Vaccinium (Blueberry & Cranberry) Post-Entry Quarantine Testing ...

Vaccinium 

(Blueberry & Cranberry) 

Post-Entry Quarantine 

Testing Manual 

July 2010 

BIOSECURITY NEW ZEALAND 

Ministry of Agriculture and Forestry 

Te Manatu Ahuwhenua, Ngaherehere 

Plant Health & Environment Lab, IDC-Tamaki, 231 Morrin Road, St Johns, PO Box 2095, Auckland, New Zealand 

E-mail: peqtesting@maf.govt.nz Tel: 64 9 909 3015 Fax: 64 9 909 5739 Web: www.biosecurity.govt.nz

CONTENTS 

Vaccinium Post-Entry Quarantine Testing Manual 

1. SCOPE ..................................................................................................................................................... 4 

2. INTRODUCTION................................................................................................................................... 4 

3. IMPORT REQUIREMENTS................................................................................................................. 5 

4. PESTS AND DISEASES......................................................................................................................... 6 

4.1 Regulated pests and diseases for which generic measures are required ...................................... 6 

4.1.1 ‘Blueberry type’ Vaccinium species......................................................................................... 6 

4.1.2 ‘Cranberry type’ Vaccinium macrocarpon ............................................................................. 7 

4.2 Regulated pests and diseases for which specific tests are required .............................................. 7 

4.2.1 ‘Blueberry type’ Vaccinium species......................................................................................... 7 

4.2.2 ‘Cranberry type’ Vaccinium macrocarpon ............................................................................. 7 

5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE................... 8 

5.1 Nursery stock .................................................................................................................................... 8 

5.1.1 Hardwood cuttings.................................................................................................................... 8 

5.1.2 Softwood cuttings...................................................................................................................... 9 

5.1.3 Plants in tissue culture.............................................................................................................. 9 

5.2 Seed for sowing ................................................................................................................................. 9 

6. INSPECTION........................................................................................................................................ 10 

7. TESTING............................................................................................................................................... 10 

7.1 Specific tests for nursery stock ...................................................................................................... 11 

7.1.1 ‘Blueberry type’ Vaccinium species....................................................................................... 11 

7.1.1.1 Herbaceous indexing ..................................................................................................... 11 

7.1.1.2 Transmission electron microscopy (TEM) .................................................................. 14 

7.1.1.3 Serological and molecular assays ................................................................................. 15 

7.1.1.3.1 Enzyme-linked immunosorbent assay (ELISA)..................................................... 15 

7.1.1.3.2 Polymerase chain reaction (PCR)............................................................................ 17 

7.1.1.3.2.1 Virus reverse-transcription PCR (RT-PCR)................................................... 18 

7.1.1.3.2.1.1 Blueberry red ringspot virus (BRRV)........................................................ 20 

7.1.1.3.2.1.2 Blueberry scorch virus (BlScV) ................................................................. 20 

7.1.1.3.2.1.3 Blueberry shock virus (BlShV) .................................................................. 20 

7.1.1.3.2.1.4 Tobacco streak virus (TSV)........................................................................ 20 

7.1.1.3.2.1.5 Tomato ringspot virus (ToRSV)................................................................. 21 

7.1.1.3.2.2 Phytoplasma and Bacteria PCR....................................................................... 21 

7.1.1.3.2.2.1 Blueberry stunt phytoplasma ................................................................... 23 

7.1.1.3.2.2.2 Cranberry false blossom phytoplasma .................................................... 23 

7.1.1.3.2.2.3 Vaccinium witches’ broom phytoplasma ................................................. 23 

7.1.1.3.2.2.4 Xylella fastidiosa......................................................................................... 23 

7.1.2 ‘Cranberry type’ Vaccinium macrocarpon ........................................................................... 24 

7.1.2.1 Herbaceous indexing ..................................................................................................... 24 

7.1.2.2 Transmission electron microscopy (TEM) .................................................................. 24 

7.1.2.3 Serological and molecular assays ................................................................................. 24 

7.1.2.3.1 Enzyme-linked immunosorbent assay (ELISA)..................................................... 24 

7.1.2.3.2 Polymerase chain reaction (PCR)............................................................................ 24 

7.1.2.3.2.1 Virus reverse-transcription PCR (RT-PCR)................................................... 24 

7.1.2.3.2.1.1 Blueberry red ringspot virus (Cranberry ringspot disease)..................... 24 

7.1.2.3.2.1.2 Blueberry scorch virus................................................................................ 24 

7.1.2.3.2.1.3 Tobacco streak virus................................................................................... 24 

7.1.2.3.2.2 Phytoplasma and bacteria PCR ....................................................................... 24 

7.2 Specific tests for seed for sowing ................................................................................................... 25 

7.2.1 All Vaccinium species (‘Blueberry and Cranberry type’) ................................................... 25 

Vaccinium Post-Entry Quarantine Testing Manual - July 2010 

2

8. CONTACT POINT ............................................................................................................................... 25 

9. ACKNOWLEDGEMENTS.................................................................................................................. 25 

10. REFERENCES...................................................................................................................................... 26 

Appendix 1. Symptoms of significant regulated diseases in Vaccinium ..................................................... 28 

1.1 ‘Blueberry type’ Vaccinium species.................................................................................................... 28 

1.1.1 Blueberry leaf mottle virus....................................................................................................... 28 

1.1.2 Blueberry red ringspot virus .................................................................................................... 28 

1.1.3 Blueberry scorch virus ............................................................................................................. 28 

1.1.4 Blueberry shock virus .............................................................................................................. 28 

1.1.5 Blueberry shoe string virus...................................................................................................... 29 

1.1.6 Peach rosette mosaic virus....................................................................................................... 29 

1.1.7 Tomato ringspot mosaic virus.................................................................................................. 29 

1.1.8 Blueberry stunt phytoplasma................................................................................................. 29 

1.2 ‘Cranberry type’ Vaccinium species................................................................................................... 30 

1.2.1 Cranberry ringspot disease.................................................................................................... 30 

1.2.2 Cranberry false blossom phytoplasma.................................................................................. 30 

Appendix 2. Symptoms of nutrient deficiencies in Vaccinium .................................................................... 31 

2.1 Nitrogen deficiency (blueberry) .......................................................................................................... 31 

2.2 Phosphorus deficiency (blueberry) ..................................................................................................... 31 

2.3 Potassium deficiency (blueberry)........................................................................................................ 31 

2.4 Nitrogen deficiency (cranberry).......................................................................................................... 31 

Appendix 3. Protocols referenced in manual................................................................................................ 32 

3.1 Silica-milk RNA extraction protocol (Menzel et al., 2002) .......................................................... 32 

3.2 Phytoplasma DNA enrichment CTAB extraction protocol (Kirkpatrick et al., 1987and 

modified by Ahrens & Seemüller, 1992) ....................................................................................... 32 

© Ministry of Agriculture and Forestry, July 2010 


3

1. SCOPE 

The scope of this manual is limited to nursery stock (dormant cuttings and plants in tissue 

culture, and tissue culture-derived plants - ½″ plug, rooted micro-cuttings from Fall Creek 

Farm and Nursery Inc., only) and seed for sowing of Vaccinium species permitted entry 

into New Zealand as listed in the Ministry of Agriculture and Forestry’s (MAF) Plants 

Biosecurity Index (see: http://www1.maf.govt.nz/cgi-bin/bioindex/bioindex.pl). At the 

date of publication of this manual, these species were as follows: 

(a) ‘Blueberry type’ 

Vaccinium angustifolium 

Vaccinium ashei 

Vaccinium atrococcum 

Vaccinium bracteatum 

Vaccinium corymbosum 

Vaccinium delavayi 

Vaccinium erythrinum 

Vaccinium glauco-album 

Vaccinium japonicum 

Vaccinium membranaceum 

(b) ‘Cranberry type’ 

Vaccinium macrocarpon 


Vaccinium mortinia 

Vaccinium moupinense 

Vaccinium myrtillus 

Vaccinium nummularia 

Vaccinium oldhamii 

Vaccinium ovalifolium 

Vaccinium oxycoccos 

Vaccinium praestans 

Vaccinium virgatum 

Vaccinium vitis-idaea 

This manual describes the testing protocols specified in the import health standards for 

these commodities. The manual also provides an introduction to the crop and guidance on 

the establishment and maintenance of healthy plants in quarantine. 

2. INTRODUCTION 

The genus Vaccinium (family Ericaceae) consists of about 450 species. Vaccinium species 

grow wild around the world and there are many names given to the numerous varieties that 

produce edible fruits, such as blueberry, cranberry, bilberry, cowberry, crowberry, 

farkleberry, lingonberry, partridgeberry, huckleberry, whortleberry and sparkleberry. 

Blueberries and cranberries are the only Vaccinium species commercially grown and these 

are both native to North America (www.botany.com/vaccinium.html; 

www.cranberries.org). 

