Proceedings of the 4th Canadian Barley Symposium

18 th North American
Barley Researchers
Workshop
and
4 th Canadian Barley
Symposium
July 17-20, 2005
Red Deer, Alberta

Proceedings
of the
18 th Triennial
North American Barley Researchers Workshop
and
4 th Canadian Barley Symposium
July 17–20, 2005
Capri Hotel and Convention Centre
Red Deer, Alberta, Canada

Contents
Sponsors ........................................................................................................................................... 1
Hosts .................................................................................................................................................. 7
NABRW Website ............................................................................................................................... 7
Organizing Committee ..................................................................................................................... 8
Agenda............................................................................................................................................... 9
Monday, July 18, 2005 – a.m.
Session 1 - FEED AND FOOD QUALITY ....................................................................................... 15
Expanding opportunties for barley food and feed through product innovation
L. Malcolmson, R. Newkirk and G. Carson...........................................................................................................16
Validation of an in vitro analysis to determine energy digestibility of barley for grower pigs
R.T. Zijlstra, W.C. Sauer, J.H. Helm, D.N. Overend, R.W. Newkirk....................................................................18
Beta-glucan depleted barley and oat flours as animal feed
Ian R. Johnson, Doug R. Korver, Thava Vasanthan and Feral Temelli .................................................................19
Improvement of barley-based food product color
B.-K. Baik , Z. Quinde, and S. E. Ullrich ..............................................................................................................24
Food barley development at the Crop Development Centre, University of Saskatchewan
B.G.Rossnagel, T. Zatorski and G. Arganosa........................................................................................................29
Posters
Breeding for malt and feed quality barley in northern Australia
Glen Fox, Jan Bowman, Karyn Onley-Watson, Andrew Skerman, Gary Bloustein, Alison Kelly,
Andy Inkerman, David Poulsen and Robert Henry................................................................................................33
Milling energy and grain hardness in barley
G. A. Camm and B.G. Rossnagel ..........................................................................................................................34
Low phytate barley (Hordeum vulgare L.) development at the Crop Development Centre,
University of Saskatchewan
B.G. Rossnagel, T. Zatorski, G. Arganosaand V. Raboy.......................................................................................35
Post-anthesis biomass yield and quality of barley cultivars developed by Field Crop
Development Centre
Nyachiro, J.M., J.H. Helm and P.E. Juskiw...........................................................................................................36
Process development for quick cooking barley products
Hong Qi; Connie Phillips; M. Eliason; Karen Erin and Feral Temelli ..................................................................37
Monday, July 18, 2005 – p.m.
Session 2 - PATHOLOGY AND ENTOMOLOGY........................................................................... 38
International germplasm development for multiple disease resistance
Flavio Capettini, Stefania Grando, Salvatore Ceccarelli, Amor Yahyaoui............................................................39
Differential response of barley cultivars and accessions to Rhynchosporium secalis under field
conditions
Turkington, T.K., and Xi, K...................................................................................................................................50

Mapping genes for Russian wheat aphid resistance in barley
Shipra Mittal, Lynn Dahleen and Dolores Mornhinweg........................................................................................55
Sequence tagged site markers linked to Septoria speckled leaf blotch resistance genes in barley
(Hordeum vulgare L.)
S.H. Lee and S.M. Neate........................................................................................................................................56
Posters
PCR detection and quantification of Fusarium species
Tajinder S. Grewal, Brian G. Rossnagel, Graham J. Scoles ..................................................................................61
Can we use Australian identified molecular markers for barley net blotch resistance in western
Canadian barley breeding programs?
Tajinder S. Grewal, Brian G. Rossnagel, Graham J. Scoles ..................................................................................62
Selection for improved scald resistance in the Crop Development Centre barley improvement
program
B.G. Rossnagel, D. Voth, T. Zatorski, D.D. Orr and T.K. Turkington..................................................................63
Selection for improved FHB tolerance in the Crop Development Centre barley improvement
program
B. Rossnagel, D. Voth, T. Zatorski, J. Tucker, W. Legge, and M. Savard ............................................................64
An AFLP derived tightly linked marker for true loose smut resistance (Un8)
Peter Eckstein, Donna Hay, Brian Rossnagel, and Graham Scoles .......................................................................65
Cytological karyotyping of Pyrenophora teres
A.D. Beattie, G.J. Scoles, B.G. Rossnagel.............................................................................................................66
A molecular linkage map of Pyrenophora teres
A.D. Beattie, G.J. Scoles, B.G. Rossnagel.............................................................................................................67
The barley stem rust resistance gene Rpg5 encodes NBS-LRR and protein kinase domains
in a single gene
R. Brueggeman , T. Drader , A. Druka , T. Cavileer , B. Steffenson , J. Nirmala, H. Bennypaul,
K. Gill and A. Kleinhofs........................................................................................................................................68
In vitro selection for pre-screening barley for resistance to Fusarium head blight
Kumar, K. , Xi, K. , Helm, J.H. , Turkington, T.K. (3), and Jennifer Zantinge ....................................................69
Diversification strategies for barley disease management in Alberta
Turkington, T.K., Xi, K., Clayton, G.W., Harker, K.N., O’Donovan, J.G., and Lupwayi, N. ..............................70
Resistance of western Canadian barley genotypes to scald in Alberta
K. Xi , T.K. Turkington and C. Bos .....................................................................................................................71
Mapping and molecular marker development of scald resistance in ‘Seebe’ barley
Zantinge, J.L., J.H. Helm, Z. Hartman, J.B. Russell, and K. Xi ............................................................................72
Breeding for multiple disease and multiple gene resistance in barley
James H. Helm, H. Vivar, F. Capettini, K. Xi, P. Juskiw, and J. Zantinge............................................................73
Variation in virulence among net blotch isolates infecting barley
Linnea G Skoglund ................................................................................................................................................74
Assessment of artificial inoculation methods and deoxynivalenol levels in barley lines
representing various candidate sources of resistance to Fusarium head blight
Geddes, J. , Eudes, F. , Legge, B. , Tucker, J. .......................................................................................................75
Reactions of barley lines to leaf rust, caused by Puccinia hordei
Y. Sun , J. D. Franckowiak , and, S. M. Neate .....................................................................................................76

Tuesday, July 19, 2005 – a.m.
Session 3: MALTING AND BREWING QUALITY ......................................................................... 77
Brewing and Malting: Where are we and more importantly, where are we going?
Rob McCaig...........................................................................................................................................................78
The endoproteinases of barley and malt and their endogenous inhibitors
Berne L. Jones........................................................................................................................................................87
Molecular structure and degradation patterns of endosperm cell walls from barley differing in
hardness and beta-glucan and protein contents
M.S. Izydorczyk , A. Lazaridou , T. Chornick , L. Dushnicky .............................................................................93
Amino acid levels in wort and their significance in developing malting barley varieties
Edney, M.J., Legge, W.G. and Rossnagel, B.G.....................................................................................................99
Commercialization of Near Infrared Reflectance Spectroscopy (NIRS) for screening breeding
lines in the breeding program and screening grain lots in a malt plant
James H. Helm, Lori Oatway and Patricia Juskiw...............................................................................................104
Posters
The differences in fermentable carbohydrates of major Canadian malting barley varieties and
their effects on fermentation
Yueshu Li, Rob McCraig, Ken Sawatzky, Aleks Egi and Michael Edney ..........................................................108
NanoMash: A novel procedure for research mashing of limited-quantity barley malts
Laurie A. Marinac and Mark R. Schmitt..............................................................................................................108
Comparison of hull peeling resistance of barley and malt in western Canadian two-row
barley lines
W.G. Legge, J.S. Noll, and B.G. Rossnagel ........................................................................................................109
Elimination of barley colour defects in Australia
Glen Fox, Maria Sulman and Kevin Young.........................................................................................................110
Characterization of barley tissue-ubiquitous beta-amylase2
Suzanne E. Clark, Patrick M. Hayes, and Cynthia A. Henson.............................................................................110
Barley seed osmolyte concentration as an indicator of preharvest sprouting
Cynthia A. Henson, Stanley H. Duke, Paul Schwarz, Rich Horsley, and Charles Karpelenia ............................111
Osmolyte concentration as an indicator of malt quality
Cynthia A. Henson, Stanley H. Duke, and Charles Karpelenia ...........................................................................111
Relationships among malt fermentability and malt quality parameters under the influence of
barley β-amylase heat stable allele
Blanca Gómez, Héctor Acevedo, and Ana Clara Lopez ......................................................................................112
Tuesday, July 19, 2005 – p.m.
Session 4: BREEDING, AGRONOMY, AND GERMPLASM....................................................... 113
Barley ecology and management
Clayton, G.W., O’Donovan, J.T., Irvine, R.B., Harker, K.N., Turkington, T.K. Lupwayi, N.Z.,
and McKenzie, R.H. ............................................................................................................................................114
Carbon isotope discrimination as a selection criterion for improved water use efficiency and
productivity of barley on the prairies
Anyia, A.O., Archambault, D.J., Slaski, J.J., and Nyachiro, J.M. .......................................................................118
Twenty-five years of male-sterile-facilitated recurrent selection in barley
Mario C. Therrien ................................................................................................................................................124
Measuring phyllochrons in barley to use for seeding date recommendations
Pat Juskiw, Jim Helm and Joseph Nyachiro ........................................................................................................128

Posters- Breeding, Agronomy, and Germplasm
Russian wheat aphid resistant barley – cultivar and germplasm release
D.W. Mornhinweg, P.P. Bregitzer, D.A. Obert, F.B. Peairs, D. Baltensperger and R. Hammon........................133
BARMS: A new relational database for barley breeding programs
D. B. Cooper and Bruce Westlund.......................................................................................................................134
Mapping and molecular marker development of seed dormancy in a barley population derived
from ‘Samson’ barley
J.L. Zantinge, J.M. Nyachiro, S. Chisholm, J.H. Helm, P.E. Juskiw and D.F. Salmon .......................................135
Genotypic variations in preharvest sprouting resistance and seed dormancy in barley
Nyachiro J.M., J.L. Zantinge, J.H. Helm, P.E. Juskiw and D.F. Salmon.............................................................136
Using growing degree days to estimate maturity in small grain cereals
Juskiw, P., Helm, J., Salmon, D., and Nyachiro, J...............................................................................................137
Twelve years of barley-based rotations
Juskiw, P., and Westling, D. ................................................................................................................................137
Development of winter hulless barley varieties as a high value crop
W.S. Brooks, C.A. Griffey and M.E. Vaughn .....................................................................................................138
Multiple dominant and recessive marker stock development
Robert I. Wolfe ....................................................................................................................................................139
Genetic male sterile and xenia assisted reciprocal recurrent selection
Robert I. Wolfe ....................................................................................................................................................140
Isoyield analysis of barley cultivar trials in the Canadian Prairies
Rong-Cai Yang, Daniel Stanton, Stanford F. Blade, James Helm and Dean Spaner...........................................141
Wednesday, July 20, 2005 – a.m.
Session 5: BIOTECHNOLOGY AND GENOMICS ...................................................................... 142
Applications of GeneChips for barley improvement
Gary J. Muehlbauer, David F. Garvin, Kevin Smith, Jayanand Boddu and Seungho Cho ..................................143
Molecular characterization of barley for variety description and identification
Peter Eckstein, Donna Hay, Brian Rossnagel, and Graham Scoles .....................................................................148
Transcriptional profiling of gene expression during malting in barley
Nora Lapitan, Anna-Maria Botha-Oberholster, Timothy J. Close, and Christopher Lawrence...........................152
Molecular marker assisted introgression of loose and covered smut resistance into CDC McGwire
hulless barley
Tajinder S. Grewal, Brian G. Rossnagel, Graham J. Scoles ................................................................................157
Coupling expressed sequences and bacterial artificial chromosome resources to access the
barley genome
Kavitha Madishetty, Jan T. Svensson, Pascal Condamine, Jie Zheng, Steve Wanamaker, Ming-Cheng Luo,
Tao Jiang, Stefano Lonardi and Timothy J. Close ...............................................................................................162
Analysis of barley necrotic mutants in relation to disease resistance/susceptibility
A. Kleinhofs, N. Rostoks, L. Zhang and B. Steffenson .......................................................................................168
Posters
A TaqMan ® fluorescent reporter probe replaces gel electrophoresis for the Rpg1 SCAR
marker in molecular marker-assisted selection
Peter Eckstein, Donna Hay, Brian Rossnagel, and Graham Scoles .....................................................................169
Genetic analysis of preharvest sprouting in barley
S.E. Ullrich, J.A. Clancy, H. Lee, F. Han, K. Matsui, I.A. del Blanco ................................................................170

Effects of ethylene in barley (Hordeum vulgare L.) tissue culture regeneration
Jha, Ajay K., Lynn S. Dahleen and Jeff C. Suttle ................................................................................................171
Validation of select diastatic power QTL in elite Western U. S. six-rowed spring barley
germplasms
D. Hoffman, A. Hang, and D. Obert....................................................................................................................172
The barley stem rust resistance gene product RPG1 is specifically degraded upon infection
with the stem rust fungus Puccinia graminis f. sp. tritici pathotype MCC
J. Nirmala, B. Steffenson and A. Kleinhofs ........................................................................................................173
Saturation mapping of barley chromosome 2H Fusarium head blight resistance QTL
Christina Maier, Deric Schmierer, Thomas Drader, Richard Horsley, and Andris Kleinhofs .............................174
Map-based cloning efforts of the barley spot blotch resistance gene Rcs5
Thomas B Drader, Kara A Johnson, Robert S Brueggeman, Hye Ran Kim, Dave Kudrna, Rod Wing,
Brian Steffeson, and Andris Kleinhofs ................................................................................................................175
A gene tagging system for Hordeum vulgare
François Eudes, André Laroche, Michele Frick, Jennifer Geddes and Laurian Robert .......................................176
Unraveling the mysteries of germination using SAGE (Serial Analysis of Gene Expression)
Toni Pacey-Miller, Jessica White, Allison Crawford, Peter Bundock, Giovanni Cordeiro, Daniel Barbary
and Robert Henry.................................................................................................................................................177
Participants ................................................................................................................................... 178

