are not significantly different. 

aerogenes, K. pneumoniae and S. typhi. These 

investigations supported the use of B. pinnatum in 

treating the placenta and navel of a new born 

baby, which heal fast and prevent infections 

(Okwu, 2003). 

Taylor (2010) explained that the traditional use 

of B. pinnatum for the treatment of internal and 

external infections is supported by the fact that the 

leaves have antibacterial, antiviral and antifungal 

activities. An aqueous extract of the leaves 

administered topically and internally has been 

shown to prevent and treat leishmaniasis in both 

human and animals. In addition, the traditional 

uses of the plant for upper respiratory conditions 

and cough might be explained by the report that 

shows that the leaf juice has potent anti-histamine 

and anti-allergic activities. In vivo studies with rats 

and guinea pigs showed that the leaf juice was 

able to protect against chemically induced 

anaphylactic reactions and death by selectively 

blocking histamine receptors in the lungs. Another 

in vivo study showed that the leaf extract 

protected mice from ulcer-inducers such as 

stress, aspirin, ethanol and histamine, thus 

validating the traditional use of the plant for gastric 

ulcers. Other in vivo investigations confirmed that 

the leaf extract can reduce fever, provides antiinflammatory, 

pain-relieving and muscle-relaxant


effects. Its anti-inflammatory effects have been partially 

attributed to the immunomodulatory and immune 

suppressant effects. Animal studies have shown that the 

leaf extract possesses sedative and central nervous 

system depressant action. These effects were attributed 

partially to the ability to increase the levels of a neuro 

transmitter, Gamma aminobutyric acid (GABA), in the 

brain (Taylor, 2010). Results obtained from animal 

studies indicate that the aqueous and methanol extracts 

of B. pinnatum leaf possess antihypertensive properties. 

This lends credence to the folkloric use of the herb in the 

management of hypertension by some Yoruba people of 

Western Nigeria (Ojewole, 2002). 

In this investigation, 100 mg/ml was the most effective 

against the susceptible bacteria used and the lower the 

concentration, the lower the effectiveness, to the extent 

that 6.25 mg/ml showed no activity against any microorganism. 

This is similar to the work of Nwadinigwe 

(2009), who reported that the 150 mg/ml concentration of 

the ethyl acetate fraction of Emilia sonchifolia was the 

most effective against the bacteria used. Also, the lower 

the concentration, the lower the effectiveness to the 

extent that 9.375 and 4.688 mg/ml showed no activity 

against any micro-organism. In this work, S. aureus 

showed the lowest MIC value, while S. typhi 

demonstrated the highest MIC. This is somehow similar 

to the work of Nwadinigwe (2009) who reported that B. 

subtilis exhibited the lowest MIC value, while S. typhi 

showed the highest MIC for the ethyl acetate fraction of 

E. sonchifolia. 

In conclusion, B. pinnatum stem has the potential to be 

used as an antimicrobial agent, just like the leaves. 

However, further laboratory and clinical studies are 

required to determine its potency and safety. 

REFERENCES 

Akinpelu DA (2000). Antimicrobial activity of Bryophyllum pinnatum 

leaves. Fitoterapia 71:193-194. 

Akinsulire OR, Aibin IE, Adenipekun T, Adelowotan T, Odugbemi T 

(2007). In vitro antimicrobial activity of crude extracts from plants, 

Bryophyllum pinnatum and Kalanchoe crenata. Afr. J. Trad. Compl. 

Alt. Med. 4:338-344. 

Alade PI, Irobi ON (1993). Antimicrobial activities of crude leaf extracts 

of Acalypha wilkesiana. J. Ethnopharmacol. 39:171-174. 

Anonymous (2005). Checklist of medicinal plants of Nigeria and their 

uses. Jamoe pub. in Assoc. with Trinity-Biz pub., Nigeria. 

Aquil F, Ahmad I (2003). Broad-spectrum antibacterial and antifungal 

properties of certain traditionally used Indian medicinal plants. World 

J. Microbiol. Biotechnol. 19:653-657. 

Edafiogho DOC (2006). Computer graphics, spreadsheet (Excel) and 

SPSS. University of Nigeria Press Ltd., Nigeria. 

Harborne JB (1973). Phytochemical methods. Chapman and Hall, 

London. 

Hutchinson J, Dalziel JM (1954). Flora of West Tropical Africa. The 

Crown Agent for Colonies, Westminister, London. 

Igwe SA, Akunyili DN (2005). Analgesic effects of aqueous extracts of 

the leaves of Bryophyllum pinnatum. Pharm. Biol. 43:658-661. 

Kamboj A, Saluja A (2010). Microscopical and preliminary 

phytochemical studies on aerial parts (leaves and stem) of 

Bryophyllum pinnatum Kurz. Pharmacol. J. 2: 254-259. 

Lans CA (2006). Ethnomedicines used in Trinidad and Tobago for 

urinary problems and Diabetes mellitus. J. Ethnobiol. Ethnomed. 2:45 

DOI 10. 1186/1746-4269-2-45. 

Marriage PB, Wilson DG (1971). Analysis of the organic acids of 

Bryophyllum calycinum. Can. J. Biochem. 49:282-295. 

Mckenzie RA, Dunster PJ (1986). Hearts and flowers: Bryophyllum 

poisoning of cattle. Aust. Vet. J. 63:222-227. 

Mckenzie RA, Franke FP, Dunster PJ (1987). The toxicity to cattle and 

bufadienolide content of six Bryophyllum species. Aust. Vet. J. 

64:298-301. 

Mudi SY, Ibrahim H (2008). Activity of Bryophyllum pinnatum Kurz 

extracts on respiratory tract pathogenic bacteria. Bayero J. Pure and 

Appl. Sci. 1:43-48. 

Nwadinigwe AO (2009). Antimicrobial activities of some fractions of the 

extract of Emilia sonchifolia (Linn.) DC (Asteraceae). Plant Prod. Res. 

J. 13:31-34. 

Ofokansi KC, Esimone CO, Anele CK (2005). Evaluation of the in-vitro 

combined antibacterial effects of the leaf extracts of Bryophyllum 

pinnatum (Fam.Crassulaceae) and Ocimum gratissimum (Fam. 

Labiatae). Plant Prod. Res. J. 9:23-27. 

Ojewole JAO (2002). Antihypertensive properties of Bryophyllum 

pinnatum (Lam) Oken leaf extracts. Am. J. Hypert.15 (4): A34-A39. 

Ojewole JAO (2005). Antinociceptive, anti-inflammatory and antidiabetic 

effects of Bryophyllum pinnatum (Crassulaceae) leaf aqueous 

extract. J. Ethnopharmacol. 99: 13-19. 

Okwu DE (2003). The potentials of Ocimum gratissimum, Pengularia 

extensa and Tetrapleura tetraptera as spice and flavouring agents. 

Nig. Agric. J. 34: 143-148. 

Okwu DE, Josiah C (2006). Evaluation of the chemical composition of 

two Nigerian medicinal plants. Afr. J. Biotechnol. 5:357-361. 

Pelczar MJ, Chan ECS, Krieg NR (1993). Microbiology: concepts and 

applications. McGraw Hill Inc., New York. 

Salahdeen HM, Yemitan OK (2006). Neuropharmacological effects of 

aqueous leaf extract of Bryophyllum pinnatum in mice. Afr. J. 

Biomed. Res. 9: 101-107. 

Supratman U, Fujita T, Akiyama K, Hayashi H (2000). New insecticidal 

bufadienolide: bryophyllin C, from Kalanchoe pinnata. Biosci. 

Biotechnol. Biochem. 64:1310-1312. 

Taylor L (2010). The healing power of rainforest herbs. Rain Tree Nutr. 

Inc., Carson City, NV 89701. 

Trease GE, Evans WC (1983). Pharmacognosy. 12 th ed. Bailliere 

Tindal, London. 

Wikipedia, The free Encyclopedia (2009). Kalanchoe pinnata. 

http://en.wikipedia.org/wiki/kalanchoe.pinnata. 

Yamagishi T, Yan XZ, Wu RY, McPhail MC, Lee KH (1989). Antitumor 

agents, 110 bryophyllin B, a novel potent cytotoxic bufadienolide from 

Bryophyllum pinnatum. J. Nat. Prod. 52: 1071-1079. 

Yemitan OK, Salahdeen HM (2005). Neurosedative and muscle 

relaxant activities of aqueous extract of Bryophyllum pinnatum. 

Fitoterapia 76: 187-193.



DOI: 10.5897/AJB11.2295 



Determining the relationship between the application of 

fixed appliances and periodontal conditions 

Ahmad Sheibaninia 1 *, Mohammad Ali Saghiri 2 , A. Showkatbakhsh 3 , C. Sunitha 4 , S. Sepasi 1 , 

M. Mohamadi 5 and N. Esfahanizadeh 6 

1 Department of Orthodontic Fellow of Orthosurgery, Dental Branch, Islamic Azad University, Tehran, Iran. 

2 Department of Dental and Biological Materials, Kamal Asgar Research Center, MI, USA. 

3 Department of Orthodontic, Director of Orthosurgery Fellowship, Dental School, Shaheed Beheshti University of 

Medical Sciences, Tehran, Iran. 

4 Department of Conservative Dentistry and Endodontics, Saveetha Dental College Hospitals, Saveetha University, 

Chennai, India. 

5 Private Practice, Tehran, Iran. 

6 Department of periodontics, Dental Branch, Islamic Azad university, Tehran, Iran. 


The aim of this work was to study the relationship between the use of fixed appliances and periodontal 

conditions during orthodontic treatment. A Historical Cohort study design was used. The treatment 

group consisted of 30 patients undergoing fixed orthodontic treatment and 30 patients were used as 

controls. Both patient groups had no background of trauma resulting from bracket which might affect 

the gingival status and the control group had no history of previous orthodontic treatment. Periodontal 

condition of both groups was evaluated and assessed with bleeding index and periodontal hyperplasia. 

Exact Fisher test was used for statistical analysis. The mean age for the treatment group and the 

control group was 15.1±1.5 years and 14.7 ± 2.4 years, respectively. Gingival bleeding was 50 and 

76.7%, while gingival recession was 3.3 and 0% in control and treatment groups (P


Table 1. Distribution of studied groups according to age and periodontal symptoms using fixed orthodontic appliances. 

Group Mean age 

Gingival bleeding 

No Yes 

Gingival recession 

No Yes 

Gingival hyperplasia 

No Yes 

Control (N1 = 30) 15.14 ± 1.46 15 (50%) 15 (50%) 29 (96.7%) 1 (3.3%) 26 (86.6%) 4 (13.3%) 

Cases (N2 = 30) 14.73 ± 2.39 7 (23.3%) 23 (76.7%) 30 (100%) 0 16 (53.3%) 14 (46.6%) 

Test result P

control group. The amount of attributable risk of gingival 

enlargement (grade 2 and more) in the study group was 

33.3% as compared to the control group. 

DISCUSSION 

According to the results of the experimental group, 23 

persons (76.6%) complained of gingival bleeding, 16 

persons (53.3%) showed grade 1 gingival hyperplasia 

and less, and 14 persons (46.6%) showed grade 2 

gingival hyperplasia and more, and gingival recession 

was not observed in any of the experimental groups. 

There is a significant relationship between gingival 

bleeding (p


causes and prevent possible progress of the 

periodontal problem. 


We thank Dr Prasanna Neelakantan for invaluable help in 

many sections of this manuscript. 

REFERENCES 

Caranza FA, Newman MG, Glickman's I (1996). Clinical 

Periodontology.8th ed. Philadelphia, W. B SandersCo. ch 1,4: pp. 12- 

26, 218-232. 

Dieedrich P, Rudzki-Janson I, Wehrbein H, Fritz U (2001). Effects of 

orthodontic bands on marginal periodontal tissues. A histologic study 

on two human specimens. J. Orofac. Orthop. 2: 146-56. 

Gursoy UK, Sokucu O, Uitto VJ, Aydin A, Demirer S(2007).The role of 

nickel accumulation and epithelial cell proliferation in orthodontic 

treatment-induced gingival overgrowth. Eur. Orthod. 6: 555-558. 

Janson GR, Dainesi EA, Consolaro A, Woodside DG, de Freitas MR 

(1998). Nickel hypersensitivity reaction before,during,and after 

orthodontic therapy. Am. J. Orthod Dentofacial Orthop. 6: 655-660. 

Jenkings GN (1971). Plaque formation and metabolism. In: Eastoe Je, 

Diction DGA, Alexander AG, eds. The prevention of periodontal 

disease.London: Kimpton, pp. 34-45. 

Kloehn JS, Pfeier JS (1974). Effect of orthodontic treatment on 

periodontium. Angle Orthod. pp. 127-134. 

Lau PYW, Wong RWK (2006). Risks and complications in orthodontic 

treatment. Hong Kong Dental. J. 3: 15-22. 

Mercado F, Marshall R (2001). Relationship between R.A and 

periodontitis. J. Periodontol. 12: 779-787. 

Nagwa Helmy El-Mangoury, Soheir Gaafar M, Yehya Mostafa A (1987). 

Mandibular anteriorcrowding and periodontal disease. Angle Orthod. 

Jan: 33-38. 

Ristic M, Svabic MV, Sasic M, Zelic O (2007). Clinical and 

microbiological effects of fixed orthodontic appliance on periodontal 

tissues in adolescents. Orthod. Craniofacial Res. 4: 187-195. 

Shaw WC, O Brien KD, Richmond S, Brook P (1991). Quality control in 

orthodontics: risk/benefit conciderations. Br. Dent. G.170: 33-37. 

Theilade E, Theilade J (1976). Role of plaque in the etiology of 

periodontal disease and caries. Oral Sci. Rev. 9: 23-63. 

Travess H, Roberts Harry D, Sandy J(2004). Orthodontics .Part 6. Risks 

in orthodontic treatment. Br. Dent. J. 196: 71-77. 

Tuncer AV, Baylas H (1990). Examination of the effects of various 

orthodontic appliances on periodontal tissues. Turk. Ortodontic. 

Derg.3:13-8. 

Turkkahraman H, Sayin MO, Bozkurt FY, Yetkin Z, Kaya S, Onal S 

(2005). Arch wire ligation techniques, microbial colonization and 

periodontal status in orthodontically treated patients. Angle 

Orthod.2:231-6. 

Zachrisson S, Zachrisson BU (1972). Gingival condition associated with 

orthodontic treatment. Angle Orthod. 42: 26-34.



DOI: 10.5897/AJB11.1709 



Use of pheromone-baited traps for monitoring Ips 

sexdentatus (Boerner) (Coleoptera: Curculionidae) in 

oriental spruce stands 

Gonca Ece Ozcan 1 , Mahmut Eroglu 1 and Hazan Alkan Akinci 2 

1 Department of Forest Engineering, Faculty of Forestry, Karadeniz Technical University, Trabzon 61080, Turkey. 

2 Department of Forest Engineering, Faculty of Forestry, Artvin Coruh University, 08000 Artvin, Turkey. 


The population level and flight periods of Ips sexdentatus (Boerner) (Coleoptera: Curculionidae) was 

determined according to certain stand dynamics, altitude steps and temperatures based on the capture 

amounts in pheromone traps hung on some spruce stands in the oriental spruce, Picea orientalis (L.) 

Link. Forests of Turkey in 2006 to 2009. Average number of I. sexdentatus was statistically different 

between years and average annual highest number of captured beetles showed differences according 

to regions. The averages of the numbers of beetles caught in two different altitudes in two separate 

years are statistically different. In higher altitudes, average number of beetles caught per trap was 

higher. Provided data showed that I. sexdentatus has at least 2 generations in the forests of the region. 

First adult flight ranged from end of April to mid-June in both altitude steps, while second flight started 

in mid-June and continued until the mid-September. It was concluded that the beetles that were caught 

during fourth week of August and first week of September were the adults that would start a third 

generation. The predator species Thanasimus formicarius (L.) (Coleoptera: Cleridae) was caught in the 

pheromone traps as well as I. sexdentatus. In each trap, an average of 43.92 I. sexdentatus adults was 

captured per 1 T. formicarius adult. A total of 18 I. typographus (L.) (Coleoptera: Curculionidae) adults 

were captured by 5 traps containing Tryphreon Ipstyp aggregation pheromones. The trapping works in 

the research region have once again detected the existence of this species, which has densities that 

cannot be detected by other methods, and which is very dangerous for spruce stands since the first 

detection 75 years ago. 

Key words: Ips sexdentatus, pheromone baited traps, monitoring. 

INTRODUCTION 

Humans and insect pests are the most important biotic 

factors threatening oriental spruce forest wealth in the 

Eastern Black Sea region of Turkey (Ozcan and Alkan, 

2003). In sensitive nature of the region, spruce forests 

have an uppermost function expected from forests in 

water supplying, soil protection and preventing natural 

destructions (Eroglu et al., 2005). Regional forests are 

under serious pressure of people that live in mountain 

villages. This pressure makes forests extremely exposed 

against the attacks of some bark beetles (Benz, 1984). 

*Corresponding author. E-mail: goncaece@hotmail.com. Tel: 

+90 312 785 27 12. Fax: +90 462 325 74 99. 

Scolytid bark beetles (Coleoptera: Curculionidae) are 

important forest pests all over the world (Bakke, 1989). 

Most bark beetle species infest recently dead trees 

(Wood, 1982); some bark beetle species are known to 

attack and kill living trees, causing large economic losses 

(Berryman and Ferrell, 1988; Turchin et al., 1991; Reeve, 

1997). Natural distribution of oriental spruce, Picea 

orientalis (L.) Link., in Turkey (approximately 300 

thousand ha), in Eastern Black Sea region is generally at 

the seaside slopes of Black Sea mountain chains 

between the altitudes of 500 to 2400 m. Optimal 

distribution is over 1200 m (Saatcioglu, 1976; Demirci, 

1991). Oriental spruce stands are under serious threats 

of Dendroctonus micans (Kugelann), a very important 

pest directly attacking healthy trees; and Ips sexdentatus


(Boerner) and Ips typographus (L.) (Coleoptera: 

Curculionidae), both of which can easily have a primary 

position and cause a great outbreak. The attacks of D. 

micans in the oriental spruce forests of Turkey first 

started in 1966 (Acatay, 1968) and extended to the entire 

spruce stands in early 2000s (Eroglu et al., 2005). I. 

typographus outbreaks that were first discovered in 1984 

(Alkan, 1985) have caused major forest losses until 2007 

(Gokturk and Eldemir, 2005; Alkan-Akinci et al., 2009). I. 

sexdentatus is one of the most important pests of the 

forests of Turkey (Oymen, 1992). It has caused death of 

Pinus sylvestris L. and P. radiate D. Don. suffering from 

drought stress in central and Southern France, Northern 

Spain and Portugal (Goix, 1977; Perrot, 1977; Lieutier et 

al., 1988; Paiva et al., 1988). Outbreaks have occurred 

on P. orientalis and P. sylvestris in Turkey (Schimitschek, 

1939; Canakcıoglu, 1983; Schönherr et al., 1983; Oymen 

and Selmi, 1997). The existence of this beetle in Turkish 

pine and spruce forests has a very long past and 

recently, especially the great outbreaks in spruce forests 

have been recorded as the most outstanding disasters in 

the country (Bernhard, 1935; Schimitschek, 1953). This 

beetle has spread to a very wide area; from Japan to 

Southern Europe and Trans-Caucasia, from the Atlantic 

to the Pacific. This beetle prefers dead, dying, or 

weakened trees as its breeding material and is referred to 

as secondary insects, although it can become primary 

pest under outbreak conditions. The wood under the 

gallery is stained blue from fungi transferred by the 

beetles (Chararas, 1962). As in the case of other conifer 

bark beetles, I. sexdentatus acts as a vector for a blue 

stain fungus which also damages the tree (Lieutier et al., 

1989). This way, hundred hectares of forests can be 

easily destroyed (Schimitschek, 1953; Keskinalemdar 

and Ozder, 1995; Oymen and Selmi, 1997; Selmi, 1998, 

Yuksel and Tozlu, 2000). It prefers trees with thick bark. 

Moreover, it is observed to attack begining from the top 

sections of the trees (Canakcioglu, 1983). This beetle 

kills the trees in spruce forests in masses and thus, 

causes interruption of canopy in stand canopy closure 

and serious structural deteriorations within the stand 

(Ozcan, 2009). 

The development of mass deaths which appeared 

suddenly actually was completed in a long process 

(Yuksel, 1998). In Turkey, at Trabzon Yanbolu Valley - 

Santa and Degirmendere Valley - Meryemana spruce 

forests, 250,000 m 3 tree loss caused by I. sexdentatus in 

1928 (Bernhard, 1935) and had reached approximately 

one million m 3 in 1930s (Schimitschek, 1953). It was 

recorded that the total damage of the beetle in 1930 to 

1994 was over 1.500.000 m 3 (Keskinalemdar and Ozder, 

1995). I. sexdentatus is a native species of oriental 

spruce forests and until very recently when D. micans 

reached these forests and I. typographus developed an 

outbreak, it was the only threatening bark beetle of these 

forests. Great scale destructions of oriental spruce 

forests which were especially recorded in the last century 

and which were told by the public previously requires 

regular monitoring of population changes and densities of 

I. sexdentatus. The primary purpose of sampling the 

populations in these types of monitoring programs is to 

classify the population in terms of being under or over a 

critical threshold (Wainhouse, 2005). The validity of using 

pheromones has been proven for monitoring pests 

(Shorey, 1991). Lindgren funnel traps baited with aggregation 

pheromones are widely used to monitor and 

manage populations of economically important bark 

beetles (Hayes et al., 2008). Funnel traps are especially 

useful for monitoring the adult stages of beetles if proper 

attractors are available in the market. Although, they 

have the disadvantage of catching the natural enemies 

that react to the pheromone, funnel traps mainly provide 

“clean” sampling since they are species-specific 

(Wainhouse, 2005). Hagler (2000) expresses the 

compatibility of the use of pest-specific pheromones to 

biological control as stated by Shorey (1991). As with the 

other parabiologicals, pheromones are designed to be 

used as one of several components of an overall IPM 

program (Hagler, 2000). For example, the use of scolytid 

aggregation pheromones in traps for mass-trapping to 

reduce the density of local populations in the forest. 

Research on the role of semiochemicals in the ecology 

and behavior of insect pests has provided novel and 

potentially very powerful techniques for the management 

of insect populations (Wainhouse, 2005). I. sexdentatus 

is a bark beetle for which aggregation pheromones are 

important in determining the beetle colonization process 

(Bouhot et al., 1988). The male beetle initiates the boring 

and releases an aggregation pheromone consisting 

mainly of ipsdienol (Vité et al., 1974). Traps can be used 

in a large scale (Minks, 1977) for monitoring the beetle 

population (Lindelow and Schroeder, 2001; Wermelinger, 

2004). Moreover, monitoring based on pheromone traps 

can provide information on beetle population density and 

flight periods, based on yearly changing captured beetle 

number (Faccoli and Stergulc, 2006). In Turkey, first 

capturing trials against I. sexdentatus with pheromone 

traps started in 1982 in oriental spruce forests; the control 

measures against this beetle has continued through 

mechanical methods, variously designed funnel traps and 

biological agents (Serez and Eroglu, 1991; Serez, 2001). 

A total of 6290 pheromone traps were hung in Artvin 

forests between 2004 to 2009 in 4050 hectare area and 

11,482,000 adults were captured (Ozkaya et al., 2010). 

In this study that was based on the capture amounts in 

pheromone traps, the population levels, flight periods, 

flight durations and the time intervals of most catches of I. 

sexdentatus were determined according to certain stand 

dynamics, altitude steps and temperatures. With these 

evaluations, it was aimed to research the opportunities of 

more efficient utilizations of pheromone traps, in order to 

provide better monitoring of pest population levels and 

develop a more comprehensive and economic management 

strategy against the pest.

Table 1. Ips sexdentatus amounts captured in Macka Directorate of Forest Enterprises in 2006 to 2009 by funnel traps. 

Ozcan et al. 16353 

Region Year Number of traps Total number of beetles caught in traps Average number of beetle per trap 

2006 40 11608 290.20 

Yesiltepe 2007 65 33390 513.69 

2008 80 19469 243.36 

2009 45 28362 630.27 

Macka 

Catak 

Esiroglu 

Hamsikoy 


2006 35 5165 147.57 

2007 35 5890 168.29 

2008 40 18786 469.65 

2009 40 8354 208.85 

2006 50 8369 167.38 

2007 40 4221 105.53 

2008 40 6049 151.23 

2009 40 4415 110.38 

2006 30 770 25.67 

2007 35 3297 94.20 

2008 35 21500 614.29 

2009 35 31770 907.71 

2006 30 5079 169.30 

2007 41 11882 289.80 

2008 35 12905 368.71 

2009 35 7810 223.14 

This study was performed in Eastern Black Sea Region of Turkey, 

at the oriental spruce, Picea orientalis (L.) Link. stands with a 

natural dispersion area of 297,397 ha. The materials of this study 

are 1652 Triphreon Ipssex and 96 Triphreon Ipstyp commercially 

branded pheromone preparations, 826 pheromone traps containing 

these preparations, hung in spruce stands at Trabzon Regional 

Directorate of Forestry, Macka Directorate of Forest Enterprises, 

Yesiltepe, Macka, Catak, Esiroglu and Hamsikoy. The dominant 

tree species is oriental spruce. There are Scotch pine, beech, 

hornbeam, oak and chestnut in mixed stands in the study area and 

in the vicinity. Divisions of Forestry between the years 2006 to 

2009, and a total of 249,091 I. sexdentatus, 18 I. typographus 

adults caught in these traps, and 207 Thanasimus formicarius 

adults only caught in 40 traps in 2006. 

For monitoring I. sexdentatus flight periods, 75 traps containing 

Triphreon Ipssex branded pheromone preparations were used in 

2006, and 125 of these were used in 2009. For this purpose, the 

pheromone traps were placed in certain forest areas in 2006 at 

Yesiltepe and Macka regions, in 2009 at Yesiltepe, Macka and 

Catak regions, with 100 to 120 m intervals to provide a 

homogeneous dispersion. Pheromone traps were hung 15 to 20 m 

to the edge of the stand, inside the openings in the forest and 

roadsides during mid-April in both years. They were placed 

between two poles and 1.5 m higher over the ground. The traps 

were fixed by ropes to the wooden poles both from top and bottom. 

The traps were numbered with special cards attached. The altitudes 

and exposures of the points, where the traps were hung were 

recorded and first pheromone preparations were placed in the 

traps. First preparations were replaced in mid-June and the traps 

were kept in the forest until mid-September. The traps were 

regularly controlled after being placed in the forest; captured 

beetles were counted and recorded. Additionally, in 2006 a total of 

18 traps and in 2009 a total of 30 traps containing Triphreon Ipstyp 

commercially branded pheromone preparations were used. T. 

formicarius adults caught in the 31 traps between 3 May and 24 

August 2006 at Yesiltepe region, and I. sexdentatus adults caught 

during the same period have been assessed together. 


All statistical analyses were performed using SPSS 13.0 for 

Windows ® software. Logarithmic transformation was applied to the 

I. sexdentatus amounts gathered from capture results that did not 

show normal dispersions. Independent sample T-test and one way 

ANOVA were used depending on the variables. 

RESULTS 

I. sexdentatus amounts captured by a total of 826 funnel 

traps in the spruce stands of Macka Directorate of Forest 

Enterprises and Yesiltepe, Macka, Catak, Esiroglu and 

Hamsikoy forestry divisions in 2006, 2007, 2008 and 

2009 are given in Table 1. Without taking the years into 

account, the average number of beetles per trap has


Table 2. Number of beetles captured at two altitude ranges in 2006 and 2009 at Yesiltepe, Macka and Catak Regions. 