Blueberries are evergreen deciduous, moderate-growing shrubs. Plants require acidic 

conditions for optimal growth (pH 4.0 to 5.5), and 120 to 160 growing days to ripen fruit. 

Blueberry plants flower in spring and are pollinated by honey bees. Fruit development 

occurs for about 2 to 3 months after bloom, depending on cultivar, weather and plant 

vigour. Yields can be as high as 50 tonnes per hectare, although yields of 18 to 20 tonnes 

per hectare are more typical of mature plantings 

(http://www.overlakefoods.com/history_blueberry.htm#TheImprovedBlueberry). 

Blueberries come from a variety of different Vaccinium species occurring in North 

America. The main species of blueberry are: Northern Highbush (V. corymbosum), 

Lowbush (V. angustifolium) and Southern Rabbiteye (V. ashei), however, there are also 

many hybrids of these species. Over time, the "cultivated" or "Highbush" blueberries have 

been improved through natural selection and plant breeding programmes to develop 

superior berries both for the consumer and the food processing industry. The blueberry 

4

industry is currently segmented into two major market categories, fresh and processed. 

Today the Highbush berry is grown commercially in North and South America, Australia, 

New Zealand and Europe. More than 42,000 tonnes of blueberries are harvested each year, 

of which 90% derives from North America (www.blueberry.org/blueberries.htm). 

In New Zealand the majority of growers (80%) are based in the Waikato area of the North 

Island and blueberry production is largely based on the Highbush and Rabbiteye species. 

The Southern Highbush blueberry with considerable genetic input from Vaccinium 

darrowii is becoming increasingly important worldwide with low chill adaptation, 

evergreen leaves and the ability to crop year round in some locations. New Southern 

Highbush varieties (e.g. ‘Island Blue’ released by HortResearch in 2002), is suited to 

warmer regions, has increased growing opportunities for Northland growers. New Zealand 

blueberry exports are increasing steadily, e.g. fresh fruit exports were worth $6.8 million in 

2000 compared to $9.2 million in 2005; the main importers being Japan and the USA 

(www.blueberriesnz.co.nz). 

Cranberries grow as prostrate, evergreen shrubs. The shrubs produce stolons with buds 

from which short vertical branches, or uprights grow, these can be either vegetative or 

fruiting. Each fruiting upright may contain as many as seven flowers. Pollination is 

primarily via honey bees. The growing season for cranberry runs from spring to autumn 

including a dormancy period in the winter months that provides an extended chilling period 

necessary to mature fruiting buds. 

Cranberry are unique fruit in that they can only grow and survive under a very special 

combination of factors: they require acid conditions (ph 4.0 to 6.1), and grow on vines in 

impermeable beds (commonly known as "bogs") layered with sand, peat, gravel and clay 

(www.cranberries.org). Depending on how the cranberries are harvested, they are either 

used for making juice or sauces (wet harvest) or sold as fresh fruit (dry harvest) 

(www.cranberryinstitute.org). 

Most of the world’s cranberries are cultivated in either the USA or Canada. Recently, 

cranberries have been also been grown in Chile (www.cranberries.org; 

www.cranberryinstitute.org). Cranberries have been present in New Zealand for at least 20 

years (Patel et al., 2002), and to date are only produced commercially on the west coast of 

the South Island. 

Further information on Vaccinium can be found using the following sources (Luby et al. 

1990; Lyrene 1997); and 

http://plants.usda.gov/java/profile?symbol=VACCI 

http://www.desert-tropicals.com/Plants/Ericaceae/Vaccinium.html 

http://www.dierking.de/englisch/about_us/about_us.html 

http://www.fallcreeknursery.com/ 

3. IMPORT REQUIREMENTS 

The import requirements for nursery stock (dormant cuttings and plants in tissue culture, 

and tissue culture derived plants - ½″ plug, rooted micro-cuttings from Fall Creek Farm and 

Nursery Inc., only) of Vaccinium are set out in MAF’s import health standard “Importation 

of Nursery Stock http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf”. Imported 

cuttings and tissue culture plants must meet the general requirements (sections 1-3) and the 

additional specific requirements detailed in either the “Vaccinium” and “V. macrocarpon” 


5

schedules in section 3. In summary, an import permit is required and a phytosanitary 

certificate must accompany all consignments certifying that the nursery stock has been 

inspected and found to be free of any visually detectable regulated pests, and has been 

treated for regulated insects and mites (cuttings only). On arrival in New Zealand, the 

nursery stock must be grown for a minimum period of 9 months (tissue culture) or 16 

months (cuttings) in a Level 3 post-entry quarantine facility where it will be inspected, 

treated and/or tested for regulated pests. 

Vaccinium nursery stock can also be imported from offshore accredited facilities (see the 

following link for details of offshore accredited facilities: 

http://www.biosecurity.govt.nz/regs/imports/plants/off-shore. On arrival in New Zealand, 

the nursery stock must be grown for a minimum period of 6 months in a Level 2 post-entry 

quarantine facility where it will be inspected, treated and/or tested for regulated pests. 

The import requirements for Vaccinium seed for sowing are set out in MAF’s import health 

standard “Importation of Seed for Sowing http://www.biosecurity.govt.nz/files/ihs/155-02- 

05.pdf”. Imported seed must meet the general requirements (sections 1-2) and the specific 

requirements detailed in the “Vaccinium” schedule in section 3. In summary, an import 

permit is required and a phytosanitary certificate must accompany all consignments 

certifying that the seeds have been inspected and found free of any visually detectable 

regulated pests. On arrival in New Zealand, the seed must be grown for a minimum period 

of 6 months in a Level 3 post-entry quarantine facility where it will be inspected, treated 

and/or tested for regulated pests. 

4. PESTS AND DISEASES 

A complete list of regulated and non-regulated pests and diseases of Vaccinium can be 

found in the nursery stock and seed for sowing import health standards (see section 3). 

4.1 Regulated pests and diseases for which generic measures are required 

4.1.1 ‘Blueberry type’ Vaccinium species 

Insects: Refer to import health standard. 

Mites: Refer to import health standard. 

Fungi: 

Diaporthe vaccinii [Seed for sowing only] 

Botryosphaeria vaccinii [Seed for sowing only] 

Monilinia fructigena [Seed for sowing only] 

Monilinia vaccinii-corymbosi [Seed for sowing only] 

Bacteria: 

Agrobacterium rubi [Nursery stock only] 

Diseases of unknown aetiology: 

Blueberry fruit drop disease [Nursery stock only] 

Blueberry mosaic disease [Nursery stock only] 


6

4.1.2 ‘Cranberry type’ Vaccinium macrocarpon 

Insects: Refer to import health standard. 

Mites: Refer to import health standard. 

Fungi: Refer to import health standard. 

Bacteria: 

Agrobacterium rubi [Nursery stock only] 

4.2 Regulated pests and diseases for which specific tests are required 


Bacteria: 

Xylella fastidiosa [Nursery stock only] 

Viruses: 

Blueberry leaf mottle virus [Nursery stock & seed for sowing] Figure 1.1.1 

Blueberry red ringspot virus [Nursery stock only] Figure 1.1.2 

Blueberry scorch virus [Nursery stock only] Figure 1.1.3 

Blueberry shock virus [Nursery stock & seed for sowing] Figure 1.1.4 

Blueberry shoestring virus [Nursery stock only] Figure 1.1.5 

Peach rosette mosaic virus [Nursery stock & seed for sowing] Figure 1.1.6 

Tobacco streak virus [Nursery stock only] 

(strains not in New Zealand) 

Tomato ringspot virus [Nursery stock & seed for sowing] Figure 1.1.7 


Phytoplasmas: 

Blueberry stunt phytoplasma [Nursery stock only] Figure 

2202775601.1.61.1.8 

Cranberry false blossom phytoplasma [Nursery stock only] Figure 

01.1.51.2.21.2.2 

Vaccinium witches’ broom phytoplasma [Nursery stock only] 


Viruses: 

Blueberry leaf mottle virus [Seed for sowing only] Figure 

11.1.1 

Blueberry red ringspot virus [Nursery stock only] Figure 

01.1.51.2.1 

(putative casual agent of Cranberry ringspot disease) 

Blueberry scorch virus [Nursery stock only] Figure 11.1.3 

Blueberry shock virus [Seed for sowing only] Figure 11.1.4 

Peach rosette mosaic virus [Seed for sowing only] Figure 01.1.6 

Tobacco streak virus [Nursery stock only] 



7

Tomato ringspot virus [Seed for sowing only] Figure 

01.1.61.1.7 


Phytoplasmas: 

Cranberry false blossom phytoplasma [Nursery stock only] Figure 

01.1.51.2.21.2.2 

5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY 

QUARANTINE 

Plants must be maintained in a healthy, vigorous state free of nutrient deficiencies. 