Sponsors
Sponsors
PLATINUM
Alberta Barley Commission
Alberta Agriculture, Food & Rural Development
Field Crop Development Centre
GOLD
Canadian Wheat Board
ICARDA
SILVER
Big Rock Brewery
Brewing and Malting Barley Research Institute
SeCan Association
BRONZE
Canadian Grain Commission
Rahr Malting Canada
Wintersteiger
SUPPORTER
Alley Kat Brewing
Conviron
Fischer Scientific
FOSS
Western Producer
- 1 -

Sponsors
Platinum Sponsorship – Alberta Barley Commission
To advance the interests of
Alberta barley farmers
through leadership and
investment in innovation and
development.
The Alberta Barley Commission is a not-for-profit organization which is funded,
directed and controlled by Alberta barley farmers. The Commission was established
on August 1, 1991 under the province's Marketing of Agricultural Products Act with
a mandate to coordinate and sponsor research, market development, technology
transfer, and policy development on behalf of barley producers. It is the only barley
commission in Canada.
- 2 -

Sponsors
Platinum Sponsorship – Alberta Agriculture, Food & Rural Development
Mission Statement
The purpose and goal of the Field Crop Development Centre is:
The development of cereal crops through breeding, genetic, molecular,
physiological and agronomic research with emphasis on high quality feed,
fodder, and food crops, for the benefit of a viable and sustainable agri-food
industry.
Alberta / Canada Barley Development Project
The agreement came into being as a joint partnership between Alberta Agriculture, Food &
Rural Development, Agriculture & Agri-Food Canada, Alberta Agricultural Research Institute
and the Alberta Barley Commission.
The Alberta/Canada Barley Development Agreement is a co-operative scientific research
program that has come together to develop new and better barley cultivars to enhance and
advance the agri-food sector in Alberta and the Peace River area of British Columbia.
- 3 -

Vision
Sponsors
Gold Sponsorship – The Canadian Wheat Board
To unite western Canadian grain farmers as the world-recognized, premier
grain marketer.
Mission
The CWB markets and provides quality products and services in order to maximize
value to our owners, western Canadian grain farmers.
About Us
The Canadian Wheat Board (CWB) is a farmer-controlled organization that markets wheat
and barley grown by western Canadian producers. Based in Winnipeg, Manitoba, the CWB is
the largest single seller of wheat and barley in the world, holding more than 20 per cent of
the international market.
Gold Sponsorship – ICARDA
INTERNATIONAL CENTRE FOR AGRICULTURAL RESEARCH IN THE DRY AREAS
ICARDA’s mission is to improve the welfare of poor people and
alleviate poverty through research and training in dry areas of the
developing world, by increasing the production, productivity, and
nutritional quality of food, while preserving and enhancing the
natural resource base.
- 4 -

Sponsors
Silver Sponsorship
Big Rock Brewery
5555-76th Avenue S.E.
Calgary, Alberta Canada T2C 4L8
beer@bigrockbeer.com
Supporting the development and evaluation of new malting barley varieties
in Canada since 1948
. . . the Seeds of a Successful Future . . .
- 5 -

Sponsors
Bronze Sponsorship
Canadian Grain Commission
Rahr Malting Canada
Wintersteiger
- 6 -

Conference Hosts
Hosts
Barley Development Council
Alberta Barley Commission
Field Crop Development Centre
NABRW Website
The workshop papers and abstracts will be posted on the NABRW website which is on Alberta
Agriculture’s Ropin’ the Web site at http://www.agric.gov.ab.ca and click on Crops > Cereals >
Research.
- 7 -

Organizing Committee
Organizing Committee
Chair
Jim Helm
Co-Chairs
Bill Chapman
George Clayton
Patricia Juskiw
Joseph Nyachiro
Kelly Turkington
Kequan Xi
Jennifer Zantinge
Sponsorship Chair
Dave Dyson
Local Organizers
Lori Oatway
Carol Dyson
Thank you
To all the staff at the Field Crop Development Centre
for all of your help.
Susie Albers Elaine Lacroix
Colin Bergen Susan Lajeunesse
Tracy Black Laura Leggott
Cherylynn Bos Shan Lohr
John Bowness Donald Morehouse
Sasha Chisholm Ward Oatway
Tim Duggan Mike Oro
Stan Hand Jeannie Russell
Deanna Hall Don Salmon
Christine Hanrahan Bev Smith
Mark Howe Carla Weidner
Krishan Kumar Donna Westling
- 8 -

PRE-MEETINGS AND WELCOME
3:00 pm Barley Development Council Annual
Meeting
7:30 – 8:30 Poster set-up and Registration
7:30 – 9:30 Welcome Social
8:30 Short program
Session 1
Session 1
8:15 – 9:00
Theme
9:00 – 9:20
Feed Oral 1
9:20 – 9:40
Feed Oral 2
9:40 – 10:00
FEED AND FOOD QUALITY
Oral Presentations
Theme Speaker: Linda Malcolmson
Zijlstra, R.T., W.C. Sauer, J.H. Helm, D.N.
Overend, and R.W. Newkirk.
Johnson, I.R., D.R. Korver, T. Vasanthan,
and F. Temelli
Break
Agenda
Agenda
Sunday, July 17 th
Monday, July 18 th - morning
Chair: Ruurd Zijlstra
Expanding opportunities for barley food and
feed through product innovation
Validation of an in vitro analysis to
determine energy digestibility of barley for
grower pigs
Beta-glucan depleted barley and oat flours as
animal feed
Canadian
International
Grains Institute
University of
Alberta
University of
Alberta
10:00 – 10:20 Baik, B.-K., Z. Quinde, and S.E. Ullrich Improvement of barley-based food product Washington State
Feed Oral 3
color
University
10:20 – 10:40 Rossnagel, B.G., T. Zatorski, and G. Food barley development at the Crop University of
Feed Oral 4 Arganosa
Development Centre, University of
Saskatchewan
Saskatchewan
10:40 – 12:00 Session 1
Poster Presentations
Feed Poster 1 Fox, G., J. Bowman, K. Onley-Watson, A. Breeding for malt and feed quality barley in Queensland Dept.
Skerman, G. Bloustein, A. Kelly, A.
Inkerman, D. Poulsen, and R. Henry
northern Australia
Primary Industries
Feed Poster 2 Camm, G., and B.G. Rossnagel Milling energy and grain hardness in barley University of
Saskatchewan
Feed Poster 3 Rossnagel, B.G., T. Zatorski, G. Arganosa, Low phytate barley (Hordeum vulgare L.) University of
and V. Raboy
development at the Crop Development
Centre, University of Saskatchewan
Saskatchewan
Feed Poster 4 Nyachiro, J., J.H. Helm and P.E. Juskiw Post-anthesis biomass yield and quality of Field Crop
barley cultivars developed by the Field Crop Development
Development Centre
Centre
Feed Poster 5 Qi, H., C. Phillips, M. Eliason, K. Erin, and Process development for quick cooking Ctr. For Agri-
F. Temelli
barley products
Industrial Techn.
(AAFRD)
12:00 – 1:00 Lunch
- 9 -

Agenda
Monday, July 18 th - afternoon
Session 2 PATHOLOGY AND ENTOMOLOGY Chairs: Kelly Turkington and Kequan Xi
Session 2 Oral Presentations
1:00 – 1:45 Theme Speaker: Flavio Capettini
International germplasm development for CIMMYT /
Theme
multiple disease resistance
ICARDA
1:45 – 2:05 Turkington, T.K. and K. Xi Differential response of barley cultivars and AAFC
Pathology
accessions to Rhynchosporium secalis under Lacombe
Oral 1
field conditions
2:05 – 2:25 Mittal, S., L. Dahleen, and D. Mornhinweg Mapping genes for Russian wheat aphid North Dakota
Pathology
Oral 2
resistance in barley
State Univ.
2:25 – 2:45 Lee, S.H., and S. M. Neate
Sequence tagged site markers linked to North Dakota
Pathology
Septoria speckled leaf blotch resistance genes State Univ.
Oral 3
in barley (Hordeum vulgare L.).
2:45 – 3:45 Break and Poster Presentations
Pathology Grewal, T.S., B.G. Rossnagel and G.J. Scoles PCR detection and quantification of Fusarium University of
Poster 1
species
Saskatchewan
Pathology Grewal, T.S., B.G. Rossnagel and G.J. Scoles Can we use Australian identified molecular U of Sask.
Poster 2
markers for barley net blotch resistance in
western Canadian barley breeding programs?
Pathology Rossnagel, B.G., D. Voth, T. Zatorski, D.D. Selection for improved scald resistance in the U of Sask.
Poster 3 Orr, and T.K. Turkington
Crop Development Centre barley improvement
program
Pathology Rossnagel, B., D. Voth, T. Zatorski, J. Selection for improved FHB tolerance in the U of Sask.
Poster 4 Tucker, W. Legge and M. Savard
Crop Development Centre barley improvement
program
Pathology Eckstein, P., D. Hay, B. Rossnagel, and G. An AFLP derived tightly linked marker for true U of Sask.
Poster 5 Scoles
loose smut resistance (Un8)
Pathology Beattie, A.D., G.J. Scoles, and B.G.
Cytological karyotyping of Pyrenophora teres U of Sask.
Poster 6 Rossnagel
Pathology Beattie, A.D., G.J. Scoles, and B.G.
A molecular linkage map of Pyrenophora teres U of Sask.
Poster 7 Rossnagel
Pathology Brueggeman, R.S., T. Drader, A. Druka, T. The barley stem rust resistance gene Rpg5 Washington
Poster 8 Cavileer, B. Steffenson, J. Nirmala, H. encodes NBS-LRR and protein kinase domains State Univ.
Bennypaul, K. Gill, and A. Kleinhofs in a single gene
Pathology Kumar, K., K. Xi, J.H. Helm, T.K.
In vitro selection for pre-screening barley for FCDC
Poster 9 Turkington, and J. Zantinge
resistance to fusarium head blight
Pathology Turkington, T.K., K. Xi, G.W. Clayton, K.N. Diversification strategies for barley disease AAFC
Poster 10 Harker, J.G. O’Donovan, and N. Lupwayi management in Alberta
Lacombe
Pathology Xi, K., T.K. Turkington, and C. Bos Resistance of western Canadian barley FCDC
Poster 11
genotypes to scald in Alberta
Pathology Zantinge, J.L., J.H. Helm, Z. Hartman, J.B. Mapping and molecular marker development of FCDC
Poster 12 Russell, and K. Xi
scald resistance in ‘Seebe’ barley
Pathology Helm, J.H., H. Vivar, F. Capettini, K. Xi, P. Breeding for multiple disease and multiple FCDC
Poster 13 Juskiw, and J. Zantinge
gene resistance in barley
Pathology Skoglund, L.G. Variation in virulence among net blotch Busch Agric.
Poster 14
isolates infecting barley
Resources, Inc.
Pathology Geddes, J., F. Eudes, B. Legge, and J. Tucker Assessment of artificial inoculation methods AAFC,
Poster 15
and deoxynivalenol levels in barley lines
representing various candidate sources of
resistance to Fusarium head blight.
Lethbridge
Pathology Sun, Y., J.D. Franckowiak, and S.M. Neate Reaction of barley lines to leaf rust caused by NDSU
Poster 16
Puccinia hordei
3:45 – 4:45 NABRW Business Meeting
5:30 Buses leave for FCDC Research Farm Barbeque at Research Farm
8:30 Buses return to Capri Hotel
- 10 -

Session 3
Agenda
Tuesday, July 19 th - morning
MALTING AND BREWING QUALITY
Chair: Patricia Juskiw
Session 3 Oral Presentations
8:30 – 9:15 Theme Speaker: Rob McCaig Brewing and malting: Where are we and Canadian
Theme
more importantly, where are we going? Malting Barley
Technical Centre
9:15 – 9:35 Jones, B.L. The endoproteinases of barley and malt USDA (retired)
Malt Oral 1
and their endogenous inhibitors
9:35 – 9:55 Izydorczyk, M.S., A. Lazaridou, T. Molecular structure and degradation Canadian Grain
Malt Oral 2 Chornick, and L. Dushnicky
patterns of endosperm cell walls from Commission,
barley differing in hardness and betaglucan
and protein contents
GRL
9:55 – 10:15 Break
10:15 – 10:35 Edney, M.J., W.G. Legge, and B.G. Amino acid levels in wort and their Canadian Grain
Malt Oral 3 Rossnagel
significance in developing malting barley
varieties
Commission
10:35 – 10:55 Helm, J.H., L. Oatway, and P. Juskiw Commercialization of near infrared Field Crop
Malt Oral 4
reflectance spectroscopy (NIRS) for Development
screening barley lines in the breeding
program and screening grain lots in a malt
plant
Centre
11:00 – 12:00 Session 3
Poster Presentations
Malt Poster 1 Li, Y., R. McCaig, K. Sawatzky, A. Egi, The differences in fermentable
CMBTC
and M. Edney
carbohydrates of major Canadian malting
barley varieties and their effects on
fermentation
Malt Poster 2 Marinac, L.A. and M.R. Schmitt NanoMash: A novel procedure for USDA, ARS,
research mashing of limited-quantity Cereal Crops
barley malts
Research Unit,
Madison WI
Malt Poster 3 Legge, W.G., J.S. Noll, and B.G.
Comparison of hull peeling resistance of AAFC Brandon
Rossnagel
barley and malt in western Canadian tworow
barley lines
Malt Poster 4 Fox, G., M. Sulman, and K. Young Elimination of barley colour defects in Queensland
Australia
Dept. of Primary
Industries
Malt Poster 5 Clark, S.E., P.M. Hayes and C.A. Henson Characterization of barley tissue- University of
ubiquitous beta-amylase2
Wisconsin
Malt Poster 6 Henson, C.A., S.H. Duke, P. Schwarz, R. Barley seed osmolyte concentration as an University of
Horsley and C. Karpelenia
indicator of preharvest sprouting Wisconsin
Malt Poster 7 C.A. Henson, S.H. Duke and C. Karpelenia Osmolyte concentration as an indicator of University of
malt quality
Wisconsin
Malt Poster 8 Gomez, B., H. Acevedo, and A.C. Lopez Relationships among malt fermentability Laboratorio
and malt quality parameters under the Tecnologico del
influence of barley beta-amylase heat
stable allele
Uruguay
12:00 Address from the Minister of Alberta
Agriculture, Food & Rural
Development, Honorable Doug Horner
12:15 – 1:00 Lunch
- 11 -