Year 

Number 

of traps 

2006 75 

2009 125 

Average number of 

beetles per traps 

223,76 

329,05 

Altitude range 

close values in Macka, Catak and Hamsikoy regions, 

while it was higher in Yesiltepe and Esiroglu regions. 

Average number of beetles per trap was higher in 

Yesiltepe in 2007 and 2009, higher in Macka in 2008, 

higher in Esiroglu in 2008 and 2009; while Catak and 

Hamsikoy had the same rates of captures in all years 

(Table 1). 

In Yesiltepe and Macka regions, 61.48% of all beetles 

captured by the traps in 2006 were received from 10 

traps. In these traps, average number of beetles per trap 

was 1031.2 (436 to 2580), while it was 99.4 in the 

remaining traps. In Yesiltepe, Macka and Catak regions 

59.93% of all beetles captured by the traps in 2009 were 

received from 12 traps. In these traps, average number of 

beetles per trap was 2054.33 (920 to 4761) while it was 

145.83 in the remaining traps. The higher captures at 

these two divisions in 2006 and 2009 happened in 

different compartments. Average highest number of 

beetles per year has also differed according to divisions 

(Table 1). In 2009, at a compartment in Yesiltepe region 

where traps 46, 47 and 48 were located between 

altitudes of 1200 to 1250 m and an average of 1941.33 

beetles were captured per trap; 18 to 20 spruces, with 

diameters of 30 to 60 cm, were killed in groups due to 

very severe attacks by I. sexdentatus in 2010. 

More also, in Yesiltepe and Macka regions in 2006, 

25.24% of all captured beetles were received from 48 

traps between 800 to 1200 m and 74.76% were received 

from 27 traps at altitudes of 1200 m and higher. At these 

altitudes, average numbers of beetles per trap were 

88.21 and 464.41, respectively (Table 2). In Yesiltepe, 

Macka and Catak Regions in 2009, 46.55% of all 

captured beetles were taken from 77 traps between 800 

to 1200 m, and 53.45% were taken from 48 traps at 

altitudes of 1200 m and higher. The average numbers of 

beetles per trap were 248.64 and 458.04, respectively 

(Table 2). Average number of beetles captured both 

years in these two altitude ranges have been statistically 

different (p0.05). In addition, in 

stands with various closures at Yesiltepe and Macka 

Number 

of traps 

Total number of 

beetles caught in traps 

Percentage of 

caught beetles (%) 

800 – 1200 m 48 4243 25.24 

1200 m and higher 27 12539 74.76 

800 – 1200 m 77 19145 46.55 

1200 m and higher 48 21986 53.45 

regions in 2006 and 2009, the average number of beetles 

captured by traps were statistically not different from 

each other (p>0.05). At the research areas, average 

number of beetles trapped in stands at different exposures 

both years, statistically were not different from each 

other (p>0.05). However, average number of captures of 

the traps with southern exposures (average 384.75) was 

higher than the traps with other exposures (average 

159.83). 

The distribution of the number of beetles, trapped 

between 800 to 1200 m and higher than 1200 m in 2006 

and 2009 at Yesiltepe, Macka and Catak regions, are 

shown in Figures 1 and 2 according to control dates. 

These data provided showed that I. sexdentatus has at 

least 2 generations in the forests of the region. At 

Yesiltepe and Macka regions, on May 3, when the first 

control of the traps at the spruce stands were made in 

2006 between 800 to 1200 m and higher than 1200 m; 

respectively, an average of 2.85 and 0.92 adult beetles 

were captured per trap. In 2006, it was observed that first 

flight of I. sexdentatus began before 3 May at both 

altitude steps. It was detected that the over-wintering 

adults mated and their attacks to the host trees began 

before May to lay the first eggs that would start the first 

generation of this year and that it lasted until the third 

week of June at both altitudes in this flight period. It was 

also observed that the adults that would start the second 

generation began to fly at the third week of June. 

Accordingly, the completion of the first generation that 

started in early May lasted for 50 to 55 days. On the 24th 

of August, when the last control of the traps at both 

altitudes were performed, respectively an average of 0.6 

and 2.18 captured adults per trap shows that the adult 

flights of the beetle in this year continued at least until 

end of August (Figure 1). 

At Yesiltepe, Macka and Catak regions, on 26 April 

2009, when the first control of the traps were performed 

at altitudes of 800 to 1200 m and higher than 1200 m, 

respectively an average of 0.22 and 0.13 beetles were 

captured per trap. This shows that in 2009, at both 

altitude steps, first flight of I. sexdentatus started before 

26 April. It was detected that the over-wintering adults 

mated and their attacks to the host trees began at the last 

week of April to lay the first eggs that would start the first 

generation in 2009 and that it lasted until the third week 

of June at both altitudes in this flight period, just like the

Average number of beetles per trap 

140 

120 

100 

80 

60 

40 

20 

0 

01.05.2006 

11.05.2006 

21.05.2006 

31.05.2006 

10.06.2006 

20.06.2006 

30.06.2006 

Control dates of traps 

10.07.2006 

800-1200m 800 – 1200 m 

1200m 1200 m and higher 

20.07.2006 

30.07.2006 

09.08.2006 


Figure 1. Number of Ips sexdentatus caught in traps on the control dates at two different altitudes in 2006 at Yesiltepe 

and Macka Regions. 

previous year. 

Furthermore, it was observed that the adults that would 

start the second generation of the beetle began to fly in 

third week of June. Accordingly, in this year the 

completion of the first generation that started in last week 

of April continued approximately for 55 to 60 days. On the 

4th of September when the last control of the traps at 

both altitudes were performed respectively, an average of 

2.84 and 3.38 captured adults per trap shows that the 

adult flights of the beetle in this year continued at least 

until the second week of September (Figure 2). In the 

research region, it was seen that the first adult flight 

observed in early May and end-April in 2006 and 2009, 

reached its highest number after approximately 20 days 

after the first flight at both altitude steps and that this high 

flight activity continued for approximately 20 days. In 

2006, 69.51 and 84.76% of all beetles trapped in the first 

and second altitude steps respectively, were captured in 

the first flight period; these numbers were 78.37 and 

71.27% in 2009 (Figures 1 and 2). In 2006, average 

number of beetles caught per trap in the first and second 

flight periods was respectively 12.26 and 4.48 at first 

altitude step, and respectively 78.72 and 11.79 at the 

second altitude step. In 2009, these amounts were 

respectively 39.15 and 18.01 at the first altitude step and 

respectively 72.78 and 44.79 at the second altitude step. 

The predator species T. formicarius was also caught by 

the pheromone traps together with I. sexdentatus. During 

the control of the traps, the predators, almost all being 

alive, were released. Number of I. sexdentatus and T. 

formicarius captured in 40 traps in Yesiltepe region 

between 3 May and 24 August 2006 are given in Table 3. 

All lively 207 T. formicarius adults were taken from 31 of 

40 traps (77.5%). In each of the eleven different control 

dates, an average of 9.36 (1 to 19) T. formicarius was 

found in these 31 traps. During the whole trapping 

season, these 31 traps averaged 293.42 I. sexdentatus 

and 6.68 T. formicarius adults. Each trap averaged 1 T. 

formicarius adult against 43.92 I. sexdentatus adults. 

Additionally, in 8 different controls; 1 to 6 T. formicarius 

adults were found in traps where no I. sexdentatus were 

found. Additionally, in 2006, only I. typographus adults 

were captured in traps containing I. typographus aggregation 

pheromones, using 5 Tryphreon Ipstyp commercially 

branded pheromone preparations. In these traps, 

on controls dated 3rd May, 26th May and 13th June; 2, 

11 and 5 I. typographus adults were found. In 2009, 13 

traps with the same pheromone preparations were hung 

but no I. typographus could be captured. 

DISCUSSION 

In Yesiltepe, Macka and Catak regions, the average 

number of I. sexdentatus trapped in two different years 

were found to be statistically different and the average 

number of beetles trapped in 2009 was 46.9% more than 

that of 2006. In 2006 and 2009, 61.48 and 59.93% of the 

total captured beetles were respectively taken from 10 

and 12 traps. In these traps, the average number of 

19.08.2006 

29.08.2006


Average number of beetles per trap 

300 

250 

200 

150 

100 

50 

0 

15.04.2009 

25.04.2009 

05.05.2009 

15.05.2009 

25.05.2009 

04.06.2009 

14.06.2009 

24.06.2009 

Control dates of traps 

04.07.2009 

14.07.2009 

24.07.2009 

03.08.2009 

800-1200m 

800 – 1200 m 

1200 1200m m and higher 

Figure 2. Number of Ips sexdentatus caught in traps on the control dates at two different altitudes in 2009 at 

Yesiltepe, Macka and Catak regions. 

Table 3. Numbers of Ips sexdentatus and Thanasimus formicarius, counted in the traps according to control dates. 

Trap control 

dates 

Number of traps with 

captured Thanasimus 

formicarius 

Number of Ips 

sexdentatus caught 

in traps 

Number of Thanasimus 

formicarius caught in 

traps 

13.08.2009 

23.08.2009 

02.09.2009 

Average number of 

predator per capture 

03.05.2006 1 8 1 1 

15.05.2006 9 1579 26 2.89 

26.05.2006 15 2486 58 3.87 

06.06.2006 8 1707 10 1.25 

13.06.2006 19 1794 45 2.37 

26.06.2006 3 133 3 1 

08.07.2006 12 664 22 1.83 

20.07.2006 6 298 9 1.5 

02.08.2006 9 258 14 1.56 

15.08.2006 6 111 12 2 

24.08.2006 5 58 7 1.4 

Total 93 9096 207 1.88 

beetles per trap was 1031.2 and 2054.33, and 99.4 and 

145.83 in the remaining traps. The higher captures at 

Yesiltepe and Macka regions in 2006 and 2009 occurred 

in different compartments. The highest average number 

of beetles captured per year differed according to forestry 

divisions (Table 1). At a compartment in Yesiltepe region 

where an average of 1941.33 beetles were captured per 

trap in 2009, 18 to 20 spruces with 30 to 60 cm diameters 

were killed in groups due to very severe attacks by I. 

sexdentatus in 2010. Similarly, the increase of average 

25.67 and 94.20 captures per trap in Esiroglu region in 

2006 and 2007 to 614.29 and 907.71 in 2008 and 2009 

may be the precursor of a similar damage impact at this 

certain areas in this region. Depending on the beetle’s 

population density in the distribution range, the amount 

caught by the pheromone traps differ from year to year 

and from region to region. 

In Black Sea Region, population of I. sexdentatus is

fluctuated at high densities (Oymen, 1992). Capture 

capacities of traps are affected by many factors such as 

their being hung to locations where there are suitable 

trees for the reproduction of the beetle, the attacks being 

near the trees, stand density and wind direction 

(Safranyik et al., 2004). The number of the bark beetles 

captured in the pheromone traps depends on environmental 

and local conditions (Lobinger, 1995). Beetles can 

only find the source of the pheromone under average 

weather and climate conditions. Having a small number 

of flying beetles, or short flight period affects the 

capturing efficiency of the traps. Additionally, the position 

of the location of the pheromone trap also has a different 

effect on capturing efficiency. If traps are hung close to 

each other, both affect the other mutually. Traps must be 

at least 10 m to the closest tree otherwise some beetles 

could attack trees near the trap and damage them 

(Serez, 1987). It is estimated that I. sexdentatus are 

attracted to pheromone traps from a maximum of 80 m 

(Jactel, 1991). In an assessment with 38 adult 

individuals, 98% of I. sexdentatus adults have flown more 

than 5 km, 50% have flown more than 20 km, and 10% 

have flown more than 45 km (Jactel and Gaillard, 1991). 

Beetles have been found in the stomach of trout in lakes 

35 km from the nearest spruce forest (Nilssen, 1978). 

Dispersal over longer distances depends on transportation 

under the bark of logs. Stinking smell caused by 

rotten beetles can decrease the capturing efficiency of 

the traps (Kretschmer, 1990). Therefore, traps must be 

controlled with brief intervals and their being cleaned 

after each control, especially after rain and snow, is 

essential. 

In Yesiltepe, Macka and Catak regions during 2006 and 

2009, the average number of beetles trapped bet-ween 

800 to 1200 m and at 1200 m and higher altitudes were 

statistically different. Average beetle amount captured per 

trap at 1200 m was 5.26 times higher in 2006 and 1.84 

times higher in 2009, than those in traps at 800 to 1200 

m. At altitudes where spruce has optimum distribution, 

namely 1200 m and higher, higher amount of trapped 

beetles can be explained by having a higher beetle 

population. However, number of trapped beetle may 

change due to regional differences dependent on stand 

characteristics influencing density increase and outbreak 

development, ecologic factors such as water economy 

and relative humidity, and the features of growing 

environment based on bedrock and soil structures. 

Captured beetle data gathered from Yesiltepe, Macka 

and Catak regions in 2006 and 2009 at two different 

altitude steps reveal that I. sexdentatus has at least 2 

generations in the forests of these regions. This result is 

directly supported by other researches based on field 

findings. The species has only two generations in central 

areas of Eurasia and four to five generations in the 

Mediterranean area and in other areas with a long, warm 

summer season (Vité et al., 1974). It is known that in this 

region, first flight occurs during early April (Besceli and 


Ekici, 1969; Serez, 1983) and mid-May and second flight 

occurs between mid-June and end-August (Besceli and 

Ekici, 1969). It is observed that I. sexdentatus usually 

completes 2 generations a year in oriental spruce forests 

and that the adults, who could only start the third 

generation in suitable weather conditions (Sekendiz, 

1991), mate at the end of August and early-September 

and lay eggs (Yuksel, 1998). The flight time of the first 

generation in the pine forests of the Mediterranean 

Region occurs in May, and the second generation’s flight 

occurs in August (Tosun, 1977). Under the conditions in 

Turkey, usually 2 generations a year is seen; however, a 

third generation can be seen under suitable climate 

conditions. (Sarıkaya, 2008) 

In 2006, at both altitude steps, I. sexdentatus’s first 

flight started before 3rd May and continued until the third 

week of June. The flight of the adults that would start the 

second generation started in the third week of June and 

continued until the end of August. In 2009, at both 

altitude steps, the first flight started before 26 April and 

continued until the third week of June. The second flight 

again started in third week of June and continued until 

the end of second week of September. It was seen in 

2006 and 2009 that there were no differences between 

the first adult flight dates at two altitude steps. Average 

temperatures of January, February, March and April in 

2006 and 2009 at 1000 m were 3.3 and 4.1°C. Average 

temperatures of these months at 1500 m were 0.8 and 

1.57°C. In both years, average temperatures of April, 

according to altitude steps, were respectively 6.3 and 

3.8°C, and 5.2 and 2.7°C. The spring flight starts when 

the temperature exceeds about 20°C; in the north- this is 

in May/June, in southern areas in March/April (Vité et al., 

1974; Sarıkaya, 2008). In this case, it was understood 

that the highest temperatures reached in late-April and 

early-May and their durations have been effective on 

these flights, rather than the monthly average 

temperatures. Temperature has a role of a limiting factor 

on the daily amounts of trapped beetles and captured 

beetle amounts depend on the daily duration of a 

temperature over a threshold that allows the beetles’ 

flight, and on the daily highest temperature (Bakke, 

1968). 

In the assessment made according to the results of 

these captures; the flight times of the adults who flew last 

in the first flight in very little numbers, and of the adults 

who flew first in the second flight cannot be distinguished 

and thus; the ending dates of the first flight and the 

starting dates of the second flight coincide. It was 

detected that the first flight of this beetle begins in March, 

April and May in the forests of the region depending on 

the altitude, and consequently they laid eggs in April, May 

and June (Yuksel, 1998). The second flight that began in 

the third week of June continued until the end of August 

in 2006 and until the second week of September in 2009. 

Laying period of the second generation continues from 

June to first week of August depending on the altitude.


According to these results, it can be understood that the 

adults trapped in late August in 2006 and early 

September in 2009 are the adults who would start the 

third generation observed in late August and early 

September according to lower and higher altitude steps 

(Yuksel, 1998). 

In 2006 and 2009, the completion of the first generation, 

which started in early May and last week of April, 

has taken approximately 50 to 60 days. The completion 

of the second generation between last week of June and 

last week of August was approximately 60 to 65 days. It 

is reported that the period of development from I. 

sexdentatus eggs laid in the first generation to the 

emergence of young adults is 40 days (Bonnemasion, 

1962). However, it is also reported that this period can 

increase to 78 days in nature, due to larval development 

phases being affected by climate conditions (Chararas, 

1962). A total of 40 days period of a generation of this 

beetle (Ozder, 1978) was detected as 60 days in Artvin 

(Ataman, 1967). Brood development from the start of 

gallery construction until the emergence of the new 

generation adults may take 2 to 3 weeks at a constant 

laboratory temperature of 27°C and 3 to 4 weeks at 22°C. 

No gallery construction and brood production succeeds at 

a constant temperature of 12°C. Overwintering is in the 

adult stage. The super-cooling point in hibernating adults 

is about -19°C, whereas in larvae it is only -9°C (Bakke, 

1968). At both altitude steps, the numbers of beetles 

trapped in the first flight are higher than those in the 

second flight. Average capture rates per trap in 2006 and 

2009 are respectively 2.74 and 2.17 times higher in the 

first flight periods than the second flight periods at the 

first altitude steps and respectively 6.68 and 1.62 times 

higher in the second altitude steps. Highest catches in 

the first flight happened between 15th May and 13th 

June. The orientations of the over-wintering adults to 

dead and felled trees in the second flight might have 

caused them to react less to the aggregation pheromone 

used. In this case, it can be more valid to take into 

account the capture amounts for sampling the populations 

in the monitoring programs. Although pheromone 

preparations in the traps are replaced before the second 

flight, the capture efficiency decrease in this flight period 

may require a research on the format of the chemical 

compound of the pheromone preparations to be used for 

this flight. Most of the pheromone traps caught the 

predator species T. formicarius as well as I. sexdentatus. 

In 2006, at Yesiltepe region, between 3rd May and 24th 

August, all lively 207 T. formicarius adults were taken 

from 31 of 40 traps. In each trap 1 T. formicarius adult 

was captured against an average of 43.92 I. sexdentatus 

adults. Additionally, in eight different controls, 1 to 6 T. 

formicarius adults were found in traps where no I. 

sexdentatus adults existed. T. formicarius is an abundant 

and voracious predator of bark beetles. It is attracted by 

bark beetle pheromones and host tree substances 

(Schroeder, 1997). Serez (1983) states that next to I. 

sexdentatus, parasitoid species are also caught 

by pheromone traps as well as predator species T. 

formicarius. Clerid beetles react to the same pheromones 

with their preys (Aukema et al., 2000). In the mechanical 

control against I. sexdentatus in Murgul in 1985, plenty of 

predators (Rhizophagus dispar, T. formicarius, Raphidia 

sp.) were found in beetle galleries (Alkan and Aksu, 

1990). The assessments based on fresh I. sexdentatus 

galleries in the Eastern Black Sea Region between 1992 

and 1996, T. formicarius, Cylister oblongum, Paraphloeus 

longulus, Rhizophagus depressus, Rhizophagus dispar 

and Hypophloeus unicolor were found to be the most 

effective predators (Yuksel 1998). In the experiments, it 

was observed that T. formicarius reduced T. piniperda’s 

(L.) (Coleoptera: Scolytidae) reproduction efficiency as 

much as 81 to 92% (Schroeder, 1996; Schroeder and 

Weslien, 1994). Therefore, having this many T. 

formicarius adults in the traps comes out as a disadvantage 

of pheromone traps. Furthermore, in 2006, 18 

I. typographus adults were captured by 5 traps containing 

Tryphreon Ipstyp aggregation pheromone. In 2009, I. 

typographus was not caught in any traps other than 

these, including the 13 traps containing the same pheromone 

preparation. Also, I. typographus was not found 

among the beetles captured by traps with I. sexdentatus 

preparations, where I. typographus had been caught 

previously. This situation may be an indication of the 

selectivity of the used pheromone preparations against 

species. 

The existence of I. typographus in Turkish oriental 

spruce forests has been known for 75 years (Berker, 

1936; Alkan, 1964). However, I. typographus has developed 

a very severe outbreak effective in a 15,000 ha 

area, in 1984 in Artvin (Alkan, 1985), the first infested 

region after the great scale outbreak first caused by D. 

micans in the spruce forests (Eroglu et al., 2005). The 

results of these captures by pheromone traps, which 

were made after the first detection of I. typographus in 

Trabzon-Macka spruce forests, were a second finding of 

this beetle in these forests. The second big outbreak of I. 

typographus occurred in the spruce stands of Giresun 

where D. micans infested after Artvin. These pheromone 

traps, which were mostly used to support pressuring of 

low-intensity populations and to gather data on 

population fluctuations, made it available to detect the 

existence of a very dangerous species, I. typographus, in 

the region, a species which stayed under such low 

densities that could not be detected with other methods 

for long. 

REFERENCES 

Acatay A (1968). Turkiye’de yeni bir ladin tahripcisi, Dendroctonus 

micans Kug. I.U. Orm. Fak. Derg. 18: 18–36. 

Alkan B (1964). Turkiye’nin bitki zararlısı kabuk bocekleri (Col., 

Scolytidae) faunası uzerine arastırmalar. A.U. Zir. Fak. Yıll. 4: 345– 

401.

Alkan S (1985). Savsat isletmesi ormanlarında Dendroctonus micans 

Kug. (dev soymuk bocegi). Orm. Muh. Derg. 1: 59–62. 

Alkan S, Aksu Y (1990). Rhizophagus dispar Pk.'in Ips sexdentatus ve 

diger kabuk bocekleri uzerindeki etkisi ile biyolojik mucadele 

uygulamalarında kullanılması olanakları uzerine arastırmalar. 

Uluslararası Biyolojik Mucadele Sempozyumu, Antalya, pp. 120–123. 

Alkan Akinci H, Ozcan GE, Eroglu M (2009). Impacts of site effects on 

losses of oriental spruce during Dendroctonus micans (Kug.) 

outbreaks in Turkey. Afr. J. Biotechnol. 8(16): 3934-3939. 

Ataman O (1967). Dogu Karadeniz ladin ormanlarında Ips sexdentatus 

kabuk bocegi tahribatı ve mucadele esasları. Tek. Bult. Derg. 6(22): 

79–89. 

Aukema BH, Dahlsten DL, Raffa KF (2000). Exploiting behavioral 

disparities among predators and prey to selectively remove pests: 

maximizing the ratio of bark beetles to predators removed during 

semiochemically based trap-out. Environ. Entomol. 29: 651–660. 

Bakke A (1968). Ecological studies on bark beetles (Coleoptera: 

Scolytidae) associated with Scots pine (Pinus sylvestris L.) in Norway 

with particular reference to the influence of temperature. Meddelelser 

fra det Norske Skogforsøksvesen, 83: 441–602. 

Bakke A (1989). The recent Ips typographus outbreak in Norwayexperiences 

from a control program. Holarct. Ecol. 12: 515–519. 

Benz G (1984). Dendroctonus micans in Turkey: The stuation today. 

Proceedings of the EEC Seminar Biological Control of Bark Beetles 

(Dendroctonus micans), 3–4 October, Brussels, Belgium, pp. 43–47. 

Berker A (1936). Orman Koruma Bilgisi. Ziraat Vekaleti, Orman 

Mektebi, Yayın 1, Istanbul, p. 377. 

Bernhard R (1935). Türkiye ormancılıgının mevzuatı, tarihi ve vazifeleri. 

Yük. Zir. Ens. Nesriyatı, No: 15, Ankara. 

Berryman AA, Ferrell GT (1988). The fir engraver beetle in western 

states. Dynamics of forest insect populations: patterns, causes, and 

implications (ed. by Berryman AA), Plenum, New York, pp. 556–576 

Besceli O, Ekici M (1969). Dogu ladini (Picea orientalis L.) mintikasinda 

Ips sexdentatus’un biyolojisi ve mucadelesi. Ormancılık Aras. Ens. 

Yayınl., Tek. Bul. Ser. No. 32, p. 32. 

Bonnemasion L (1962). Les ennemis animaux des plantes cultivées ed 

des forests. Editions Sep Paris. I, 586p, II, 500p, III 413p. 

Bouhot L, Lieutier F, Debouzie D (1988). Spatial and temporal 

distribution of attacks by Tomicus piniperda L. and Ips sexdentatus 

Boern. (Col., Scolytidae) on Pinus sylvestris. J. Appl. Entomol. 106: 

356–371. 

Canakcıoglu H (1983). Orman Entomolojisi, Ozel Bolum. I.U. Orm. Fak. 

Yayın No: 412, 244–247. 

Chararas C (1962). Etude biologigue des scolytides des conifères, 

Editions Paul. Lechevalier, Paris, p. 556. 

Demirci A (1991). Dogu Ladini (Picea orientalis (L.) Link.)–Dogu Kayını 

(Fagus orientalis Lipsky.) karısık mescerelerinin genclestirilmesi. 

Doktora tezi, KTU Fen Bilimleri Enstitüsü, Trabzon. 

Eroglu M, Alkan Akinci H, Ozcan GE (2005). Ladin ormanlarımızda 

kabuk bocegi yıkımlarına karsı izlenebilecek kısa ve uzun dönemli 

mücadele ve iyilestirme calısmaları. Ladin Sempozyumu, 20-22 Ekim 

2005, Trabzon, Bildiriler Kitabı, I. Cilt, pp. 184-194. 

Faccoli M, Stergulc F (2006). A practical method for predicting the 

short-time trend of bivoltine populations of Ips typographus (L.) 

(Coleoptera, Scolytidae). J. Appl. Entomol. 130(1): 61–66. 

Goix J (1977). Le dépérissement des pins dans la region 'Centre'. 

Phytoma, 290: 18-21. 

Gokturk T, Eldemir B (2005). Kabuk boceklerinin Artvin ormanlarında 

olusturdugu servet kaybı. Ladin Sempozyumu, 20-22 Ekim 2005, 

Trabzon, Bildiriler Kitabı, I. Cilt, pp. 300-306. 

Gokturk T, Eldemir B (2005). Kabuk boceklerinin Artvin ormanlarında 

olusturdugu servet kaybı. Ladin Sempozyumu, 20-22 Ekim 2005, 

Trabzon, Bildiriler Kitabı, I. Cilt, pp. 300-306. 

Hagler JR (2000). Biological control of insects, In: Rechcigl JE and 

Rechcigl NA (Eds.), Insect Pest Management: Techniques for 

Environmental Protection, CRC Lewis Publishers, Boca Raton, New 

York. 

Hayes CJ, DeGomez TE, Clancy KM, Williams KK, McMillin JD, Anhold 

JA (2008). Evaluation of funnel traps for characterizing the bark 

beetle (Coleoptera: Scolytidae) communities in ponderosa pine 

forests of north-central Arizona. J. Econ. Entomol. 101(4): 1253–65. 

Jactel H (1991). Dispersal and flight behaviour of Ips sexdentatus 


(Coleoptera: Scolytidae) in pine forest. Ann. Sci. For. 48: 417-428. 

Jactel H, Gaillard J (1991). A preliminary study of the dispersal potential 

of Ips sexdentatus Boern (Coleoptera: Scolytidae) with an 

automatically recording flight mill. J. Appl. Entomol. 112: 138–145. 

Keskinalemdar E, Ozder Z (1995). Dogu Karadeniz ormanlarında 

meydana gelen onemli bocek salgınları ve yapılan mucadeleler. I. 