Symptoms of nutrient disorders are illustrated in Appendix 2 (Figures 2.1 to 2.4). Further 

illustrations of nutrient deficiencies of blueberries and cranberries can be found on the 

American Phytopathological Society’s CD-ROM ‘Diseases of Small Fruits’ 

(www.aps.org). 

Details of propagating Vaccinium spp. can be found at: 

http://berrygrape.oregonstate.edu/fruitgrowing/berrycrops/blueberry/propagat.htm and 

www.smallfruits.org/Blueberries/production/03BlueberryPropagationSuggestions.pdf 

5.1 Nursery stock 

Vaccinium nursery stock may be imported in a variety of forms including hardwood and 

softwood cuttings, plants in tissue culture and tissue culture-derived plants (½″ plug, rooted 

micro-cuttings from Fall Creek Farm and Nursery Inc. only). It is best to import Vaccinium 

cuttings between December to February (northern hemisphere), or June to July (southern 

hemisphere). All imported cutting material must be free of foliage prior to shipping to 

minimise the introduction of pests and diseases. Tissue culture plants should ideally be 

imported around June to July (southern hemisphere winter) to allow them to become 

established prior to summer. Successful establishment of Vaccinium is best achieved using 

acidified rooting media and irrigation water (pH 4.5-5.5; irrigation water can be acidified 

using phosporic acid). 

It is important that pruning and cutting tools used on the imported cuttings are disinfected 

between each plant. Alternatively, disposable razor blades may be used. 

5.1.1 Hardwood cuttings 

Hardwood cuttings are generally imported as dormant one-year-old shoots that have been 

harvested in late winter or early spring prior to bud break (approximately 10-20 cm in 

length). Cuttings are stored in plastic bags with sphagnum moss to prevent drying out and 

maintained at 4 o C. They can be stored in this way for 2 to 3 months but should be checked 

frequently for signs of deterioration. 

To stimulate rooting, re-cut the base of the cutting and then slice a layer of bark 10-20 mm 

long from both sides of the base of the cutting, then insert the cutting vertically into a welldrained 

50:50 (v/v) peat:perlite mix, allowing only the top bud to remain above the surface. 

The cuttings should be propagated in beds located in full sun and must be protected from 

drying out. 


8

Propagation beds/poly cold frame (around 1 m by 2 m in length and 20 cm depth) must be 

raised above the ground. The media is supported by a hard wearing cloth on the bottom of 

the bed/frame. Bottom heating (e.g. heating mats) can be used to improve rooting. The 

recommended bottom heat is 20ºC. Avoid wide temperature fluctuations and draughts in 

the propagation bed and greenhouse structure to promote rapid and even rooting. 

If cuttings are struck in early spring, vegetative buds will leaf out in about 6 weeks. There 

are no roots at this stage. These will be formed after another 4 weeks or so, along with a 

second flush of leaves. After the roots and foliage have developed, increase ventilation and 

apply a general purpose nitrogen fertiliser weekly (e.g. Plantosan ® ) as per manufacturer’s 

recommendations. 

5.1.2 Softwood cuttings 

Imported softwood cuttings are generally between 10-15 cm long with at least 3 vegetative 

buds but no leaves. Re-cut the base of the cutting and then wound the base of the stem on 

each side with a sharp knife and dip briefly in rooting hormone (e.g. softwood IBA or 

Liba ® ). Insert cuttings 5 cm deep into rooting medium, made up of a 60:40 (v/v) 

pasteurised peat:perlite mix in trays, then place on heated sand beds in a greenhouse. 

Bottom heating of the propagation beds to 20ºC is normally used to improve rooting. 

Softwood cuttings must have an acidified mist propagation system or similar set-up to 

prevent drying out and wilting. The misting should be applied in regular short intervals to 

maintain a high level of humidity at all times. See ‘Blueberry Propagation Suggestions’ for 

more detailed suggestions on watering systems and regimes 

(www.smallfruits.org/Blueberries/production/03BlueberryPropagationSuggestions.pdf) 

After roots and foliage appear, good air circulation is required to prevent the build-up of 

air-borne fungal disease (e.g. Botrytis cinerea). A soluble fertiliser (e.g. Nitrosol ® or Wuxal 

Amino ® ) should be used to ensure good foliage and root growth. The growing temperature 

should not drop below 16ºC. 

Softwood cuttings should root in 6 to 8 weeks and can then be transplanted into plastic pots 

(peat can be used at this stage). Do not allow evening or night temperatures to fall below 

15ºC. 

5.1.3 Plants in tissue culture 

Tissue culture plantlets must be carefully removed from the growing media and rooted into 

a 1:1 (v/v) pasteurised peat:perlite mix in cell trays. Plantlets should be kept at 20ºC in 

shady conditions, watered gently and kept covered in clear plastic (e.g. Ziploc ® bags) to 

retain high humidity. Plantlets should be kept in this state for around 4 weeks, after which 

time they can be transferred to a mist bed with bottom heat (20°C) for an additional 2 

weeks. Once roots are established, the plants can be re-potted into peat and grown-on in the 

glasshouse. 

5.2 Seed for sowing 

Seeds are imported air-dried in airtight vials. Seeds can be stored in this way, at 3 to 4°C, 

for several weeks prior to use. 

Sow seeds onto the surface of a 1:1 (v/v) pasteurised peat:sand mix in shallow plastic trays 

and then cover with a thin layer of pasteurised sphagnum peat. Stratified seed will 


9

normally germinate readily at 20-21º C under a regime of 16 hours light per 24-hour period. 

It is also possible to stimulate germination by soaking seeds overnight at room temperature 

in an aqueous solution of gibberellic acid (1mM); the seeds are then briefly rinsed in tap 

water prior to sowing. Keep seedlings between 16-21ºC and ensure peat media is kept 

moist (but not soaked) at all times using acidified irrigation water. Germination generally 

begins within 3 to 4 weeks and continues for 6 to 8 weeks. Continue to grow germinated 

seedlings until they are around 5-7 cm tall, and then transplant seedlings into a pasteurised 

peat-based mixture in plastic seedling trays with one seedling per compartment. 

6. INSPECTION 

The inspection requirements for the operator of the facility are set out in the “MAF 

Biosecurity Authority Standard PBC-NZ-TRA-PQCON” (see: 

http://biosecurity.govt.nz/border/transitional-facilities/plants/pbc-nz-tra-pqcon.htm). 

Photographs of symptoms caused by significant regulated diseases can be found in 

Appendix 1 (Figures 11.1.1 to 01.1.61.1.8 and Figures 01.1.51.2.1 and 01.1.51.2.21.2.2). 

7. TESTING 

Each of the specific tests required in the import health standard (as described in section 4) 

must be done irrespective of whether plants exhibit symptoms (Table 1). 

Table 1. Summary of the regulated pests and diseases for Vaccinium indicating the 

specific tests that are required (■) or alternative (□). 

Organism Type 

‘Blueberry type’ Vaccinium species 

Bacteria 

TEM Herbaceous 

Indexing 

ELISA PCR 

Xylella fastidiosa 

Phytoplasmas 

■ 

Blueberry stunt phytoplasma ■ 

Cranberry false blossom phytoplasma ■ 

Vaccinium witches’ broom phytoplasma 

Viruses 

■ 

Blueberry leaf mottle virus ■ ■ ■ 

Blueberry red ringspot virus ■ ■ 

Blueberry scorch virus ■ ■ □ □ 

Blueberry shock virus ■ ■ □ □ 

Blueberry shoestring virus ■ ■ 

Peach rosette mosaic virus ■ ■ ■ 

Tobacco streak virus ■ ■ □ □ 

Tomato ringspot virus 

‘Cranberry type’ Vaccinium species 

Phytoplasmas 

■ ■ □ □ 

Cranberry false blossom phytoplasma 

Viruses 

■ 

Blueberry red ringspot virus (Cranberry 

ringspot disease) 

■ ■ 

Blueberry scorch virus ■ ■ □ □ 

Tobacco streak virus ■ ■ □ □ 


Selective 

Medium 

For each Vaccinium plant, two young fully expanded leaves must be sampled, one from 

each of two different branches of the main stem. The two leaves must be bulked and tested 

10

as soon as possible after removal from the host plant. If leaf samples have to be stored 

before testing, the leaves must be kept whole, all surface water must be removed, and they 

must be stored in a plastic bag at 4 o C for no more than 7 days. Samples that become 

partially decayed or mouldy must not be tested but further samples must be collected. 

Laboratory tests for viruses (ELISA, RT-PCR and electron microscopy) must be carried out 

in the spring using the new flush of spring growth. Laboratory tests for phytoplasma and 

bacteria must be carried out at the end of the summer. Herbaceous indexing of established 

Vaccinium plants must be carried out in spring/early summer using established Vaccinium 

plants alternatively, plants can be tested out of season if grown under simulated spring 

conditions. 