Session 4
Session 4
1:00 – 1:45
Theme
1:45 – 2:05
Breeding
Oral 1
2:05 – 2:25
Breeding
Oral 2
2:25 – 2:45
Breeding
Oral 3
2:45 – 3:05 Break
3:05 – 3:25
Breeding
Oral 4
3:25 – 3:45
Breeding
Oral 5
BREEDING, AGRONOMY, AND
GERMPLASM
Agenda
Tuesday, July 19 th - afternoon
Chairs: Joseph Nyachiro and Bill
Chapman
Oral Presentations
Theme Speaker: Dale Clark Using multiple resources to develop barley
varieties for North America
Mr. Mike Grenier Agronomic management barriers for
improving selection rate of malting barley on
Clayton, G.W., J.T. O’Donovan, J.T.
Irvine, K.N. Harker, T.K. Turkington, N.Z.
Lupwayi and R.H. McKenzie
Anyia, A.O., D.J. Archambault, J.J. Slaski,
and J.M. Nyachiro
the Canadian prairies
Western
Plant
Breeders
Canadian
Wheat Board
Barley ecology and management AAFC,
Lacombe
Carbon isotope discrimination as a selection
criterion for improved water use efficiency
and productivity of barley on the prairies
Therrien, M.C. Twenty-five years of male-sterile-facilitated
recurrent selection in barley
Juskiw, P., J. Helm, and J. Nyachiro Measuring phyllochrons in barley to use for
seeding date recommendations
3:45 – 4:45 Session 4
Poster Presentations
Breeding Mornhinweg, D.W., P.P. Bregitzer, D.A. Russian wheat aphid resistant barley –
Poster 1 Obert, F.B. Peairs, D. Baltensperger, and
R. Hammon
cultivar and germplasm release
Breeding Cooper, D.B., and B. Westlund BARMS: A new relational database for
Poster 2
barley breeding programs
Breeding
Poster 3
Breeding
Poster 4
Breeding
Poster 5
Breeding
Poster 6
Breeding
Poster 7
Zantinge, J. and J. Nyachiro Mapping and molecular marker development
of seed dormancy in a barley population
derived from ‘Samson’ barley
Nyachiro, J.M., J.L. Zantinge, J.H. Helm, Genotypic variation in preharvest sprouting
P.E. Juskiw, and D.F. Salmon
resistance and seed dormancy in barley
Juskiw, P., J. Helm, D. Salmon, and J. Using growing degree days to estimate
Nyachiro
maturity in small grain cereals
Alberta
Research
Council
AAFC,
Brandon
FCDC
USDA-ARS,
Stillwater
OK
Busch
Agricultural
Resources
FCDC
FCDC
FCDC
Juskiw, P., and D. Westling Twelve years of barley-based rotations FCDC
Brooks, W.S., C.A. Griffey and M.E.
Vaughn
Development of winter hulless barley
varieties as a high value crop
Breeding Wolfe, R.I. Multiple dominant and recessive marker
Poster 8
stock development
Breeding Wolfe, R.I. Genetic male sterile and xenia assisted
Poster 9
reciprocal recurrent selection
Breeding Yang, R.-C., D. Stanton, S. F. Blade, J. Isoyield analysis of barley cultivar trials in
Poster 10 Helm, and D. Spaner
the Canadian Prairies
5:30 - 6:30 Cocktails Monaco Room
6:30 Banquet at the Capri Hotel Monaco Room
- 12 -
Virginia
Polytech.
Inst. & State
Univ.
AAFC/FCD
C (retired)
AAFC/FCD
C (retired)
Alberta
Agriculture

Agenda
Wednesday, July 20 th - morning
Session 5 BIOTECHNOLOGY AND GENOMICS Chair: Jennifer Zantinge
Session 5 Oral Presentations
8:15 – 9:00 Theme Speaker: Gary Muehlbauer
Applications of GeneChips for barley
University of
Theme Muehlbauer, G.J., D.F. Garvin, K. Smith, J.
Boddu, and S. Cho
improvement
Minnesota
9:00 – 9:20 Eckstein, P., D. Hay, B. Rossnagel, and G. Molecular characterization of barley for variety University of
Biotech
Oral 1
Scoles
description and identification
Saskatchewan
9:20 – 9:40 Lapitan, N., A.-M. Botha-Oberholster, T.J. Transcriptional profiling of gene expression Colorado State
Biotech
Oral 2
Close, and C. Lawrence
during malting in barley
University
9:40 – 10:00 Break
10:00 – 10:20 Grewal, T.S., B.G. Rossnagel, and G.J. Molecular marker assisted introgression of University of
Biotech Scoles
loose and covered smut resistance into CDC Saskatchewan
Oral 3
McGwire hulless barley
10:20 – 10:40 Madishetty, K., J.T. Svensson, P. Condamine, Coupling expressed sequences and bacterial University of
Biotech J. Zheng, S. Wanamaker, M.-C. Luo, T. artificial chromosome resources to access the California,
Oral 4
Jiang, S. Lonardi, and T.J. Close
barley genome
Riverside
10:40 – 11:00 Kleinhofs, A., N. Rostoks, L. Zhang, and B. Analysis of barley necrotic mutants in relation Washington
Biotech
Oral 5
Steffenson
to disease resistance/susceptibility
State University
11:20 – 12:10 Session 5 Poster Presentations
Biotech Eckstein, P., D. Hay, B. Rossnagel, and G. A TaqMan® fluorescent reporter probe U of Sask.
Poster 1 Scoles
replaces gel electrophoresis for the Rpg1
SCAR marker in molecular marker-assisted
selection
Biotech S.E. Ullrich, J.A. Clancy, H. Lee, F. Han, K. Genetic analysis of preharvest sprouting in Washington
Poster 2 Matsui, and I.A. del Blanco
barley
State University
Biotech Jha, A.K., L.S. Dahleen, and J.C. Suttle Effects of ethylene in barley (Hordeum vulgare NDSU and
Poster 3
L.) tissue culture regeneration
USDA-ARS,
Northern Crop
Sci. Lab
Biotech Hoffman, D., A. Hang, and D. Obert Validation of select diastatic power QTL in USDA-ARS,
Poster 4
elite Western U.S. six-rowed spring barley
germplasms
Aberdeen ID
Biotech Nirmala, J., B. Steffenson and A. Kleinhofs The barley stem rust resistance gene product Washington
Poster 5
Rpg1 is specifically degraded upon infection
with the stem rust fungus Puccinia graminis
f.sp. tritici pathotype MCC
State University
Biotech Maier, C., D. Schmierer, T. Drader, R. Saturation mapping of barley chromosome 2H Washington
Poster 6 Horsley, and A. Kleinhofs
fusarium head blight resistance QTL
State University
Biotech Drader, T.B., K.A. Johnson, R.S.
Map-based cloning efforts of the barley spot Washington
Poster 7 Brueggeman, H.-R. Kim, D. Kudrna, R.
Wing, B. Steffeson, and A. Kleinhofs
blotch resistance gene Rcs5
State University
Biotech Eudes, F., A. Laroche, M. Frick, J. Geddes A gene tagging system for Hordeum vulgare AAFC,
Poster 8 and L. Robert
Lethbridge
Biotech Pacey-Miller, T., J. White, A. Crawford, P. Unraveling the mysteries of germination using Grain Foods
Poster 9 Bundock, G. Cordeiro, D. Barbary and SAGE (Serial Analysis of Gene Expression) CRC, Southern
Robert Henry
Cross Univ.,
Australia
12:10 End conference
12:30 Buses leave for post-conference tour of Please pre-register so that lunch can be
research farm
provided. Also please indicate if you require
transportation to the farm.
- 13 -

Chair
Ruurd Zijlstra, University of Alberta
Session 1: Feed and Food Quality
Monday, July 18, 2005 – a.m.
Session 1 - FEED AND FOOD QUALITY
Presenters
Linda Malcolmson, Canadian International Grains Institute
Ruurd Zijlstra, University of Alberta
Ian Johnson, University of Alberta
Byung-Kee Baik, Washington State University
Brian Rossnagel, Crop Development Centre, University of Saskatchewan
- 15 -

Session 1: Feed and Food Quality – Oral presentations
Expanding opportunties for barley food and feed through product innovation
L. Malcolmson, R. Newkirk and G. Carson
Canadian International Grains Institute, Winnipeg, Manitoba
Barley has a long history of use as both human and animal food and is grown in many countries
around the world. In Western countries, barley is primarily used for animal feed and for malting
and brewing with very little designated for food use. Over the last two decades there have been a
number of important developments that have influenced or have the potential to influence barley
utilization in food and feed.
Interest in the use of barley as a food grain has increased primarily because of its reported health
benefits. Barley is an excellent source of β-glucan soluble fibre and contains antioxidants,
vitamins, minerals, and phytonutrients such as phenolics and lignans. These components have
biological activities that can reduce the risk of coronary heart disease, diabetes and certain
cancers. As a whole grain, barley can also play a role in weight maintenance. One key
development which will have a significant effect on the use of barley as a food ingredient in
North America is the pending FDA health claim for coronary heart disease and β-glucan soluble
fibre from barley.
Another important development that has the potential to influence the use of barley in food
applications is the development of hulless barley cultivars and varieties with low amylose
(waxy), zero amylose and high amylose content. Hulless cultivars permit greater ease in milling
and pearling with enhanced processing yields and have higher levels of β-glucan. Waxy cultivars
typically have higher β-glucan levels than non-waxy types. Although high levels of β-glucan are
undesirable in animal feed and malting and brewing applications, it can be advantageous in the
development of barley based foods by providing improved functionality and nutritional
properties. Thus, the development of a wide range of barley types allows for targeting specific
barley cultivars to specific end uses.
Application of novel technologies to isolate and concentrate β-glucan to maintain molecular
structure and solubility has resulted in commercialization of barley β-glucan preparations for use
in the food industry. In addition, the application of infrared technology has shown the potential
to yield whole barley food products with unique end-properties.
In terms of animal feed, barley has the potential to continue to be one of the preferred cereals in
beef, dairy and swine rations in Western Canada. Until the late 1990’s barley was only used to a
limited extent in poultry rations due to the negative effects associated with the viscous soluble
fibre, β-glucan, on bird performance. However since that time, an endogenous enzyme, βglucanase,
has been developed that effectively eliminates the anti-nutritional effects associated
with β-glucan. This enzyme is now commercially available and it is common practice to use
barley in poultry rations when the cost is competitive with other cereals. However, the use of
enzymes to reduce the negative impacts of the soluble fibre in cultivars specifically designed for
food use which contain exceptionally high levels of soluble β-glucan may not be sufficient
thereby reducing the utility of this ingredient in poultry diets unless regular types of barley are
used.
- 16 -

Session 1: Feed and Food Quality – Oral presentations
One factor that has limited the use of barley in poultry and some swine rations is the high
proportion of insoluble fibre from the hull attached to the seed. As a result, hulless barley
cultivars have the potential to markedly increase energy content if used as a feed ingredient.
Although the development of hulless cultivars could significantly impact the utilization of barley
in feed rations both domestically and internationally, there have been difficulties in establishing a
market for hulless barley. The primary issue has been the inability to obtain a premium for the
product that offsets the reduced yield caused by loss of hulls during harvesting. If this issue can
be addressed, hulless barley has the potential to develop into an important market in both feed
and food.
Another new possibility which has the potential to increase the use of barley in feed applications
is the development of a new type of barley which may reduce phosphorus levels in animal feces.
The majority of phosphorus in plants is found in a form that animals are not able to digest. As a
result, the diets are supplemented with available inorganic phosphorus and the undigested
organic fraction is passed into the feces which can result in environmental issues where intensive
livestock production occurs. Although these low phytate cultivars are not currently available on
a commercial basis, if they are released for production, they will likely be an attractive feed
ingredient given the pressure to reduce the impact of livestock production on the environment.
Although barley is a very popular ingredient in ruminant rations, the starch is susceptible to rapid
fermentation in the rumen resulting in digestive disorders if the product is not handled correctly.
In addition, rapidly fermented starch can cause depression in milk fat content which is
undesirable given the current incentive to increase milk fat content of milk. The recent
development of the barley cultivar Valier shows significantly reduced rates of starch
fermentation suggesting a possible improvement in the utility of barley as a feed ingredient.
Barley, like all other feed ingredients has inherent variability and this affects the value and the
utility of the product. Prior studies have demonstrated the potential to determine nutritional
value of barley using Near Infrared Reflectance Spectroscopy (NIRS) but the calibrations were
not developed to the extent that they could be used commercially. Recently, a consortium of
researchers and industry partners in Canada have initiated a program to develop a commercially
useful NIRS calibration so the nutritional profile of individual lots of barley could be rapidly
established prior to use. Once this calibration is available in approximately 3 years, both the
producers and the end users will have the ability to segregate, value and use the barley based on
its’ actual value further improving the utilization and value of this important feed grain.
Additionally, this technique has the potential to be used to confirm the identity of varieties of
grains with unique characteristics increasing the likely hood that novel barley will be identifiable
and utilized by the feed industry. It is also possible that this initiative will be useful to the food
industry to target selected barley qualities to specific end use applications.
Thus, the use of barley as a food and feed ingredient shows tremendous potential for the future.
Development of hulless and novel types of barley with unique characteristics as well as the
application of novel technologies has and will continue to have a significant effect on the
expansion of barley utilization. Efforts to increase the use of barley need to continue and success
can be achieved through innovations made at the breeding, processing and product development
level.
- 17 -