Ulusal Karadeniz Ormancılık Kongresi, 23–25 Ekim 1995, Trabzon, 

Bildiriler Kitabı, 3. Cilt, pp. 175-181. 

Kretschmer K (1990). Zur wirkung von aasgeruch auf die fangleistung 

von buchdruckerfallen. Anz. Schaädlingskde., Pflanzenschutz, 

Umweltschutz, 63: 46–48. 

Lieutier F, Faure T, Garcia J (1988). Les attaques de scolytes et le 

dépérissement du pin sylvestre dans la region Provence-Cote d'Azur. 

Revue Forestière-Française, 40: 224-232. 

Lieutier F, Cheniclet C, Garcia J (1989). Comparison of the defense 

reactions of Pinus pinaster and Pinus sylvestris to attacks by two 

bark beetles (Coleoptera: Scolytidae) and their associated fungi. 

Environ. Entomol. 18, 228-234. 

Lindelow Å, Schroeder M (2001). Spruce bark beetle, Ips typographus 

(L.), in Sweden: monitoring and risk assessment. J. For. Sci. 47: 40– 

42. 

Lobinger G (1995). Einsatzmoglichkeiten von borkenkäferfallen. Allg. 

Forst. Z., Waldwirtsch, Umweltvorsorge, 50: 198–201 

Minks AK (1977). Trapping with behaviour-modifying chemicals: 

feasibility and limitations. In: Shorey HH, McKelvey Jr. JJ (Eds.), 

Chemical control of insect behavior, NY: John Wiley and Sons Inc. 

pp. 385–395. 

Nilssen AC (1978). Development of a bark fauna in plantation of spruce 

(Picea abies (L.) Karst.) in North Norway. Astarte 11: 151-169. 

Oymen T (1992). The forest scolytidae of Turkey. I.U. Orm. Fak. Derg. 

A, 42(I): 77–91. 

Oymen T, Selmi E (1997). The forest bark beetles of Turkey and their 

epidemy. Porceedings of the XI. World Forestry Congress, Antalya, 

A(1): p. 200. 

Ozcan GE, Alkan Akinci H (2003). The effects of insect pest on the 

oriental spruce forests under traditional utility in the Eastern Black 

Sea Region of Turkey. XXXI. IFSS Congress, Istanbul, Turkey, 

Proceedings, pp. 91-95. 

Ozcan GE (2009). Macka orman isletmesi dogu ladini ormanlarında 

baslıca kabuk boceklerinin savas olanaklarının arastırılması. KTU 

Fen Bilim. Enstitüsü, Trabzon, p. 147. 

Ozder MZ (1978). Dogu ladini mıntıkasında Ips sexdentatus'un biyolojisi 

ve mucadelesi, Trabzon Hasere Mucaele Grup Mudurlugu Yayını, p. 

4. 

Ozkaya MS, Aksu Y, Gokturk BC (2010). Picea orientalis ve Pineus 

silvestris ormanlarında zarar yapan Ips sexdentatus (Boerner) 

(Coleoptera: Scolytidea)’un biyolojisi, morfolojisi, yayılısı, zararı, yapılan 

mucadele calısmaları ve alınan sonuclar uzerine arastırmalar. III. 

Ulusal Karadeniz Ormancılık Kongresi, 20-22 Mayıs 2010, Artvin, 

Bildiriler Kitabı, Cilt 4, pp. 1318–1326. 

Paiva MR, Pessoa MF, Vité JP (1988). Reduction in the pheromone 

attractant response of Orthotomicus erosus (Woll.) and Ips 

sexdentatus Boern. (Col., Scolytidae). J. Appl. Entomol. 106: 198- 

200. 

Perrot M (1977). Les attaques de scolytes sur les pins de la région 

centre. Revue Forestière Française, 29: 185-198. 

Reeve JD (1997). Predation and bark beetle dynamics. Oecologia 112: 

48–54 

Saatcioglu F (1976). Silvikulturun Biyolojik Esasları ve Prensipleri 

(Silvikultur I). I.U. Orm. Fak. Yayın No: 2187, p. 222. 

Safranyik L, Shore TL, Linton DA (2004). Measuring trap efficiency for 

bark beetles (Col., Scolytidae). Blacwell Verlag, JEN. 128(5): 337– 

341. 

Sarıkaya O (2008). Batı Akdeniz Bölgesi İğneyapraklı Ormanlarının 

Scolytidae (Coleoptera) Faunası. Süleyman Demirel Üniversitesi, Fen 

Bilimleri Enstitüsü, Doktora Tezi, Isparta, p. 224. 

Schimitschek E (1939). Beiträge zur Forstentomologie der Türkei III: Die 

Massenvermehrung des Ips sexdentatus Börner im Gebiete der 

orientalischen Fichte. Zeitschrift für angew. Entomologie, 26: 545- 

588. 

Schimitschek E (1953). Turkiye Orman Bocekleri ve Muhiti. I.U. Yayın 

No: 556, Orm. Fak. Yayın No: 24, p. 471.


Schönherr J, Vité JP, Serez M (1983). Überwachung von Ips 

sexdentatus-Populationen mit synthetischem Lockstoff. Zeits. für 

angew. Entomologie, 95: 51-53. 

Schroeder LM, Weslien J (1994). Interactions between the phloemfeeding 

species Tomicus piniperda (Col.: Scolytidae) and 

Acanthocinus aedilis (Col.: Cerambycidae) and the predator 

Thanasimus formicarius (Col.: Cleridae) with special reference to 

brood production. Entomophaga, 39: 149–157. 

Schroeder LM (1996). Interactions between the predators Thanasimus 

formicarius (Col.: Cleridae) and Rhizophagus depressus (Col.: 

Rhizophagidae), and the bark beetle Tomicus piniperda (Col.: 

Scolytidae). Entomophaga, 41: 63–75. 

Schroeder LM (1997). Impact of natural enemies on Tomicus piniperda 

offspring production. Proceedings: Integrating cultural tactics into the 

management of bark beetle and reforestation pests. USDA Forest 

Service General Technical Report NE 236: 204–214. 

Sekendiz OA (1991). Abies nordmanniana (Stev.) Spach.’nın Doğu 

Karadeniz Bölümü Ormanlarındaki Zararlı Böcekleri ile Koruma ve 

Savaş Yöntemleri. OGM Yayınları, Yayın No: 678, Sıra No: 73, p. 

200. 

Selmi E (1998). Turkiye Kabuk Bocekleri ve Savası. I.U. Yayın No: 

4042, p. 196. 

Serez M (1983). Turkiye orman zararlı boceklerinden Ips sexdantatus 

(Boerner) savasında ilk feromon denemeleri. KTU Orm. Fak. Derg. 2: 

251–256. 

Serez M (1987). Bazı onemli kabuk bocekleriyle savasda feromonların 

kullanılma olanakları. KTU Orm. Fak. Derg. 10(1): 99–131. 

Serez M, Eroglu M (1991). Turkiye'de orman zararlısı bazı boceklerle 

savasta biyoteknik yontemlerden yararlanma olanakları. VII. Kukem 

Kongresi, Kukem Derg. 14 (2): 58–59. 

Serez M (2001). Zararlı boceklere karsı feromon tuzaklarının 

kullanılması. Orm. Muh. Derg. 8: 5-6. 

Shorey HH (1991). The use of chemical attractants in insect control, in 

CRC handbook of pest management in agriculture, 2nd Edition, Vol. 

II, Pimentel D. Ed. CRC Press, Inc., Boca Raton. 

Tosun I (1977). Akdeniz bolgesi igne yapraklı ormanlarında zarar yapan 

bocekler ve onemli turlerin parazit ve yırtıcıları uzerine arastırmalar. 

O.G.M. Yayınl., Sıra No: 612, Seri No: 24, p. 201. 

Turchin P, Lorio PL, Taylor AD, Billings RF (1991). Why do populations 

of southern pine beetles (Coleoptera: Scolytidae) fluctuate? Environ. 

Entomol. 20: 401–409 

Vité JP, Bakke A, Hughes PR (1974). Ein Populations lockstoff des 

Zwölfzähnigen Kiefern borkenkäfers Ips sexdentatus. 

Naturweissenschaften, 61: 365-366 

Wainhouse D (2005). Ecological methods in forest pest management. 

Oxford University Press, New York 

Wermelinger B (2004). Ecology and management of the spruce bark 

beetle Ips typographus -a review of recent research. For. Ecol. 

Manage. 202: 67–82. 

Wood DL (1982). The role of pheromones, kairomones, and allomones 

in the host selection and colonization behavior of bark beetles. Ann. 

Rev. Entomol. 24: 411–446. Environ. Entomol. 20: 401–409. 

Yuksel B (1998). Ips sexdentatus (Boerner)’un biyolojisi ve mucadelesi. 

I.U. Orm. Fak. Cumhuriyetimizin 75. Yılında Ormancılıgımız 

Sempozyumu. 

Yuksel B, Tozlu G, Senturk M (2000). Sarıkamıs sarıcam (Pinus 

silvestris L.) ormanlarında etkin zarar yapan kabuk bocekleri ve 

bunlara karsı alınabilecek onlemler. Dogu Anadolu Orm. Aras. Enst. 

Tek. Bulten Yayın No: 3 p. 69.



DOI: 10.5897/AJB11.2094 



Distributional record of oak gall wasp (Hymenoptera: 

Cynipidae) species’ diversity in different regions of 

West-Azerbaijan, Iran 

Abbas Hosseinzadeh 

Department of Plant Medicine, Mahabad Branch, Islamic Azad University, Mahabad, Iran. E-mail: 

abas1354@yahoo.com. Tel: +98-9143435104. Fax: +98-442-2341005. 


Among gall–inducing insects, the majority of species are gall wasps (Hymenoptera: Cynipidae) that 

occur on oak trees (Quercus spp.) and produce galls on a certain part of the host. In this survey, oak 

gall wasp species were collected from the oak forests of Pardanan, Mirabad, Nalas, Sardasht, Hamran 

and Dar-ghabr in West-Azerbaijan province. The galls occurring on 50 cm sampled branches from four 

cardinal directions on each tree were counted multiple times throughout the season. Species richness 

of oak gall wasps was estimated for each region and also species diversity indices such as Simpson’s 

index, Shannon’s H', and Sorensen similarity quotient were calculated. In this survey, 40 oak gall wasps 

species were identified. Most galls were found on Quercus infectoria. All of the collected oak gall wasps 

belonged to seven genera: Andricus, Cynips, Neuroterus, Chilaspis, Pseudoneuroterus, Biorhiza and 

Aphelonyx. Among these species, 28 were related to the Andricus genus. The highest Simpson and 

Shannon indices were recorded in the Dar-ghabr and Pardanan regions in the fall, respectively. The 

highest Sorensen similarity was recorded in the spring's galls (sexual generation of oak gall wasps) and 

fall' galls (asexual generation) between Pardanan and Mirabad, and between Pardanan and Dar-ghabr 

regions, respectively. Differences in the local distribution of oak species, especially their subspecies, 

and the climate of the locations should be considered as main factors in oak gall wasp species diversity 

and the distribution of oak gall wasp species. 

Key words: Diversity, Similarity index, oak, gall wasps, forest. 

INTRODUCTION 

The Zagros Mountains in Iran are divided into the 

northern Zagros and southern Zagros. West-Azerbaijan 

province is located in the northern Zagros that is the main 

habitat of Quercus infectoria Oliv (Fatahi, 1994; Sabeti, 

1998; Saghebtalbi et al., 2004). This region is the focus 

of our study. 

Oak gall wasps select oak trees for gall formation on 

certain specialized organs (Rokas et al., 2003). About 

80% of wasps in the family Cynipidae produce diverse 

galls on oaks in terms of structure and form (Short and 

Castner, 1997; Liljeblad and Ronquist, 1998). Cynipid gall 

formation is an extremely complex interaction between 

cynipid gall wasps and the host plant, in which the wasp 

communicates with the host plant to redirect normal plant 

development to create galls that provide nutrients and 

protection for the developing larva (Nyman and Julkunen- 

Tiitto, 2000; Stone et al., 2002; Nylander, 2004). Sexual 

and asexual generations of oak gall wasps produce galls 

in the spring and early summer, and in the summer and 

autumn, respectively (Schonrogge et al., 1999). Biodiversity 

in each region should be a key health and 

environmental sustainability of the region (Schowalter, 

1996; Ashori and Kheradpir, 2009). 

Species diversity refers to the variety of species such 

as the number and relative abundance in a defined 

location. Species diversity can be measured in different 

ways, which can be classified into three groups of 

measurements: species richness, species abundance 

and taxonomic or phylogenetic diversity (Magurran, 

1988). There are four methods for evaluating species 

diversity and one of them is general index of diversity. A 

number of these indices that assess the relative 

frequency of the species are known as heterogeneity 

indexes. One indicator is the Shannon diversity index that


involves predicting an individual randomly from a set of S 

species with N selected individuals (Magurran, 1988, 

2004). This index is usually between 1.5 and 4.5 and the 

low level of this index represents the destruction of the 

environment (Schowalter, 1996). Another index is 

Simpson index that is based on abundance and 

evenness of species. This indicator is strongly related to 

dominant species, but has little sensitivity to species 

richness. This index value is between zero and one and 

the numbers close to one represent a high diversity 

(Simpson, 1949). Beta diversity is measured by important 

indicators such as Sorensen which are used to show the 

variation in trends in different localities (Schowalter, 

1996). 

Oak gall wasp species have high richness in the West- 

Azerbaijan province. Shojai (1980) reported 36 oak gall 

wasp species associated with oak Q. infectoria from Iran. 

Recent surveys were conducted about the cynipids fauna 

in Iran (Azizkhani, 2006; Tavakoli et al., 2008; Zargaran 

et al., 2008) and according to the latest results, and 82 

species of oak gall wasps have been introduced in the 

oak forests of Iran whereas 25 species are species that 

were reported in the world for the first time (Sadeghi et 

al., 2010). However, few studies have measured oak 

cynipid gall wasps diversity. Nazemi et al. (2008) 

reported species richness of oak gall wasps from 

Kurdistan, Ilam and Kermanshah provinces of Iran. The 

oak gall wasps species diversity and their distribution in 

West-Azerbaijan province of Iran were carried out in 

2008-2009. The objective of this paper is to measure oak 

gall wasp diversity in multiple regions in West-Azerbaijan 

province. 


Sampling was performed in six regions of West-Azerbaijan 

province, Iran (Table 1), in 2008-2009 where cynipid galls were 

collected from oak forests. The climates were identified based on 

Dumarten's climate classification method. In our study area, 

sampling of cynipid galls took place in the mid and the end of 

spring, in the end of summer, and in the mid of fall to collect sexual 

and asexual galls occurring throughout the seasons. The optimal 

number of samples was determined according to Southwood and 

Henderson’s formula (2000) that is N=(t×s / D×m) 2 , where t is 

student’s T-test of standard statistical tables, D is the 

predetermined confidence limit for the estimation of the mean 

expressed as a decimal (0.2), m is preminaliry sampling mean and 

s is the standard deviation. The optimal number of samples was 

determined to be 30 trees per region. In total, we counted galls on 

360 trees in six sites (30 trees per site) in two years. All cynipid 

galls were counted on randomly selected four branches (each 

branch length was 50 cm) in four cardinal directions per tree. Also, 

the trees were selected randomly. 

We calculated species diversity using a variety of indices. 

Species diversity refers to the variety of species. Species richness 

was measured by counting the number of species in a defined area 

or site. We also measured the species abundance of each species. 

Measures of species diversity that simplify information on species 

richness and relative abundance into a single index are of extensive 

use (Magurran, 2004). We calculated species richness, Shannon’s 

H', Simpson’s index, and Sorensen similarity coefficient for each 

region in the spring and the fall collections separately using 

Ecological Methodology 3.0 software (Krebs, 1998). 

Shannon-Weiner index: The computation of this diversity index 

uses the following formula: 

N o 

Shannon’s H' = - i 1 

p 

i 

* log 

p 

i 

Where, pi is the proportion of the total number of individuals, and No 

is the total number of species in a region. 

Simpson's index: The diversity index is calculated using the 

following formula: 

Simpson’s diversity indices = 1 - 

i 

N 

1 

ni 

( ni 

N( 

N 

1) 

1) 

Where, ni is the number of individuals of a particular species in a 

region, N is the total number of individuals of all species in a region. 

Similarity coefficients directly compare diversity of different sites 

and represent the number of species common to all areas. 

Sørensen similarity index is calculated from this formula as: 

Cs = 2a / (2a + b + c) 

Where, a is the number of species common to both sites, b is the 

number of species in site B, but not in A and c is the number of 

species in site A, but not in B. 

RESULTS 

In the six sites, 40 oak gall wasps species were collected 

and separated. These species were in the following 

genera: Andricus (28 species), Cynips (3 species), 

Neuroterus (4r species), Pesudoneuroterus (1 species), 

Chilaspis (1 species), Biorhiza (1 species) and Aphelonyx 

(2 species). The genus Andricus had the highest species 

richness. Also, gall wasp species richness was different 

among the regions. We collected 34 species from 

Pardanan, 17 species from Mirabad, 15 species from 

Nalas, 18 species from Hamran, 28 species from Darghabr 

and 17 species from Sardasht regions. The highest 

oak gall wasp species’ richness was found in the 

Pardanan region whereas Nalas region had the lowest 

species richness among the stations. The highest 

number of species of the genus Andricus was observed 

in the Pardanan region with 25 species and the lowest 

number of this genus was 8 species in Nalas region. 

Cynips was found in all of the regions and maximum 

number of 3 species belonging to Cynips was collected 

from Pardanan and Dar-ghabr regions. All species of the 

genus Neuroterus sp. (total 4 species), were obtained 

from the Nalas region. Meanwhile, only 1 species of the 

genus Neuroterus was observed in Mirabad region. The 

two genera Pseudoneuroterus and Chilaspis with 1 

species were found only in the Hamran region. Biorhiza 

pallida Olivier was obtained from Pardanan, Mirabad and 

Sardasht but Aphelonyx was observed in all of the study 

regions.

Table 1. Oak gall wasp species diversity in different regions of West-Azerbaijan, 2008-2009. 

Characteristic 

Host (Quercus) 

S, Spring; F, fall; *, not calculated (only one species was collected). 

Table 2. Sorensen similarity quotient (percent) in different regions of West-Azerbaijan. 

Hosseinzadeh 16363 

Region 

Pardanan Mirabad Hamran Nalas Dar-ghabr Sardasht 

Q. infectoria 

Q. brantii 

Q. libani 

Q. infectoria 

Q. brantii 

Region Pardanan Mirabad Nalas Hamran Dar-ghbr Sardasht 

Pardanan * 70.2(max) *62.2 * Not similar * Not similar *65.3 

Mirabad 56.2 *66 *41 * Not similar *61 

Nalas 53 45.2 *32(min) * Not similar *43.5 

Hamran 42 43.1 51.5 *57.6 * Not similar 

Dar-ghbr 87.3(max) 44 25.4(min) 55 * Not similar 

Sardasht 64.2 60.7 38 33.2 58 

(* means, for the spring's galls and other are the fall's galls). 

All species of oak gall wasps were gathered on 3 

species of oak Q. infectoria, Q. brantii and Q. libani and 

Table 3 presents the species-rich fauna of oak gall wasp 

species in West-Azerbaijan that occurred on Q. infectoria. 

The highest number of the spring' species was found on 

Q. brantii The lowest value of Simpson index (0.524) 

was found in the spring collected galls from Sardasht 

region and the highest value of this index (0.912) was 

recorded in the summer and fall galls in Dar-ghabr region 

(Table 1). The only collected species from Dar-ghabr in 

spring was Andricus cecconi Kieffer that produced the 

galls on Q. brantii. Thus, we could not calculate diversity 

indices for this region. The highest value of Shannon 

index, for summer-fall galls was recorded in Pardanan 

and Dar-ghabr regions and the high level of this index in 

these regions indicate that oak gall wasp species have 

the highest species richness and abundance in these 

regions. The lowest of Shannon index in spring's galls 

was observed in Sardasht (2.231) area 

Beta diversity, which indicates a change in species 

richness among regions, is measured using Sorensen 

Q. infectoria 

Q. brantii 

similarity quotient Of spring's galls, the highest similarity 

was between Mirabad and Pardanan and the lowest 

recorded index of similarity was between two regions, 

Hamran and Nalas (Table 2). Pair wise regions such as 

Hamran and Pardanan, Dar-ghabr and Pardanan, Darghabr 

and Mirabad, Dar-ghabr and Nalas, Sardasht and 

Hamran do not share any species; therefore, the similarity 

value was zero The highest and lowest similarity 

index of the summer galls was observed between Darghabr 

and Pardanan (87.3%), and between Nalas and 

Dar-ghabr (25.4%), respectively (Table 2). 

DISCUSSION 

Q. infectoria 

Q. brantii 

Q. infectoria 

Q. brantii 

Q. libani 

Q. infectoria 

Q. brantii 

Q. libani 

Latitude 36° 39′N 36° 15′N 36° 01′N 36° 35′N 36° 11′N 36° 25′N 

Longitude 45° 28′W 45° 22′W 45° 47′W 45° 11′W 45° 24′W 45° 48′W 

Climate Very humid and cold 

Very humid 

and cold 

Humid 

Mediterranean 

Very humid 

Mediterranean 

Humid 

Mediterranean 

Very humid 

Mediterranean 

Diversity index 

Simpson 

Shannon’s H’ 

No. of species 

(Spring+Fall) 

S 0.721 0.811 0.612 0.659 * 0.524 

F 0.896 0.841 0.875 0.813 0.912 0.835 

S 2.019 2.322 1.662 1.756 * 1.231 

F 4.117 2.963 3.109 2.735 4.108 3.308 

34(4+30) 17(5+12) 18(3+15) 15(3+12) 28(1+27) 17(3+14) 

40 oak gall wasps species from studied areas in West- 

Azerbaijan province were identified to belong to seven 

major genera of the family Cynipidae. Andricus, Cynips 

and Aphelonyx with 65.7, 11.42 and 5.7 abundance, 

respectively were distributed in all of the areas. Andricus 

was found on the three oak species, Cynips on Q.


Table 3. Oak gall wasps species associated with oak trees in West-Azerbaijan, 2008-2009. 

Oak gall wasps species 

Spring gall 

Location of gall formation Type of generation Host 

1 A. burgundus (Giraud, 1859) Catkin Sexual Q. libani 

2 A. cecconii (Kieffer, 1901) Catkin Sexual Q. brantii 

3 A. curvator (Hartig, 1840) Leaf Sexual Q. infectoria 

4 A. grossulariae (Giraud, 1859) Catkin Sexual Q. brantii 

5 A. multiplicatus (Giraud, 1859) Leaf Sexual Q. brantii 

6 Biorhiza pallida (Olivier, 1791) Shoot Sexual Q. infectoria 

7 Chilaspis israeli (Sternlicht, 1968) Catkin Sexual Q. brantii 

8 Andricus pseudoaries (Melika et al. 2004) Shoot Asexual Q. infectoria 

9 A. askewi (Melika and Stone, 2001) Shoot Asexual Q. infectoria 

10 A. caliciformis (Giraud, 1859) Shoot Asexual Q. infectoria 

11 A. caputmedusae (Hartig, 1843) Shoot Asexual Q. infectoria 

12 A. conglomeratus (Giraud, 1859) Shoot Asexual Q. infectoria 

13 A. coriarius (Hartig, 1843) Shoot Asexual Q. infectoria 

14 A. foecundatrix (Hartig, 1840) Shoot Asexual Q. infectoria 

15 A. galeatus (Giraud, 1859) Shoot Asexual Q. infectoria 

16 A. gemmeus (Giraud, 1859) Shoot Asexual Q. infectoria 

17 A. hystrix (Trotter, 1899) Shoot Asexual Q. infectoria 

18 A. kollari (Hartig, 1843) Shoot Asexual Q. infectoria 

19 A. lucidus (Hartig, 1843) Shoot Asexual Q. infectoria 

20 A. mediterraneae (Trotter, 1901) Shoot Asexual Q. infectoria 

21 A. megalucidus (Melika et al. 2003) Shoot Asexual Q. infectoria 

22 A. panteli (Kieffer, 1901) Branch Asexual Q. infectoria 

23 A. polycerus (Giraud, 1859) Branch Asexual Q. infectoria 

24 A. quercuscalicis (Borgsdorf, 1783) Fruit Asexual Q. infectoria 

25 A. quercustozae (Bosc, 1792) Shoot Asexual Q. infectoria 

26 A. seckendorffi (Wachtl, 1879) Shoot Asexual Q. infectoria 

27 A. sternlichtii (Bellido and Melika, 2003) Shoot Asexual Q. infectoria 

28 A. theophrastea (Trotter, 1901) Shoot Asexual Q. infectoria 

29 A. tomentosus (Trotter, 1901) Shoot Asexual Q. infectoria 

30 A. megatruncicolus Giraud Shoot Asexual Q. infectoria 

31 Aphelonyx cerricola (Giraud, 1859) Shoot Asexual Q. brantii 

32 Aphelonyx persica (Melika et al. 2004) Shoot Asexual Q. brantii 

33 Cynips cornifex (Hartig, 1843) 

Leaf Asexual Q. infectoria 

34 C. quercus (Fourcroy, 1785) Leaf Asexual Q. infectoria 

35 C. quercusfolii (Linnaeus, 1758) Leaf Asexual Q. infectoria 

36 Neuroterus saliens (Kollar, 1857) Leaf Asexual Q. brantii 

37 N. lanoginosus (Giraud, 1859) Leaf Asexual Q. brantii 

38 N. numismalis (Geoffroy, 1785) 

Leaf Asexual Q. infectoria 

39 N. quercus-baccarum (Linnaeus, 1758) Leaf Asexual Q. infectoria 

40 Pseudoneuroterus macropterus (Hartig, 1843) Shoot Asexual Q. brantii 

infectoria and Q. brantii, and Aphelonyx only on Q. 

brantii. Considering the different studied climatic regions, 

at the first stage it did not appear that these species’ 

distribution will be affected by climate change. Q. 

infectoria was the most widely distributed oak in all 

regions, and subsequently the highest number of galls 

(30 galls) was recorded on this oak species It was host 

to the highest gall species richness on Q. infectoria. 

Meanwhile, the numbers of 9 and 1 species of gall wasps 

were present on Q. brantii and Q. libani, respectively. 

Similarly, Azizkhani et al. (2007) found that oak gall wasp 

fauna of the Lorestan province in Iran was higher on Q. 

brantii compared to Q. infectoria Pseudoneuroterus and 

Chilaspis species produced galls on Q. brantii and only 

were collected from the Hamran region. Given that Q. 

brantii was present in both areas and that Hamran and

Dar-ghabr regions have similar climates, which appear to 

be of other factors involved in the distribution of these 2 

species and very possibly the presence of different 

subspecies of oak trees will be investigated as the first 

important factor in this relationship. Among 40 of oak gall 

wasps species, 7 spring galls and 33 summer-fall galls 

were identified. Most of the spring's galls (4 galls) were 

created by the sexual generation of oak gall wasp 

species on Q. brantii. In contrast, most summer-fall galls 

(28 species) were made by asexual generation of oak 

gall wasps on Q. infectoria. Only one species of oak gall 

wasps in the spring is gall-maker on Q. libani. In fact, 

these oak species have the lowest richness of oak gall 

wasps. Based on climatic similarity in the Pardanan and 

Mirabad regions and also the presence of Q. brantii as a 

dominant species, the highest similarity was found in the 

spring between these two regions. The lowest similarity 

was registered between Hamran and Nalas regions that 

contain similar oak species, and different climates. It 

seems that presence of oak gall wasp species was 

affected by climate and or oak species and also 

subspecies. Due to a lower species richness in spring (7 

species) and lack of equal distribution in various regions, 

the rate similarity index was zero in many areas that 

showed dissimilarity in the desired areas (Table 2). Stone 

et al. (2002) suggests geographical differences in oak 

gall wasp fauna is related to oak distribution patterns in 

different regions The highest similarity of the asexual 

generation of oak gall wasp was observed between the 

Pardanan and Dar-ghabr regions where the plant 

covering is the same but climates are different from each 

other. Oak gall wasp species richness might be expected 

to increase due to the richness of host plant species 

(Starzomski et al., 2008) Species richness of oak gall 

wasps in Mexico was reviewed and the results showed 

that species richness between insects and host plants 

have positive correlations (Cuevas-Reyes et al., 2004). 