7.1 Specific tests for nursery stock 

Each plant must be tested separately with the following exceptions, samples from up to 5 

plants may be bulked for testing provided that either: 

(a) the plants were derived from a single imported dormant cutting which was split into 

separate cuttings upon arrival in New Zealand, in the presence of a MAF Quarantine 

Service Inspector; or 

(b) in the case of tissue culture where plants are clonal, and this is confirmed by evidence 

from the national plant protection organisation in the exporting country. 


7.1.1.1 Herbaceous indexing 

Two indicator plants each of Chenopodium quinoa, Nicotiana clevelandii and Nicotiana 

tabacum must be used in mechanical inoculation tests. 

It is important that the pre- and post-inoculation growing conditions of the herbaceous 

indicator plants promote their susceptibility. Indicator plants must be grown at 18-25 o C. 

The stage of development to inoculate the indicator plants are 4-6 fully expanded true 

leaves for Chenopodium quinoa and 4 fully expanded true leaves for Nicotiana spp. 

Recommended method 

1. Place indicator plants in the dark for 12-24 h prior to inoculation to increase 

susceptibility. 

2. Grind leaf tissue (approximately 1/4, w/v) in 0.1 M sodium phosphate buffer (pH 7.5), 

containing 5% (w/v) polyvinylpyrrolidone (PVP 40) and 0.12% (w/v) sodium sulphite 

(Na2SO3). A buffer only control and a positive control (a non-regulated virus which is 

moderately transmissible and produces clear symptoms on the herbaceous indicators e.g 

Arabis mosaic virus, Table 2) must be included in each batch of inoculations. The 

plants must be inoculated in the following order: 

(a) inoculation buffer only; then 

(b) imported plants to be tested; then 

(c) positive control (non-regulated virus). 

3. Select two young fully expanded leaves, preferably opposite leaves, to be inoculated on 

each plant and mark them by piercing holes with a pipette tip. 

4. Lightly dust the leaves with celite or carborundum powder (wear a mask or perform in a 

fume hood). Alternatively, a small amount of celite or carborundum powder may be 

mixed with the sap extract. 


11

5. Using a gloved finger gently apply the sap to the marked leaves of the indicator plants, 

stroking from the petiole towards the leaf tip while supporting the leaf below with the 

other hand. 

6. After 3-5 minutes rinse inoculated leaves with water. 

7. Maintain post-inoculated indicator species under appropriate glasshouse conditions for 

a minimum of 4 weeks and inspect twice a week for symptoms of virus infection. 


12

Table 2. Source of positive control non-regulated virus for use in herbaceous indexing 

Positive control 

(non-regulated virus) 

Virus genera Source of isolates 1 

Arabis mosaic virus 

1 

http://www.atcc.org/ 

Nepovirus ATCC: PV192 PV589 

Virus isolates may be available from alternative sources. 

Interpretation of results 

The herbaceous indexing results will only be considered valid if: 

(a) the positive control (non-regulated virus) produces the correct symptoms on the 

indicator hosts. 

(b) no symptoms are produced on the indicator hosts with the inoculation buffer 

negative control. 

The symptoms produced by Arabis mosaic virus on herbaceous indicators are as follows: 

C. quinoa - local lesions, systemic chlorotic mottling. 

N. clevelandii - local lesions, systemic spots, rings and lines. 

N. tabacum - local lesions, systemic spots, rings and lines. 

Test viruses 

Blueberry leaf mottle virus produces the following symptoms on herbaceous indicators: 

C. quinoa - chlorotic local lesions, mottling and epinasty of terminal leaves 

followed by death of the apex. 

N. clevelandii - systemic necrosis. 

Blueberry scorch virus produces the following symptoms on herbaceous indicators: 

C. quinoa - small chlorotic local lesions. 

Blueberry shock virus produces the following symptoms on herbaceous indicators: 

N. clevelandii - necrotic local lesions; systemic necrosis. 

N. tabacum - necrotic local lesions. 

Peach rosette mosaic virus produces the following symptoms on herbaceous indicators: 

C. quinoa - chlorotic local lesions, tip necrosis and epinasty. 

N. tabacum - chlorotic lesions, necrotic ringspots. 

Tobacco streak virus produces the following symptoms on herbaceous indicators: 

C. quinoa - chlorotic local lesions, systemic apical necrosis. 

N. tabacum - necrotic local spot or rings, systemic etched ring and line patterns. 

Leaves produced later are symptomless but contain virus. 

Tomato ringspot virus produces the following symptoms on herbaceous indicators: 

C. quinoa - chlorotic local lesions, systemic apical necrosis. 

N. tabacum - necrotic local spots or rings, systemic etched ring and line patterns. 

Leaves produced later are symptomless but contain virus. 


13

7.1.1.2 Transmission electron microscopy (TEM) 

A single electron microscopy grid must be prepared and examined for each Vaccinium 

plant. Note that a single grid can be used to examine plants for all regulated viruses listed as 

requiring this measure in the import health standard. 


1. Grind 0.25 g of leaf sample in 1 ml of 0.1 M phosphate buffer (pH 7.4) and place a drop 

of the homogenate onto a carbon-coated electron microscopy grid for 1-2 minutes. 

2. Wash approximately 30 drops of water over the grid. 

3. Stain the grid with 2% (w/v) potassium phosphotungstate (pH 7.0) by placing a drop of 

stain on the grid for 2-3 min or with 1% (w/v) uranyl acetate by washing 5-7 drops of 

stain over the grid. 

4. Remove the excess stain with filter paper and leave the grid to dry. 

5. Examine grids using a TEM for a minimum of 15 minutes per grid unless viral particles 

are observed sooner. 


The physical appearance of each virus is described below. 

Blueberry leaf mottle virus appears as isometric non-enveloped particles, angular in profile 

and around 28 nm in diameter without a conspicuous capsomere arrangement. 

Blueberry red ringspot virus appears as round non-enveloped capsids that exhibit 

icosahedral symmetry. The isometric capsids have a diameter of 42-46 nm. The capsid 

shells of virions are composed of multiple layers. The capsomer arrangement is not 

obvious. 

Blueberry scorch virus appears as non-enveloped capsids which are elongated and exhibit 

helical symmetry. The capsids are filamentous and straight with a length of 690 nm and a 

width of 14 nm. Axial canal is indistinct and the basic helix is obscure. 

Blueberry shock virus appears as round to elongated non-enveloped capsids with 

icosahedral symmetry. The capsids are isometric to quasi-isometric and have a diameter of 

27 nm. Capsids appear hexagonal in outline. Virus preparations contain more than one 

particle component. 

Blueberry shoestring virus appears as round non-enveloped capsids that exhibit icosahedral 

symmetry. The capsids are isometric and have a diameter of 27 nm. The capsomer 

arrangement is not obvious. 

Peach rosette mosaic virus appears as isometric particles that average 28 nm in size. 

Tobacco streak virus appears quasi-isometric or occasionally bacilliform. There are three 

major sizes: 27, 30 and 35 nm in diameter. Regularity in arrangement of subunits is not 

apparent in electron micrographs which show slightly distorted particles without hollow 

centres. 

Tomato ringspot virus particles are isometric, about 28 nm in diameter and angular in 

profile without a conspicuous capsomere arrangement. 


14

7.1.1.3 Serological and molecular assays 

ELISA MUST be carried out for the following pathogens: 

Blueberry leaf mottle virus 

Blueberry shoestring virus 

Peach rosette mosaic virus 

ELISA OR PCR MUST be carried out for the following pathogens: 

Blueberry scorch virus 

Blueberry shock virus 

Tobacco streak virus 

Tomato ringspot virus 

PCR MUST be carried out for the following pathogens: 

Blueberry red ringspot virus 

Blueberry stunt phytoplasma 


Vaccinium witches’ broom phytoplasma 

Xylella fastidioa 

7.1.1.3.1 Enzyme-linked immunosorbent assay (ELISA) 


1. Perform the ELISA according to the manufacturer’s instructions. The following 

controls must be included on each ELISA plate: 

(a) positive control: infected leaf tissue or equivalent (Table 3); and 

(b) negative control: blueberry leaf tissue that is known to be healthy; and 

(c) buffer control: extraction buffer only. 

2. Add each of the samples and controls to the ELISA plate as duplicate wells. 

3. Measure the optical density 60 minutes after addition of the substrate (or as per 

manufacturer’s instructions). 