Session 1: Feed and Food Quality – Oral presentations
Validation of an in vitro analysis to determine energy digestibility of barley
for grower pigs
R.T. Zijlstra* 1 , W.C. Sauer 1 , J.H. Helm 2 , D.N. Overend 3 , R.W. Newkirk 4
1 University of Alberta, Edmonton, AB,
2 Field Crop Development Centre, Lacombe, AB,
3 Ridley Inc, Mankato, MN,
4 Canadian International Grains Institute, Winnipeg, MB.
In vitro analyses will be beneficial to characterize the existing variation in energy digestibility
within specific feed ingredients such as grains and to develop procedures predicting nutritional
value of grains for swine. Analytical procedures have been developed to determine in vitro
energy digestibility and DE content for barley, but have not been validated for their suitability to
predict in vivo values. First, 21 barley samples with a range in fiber content (5.7 to 12.1% ADF)
and total-tract energy digestibility (51.9 to 78.5%) and DE content in grower pigs were subjected
to an existing in vitro analysis in duplicate (Huang et al. 2003). Briefly, the procedure involved
subsequent digestions with pepsin (6 hr), pancreatin (18 hr), and cellulase (24 hr), and DM and
GE analyses of the barley sample and residue. The in vitro energy digestibility ranged from 63.7
to 82.2% for the 21 barley samples and relative errors for samples ranged from 0.2 to 4.8%. In
vitro energy digestibility was strongly related to swine in vivo energy digestibility content
(R 2 =0.81). Second, a subset of seven barley samples was subjected to quadruplicate in vitro
analyses. In vitro energy digestibility ranged from 63.5 to 82.8% for the seven samples and the
relative error was 4.2% for the barley sample with a low energy digestibility (63.5%) and ranged
from 0.6 to 1.4% for the other six barley samples. For the seven barley samples, in vitro energy
digestibility was strongly related to in vivo energy digestibility content (R 2 =0.97). In summary,
with quadruplicate analyses, in vitro energy digestibility was an accurate predictor of in vivo
energy digestibility. In vitro energy digestibility can be successful as the core analytical
procedure to calibrate rapid analytical equipment to predict energy digestibility and therefore DE
content of barley for grower pigs.
Key Words: swine, grain, analysis
- 18 -

Session 1: Feed and Food Quality – Oral presentations
Beta-glucan depleted barley and oat flours as animal feed
Ian R. Johnson, Doug R. Korver * , Thava Vasanthan * and Feral Temelli
1 University of Alberta, Edmonton, Alberta, Canada
*Corresponding authors
Background
A vital connection exists between the crops and livestock components of agriculture. In Alberta,
livestock producers select their grain source for feed based on the cost of the grain and its
method of processing, the primary goal of which is to increase energy availability (Owens et al.
1997). The combination of lower price and limitations of climate and soil fertility that impede
corn production (Boss & Bowman, 1996) makes barley an economically attractive feed. As a
result, barley is used primarily as an energy and protein source in cattle diets and is one of the
primary feed ingredients used by the swine industry. Barley varieties are generally plentiful
crops and are therefore readily available at a reasonable cost. However, these grains contain
relatively high proportions of non-starch polysaccharides (NSPS), especially beta-glucans (~4-
7%), which are known for their anti-nutritive properties. In poultry, for example, endogenous
enzymes have a limited ability to digest non-starch polysaccharides. Thus their content and
composition in the diet can impart significant differences in biological responses and thus
influence poultry productivity (Campbell et al. 1989). To control this anti-nutritive effect,
enzymes that hydrolyze non-starch polysaccharides are often added to feeds and thus enhance
the overall digestibility. Livestock producers generally select varieties low in beta-glucans in an
attempt to control for these anti-nutritive properties.
A novel grain fractionation technology has been developed at the Dept. of Agricultural, Food and
Nutritional Science, University of Alberta to isolate/concentrate beta-glucan from oat and barley
grains in a cost-efficient manner. The technology is patented and now licensed to Cevena
Bioproducts Inc., Edmonton, Alberta. Flours produced from these grains undergo alcohol based
enzymatic process for beta-glucan isolation/concentration. The beta-glucan concentrate
(Viscofiber ® ) is now commercially available for use in functional food and dietary supplements
due to its valuable physiological properties (For more information go to: www.cevena.com).
Two major byproducts of the process are crude starch and a blend of hydrolyzed starch and
protein mixture. These components are the most valuable by-products of the technology and
comprise the largest volume (~80% and ~5%, w/w, respectively) of the raw material weight.
While, whole or minimally processed (i.e. flaked) barley and oat grains have been traditionally
used in animal feeds, the nutritional value of the aforementioned by-products that are depleted in
anti-nutritional factors (i.e. beta-glucan) is not known.
Overall Goals and Objectives
The overall goal of this research project is to evaluate the potential of beta-glucan depleted
barley/oat flour (i.e. crude starch) for use in the diets of livestock animals in order to determine
their digestible nutrient content and optimal level of inclusion and thereby to provide evidence
for inclusion of these byproducts in livestock production. Diets formulated with these ingredients
will be compared to commercial feeds. Development of novel applications for these by-products
- 19 -

Session 1: Feed and Food Quality – Oral presentations
is important to ensure that the grains are completely utilized and this is critical for the overall
commercial success of this technology. Furthermore, since barley and oats are established natural
feed crops, utilization of the aforementioned byproducts in feeds would be safe and would not
pose any threat to food security. It is also important to note that this research has potential to
doubly benefit the agriculture industry, not only by enhancing cereal production and processing,
but also by improving livestock production.
Evaluation of the use of beta-glucan depleted barley/oat flour as natural feed ingredient in
young Holstein calves
The objective of the first trial conducted in young Holstein calves was to compare the nutritional
value of barley and oat starch isolate by-products to a commercial calf grower diet. Calves
(n=27, approximately 2-4 months of age, average initial weight: 110 kg ± 3) were randomly
allocated to one of three treatment diets (3 calves/diet/pen) and fed ad libitum using Cailan gates.
Three diets were formulated as specified by the National Research Council (NRC 2000) and
contained 25% oat starch (oat starch diet) and 25% barley starch (barley starch diet). In order to
allow an appropriate comparison between the commercial and starch test diets, all diets were
made isonitrogenous (18% crude protein) and similar in energy content (MCal; Standard – 1.21,
Oat – 1.33, Barley – 1.33), which was verified by proximate analysis. Following feed
acclimatization and training on the Cailan gate system (approx. 3 weeks), calves were healthy,
consumed adequate feed and grew well for the remainder of the trial. On average, calves
supplemented for five weeks gained 52 ± 1 kg and had an average final BW of 189 ± 4 kg. Feed
intake (FI) averaged 4.95 ± 0.20 kg/d. Despite initial concerns that the high amount of starch in
the oat and barley diets would influence calf feed intake, and thus performance, there was no
significant effect of diet on any of the recorded performance measures in this study (Table 1). A
sub-group of calves that were fed Chromium-mordanted fiber underwent periodic feces
collection (4 hours for two days, then at 54, 60, 72 and 96 hours). The appearance of Chromium
in feces, and thus the rate of passage of each diet was similar, peaking between 16 and 36 hours
and reaching negligible levels by 96 hours. Therefore, based on the results from this initial study,
a high proportion (up to 25%) of both oat- and barley-derived starch products can be included in
the diets of young calves as an ideal energy source.
Table 1. Body weight and feed intake of calves
Dietary Group Standard (g/kg) Oat Crude Starch Barley Crude Starch
(g/kg)
(g/kg)
Initial BW, g 136 ± 7 12
136 ± 5 138 ± 6
Final BW, g 192 ± 8 187 ± 7 190 ± 7
Average Gain, g 56 ± 2 50 ± 3 51 ± 2
Average FI, g/d 5.0 ± 0.53 5.1 ± 0.28 4.7 ± 0.13
1
Values presented as mean ± SEM.
2
There were no significant differences (p

Session 1: Feed and Food Quality – Oral presentations
Evaluation of the use of beta-glucan-depleted barley and oat flour as a natural ingredient for
chickens
The objective of this trial was to evaluate the digestible nutrient content of beta-glucan depleted
barley flour (i.e. crude starch) in the diets of broiler chickens. Since the endogenous enzymes of
poultry cannot digest non-starch polysaccharides, the ability of enzyme (Avizyme ® 1102;
Danisco Animal Nutrition) to hydrolyze beta-glucans and thus enhance the overall digestibility
was also examined in this study. Broiler chickens were fed isonitrogenous, isoenergetic diets
between 0 and 42 d of age. For each growth period (starter 0-10 d, grower 11-28 d and finisher
29-42 d), a total of 5 diets were formulated according to NRC requirements (NRC 1994), which
was confirmed by proximate analysis. Diets included a corn basal diet (#1), a barley flour based
diet with (#2) and without (#3) added enzyme, and a barley crude starch-based diet with (#4) and
without (#5) added enzyme. The major ingredient (i.e. barley flour, crude starch, etc) in each diet
made up approximately 50% of the total diet. Chicks (n=602) were obtained at 1 d of age (initial
weight: 44.3 g) and randomly assigned to 1 of 72 pens (8 pens/treatment). Body weight was
measured on days 0, 10, 28 and 42. Average daily gain, feed intake and feed conversion
efficiency were also determined between 0-10, 11-28 and 29-42 days.
Results of the study (Table 2) revealed that chickens consuming corn-based diets had a
significantly higher average body weight, average daily gain and feed intake throughout the
course of the trial. In contrast, with the exception of initial values, birds consuming barley flourbased
diet had the lowest average body weight compared to all other dietary treatments. Barleyfed
chickens had lower average daily gain, but higher feed conversion efficiency for the duration
of the trial, which was also reflected at all time points. However, addition of enzyme to barley
diets significantly improved average body weight and average daily gain at all time points.
Chickens fed with barley crude starch diets were found to have many similar performance
parameters to those chickens fed with enzyme-supplemented barley diets.
The poor performance of barley flour-fed chickens may be attributed to the high viscosity and
texture of diets containing barley. The high beta-glucan content of barley flour would have
substantially increased intestinal viscosity and may have interfered with digestion. In addition,
beta-glucan has satiety factors, which may have influenced the amount of feed that chickens in
this group were compelled to consume. Alternatively, barley-containing diets had a tendency to
stick together within feeders, which may have interfered with the birds’ consumption ability (i.e.
feed intake). Therefore, an alternate type of feed processing, such as pelleting, may have
minimized some of the observed problems in feed handing and feed flow and may improve feed
intake. Since feed conversion efficiency was highest in barley-fed chickens, an improvement in
feed intake would likely cause increased weight gain. It should also be noted that high inclusion
levels (~50%) of the major ingredient were used in this study. Future studies are warranted to
determine if performance would differ with different levels of inclusion. Results of this trial
confirmed the ability of enzyme supplementation to enhance digestibility, a trend most
pronounced in chickens fed barley-based diets. In addition to hydrolyzing non-starch
polysaccharides, the enzyme used in this study would have also decreased intestinal viscosity.
This would explain the observed increased performance of chicks fed barley-based diets with
enzyme. It is important to highlight the fact that chickens fed with barley crude starch diets had
generally equal performance to enzyme-supplemented broilers. This finding reinforces the great
- 21 -

Session 1: Feed and Food Quality – Oral presentations
potential of this byproduct in livestock formulations to cut down on costs incurred from enzyme
supplementation, without suffering any detriment to broiler performance.
Table 2. Performance measures of chickens fed diets differing in major grain
Ingredient 1
#1 – Corn #2 – Barley
flour
#3 – Barley
flour + enzyme
#4 - Barley
Crude Starch
#5 - Barley
Crude Starch +
enzyme
ABW 1 (g)
D0 43.8 2 ± 0.44 44.5 ± 0.48 44.7 ± 0.39 44.7 ± 0.40 44.3 ± 0.48
D10 231.5 ± 5.43 a3
147.2 ± 3.98 d
176.3 ± 5.50 c
202.3 ± 8.01 b
186.3 ± 3.32 c
D28 1110.3 ± 33.53 a
650.6 ± 26.33 c
794.3 ± 26.04 b
825.2 ± 31.93 b
850.5 ± 18.44 b
D42 2394.2 ± 33.70 a
1369.9 ± 46.86 c
1709.1 ± 64.02 b
1714.5 ± 50.50 b
1809.8 ± 73.11 b
ADG 4 (g/d)
D0-10 19.7 ± 0.54 a
10.8 ± 0.38 d
13.6 ± 0.59 c
16.4 ± 0.80 b
14.8 ± 0.30 c
D11-28 51.7 ± 1.89 a
29.6 ± 1.34 c
36.3 ± 1.35 b
36.4 ± 1.88 b
38.0 ± 1.16 b
D29-42 99.9 ± 2.16 a
55.8 ± 2.21 c
67.4 ± 3.22 b
69.9 ± 2.33 b
72.7 ± 4.56 b
D1-42 54.8 ± 0.65 a
30.7 ± 0.99 c
37.5 ± 1.68 b
39.1 ± 1.17 b
38.6 ± 1.34 b
FI 5 (g/bird/d)
D0-10 25.0 ± 0.47 a
20.8 ± 0.84 b
22.0 ± 0.96 b
22.0 ± 1.22 b
21.4 ± 0.33 b
D11-28 83.3 ± 2.66 81.6 ± 4.93 79.3 ± 3.70 75.9 ± 1.67 84.5 ± 3.00
D29-42 173.3 ± 3.87 a
134.5 ± 10.61 b
137.9 ± 8.24 b
129.3 ± 3.89 c
152.5 ± 9.92 a
D1-42 89.7 ± 1.02 a
76.6 ± 4.16 b
76.4 ± 3.48 b
73.4 ± 0.81 b
79.5 ± 2.33 b
FCE 6
D0-10 1.27 ± 0.03 d
D11-28 1.61 ± 0.03 c
D29-42 1.74 ± 0.02 b
D1-42 1.64 ± 0.01 c
1.94 ± 0.12 a
2.79 ± 0.19 a
2.40 ± 0.12 a
2.50 ± 0.12 a
1.62 ± 0.07 b
2.18 ± 0.07 b
2.08 ± 0.15 ab
2.05 ± 0.08 b
1 Average Body Weight
2 Values presented as mean ± SEM
3 Within a row, means without a common superscript letter differ (P < 0.05)
4 Average Daily Gain
5 Feed Intake
6 Feed Conversion Efficiency
Future Direction and Conclusion
1.36 ± 0.08 cd
2.13 ± 0.13 b
1.86 ± 0.07 b
1.89 ± 0.06 b
1.46 ± 0.05 bc
2.24 ± 0.11 b
2.12 ± 0.10 ab
2.07 ± 0.07 b
At this stage of the research project, the nutritional value of barley crude starch diets has been
determined in young calves and the digestible nutrient content has been determined in broilers.
The next phase of the research project is on the verge of beginning. The objective of this trial is
to relatively evaluate the digestible nutrient content of barley crude starch in growing pigs.
Digestibility will be assessed by fitting 8 pigs with ileal T-cannulas, followed by collection of
ileal digesta samples. Results from this trial will be compared to the previous study in poultry, as
digestibility of these products is expected to differ. Once the digestible nutrient content of these
products has been determined, it will be possible to proceed with more detailed studies. These
will include livestock production trials that will utilize these products in nutritionally complete
diets that have also been formulated from an economical perspective, thus allowing these diets to
- 22 -