Galling insects may preferentially select those plant 

species with characteristics such as chemical toxicity, 

mechanical strength, or longevity that can be manipulated 

to benefit the galler (Genimar-reboucas et al., 

2003). Gall traits (such as structure, location, and 

phenology) may play important roles in community 

diversity, but there is little empirical evidence of this 

(Hayward and stone, 2005). The lowest similarity was 

observed between Dar-ghabr and Nalas in summer. 

Probably the presence of oak species and their 

subspecies was the cause of this difference and led to 

different richness of oak gall wasp and a minimum 

similarity between these two regions has been recorded 

Blanche (2000) in a study concluded that the ambient 

temperature and rainfall does not have an effect on 

distribution of galling insects and we cannot conclude that 

the species richness in warm and dry regions is higher 

than the cold and humid regions. But, some results in 

relation to galling-insect distribution showed that the 

effect of humidity on the distribution of these insects is 

Hosseinzadeh 16365 

minor and leads to the lower species richness (Fernandes 

and Price, 1992) 

Price et al. (2004) studied the oak gall wasps demographic 

population changes and also the relationship 

between host plant and gall wasps species richness. Gall 

wasps are specialist and because all of the galling 

insects are usually host-specific, generation and maintenance 

of gall wasp species richness is often related to 

plant species richness (Wright and Samways, 1996; 

Abrahamson et al., 1998; Price, 2005). 


I dedicate my cordial thanks to the head of Islamic Azad 

University, Mahabad Branch, for their financial and 

scientific supports. I also thank Dr. Zargaran for 

assistance and analyzing of the data. 

REFERENCES 

Abrahamson WG, Melika G, Scrafford R, Csoka C (1998). Gall-inducing 

insects provide insights plant systematic relationships. Am. J. Bot. 85: 

1159-65. 

Ashori A, Kheradpir N (2009). Inset Ecology. University of Tehran 

Publishing. p. 579. 

Azizkhani E (2006). Parasitoid fauna of oak gall wasps in Lorestan 

province. PhD thesis, Faculty of Agricultural, Tehran University, p. 

277. 

Azizkhani E, Sadeghi SE, Rasoulian GR, Tavakoli M, Omid R, Moniri 

VR, Yarmand H (2007). Survey of gall wasps of the family Cynipidae 

associated with two oak species Quercus brantii and Q. infectoria in 

Lorestan province of Iran. Iranian J. For. Range Prot. Res. 5: 66-79. 

Blanche KR (2000). Diversity of insect-induced galls along a 

temperature-rainfall gradient in the tropical savannah of the Northern 

Territory. Austral. Ecol. 25(4): 311-18. 

Cuevas-Reyes P, Quesada M, Hanson P, Dirzo R, Oyama K (2004). 

Diversity of gall-inducing insects in a Mexican tropical dry forest: the 

importance of plant species richness, life-forms, host plant age and 

plant density. J. Ecol. 92: 707-716. 

Fatahi M (1994). Oak Forests of Zagros. Institute of Forests and 

Rangelands Publishing. p. 63. 

Fernandes GW, Price WP (1992). Adaptive significance of insect galls 

distribution: survival of species in xeric and mesic habitats. Oecologia, 

90: 14-20. 

Hayward A, Stone GN (2005). Oak gall wasp communities: evolution 

and ecology. Basic Appl. Ecol. 6(5): 435-443. 

Genimar-Reboucas J, Eduardo-Martins V, Wilson F (2003). Richness 

and abundance of gall-forming insects in the Mamiraua Varzea, a 

flooded Amazonian forest. UAKARI, 1(1): 39-42. 

Krebs CJ (1998). Ecological methodology. Second ed. Addison Wesley 

Publishing, USA. p. 620. 

Liljeblad J, Ronquist F (1998). Phylogenetic analysis of higher-level gall 

wasp relationships (Hymenoptera: Cynipidae). Syst. Entomol. 23: 

229-252. 

Magurran AE (1988). Ecological diversity and its measurement. First ed. 

Croom Helm Ltd. Publishing, London. p. 179. 

Magurran AE (2004). Measuring biological diversity. Blackwell 

Publishing, Oxford, UK. 

Nazemi J, Talebi AA, Sadeghi SE, Melika G, Lozan A (2008). Species 

richness of oak gall wasps (Hymenoptera: Cynipidae) and 

identification of associated inquilines and parasitoids on two oak 

species in western Iran. North-Western J. Zool. 4: 189-202. 

Nylander JAA (2004). Bayesian phylogenetics and the evolution of gall 

wasps. Comprehensive summaries of Uppsals dissertations from the 

Faculty of Science and Technology. Available on: http://www.uu.se. p.


43. 

Nyman T, Julkunen-Titto R (2000). Manipulation of the phenolic 

chemistry of Willows by gall-inducing sawflies. Proc. Natl. Acad. Sci. 

USA, 97: 13184-13187. 

Price PW (2005). Adaptive radiation of gall-inducing insects. Basic . 

Appl. Ecol. 6:413-421. 

Price PW, Abrahamson WG, Hunter M, Melika G (2004). Using gall 

wasp on oaks to test broad ecological concepts. Conserv. Biol. 18: 

1405-16. 

Rokas A, Melika G, Abe Y, Nieves-Aldrey J, Cook J, Stone NG (2003). 

Life cycle closure, lineage sorting, hybridization revealed in a 

phylogenetic analysis of European oak gall wasps. Mol. Phyl. Evol. 

26: 36-45. 

Sabeti H (1998). Forests, Trees and Shrubs of Iran. University of Yazd 

Publishing. p. 802. 

Sadeghi SE, Melika G, Stone GN, Assareh MA, Askary H, Tavakoli M, 

Yarmand H, Azizkhani E, Zargaran MR, Barimani H, Dordaii AA, 

Aligholizadeh D, Salehi M, Mozafari M, Zeinali S, Mehrabi A (2010). 

Oak gallwasps faune of Iran (Hym: Cynipidae: Cynipini). 7th 

international Congress of Hymenoptroists, p. 112. 

Saghebtalbi K, Sajedi T, Yazdian F (2004). Forests of Iran. Institute of 

Forests and Rangelands Publishing. p. 27. 

Schonrogge K, Walker P, Crawley M (1999). Complex life-cycle in 

Andricus kollari Linneaus (Hymenoptera: Cynipidae). Oikos, 84: 293- 

301. 

Schowalter T (1996). Insect ecology. Oregon Univ. Pub. p. 479. 

Shojai M (1980). Study of the gall forming cynipid Hymenoptera of 

Iranian oak forests. J. Entomol. soc. Iran, supplement 3. 

Short D, Castner L (1997). Insect Galls. Available on: http:// hammock. 

ifas. ufl. edu. p. 22. 

Simpson GH (1949) Measurement of diversity. Nature, 163: p. 688. 

Southwood TRE, Henderson PA (2000). Ecological methods. First ed. 

Blackwell Science Ltd., Oxford, UK. pp. 575. 

Starzomski BM, Parker RL, Srivastava DS (2008). On the relationship 

between regional and local species richness: A test of saturation 

theory. Ecology, 89(7): 1921-1930. 

Stone GN, Schonrogge K, Atkinson R, Bellido D, Pujade-Villar J (2002). 

The population biology of oak gall wasps (Hymenoptera:Cynipidae). 

Annu. Rev. Entomol. 47: 633-668. 

Tavakoli M, Melika G, Sedeghi S, Penzes Zs, Assareh M, Atkinson R, 

Betchold M, Miko I, Zargaran MR, Aligholizadeh D, Barimani H, Bihari 

P, Pirozi F, Fulop D, Somogyi K, Challis R, Preuss S, Nichollas J, 

Stone GN (2008). New species of Cynipid gall wasps from Iran and 

Turkey (Hymenoptera: Cynipini). Zootaxa, 1699: 1-64. 

Wright MG, Samways MJ (1996). Insect species richness tracking plant 

species richness in a diverse flora: gall-insects in the Cape floristic 

region. Oecologia, 115: 427-433. 

Zargaran MR, Sadeghi SE, Hanifeh S (2008). Identification of oak gall 

wasps and their parasitoids in west Azerbaijan province of Iran. 

Report of project of Institute of forests and rangelands, Iran. p. 108. 

(in Persian).



DOI: 10.5897/AJB11.1101 



Phosphine resistance in Rhyzopertha dominica 

(Fabricius) (Coleoptera: Bostrichidae) from different 

geographical populations in China 

XuHong Song, PingPing Wang and HongYu Zhang* 

State Key Laboratory of Agricultural Microbiology, Institute of Urban and Horticultural Pests, College of Plant Science 

and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China. 


This study was carried out to determine the level of phosphine resistance in 16 Rhyzopertha dominica 

(Fabricius) populations that were collected from ten provinces and one municipality in China following 

the Food and Agriculture Organization’s (FAO) standard method. Results showed that the 50% lethal 

concentration (LC50) of phosphine to these R. dominica populations ranged from 0.017 to 4.272 mg/L. Of 

the 16 populations, 5 were of low resistance, 6 were moderately resistant, and 5 were high resistant. 

The instantaneous rate of population increase (ri) was correlated with phosphine resistance followed by 

the Exponential model (y = 0.037e -0.005X , R 2 = 0.937). The relationship between the types of grain storage 

and the phosphine resistance of R. dominica population were also discussed. 

Key words: Phosphine resistance, instantaneous rate of population increase, Rhyzopertha dominica, China. 

INTRODUCTION 

The lesser grain borer, Rhyzopertha dominica (Fabricius) 

(Coleoptera: Bostrichidae), is a widely studied stored-product 

insects originating from tropical areas, but actually 

distributed all over the world. Both larvae and adults are 

internal feeders, causing serious damages to grains, 

such as rice, maize, wheat and other stored commodities. 

The insect can develop and maintain a high rate of 

oviposition in dry grains, and can even survive in grains 

with as low as 8% moisture content (Birch, 1945a, b). 

Existing projections indicate that future population and 

economic growth will require a doubling of current food 

production, including an increase from 2 billion to 4 billion 

tons of grains annually (Tubiello et al., 2007). However, 

the activities of insects and mites could frustrate these 

efforts. Arthropod pests are responsible for deterioration 

of stored food and can cause yearly losses estimated at 

about 30% of 1800 million tons of stored grain (Haubruge 

et al., 1997). In China, 60% grain yield is usually stored 

for further use, and as part of food security grain storage; 

*Corresponding author. E-mail: hongyu.zhang@ mail.hzau. edu. 

cn Tel: 86-27-87281156. 

during which about 6-12% grain loss as a result of pest 

damage is recorded in rural areas (Lan, 2006). 

The main method for controlling stored-product insects 

in many countries, including China, is through fumigation 

with phosphine and methyl bromide. Use of methyl 

bromide is associated with depletion of the ozone layer 

and bromine residues in the soil (WMO, 1995; Ristaino 

and Thomas, 1998). Therefore, there is increased 

reliance on phosphine to control stored-product insects 

(Lorini et al., 2007). Phosphine gas has been used worldwide 

for more than half a century as a useful fumigant for 

the control of stored-product insects (Price and Mills, 

1988; Chaudhry, 2000), and for the protection of stored 

grains and other commodities from pest attack. 

However, widespread resistance to phosphine has 

emerged in several species of stored-product insects in 

many countries in which phosphine control failure has 

been detected (Champ and Dyte, 1977; Chaudhry, 2000; 

Collins et al., 2005; Lorini and Collins, 2006; Pimentel et 

al., 2007, 2010; Savoldelli and Süss, 2008; Collins, 

2009). Several strong phosphine-resistant stored-product 

insects have been found in Morocco (Benhalima et al., 

2004), Brazil (Ansell et al., 1990; Mills and Athie, 2001; 

Athie and Mills, 2005), Vietnam (Bui, 1999), China (Yan


Table 1. Origin of Chinese populations of R. dominica. 

Population City Province Grain category Storage facility Time 

ZC Zhucheng Shandong Wheat Wheat processing industry September, 2007 

XC Xuchang He’nan Wheat Local storage August, 2007 

HD Handan Hebei Wheat National storage September, 2008 

XN Changsha Hu’nan Rice Rice processing industry August, 2008 

ZG Hefei Anhui Rice Rice processing industry August, 2008 

GA Gaoan Jiangxi Rice Local storage August, 2008 

HP Wuhan Hubei Rice National storage July, 2008 

AL Anlu Hubei Rice National storage September, 2007 

SY Shayang Hubei Rice National storage May, 2007 

XF Xiangfan Hubei Rice National storage May, 2007 

BN Chongqing Chongqing Rice Rice processing industry September, 2007 

BB Chongqing Chongqing Rice National storage September, 2007 

LZ Luzhou Sichuan Rice National storage October, 2008 

GY Guiyang Guizhou Rice National storage August, 2008 

YC Yangchun Guangdong Rice Local storage May, 2007 

JM jiangmen Guangdong Rice Local storage August, 2007 

et al., 2004; Cao, 2006), Australia (Collins, 1998; 

Bengston et al, 1999; Valmas and Ebert, 2006 ) and 

Pakistan (Alam et al., 1999; Ahmedani et al., 2006, 

2007). 

Resistance to phosphine has been reported in several 

economical important insect species, including R. 

dominica (F.), Sitophilus oryzae (Linnaeus), Sitophilus 

zeamais (Motschulsky), Tribolium castaneum (Herbst) 

Trogoderma granarium Evert, Oryzaephilus surinamensis 

(L.), Cryptolestes ferrugineus (Stephens), Liposcelis 

bostrychophila (Badonnel), L. entomophila (Enderlein) 

and L. decolor (Pearman) (Champ and Dyte, 1977; Borah 

and Chahal, 1979; Benhalima, 1988; Leong and Ho, 

1994; Lorini and Galley, 1999; Nayak et al., 2002, 2003; 

Cao et al., 2003; Athie and Mills, 2005; Pimentel et al., 

2010; Nayak and Collins, 2008; Collins, 2009). 

Resistance in insects is often linked (among other 

factors) to various fitness traits, such as intrinsic rates of 

increase (White and Bell, 1990), the change of rate of 

population growth (Fragoso et al., 2005; Haubruge and 

Arnaud, 2001), fecundity and male reproductive competition 

(Arnaud and Haubruge, 2002). Fragoso et al. 

(2005) detected that insect population that are resistant 

to pyrethroid showed a reduced rate of population growth 

compared with other populations. However, Haubruge 

and Arnaud (2001) suggested that resistant population 

did not always involve decreased fitness. Therefore, the 

growth rate of insect populations was fundamental to 

insecticide resistance management. 

The aim of this study was to detect the phosphineresistance 

status of R. dominica populations in China. 

Understanding the level of resistance to phosphine and 

assessing the instantaneous rate of population increase 

(ri) would be very useful toward the development of an 

appropriate strategy for resistance management of this 

pest. 


16 populations of R. dominica were collected from ten provinces 

and one municipality in China between May, 2007 and October, 

2008 (Table 1). Geographical distribution of R. dominica 

populations sampled in China includes: Shandong, He’nan, Hebei, 

Hubei, Guangdong, Sichuan, Jiangxi, Anhui, Guizhou, Hu’nan 

provinces and Chongqing municipality. The cities from which 

samples were obtained are as follows; Zhucheng (ZC), Xuchang 

(XC), Handan (HD), Changsha (XN), Hefei (ZG), Gaoan (GA), 

Wuhan (HP), Anlu (AL), Shayang (SY), Xiangfan (XF), Chongqing 

(BN), Chongqing (BB), Luzhou (LZ), Guiyang (GY), Yangchun (YC) 

and Jiangmen (JM). The sparseness of these locations with their 

latitude and longitude coordinates, and the type of grain storage 

facilities are shown in Figure 1 and Table 1, respectively. BB, LZ, 

HD, GY, HP, AL, XF and SY populations were collected from 

national storage facilities. ZC population came from wheat 

processing industry. BN, XN and ZG populations were collected 

from rice processing industry, while XC, YC, JM and GA populations 

were from local storage. 

The 16 populations and standard susceptible population of R. 

dominica studied were then reared on cracked wheat grains (13 ± 

1% moisture content) free of insecticide residues. The temperature 

in the rearing chamber was maintained at 30 ± 1°C and 75 ± 5% 

relative humidity. Non-sexed adults of R. dominica (14 to 21-day 

old) were used in phosphine resistance assays. 

Phosphine bioassays 

Fumigation of adult R. dominica was based on the FAO standard 

method (FAO, 1975) and it took place in a controlled temperature 

and relative humidity chamber (25°C, 70% rh). Phosphine was 

obtained by a reaction of Zinc phosphide (Ji’ning City Yimin 

Chemical Plant, China) in acidified water (10% sulfuric acid). The 

concentration of the phosphine was always tested before the 

bioassays. Depending on the mortality at these concentrations, 

higher or lower concentration (at least 5 to 8 concentration) was

Figure 1. Distribution of R. dominica collection sites across China. 

used to estimate the concentration-mortality curves after preliminary 

tests. Test adults were held in a perforated metallic tube closed with 

rubber stoppers and secured with adhesive tape inside modified 

gas desiccators. Gas was injected with micro-syringes through a 

septum in the lid of each desiccator. After 20 h of fumigation, test 

insects were transferred into glass tubes with cracked wheat, and 

were kept for 14 days (25°C, 70% rh). The mortality was then 

recorded. Each treatment was repeated three times. 

Instantaneous rate of population growth (ri) 

The instantaneous rate of increase (ri) test was carried out in 250 

ml glass conical flask with 40 g cracked wheat. Each conical flask 

was infested with 20 non-sexed R. dominica adults (14 to 21- day 

old) and maintained at 30 ± 1°C, 75 ± 5% rh. Then, the conical flask 

was covered with a ventilated cloth. The number of surviving adults 

was counted after 60 days, and the instantaneous rate of increase 

in each population was calculated as follows: 

ri = ㏑ (Nf / N0) / Δt 

Where, Nf is the final number of observed live adults; N0 is the initial 

number of R. dominica and Δt is the duration of the experiment 

(Walthall and Stark, 1997; Pimentel et al., 2007). 

Three replicates were used for each population in this test. 

Data analysis 

The concentration-mortality data were analyzed using probit 

program software, where probit-transformed mortality was 

regressed against Log10-transformed dose (SPSS16.0). The 

instantaneous rate of population increase (ri) were subjected to 

analysis of variance (P 0.05) 

from the bioassay observed values (Table 2). The logit 

model was therefore appropriate to be used for concentration-mortality 

analysis. The concentration-mortality 

curves indicated that 5 populations of R. dominica (ZC, 

GY, XN, BN and ZG) exhibited low resistant to phosphine 

(RF value < 10-fold), while 6 populations (LZ, BB, HP, 

HD, JM and XF) were mo-derately resistant (10-fold < RF 

value < 100-fold). AL, SY, YC GA and XC populations 

showed high resistance (>100-fold) (Table 2).


Table 2. Relative toxicity to phosphine of sixteen populations of R. dominica. 

Population Slope ± SE a LC50 (95% CL) (mg/L) LC95 (95% CL) (mg/L) X 2 P RF b 

SCS c 2.518±0.222 0.007(0.006-0.009) 0.033(0.022-0.064) 9.687 0.085 ----- 

ZC 1.893±0.165 0.017(0.012-0.023) 0.124(0.076-0.293) 9.837 0.080 2.429 

GY 1.464±0.110 0.030(0.020-0.042) 0.395(0.229-0.935) 9.024 0.108 4.286 

XN 1.090±0.129 0.033(0.021-0.048) 1.068(0.584-2.661) 0.965 0.810 4.714 

BN 2.573±0.202 0.037(0.029-0.047) 0.162(0.109-0.321) 7.154 0.128 5.286 

ZG 1.020±0.091 0.066(0.046-0.093) 2.723(1.487-6.203) 6.291 0.178 9.429 

LZ 0.975±0.129 0.120(0.059-0.228) 5.870(1.671-131.673) 8.658 0.124 17.143 

BB 1.044±0.085 0.155(0.107-0.215) 5.816(3.583-10.901) 5.701 0.223 22.143 

HP 0.932±0.108 0.282(0.165-0.419) 16.414(8.944-40.849) 4.750 0.314 40.286 

HD 1.653±0.182 0.302(0.137-0.518) 2.992(1.359-25.555) 6.344 0.096 43.143 

JM 1.536±0.112 0.327(0.269-0.397) 3.850(2.703-6.071) 6.198 0.287 46.714 

XF 1.551±0.239 0.338(0.208-0.467) 3.882(2.459-8.489) 5.091 0.165 48.286 

AL 1.169±0.100 0.903(0.606-1.389) 23.040(10.06-94.899) 13.620 0.058 129.000 

SY 1.397±0.149 0.913(0.757-1.125) 13.744(8.030-30.818) 3.530 0.473 130.429 

YC 1.453±0.282 1.349(0.859-1.993) 18.293(8.697-87.505) 5.523 0.238 192.714 

GA 2.276±0.208 1.826(1.565-2.114) 9.640(7.340-14.039) 2.894 0.408 260.857 

XC 6.650±0.897 4.272 (3.876-4.595) 7.550(6.795-8.918) 3.382 0.336 610.286 

a SEM = Standard error of mean, b RF = resistance factor (LC50 of resistant population/ LC50 of sensitive population, c = standard 

susceptible population. 

Majority of the slopes of the concentration-mortality 

curves were similar among the populations of R. 

dominica, except for BN, GA and XC populations. Among 

these three populations, BN population showed lowresistance, 

while GA and XC populations had high-resistance. 

These results indicate that the resistance of R. 

dominica populations was not associated with the slopes 

of the concentration-mortality curves. Furthermore, response 

curves from all populations except XC had low 

slope values, indicating that there was high heterogeneity 

in these populations. 

The populations were ranked in order of RF values; the 

populations from processing facilities cluster near the top, 

then the national storage populations and the populations 

from local storage. The average RF for processing facileties, 

national storages and local storage were 5.465, 61. 

490 and 277.643, respectively. This result indicates that 

resistance is connected with the type of grain storage. 

Instantaneous rate of population increase (ri) 

The instantaneous rate of population increase (ri) was 

used to assess the fitness disadvantage associated with 

phosphine in the absence of the fumigant. There was 

significant variation in ri among populations of R. 

dominica (F15, 32 = 64.423, P < 0.001). The ri curve was 

fitted using exponential regression curve (y = 0.037e - 

0.005X , R 2 = 0.937; F1, 14 = 209.488, P < 0.001). 

R. dominica populations with high ri showed low 

resistance factor (RF for LC50), while low ri presented 

high RF value (Figure 2). This indicated that the 

existence of fitness costs (ri) was connected with the 

resistance of phosphine in R. dominica population. 

DISCUSSION 

A global survey undertaken by the FAO in 1972/1973 

showed that about 10% of investigated populations 

contained phosphine resistant insects, including a R. 

dominica population collected from Keelung of Taipei, 

China (Champ and Dyte, 1976). The earliest phosphine 

resistance in Chinese populations of R. dominica was 

reported by the Guangdong Institute of Cereal Science 

Research in 1976 (Zeng, 1996). In this study, all 16 

populations of R. dominica were identified as phosphine 

resistant strains. Of the 16 populations, 31.25% were low 

resistant, 37.5% were moderately resistant, while 31.25% 

were highly resistant. XC population showed the highest 

resistance to phosphine, and the RF value was 610.286. 

The results therefore reveal the seriousness of the 

problems of phosphine resistance in China. 

Response curves with low slopes are correlated with 

high levels of heterogeneity, suggesting a high variation 

in response to phosphine in treated populations (Lorini et 

al., 2007). The low slope of the response curves for all 

but the XC population indicated that there was high heterogeneity 

in the tested populations and that there is high 

variation in response to phosphine in these samples. 

Some populations of R. dominica (HP, AL, SY and YC) 

showed high LC95 value (Table 2), revealing that these

Figure 2. The instantaneous rate of population increase ( ri) for R. domininca as a function of 

resistance factor (RF value for LC50). Curve was fitted using Exponential regression curve (y = 0.037e - 

0.005X , R 2 = 0.937; F1,14 = 209.488, P


samples. We would like to thank Zhang-Hong Shi for his 

advice on data analysis. This work was partially 

supported by China Postdoctoral Science Foundation, 

China National Science and Technology Project of the 

11th Five-Year Plan (2006BAD02A18-03 and 

2006BAI09B04-06) and Hubei Key Project of Science 

and Technology. 

REFERENCES 

Ahmedani MS, Khaliq A, Aslam M, Naz S, Ahmedani MY (2006). 

Fumigation technique used in house type godowns for the 

management of resistant Trogoderma granarium larvae. Pak. J. Arid 

Agric., 9: 5-11. 

Ahmedani MS, Shaheen N, Ahmedani MY, Aslam M (2007). Status of 

phosphine resistance in Khapra beetle, Trogoderma granarium 

(Everts) strains collected from remote villages of rawalpindi district. 

Pak. Entomol., 29: 95-102. 

Alam MS, Shaukat SS, Ahmed M, Iqbal S, Ahmad A (1999). A survey of 

resistance to phosphine in some coleopterous pests of stored wheat 

and rice grain in Pakistan. Pak. J. Biol. Sci., 2: 623-626. 

Ansell MR, Dyte CE, Smith RH (1990). The inheritance of phosphine 

resistance in Rhyzopertha dominica and Tribolium castaneum. In: 

Fleurat-Lessard F, Ducom P (Eds.) Proceedings of the 5 th Int. 

Working Conference on Stored-product Protection. Paris France, pp: 

961-970. 

Arnaud L, Haubruge E (2002). Insecticide resistance enhances male 

reproductive success in a beetle. Evolution, 56: 2435-2444. 

Athie I, Mills KA (2005). Resistance to phosphine in stored-grain insect 

pests in Brazil. Braz. J. Food Technol., 8: 143-147. 

Bengston M, Acda MA, Daglish GJ, Collins PJ (1999). Phosphine 

resistance in the Asia/Australia region. In: Jin Z, Liang Q, Tan X, 

Guan L (eds.), Stored product protection. Proc. 7 th Int. Working 

Conference on Stored-product Protection, Beijing, China. Chengdu: 

Sichuan Pub. House of Sci.Technol., pp: 631-634. 

Benhalima H (1988). The detection and measurement of resistance to 

phosphine in three species of insect pests of stored cereals: S. 

oryzae, R. dominica and T. castaneum. (M.Sc. dissertation). Univ. 

Edinburgh, Scotland, UK. 

Benhalima H, Chaudhry MQ, Mills KA, Price NR (2004). Phosphine 

resistance in stored-product insects collected from various grain 

storage facilities in Morocco. J. Stored Prod. Res., 40: 241-249. 

Birch LC (1945a). The mortality of the immature stages of Calandra 

oryzae L (Coleoptera: Curculionidae) (small stain) and Rhyzopertha 

dominica (F) (Coleoptera: Bostrychidae) in wheat of different 

moisture content. Aust. J. Exp. Biolo. Med. Sci., 23: 141-145. 