Table 3: Source of antisera and positive controls for ELISA 

Pathogen Antisera 1 Positive control 

Blueberry leaf mottle virus Agdia Cat No. CAB40100/ECA88001 Agdia Cat No. LPC88001 

Blueberry scorch virus Agdia Cat No. CAB19100/ECA19100 Agdia Cat No. LPC19100 

Blueberry shock virus Agdia Cat No. CAB19200/ECA19200 Agdia Cat No. LPC19200 2 

Blueberry shoestring virus Agdia Cat No. CAB19000/ECA19000 Agdia Cat No. LPC19000 

Peach rosette mosaic virus Agdia Cat No. CAB87700/ECA87700 Agdia Cat No. LPC87700 

Tobacco streak virus Agdia Cat No. CAB25500/ECA25500 Agdia Cat No. LPC25500 

Tomato ringspot virus Agdia Cat No. CAB22000/ECA22000 Agdia Cat No. LPC22000 

Healthy blueberry leaf tissue N/A Agdia Cat No. NC88001 

1 Catalogue numbers are for capture (CAB) and detection (ECA) antisera. 

2 The Agdia Blueberry shock virus positive control is unsuitable for RT- PCR. 

The antisera listed have been tested by the Investigation and Diagnostic Centre – Tamaki, 

MAF Biosecurity New Zealand. Alternative antisera and positive controls are available 

from other manufacturers. 


15


A result is considered positive if the mean absorbance of the two replicate wells is greater 

than 2 times the mean absorbance of the negative control. The test will only be considered 

valid if: 

(a) the absorbance for the positive and negative controls are within the acceptable range 

specified by the manufacturer; and 

(b) the coefficient of variation (standard deviation / mean × 100), between the duplicate 

wells is less than 20%. 

If the test is invalid, it must be repeated with freshly-extracted sample. Samples that are 

close to the cut-off must be retested at a later time. 


16

7.1.1.3.2 Polymerase chain reaction (PCR) 

PCR primers used to detect viruses, bacteria and phytoplasmas of Vaccinium are listed in 

Table 3 along with internal control primers. The inclusion of an internal control assay is 

recommended to eliminate the possibility of PCR false negatives due to extraction failure, 

nucleic acid degradation or the presence of PCR inhibitors. 

Table 4: PCR primers used for the detection of regulated diseases of Vaccinium spp. 

Target 

organism 

Bacteria 

Xylella 

fastidiosa 

Phytoplasmas 

Universal 

phytoplasmas 

Primer 

name 

XF-F 

XF-R 

XF-P 2 

P1 

P7 

R16F2 

R16R2 

Phyto-F 

Phyto-R 

Phyto-P 2 

Viruses 

BRRV 1 RRSV3 

RRSV4 

BlScV Agdia 

Carlavirus 

primer 

mix 

BlShV, TSV Agdia 

Ilarvirus 

primer 

mix 

ToRSV U1 

D1 

Plant control 

Plant DNA 

control 

Plant RNA 

control 

Plant DNA 

control 

Gd1 

Berg54 

Nad5-s 

Nad5-as 

COX-F 

COX-R 

COX- P 2 


Sequence (5´-3´) Tm 

ºC 

CACGGCTGGTAACGGAAGA 

GGGTTGCGTGGTGAAATCAAG 

FAM-CGCATCCCGTGGCTCAGCC-NFQ 3 

AAGAGTTTGATCCTGGCTCAGGATT 

CGTCCTTCATCGGCTCTT 

ACGACTGCTAAGACTGG 

TGACGGGCGGTGTGTACAAACCCCG 

CGTACGCAAGTATGAAACTTAAAGGA 

TCTTCGAATTAAACAACATGATCCA 

FAM-TGACGGGACTCCGCACAAGCG-NFQ3 

ATCAGTCCCAGAAGAAAAGAAGTATCCGA 

AAAATAGATAGTGTCAGC 

Sequence unavailable 

Sequence unavailable 

GACGAAGTTATCAATGGCAGC 

TCCGTCCAATCACGCGAATA 

ACGGAGAGTTTGATCCTG 

AAAGGAGGTGATCCAGCCGCACCTTC 

GATGCTTCTTGGGGCTTCTTGTT 

CTCCAGTCACCAACATTGGCATAA 

CGTCGCATTCCAGATTATCCA 

CAACTACGGATATATAAGAGCCAAAACTG 

FAM-TGCTTACGCTGGATGGAATGCCCT- 

FQ 3 

N= 

Band 

Size 

(bp) 

Reference 

62 70 Harper & Ward, 

2010 (Unpub) 

53 1800 Deng & Hiruki 

(1991); 

Schneider et al. 

(1995) 

50 1248 Schneider et al., 

1995; Lee et al., 

1995 

60 75 Christensen et 

al., 2004 

57 594 Polashock & 

Ehlenfeldt 

52 250- 

300 

52 440- 

500 

1 BRRV is a dsDNA Caulimovirus; 2 Real-time probe; 3 NFQ= Non-fluorescent quencher. 

(2009) 

Agdia Cat no. 

PCR93000/0025 

Agdia Cat no. 

PCR96100/0025 

55 449 Griesbach (1995) 

55 1500 Andersen et al. 

(1998) 

50- 

60 

180 Menzel et al. 

(2002) 

60 74 Weller et al., 

2000 

17

7.1.1.3.2.1 Virus reverse-transcription PCR (RT-PCR) 

Recommended method for RNA viruses 

1. Extract total RNA from leaf tissue according to a standard protocol. Successful RT- 

PCR amplification can be achieved using the following RNA extraction procedures: 

(a) RNeasy ® Plant Mini Kit (Qiagen Cat. No. 74904); or 

(b) Silica-based method as described by Menzel et al. (2002) (see Appendix 3 for 

details of the extraction method). 

Alternative methods may also be used after validation. 

2. Perform a cDNA synthesis step by combining the purified RNA, RNasinPlus (optional) 

and random hexamer primers as listed in Table 5, heat mixture at 70ºC for 10 min, 

briefly centrifuge and incubate at room temperature for 15 min. Add this denatured 

RNA mix to the reverse transcription reaction mix (Table 6), mix well and incubate at 

42ºC for 1 hour. 

3. Optional: Perform a PCR on the cDNA from step 2 with the Nad5 internal control 

primers (Menzel et al., 2002) using the components and concentrations listed in Table 7 

and cycled under the conditions listed in Table 8. The Nad5 primers amplify mRNA 

from plant mitochondria which therefore eliminates the possibility of false negatives 

due to RNA degradation or the presence of inhibitors. 

4. Perform a PCR on cDNA from step 2 using the pathogen-specific primers (Table 4) and 

using the components and concentrations listed in Table 7 and cycled under the 

conditions listed in Table 8. The following controls must be included for each set of 

RT-PCR reactions: 

(a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and 

(b) no template control: water is added instead of RNA template. 

When setting up the test initially, it is advised that a negative control (RNA extracted 

from healthy Vaccinium leaf tissue) is included. 

Please note that the Nad5 internal control primers do not reliably amplify a product 

from RNA extracted from freeze-dried material. We therefore recommend mixing fresh 

healthy leaf material with freeze-dried positive control material (3:1 w/w) prior to 

carrying out the extraction. 

5. Analyse the PCR products by agarose gel electrophoresis. 

Recommended method for DNA viruses 

1. Extract total DNA (for BRRV) from leaf tissue according to a standard protocol. 

Successful PCR amplification can be achieved using the Qiagen DNeasy ® Plant Mini 

Kit (Qiagen Cat. No. 69104). Alternative methods may also be used after proper 

validation. 

2. Optional: Perform a PCR on the DNA with the Gd1/Berg54 internal control primers 

(Table 3) using the components and concentrations listed in Table 7 and cycle under the 

conditions listed in Table 8. (The Gd1/Berg54 primers amplify the 16S rRNA gene 

from most prokaryotes as well as from chloroplasts which therefore eliminates the 

possibility of false negatives due to DNA degradation or the presence of inhibitors). 

3. Perform a PCR on the DNA with the pathogen-specific primers (Table 4) using the 

components and concentrations listed in Table 7 and cycle under the conditions listed in 

Table 8. The following controls must be included for each set of PCR reactions: 

(a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and 

(b) no template control: water is added instead of DNA template. 

When setting up the test initially, it is advised that a negative control (DNA extracted 


4. Analyse the PCR products by agarose gel electrophoresis. 


18

Table 5: RNA denaturation mix 

Reagent* Volume per reaction (µl) 

RNA template 2.0 

Nuclease-free water 2.7 

5 × First-Strand Buffer (Invitrogen) 2.0 

40 U/µl RNasinPlus (Promega N261A) 1.0 

0.5 ng/µl Random hexamer primers (Invitrogen 48190-011) 0.3 

Total 8.0 

*Alternative reagents may give similar results but will require validation. 