Session 1: Feed and Food Quality – Oral presentations
be manufactured and purchased at a reasonable cost. There are also trials being planned to extend
the results of previous studies and answer some of the questions these trials have presented. It is
still unclear if the texture and form of the diets may have influenced the results of this pilot
study. It would be necessary to evaluate if chickens would respond differently, especially in
terms of feed intake and weight gain, to a product that undergoes cold pelleting and then
crumbling. An additional component of this feed research project currently being planned is the
use of the high-quality hydrolyzed protein and starch blend from oat and barley that are produced
along with the crude starch products. In conclusion, studies conducted thus far indicate that
barley- and oat-derived products have great potential as valuable and cost effective feed
ingredients.
References
1) Boss, D.L., and Bowman, J.G.P. 1996. Barley varieties for finishing steers: I. Feedlot
performance, in vivo diet digestion, and carcass characteristics. J. Anim. Sci. 74(8): 1967.
2) Campbell, G.L., Rossnagel, B.G., Classen, H.L., and Thacker, P.A. 1989. Genotypic and
environmental differences in extract viscosity of barley and their relationship to its nutritive
value for broiler chickens. Ani. Feed Sci. Tech. 226: 221.
3) NRC. 1994. Nutrient Requirements of Poultry (9 th Ed.). Subcom. Poultry Nutr., Comm
Anim. Nutr., Board Agric., NRC. Nat. Acad. Press, Wash. pp 157.
4) NRC. 2000. Nutrient Requirements of Beef Cattle (7 th Ed. update). Subcom. Beef Cattle
Nutr., Comm. Anim. Nutr., Board Agric., NRC. Nat. Acad. Press, Wash. pp 224.
5) Owens, F.N., Secrist, D.S., Hill, W.J., and Gill, D.R. 1997. The effect of grain source and
grain processing on performance of feedlot cattle: a review. J. Anim. Sci. 75(3): 868.
- 23 -

Session 1: Feed and Food Quality – Oral presentations
Improvement of barley-based food product color
B.-K. Baik 1 , Z. Quinde 2 , and S. E. Ullrich 1
1 Assistant Professor and Professor, respectively, Department of Crop and Soil Sciences;
2 Graduate research assistant, Department of Food Science & Human Nutrition, Washington State University, Pullman, WA
99164-6420
Color is one of the most important sensory attributes of food products. A food product with the
unacceptable color is not likely to be chosen and eaten by consumers, even it is highly nutritious,
flavorful and well texture. While acceptable color of a food varies depending on cultural,
geographic and sociological aspects of a given population, certain food groups are acceptable
only if they fall within a certain color range. Also, in many cases quality and value of raw
materials are judged by their color.
White color of flours from cereal grain is generally preferred to dark color. Moreover, most of
the food products prepared from cereal grains should be of bright light color to command high
quality. Dark discoloration of abraded barley kernels when used as a rice extender, in soups or
in preparation of baby foods has been a serious concern of food industries and a significant factor
preventing use of barley in food formulation.
Barley grains contain numerous polyphenols, proanthocyanidins and catechins, which are
distributed in the hull, seed coat and aleurone layer. Total polyphenol content of barley,
expressed as gallic acid, ranges from 0.2 to 0.4% of grain (Bendelow and LaBerge 1979). PPO
has high activity in raw barley (Clarkson et al 1992). The role of polyphenols in brewing,
especially their implication in haze formation in beer, was reviewed by Gardner and McGuinness
(1977). However, the relationship between polyphenols and discoloration of food products
prepared from barley, and the role of PPO on discoloration of barley based products has not been
investigated, mainly due to the insignificance of barley as a food.
Barley is increasingly incorporated into the human diet, because of human health benefits, easy
availability and inexpensive price. To maintain or even increase consumer’s interest in barley
foods, and to improve the willingness of food processors to use barley in food product
formulations, it is crucial to control discoloration of barley-based food products. Discoloration of
barley-based food products may be controlled by the proper selection of raw materials,
appropriate processing and use of chemicals. We explored the grain components responsible for
the barley food product discoloration, genotypic variation in discoloration as well as phenolics
content and PPO activity, and environment effects on the grain components responsible for
discoloration of barley food products.
Total polyphenol content and PPO activity
Total polyphenol content of abraded barley kernels was lowest in hulled proanthocyanidin-free
barley, ranging from 0.02 to 0.04% (Table I). Hulled proanthocyanidin-containing abraded
barley had lower total polyphenol content (0.11-0.18%) than hulless abraded barley (0.19-
0.26%). Although proanthocyanidin-containing barleys were abraded by 30% for hulled and
15% for hulless genotypes, abrasion does not necessarily remove the same layers or components
- 24 -

Session 1: Feed and Food Quality – Oral presentations
of the kernel because of differences in thickness of outer layers, kernel size and shape among
genotypes.
PPO activity of abraded barley grains varied among genotypes, while differences in PPO activity
between barley classes were not evident. PPO activity of abraded barley grains ranged from 62.2
to 116.5 units/g in hulled barley and from 63.1 to 106.6 in hulless barley genotypes.
Table I. Total Polyphenol Content and PPO Activity of Abraded Grains of Different Barley
Genotypes
Barley Class
Hulled
Protein (%) Ash (%) Total Polyphenol
(gallic acid %)
PPO Activity
(units/g)
PA + (n=10) 8.0-11.1 0.74-0.96 0.11-0.18 62.2-94.7
PA - (n=4) 8.8-10.1 0.84-0.99 0.02-0.04 84.1-116.5
Hulless
Regular (n=5)
Waxy (n=3)
10.4-15.0
11.7-13.1
0.85-1.16
0.99-1.15
0.22-0.26
0.19-0.21
PA +: proanthocyanidin-containing; PA -: proanthocyanidin-free.
Brightness of barley dough sheets
63.1-106.6
68.7-79.9
The L* values of barley flour dough sheets measured over time are summarized in Table II.
Immediately after preparation, L* value of dough sheets exhibited relatively small differences
between classes and genotypes of barley. The rate of L* value decrease during storage was
highest in hulless barley genotypes, lower in hulled proanthocyanidin-containing and lowest in
hulled proanthocyanidin-free genotypes. Accordingly, differences in L* values of the dough
sheets among barley classes and individual genotypes were much more evident at 24 hr after
preparation than immediately after preparation. Hulled proanthocyanidin-free barley exhibited
the highest L* values (72.2-78.1), followed by hulled proanthocyanidin-containing barley (65.3-
69.6) and hulless barley (59.0-63.9). There were also large variations in L* values among
genotypes of the same barley class, indicating the complexity of discoloration in processed
barley.
Table II. Brightness (L*) of Dough Sheets Prepared from Barley Flours
Barley Class
Hulled
0 Hr
Brightness (L*)
24 Hr
PA + (n=10)
78.0-80.9
65.3-69.6
PA - (n=4)
79.8-82.6
72.2-78.1
Hulless
Regular (n=5)
74.3-79.3
Waxy (n=3)
75.4-77.7
PA +: proanthocyanidin-containing; PA -: proanthocyanidin-free.
- 25 -
59.7-63.9
59.0-61.1

Session 1: Feed and Food Quality – Oral presentations
Relationships between composition and discoloration potential of barley
Correlation analyses between the composition of barley kernels and L* values of dough sheets
are summarized in Table III. Total polyphenol content significantly correlated with the L* values
of dough sheets. A large variation in L* values of dough sheets among barley genotypes of
similar total polyphenol content (Table I) may indicate that, in addition to polyphenols, other
factors, including PPO activity and metal ions, may contribute to the discoloration of dough
sheets.
Relationships between PPO activity and L* values of dough sheets were not significant.
However, protein content and ash content exhibited significant negative correlations with L*
values of barley dough sheets in barley genotypes. Protein content may be correlated with an
unknown component that affects hardness or the rate of water binding during dough processing.
Highly negative correlation between wheat ash content and spaghetti brightness was also
reported by Matsuo et al (1982).
Table III. Simple Pearson Coefficients (r) a Between Composition and Brightness of Barley
Flour Dough
Composition Brightness of Dough (L*)
Total Polyphenols
Polyphenol Oxidase Activity
Protein
Ash
-0.910***
0.270
-0.714**
-0.469*
a *, **, *** = significant at P < 0.05, P < 0.01, P < 0.001, respectively.
Genotypic and environmental effects on discoloration potential of barley
Twelve genotypes of barley grown in five environments (location-year combination) were
analyzed to determine the relative contribution of genotype and environment on quality traits
associated with discoloration potential of barley. Both genotype (G) and environment (E)
contributed to significant variation for protein, ash, total polyphenol content, PPO activity and
brightness of dough sheets (Table IV). G × E interactions were also significant for all
parameters. Analysis of profile plots for all parameters with significant G × E interactions
indicated that total polyphenol content, PPO activity and brightness of dough sheets had noncrossover
interactions (Figure 1). Non-crossover interaction indicated that the rank of the means
for genotypes was unchanged although the magnitude of the differences between genotypes
changed among environments.
The ratios of genetic to environmental (G/E) variances showed that genetic factors had a larger
influence than environmental factors on total polyphenol content, PPO activity and brightness of
dough sheets (Table V). G/E variance ratios were similar in magnitude and nearly evenly
balanced for protein and ash content. These results indicate that genetic factors were more
important than environmental factors or G × E interactions in determining total polyphenol
content, PPO activity and brightness of dough. Therefore, the selection of barley genotypes
during the breeding process based on polyphenol content and PPO activity as well as dough
brightness, could be the effective way to control discoloration of barley-based food products.
- 26 -

Total Polyphenol (gallic acid, %
0. 4
0. 3
0. 2
0. 1
0
A
Pul 1 Pul 2 RS 1 RS 2 Rit 2
Session 1: Feed and Food Quality – Oral presentations
Waxy Regular PA + PA - )
PPO Activity (units/g
Flour Dough Brightness (L*)
- 27 -
250
200
150
100
50
0
85
80
75
70
65
60
55
B
C
Pul 1 Pul 2 RS 1 RS 2 Rit 2
Pul 1 Pul 2 RS 1 RS 2 Rit 2
Figure 1. Genotype (G) x environment (E) effect on (A) total polyphenol content, (B) polyphenol oxidase (PPO)
activity and (C) flour dough brightness (L*) of barley grown in 2001 and 2002 in three locations. PA + =
proanthocyanidin-containing; PA - = proanthocyanidin-free; Pul 1 = Pullman 2001; Pul 2 = Pullman 2002; RS 1 =
Royal Slope 1; RS 2 = Royal Slope 2; and Rit 2 = Ritzville 2002.

Session 1: Feed and Food Quality – Oral presentations
Table IV. Mean Squares for the ANOVA of Chemical Composition and Discoloration Potential
of Abraded Barley a
Source of
Variation
df
Chemical Composition
Total
Protein Ash
Polyphenol
Genotype (G) 11 16.2*** 0.20*** 0.049***
Environment (E) 4 40.9*** 0.39*** 0.016***
G × E
44 0.7** 0.01*** 0.001***
a
** and *** = P

Session 1: Feed and Food Quality – Oral presentations
Food barley development at the Crop Development Centre, University of
Saskatchewan
B.G.Rossnagel, T. Zatorski and G. Arganosa
Crop Development Centre/Plant Sciences Department, University of Saskatchewan, 51 Campus Drive, Saskatoon SK S7N 5A8
Food barley development at the Crop Development Centre (CDC), University of Saskatchewan
grew out of the longstanding hulless barley development program at the CDC. The food barley
sub-project was initially based on crosses made in the mid-1970’s with the 95% amylopectin
starch genotype “waxy Betzes” from Montana State University. These crosses, aimed at
producing hulless waxy barley, had been made with the original intent to produce barley
varieties that could be used to provide waxy starch for use in the solution mining system
employed in several Saskatchewan potash mines. While this utility has not come to pass to date,
the material provided an excellent base from which our food barley R&D efforts have developed.
Because of our joint program efforts on oat R&D, our resultant interaction with the oat food
industry, their keen interest in beta glucan and soluble dietary fibre in the 1980’s and our
knowledge of the tremendous variability in beta glucan content in barley germplasm, especially
in the waxy starch type, we were able to foresee a possible increased opportunity for barley in
the food industry and embarked upon specific food hulless barley development. Thanks to
support from the Saskatchewan Agriculture Development Fund and the Alberta Wheat Pool,
Agricore and now Agricore United we have been able to make good progress.
Selection for the waxy type has and is still conducted first by visual inspection of lines from
crosses between waxy starch and normal parents to select the waxy segregates. In hulless
material this is actually quite easy as the waxy segregates have a much lighter grain colour and,
if in doubt, one can cut through the kernel to see if the endosperm is floury. Initial chemical
selection was based largely on analysis of acid extract viscosity (AEV) as we did not have
affordable access to equipment to analyze large numbers of samples for beta glucan (BG). The
strong positive correlation between AEV and BG in waxy starch material allowed reasonable
success with this crude screening technique.
However, it is desirable to screen for both BG and AEV in order to develop a diverse selection of
high BG varieties with variable AEV for different end-users. Therefore, more recently the CDC
program annually screens a significant number of samples for both BG concentration and AEV.
BG is determined by Flow Injection Analysis (Aastrup, S. and Jorgensen, K.G., 1988) using a
Fiatron Flow Injection analyzer, Oconomowoc, WI and AEV (Greenberg, D.C. and Whitmore,
E.T. 1974) is determined using a Brookfield Digital Viscometer Model DV-II. We strongly
believe our combined selection for high BG and high AEV is a major reason for the repeated
desirability of our materials in various evaluations for food and industrial purposes.
While initially working mainly with the 95% amylopectin waxy starch types the program works
on 100% amylopectin starch types (pioneered at the CDC), has an effort dedicated to
improvement of high amylose (approx 40%) hulless types and has hulless compound granule or
fractured starch types under evaluation and development.
- 29 -