Birch LC (1945b). The influence of temperature humidity and density on 

the oviposition of the small stain of Calandra oryzae L (Coleoptera: 

Curculionidae) (small stain) and Rhyzopertha dominica (F) 

(Coleoptera: Bostrychidae). Aust. J. Exp. Biol. Med. Sci., 23: 197- 

203. 

Borah G, Chahal BS (1979). Development of resistance, in Trogoderma 

granarium Everts to phosphine in the Punjab. FAO Plant Prot. Bull. 

27: 77-80. 

Bui CH (1999). Some initial results on phosphine resistance of major 

product insect pests in Vietnam. In: Jin Z, Liang Q, Tan X, Guan L 

(eds.), Stored product protection. Proceedings of the 7 th International 

Working Conference on Stored-product Protection, Beijing, China. 

Chengdu: Sichuan Pub. House of Sci. Technol., pp: 648-652. 

Cao Y (2006). Survey of the resistance of stored-grain pests to 

phosphine in China. J. Henan Univ. Technol. (Natural sci. edition) (in 

Chinese with English abst.). 27(1): 1-6. 

Cao Y, Song Y, Sun G (2003). A survey of psocid species infesting 

stored grain in China and resistance to phosphine in field populations 

of Liposcelis entomophila (Enderlein) (Psocoptera: Liposcelididae). 

In: Credland PF, Armitage DM, Bell CH, Cogan PM, Highley E. (eds.), 

Advances in stored product protection. Wallingford, CAB int., pp: 662- 

667. 

Champ BR, Dyte CE (1976). Report of the FAO global survey of 

pesticide susceptibility of stored grain pest. Food and Agriculture 

Organization of the United Nations. Rome. Series: FAO plant 

production and protection series; 5: 260-297. 

Champ BR, Dyte CE (1977). Fao global survey of pesticide 

susceptibility of Stored Grain Pests. FAO Plant Protection Bulletin. 

25: 49-67. 

Chaudhry MQ (2000). Phosphine resistance: a growing threat to an 

ideal fumigant. Pesticide Outlook. June 2000: 88-91. 

Collins P (2009). Strategy to manage resistance to phosphine in the 

Australian grain industry. CRC Plant Biosecurity. 1-13. 

Collins PJ (1998). Resistance to grain protectants and fumigants in 

insect pests of stored products in Australia. In: Banks HJM Wright EJ, 

Damcevski KA. [ed.,] Stored grain in Australia Canberra, CSIRO 

Stored Grain Res. Lab., pp: 55-57. 

Collins PJ, Daglish GJ, Pavic H, Kopittke RA (2005). Response of 

mixed-age cultures of phosphine-resistant and susceptible strains of 

lesser grain borer, Rhyzopertha dominica, to phosphine at a range of 

concentrations and exposure periods. J. Stored Prod. Res., 41: 373- 

385. 

FAO (1975). Recommended methods for the detection and 

measurement of resistance of agricultural pests to pesticides. 16: 

Tentative method for adults of some stored cereals, with methyl 

bromide and phosphine. FAO Plant Prot. Bull., 23:12-25. 

Fragoso DB, Guedes RNC, Peternelli LA (2005). Developmental rates 

and population growth of insecticide-resistant and susceptible 

populations of Sitophilus zeamais. J. Stored Prod. Res., 41: 271-281. 

Haubruge E, Arnaud A (2001). Fitness consequences of malathionspecific 

resistance in red flour beetle (Coleoptera: Tenebrionidae) and 

selection for resistance in the absence of malathion. J. Econ 

Entomol., 94: 552-557. 

Haubruge E, Arnaud L, Mignon J (1997). The impact of sperm 

precedence in malathion resistance transmission in populations of 

the red flour beetle Tribolium castaneum (Herbst) (Coleoptera: 

Tenebrionidae). J. Stored Prod. Res., 33: 143-146. 

Lan SB (2006). Study on farm grain storage in China. 9 th International 

Working Conference on Stored Product Protection, Brazil, pp: 47-52. 

Leong ECW, Ho SH (1994). Relative tolerance of Liposcelis 

bostrychophila (Bad) and L-entomophila (End) to some 

organophosphorus and carbamate insecticides. Insect Science and 

Its Application. 15: 343-349. 

Longstaff BC (1991). An experimental study of the fitness of susceptible 

and resistant strains of Sitophilus oryzae (L.) 

(Coleoptera:Curculionidae) exposed to insecticide. J. Stored Prod. 

Res., 27:75-82. 

Lorini I, Collins PJ (2006). Resistance to phosphine in Rethzopertha 

dominica (F.) (Coleoptera: Bostrychidae) collected from wheat 

storages in Brazil. 9 th International Working Conference on Stored 

Product Protection. Brazil, pp: 319-323. 

Lorini I, Collins PJ, Daglish GJ, Nayak MK, Pavic H (2007). Detection 

and characterization of strong resistance to phosphine in Brazilian 

Rhyzopertha dominica (F.) (Coleoptera: Bostrychidae). Pest Manag. 

Sci. 63: 358-364. 

Lorini I, Galley DJ (1999). Deltamethrin resistance in Rhyzopertha 

dominica (F.) (Coleoptera: Bostrichidae), a pest of stored grain in 

Brazil. J. Stored Prod. Res., 35: 37-45. 

Mills KA, Athie I (2001). Control of immature stages of Sitophilus oryzae 

(L.) strains susceptible and resistant to phosphine by phosphine 

fumigation. Braz. J. Food Technol., 3: 171-176. 

Nayak MK, Collins PJ (2008). Influence of concentration, temperature 

and humidity on the toxicity of phosphine to the strongly phosphineresistant 

psocid Liposcellis bostrychophila Badonnel (Psocoptera: 

Liposcelididae). Pest Manag. Sci., 64(9): 971-976. 

Nayak MK, Collins PJ, Pavic H (2002). Resistance to phosphine in 

psocids: Challenges ahead!, In: Wright EJ, Banks HJ, Highley E. 

(eds.), Proc. of the 2nd Australian Postharvest Technical Conference, 

August 1-4, 2000. Adelaide, Aust., pp: 113-118. 

Nayak MK, Collins PJ, Pavic H. Cao Y (2003). Developments in 

phosphine resistance in China and possible implications for Australia. 

In: Wright MC, Webb MC, Highley E (eds.), Stored grain in Australia 

(2003), Proceedings of the Australian Postharvest Technical 

Conference, Canberra, 25-27 June 2003. CSIRO Stored Grain Res. 

Lab. Canberra.

Pacheco IA, Sartori MR, Taylor RWD (1990). Survey of resistance of 

insect pests of stored grain to phosphine in the State of San Paulo. 

Collection of ITAL, 20: 144-154. 

Pimentel MAG, Faroni LRD’A, Silva FH, Batista MD, Guedes RNC 

(2010). Spread of phosphine resistance among Brazilian populations 

of thee species of stored product insects. Neotrop. Entomol., 39(1): 

101-107. 

Pimentel MAG, Faroni LRD’A, Tótola MR, Guedes RNC (2007). 

Phosphine resistance, respiration rate and fitness consequences in 

stored-product insects. Pest Manag. Sci. 63: 876-881. 

Price LA, Mills KA (1988). The toxicity of phosphine to the immature 

stages of resistant and susceptible strains of some common stored 

product beetles, and implications for their control. J. Stored Prod. 

Res., 24: 51-59. 

Ristaino J, Thomas W (1998). Agriculture, methyl bromide, and the 

ozone hole: can we fill the gap? Plant Dis. 81: 964-977. 

Savoldelli S, Süss L (2008). Preliminary investigations about tolerance 

to phosphine in Tribolium strains (Coleoptera: Tenebrionidae) in Italy. 

IOBC/WPRS Bulletin. 40: 313-317. 

Tubiello FN, Soussana JF, Howden SM (2007). Crop and pasture 

response to climate change. Proc. Natl. Academy of Sci. the United 

States of Am., 104: 19686-19690. 

Valmas N, Ebert PR (2006). Comparative toxicity of fumigants and a 

phosphine synergist using a novel containment chamber for the safe 

generation of concentrated phosphine gas. PLoS ONE. PLoS ONE 

1(1): e130. doi:10.1371/j. pone.0000130. 

Walthall WK, Stark JD (1997). A comparison of acute mortality and 

population growth rate as endpoints of toxicological effect. Ecotoxicol. 

Environ., Safe. 37: 45-52. 

Song et al. 16373 

Wang D, Qin Z, Song W (2002). LS/T1201-2002 Fumigation Regulation 

of Phosphine Recirculation. The Standard of State Administration of 

Grain. Beijing: Standard Pub. House of China. 

White NDG, Bell RJ (1990). Relative fitness of a malathion-resistant 

strain of Cryptolestes ferrugineus (Coleoptera: Cucujidae) when 

development and oviposition occur in malathion-treated and 

untreated wheat kernels. J. Stored Prod. Res., 26: 23-37. 

World Meteorological Organization (WMO) (1995). Scientific 

assessment of ozone depletion: 1994, World Meteorological 

Organization global ozone research and monitoring project. Report 

No. 37. 

Yan XP, Li WW, Liu ZW, Qin ZG, Wu XQ, Song YC, Shen ZP (2004). 

Investigation of phosphine-resistance in major stored grain insects in 

china. Grain storage (in Chinese with English abstract). 32: 17-25. 

Zeng L (1996). The advance of phosphine resistance in stored grain 

insects (in Chinese with English abstract). Natural Enemies of Insects 

(supplement). 18: 37-41. 

Zeng L (1999). Development and countermeasures of phosphine 

resistance in stored grain insects in Guangdong of China. In: Jin Z, 

Liang Q, Tan X and Guan L (eds.), Stored product protection: 

Proceedings of the 7 th International Working Conference on Storedproduct 

Protection, Beijing, China. Chengdu: Sichuan Pub. House of 

Sci. Technol., pp. 642-647.



DOI: 10.5897/AJB11.1684 



Contribution to the knowledge of Gnaphosidae 

(Arachnida: Araneae) in Turkey 

Adile Akpınar, Ismail Varol*, Faruk Kutbay and Bilal Taşdemır 

Faculty of Arts and Sciences, University of Gaziantep, Gaziantep, 27310, Turkey. 


In this study, some additions were made on arachnofauna in Turkey. We recorded Drassodex Murphy, 

2007 genus and six gnaphosid species: Drassodex hypocrita (Simon, 1878), Drassodes cupreus 

(Blackwall, 1834), Echemus angustifrons (Westring, 1861), Setaphis gomerae (Schmidt, 1981), 

Trachyzelotes fuscipes (L. Koch, 1866) and Zelotes hermani (Chyzer, 1897), for the first time in Turkey. 

Also, we colleced specimens from Kahramanmaraş and Adiyaman provinces, between April 2007 and 

May 2009. The characteristic features, distributions, ecologies, genital structures, identification keys of 

these species were described according to literature. 

Key words: Araneae, Cithaeronidae, Cithaeron praedonicus, Turkey, Middle East. 

INTRODUCTION 

Gnaphosid spiders have been recognized by their 

abdomen, eyes and spinnerets. The abdomen varies in 

colour from greyish to black and is elongated in shape. 

The posterior median eyes are oval or elliptical in shape. 

Spinnerets are cylindrical in shape, the anterior pairs are 

widely separated and usually project from the posterior 

end of the abdomen. They are nocturnal hunters. 

Gnaphosidae is one of the familiar families of spiders in 

Turkey. There are many researchers carrying out detailed 

study on this family, their systematics, faunistics and 

ecologic features. It is one of the biggest spider families. 

In this family, 2123 species of Gnaphosidae (Pocock, 

1898c) and 117 genera have been described to date 

(Platnick, 2011, version: 12). Some of the researchers 

that studied gnaphosid species are: Varol (1996, 2001), 

Bayram (2007), Topçu et al. (2005), Varol et al. (2006), 

Ozdemir et al. (2006), (Seyyar and Demir, 2010, Seyyar 

et al. 2008, Seyyar, 2009) and Kovblyuk et al. (2009). 

Particularly, Seyyar et al. (2008) have a checklist of 

Gnaphosidae from Turkey, which have 107 species 

belonging to 26 genera. This paper presents the first 

record of genus Drassodex Murphy, 2007 and six 

*Corresponding author. E-mail: varol@gantep.edu.tr. 

Abbreviations: AM, Anterior median eye; AL, anterior lateral 

eye; PM, posterior median eye; PL, posterior lateral eye; P, 

pedipalp; C, clypeus; LE, largest eyes; SE, smallest eyes; rt, 

retrolateral; v, ventral. 

gnaphosid species from Turkey. 


Specimens were collected from Adiyaman and Kahramanmaraş 

provinces in Turkey between years 2007 and 2009. They were 

primarily gathered on manual searching and were preserved in 70% 

ethanol before they were identified. Afterwards, drawings were 

made under a SZX12 Olympus stereomicroscope. 

In the diagnosis of the spider species collected from the research 

area, the following literature by Simon (1932), Nentwig et al. (2011), 

Muster and Thaler (2003), Logunov (1996) and Roberts (1995) 

were used, and the studied specimens were deposited in the 

Arachnology Museum of the University of Gaziantep. However, all 

measurements were done in millimetres. 

RESULTS 

Drassodex Murphy, 2007 

These species are small spiders. The prosoma is light 

brown, while the opisthosoma is lighter brown or grey and 

it is mottled. The eyes distinctively stand in a darker area. 

One type of these species is Drassodes hypocrita 

(Simon, 1878). However, this genus was first recorded in 

Turkey (Seyyar et al., 2008). 

Drassodex hypocrita (Simon, 1878) (Figure 2a) 

Material: The material used were obtained from Büyük 

Çamurlu village (37° 54' N, 36° 23' E), 1461 m, 

31.07.2008 (1♀) in Göksun district, Kahramanmaraş

province, Turkey. The spider was found in an open space 

in the forest, while a locality of the specimen was found 

close to the stream around Abies trees. 

Female: The total length for females is 5.29. Its carapace 

is 2.05 long and 1.70 wide. Its abdomen has a length of 

3.24 and a width of 2.35. However, the lengths of the 

female’s legs and pedipalp are: I-[(1.31 + 0.61 + 0.71 + 

0.67+0.56) 3.86], II-[(1.38 + 0.46 + 0.70 + 0.57+0.76) 

3.87], III-[(1.20 + 0.44 + 0.78 + 0.81 + 0.76) 3.99], IV- 

[(1.29 + 0.52 + 0.93 + 0.81 + 0.78) 4.33], P-[(0.56 + 0.29 

+ 0.33 + 0.51) 1.69]. 

Description: The prosoma, especially, is light brown to 

brown, but the distal leg segments and the eye regions 

are darker. However, the opisthosoma is light brown, 

while the vulva is convoluted with entrance ducts 

(Nentwig et al., 2011). 

General distributions: They are generally distributed in 

Russia and Europe (Platnick, 2011). 

Drassodes cupreus (Blackwall, 1834) (Figure 1a and 

b) 

Material: The material used were obtained from 

Çuhadarli village ( 37° 34' N, 36° 28' E), 1275 m, 

02.05.2009 (1♂) in Andirin district; Yarbaşi village (37° 

28' N , 37° 13' E), 852 m, 18.05.2008 (1♂) in Pazarcik 

district; and Alanli village (37° 32' N, 36° 29' E), 637 m, 

02.05.2009 (1♂) in Andirin district, Kahramanmaraş 

province, Turkey. The spiders were found under stones. 

The first specimen was found close to the stream of 

Karasu, the second specimen was found close to 

Kartalkaya dam and its river, and the last specimen was 

found close to the Karasu stream, as well. 

Male: The total length of the male species is 8.11. Its 

carapace is 3.77 in length and 2.75 in width. Its abdomen 

has a length of 4.34 and a width of 2.46. The lengths of 

the species’ legs and pedipalp are: I- [(3.21 + 1.63 + 3.34 

+ 2.53 + 2.12) 12.83], II- [(3.35 + 1.58 + 3.03 + 2.64 + 

2.09) 12.69], III- [(2.72 + 0.84 + 2.34 + 2.11 + 1.67) 9.68], 

IV- [(4.01 + 1.06 + 3.26 + 4.17 + 2.12) 14.62), P- [(0.83 + 

0.48 + 0.94 + 1.03) 3.28]. However, the dimension of the 

eyes is: AM 0.20, AL 0.67, PM 0.23, PL 1.05, AM-AM 

0.02, AM-AL 0.01, PM-PM 0.01, PM-PL 0.26, AM-PM 

0.22, AL-PL 0.32. AM-C 0.17, AL-C 0.14. LE (PM), SE 

(AM). 

Description: This species’ prosoma is yellow-brown, 

while the eye region is darker. The chelicerae is darker 

than the overall colour and it has 3 teeth. The 

opisthosoma is light to yellow-brown, while the male 

pedipalp is seen as figs. 

General distributions: It is generally distributed as 

Palaearctic ducts (Nentwig et al. 2011; Platnick, 2011). 

Echemus angustifrons (Westring, 1861) (Figure 2c) 

Material: The material used were obtained from Tanir 

Akpınar et al. 16375 

town (38° 25' N 36° 55' E), 1282 m, 15.04.2007 (1♀ ) in 

Afşin district, Kahramanmaraş province, Turkey. In this 

study, the specimens were found under stones on the 

orchard of Prunus avium. 

Female: The total length of the female species is 11.01. 

Its carapace is 8.08 in length and 6.46 in width. Its 

abdomen has a length of 2.93 and a width of 1.85. The 

lengths of the species’ legs and pedipalp are: I- [(2.49 + 

0.78 + 2.03 + 1.18 + 1.06) 7.54], II- [(2.34 + 7.3 + 1.89 + 

1.11 + 1.05) 13.69], III- [(1.55 + 0.89 + 1.33 + 1.24 + 

1.06) 6.07], IV- [(2.20 + 1.07 + 2.36 + 1.62 + 1.46) 8.71], 

P- [(0.95 + 0.32 + 0.42 + 0.85) 2.54]. However, the 

dimension of the species’ eyes is: AM 0.23, AL 0.63, PM 

0.11, PL 0.98, AM-AM 0.23, AM-AL 0.09, PM-PM 0.01, 

PM-PL 0.30, AM-PM 0.06, AL-PL 0.19. AM-C 0.22, AL-C 

0.45. LE (PM), SE (AM). 

Description: The prosoma has darker hairs than the 

opisthosoma. The distal leg segments are darker than the 

body colour, which varies from light orange to light brown. 

Nevertheless, the opisthosoma is grey in colour, and its 

abdomen is without scutum; although the epigynum has a 

wide hood and septum, while the spermathecae have 

recurved anterior lobes. 

General distributions: It is generally distributed in 

Central Asia to Europe (Platnick, 2011). 

Setaphis gomerae (Schmidt, 1981) (Figure 1c and d) 

Material: The material used were obtained from 

Altinyayla village (37° 43' N, 36° 29' E), 1260 m, 

03.05.2009 (1♂) in Andirin district, Kahramanmaraş 

province; and from Serince village (38° 05' N, 38° 36' E), 

1533 m, 26.05.2007 (1♂) in Sincik district; cross road 

Hacihalil and Kuyucak villages (37° 40' N, 38° 16' E), 

614 m, 27.04.2008 (1♂) in Besni district; and Gözebaşi 

village (37° 46' N, 38° 23' E), 644 m, 27.04.2008 (1♂) in 

City center, Adiyaman province, Turkey. The specimens 

were found usually under stones or pieces of dried mud, 

and sometimes they were found in fens on heaths. 

Male: The total length of the male species is 4.6. Its 




+ 0.82 + 0.57) 4.31], II- [(0.68 + 0.46 + 0.76 + 0.70 + 

0.51) 3.11], III- [(0.76 + 0.40 + 0.81 + 0.84 + 0.69) 3.5], 

IV- [(0.83 + 0.59 + 1.48 + 1.25 + 0.52) 4.67], P- [(1.25 + 





(AM). 

Description: The males can be recognized by the short 

projection restricted to the retrolateral side of the terminal 

apophysis. They have the metatarsal preening comb that 

is characteristic of zelotines, in addition to a distinctively 

coiled embolus in males. The typically enlarged, nearly


a b 

c d 

e f 

Figure 1. (a) Right view and (b) ventral view of Drassodes cupreus (Blackwall, 1834); (c) 

ventral view; (d) right view of Setaphis gomarea (Schmidt, 1981); (e) right view and (f) 

ventral view of Zelotes hermani (Chyzer, 1897). They all show the left male palp, while the 

scale lines are 0.5 mm.

a b 

c 

Akpınar et al. 16377 

Figure 2. (a) Drassodex hypocrita (Simon, 1878); (b) Trachyzelotes fuscipes (L. Koch, 1866); (c) Echemus 

angustifrons (Westring, 1861). They all show the ventral view of epigyne, while the scale lines are 0.5 mm. 

contiguous posterior median eyes suggest that Setaphis 

is more closely related to Camillina and Drassyllus than 

to Zelotes (Platnick and Murphy, 1996). 

General distributions: The species is generally 

distributed in Canary Island (Platnick and Murphy, 1996). 

Trachyzelotes fuscipes (L. Koch, 1866) (Figure 2b) 

Material: The material used were obtained from the 

cross roads of Boztepe and Sariharman villages (37° 43' 

N, 38° 27' E), 634 m, 26.04.2008 (1♀) in the city center of 

Adiyaman province, Turkey. The spider was found under 

pieces of chalk close to the open space of the forest. 

Female: The total length of the female species is 4.6. Its 




+ 0.73 + 0.61) 4.01], II- [(1.04 + 0.41 + 0.75 + 0.57 + 

0.57) 3.35], III- [(0.75 + 0.27 + 0.57 + 0.60 + 0.43) 2.62], 

IV- [(1.10 + 0.36 + 1.04 + 0.60 + 0.40) 3.51], P- [(0.29 + 





(AM). 

Description: The species’ carapace is yellow and brown 

in colour, while the opisthosoma is grey-dark brown in 

colour. The eyes and chelicera are dark brown; though 

the setas of the chelicera are clannish. The femur, patella 

and tibia are darker than the metatarsus and tarsus. The 

epigynal upper lateral margin is sclerotised and the 

lateral parts are pointed, whereas the vulva has an 

evident curve and its spermathecal duct is oval. 

General distributions: It is generally distributed from the 

Mediterranean to Central Asia, USA (Platnick, 2011). 

Zelotes hermani (Chyzer, 1897) (Figure 1e and f) 

Material: The material used were obtained from the city 

center of Kayatepe village (37° 51' N, 38° 15' E), 974 m, 

27.04.2008 (1♂), Adiyaman province, Turkey. The 

spiders were found running under the sun among loose 

stones. 

Male: The total length of the male spider species’ is 3.08. 

Its carapace is 1.71 in length and 1.40 in width. Its 

abdomen has a length of 1.37 and a width of 0.77. The 

lengths of the species’ legs and pedipalp are: I- [(1.19 + 

0.36 + 0.81 + 0.71 + 0.62) 3.76], II- [(0.91 + 0.40 + 0.79 + 

0.65 + 0.58) 3.34], III- [(0.81 + 0.39 + 0.44 + 0.54 + 0.51) 

2.70], IV- [(1.18 + 0.52 + 0.89 + 1.09 + 0.62) 4.29], P- 

[(0.27 + 0.26 + 0,19 + 0.67) 1.39]. However, the 

dimension of the eyes is completely unmeasured.


Description: The carapace is dark brown to black, 

though its edge is darker, while the opisthosoma is black 

in colour. The legs are yellowish in colour and the femur, 

patella and tibia of the species’ (I-II) legs are darker than 

other leg segments. However, the tibial apophysis are 

long and slightly oblique, while the embolus are short and 

broad. 

General distributions: The species is generally 

distributed from Russia to Central Europe (Platnick, 

2011). 


The authors acknowledge the Scientific Research 

Projects Unit of the University of Gaziantep (Project 

No.FEF.10.06) for financially supporting this work. 

However, some of the data used in this study were 

extracted from the doctoral thesis of the first author. 

REFERENCES 

Bayram A (2007). The Checklist of the Spiders of Turkey (Araneae; 

Arachnida). Online version: 

http://www.spidersofturkey.com/viewpage.php? p. 46 

Kovblyuk M, Seyyar O, Demir H, Topçu A (2009). New taxonomic and 

faunistic data on the gnaphosid spiders of Turkey (Aranei: 

Gnaphosidae). Arthropoda Selecta. 18(3-4): 169-187. 

Nentwig W, Blick T, Gloor D, Hänggi A, Kropf C (2011). Spiders of 

Europe, Version 6. Online version: www.araneae.unibe.ch. 

Özdemir A, Varol I, Akan Z, Kütük M, Kutbay F, Özaslan M (2006). The 

Fauna of Spider (Araneae) in the Nizip and Karkamış – Gaziantep 

(Turkey). Biotechnol. Biotechnol. Equipment, 20 (1): 74-77. 

Platnick N (2011). The World Spider Catalog, Version 12.0. Online 

version: http://research.amnh.org./iz/spiders/catalog/index.html 

Platnick N, Murphy JA (1996). Review of the Zelotine Ground Spider 

Genus Setaphis (Araneae, Gnaphosidae). Am. Mus. Novit. 3162: 1- 

23. 

Roberts MJ (1995). Spiders of Great Britain and Northern Europe. 

Collins, Harley Books. Cochester. p. 682. 

Seyyar O (2009). Ground spiders (Araneae:Gnaphosidae) fauna of the 

East Mediterranean Region of Turkey. University of Erciyes, Science 

Enstitute, Kayseri, p. 166. 

Seyyar O, Ayyıldız N, Topçu A (2008). Updated Checklist of Ground 

Spiders (Araneae: Gnaphosidae) of Turkey, With Zoogeographical 

and Faunastic Remarks, Ent. News, 119(5): 509-520. 

Seyyar O, Demir H (2010). New Records of ground spiders from Turkey 

(Aranea: Gnaphosidae). Serket, 12(1): 13-16. 

Topçu A, Demir H, Seyyar O (2005). A Checklist of the Spiders of 

Turkey. Serket. 9(4): 109-140. 

Varol Mİ (1996). Investigation of taxonomy Lycosidae, Gnaphosidae 

and Clubionidae fauna of the Van lake basin (Ordo: Araneae). 

University of Yüzüncü Yıl, Science Enstitute, Van, p. 76. 

Varol Mİ (2006). Spider List of Turkey. Online version: 

http://www1.gantep.edu.tr/~varol/tr/asil_tr.htm 

Varol Mİ (2001). The fauna, ecology and systematics of the groundliving 

spiders in the Northeast Anatolia Region (Arachnida: Araneae). 

University of Yüzüncü Yıl, Science Enstitute, Van, p. 147.



DOI: 10.5897/AJB11.876 



A new endophytic taxol- and baccatin III-producing 

fungus isolated from Taxus chinensis var. mairei 

Yechun Wang 1,2 and Kexuan Tang 1 * 

1 Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology 

R&D Center, Shanghai Jiao Tong University, Shanghai 200240, PR China. 

2 Current address: Donald Danforth Plant Science Center, 975 North Warson Road, Saint Louis, MO 63132, USA. 


120 endophytic fungi were isolated from the old inner bark of Taxus chinensis var. mairei and only a 

fungus was detected to produce Taxol and related taxanes in potato dextrose agar (PDA) medium. The 

presence of taxol and baccatin III was confirmed by high performance liquid chromatography combined 

with mass spectrometry (LC-MS) and competitive inhibition enzyme immunoassay (CIEIA). The fungal 

compound showed cytotoxic activity on liver cancer cell line BEL7402 in vitro. The strain was identified 

as one of Didymostilbe sp. (designated as DF110) according to its morphological characteristics. The 

isolation of such fungi provided a promising alternative approach to producing taxol in the near future. 