Table 6: Reverse transcription reaction mix 


0.1 M DTT (included with the SuperScriptII Reverse Transcriptase) 2.0 

40 U/µl RNAsinPlus (Promega N261A) 0.5 

10 mM dNTPs (Promega U151B) 1.0 

200 U/µl SuperScriptII Reverse Transcriptase (Invitrogen 18064-014) 0.5 

Total 4.0 


Table 7: Generic PCR reaction components 


Sterile H2O 12.8 

10 × PCR buffer (Invitrogen) 2.0 

50 mM MgCl2 

0.6 

10 mM dNTPs (Promega U151B) 0.4 

5 µM Forward primer 1.0 

5 µM Reverse primer 1.0 

5 U/µl Platinum Taq DNA polymerase (Invitrogen 10966-026) 0.2 

cDNA template 2.0 

Total 20.0 


Table 8: Generic cycling conditions for PCR reaction 

Step Temperature Time No. of cycles 

Initial denaturation 94 o C 2 min 1 

Denaturation 94 o C 30 s 

Annealing See Table 3 30 s 

Elongation 72 o 35 

C 45 s 

Final elongation 72 o C 5 min 1 


The RT-PCR test will only be considered valid if: 

(a) the positive control produces the correct size product as indicated in Table 4; and 

(b) no bands are produced in the negative control (if used) and in the no template; and 

(c) a 181 bp band is produced in the positive control and each of the test samples if the 

Nad5 internal control primers are used. 


19

Failure of the samples to amplify with the internal control primers suggests that the RNA 

extraction has failed or compounds inhibitory to PCR are present in the RNA extract or the 

RNA has degraded. 

Virus positive controls for PCR 

Virus positive controls may be obtained from the commercial sources listed in Table 3. All 

other positive control material (in the form of RNA and DNA or cDNA clones) may be 

obtained from the Investigation and Diagnostic Centre – Tamaki, MAF Biosecurity New 

Zealand (see the Contact Point, section 8). A charge may be imposed to recover costs. 

7.1.1.3.2.1.1 Blueberry red ringspot virus (BRRV) 

Plants must be tested for BRRV by PCR using the primers listed in Table 4. See section 

7.1.1.3.2.1 

7.1.1.3.2.1.2 Blueberry scorch virus (BlScV) 

Plants can be tested for BlScV by RT-PCR using the Agdia Carlavirus primer mix (Table 

4). The PCR reaction must be set-up as shown in Table 9 and cycled under the reaction 

conditions shown in Table 10. 

Table 9. PCR mix for Agdia Carlavirus primer mix 

PCR Reagent Volume per reaction (µl) 

Water 10.6 

10 X PCR buffer A 2.0 

MgCl2 (50 mM) 0.6 

dNTPs (10 mM) 0.4 

Agdia primer mix 4.0 

Taq Polymerase (5 units/µl) 0.4 

cDNA 2.0 

Total 20.0 

Table 10. Carlavirus primer cycling 

Step Temperature Time No. of Cycles 


Denaturation 94 o C 1 min 

Annealing 52ºC 4 min 


C 4 min 


7.1.1.3.2.1.3 Blueberry shock virus (BlShV) 

The Agdia Ilarvirus RT-PCR should detect BlShV, however, it has not been possible to 

validate the test because no suitable positive control is commercially available (the Agdia 

ELISA positive control is unsuitable for PCR). 

7.1.1.3.2.1.4 Tobacco streak virus (TSV) 

Plants can be tested for TSV by RT-PCR using the Agdia Ilarvirus primer mix (Table 4). 

The PCR reaction must be set-up as shown in Table 11 and cycled under the reaction 

conditions shown in Table 12. 


20

Table 11. PCR mix for Agdia Ilavirus primer mix 

PCR Reagent Volume per reaction ( µl) 

Water 10.0 

10 X PCR buffer A 2.0 

MgCl2 (25 mM) 1.2 

dNTPs (10 mM) 0.4 

Agdia primer mix 4.0 

Taq Polymerase (5 units/µl) 0.4 

cDNA 2.0 

Total 20.0 

Table 12. Ilarvirus primer cycling 

Step Temperature Time No. of Cycles 


Denaturation 94 o C 1 min 

Annealing 52ºC 2 min 


C 3 min 


7.1.1.3.2.1.5 Tomato ringspot virus (ToRSV) 

Plants can be tested for ToRSV by RT-PCR using the Griesbach (1995) primers (Table 4). 

The PCR reaction must be set-up as shown in Table 7 (section 7.1.1.3.2.1) and cycled under 

reaction conditions shown in Table 8 (section 7.1.1.3.2.1). 

7.1.1.3.2.2 Phytoplasma and Bacteria PCR 

Recommended method for conventional PCR for phytoplasma 

1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol. 

Successful PCR amplification can be achieved using the following DNA extraction 

procedures: 

(a) DNeasy ® Plant Mini Kit (Qiagen Cat. No. 69104); or 

(b) a phytoplasma enrichment procedure as described by Kirkpatrick et al. (1987) and 

modified by Ahrens & Seemüller (1992). 

See Appendix 3 for details of these extraction methods. Alternative methods may also 

be used after validation. 

2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers (Table 4) using 

the components and concentrations listed in Table 7 and cycle under the conditions 

listed in Table 8. The Gd1/Berg54 primers amplify the 16S rRNA gene from most 

prokaryotes as well as from chloroplasts. 

3. Perform a nested PCR on the purified DNA using the universal phytoplasma primer 

pair, P1/P7 (Table 4), for first-stage PCR followed by the R16F2/R16R2 primer pair for 

the second-stage PCR (Table 4). 

4. Set up the first-stage and second-stage PCR reactions using the components and 

concentrations listed in Table 7 and cycle under the conditions listed in Table 8. The 

first-stage PCR products, including the controls, are diluted 1:25 (v/v) in water and 2 µl 

used as template in the second-stage PCR. The following controls must be included for 

each set of PCR reactions: 

(a) positive control: healthy Vaccinium DNA mixed with DNA from any phytoplasma; 

and 


21

(b) no template control: water is added instead of DNA template. An additional no 

template control is included in the second-stage PCR. 

When setting up the test initially, it is advised that a negative control (DNA extracted 


5. Analyse the PCR products (second-stage PCR products only) by agarose gel 

electrophoresis. 

Interpretation of results for conventional PCR 

The pathogen-specific PCR test will only be considered valid if: 

(c) the positive control produces the correct size product as indicated in Table 3; and 

(d) no bands are produced in the negative control (if used) and the no template control. 

If the Gd1/Berg54 internal control primers are also used, then the negative control (if used), 

positive control and each of the test samples must produce a 1,500 bp band. Failure of the 

samples to amplify with the control primers suggests that the DNA extraction has failed, 

compounds inhibitory to PCR are present in the DNA extract or the DNA has degraded. 

The effect of inhibitors may be overcome by adding Bovine Albumin Serum (BSA) to a 

final concentration of 0.5 µg/µl. Alternatively, the DNA may be further purified using 

MicroSpin S-300 HR columns (GE Healthcare Cat. No. 27-5130-01). 

Recommended method for real-time PCR for phytoplasma and bacteria 

1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol (as 

described above). 

2. Set-up the PCR using pathogen-specific primers (Table 4) and the components and 

concentrations listed in Table 13 and cycle under the conditions listed in Table 14. 

Please note that reaction and cycling conditions can be changed depending on the realtime 

machine used, but this would require validation. 

3. Optional: Perform PCR on the nucleic acid using the COX internal control primers 

(Table 4), and using the components and concentrations listed in Table 13 and cycle 

under the conditions listed in Table 14. 

4. The following controls must be included for each set of reactions: 

(a) Positive control: for phytoplasma and bacteria, total DNA or a cloned fragment 

from the appropriate organism may also be used. If the internal control primers are 

not used, then the DNA must be mixed with healthy Vaccinium DNA to rule out 

the presence of PCR inhibitors; and 

(b) no template control: water is added instead of DNA template 

5. When setting up the test initially, it is advised that a negative control (DNA extracted 


6. Analyse real-time amplification data according to the real-time thermocycler 

manufacturer’s instructions. 

Interpretation of results for real-time PCR 

The real-time PCR test will only be considered valid if: 

(a) the positive control produces an amplification curve with the pathogen-specific 

primers; and 

(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the 

negative control (if used) and the no template control. 

If the COX internal control primers are also used, then the negative control (if used), 

positive control and each of the test samples must produce an amplification curve. Failure 

of the samples to produce an amplification plot with the internal control primers suggests 

that the DNA extraction has failed or compounds inhibitory to PCR are present in the DNA 

extract or the DNA has degraded. 


22

Table 13: Generic real-time PCR for DNA templates using Roche LightCycler 480 

Probes Mastermix 

Reagent Volume per reaction (µl) 

Sterile H20 4.3 

2 x Reaction Mix (Roche 04707494001) 10.0 

10 µg/µl Bovine Albumin Serum (BSA) (Sigma A7888) 0.8 

5 µM Forward primer 1.2 

5 µM Reverse primer 1.2 

5 µM Dual-labelled fluorogenic probe 0.5 

DNA 2.0 

Total 20.0 

Table 14: Generic cycling conditions for real-time PCR 

Step Temperature Time No. of cycles 


Denaturation 95 o C 10 sec 

Annealing See Table 3 45 sec 

40 

Phytoplasma and bacterial positive controls for PCR 

1. Xylella fastidiosa; ICMP No. 6575, 6576, 8729-8745, 8693, 8694 may be obtained from 

the Landcare Research International Collection of Micro-organisms from Plants 

(ICMP); http://www.landcareresearch.co.nz/research/.asp). 