Session 1: Feed and Food Quality – Oral presentations
As indicated earlier, the 95% amylopectin waxy type is based on using “waxy Betzes” as the
original donor parent. Success to date in the program has been demonstrated by the release of
CDC Candle (1995) and CDC Rattan (2003). CDC Candle normally demonstrates BG
concentration of 6.5% – 7.0 % and has relatively high AEV. CDC Rattan shows a 0.8 %
improvement in BG with similar moderately high AEV (Table 1), and is much improved
agronomically being higher yielding, stronger strawed and demonstrating improved threshability
at harvest (Table 2).
Table 1. % Beta Glucan and Acid Extract Viscosity (cps) for five CDC varieties and four CDC
selections of hulless specialty starch barley at Saskatoon 2000 through 2004.
%BG AEV
Genotype 2000 2001 2002 2003 2004 2000 2001 2002 2003 2004
CDC McGwire 5.5 5.3 4.8 5.1 3.9 11 18 6 20 4
CDC Candle* 6.2 6.7 6.5 7.0 6.0 51 93 12 207 13
CDC Rattan* ----- 7.8 7.3 7.7 6.3 ----- 235 30 239 18
CDC Alamo** 7.0 7.9 7.9 8.0 6.3 41 207 52 93 19
CDC Fibar** 11.8 9.6 10.0 10.1 9.1 204 347 63 514 56
SR93139* 8.5 9.3 8.5 9.2 7.1 434 >1000 81 578 71
SB94893^ 8.5 8.4 8.2 9.6 7.6 46 58 22 220 11
SH99250^ ----- 6.8 7.9 8.7 7.3 ----- 22 14 34 7
SH99073^ ----- 7.7 8.0 9.2 7.0 ----- 55 8 94 7
* 95% amylopectin starch, ** 100% amylopectin starch, ^ high amylose starch
Note: lower BG and especially AEV levels in 2002 and 2004 indicate adverse (wet) pre-harvest
conditions.
Table 2. Agronomic, BG and AEV data 2001 and 2002 PRRCG, Western Canadian Hulless
Barley Cooperative test.
Yield Lodging Dirty Test Clean Test % Plump % AEV
% McGwire (1-9) Wt. (kg/hl) Wt. (kg/hl) Grain BG (cps)
CDC McGwire 100 3.4 74.1 78.6 76 4.7 16
CDC Candle 86 5.5 70.2 76.6 61 6.4 121
CDC Rattan 95 3.0 71.3 78.1 80 6.9 150
# Station Years 25 6 21 27 20 2 2
Crossing the CDC two row hulless waxy breeding line SB85750 and the six row hulless waxy
variety AzHul from the University of Arizona in 1990 to determine if the gene(s) giving rise to
the waxy starch in these different germplasm sources was the same gave two interesting results.
First was the indication that the genes controlling the waxy starch trait were different based on
the fact the some segregates from the cross had normal starch type. More interesting and
valuable was the result that some unique segregates had 100% amylopectin starch, a first in
barley development (Bhatty and Rossnagel, 1997), and we believe a first in that 100%
amylopectin barley starch is the only available native form of pure amylopectin starch.
Of considerable note with this unique waxy type was even higher levels of BG and AEV as
demonstrated by the varieties CDC Alamo (released in 1999) and CDC Fibar (released in 2003)
(Table 1). CDC Alamo normally has a BG concentration of near 8% with high AEV, while CDC
Fibar consistently produces BG concentration > 9% and has on several instance had BG > 10%.
- 30 -

Session 1: Feed and Food Quality – Oral presentations
While CDC Fibar has considerably higher BG and AEV, it does not offer any improvement in
agronomic performance (Table 3).
Table 3. Agronomic, BG and AEV data 2002 PRRCG, Western Canadian Hulless Barley
Cooperative test.
Yield % Lodging Dirty Test Clean Test % Plump % AEV
McGwire (1-9) Wt. (kg/hl) Wt. (kg/hl) Grain BG (cps)
CDC McGwire 100 2.4 74.2 77.8 75 4.7 5
CDC Candle 86 4.9 70.5 76.0 72 6.5 16
CDC Rattan 98 1.9 71.4 77.3 81 7.1 18
CDC Fibar 78 2.9 66.0 73.5 88 9.1 52
# Station Years 14 3 9 11 10 6 6
Within the 95% amylopectin waxy type, CDC selection SR93139 is of note in that it has BG
levels approaching that of CDC Fibar and has exceptionally high AEV (Table 1). These traits
may be an advantage in non-food industrial applications.
CDC high amylose hulless materials are represented specifically by SB94893 a two row
selection which derives its high amylose starch from the hulled genotype high amylose Glacier.
As is the case for high amylose Glacier, SB94893 has starch which is about 40% amylose and it
has high BG with moderately high AEV (Table 1). Food industry interest in high amylose types
is increasing as interest in “resistant starch” increases, since, relative to amylopectin, amylose
behaves like resistant starch. Unfortunately, our experience has been that developing
agronomically acceptable high amylose material from the high amylose Glacier background is a
definite challenge. While selections like SB94893 are certainly “growable” under normal field
conditions, these materials tend to be very tall, weak and relatively low yielding and we have put
much less effort into improving these types to date. With increased interest in resistant starch we
have recently increased efforts on this type.
Of note are CDC selections SH99250 (2 row) and SH99073 (6 row), both of which, while having
no evidence of differential starch type in their pedigrees, have been found to be high in amylose
and have elevated BG and somewhat elevated AEV levels (Table 1). As part of our ongoing
hulless food barley effort and our annual routine screening of 1000’s of selections for BG and
AEV we have always been on the lookout for normal starch lines with elevated BG and/or AEV
since some potential users have indicated a desire for > BG, but that the waxy or high amylose
starch was undesirable for their end-use(s). Based solely on high BG concentration, SH99250
and SH99073 were retained, advanced and increased for just that purpose.
However, since the pedigrees of these two lines gave no evidence either should have altered
starch type, they were not evaluated for amylose/amylopectin ratio until relatively recently and,
much to our surprise, both selections have elevated amylose levels. While not quite as high in
amylose as the 40% amylose derivatives from high amylose Glacier, these selections are
definitely not normal 25% amylose starch type, as they consistently demonstrate amylose levels
> 35%. Of special interest is that both of these selections have relatively good agronomic
performance and are much better field performers than high amylose Glacier derivatives. These
selections are currently being further evaluated and crosses have been between them and with
high amylose derivatives like SB94893 to determine if the high amylose in these unique
- 31 -

Session 1: Feed and Food Quality – Oral presentations
selections is under different genetic control. There is of course an outside chance that combining
these materials may also result in selections with amylose > 40%.
While not yet widely used in the food or non-food industries, considerable success has been
generated using our 95% and 100% amylopectin hulless waxy material at the research and
indeed even at the commercial level. In particular, research level efforts by N. Ames at the CRC,
AAFC, Winnipeg; T. Vasanthan and F. Temelli, University of Alberta; M. Izydorczyk and J.
Dexter, GRL, CGC, Winnipeg and M. Izydorczyk, J. Li and R. McCaig, CMBTC, Winnipeg
have demonstrated unique value for uses in tortillas, high soluble fibre snacks, BG extraction and
concentration, noodles and bread products. At the commercial level, InfraReady Products Ltd.,
Saskatoon has developed a unique, biodegradable, environmentally friendly cat litter,
LitterMate TM which is being marketed across western Canada, Cevena Bioproducts, Edmonton
has been using these high BG hulless barley materials as the basic feedstock for their BG
concentration and extraction process, Sapporo Breweries, Japan have expressed considerable
interest in the use of our 100% amylopectin materials CDC Alamo and CDC Fibar for a new
food barley venture in Japan, and the Saskatchewan potash industry has again expressed interest
in the possible use of these materials in their solution mining process.
In summary we see a good future for specialty starch hulless barley especially with elevated BG
(thus soluble fibre) levels, and are confident that our project will serve as a good base for these
purposes from a western Canadian plant breeding and barley R&D perspective.
References
Aastrup, S. and Jorgensen, K.G. 1988. Application of the calcofluor flow injection analysis
method for determination of beta-glucan in barley, malt, wort and beer. J. Am. Soc. Brew.
Chem. 46(3):76-81.
Bhatty, R.S. and Rossnagel, B.G. 1997. Zero amylose lines of hull-less barley. Cereal Chem.
74(2):190-191.
Greenberg, D.C. and Whitmore, E.T. 1974. A rapid method for estimating the viscosity of
barley extracts. J. Inst. Brew. 90:178-180.
Special acknowledgements
Dr. R. S. Bhatty, Professor Emeritus (CDC), University of Saskatchewan.
Dick Klaffke, Alberta Wheat Pool and Agricore (retired).
Funding acknowledgements
University of Saskatchewan
Saskatchewan Agriculture and Food
Saskatchewan Agriculture Development Fund
Alberta Wheat Pool
Agricore Ltd.
Agricore United
- 32 -

Session 1: Feed and Food Quality – Poster abstracts
Breeding for malt and feed quality barley in northern Australia
Glen Fox 1,5 , Jan Bowman 3 , Karyn Onley-Watson 1 , Andrew Skerman 1 , Gary Bloustein 1 , Alison Kelly 1 , Andy
Inkerman 1 , David Poulsen 4 and Robert Henry 2,5
1 Department of Primary Industries& Fisheries, Toowoomba, Queensland, Australia
2 Grain Foods Cooperative Research Centre, Lismore NSW, Australia
3 Montana State University, Bozeman, Montana, USA
4 Department of Primary Industries & Fisheries, Warwick, Queensland, Australia
5 Southern Cross University, Lismore NSW, Australia.
Most countries that produce barley classify their varieties as either malt or feed with the feed class
consisting of varieties that are not biochemically suited for malting. However, these varieties have
probably not been tested for any animal feed value. In a number of countries, including Australia,
more barley is used annually for feeding animals than used in beer production. Under Australian
feedlot conditions, anecdotal data had suggested that malt varieties were best for feeding cattle but
little data was available to support this generalisation. We have undertaken a study comparing over
30 Australian varieties and breeding lines to ascertain some scientific basis to this theory. Genotypes
from two sites and two years replicated trials were evaluated for malt and feed analysis. Results
indicated that the levels of resting grain components were similar for each end-use. There was no
apparent difference in total starch content between malt and feed. However, there were differences
for the in sacco Dry Matter Digestibility with the good feed and malt genotypes having low levels.
While there was no strong relationship for particle size (hardness) between malt and feed quality
there was a relationship within a genotype with feed type being slightly harder. This relationship was
independent of protein content. The most significant area of difference is the need for malt varieties
to produce moderate to high levels of enzymes to breakdown endosperm components during malting
and mashing. Varieties that performed especially well in both end-uses, ie good malt quality and
improved animal performance, were current malting varieties. The biochemical results to date
demonstrate that breeding programs could effectively select for improved malt and feed quality in
breeding lines by focusing on malt quality and selecting lines with high level of enzymes.
- 33 -
Corresponding author: glen.fox@dpiq.ld.gov.au

Session 1: Feed and Food Quality – Poster abstracts
Milling energy and grain hardness in barley
G. A. Camm and B.G. Rossnagel
Plant Sciences Department/Crop Development Centre, University of Saskatchewan, 51 Campus Drive, Saskatoon,
Saskatchewan S7N 5A8
Grain hardness is a product of the complex interaction between compositional and structural
endosperm components, including starch, protein and beta-glucan. Hardness may contribute
significantly to barley quality. Grain hardness can be evaluated by measuring the energy required to
mill (milling energy) or crush (hardness) the grain, with harder grain requiring more force. Our
research examines the relationship between milling energy and hardness of several feed and malting
barley genotypes grown at multiple locations and the influence of protein and moisture on grain
hardness.
Seven feed, one malting variety and one malting barley breeding line were grown in field trials at six
Western Canadian sites during 2003 and 2004 and evaluated for milling energy, hardness, moisture
and protein content. Milling energy was determined using the ‘Comparamill’ at the Scottish Crop
Research Institute (Scotland). Hardness and moisture were determined using the Perten Single
Kernel Characterization System (SKCS). Grain protein was estimated using Near Infrared
Transmittance (NIT).
Analysis of variance showed significant differences between genotypes and sites for all measured
traits (P = 0.99). Milling energy of genotypes
ranged from 617 to 736 joules (SE = 5.9). McLeod and CDC Dolly required significantly more
energy to mill, followed by Valier, Newdale, Xena and CDC Helgason. CDC Bold, TR253 and CDC
Trey required the least energy to mill, indicating a softer endosperm. Milling energy ranged from
625 to 709 joules across sites. SKCS hardness of genotypes ranged from 38.5 to 56.6 (SE = 0.77).
McLeod was hardest, followed by Valier, Xena and CDC Dolly. CDC Trey, Newdale, TR253, CDC
Helgason, and CDC Bold followed with CDC Bold being softest. SKCS hardness ranged from 40.4
to 55.8 across sites. Protein concentration of genotypes ranged from 10.8 to 12.0% (SE = 0.16).
McLeod, CDC Dolly and Newdale were highest followed by Valier, CDC Helgason, TR253, CDC
Bold, Xena and CDC Trey. Protein concentration ranged from 8.8% to 13.3% across sites. Moisture
of genotypes ranged from 10.1% to 10.5% (SE = 0.06), with larger differences between sites (7.4%
to 13.1%). Milling energy was correlated (n = 9) with SKCS hardness (r = 0.81, P =