Key words: Taxol, baccatin III, endophytic fungus, Didymostilbe sp. 

INTRODUCTION 

The tricyclic diterpene taxol, a highly effective anticancer 

drug originally isolated from the bark of Taxus brevifolia 

(Wani et al., 1971), has been employed for the treatment 

of a variety of cancers. With increasing applications in 

clinical use and scientific research, there is an urgent 

need of Taxol than ever. However, the isolation of taxol 

from the tree bark is limited on account of the relative 

scarcity of yew and extremely low content of taxol in the 

plant. To solve such a problem, other attempts such as 

tissue culture (Christen et al., 1989; Hu et al., 2003) and 

chemical synthesis (Baloglu and Kingston, 1999; Holton 

et al., 1995; Nicolaou et al., 1994) etc., have been made 

to produce the drug. In addition, a great deal of efforts 

have been focused on the isolation of endophytic 

taxol-producing fungi since an exciting progress of the 

first taxol-producing fungus, Taxomyces andreanae, had 

been discovered in T. brevifolia (Stierle et al., 1993). 

Subsequently, many other endophytic taxol-producing 

*Corresponding author. E-mail: kxtang1@yahoo.com, 

kxtang1@163.com. Tel: 86-21-34206916. Fax: 86-21-34206916. 

fungi were reported (Guo et al., 2006; Kumaran et 

al.,2011; Li et al., 1998, 1996; Liu et al., 2009; Metz et 

al., 2000; Shrestha et al., 2001; Soca-Chafre et al., 

2011;Strobel et al., 1996; Wang et al., 2000, 2007; Zhao 

et al., 2009; Zhou et al., 2010). The isolation of such fungi 

bring a new promising way for the production of taxol by 

fermentation techniques, which have a lower cost 

compared to other methods. 

In our previous report, we disclosed the discovery of an 

endophytic fungus BT2 being capable of producing taxol 

and taxane baccatin III from the old inner bark of Taxus 

chinensis var. mairei (Guo et al., 2006; Wang et al., 2007). 

In this study, we reported another newly isolated 

endophytic taxol- and baccatin III- producing fungus. 

Furthermore, its biological activity was also tested against 

liver cancer cell line. 


Isolation of endophytic fungus from T. chinensis var. mairei and 

its identification 

The fungus used in this study was isolated from the old inner bark of 

T. chinensis var. mairei, which grows in Sichuan province, 

Southwest China. After the bark was cut into small pieces of about


0.25 cm 2 , these pieces were treated with 70% (v/v) ethanol for 5 min, 

and then rinsed three times with distilled water; the water was 

allowed to evaporate and then the outer black bark was removed off 

with a sterilized sharp blade. Small pieces of the inner bark were 

placed on the surface of water agar (2% g/v) in Petri plates and 

incubated at 25°C in the dark. After several days, fungi were 

observed growing from the inner bark fragments in the plates. 

Individual hyphal tips of the various fungi were transferred to new 

potato dextrose agar (PDA) medium and incubated at 25°C for one 

week. The same way was repeated 5 times for fungus purity. The 

endophytic fungus was identified according to its morphological 

characteristics (Barnett and Hunter, 1977). 

Fungal culturing and taxane isolation 

The endophytic fungus strain DF110 was grown in 1-L Erlenmeyer 

flasks containing 250 ml PDA liquid medium. The fungus was 

incubated at 25°C with shaking (140 rpm) for three weeks. Then the 

entire culture medium and mycelia were collected, respectively, 

through four layers of cheesecloth. The mycelia were re-suspended 

by 100 ml methanol and ultrasonicated for 15 to 20 min on ice, then 

centrifuged to collect the supernatant. The culture medium were 

blended well and extracted with equal volume of methylene chloride 

twice, and the organic phase was finally mixed with the mycelia 

supernatant. The mixtures were taken to dryness under reduced 

pressure at 50°C and the residue was dissolved in 1 ml methanol 

and the insoluble materials were removed off by centrifugation 

(12000 g) for 30 min at 4°C. The supernatant was filtered through a 

0.2 μm polymeric filter prior to HPLC analysis. 

LC-MS analyses 

After purification, samples were analyzed by a Perkin-Elmer HPLC 

ISS 200 system combined with a Hewlett-Packard Series 1100 MSD 

system. The column was an Alltech Econosil C18. Mass spectra 

were acquired in positive ion mode. Samples in 10 μl of methanol 

were injected and eluted with 0.8 ml/min with a starting gradient 

from 40 : 60 (v/v) H2O : methanol for 10 min, then eluted with 100% 

methanol for 20 min, and finally with 40:60 (v/v) H2O : methanol for 

10 min. A variable wavelength recorder set at 230 nm was used to 

detect taxol and baccatin III eluting from the column. 

ELISA 

A competitive inhibition enzyme immunoassay (CIEIA) kit (Hawaii 

Biotech Inc) was employed for the detection of taxol and baccatin III 

(Grothaus et al., 1993).The assay is sensitive to about 1 ng/ml. The 

assay was carried out using Taxane Immunoassay Kits (TA02, 

specific for Taxol; TA03, specific for baccatin III. Hawaii Biotech Inc) 

according to the procedure recommended by the suppliers. 

Cytotoxicity study 

The liver cancer cell line BEL7402 was used to evaluate the 

biological effect of the fungal crude extraction. The procedures were 

performed as follows: Cancer cells were placed in a 96-well plate of 

3×10 4 per well and cultured at 37°C for 10 h, and then aliquots (100 

µl) of the fungal extraction were added into the 96-well plate at 37°C 

for 48 h, meanwhile, aliquots of 50 µg/ml authentic taxol were added 

as a positive control. Another fungal extraction which did not 

produce taxol was also added as negative control. After incubation 

for 48 h, the activity of cancer cells was observed by using 

microscope. 

RESULTS 

Identification of the fungus 

Colonies of strain DF110 grew and extended more rapidly 

on PDA medium under 25°C. The mycelium surface is 

approximately lanose and eggshell yellow when young 

and forms many yellow brown to dark green conidial 

areas when it matures; reverse of colonies becoming 

golden leaf’s yellow. Conidiophores are commonly 125 to 

375 µm in length and with diameter 2.8 to 3.0 µm, 

colorless, a part branched and some of them become light 

yellow in age. There are complex Penicilli on the top of 

conidiophores. Some of sterigmata show thin rod, 

commonly 7.5 to 25 µm by 1.5 to 2 µm. Conidia is usually 

elliptical or rod, a few oval, commonly 4 to 7.3 µm by 2.3 

to 3.3 µm, usually forming a septum in age, and many of 

them are usually gathered into a drop of water. Some of 

conidiophores are usually gathered into synnemata. The 

strain DF110 was different from that of the endophytic 

taxol-producing fungi previously reported, and was 

identified as Didymostilbe sp. according to its 

morphological characteristics (Barnett and Hunter, 1977) 

and was named DF110 (Figure 1). 

LC-MS identified taxol and baccatin III in the fungal 

compound 

A total of 120 fungi were isolated from the old inner bark 

of T. chinensis var. mairei, but only strain DF110 was 

observed to produce taxol and baccatin III by LC-MS. The 

fungal compound produced a peak at 6.769 min when 

eluting from the C18 column, with approximate same 

retention time (6.798 min) as authentic baccatin III (Figure 

2). However, the fungal compound has not appeared 

apparent peak at about the same retention time (15.2 min) 

as authentic taxol, probably due to the low level of taxol in 

this sample. So amplified 10-L fluid culture medium and 

mycelia were prepared and processed by methylene 

chloride and methanol by using the method described in 

material and methods. Finally, the residue was dissolved 

in 500 µl methanol and volume of 100 µl was used to 

detect the existence of taxol on HPLC and the rest for 

cytotoxicity assay. The results show that the fungal 

compound had a peak at 15.2 min corresponding to 

authentic taxol retention time (data no shown). Further 

convincing mass spectroscopic evidence for the identity of 

Taxol and baccatin III was obtained by mass 

spectroscopy (Figure 3). Characteristically, authentic taxol 

produced electrospray mass spectrum, with the major 

molecular ion being (M+H) + = 854, (M+Na) + = 876 and 

(M+K) + = 892, and authentic baccatin III yielded the major 

molecular ion being (M+H) + = 587, (M+Na) + = 609 and 

(M+K) + = 625 (Stierle et al., 1993). By comparison, the 

fungal compound also yielded a similar electrospray mass 

spectrum as authentic taxol and baccatin III, respectively. 

The content of baccatin III was calculated as about 8 to 15

Wang and Tang 16381 

Figure 1. Morphological observation of Didymostilbe sp. strain DF110. A: Colonies of strain DF110 on PDA plate after 

30-day incubation at 25°C; B: Conidia of strain DF110; C: Penicilli and conidiophore of strain DF110; D: Synnemata and 

Penicillus of strain DF110; E: The conidia of strain DF110 on the top of Penicillus. 

µg per litre culture. However, the content of taxol was not 

precise quantified due to the low level of taxol under the 

HPLC quantification limit. 

Taxol and baccatin III immunoassays 

The competitive inhibition enzyme immunoassay (CIEIA) 

method was generally used to screen for the presence of 

taxanes in crude fungal extracts (Guillemard et al., 1999; 

Guo et al., 2006; Li et al., 1998; Stierle et al., 1993). In 

order to confirm reliability of the aforementioned results, 

taxol and baccatin III assays in the sample were carried 

out by using a taxane Immunoassay Kits. The test using 

specific monoclonal antibody TA02 and TA03 gave 

positive results, respectively. 

The anticancer activities study 

The cytotoxicity of the fungal compound was also studied, 

which showed that the fungal compound had an obvious


A 

B 

Figure 2. HPLC analysis of the fungus DF110 product (A) and of authentic baccatin III (retention time = 6.7 ± 0.1 min) (B).

A 

A 

Ion’s relative abundance (%) 


B 


Figure 3. Combined reverse-phase HPLC-atmospheric pressure chemical ionization mass spectrum analysis of authentic 

baccatin III (retention time = 6.7 ± 0.1 min; (A) and of the fungal baccatin III (retention time = 6.7 ± 0.1 min; (B). The 

diagnostic mass spectral fragment ions are at m/z (M+H) + = 587, (M+Na) + = 609, and (M+K) + = 625; the mass spectra of 

authentic taxol (C) and fungal taxol (D) (retention time = 15.2 ± 0.1 min). The diagnostic mass spectral fragment ions are at 

m/z (M+H) + = 854, 609 (M+Na) + = 876, and (M+K) + = 892.


C 


D 


Figure 3. Contd. 

cytotoxic effect on the liver cancer cell line BEL7402 

(Figure 4). The negative control had a little cytotoxicity to 

cancer cell line BEL7402 because the sample used in this 

test was mixtures. We speculated that some components 

had a little cytotoxicity on the liver cancer cells BEL7402 

in the negative control. 

DISCUSSION 

Since the first endophytic taxol-producing fungus was 

Figure 3 

reported in 1993, great progresses on this field have been 

obtained. Although, the production of taxol by most 

endophytic fungi is relatively low compared with that of the 

taxus trees, the fungi have the short generation time and 

high growth rate; what’s more, genetic manipulation of 

fungi is achieved more easily than that of plants, so it may 

be easier to improve the taxol production with the help of 

genetic engineering. Improving the culturing techniques 

and the application of genetic engineering may improve 

taxol and baccatin III production (Demain, 1981; Stierle et 

al., 1993). Strain DF110 is different from the previous


Figure 4. The microscope observation of the liver cancer cells BEL7402 treated with drug. (A) No addition. (B) 50 μg/ml 

authentic taxol. (C) No-taxol production fungal compound. (D) The fungus DF110 compound. 

reported endophytic taxol-producing fungi. Although, the 

fungus produces low level of taxol, the amounts of 

baccatin III are about 8 to 15 µg/L culture. Baccatin III is 

an important staring material in taxol semi-synthesis 

(Baloglu and Kingston, 1999). Presently, most of the taxol 

for clinical use is produced by the chemical semi-synthetic 

approach (Holton et al., 1995). However, the extraction 

and isolation of the precursors is relatively complex and 

low yield from taxus tissues, depending on epigenetic and 

environmental factors (Vidensek et al., 1990; Wheeler et 

al., 1992). Therefore, this increases the urgent need for 

baccatin III as a starting material to synthesize taxol and 

taxotere, a synthetic analog with anticancer activity similar 

to taxol (Holton et al., 1995). Studies are in progress to 

transfer the key genes of taxol biosynthetic pathway into 

the fungus by restriction enzyme-mediated integration 

(REMI) technique, with an aim of obtaining stable fungal 

transformants with high productivity of taxol and baccatin 

III. UP to date, some fungal transformants have been 

obtained (unpublished). So the strain DF110 may be 

applied as staring material in taxol semi-synthesis and the 

fungus may be a candidate for exploring taxol biosynthetic 

pathway in fungi. 

In conclusion, the combined LC-MS, immunochemical 

and cytotoxicity test suggest that the strain DF110 

produces taxol and baccatin III. By optimizing culturing 

conditions and genetic manipulation, the fungus may be 

an alternative candidate for the production of taxol and 

baccatin III by fermentation technology under our efforts 

in the near future. 


This work was funded by China National “863” High-tech 

Program, China Ministry of Education and Shanghai 

Science and Technology Committee. The authors would 

like to thank Ms. Ping TAO (Instrumental Analysis and 

Test Center, Shanghai Jiaotong University, China) for 

LC-MS analysis. 

REFERENCES 

Baloglu E, Kingston DG (1999). A new semisynthesis of paclitaxel from 

baccatin III. J. Nat. Prod. 62: 1068-1071. 

Barnett HL, Hunter BB (1977). Illustrated Genera of Imperfect Fungi, 3rd 

edn edn. China. Scientific. Press, Beijing. 

Christen AA, Bland J, Gibson DM (1989) cultures as a means to produce 

Taxol. Proc. Am. Assoc. Cancer Res. 30: p. 566.


Demain AL (1981). Industrial microbiology. Science, 214: 987-995. 

Grothaus PG, Raybould TJ, Bignami GS, Lazo CB, Byrnes JB (1993). 

An enzyme immunoassay for the determination of taxol and taxanes 

in Taxus sp. tissues and human plasma. J. Immunol. Methods, 158: 

5-15 

Guillemard V, Bicamumpaka C, Boucher N, Page M (1999). 

Development of a very sensitive luminescence assay for the 

measurement of paclitaxel and related taxanes. Anticancer Res. 19: 

5127-5130 

Guo BH, Wang YC, Zhou XW, Hu K, Tan F, Miao ZQ, Tang KX (2006). 

An endophytic Taxol-producing fungus BT2 isolated from Taxus 

chinensis var. mairei. Afr. J. Biotechnol. 5: 875-877. 

Holton RA, Biediger RJ, Boatman PD (1995). Semisynthesis of taxol and 

taxotere. In: Suffness M (ed) In Taxol Science and Applications. CRC 

Press, Boca Raton, pp. 97-121. 

Hu YM, Gan FY, Lu CH, Ding HS, Shen YM (2003). Production of Taxol 

and related taxanes by cell suspension cultures of Taxus yunnanensis. 

Acta. Bot. Sin. 45: 373-378. 

Kumaran RC, Jung H, Kim HJ (2011). In vitro screening of taxol, an 

anticancer drug produced by the fungus, Colletotrichum capsici. Eng. 

Life Sci. 11: 264-271. 

Li JY, Sidhu RS, Ford EJ, Long DM, Hess WM, Strobel GA (1998). The 

induction of taxol production in the endophytic fungus-Periconia sp 

from Torreya grandifolia. J. Ind. Microbiol. Biotechnol. 20: 259-264. 

Li JY, Strobel G, Sidhu R, Hess WM, Ford EJ (1996). Endophytic 

taxol-producing fungi from bald cypress, Taxodium distichum. 

Microbiology, 142 (8): 2223-2226. 

Liu K, Ding X, Deng B, Chen W (2009). Isolation and characterization of 

endophytic taxol-producing fungi from Taxus chinensis. J. Ind. 

Microbiol. Biotechnol. 36: 1171-1177. 

Metz AM, Haddad A, Worapong J, Long DM, Ford EJ, Hess WM, Strobel 

GA (2000). Induction of the sexual stage of Pestalotiopsis microspora, 

a taxol-producing fungus. Microbiology, 146(8): 2079-2089. 

Nicolaou KC, Yang Z, Liu JJ, Ueno H, Nantermet PG, Guy RK, 

Claiborne CF, Renaud J, Couladouros EA, Paulvannan K, Sorensen 

EJ (1994). Total synthesis of taxol. Nature, 367: 630-634. 

Shrestha K, Strobel GA, Shrivastava SP, Gewali MB (2001). Evidence 

for paclitaxel from three new endophytic fungi of Himalayan yew of 

Nepal. Planta Med. 67: 374-376. 

Soca-Chafre G, Rivera-Orduna FN, Hidalgo-Lara ME, 

Hernandez-Rodriguez C, Marsch R, Flores-Cotera LB (2011). 

Molecular phylogeny and paclitaxel screening of fungal endophytes 

from Taxus globosa. Fungal Biol. 115: 143-156. 

Stierle A, Strobel G, Stierle D (1993). Taxol and taxane production by 

Taxomyces andreanae, an endophytic fungus of Pacific yew. Science, 

260: 214-216. 

Strobel G, Yang X, Sears J, Kramer R, Sidhu RS, Hess WM (1996). 

Taxol from Pestalotiopsis microspora, an endophytic fungus of Taxus 

wallachiana. Microbiology, 142(2): 435-440. 

Vidensek N, Lim P, Campbell A, Carlson C (1990). Taxol content in bark, 

wood, root, leaf, twig, and seedling from several Taxus species. J. Nat. 

Prod. 53: 1609-1610. 

Wang J, Li G, Lu H, Zheng Z, Huang Y, Su W (2000). Taxol from 

Tubercularia sp. strain TF5, an endophytic fungus of Taxus mairei. 

FEMS Microbiol. Lett. 193: 249-253. 

Wang Y, Guo B, Miao Z, Tang K (2007). Transformation of 

taxol-producing endophytic fungi by restriction enzyme-mediated 

integration (REMI). FEMS Microbiol. Lett. 273: 253-259. 

Wani MC, Taylor HL, Wall ME, Coggon P, McPhail AT (1971). Plant 

antitumor agents. VI. The isolation and structure of taxol, a novel 

antileukemic and antitumor agent from Taxus brevifolia. J. Am. Chem. 

Soc. 93: 2325-2327. 

Wheeler NC, Jech K, Masters S, Brobst SW, Alvarado AB, Hoover AJ, 

Snader KM (1992). Effects of genetic, epigenetic, and environmental 

factors on taxol content in Taxus brevifolia and related species. J. Nat. 

Prod. 55: 432-440. 

Zhao K, Ping W, Li Q, Hao S, Zhao L, Gao T, Zhou D (2009). Aspergillus 

niger var. taxi, a new species variant of taxol-producing fungus 

isolated from Taxus cuspidata in China. J. Appl. Microbiol. 107: 

1202-1207.



DOI: 10.5897/AJB11.2052 



Heart dysfunction and fibrosis in rat treated with 

myocardial ischemia and reperfusion 

Cheng-Han Huang 1 , Yi-Ming Huang 2 , Yung-Sheng Tseng 2 , Wei-Chi Lee 3 , Jui-Te Wu 2 , Zhi-Jia 

Zheng 2 and Hsi-Tien Wu 1 * 

1 Department of Bioagricultural Science, National Chia Yi University, Chiayi, 60004, Taiwan. 

2 Department of Veterinary Medicine, National Chia Yi University, Chiayi, 60004, Taiwan. 

3 Animal Science Technology Service and Pathology Section Head, Animal Production Technical Division, Uni-President 

Enterprises Corp, Tainan, 72046, Taiwan. 


Because cardiovascular disease remains a serious problem in modern human society, the aim of this 

study was to establish the rat model animal and to compare the heart dysfunction and fibrosis with SD 

and LE rats when treated with myocardial ischemia and reperfusion operation. A 20-minute thoracotomy 

was performed on the rat at the left anterior descending coronary artery occlusion; then the perfusion 

was carried out. The left ventricular diastolic diameter and left ventricular systolic diameter (LVEDd and 

LVEDs) were both reduced in LE and SD rats after surgery. Compared with the sham group, the 

performance of the left ventricular fractional shortening (LVFS) significantly decreased, indicating 

systolic dysfunction was affected after surgery, and SD was significantly higher than LE at LVFS 

decreasing rate. The significant areas of collagen fibers were detected by Masson's tri-chrome staining 

after surgery. These results suggest that SD rat is more suitable than LE rat for successful 

establishment of the model of myocardial ischemia and reperfusion. Also, the rat model can provide 

good experimental materials for regenerative medicine and drug testing to enhance research results in 

the future. 

Key words: Myocardial infarction, myocardial ischemia and reperfusion, animal model. 

INTRODUCTION 

Cardiovascular diseases, especially coronary artery 

disease, are the leading cause of mortality and morbidity 

worldwide (Samadikuchaksaraei, 2006; Venardos et al., 

2007). The effect of myocardial infarction (MI) primarily 

caused by coronary artery obstruction results in heart 

damage and death associated with myocardial cells 

(Thygesen et al., 2007). Even if other heart tissue is not 

affected by coronary artery blockage, heart failure may 

still result, perhaps because the burden is finally too great 

*Corresponding author. E-mail: htwu@mail.ncyu.edu.tw. Tel: 

+886-5-2717767. Fax: +886-5-2717755. 

Abbreviations: LVEDd, Left ventricular diastolic diameter; 

LVEDs, left ventricular systolic diameter; LVFS, left ventricular 

fractional shortening; MI, myocardial infarction; NRC, United 

States National Research Council; LAD, left anterior 

descending artery; FS%, fractional shortening. 

(Camici and Crea, 2007). Because of scar- and ischemia- 

related postinfarction events, clinical manifestations are 

enormous and heterogeneous. The damaged left ventricle 

undergoes progressive “remodeling” and chamber 

dilation with myocyte slippage and fibroblast proliferation. 

These events reflect an apparent lack of effective intrinsic 

mechanisms for myocardial repair and regeneration 

(Minguell and Erices, 2006). 

Atherosclerosis with thrombus accumulated in the 

coronary artery causes MI (Hansson, 2005; Insull, 2009). 

Because of its high metabolic rate, the myocardium 

undergoes irreversible injury within 20 min of ischemia, 

which begins in the inner layers and moves toward the 

outer layers, resulting in the death of large numbers of 

myocardial cells over a 3 to 6 h period (Michael et al., 

1995). Although, cardiomyocytes are the most vulnerable 

cells, ischemia also kills vascular cells, fibroblasts, and 

nerves in the tissue. Myocardial necrosis causes severe 

inflammation, and millions of marrow-derived leukocytes


enter the infarct region (Dobaczewski et al., 2010). The 

macrophages phagocytose the necrotic cell debris and 

lead to the subsequent healing of the wounds. Before 

they become scabs, they form a granulation tissue, which 

contains a proliferation of fibroblasts and endothelial 

cells, around the infarct area and the surrounding tissue. 

Ultimately, granulation tissue remodels to form densely 

collagenous scar tissue (Laflamme and Murry, 2005). The 

repair process of myocardial infarction in humans 

requires 2 months to complete; in small experimental 

animals, such as mice or rats, the process occurs much 

faster. 

Various animal studies have shown that myocardial 

ischemia after reperfusion generates a complex series of 

inflammatory reactions (Michael et al., 1995). The heart 

function can be recovered through heart reperfusion 

when the ischemia occurs in less than 20 min. This step 

will not lead to myocardial necrosis but may cause 

temporary heart stunning. Cell necrosis amplifies from 

the subendocardium to subepicardium continuously when 

the coronal artery occlusion lasts longer than 20 min 

(Virmani et al., 1992). Myocardial ischemia and reperfusion 

in the myocardium lead to serious inflammation in 

the cardiac tissue, damaging and weakening the ventricular 

function and possibly leading eventually to 

ventricular hypokinesis, akinesis, or dyskinesis (Pfeffer 

and Braunwald, 1990). 

Medical scientists have studied coronary artery disease 

for decades, yet deaths caused by MI and related 

cardiovascular diseases continue to have serious impact 

in modern society (Venardos et al., 2007). Thus, 

choosing a suitable animal model provides good test 

material for MI and helps in clinical studies that may be 

needed before the development of pharmaceutical preparations. 

Appropriate animal model can also provides 

good material for regenerative medicine and cell therapy 

research in MI and reperfusion. Thus, the aim of this 

study was to establish the rat model animal and to 

compare the heart dysfunction and fibrosis with SD and 

LE rats after myocardial ischemia and reperfusion 

operation. 


Animals used in the experiment 

Eight-week-old male rats were used to establish the MI model 

animal. SD rats (Bltw:SD, BioLASCO Taiwan Co., Ltd) and LE rats 

(Narl:-LE, National Laboratory Animal Center, NARL Taiwan) were 

used for the experiment. The animals were kept in a clean 

conventional animal room under air, temperature, and light control. 

All animals were maintained, handled, and treated following NRC 

guidelines (1996); and the Animal Experimental Ethics Committee 

at National Chia Yi University approved all experiments. 

Myocardial ischemia and reperfusion operation in the rat 

The myocardial ischemia and reperfusion operations were 

performed according to procedures described by Michael et al. 

(1995) and Patten et al. (1998) with modification. Rats were 

anesthetized using a mixture of Zoletil (25 mg/kg) and Xylazine (10 

mg/kg) via intramuscular injection. With the rats in the supine 

position, endotracheal intubation was performed, and they were 

ventilated with a small animal respirator (A.D.S. 1000, Engler 

Engineering Co., Florida, USA). The chest was opened by a lateral 

cut with tenotomy scissors along the left side of the sternum, cutting 

through the 4th left ribs to approximately midsternum. The left 

anterior descending artery (LAD) ligation proceeded with a sterile 7- 

O silk (UNIK surgical sutures mfg. Co., Ltd., Taiwan) slipknot suture 

passed with a tapered needle. The blocking time was 20 min. 

After occlusion for a prescribed period (20 min), reperfusion 

occurred by unblocking the slipknot. This allowed release of the 

occlusion and reperfusion of the formerly ischemic bed. The chest 

walls were retracted by using 4-O silk monofilament suture 

(Ethicon, Auneau Co., France). The catheter (24G SURFLO ® IV 

catheter, TERUMO, Co., Philippines), which was connected with 

the 10 ml syringe and inserted before the chest was sutured, pulled 

out the residual air from chest; the respirator helped the animal 

breathe. The chest wall was then closed, sutured through one layer 

of the chest wall and muscle and a second layer through the skin 

and subcutaneous material. The rat was kept on a warm pad until 

awake. The control (sham) group underwent thoracic surgery but 

not vascular ligation of the LAD. The rats were placed in separate 

cages in an air conditioned animal room with clean water and diet 

for postoperative care. 

Histological section and Masson’s trichrome stain 

Two weeks after the MI and reperfusion operation, rat hearts were 

collected and fixed with 4% paraformaldehyde, followed by 

treatment with 70 to 100% ethanol and xylene. Specimens were 

embedded in paraffin and sectioned at a thickness of 6 µm via a 

microtome. Two slides were stained for each specimen, one with 

hematoxylin and eosin, and the other with Masson’s trichrome 

stain. Slides were observed with a Leica DM2000 microscope and 

digitally photographed (Wood et al., 2010). 