2. Positive control DNA for Xylella fastidiosa and Phytoplasma may be obtained from the 

Investigation and Diagnostic Centre – Tamaki, MAF Biosecurity New Zealand (see the 

Contact Point, section 8). A charge may be imposed to recover costs. 

7.1.1.3.2.2.1 Blueberry stunt phytoplasma 

Plants must be tested for blueberry stunt phytoplasma by nested PCR or real-time PCR 

using the universal primers listed in Table 4. 7.1.1.3.2.2 for details of test methods and 

interpretation of results. 

7.1.1.3.2.2.2 Cranberry false blossom phytoplasma 

Plants must be tested for cranberry false blossom phytoplasma by nested PCR or real-time 

PCR using the universal primers listed in Table 4. 7.1.1.3.2.2 for details of test methods and 


7.1.1.3.2.2.3 Vaccinium witches’ broom phytoplasma 

Plants must be tested for Vaccinium witches’ broom phytoplasma by nested PCR or realtime 

PCR using the universal primers listed in Table 4. 7.1.1.3.2.2 for details of test 

methods and interpretation of results. 

7.1.1.3.2.2.4 Xylella fastidiosa 

Plants must be tested for by Xylella fastidiosa by conventional PCR or real-time PCR using 

the primer pair listed in Table 4. See section 7.1.1.3.2.2 for details of test methods and 



23


7.1.2.1 Herbaceous indexing 

See section .5..13111367.1.1.1 for details of test methods and interpretation of results. 

7.1.2.2 Transmission electron microscopy (TEM) 

See section 7.1.1.2 for details of test methods and interpretation of results. 

7.1.2.3 Serological and molecular assays 

ELISA OR PCR MUST be carried out for the following pathogens: 

Blueberry scorch virus 

Tobacco streak virus 

PCR MUST be carried out for the following pathogens: 

Blueberry red ringspot virus (Cranberry ringspot disease) 


7.1.2.3.1 Enzyme-linked immunosorbent assay (ELISA) 

See section 0.5..13111367.1.1.3.1 for details of test methods and interpretation of results. 

7.1.2.3.2 Polymerase chain reaction (PCR) 

See section 0.57.1.1.3.2 and Table 3 for details of primer sequences used for PCR. 

7.1.2.3.2.1 Virus reverse-transcription PCR (RT-PCR) 

See section 7.1.1.3.2.1 for details of test methods and interpretation of results. 

7.1.2.3.2.1.1 Blueberry red ringspot virus (Cranberry ringspot disease) 

See section 7.1.1.3.2.1.1 for details of test methods and interpretation of results. 

7.1.2.3.2.1.2 Blueberry scorch virus 


7.1.2.3.2.1.3 Tobacco streak virus 


7.1.2.3.2.2 Phytoplasma and bacteria PCR 

See section 7.1.1.3.2.2 for details of test methods and interpretation of results. 


24

7.2 Specific tests for seed for sowing 

Tests are to be carried out on plants germinated from imported seeds. Samples from up to 5 

plants may be bulked for testing provided that the plants were derived from the same 

mother plant and this is confirmed by evidence from the national plant protection 

organisation in the exporting country. Seed imported for sowing must be tested for the 

following pathogens: 

7.2.1 All Vaccinium species (‘Blueberry and Cranberry type’) 

Blueberry leaf mottle virus (BLMV) 

Blueberry shock virus (BlShV) 

Peach rosette mosaic virus (PRMV) 

Tomato ringspot virus (ToRSV) (strains not in New Zealand) 

See Table 1 for the required or alternative tests for these pathogens and the relevant 

sections for details of the test methods and interpretation of results. 

Note: The current import requirements for seed of all Vaccinium species are the same. 

MAF Biosecurity New Zealand (Pre Clearance) are considering reviewing whether these 

tests should be required for Vaccinium macrocarpon. 

8. CONTACT POINT 

This protocol was developed by: 

Dr Lisa Ward 

Plant Health & Environment Laboratory – IDC 

MAF Biosecurity New Zealand 

231 Morrin Road 

St Johns 

PO Box 2095 

Auckland 1140 

New Zealand 

Tel: +64 9 909 3015 

Fax: +64 9 909 5739 

Email: peqtesting@maf.govt.nz 

Website: http://www.biosecurity.govt.nz/imports/plants/standards/high-value-crops 

9. ACKNOWLEDGEMENTS 

We would like to acknowledge the following people who contributed to the preparation of 

this manual: 

Dr James Polashock (United States Department of Agriculture, Agriculture Research 

Service [USDA-ARS], Fruit laboratory, Beltsville, Maryland, USA), for providing 

DNA, freeze-dried infected phytoplasma material and for valuable discussions. 

Dr Assunta Bertaccini (DiSTA, Patologia vegetale, University of Bologna) for 

providing phytoplasma DNA. 

Dr Bob Martin (USDA-ARS, Corvallis, Oregon, USA) for valuable discussions. 


25

Ms Shirley Miller, (HortResearch Ltd., Palmerston North, New Zealand), for providing 

Vaccinium propagation information and the front cover image. 

The American Phytopathological Society (APS) for permission to use images from the 

Diseases of Small Fruits CD-Rom, 2000, St Paul, MN, USA. 

10. REFERENCES 

Ahrens, U; Seemüller, E (1992) Detection of DNA of plant pathogenic mycoplasma-like 

organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene. 

Phytopathology 82: 828-832. 

Andersen, M T; Beever, R E; Gilman, A C; Liefting, L W; Balmori, E; Beck, P W; 

Sutherland, G T; Bryan, G T; Gardner, R C; Forster R L S (1998) Detection of phormium 

yellow leaf phytoplasma in New Zealand flax (Phormium tenax) using nested PCR. Plant 

Pathology 47: 188-196. 

Bereswill, S; Bugert, P; Vőlksch, B; Ullrich, M; Bender, C L; Geider, K (1994) 

Identification and relatedness of coronatine-producing Pseudomonas syringae pathovars by 

PCR analysis and sequence determination of the amplification products. Applied and 

Environmental Microbiology 60: 2924-2930. 

Christensen, N M; Nicolaisen, M; Hansen, M; Schulz, A (2004) Distribution of 

phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Molecular 

Plant Microbe Interactions 17: 1175-1184. 

Deng, S; Hiruki, D (1991) Amplification of 16S rRNA genes from culturable and 

nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61. 

Griesbach, R A (1995) Detection of Tomato ringspot virus by polymerase chain reaction. 

Plant Disease 79: 1054-1056. 

Harper, S J; Ward, L I; Clover, G R G (2010) Development of LAMP and real-time PCR 

methods for the rapid detection of Xylella fastidiosa for quarantine and field applications 

(Unpublished). 

Kirkpatrick, B C; Stenger, D C; Morris, T J; Purcell, A H (1987) Cloning and detection of 

DNA from a nonculturable plant pathogenic mycoplasma-like organism. Science 238: 197- 

200. 

Lee, I M; Bertaccini, A; Vibio, M; Gundersen, D E (1995) Detection of multiple 

phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 85: 

728-735. 

Luby, J J; Ballington J R; Draper A D; Pliszka K; Austin E (1990). Blueberries and 

cranberries: Chapter 8. p. 393-456. In: J N Moore, and J R Ballington (eds.), Genetic 

resources of temperate fruit and nut crops 1: Acta Horticulturae 290. International Society 

for Horticultural Science, Wageningen, The Netherlands 

Lyrene, P M (1997) Value of various taxa in breeding tetraploid blueberries in Florida. 

Euphytica 94:15-22. 


26

Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four blueberry viruses by multiplex 

RT-PCR assays with coamplification of plant mRNA as internal control. Journal of 

Virological Methods 99: 81-92. 

Patel, N; Broom, F D & Miller, S A (2002) Cranberries – A crop for New Zealand. 

Acta Horticulture 574 ISHS: 107-111. 

Polashock J J; Ehlenfeldt M K (2009) Molecular detection and discrimination of Bluberry 

red ringspot virus strains causing disease in cultivated blueberry and cranberry. Plant 

Disease 97: 727-733. 

Schneider, B; Seemüller, E; Smart, C D; Kirkpatrick, B C (1995) Phylogenetic 

classification of plant pathogenic mycoplasma-like organisms or phytoplasmas. In Razin, S 

& Tully, J G (eds) Molecular and diagnostic procedures in mycoplasmology, Vol. 1. 

Academic Press, San Diego, CA; p. 369-380. 

Stanier, R Y; Palleroni, N J; Doudoroff, M (1966). The aerobic pseudomonads: a 

taxonomic study. Journal of General Microbiology 43:159-271. 

Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N; Stead, D E (2000) Detection of 

Ralstonia solanacearum strains with a quantitative multiplex real-time, fluorogenic PCR 

(TaqMan) assay. Applied and Environmental Microbiology 66: 2853-2858. 


27

Appendix 1. Symptoms of significant regulated diseases in Vaccinium 

1.1 ‘Blueberry type’ Vaccinium species 

1.1.1 Blueberry leaf mottle virus 1.1.2 Blueberry red ringspot virus 

Leaves of a Highbush blueberry infected 

with BLMV showing mottling and 

necrosis. 

(Courtesy D.C. Ramsell reproduced from the Diseases 

of Small Fruits CD-ROM, 2000, APS, St Paul, MN, 

USA) 

Red ring spots on the stem of a year-old 

Highbush blueberry infected with BRRV. 

(Courtesy D.C. Ramsell, reproduced from the Diseases 


USA) 

1.1.3 Blueberry scorch virus 1.1.4 Blueberry shock virus 

A Highbush blueberry leaf with line 

patterns typical of infection with BlScV. 

(Courtesy APS reproduced from the Diseases of Small 

Fruits CD-ROM, 2000, APS, St Paul, MN, USA) 


A Highbush blueberry with leaf redding 

and chlorosis caused by infection with 

BlShV. 

(Courtesy P.R. Bristow, reproduced, with permission, 

from the Diseases of Small Fruits CD-ROM, 2000, 

APS, St Paul, MN, USA) 

28

1.1.5 Blueberry shoe string virus 1.1.6 Peach rosette mosaic virus 

A Highbush blueberry with red-streak 

symptoms on the stem caused by BBSSV. 

(Courtesy D.C. Ramsdell, reproduced from the Diseases 


USA) 

1.1.7 Tomato ringspot mosaic virus 

Shoots of a Highbush blueberry infected 

with ToRSV, showing chlorotic and 

necrotic leaf and stem lesions. 

(Courtesy R.H. Converse, reproduced, with permission, 

from the Diseases of Small Fruits CD-ROM, 2000, 

APS, St Paul, MN, USA) 


A Highbush blueberry with leaf distortion 

caused by PRMV. 



USA) 

1.1.8 Blueberry stunt phytoplasma 

A Highbush blueberry with stunt disease 

(right) shown next to a healthy Highbush 

blueberry shrub (left). 



USA) 

29

1.2 ‘Cranberry type’ Vaccinium species 

1.2.1 Cranberry ringspot disease 

Cranberry leaves with symptoms of 

ringspot disease (the putative causal agent 

is Blueberry red ringspot virus). 

(Courtesy P. R. Bristow, reproduced, with permission, 

from the Diseases of small fruits CD-ROM, 2000, APS, 

St Paul, MN, USA) 


1.2.2 Cranberry false blossom 

phytoplasma 

Witches’ broom effect seen on cranberry 

leaves (right) associated with false 

blossom disease. (shown next to healthy 

cranberry leaves [left]). 

(Courtesy D.M. Boone, reproduced, with permission, 



30

Appendix 2. Symptoms of nutrient deficiencies in Vaccinium 

2.1 Nitrogen deficiency (blueberry) 

Chlorosis and reddening of leaves in a 

Lowbush blueberry due to nitrogen 

deficiency. 

(Courtesy W.J. Kender, reproduced, with permission, 



2.3 Potassium deficiency (blueberry) 

Lowbush blueberry leaves with marginal 

scorching and chlorosis due to potassium 

deficiency. 

(Courtesy W.J. Kender, reproduced, with permission, 




2.2 Phosphorus deficiency (blueberry) 

Dark green and purple colouration of 

Highbush blueberry leaves due to 

phosphorus deficiency. 

(Courtesy H.J. Amling, reproduced, with permission, 



2.4 Nitrogen deficiency (cranberry) 

Reduced growth, abnormal reddening of 

stem, leaves and leaf margins caused by 

nitrogen deficiency. Phosphorus and 

potassium deficiency cause similar leaf 

symptoms. 

(Courtesy L.A. Peterson, reproduced, with permission, 



31

Appendix 3. Protocols referenced in manual 

3.1 Silica-milk RNA extraction protocol (Menzel et al., 2002) 

1. Grind 0.2-0.5 g leaf tissue (1/10; w/v) in RNA extraction buffer (6 M guanidine 

hydrochloride, 0.2 M sodium acetate, 25 mM EDTA, 2.5% [w/v] PVP-40 adjusted 

to pH 5 with acetic acid). 

2. Transfer 500 µl of the homogenised extract to a micro-centrifuge tube containing 

100 µl of 10% (w/v) SDS. 

3. Incubate at 70 o C for 10 minutes with intermittent shaking, and then place on ice for 

5 minutes. 

4. Centrifuge at 13,000 rpm for 10 minutes. 

5. Transfer 300 µl supernatant to a new micro-centrifuge tube and add 300 µl high salt 

buffer (6 M sodium iodide, 0.15 M sodium sulphite), 150 µl absolute ethanol and 25 

µl silica milk (1 g/ml silicon dioxide, 1-5 µM size particles, suspended in 100 mM 

glycine, 100 mM NaCl, 100 mM HCl, pH 2). 

6. Incubate at room temperature for 10 minutes with intermittent shaking. 

7. Centrifuge at 3,000 rpm for 1 minute and discard the supernatant. 

8. Resuspend the pellet in 500 µl of wash buffer (10 mM Tris-HCl pH 7.5, 0.05 mM 

EDTA, 50 mM NaCl, 50% [v/v] absolute ethanol), centrifuge at 3,000 rpm for 1 

minute and discard the supernatant. Repeat this wash step. 

9. Centrifuge at 3,000 rpm for 1 minute and remove any remaining wash buffer from 

the pellet. 

10. Resuspend the pellet in TE buffer (10mM Tris-HCl pH 7.5, 0.05 mM EDTA). 

11. Incubate at 70 o C for 4 minutes then centrifuge at 13,000 rpm for 5 minutes. 

12. Transfer 100 µl of the supernatant to a sterile nuclease-free micro-centrifuge tube, 

being careful not to disturb the pellet. Store at -80 o C. 

3.2 Phytoplasma DNA enrichment CTAB extraction protocol (Kirkpatrick et al., 

1987and modified by Ahrens & Seemüller, 1992) 

1. Grind approximately 0.3 g tissue (petioles, veins) in 3 ml ice-cold Isolation buffer 

(0.1 M Na2HPO4, 0.03 M NaH2PO4, 10 mM EDTA (pH 8.0), 10% (w/v) sucrose, 

2% (w/v) PVP-40; Adjust pH to 7.6 and filter sterilise. Just prior to use add 0.15% 

(w/v) Bovine Serum Albumin (BSA) and 1 mM ascorbic acid). 

2. Transfer crude sap to a cold 2 ml micro-centrifuge tube. 

3. Centrifuge at 4ºC for 5 min at 4500 rpm. 

4. Transfer supernatant into a clean 2 ml micro-centrifuge tube. 

5. Centrifuge at 4ºC for 15 min at 13000 rpm. 

6. Discard the supernatant. 

7. Resuspend the pellet in 750 µl of hot (55º C) CTAB buffer (2% (w/v) CTAB, 100 

mM Tris-HCl [pH 8.0], 20 mM EDTA [pH 8.0], 1.4 M NaCl, 1% (w/v) PVP-40). 

The pellet is easier to resuspend in a smaller volume of CTAB buffer (e.g. 100 µl) 

then the remaining volume of CTAB buffer is added (e.g. 650 µl). 

8. Incubate tubes at 55 ºC for 30 min with intermittent shaking. 

9. Cool the tubes on ice for 30 sec. 

10. Add 750 µl chloroform:octanol (24:1 v/v) and vortex thoroughly. 

11. Centrifuge at 4ºC or at room temperature for 4 min at 13000 rpm. 

12. Carefully remove upper aqueous layer into a clean 1.5 ml micro-centrifuge tube. 

13. Add 1 volume ice-cold isopropanol and vortex thoroughly. 

14. Incubate on ice for 4 min. 


32

15. Centrifuge at 4ºC or at room temperature for 10 min at 13000 rpm. 

16. Discard supernatant. 

17. Wash DNA pellets with 500 µl ice-cold 70% (v/v) ethanol, centrifuge at 4 o C or at 

room temperature for 10 min at 13000 rpm. 

18. Dry DNA pellets in the DNA concentrator or air-dry. 

19. Resuspend in 20 µl sterile distilled water. Incubating the tubes at 55 o C for 10 min 

can aid DNA resuspension. 

20. Store DNA at -20ºC for short time storage or -80ºC for longer time storage. 


33

Vaccinium (Blueberry & Cranberry) Post-Entry Quarantine Testing ...

Create successful ePaper yourself

Delete template?

Save as template?