Session 1: Feed and Food Quality – Poster abstracts
Low phytate barley (Hordeum vulgare L.) development at the Crop
Development Centre, University of Saskatchewan
B.G. Rossnagel 1 , T. Zatorski 1 , G. Arganosa 1 and V. Raboy 2
1 Department of Plant Sciences/Crop Development Centre, University of Saskatchewan, Saskatoon, SK, CANADA, S7N 5A8
2 U.S.D.A. Agricultural Research Service, National Small Grains Research Facility, 1691 So. 2700 W., Aberdeen, ID 83210, USA
Phytate, a complex of phytic acid (myo-inositol 1,2,3,4,5,6-hexakisphosphate) and other minerals, is
the primary form of phosphorous in barley grain. Monogastric animals do not effectively digest
phytate because they do not produce the phytase enzyme. Diets must be supplemented with
inorganic phosphorous (P) or a microbial phytase to meet minimum nutritional requirements.
Consequently, excreted phytate generates high levels of P in effluent resulting in possible
environmental pollution or eutriphication of waterways. Low phytic acid mutants (with
corresponding increases in free and available phosphorous) have been developed in Harrington
barley by Dr. V. Raboy, U.S.D.A. Hvlpa1-1 has 50% less phytate and M635 and M955 have 75%
and 95% less, respectively. Initial hybridizations of the low phytate genotypes were made in 1998 at
the Crop Development Centre (CDC) to adapted hulless parents in the combinations: Hvlpa1-1/CDC
McGwire and M635/CDC Freedom. Based on the uniformity of the original mutants from an
observation trial in 1999 the initial crosses were subjected to a rapid backcross breeding strategy with
CDC McGwire and CDC Freedom as recurrent parents. Four backcrosses were made for each hybrid
combination between 1999 and 2000 with each F1 being screened for phytate to retroactively identify
the low phytate F1 plants for the correct backcross in the greenhouse at the University of
Saskatchewan. BC4F1 generations were grown as bulk populations in 2000/01 in New Zealand
winter nurseries and the subsequent F2 populations were grown as space planted bulks at Saskatoon,
SK in 2001. The BC4F3 and BC4F4 generations were advanced using a modified single seed descent
procedure in the greenhouses at the University of Saskatchewan during the 2001/02 winter. BC4F5
lines were grown in the field at Saskatoon as F5 hill plots in 2002. Each hill plot was derived from an
individual F4 head. Selected hills were tested for phytate. Seed from selected low phytate F5 hill
plots was bulked and increased in 2002/03 winter nurseries in New Zealand. Selections were tested
in CDC yield trials in 2003, two of which, SR03013 (50% phytate reduction) and SR03044 (75%
phytate reduction), were advanced to the Western Canadian Hulless Barley Cooperative
(WCHBCoop) yield trial during 2004 as HB378 and HB379, respectively. HB379 has been
advanced for final year testing in the 2005 WCHBCoop and will be put forward for support for
variety registration in 2006. Growing 2 nd generation Breeder Hills in our 2004/05 New Zealand
contra-season nursery has allowed for rapid production of Breeder Seed of HB379 in 2005 in
anticipation of variety registration. Using this rapid breeding technique means we have moved from
1 st cross in 1998 to a released variety in 2006, a period of less than eight years.
- 35 -
E-mail: Brian.Rossnagel@usask.ca

Session 1: Feed and Food Quality – Poster abstracts
Post-anthesis biomass yield and quality of barley cultivars developed by
Field Crop Development Centre
Nyachiro* J.M., J.H. Helm and P.E. Juskiw
Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, 5030 – 50 St., Lacombe, AB T4L 1W8
Web Site: http://www1.agric.gov.ab.ca/app21/rtw/selsubj.jsp
*Corresponding author: joseph.nyachiro@gov.ab.ca
Over 2.5 million tonnes of barley silage is produced each year in Alberta to support the livestock
industry. Barley is a vigorous, early maturing crop that makes high quality silage and is also a
preferred feed grain for Alberta producers. The objective of this study was to determine postanthesis
(PA) biomass yield and quality of barley varieties and advanced breeding lines developed at
the Field Crop Development Centre (FCDC), Lacombe. Tests were grown at Lacombe from 1998 to
2004, excluding data for the drought year 2002. The varieties were grown in replicated field trials.
At about soft-dough growth stage (post-anthesis) the plots were harvested and wet weights
determined. Samples were analyzed to determine quality and percent moisture so dry weight could
be calculated. Sub-samples of biomass were analyzed for percent protein, acid detergent fibre
(ADF%), neutral detergent fibre (NDF%) and relative feed value (RFV) was calculated. Overall,
there were significant variations of 5 to 20 tonnes/ha of PA biomass yield among barley varieties.
On average there were no significant differences between the 2-rowed, 6-rowed or hulless barley
classes. Biomass protein for all varieties ranged between 8 and 15%. The 6-rowed and hulless
barley classes tended to have slightly wider range of protein values compared with the 2-rowed. The
ADF ranged between 20 and 40%. The overall NDF ranged between 30 and 65%, although the 2rowed
barleys showed a relatively narrower NDF range of between 39 and 59%. The overall RFV
varied between 85 and 200. The 2-rowed barleys showed narrower RFV values varying between 100
and 160 compared with either 6-rowed or hulless barleys. The ADF was positively correlated (r =
0.85) with NDF, and grain yield was positively correlated (r = 0.75) with biomass yield. The
biomass yields, protein % and grain yield showed no correlation to ADF, NDF or RFV. These
results suggest that it is possible to breed barley for high post-anthesis biomass yields and quality.
- 36 -

Session 1: Feed and Food Quality – Poster abstracts
Process development for quick cooking barley products
Hong Qi 1 ; Connie Phillips 1 ; M. Eliason 2 ; Karen Erin 3 and Feral Temelli 4
1 Centre for Agri-Industrial Technology, Processing Division, Alberta Agriculture, Food & Rural Development (AAFRD)
2 Agricultural Engineering Branch, Technical Services, AAFRD
3 Processing Division, AAFRD
4 University of Alberta
Barley is among the most ancient of the cereal crops. Canada is the world’s third largest barley
producer with an average annual production of 12 million tonnes. Alberta produces approximately
one half of the total Canadian production. A large percentage of the production is used as feed for
cattle, swine and poultry, while the second largest usage is in the malting industry. A limited amount
of barley is used for human food. The objective of this study was to develop processes for quickcooking
barley products to increase food barley consumption.
Alberta grown Falcon and AC Metcalfe cultivars were used for the study. The effects of variety,
pearling rate and pre-treatment on moisture uptake were studied. Moisture uptake was used to
evaluate the effect of each pre-treatment. Two processes were developed to produce quick-cooking
barley. The quick-cooking barley products reduced cooking time from 45 minutes to 15 minutes for
35% pearled barley and from 60 minutes to 18 minutes for 5% pearled barley. Quick-cooking barley
can be cooked by boiling in at least twice the volume of water for 15 to 18 minutes followed by a 5minute
stand. Quick-cooking barley products have a cooked texture, as measured by an Ottawa
extrusion method, with an average force of 450 N, an average bulk density of 530 kg/m 3 and an
appearance similar to long-cooking barley (cooking 35% pearled barley for 45 minutes and 5%
pearled barley for 1 hour).
There was a slight decrease in the beta-glucan content with the treatments except with the 35%
pearled AC Metcalfe, where the beta-glucan level increased. The 5% pearled barley had much
higher insoluble dietary fiber content than that of the 35% pearled barley samples. There was a slight
increase in the soluble fibre content with the pressure treatment compared with the untreated barley
samples.
There were no significant differences between the samples for overall acceptability or flavour, but
appearance and texture were significantly different. The steamed barley samples scored significantly
higher for appearance and colour than the pressure-cooked samples. The pressure-cooked barley
scored significantly higher than the steam-cooked samples for texture, bite and stickiness/looseness.
The successful development of a quick-cooking barley process provides an excellent
commercialization opportunity for processors to produce a human consumption barley product,
which could be conveniently incorporated into our daily diet.
- 37 -
Hong.qi@gov.ab.ca

Session 2: Pathology and Entomology
Monday, July 18, 2005 – p.m.
Session 2 - PATHOLOGY AND ENTOMOLOGY
Chairs
Kelly Turkington and Kequan Xi
Presenters
Flavio Capettini, ICARDA / CIMMYT, Mexico
T. Kelly Turkington, Agriculture & Agri-Food Canada, Lacombe Research Centre
Shipra Mittal, North Dakota State University
Seonghee Lee, North Dakota State University
- 38 -

Session 2: Pathology and Entomology – Oral presentations
International germplasm development for multiple disease resistance
Flavio Capettini 1 , Stefania Grando 2 , Salvatore Ceccarelli 2 , Amor Yahyaoui 2
1 ICARDA/CIMMYT Mexico
2 ICARDA Syria
Introduction
The International Center for Agricultural Research in the Dry Areas (ICARDA), with the
headquarters in Aleppo, Syria, is one of 15 centers strategically located all over the world and
supported by the Consultative Group on International Agricultural Research (CGIAR). With its
main research station and offices based in Aleppo, Syria, ICARDA works through a network of
partnerships with national, regional and international institutions, universities, non-governmental
organizations and ministries in the developing world; and with advanced research institutes in
industrialized countries. ICARDA serves the entire developing world for the improvement of
barley, lentil, and faba bean; and dry-area developing countries for the on-farm management of
water, improvement of nutrition and productivity of small ruminants (sheep and goats), and
rehabilitation and management of rangelands. The Global Barley Enhancement Program has its
headquarters in Syria, while the sub-program based in Latin America, targets the developing
countries in that region. The development of germplasm with resistance to the main biotic and
abiotic stresses has always had the highest priority in the program. Genetic resistance still is the
most environmentally-friendly and durable method of control of crop stresses, as well as the only
affordable method for low income farmers at different regions worldwide.
Disease Evaluation
To reach our objectives it is very important to have screening environments where it is possible
to maximize the response to selection for a determined trait. This many times implies the need to
decrease the environmental variation, giving the optimal conditions for disease development
(misting, inoculation) or stress expression (drought). This is possible in the environments that the
program uses regularly in different parts of the world. In Syria, selection is carried out at key
environments where the main diseases in the region can be reproduced. Selection for scald, loose
smut, covered smut, barley stripe, powdery mildew, net blotch and root rot are carried out at the
headquarters at Tel-Hadya, Aleppo. In Lattakia, selection is also performed for net blotch and
powdery mildew, while in Terbol (Lebanon), scald resistance is selected during the winter and
powdery mildew and leaf rust resistances during summer. In Haymana (Turkey), scald, net
blotch and powdery mildew resistances are selected.
In Mexico, key experimental stations have also allowed the accumulation of resistance to
different important diseases in an efficient manner. Toluca and El Batán, during summer time,
are key selection hot spots for several diseases. At Toluca, stripe rust, scald, Fusarium head
blight and BYDV can be selected with highest confidence. Heritabilities for Stripe Rust are
usually higher than 95% at Toluca (Vales et al., 2005). The inoculation of all the program
segregant material with scald and the natural infection with stripe rust as well as the artificial
inoculation of the advanced material with this disease, practically makes all germplasm coming
out from the program resistant to these diseases. At Ciudad Obregón during winter season, ideal
conditions for leaf rust allow us to confidently select for resistance to this disease in all the
- 39 -

Session 2: Pathology and Entomology – Oral presentations
inoculated segregant material. Again, most of the germplasm deployed is expected to be resistant
to this disease also.
Collaboration with Advanced Research Institutes and National Research Institutes
The close collaboration with centers of excellence or “Advanced Research Institutes” (ARIs) is
fundamental to develop the superior germplasm needed in the target areas, as well as the close
contact with the “National Research Institutes” (NARs) is essential to receive input about
research priorities. The ICARDA/CIMMYT program for Latin America has had long term
collaboration with several programs worldwide. Among the longest and most productive has
been the collaboration with the barley program of Alberta Agriculture, Food and Rural
Development, headed by Dr. James Helm. For many years, the synergistic interaction which
included germplasm exchange, screening and expertise, helped developing superior barleys with
resistance to 5-7 important diseases. No less important has been the interaction with the barley
program at Oregon State University, mainly regarding stripe rust research. That program under
the leadership of Dr. Patrick Hayes, made it possible to map several populations, while carrying
out the phenotyping at Toluca. These studies have helped to understand the genetics of the
diseases and generated germplasm with pyramided genes for resistance available to all the
programs in the region and worldwide. The participation in the now discontinued North
American Stripe Rust Nursery, coordinated by Drs. Bill Brown and Vidal Velasco, allowed for
the determination of the level of resistance to Stripe Rust present at the different programs in
North America, and to use the resistance for germplasm enhancement. The screening of the
Australian programs through the PBI of the University of Sydney, under the leadership of Dr.
Colin Wellings, also reaches the same objectives with that country. More recently, the
collaboration with Bush Agricultural Resources Inc. (BARI) through Dr. Leslie Wright and
Linnea Skoglund allowed us to incorporate malting quality in our multiple disease resistant
gemplasm. Using their malting barley varieties as templates, in one cycle of breeding it was
possible to obtain attractive lines that combined resistance levels to the main diseases at higher
level than the parents. In following cycles additional gains in the agronomic and quality traits are
expected.
Undoubtedly one of the greatest challenges that the barley programs in the region and worldwide
has faced in the last decade has been the epidemic outbreaks of Fusarium head blight (FHB). As
several of us know, FHB has always been present in the barley cultivated area, but never in the
proportions and frequency reached lately. The epidemic patterns appear to repeat in several
countries worldwide. After the outbreak in the Midwestern US in 1993, outbreaks of different
intensities have occurred in Uruguay, Brazil, Peru, Ecuador, etc. This supports the need to
continue intensively working with this destructive disease. Our program has, in several
opportunities, linked the NARs and the ARIs in order to facilitate research exchange. Our
collaboration within the US Wheat and Barley Scab Initiative has been essential to support our
research as well as to keep scientists updated with the latest research advances. Probably as with
no other disease has the interaction among colleagues and the synergistic relationships been so
important, from the collaborative germplasm screening networks to the brainstorming sessions
carried out when working together, from China to the Midwest or Mexico.
- 40 -