Echocardiography 

Echocardiographic assessment was performed according to 

procedures described by Michael et al. (1995) and Patten et al. 

(1998) with slight modification. Echocardiographs were obtained 

using the Philips SONOS 7500 Ultrasound system (Koninklijke 

Philips Electronics N.V.) with 12 MHz frequency transducer, 10 x 13 

mm footprint at an image depth of 2 cm. Left ventricular M-mode 

measurements at the level of the papillary muscles were used to 

define left ventricular end-diastolic diameter (LVEDd) and left 

ventricular end-systolic diameter (LVEDs). Fractional shortening 

(FS %) was defined as (LVEDd - LVEDs) / LVEDd x 100% (Park et 

al., 2010). 

Rats were anaesthetized intraperitoneally with a mixture of Zoletil 

(25 mg/kg) and Xylazine (10 mg/kg). The hair around the chest was 

shaved while the rat was supine and the limbs were fixed by tape. 

Echocardiographic assessment was performed 3 days before MI 

and reperfusion surgery (baseline) and 2 weeks after surgery (after 

treatment). 

Statistical analyses 

All values of echocardiography are listed as means ± SEM. The 

statistical analysis was evaluated with Student’s t-test to measure 

difference among means.

Huang et al. 16389 

Figure 1. Change of left ventricular end diastolic diameter (LVEDd, A) and left ventricular end systolic diameter (LVEDs, B) before and 

after myocardial ischemia and reperfusion surgery. The baseline indicated 3 days before surgery. The after treatment indicated 2 

weeks after surgery. The triangle line as LE rats (N=6), the black square line as SD rats (N=6). Data represented centimeters (CM). 

RESULT 

Echocardiography analysis 

In order to evaluate the structure and function of cardiac 

contractility, this test was conducted 3 days before MI 

and reperfusion surgery and 2 weeks after surgery, using 

the cardiac ultrasound M-mode. Results showed that the 

LVEDd and LVEDs of LE and SD rats increased after 

surgical treatment (Figure 1). LE rats, LVEDd, baseline, 

0.63±0.01 cm; after treatment, 0.67±0.03 cm; SD rats, 

LVEDd, baseline, 0.55±0.01 cm; after treatment, 

0.60±0.02 cm (Figure 1A). LE rats, LVEDs, baseline, 

0.38±0.02 cm; after treatment, 0.41±0.05 cm; SD rats, 

LVEDs, baseline, 0.32±0.02 cm; after treatment, 

0.40±0.01 cm, P


Figure 2. Change of left ventricular shortening fraction (LVFS) 

before and after myocardial ischemia and reperfusion 

surgery. The baseline indicated 3 days before surgery. The after 

treatment indicated 2 weeks after surgery. The circle line as sham 

operation group (N=5). The triangle line as LE rats (N=6), the 

black square line as SD rats (N=6). Data represented percentage. 

Figure 3. Change of left ventricle area after myocardial ischemia and reperfusion surgery. The increased of left ventricular inside 

diameter (D) and the loosed of ventricular wall thickness (T) were seen at LE and SD rat that compared with sham group. Cardiac 

sections were stained with Masson's trichrome staining. All images were captured at 6.8 x magnification. 

fibrosis with SD and LE rats when treated with myocardial 

ischemia and reperfusion operation. For accessibility and 

stability of performance after the experiment, it is 

necessary to find the appropriate rats for the study at the 

outset. Two outbred rats, LE and SD, were chosen for 

this study to evaluate the individual differences before 

and after the operation. 

Both SD and LE rats can enter into a stable anesthesia 

period under appropriate doses of anesthetics and can 

maintain 2 to 3 h until the emergence from anesthesia, 

which is enough time to complete the operation (Zheng 

and Hu, 2006). Using the M-mode on the 

echocardiography combined with appropriate ane-sthetic 

can stabilize the measurement of cardiac diastolic and 

systolic performance (Migrino et al., 2008). After 

myocardial infarction, the left ventricular structure 

changed as a result of the generated mechanical stretch 

and led to increased ventricular wall stress. The result 

was a decrease in left ventricular contractility and loss of 

its ability to eject blood (Sutton and Sharpe, 2000). After 

surgical treatment, compared with LE, SD rats had 

obvious differences in left ventricular diastolic and

H and stain 

Figure 4. The myocardial fibrosis formation after myocardial ischemia and reperfusion surgery. Pictures 

on the left were hematoxylin and eosin (H and E) staining results, pictures on the right were Masson's 

trichrome staining results. Blue stain area presented the formation of myocardial fibrosis (arrow 

indicated). The orders from top to bottom were LE rat, SD rat and the sham group. All images were 

captured at 10 X object lens. 

systolic diameter. After the MI and reperfusion operation, 

on both the SD and LE, caused an increase in left 

ventricular diameter, and a reduction in the thickness of 

the left ventricular wall. Echocardiography measurements 

of SD after surgery were significant, the differences in left 

ventricular fractional shortening (LVFS) were more 

apparent than in LE. According to the results, the 

significant performance indicated the SD rats were more 

suitable for myocardial ischemia and reperfusion surgery. 

In accordance with the collagen fibers area by 

Masson’s trichrome staining, infarct size and distribution 

were also obvious. By contrast, the observation of 

postoperative ventricular tissue biopsies indicates that 

Huang et al. 16391 

the SD and LE rats exhibited fibrous tissue hyperplasia 

after myocardial self-healing and mild inflammation and 

macrophage infiltration in myocardial tissue; however, the 

postoperative inflammation and formation of collagen 

fibers in SD or LE rats showed no significant difference. 

Conclusion 

The study compared the heart dysfunction and fibrosis 

with SD and LE rats when treated with myocardial 

ischemia and reperfusion. From the successful rat model 

established, we found out that SD rat is a suitable model


animal than LE for myocardial ischemia and reperfusion 

studies. Rat heart systolic function weakened significantly 

after postoperative recovery and obviously in myocardial 

collagen fiber proliferation. This method to establish the 

model animal can be used to study drug treatment to 

improve the condition of myocardial ischemia, stem cell 

therapy research, and regenerative medicine applications, 

helping to improve research in cardiac medicine. 


This work was supported by Nation Science Council, 

Taiwan (NSC 97-2313-B-415-005-MY3). 

REFERENCES 

Bader M (2010). Rat models of cardiovascular diseases. Methods Mol. 

Biol. 597: 403-414. 

Camici PG, Crea F (2007). Coronary microvascular dysfunction. N. 

Engl. J. Med. 356: 830-840. 

Dobaczewski M, Gonzalez-Quesada C, Frangogiannis NG (2010). The 

extracellular matrix as a modulator of the inflammatory and reparative 

response following myocardial infarction. J. Mol. Cell. Cardiol. 48: 

504-511. 

Hansson GK (2005). Inflammation, atherosclerosis, and coronary artery 

disease. N. Engl. J. Med. 352: 1685-1695. 

Insull Jr. W (2009). The pathology of atherosclerosis: plaque 

development and plaque responses to medical treatment. Am. J. 

Med. 122: 3-14. 

Laflamme MA, Murry CE (2005). Regenerating the heart. Nat. 


Michael LH, Entman ML, Hartley CJ, Youker KA, Zhu J, Hall SR, 

Hawkins HK, Berens K, Ballantyne CM (1995). Myocardial ischemia 

and reperfusion: a murine model. Am. J. Physiol. 269: H2147-2154. 

Migrino RQ, Aggarwal D, Konorev E, Brahmbhatt T, Bright M, 

Kalyanaraman B (2008). Early detection of doxorubicin 

cardiomyopathy using two-dimensional strain echocardiography. 

Ultrasound Med. Biol. 34: 208-214. 

Minguell JJ, Erices A (2006). Mesenchymal stem cells and the treatment 

of cardiac disease. Exp. Biol. Med. 231: 39-49. 

Park K, Chang SA, Kim HK, Park HE, Na SH, Kim YJ, Sohn DW, Oh 

BH, Park YB (2010). Normal ranges and physiological changes of 

midwall fractional shortening in healthy korean population. Korean 

Circ. J. 40: 587-592. 

Patten RD, Aronovitz MJ, Deras-Mejia L, Pandian NG, Hanak GG, Smith 

JJ, Mendelsohn ME, Konstam MA (1998). Ventricular remodeling in a 

mouse model of myocardial infarction. Am. J. Physiol. 274: H1812- 

1820. 

Pfeffer M, Braunwald E (1990). Ventricular remodeling after myocardial 

infarction. Experimental observations and clinical implications. 

Circulation, 81: 1161-1172. 

Samadikuchaksaraei A (2006). Stem cell therapy for acute myocardial 

infarction. Hellenic. J. Cardiol. 47: 100-111. 

Sutton MG, Sharpe N (2000). Left ventricular remodeling after 

myocardial infarction: Pathophysiology and therapy. Circulation, 101: 

2981-2988. 

Thygesen K, Alpert JS, White HD (2007). Universal definition of 

myocardial infarction. Circulation, 116: 2634-2653. 

Venardos KM, Perkins A, Headrick J, Kaye DM (2007). Myocardial 

ischemia-reperfusion injury, antioxidant enzyme systems, and 

selenium: a review. Curr. Med. Chem. 14: 1539-1549. 

Virmani R, Kolodgie FD, Forman MB, Farb A, Jones RM (1992). 

Reperfusion injury in the ischemic myocardium. Cardiovasc. Pathol. 

1: 117-129. 

Wood A, Docimo S, Elkowitz DE (2010). Cardiovascular disease and its 

association with histological changes of the left stellate ganglion. Clin. 

Med. Insights Pathol. 3: 19-24. 

Zheng X, Hu SJ (2006). Effects of simvastatin on cardiohemodynamic 

responses to ischemia-reperfusion in isolated rat hearts. Heart 

Vessels, 21: 116-123.



DOI: 10.5897/AJB11.2061 



Cardiodepression as a possible mechanism of the 

hypotensive effects of the methylene chloride/methanol 

leaf extract of Brillantaisia nitens Lindau (Acanthaceae) 

in rats 

Orelien Sylvain Mtopi Bopda 1 *, Theophile Dimo 2 , Ives Seukep Tonkep 2 , Louis Zapfack 3 , 

Desire Zeufiet Djomeni 2 and Pierre Kamtchouing 2 

1 Department of Plant and Animal Sciences, University of Buea, P.O. Box 63 Buea, Cameroon. 

2 Department of Animal Biology and Physiology, University of Yaounde I, P.O. Box 812, Yaounde, Cameroon. 

3 Department of Vegetal Biology and Physiology, University of Yaounde I, P.O. Box 812, Yaounde, Cameroon. 


Brillantaisia nitens Lindau (Acanthaceae) is traditionally used in Cameroon for the management of 

many diseases including cardiovascular disorders. The aim of this study was to demonstrate the 

contribution of cardiodepressive activity of methylene chloride/methanol leaf extract of B. nitens to its 

hypotensive action in normotensive (NTR) and deoxycorticosterone acetate-salt hypertensive rats 

(DSHR). In this study, we used the direct cannulation method for blood pressure measurements and 

electrodes for electrocardiogram (ECG). In NTR, the systolic blood pressure dropped by 12.6, 13.8, 22.5 

and 39.3% at the doses 5, 10, 20 and 40 mg/kg, respectively. In DSHR, systolic blood pressure 

decreased by 13.8, 16.2, 16.3 and 20.4% at the same doses, respectively. B. nitens extract (40 mg/kg) 

produced a significant reduction of the heart activity while the blood pressure rapidly dropped. At this 

same dose in NTR, B. nitens induced a negative chronotropic effect by causing a 20.59% (p


performance is, the higher the blood pressure would be. 

In our previous work we reported that a decrease in heart 

rate contributes to the hypotensive effect of methylene 

chloride/methanol extract of B. nitens in normotensive 

and hypertensive rats (Bopda et al., 2007). 

The aim of this study was to demonstrate the mechanistic 

contribution of cardiodepressive activity of B. nitens 

extract to its hypotensive activity on normotensive (NTR) 

and deoxycorticosterone acetate-salt hypertensive rats 

(DSHR). 


Plant material 

Fresh leaves of B. nitens were collected around Yaounde, Centre 

Province of Cameroon, in April 2007. The plant material was 

identified at the National Herbarium in Yaounde, where a voucher 

specimen no HNC/22729 has been deposited. The leaves were airdried 

and ground into powder. Air-dried material (1 kg) was 

macerated in 7 L of methylene chloride/methanol (v/v) for 48 h and 

the solution obtained after filtration was then concentrated in a 

rotary evaporator under reduced pressure to obtain a semi-solid 

material. The viscous residue thus obtained, was kept at room 

temperature for one week to obtain 170 g of a completely dried 

solid mass. The extract (800 mg) was dissolved in 0.2 ml of Tween 

20 and the volume of solution was then adjusted to 10 ml with 

distilled water to obtain a final extract concentration of 80 mg/ml. 

Dilution was later made so that all animals received the same 

volume of solution (1 ml/100 g or 0.1 ml/100 g body weight, 

respectively for toxicity or electrocardiogram studies). 

Acute toxicity test 

50 mice were divided into five groups of ten (sex equal) per group 

after 12 h fasting period, with free access to water. The mice in one 

of the groups received Tween 20 solution 2% (1 ml/100 g of body 

weight, per os), while those in the four other groups received oral 

doses of the extract (1000, 2000, 4000 and 8000 mg/kg, 

respectively). The animals were observed for obvious toxic 

symptoms (changes in body weight, aggressiveness, sensitivity to 

noise and touch, stools aspect and locomotion), and eventual 

mortality in each group was searched 48 h after extract 

administration. Animal were kept under observation for 14 days 

(Joshua et al., 2008; Abdulla et al., 2010). 

Arterial blood pressure and cardiac activity 

Experimental animals 

75 Wistar rats of 8 to 12 weeks old for both sex, and weighing 

between 180 to 230 g were used. They were shared into groups of 

five as follows: eight groups (four per animal model) were used for 

blood pressure measurement. For ECG investigations, four of the 

aforementioned groups were exploited (since blood pressure and 

ECG values were simultaneously recorded), while seven groups 

were newly set (reference drugs and their antagonists). They were 

carefully handled according to guidelines for the care and use of 

laboratory animals approved by the Japanese Pharmacological 

Society. The animals were maintained on a 12-h day/night cycle, 

with free access to standard laboratory rat chow and tap water. 

Normotensive rats (NTR) were used to evaluate the effects of the 

plant extract on blood pressure and ECG and its possible 

mechanism of action. To better understand the mechanism of 

action, we used DSHR obtained from unnephrectomized NTR, as 

described by Vogel and Vogel (1997). The rats were injected twice 

weekly with deoxycorticosterone acetate (DOCA 20 mg/kg, s.c.) in 

carboxymethyl-cellulose (5% of DOCA weight), for four weeks. 

Drinking water was replaced with a 1% NaCl solution. At the end of 

the treatment, rats showing a systolic blood pressure higher than 

150 mmHg were considered as hypertensive. 

Measurement of blood pressure, cardiac activity and 

evaluation of the effects of the plant extract 

The rats were anaesthetized using an intraperitoneal injection of 

urethane (1 g/kg). The trachea was exposed and cannulated to 

facilitate spontaneous respiration. Blood pressure was measured by 

the direct method from right carotid artery, using a cannula 

connected to a pressure transducer. The latter was coupled with a 

Biopac Student Lab. (MP35) hemodynamic recorder and a 

computer. ECG was measured using high sensitivity needles 

(electrodes), connected to the same recorder and computer. The 

animals were allowed to stabilize for at least 30 min before the 

administration of any test substances. The plant extract (5, 10, 20 

and 40 mg/kg) was injected via a cannula inserted into the left 

femoral vein. 

Moreover, the effects of the plant extract were compared with 

those of acetylcholine and isoprenaline (10 μg/kg each). The effect 

of the dose 40 mg/kg (which appeared to be the optimal, from our 

previous investigations) was examined after administration of 

atropine (1 mg/kg) and propranolol (100 μg/kg). Atropine and 

propranolol were injected intravenously 5 min before administration 

of the plant extract. The effectiveness of blockade was tested by 

injecting 10 μg/kg of isoprenaline (agonist). In another set of 

experiment, reserpine (5 mg/kg) was given orally to NTR once a 

day for three days. The effects of the extract were evaluated on the 

blood pressure and ECG parameters, which were observed for 1 h 

after test drug administration. The effect of solvent (2% Tween 20) 

was tested in order to ascertain that the results obtained were 

exclusively due to the extract. Changes in blood pressure and ECG 

were expressed in real values, or as a percentage of the control 

values obtained just before the administration of test substances. 

Drugs 

Urethane, isoprenaline and acetylcholine chloride were obtained 

from Prolabo, France, while atropine sulphate, propranolol, DOCA 

and carboxymethyl-cellulose were obtained from Sigma Chemical, 

St Louis, MO, USA. Heparin was from Sanofi, France. The drugs 

were freshly prepared before the experiment. All drugs were 

dissolved in distilled water except for the plant extract that was 

dissolved in 2% Tween 20 and the solution adjusted with distilled 

water. 


Data were shown as mean ± S.E.M. Statistical significance was 

estimated by one way ANOVA, followed by Dunnett’s test. 

Difference between means were regarded as significant at p

RESULTS 

Bopda et al. 16395 

5 mg/kg 

10 mg/kg 

20 mg/kg 

40 mg/kg 

Figure 1. Effects of B. nitens methylene chloride/methanol extract on the systolic blood pressure in normotensive rats. 

Each point represents the mean ± SEM; n = 5; *p


5 mg/kg 

10 mg/kg 

20 mg/kg 

40 mg/kg 

Figure 2. Effects of B. nitens methylene chloride/methanol extract on the systolic blood pressure in hypertensive rats (DSHR). 

Each point represents the mean ± SEM; n = 5; *p

ECG (.05 - 150 Hz) 

B.n 40 mg/kg 

428.00 428.50 429.00 429.50 

seconds 

ECG (.05 - 150 Hz) 

430.50 431.00 431.50 

seconds 

A 

B 


R 

T 

P 

p 

Q 

S 

Figure 3. Effects of B. nitens (B.n., 40 mg/kg) methylene chloride/methanol extract on ECG of normotensive rat. (A) Changes in 

ECG immediately after B. nitens methylene chloride/methanol extract (B.n., 40 mg/kg) injection into rat’s vein; (B) normal state 

recovering about 4 s after extract injection to rat; P, QRS and T are various waves of normal ECG. 

In addition, as shown in table 2, neither atropine (1 

mg/kg) nor propranolol (100 μg/kg) caused any significant 

(p>0.05) modification of the action of B. nitens extract on 

ECG parameters. similarly, in reserpine (5 mg/kg/day) 

pre-treated rats, the elongation of R-R interval due to B. 

nitens (40 mg/kg) was not significantly inhibited. The 

20.59% (from 170 ± 10 to 205 ± 10 min) R-R interval 

elongation was reduced non significantly (p>0.05) by 

71.43% (maintaining the time at 180 ± 10 min). A non 

significant (p>0.05) 50% inhibition of the extract induced 

P wave magnitude decrease was also observed in 

the same animals. 

Effects of the methylene chloride/methanol extract of 

B. nitens on hypertensive rats ECG parameters 

In DSHR, injection of B. nitens extract (40 mg/kg) 

induced significant changes on T wave time, R-R interval 

and P wave magnitude (Figure 4; Table 3). On T wave, 

B. nitens extract caused a change of duration from 90 ± 

20 to 50 ± 10 min, representing a 44.44% (p


ECG (.05 - 150 Hz) 

ECG (.05 - 150 Hz) 

ECG (.05 - 150 Hz) 

B.n. 40 mg/Kg 

791.83 792.33 792.83 793.33 

seconds 

A 

B 

793.83 794.33 794.83 795.33 

seconds 

C 

797.83 798.33 798.83 799.33 

seconds 

Figure 4. Effects of B. nitens (B.n., 40 mg/kg) methylene chloride/methanol extract on DOCA-salt hypertensive rat ECG. (A) Changes in ECG 

immediately after B. nitens methylene chloride/methanol extract (B.n., 40 mg/kg) injection into rat’s vein; (B) Fall down of the isoelectrical line 

2 s after extract injection; (C) Recovery of steady state 6 s after extract injection to rat; P, QRS and T are the various waves of normal ECG. 

P 

p 

R 

Q 

S 

T 

1.00 

0.50 

0.00 

-0.50 

-1.00 

1.00 

0.50 

0.00 

-0.50 

-1.00 

1.00 

0.50 

0.00 

-0.50 

-1.00 

mV 

mV 

mV

Table 2. Effects of B. nitens methylene chloride/methanol extract, reference drugs and their antagonists on ECG of normotensive rats. 

ECG parameter 

P 

wave 

P-R 

interval 

P-R 

segment 

Time (min) Magnitude (mV) 

QRS 

complex 

Q-T 

interval 

T wave 

R-R 

interval 

P wave 

Complex 

QRS (R) 


B. nitens (40mg/kg) 30 ± 4 50 ± 9 20 ± 5 30 ± 5 105 ± 20 75 ± 10 205 ± 10 0.15 ± 0.01 0.84 ± 0.01 0.16 ± 0.01 

Res + B. nitens 35 ± 7 50 ± 8 20 ± 7 30 ± 7 110 ± 20 80 ± 10 180 ± 10 0.17 ± 0.01 0.87 ± 0.01 0.17 ± 0.01 

Atro + B. nitens 30 ± 6 50 ± 8 20 ± 4 30 ± 7 115 ± 20 85 ± 10 210 ± 10 0.16 ± 0.01 0.85 ± 0.01 0.17 ± 0.02 

Propra + B. nitens 30 ± 5 50 ± 8 20 ± 7 30 ± 5 110 ± 20 80 ± 10 205 ± 10 0.15 ± 0.01 0.85 ± 0.01 0.16 ± 0.01 

Actylcholine (10 µg/kg) 30 ± 7 50 ± 6 20 ± 6 30 ± 6 80 ± 20 50 ± 20 240 ± 20 0.19 ± 0.02 0.85 ± 0.04 0.24 ± 0.03 

Atro + Acetylcholine 30 ± 5 50 ± 4 20 ± 3 30 ± 8 110 ± 10 80 ± 10 180 ± 10* 0.19 ± 0.03 0.85 ± 0.04 0.19 ± 0.01 

Isoprenaline (10 µg/kg) -- -- -- 30 ± 5 -- -- 140 ± 20 -- 0.78 ± 0.02 -- 

Propra + Isoprenaline 30 ± 7 50 ± 4 20 ± 5 30 ± 4 110 ± 10 80 ± 10 180 ± 10* 0.19 ± 0.03 0.85 ± 0.02 0.19 ± 0.01 

Each value represents the mean ± SEM; n = 5; *p


hypotensive effects in anaesthetized rats. Abdul-Ghani 

and Amin (1997) also found similar results while 

evaluating the effects of the aqueous extract of 

Commiphora opobalsamum on blood pressure and heart 

rate in rats. The earlier phase was brief and deep while 

the later phase was sustained. The latter was due to 

vasorelaxation induced by B. nitens extract, as we 

previously showed in normotensive rats (NTR) (Bopda et 

al., 2007; Dimo et al., 2007). 

Prompt drops in both heart rate and blood pressure 

have been demonstrated for several medicinal plant 

extracts after their administration to rat (Corallo et al., 

1997; Dimo et al., 2003; Kitjaroennirut et al., 2005). We 

earlier reported a possible contribution of cardiodepressive 

activity of B. nitens extract to the rapid phase of 

its hypotensive effects. In NTR and DOCA-salt 

hypertensive rats (DSHR), B. nitens (40 mg/kg) induced a 

20.59 and 100% increase of R-R interval time, 

respectively. This corresponded to a decrease of heart 

rate, and confirms our previous results obtained by direct 

heart rate records (Bopda et al., 2007). In NTR, the 

extract caused a decrease of P wave and T wave 

magnitude; P wave and T wave are atria depolarization 

by nodal tissue and ventricle repolarization, respectively. 

Our results demonstrate that B. nitens extract inhibits 

atria depolarization and ventricle repolarization. We 

previously demonstrated on rat aorta smooth muscle that 

vasorelaxation induced by B. nitens extract relied on its 

calcium channels blocking action, which prevented the 

influx of extracellular calcium (Dimo et al., 2007). It is 

assumed nowadays that during the action potential of 

almost all cardiac muscle cells, depolarization is due to 

sodium influx, and directly followed by calcium influx in 

cardiac muscle cells. B. nitens also elicited a hypotensive 

action and a P wave magnitude decrease in DSHR. Salt 

given to those DSHR was NaCl and DOCA is known as a 

mineralocorticoid, thus has ability to retain sodium ions in 

rat internal medium. The higher the sodium concentration 

in the internal medium, the easier the muscle cells 

depolarization could be. Results demonstrate that B. 

nitens extract might have inhibited sodium influx and/or 

calcium influx, and then reduced ability of atria muscle 

cells to depolarize or to elicit a proper action potential. 

Furthermore, the decrease of T wave magnitude reinforced 

this issue, since during a normal heart contraction, 

ventricles repolarization is a prerequisite for a new atria 

depolarization. The decrease of T wave time observed in 

DSHR was due to the global miniaturization of the ECG 

duration in the presence of extract, which contributes to 

lowering the capacity of ventricle to totally repolarise, and 

hence make it difficult for the next depolarization by nodal 

tissue. Thus, it obviously appears that the extract exerted 

a depressive action on electrical activity of cardiac 

muscle, and then on its contraction. The relaxation of 

cardiac muscle might happen, as in aorta muscle, via a 

calcium channels blockade. 

Atropine and propranolol are muscarinic and βadrenoceptor 

blockers, respectively (Dimo et al., 2003; 

Bopda et al., 2007; Kouakou et al., 2008). The 

cardiodepressive activity of B. nitens extract was not 

affected by those blockers. Neither did the extract act via 

muscarinic receptors nor via β-adrenoceptors. Similar 

results were reported by Eno and Owo (1999) in their 

study on the cardiovascular effects of an Elaeopphorbia 

drupifera roots extract. The negative chronotropic effect 

of the extract, as well as its decreasing effect on the 

magnitude of P wave, were partially (but not significantly) 

inhibited by reserpine (5 mg/kg/day). These results might 

express a possible interaction between the extract and 

reserpine, but not on cardiac β-adrenergic receptors. 

Thus, the main possible mechanism of action of B nitens 

extract should be a direct calcium channels inhibition, as 

we suggested previously (Bopda et al., 2007). This might 

be associated with a blockade of sodium channels. While 

investigating the effects of some Calotropis procera 

extracts on the activity of diverse rabbit muscles, 

Moustafa et al. (2010) also suggested that the ethanol 

extract might act directly on the myocardium, inducing a 

negative chronotropic effect. 

In our previous works, we explained that the calcium 

blockade caused by B. nitens extract on vessels is due to 

some alkaloids (Bopda et al., 2007; Dimo et al., 2007) 

and also suggest that the same molecules might be 

responsible for the direct calcium channels inhibition on 

the cardiac pump. The cardiodepressive activity of B 

nitens extract is rather partial vis-a-vis of its hypotensive 

effect, since only the higher dose (40 mg/kg) was 

significantly efficient. 

More also, our results relating to acute toxicity indicate 

that B. nitens extract was not toxic when administered to 

mice by oral route. Similar results were reported by Akah 

et al. (2009, 2010) while evaluating the acute toxicity of 

the aqueous extract and that of the methanol fractions of 

the leaves of B. nitens in mice. All the changes on heart 

activity occurred within less than 10 s following extract 

administration. The recovery observed in all the animals, 

as well as the non-lethality up to 8000 mg/kg of extract, 

gave proof that B. nitens causes no acute toxic effect in 

mice or rats. Those observations justified the fact that the 

early hypotensive phase of B. nitens extract was linked to 

a non-toxic depression on ECG parameters. 

In conclusion, the hypotensive effects induced by the 

CH2Cl2/CH3OH leaf extract of B. nitens rely on its 

cardiodepressive activity. The extract at a higher dose 

(40 mg/kg) caused, in NTR and DSHR, a negative 

chronotropic effect and a decrease of the magnitude of P 

wave. The extract might act by blocking calcium channels 

and possibly sodium channels.


We are very grateful to Dr. Asongalem Emmanuel Acha 

(Faculty of Health Science, University of Buea), for taking 

his time to proof-read this paper. 

REFERENCES 

Abdul-Ghani AS, Amin R (1997). Effect of aqueous extract of 

Commiphora opobalsamum on blood pressure and heart rate in rats. 

J. Ethnopharmacol. 57(3): 219-222. 

Abdulla MA, AL-Bayaty FH, Younis LT, Abu Hassan MI (2010). Antiulcer 

activity of Centella asiatica leaf extract against ethanol-induced 

gastric mucosal injury in rats. J. Med. Plants Res. 4(13): 1253-1259. 

Adjanohoun JE, Aboubakar N, Dramane NN (1996). Contribution to 

ethnobotanical and floristic studies in Cameroon. National Centre for 

Production of school tools, Benin, p. 19. 

Akah PA, Okolo CE, Okoye TC, Offiah NV (2010). Aqueous extract and 

methanol fractions of the leaves of Brillantaisia nitens Lindau 

reverses phenylhydrazine – induced anaemia in rats. J. Med. Plants 

Res. 4(3): 271-277. 

Akah PA, Okolo CE, Ezike Adaobi C (2009). The haematinic activity of 

the methanol leaf extract of Brillantaisia nitens Lindau (Acanthaceae) 

in rats. Afr. J. Biotechnol. 8 (10): 2389-2393. 

Bopda Mtopi OS, Dimo T, Nguelefack TB, Dzeufiet D, Rakotonirina SV, 

Kamtchouing P (2007). Effect of Brillantaisia nitens Lindau 

(Acanthaceae) methylene chloride/methanol leaf extract on rat 

arterial blood pressure and heart rate. Pharmacologyonline, 1: 495- 

510. 

Burkill HM (1985). The useful plants of west tropical Africa. Royal 

Botanic Gardens Kew, England, p. 7. 

Corallo A, Foungbe S, Davy M, Cohen Y (1997). Cardiovascular 

pharmacology of aqueous extract of the leaves of Bridelia atroviridis 

Muell. Arg. (Euphorbiaceae) in the rat. J. Ethnopharmacol. 57:189- 

196. 

Dimo T, Bopda Mtopi OS, Nguelefack TB, Kamtchouing P (2007). 

Vasorelaxant effect of Brillantaisia nitens Lindau (Acanthaceae) 

extracts on isolated rat vascular smooth muscle. J. Ethnopharmacol. 

111(1): 104-109. 


Dimo T, Nguelefack TB, Tan PV, Yewah MP, Dongo E, Rakotonirina 

SV, Kamanyi A, Bopelet M (2003). Possible mechanisms of action of 

the neutral extract from Bidens pilosa L. leaves on the cardiovascular 

system of anaesthetized rats. Phytother. Res. 17: 1135–1139. 

Dimo T, Nguelefack BT, Kamtchouing P, Dongo E, Rakotonirina A, 

Rakotonirina SV (1999). Hypotensive effects of a methanol extract 

from Bidens pilosa Linn on hypertensive rats. A report from the 

Academy of Science - Series III – Sci. Vie, 322(4): 323-329. 

Eno AE, Owo OI (1999). Cardiovascular effects of an extract from the 

roots of a shrub elaeophorbia drupifera. Phytother. Res. 13: 549-554. 

Fezeu L, Kengne AP, Balkau B, Awah PK, Mbanya JC (2010). Ten-year 

change in blood pressure levels and prevalence of hypertension in 

urban and rural Cameroon. J. Epidemiol. Community Health, 64(4): 

360-365. http://dx.doi.org/10.1136/jech.2008.086355 

Joshua AJ, Goudar KS, Damodaran A, Sameera N, Amit A (2008). 

Acute oral toxicity evaluation of some polyherbal formulations in 

albino wistar rats. Int. J. Pharmacol. 4(5): 388-392. 

Kamadjeu RM, Edwards R, Atanga JS, Unwin N, Kiawi EC, Mbanya JC 

(2006). Prevalence, awareness and management of hypertension in 

Cameroon: findings of the 2003 Cameroon Burden of Diabetes 

Baseline Survey. J. Human Hypert. 20: 91–92. 

Kitjaroennirut N, Jansakul C, Sawangchote P (2005). Cardiovascular 

effects of Tecca integrifolia Ker-Gawl. Extract in rats. J. Sci. Technol. 

27(2) : 281-289. 

Kouakou KL, Abo Kouakou JC, Traore F, Ehile Ehouan E (2008). Effet 

antihypertensif de BpF2, une fraction d’extrait aqueux de feuilles de 

Bidens pilosa L. (Asteraceae) chez le lapin. Sci. Nat. 5(1): 29–37. 

Matheus ME, Berrondo LF, Vieitas EC, Menezes FS, Fernandes PD 

(2005). Evaluation of the antinociceptive properties from Brillantaisia 

palisotii Lindau stems extracts. J. Ethnopharmacol. 102(3): 377-381. 

Moustafa AM, Ahmed SH, Nabil ZI, Hussein AA, Omran MA (2010). 

Extraction and phytochemical investigation of Calotropis procera: 

effect of plant extracts on the activity of diverse muscles. Pharm. Biol. 

48(10): 1080-1090. 

Vogel GH, Vogel HW (1997). Drug discovery and evaluation. 

Pharmacological assays. Springer-Verlag, Berlin Heidelberg, 

Germany, pp. 77-78.



DOI: 10.5897/AJB11.2113 



Influence of cross-breeding of native breed sows of 

Zlotnicka spotted with boars of Duroc and polish large 

white (PLW) breeds on the slaughter value fatteners 

Karolina Szulc 1 *, Karol Borzuta 2 , Dariusz Lisiak 2 , Janusz T. Buczynski 1 , Jerzy Strzelecki 2 , 

Eugenia Grzeskowiak 2 , Fabian Magda 2 and Beata Lisiak 2 

1 The Poznan University of Life Sciences, Department of Pig Breeding and Production, ul. Wolynska 33, 

60-637 Poznan, Poland. 

2 Institute of Agricultural and Food Biotechnology, Department of Meat and Fat Technology, 

60–111 Poznan, ul Głogowska 239, Poland. 


The aim of this study was the estimation of the cross-breeding influence of Zlotnicka spotted sows with 

boars of polish large white and Duroc breeds on carcass traits of fatteners. 50 pigs were divided into 

four groups: Zlotnicka spotted (ZS), Zlotnicka spotted x polish large white (ZS x PLW), Zlotnicka 

spotted x Duroc (ZS x D) and Zlotnicka spotted x (Zlotnicka spotted x D). Obtained results confirm the 

results of previous studies. It was found that animals of the native breed ZS were characterized by 

small height of the loin ‘eye’ (52.20mm), low meatiness (43.99%) and considerable backfat thickness 

(4.22 cm). The analysis of the cross-breeding influence on the value of slaughter traits, was confirmed 

by significant higher thickness and surface of the loin ‘eye’ in crossbred fatteners (ZS x PLW, ZS x D, 

ZS x (ZS x D) in comparison with purebred fatteners ZS. The highest meatiness (48%) and lowest 

backfat thickness (3.61cm) were observed in fatteners from group ZS x PLW. With regards to these 

traits, this group differed significantly from group ZS x (ZS x D). Crossbred fatteners ZS x PLW and also 

ZS x D had significantly higher share of meat cuts in comparison with purebred fatteners ZS and 

crossbred fatteners ZS x (ZS x D). However, with regards to share of fat cuts, crossbred animals ZS x 

PLW and ZS X D showed the significant lower capacity of these joints than groups ZS and ZS x (ZS x D). 

Obtained results show that crossbreeding of sows of the breed ZS with boars PLW and also D 

influenced significantly the value of some important slaughter traits and animals from these crossbreeding 

can be used for the purpose of improving economic effects of the goods production. 

Key words: Pigs, Zlotnicka spotted, crossbreds, slaughter value. 

INTRODUCTION 

It has been observed that carcass traits of swine breeds 

reared for meat usually have some faults, which makes 

them unsuitable for traditional culinary processes and 

aims. Therefore, the meat industry in many countries and 

also in Poland increases the interest of native races of 

the unique genetic value which at proper feeding, provide 

*Corresponding author. E-mail: karolasz@jay.au.poznan.pl. 

Abbreviations: PLW, Polish large white; ZS, Zlotnicka spotted; 

D, Duroc. 

the raw material particularly useful to the production of 

raw-ripen products. In Poland, native pigs belong to the 

following breeds: Zlotnicka spotted (ZS), Zlotnicka White 

and Pulawska breeds. Many European countries take 

special care of their own old races of pigs (Salvatori, 

2008; Szulc, 2009). Carcasses of these pigs have the 

thick backfat and meat is prized for its organoleptic traits. 

Carcasses of these pigs are also the raw material to the 

production of the raw-ripen ham. In Pie Noir du Pays 

Basque, the old race is prized for the production of the 

Basque ham (Szulc, 2010). In Spain, the native race 

Iberico is highly valued for the production of dry-cured 

hams and loins. In this country, 2.6 millions of Iberian

Table 1. Proximate composition of diets. 

Item 

Starter 

Diet 

Grower Finisher 

Dry matter (%) 90.29 90.28 90.56 

Energy (MJ/kg) 13.46 12.63 12.46 

Crude protein (%) 16.26 17.31 14.79 

Digestible energy (%) 13.65 14.65 12.65 

Crude fibre (%) 3.45 4.16 3.90 

Crude fat (%) 3.58 1.95 2.01 

Ash (%) 4.73 4.98 4.77 

Ca (%) 0.81 0.79 0.77 

P (%) 0.67 0.62 0.61 

Lysine (%) 1.11 0.99 0.79 

hams are produced annually and the production of these 

dry-cured hams is nowadays the known mark in many 

countries (Serrano et al., 2008). 

As it was reported by Buczyński et al. (2001), 

Grześkowiak et al. (2006), Strzelecki et al. (2006), and 

Buczyński et al. (2005), traditional Polish breeds are 

good and thus are quite popular because of their meat 

quality and quantity but one of the major disadvantages 

of these breeds is their low meat content (44 to 46%) 

comparatively, which is significantly lower in comparison 

with modern breeds and from here is not favoured by 

many commercial meat processors. It was reported by 

Buczyński et al. (1996), Grześkowiak et al. (2006), 

Strzelecki et al. (2006), Michalska and Chojnacki (2005) 

and also Nowachowicz (2005) that the crossbreeding 

project was initiated with ZS swine with breeds having the 

better meat content. 

Buczyński et al. (2001) and Nowachowicz (2005) 

reported that Pietrain was the breed chosen for such 

crossbreeding projects. Using the race Pietrain, there 

was observed increase of meatiness. However, it also led 

to the deterioration of qualitative traits of the meat. It also 

led to the need of initiating the project, in which 

qualitative traits can be improved besides the meat 

quantity as whole. 


The study was conducted in Jaworowo near Gniezno (17˚36ˈ E, 

52˚32ˈ N), with both purebred and crossbred swines of ZS, Duroc 

(ZS x D) and polish large white (ZS x PLW). Races Duroc and also 

PLW were chosen with regards to the good quality of the meat. In 

Poland, both are used widely as components for cross-breeding. 

Animals were divided into four experimental groups with equal 

numbers of sows and boars. All animals were tattooed and earmarked. 

Experimental animals having the average weight of 20 kg 

were selected and the experiment ended when animals reached the 

slaughter weight of about 120 kg (113.0 to 123.6 kg). The 

experiment was divided into starter (20 to 30 kg), grower (30 to 80 

kg) and finisher (over 80 kg) rations. The approximate composition 

of the diets is shown in Table 1. The rations in all the three stages 

Szulc et al. 16403 

were similar for all three genotypes. Fatteners were kept in 

collective coops with 35 animals on the plate bedding. Animals 

were fed ad libitum using the collective feeding and there was the 

stable approach to water all the time. 

After obtaining the final fattening, animals were transported from 

the farm to the slaughter-house located in the distance of about 50 

km. Animals rested for about 2 h prior to slaughtering. Fatteners 

were stunned before slaughter. The carcasses were weighed with 

having the precision of 100 g electronic scales typical in polish 

slaughter-houses 30 min after slaughter and the meat content was 

estimated the with the help of the optical-needle apparatus CGM 

made by the Sydel firm (in France). The backfat thickness was also 

measured in 5 points on the lying right half-carcass (accurate to 0.1 

cm); 1) in the thickest point over the shoulder; 2) on the back - 

between the last thoracic vertebra and the first lumbar vertebra; 2, 

3, 4) in three points over the lumbar loin (on the cross I, II, III): for 

example under the beginning, middle and end of the section of 

gluteus medius muscle (Borzuta, 1998). Later, half-carcasses were 

cooled down using the mono-gradual system to about 4°C. After the 

24 h cycle of cooling down, carcasses were transported to the 

factory in Bieganów on the distance of about 30 km where they 

were cut down into fundamental cuts according to the method given 

in the Polish norm (PN-86-A/82002). Cuts were weighted with the 

scales having the precision of ± 1 g. Obtained results were 

analysed statistically using STATISTICA 6.0 by calculating 

arithmetic means and the standard deviation. One-way analysis of 

variance was conducted and significance of differences between 

genetic groups was identified with the Tukey’s test (Stanisz, 1998). 


The studied fatteners had weak traits of the slaughter 

value (Tables 2, 3 and 4). The observed slaughter 

productivity oscillated from 73.33 to 78.54% and was 

approximate to the results obtained earlier by other 

authors (Kapelański et al. 2006; Wajda and Meller, 1996; 

Kapelański and Rak 1999). The meat content in the pig 

carcass of the race Zlotnicka spotted was estimated as 

low. In our studies, it amounted to 43.99% and the lowest 

meat content was found in crossbreds ZS x ZS/ D while 

the highest one was in crossbreds ZS x PLW (P≤0.05). 

Kapelański et al. (2006) obtained the average 

meatiness as 44.69% but in turn, Szulc et al. (2006)


Table 2. Formation of slaughter traits of fatteners taking into consideration the genetic group. 

Trait 

ZS 

Genetic group 

ZS x PLW ZS x D ZS x (ZS x D) 

Slaughter weight (kg) 114.00 a ±11.05 113.10 a ±5.97 113.00 a ±8.03 123.60 b ±7.90 

Hot carcass weight (kg) 88.92±6.29 87.26±5.76 88.57±5.46 90.57±6.08 

Slaughter productivity (%) 78.25±5.39 77.24±4.93 78.54±4.60 73.33±5.06 

High of the loin ‘eye’ (mm) 52.20 a ±6.25 61.89 b ±11.61 60.10 b ±7.55 61.00 b ±6.88 

Loin ‘eye’ area (cm 2 ) 29.61 a ±5.46 35.97 b ±5.61 35.24 b ±4.77 36.63 b ±7.05 

Meat content (%) 43.99±5.54 48.00 a ±3.47 45.02±3.61 42.47 b ±3.41 

a, b Means along the same row with different superscripts are significant (P≤0.05). Values are mean± SD. 

Table 3. Formation of the backfat thickness in fatteners taking into consideration the genetic group. 

Trait 

ZS 

Genetic group 


Backfat thickness over shoulder (cm) 5.42±0.86 4.70 a ±0.77 5.35±0.49 6.08 b ±0.75 

Backfat thickness on the back (cm) 3.13±0.95 2.72 a ±0.46 2.87±0.51 3.29 b ±0.70 

Backfat thickness on the cross I (cm) 4.40 b ±0.94 3.61 a ±0.38 3.88±0.70 4.45 b ±0.64 

Backfat thickness on the cross II (cm) 3.63±0.97 3.04 a ±0.45 3.20±0.66 3.92 b ±0.62 

Backfat thickness on the cross III (cm) 4.54±1.26 3.96 a ±0.51 4.00±0.70 4.82 b ±0.63 

Backfat thickness from five measurements (cm) 4.22±0.93 3.61 a ±0.36 3.86±0.58 4.51 b ±0.57 

a, b Means along the same row with different superscripts are significant (P≤ 0.05). Values are mean± SD. 

Table 4. Productivity of cuts in analysed carcasses. 

Trait 

ZS 

Genetic group 


Pork-chop (%) 8.08 a ±0.79 9.01 b ±0.72 9.00 b ±0.66 8.02 a ±0.69 

Ham with shank (%) 25.38 a ±1.32 26.14 b ±1.47 26.49 b ±1.31 25.34 a ±1.23 

Neck (%) 6.12±0.78 5.99±0.53 5.77±0.64 5.95±0.61 

Shoulder with shank (%) 13.30±0.96 13.48±1.24 13.68±0.74 13.08±1.17 

Sum of four meaty cuts down (%) 52.88 a * 

54.62 b 

54.94 b 

52.39 a 

Belly with bone (%) 9.92±1.38 9.65±1.48 9.24±3.16 10.56±1.21 

Backfat with skin (%) 13.71 a ±2.57 11.92 b ±1.53 12.35 b ±2.37 15.10 a ±1.83 

Dewlap (%) 4.84±0.58 4.55±0.53 4.31±0.89 4.68±0.77 

Grain (%) 2.19±0.77 2.36±0.86 2.84±1.03 2.55±0.72 

Sum of four fat cuts 30.66 a * 

28.48 b 

28.74 b 

32.89 a 

a, b means along the same row with different superscripts are significant (P≤ 0.01). Values are mean± SD ; *values are expressed as mean. 

noted the meat content as 47%. Similar results were 

obtained by Grześkowiak et al. (2007). In the experiment, 

on cross-breeding of the Zlotnicka White race with race 

PLW conducted by Strzelecki et al. (2006), they obtained 

similar effects as in this work and for example meatiness 

increased from 46.4 to 49.7%. The increase of the 

surface of the loin ‘eye’ was observed from 36 to 42 cm 2 

but the medium backfat thickness decreased from 4.1 to 

3.1 cm. In this work, it was noticed that the surface of the 

loin ‘eye’ was small and was about 30 cm 2 . It confirms the 

results of earlier research (Kapelański and Rak, 1999; 

Grześkowiak et al., 2007). Height of the loin ‘eye’ was 

higher significantly in crossbreeds groups than in 

purebred groups ZS. The backfat in Zlotnicka pigs was 

rather thick and the mean from five measurements was 

4.22 cm. In other studies, it was noticed that the thinner 

backfat was 3.3 cm as was given by Kapelański and Rak 

(1999), 3.2 cm by Grześkowiak et al. (2009) and 2.4 cm 

by Kapelański et al. (2006). The highest mean of the 

backfat thickness in the five points was found in group ZS 

x Z/D, and the lowest one was in group ZS x PLW. 

Between groups, significant difference was found in the

ackfat thickness in all the measured points. 

Higher productivity of pork-chop than for ham was 

found in crossbreeds ZS x PLW and ZS x D lacked 

significant differences in the productivity of shoulder and 

neck. The share of four cuts (pork-chop, ham, shoulder, 

neck) in these groups were found on the average from 

54.6 to 54.9% and was bigger; about 2% in comparison 

with the remaining groups. Grześkowiak et al. (2006) 

showed the increase of the share of the pork-chop, neck 

and shoulder in crossbreds ZS x PLW. Improvement of 

the slaughter value in crossbreds with Duroc in 

comparison with purebred fatteners, was observed for 

race Cinta Sense. In crossbreds, the productivity of four 

cuts increased from about 54 to about 68% (Franci et al., 

2003). Studies were conducted on native races in other 

European countries pointing to the worse muscularity, 

bigger backfat thickness and lower share of ham, 

shoulder blade and pork-chop in comparison with Duroc 

(Serrano et al., 2008). 

It should be also noted that fattening of native pigs in 

Italy and in Spain had body mass of about 140 to 150 kg; 

about 40 kg higher than that in Poland. It resulted from 

the destiny of this raw material to the production of rawripen 

manufacturers. In Poland, possibilities of using 

native pigs and their crossbreds to such production, 

particularly in the light of the obtained result in this work 

should be considered. 

Conclusion 

Analyzing the influence of cross-breeding on the results 

of the slaughter utility, showed that animals of all 

crossbred groups had significant bigger thickness and 

surface of the loin ‘eye’ in comparison with purebred 

fatteners. Fatteners from group ZS x PLW, had the 

highest meatiness which was on the average 48%. The 

lowest meatiness was found in animals from groups ZS x 

(ZS x D) and the difference among these groups was 

statistically significant. 

The thinnest backfat was observed in fatteners from 

group ZS x PLW (3.61 cm) while the thickest (4.51 cm) 

was in animals from group ZS x (ZS x D). Difference was 

found among these groups, which proved significant 

bigger share of four meaty cuts in comparison with 

purebred fatteners ZS and also crossbreds ZS x (ZS x 

D). In turn, with regards to share of fat cuts, crossbred 

animals ZS x PLW and ZS x D showed the lower content 

of these cuts (P≤0.05) than groups ZS and ZS x (ZS x D). 


The study was conducted within the framework of the 

Ministry of Science and Higher Education grant no. N 

N311 266336 ‘Analysis of suitability of Zlotnicka Spotted 

pigs and their crosses with Duroc and Large White Polish 

Szulc et al. 16405 

pigs in the production of heavy fatteners, porcine material 

for production of raw and raw maturing products’. 

REFERENCES 

Borzuta K (1998). Badania nad przydatnością różnych metod 

szacowania mięsności do klasyfikacji tusz wieprzowych w systemie 

EUROP. Rocz. Inst. Przem. Mięs. Tł., XXXV/2. Roz. Hab. 

Buczyński JT, Krupniak S, Dudziak P (1996). Wyniki krzyżowania loch 

rasy wbp z knurami rasy Pietrain x pbz i Pietrain x złotnicka pstra. 

Zesz. Nauk. Przeg. Hod., PTZ, 26: 161-168. 

Buczyński JT, Borzuta K, Szulc K (2001). Carcass quality in złotnicka 

spotted hybrid pigs. Ann. Anim. Sci. Suppl. 1: 13-17. 

Buczyński JT, Panek A, Luciński P, Skrzypczak E, Szulc K (2005). The 

effect of genotype on fattening and slaughter performance in pigs. 

Ann. Anim. Sci. Suppl. 1: 11-15. 

Franci O, Campadoni G, Bozzi R, Pugliese C, Acciaioli A, Gandini G 

(2003). Productivity of Cinta Senese and Large White x Cinta Senese 

pigs reared outdoors in woodlands and indoors. 2. Slaughter and 

carcass traits. Ital. J. Anim. Sci. 2: 59-65. 

Grześkowiak E, Borzuta K, Strzelecki J, Borys A, Lisiak D, Janiszewski 

P (2006). Badania wpływu krzyżowania świń czystorasowych 

złotnickiej białej z wielką białą polską, na jakość tusz oraz 

przydatność technologiczną mięsa. Rocz. Inst. Przem. Mięs. i Tł. 

XLIV/2: 33–42. 

Grześkowiak E, Borzuta K, Strzelecki J, Buczyński JT, Lisiak D, 

Janiszewski P (2007). Jakość tusz oraz przydatność technologiczna 

mięsa świń ras złotnickich Rocz. Nauk. Zoot. T. 34, z.: 239–250. 

Grześkowiak E, Borys A, Borzuta K, Buczyński JT, Lisiak D (2009). 

Slaughter value, meat quality and backfat fatty acid profile in 

złotnicka white and złotnicka spotted fatteners. Anim. Sci. Pap. Rep. 

27(2): 115-125. 

Kapelański W, Rak B (1999). Growth performance and carcass traits of 

pietrain and złotnicka spotted pigs and their crossbreds evaluated in 

1969 and 1997. Advan. Agroc. Sci. vol. VI, Facs. 2: 45-50, Szczecin. 

Kapelański W, Buczyński JT, Bocian M (2006). Slaughter value and 

meat quality in the Polish native Złotnicka Spotted pig. Anim. Sci. 

Pap. Rep. 24(1): 7-13. 

Michalska G, Chojnacki Z (2005). Performance test results of young 

crossbreed boars with Złotnicka Spotted and Pietrain breeding. Ann. 

Anim. Sci., Suppl. 1: 35-38. 

Nowachowicz J (2005). Meat and fat content of young crossbreed boars 

with złotnicka spotted and pietrain breeding depending on their 

growth rate. Ann. Anim. Sci., Suppl. 1: 47-50. PN-86-A/82002 Polska 

Norma. Wieprzowina. Części zasadnicze. 

Salvatori G, Filetti F, Di Cesare C, Maiorano G, Pilla F, Oriani G (2008). 

Lipid composition of meat and backfat from casertana purebred and 

crossbred pigs reared outdoors. Meat Sci. 80: 623-631. 

Serrano MP, Valencia DG, Nieto M, Lazaro R, Mateos GG (2008). 

Influence of sex and terminal sire line on performance and carcass 

and meat quality of Iberian pigs reared under intenstive production 

systems. Meat Sci. 78: 420-428. 

Stanisz A (1998). Przystępny kurs statystyki w oparciu o program 

Statistica PL na przykładach z medycyny. Startsoft Polska, Sp. z o. o 

Kraków. 

Strzelecki J, Borzuta K, Grześkowiak E, Janiszewski P, Lisiak D, 

Buczyński JT (2006). Effect of crossbreeding złotnicka white pigs on 

carcass slaughter value. Ann. Anim. Sci., Suppl. 2(1): 287-290. 

Szulc K, Buczyński JT, Skrzypczak E, Panek A (2006). Live testing 

results of złotnicka spotted (ZS), ZS x Polish Large White and ZS x 

Hampshire fatteners. Anim. Sci. Pap. Rep. 24: 65-69. 

Szulc K (2009). Stare rasy świń w Europie-casertana i sarda. Trz. Chl. 

XLVII, 4: 36–37. 

Szulc K (2010). Stare rasy świń w Europie – Pi Noir du Pays Basque. 

Trz. Chl. XLVIII, 10: 23–24. 

Wajda S, Meller Z (1996). Technological ability of meat of złotnicka 

spotted pigs. Mat. I Konf. Nauk. Rasy rodzime świń”. Poznań 26. XI. 

1996: 41–50.

UPCOMING CONFERENCES 

2012 International Conference on Biotechnology and Food Engineering 

ICBFE 2012 Dubai, UAE. August 4-5, 2012 

15th European Congress on Biotechnology: "Bio-Crossroads", 

Istanbul, Turkey, 23 Sep 2012

Conferences and Advert 

September 2012 

15th European Congress on Biotechnology: "Bio-Crossroads", Istanbul, Turkey, 23 

Sep 2012 

October 2012 

Biotechnology and Bioinformatics Symposium, Provo, USA, 25 Oct 2012

African Journal of 

Biotechnology 

Related Journals Published by Academic Journals 

■ Journal of Evolutionary Biology Research 

■ Journal of Yeast and Fungal Research 

■ Journal of Brewing and Distilling 

■ African Journal of Biochemistry Research 

■ African Journal of Food Science 

■ African Journal of Plant Science

(L.) C. Jeffrey from India using internal transcribed - Academic ...

Create successful ePaper yourself

Delete template?

Save as template?