Breeding Strategies
Session 2: Pathology and Entomology – Oral presentations
ICARDA/CIMMYT - México
Since the early 1980s, several programs have been involved in breeding for disease resistance.
The program in Mexico took advantage of collaboration and experience to build the foundation
of resistances to the different diseases. Webster et al. (1980) screened 18,000 accessions from
the world barley collection for scald resistance. They found 273 entries that showed no
symptoms. Resistant entries were introduced and screened for virulence in Central Mexico. From
the 273, 13% showed susceptibility under those conditions and were discarded.
The national research program at Colombia screened 8,650 accessions for race 24 of Puccinia
striiformis f. sp. hordei (Anonymous, 1984). In Mexico, 285 entries were found to be resistant
out of 11,087 accessions screened at CIANO experiment station in Obregón for races 8, 19 and
30 of P. hordei . Vivar (1986) in México and Takeda and Heta (1989) in Japan screened 5,000
accessions and found 23 lines with resistance to FHB. The germplasm identified above was used
as the starting point for disease resistance in the program.
Resistant germplasm was evaluated against the virulence of the most aggressive pathogens
collected and introduced into the US and Europe from hot spots around the world. Work on leaf
rust by Sharp and Reinhold (1982) in Montana and Parlevliet in Holland (1977) helped the
program identify parents to use in the crossing program. To accomplish the goal of introgressing
the resistance of all those diseases into high yielding germplasm, “templates” were developed,
first for scald and leaf rust, followed by templates to which stripe rust and other diseases
resistances were added. Over a period of 25 years (two growing seasons per year) different
diseases were pyramided. Varieties produced appeared to be commonly resistant to scald, leaf
rust, stripe rust and stem rust, BYDV, net blotch and spot blotch and since several cases also to
FHB. Besides the resistance, the agronomic type made the germplasm attractive enough to be
extensively used as cultivars or as source of resistance by our colleagues.
ICARDA – Syria
To target the poor, the breeding philosophy of the project, which evolved during the last 14
years, is based on exploiting specific adaptation through direct selection in the target
environments using locally adapted germplasm and sustainable levels of external inputs.
The two major implications of this philosophy were that (1) many varieties were generated by
national programs, each adapted to specific conditions, and (2) the superior performance of the
varieties developed for low-input and less-favored lands are not dependent on agronomic
practices that require large amount of inputs. A breeding program based on this philosophy does
not endanger biodiversity, and is environmentally benign.
A fundamental question the barley program has addressed in the last 14 years is why plant
breeding has been beneficial to those farmers who either enjoy favorable environments or could
profitably modify their environment to suit new cultivars, and it has not been equally beneficial
to those farmers who could not afford to modify their environment through the application of
additional inputs. Farmers in favorable environments, using high quantities of inputs, are now
concerned with the adverse environmental effects and the loss of genetic diversity. Poor farmers
in less-favored environments continue to suffer from chronically low yields, crop failures and, in
- 41 -

Session 2: Pathology and Entomology – Oral presentations
the worse situations, malnutrition and famine. Because of its past successes, conventional plant
breeding has tried to solve the problems of poor farmers living in unfavorable environments by
simply extending the same methodologies and philosophies applied earlier to favorable, high
potential environments. We have now concluded that difficult environments and resource-poor
farmers require a different type of breeding.
Using contrasting sites in NW Syria we found repeatable genotype x environment (GE)
interactions of crossover type between the main experiment station and experiment sites
managed according to farmers' practices. GE interactions of crossover type are common in the
literature, in different crops and in different types of stress environments. We then concluded that
selection in high input experimental stations is very effective in generating varieties for favorable
environments, but does not allow the identification of the best genotypes for less-favored lands,
and promotes genotypes which are in fact inferior in stressful conditions.
Formal breeding has taken a negative attitude towards GE interactions of crossover type, in the
sense that only breeding lines with low GE interaction (good average grain yield, across
locations and years) are selected, while lines with good performance at some site and poor
performance at others are discarded. Because lines with good performance in unfavorable sites
and poor response to favorable conditions have a low average grain yield, they are systematically
discarded. Yet they would be the ideal lines for farmers in unfavorable locations. Therefore,
having recognized the importance of GE interactions of the crossover type, a major conclusion
has been that breeding for difficult environments must be based on the exploitation of specific
adaptation, and this in turn can only be done by selecting directly in the target environments.
While the application of this philosophy started being successful in Syria with the adoption of
three varieties in stress environments, the next question was: how to reconcile the mandate of an
international breeding program with the importance of specific adaptation?
The response to this question has been the decentralization of the breeding work. The term
decentralization has been used often to describe two fundamentally different processes, namely
decentralized selection and decentralized testing.
Decentralized selection is a term first used by Simmonds (1984) and defined as selection in the
target environment(s). Decentralized selection has been also termed in-situ or on-site selection.
In the case of self-pollinated crops it consists in selection of early segregating populations (such
as F2) in a number of locations representing the target environment(s) (climate, soil, farming
system and management) the breeding program aims to serve. Decentralized selection becomes
selection for specific adaptation when the selection criterion is the performance in specific
environments rather than the mean performance across environments.
Decentralized selection is different from decentralized testing, which is a common feature of
breeding programs and takes place, usually in the form of multi-location trials and on-farm trials,
after a number of cycles of selection in one or few environments (usually with high levels of
inputs).
- 42 -

Session 2: Pathology and Entomology – Oral presentations
Addressing the issue of resistance to biotic stresses, it is acknowledged that barley is affected by
several foliar and root diseases, several insects, nematodes, and viruses. The organisms which
can potentially damage a barley crop can be divided in two broad categories, namely those which
are specific (either as organism or as a physiological race) to a given country or area, and those
which are widespread to several countries.
The overall strategy, once the priority biotic stresses have been identified together with NARs, is
to decentralize the work on biotic stresses of the first type to NARs following the development of
the necessary expertise, and to concentrate at the headquarters on the second type of biotic
stresses. The latter is an ideal ground for collaboration with ARIs.
Within this broad strategy, the work on biotic stresses is integrated in the more general,
decentralized approach to plant breeding followed by the project.
In the case of foliar diseases, insects and viruses, the screening of large amount of breeding
material, which has represented 90% of the activities in the past, has been gradually reduced to
about 10% of the total work on biotic stresses. Eventually, screening was entirely transferred to
NARs. Specific pests are tested at hot spots, and information circulated to all collaborators.
Sources of resistance are being characterized at the headquarters which focus on the transfer of
genes for resistance into the breeding material developed by the decentralized program for
specific countries and/or regions. In these cases the national programs receive F4 families
homozygous for the resistance gene(s), but variable for everything else. This is done at the
headquarters in the case of genes with non-specific resistance (for example, the genes for
resistance to RWA and BYDV), and within five years it will be done routinely with the aid of
molecular markers. These first molecular markers assisted selection programs will also be used
to train national program scientists.
In the case of foliar diseases, where a large variability exists for physiological races, the
responsibility of the headquarter pathologist is the identification of genes which are effective
against the virulences of target countries/regions. Sources of resistance for these genes are used
in the targeted crosses at the headquarters, but the selection of the segregating populations are
done in the target environments. Marker assisted selection will be made available to NARs to
increase the efficiency of selection.
Two areas which need expansion are a) scab, root diseases and nematodes, and b) durable
resistance and population improvement.
The entire area of durable resistance, and of the consequent changes in the breeding strategies
which are needed, are addressed by the barley project, and at least one case-study is being
developed to address one of the most variable foliar diseases (powdery mildew) with two
alternative strategies, one based on deployment of major genes and one based on the increase of
horizontal resistance through population improvement.
- 43 -

Results Obtained
Session 2: Pathology and Entomology – Oral presentations
In decentralized selection, the barley project at ICARDA continues to generate genetic variation
by maintaining a large crossing program, but selection is carried out by the breeders in the
National Programs. At this moment, decentralization of barley breeding is fully implemented in
North Africa, Iraq and Ethiopia, and it is gradually being implemented in the Mediterranean
highlands in the framework of the ICARDA/Iran Project, and in other countries (Table 1).
Table 1. Countries and regions where decentralized barley breeding has been initiated.
Country/Region Countries/Area Status
North Africa Egypt, Libya, Tunisia, Algeria, Morocco Fully implemented
Iraq (Baghdad) Central Iraq Fully implemented
Iraq (Mosul) Northern Iraq Fully implemented
East Africa/Red Sea Yemen, Eritrea, Tigray First crosses made in 1998
Ethiopia Ethiopia (except Tigray)
Use of local landraces fully implemented, first
crosses in 1998.
Central Asia First special nursery in 1997
Turkey First nursery planned for 1999
Cyprus Cyprus First special nursery in 1995, first crosses in 1998
Far East India, Thailand, Vietnam, China First special nursery in 1996, first crosses in 1997
Pakistan Pakistan First special nursery in 1997
Gulf Countries S. Arabia, Qatar, Oman First crosses made in 1992
Ecuador Ecuador First nursery planned for 2006
The project in Latin America has been successful in developing useful germplasm adopted by the
programs in the main target area, as well as in some other regions worldwide. In Ecuador, all the
commercial varieties are directly released from material received from Mexico, or were derived
from crosses made with that germplasm, and selected in the country. In Uruguay, Brazil and
México, germplasm has been intensively used as a source of disease resistance as well as to
improve agronomic types. The same situation occurred with several of the most planted varieties
released in Peru in the last 25 years. According to information received from China (Dr.
Zhonghu He, CIMMYT representative in China, personal communication), the area planted to
barley in 2000 with germplasm developed by the program (either direct introduction or varieties
derived from past introductions) account for 40% of the one million hectares cultivated to barley
in the country. The key traits for a successful variety in that region is the resistance to FHB,
tolerance to barley yellow mosaic virus (BYMV) and consistent high yield potential.
The strategy used to incorporate leaf rust resistance into Shyri, a variety released in Ecuador,
may explain the durability of the resistance obtained. The virulence present in that country is
capable of overcoming all major resistance genes (Brodny and Rivadeneira, 1996). Shyri was
released in 1989 with low symptoms for leaf rust. After two years a race was able to overcome
the major gene located on chromosome 1 of the variety (Toojinda et al., 2000), however it
- 44 -

Session 2: Pathology and Entomology – Oral presentations
produced reasonable yield despite the presence of symptoms on leaves late in the season. In 1991
Ochoa concluded that Shyri had partial resistance that delays disease development.
In Stripe rust, the collaboration with Oregon State University has been fundamental to
understand the genetics of resistance and create germplasm which pyramids resistance genes
from different sources. Using resistance sources as Shyri, Calicuchima (a variety also released in
Ecuador) and CI10587, mapping studies determined that resistance QTLs were present in the
chromosome 1H in Shyri, 4H and 5H in Calicuchima and a major gene was present at the 7H in
CI10587 (Picture 1). The importance of this type of study was evident when new resistance
patterns were observed in Peru and Ecuador after the year 2000. After more than 15 years of no
observed changes, several well known resistant lines appeared as susceptible in that region. The
pyramided germplasm allowed us to determine that the resistance QTLs and major gene present
at chromosomes 4H, 5H and 7H were susceptible to that putative new race of the disease, while
the QTL at Chromosome 1H (from Shyri) was still holding resistance. All the germplasm
developed by OSU was planted in those countries, and are expected to collaborate in the
development of varieties that still are resistant in the region. Although in North America the old
sources still appear as resistant, it is expected that, like has occurred in the past, the possible new
race would come to the region and change the resistance patterns of the varieties present there
also.
Picture 1.
Pedigree developed by Patrick Hayes, Oregon State University.
- 45 -

Session 2: Pathology and Entomology – Oral presentations
Another example of progress in the fight against disease losses has been the case of FHB. When
FHB epidemics occurred in the Midwestern US after 1993, the barley program at México had
already been working in that disease for several years. That allowed the main source of
resistance to become available to the US programs that were re-starting their work with FHB.
Several well-known resistance sources like Atahualpa, Shyri, Gobernadora, etc. were rapidly
introgressed into the programs. At present, the collaboration is in a more formal fashion, through
the USWBSI. This has allowed the testing of high numbers of genotypes every year and
participation in the testing network at different locations allows confirmation and sharing of the
resistance observed. In the Table 2 we can see some lines developed through the agreement with
BARI that have had their resistance confirmed at several locations.
In recent studies of the resistance sources for scald used in the program, slow-scalding resistance
(S-SR) appeared to be present in the core material released by the program. Little was known
about the inheritance of S-SR. Studies carried out by B. Sorkhilalehloo et al. (2001, 2004)
showed indications of incomplete dominance for that trait and additive variance was the major
portion of total genetic variance for S-SR. The estimates of narrow-sense heritability of S-SR
were quite high (0.80-0.98). Such resistance genes with additive effects and high heritabilities,
should support successful phenotypic selections for S-SR in early generations, and are promising
for pyramiding resistance genes for achieving stable resistance against barley scald using backcrossing
methodology. The results also showed that none of the barley genotypes were immune
against all the isolates used in the study. However, the cluster of “highly resistant” genotypes
contained barleys resistant to the majority of the pathotypes among which there was some
malting, hulless, slow-scalding, and differential lines as promising potential sources of stable
resistance to scald.
The more than 20-year collaboration with the FCDC in Alberta, focusing on scald resistance and
other diseases, has allowed both programs to develop germplasm resistant to all the regionally
important diseases. New combinations of resistance genes have been found, with some lines
containing resistance to 5 and 6 diseases. Helm et al. (2004) determined that these gene
combinations for scald resistance should give durable resistance in Canada and México. The
classification of breeding lines according to resistance genes combinations is currently under
pedigree analysis to determine the relationship for sources of resistance genes. Some of the lines
from the collaborative program also showed high level of resistance to FHB in Mexico, Canada,
USA and China.
- 46 -

Session 2: Pathology and Entomology – Oral presentations
Table 2. Sample of 6-row barley lines with mating quality parents and higher levels of resistance to FHB and other diseases and desirable agronomic traits.
Entry Cross FHB P.hodei Protein Yield PS*
(%) (%) (%) (%) (1-5) (0-5) (Cobbs) (%) (t/ha) (1-5)
Type I Type II Type I
Hangzhou Toluca Toluca Toluca ND Brandon Obregón Obregón Obregón Mean
2004 2004 2004 2003 2004 2004 2004 2004 2004
254 6B89.2027/CHAMICO 5.9 3.0 2.5 0.15 R 13.7 5.4 4.25
77 LEGACY//PENCO/CHEVRON-BAR 2.3 4.4 1.52 3 2.5 60S 11.0 8.1 1.75
148 LEGACY/3/SVANHALS-BAR/MSEL//AZAF/GOB24DH 8.2 2.0 10.3 0.64 R 14.6 3.9 2.50
147 LEGACY/3/SVANHALS-BAR/MSEL//AZAF/GOB24DH 11.1 1.4 4.1 1.32 R 14.3 4.3 3.00
55 LEGACY/4/TOCTE//GOB/HUMAI10/3/ATAH92/ALELI 6.3 1.7 4.0 0.38 1 1.5 R
11.4 6.8 2.25
53 LEGACY/4/TOCTE//GOB/HUMAI10/3/ATAH92/ALELI 5.3 1.4 3.9 0.13 2 4 R
11.3 6.4 3.00
54 LEGACY/4/TOCTE//GOB/HUMAI10/3/ATAH92/ALELI 1.1 4.1 1.09 1 2 R 12.7 6.0 2.75
60 LEGACY/4/TOCTE//GOB/HUMAI10/3/ATAH92/ALELI 1.0 13.3 1.71 1 2.5 R
11.7 5.8 4.50
65 LEGACY/4/TOCTE//GOB/HUMAI10/3/ATAH92/ALELI 2.3 6.0 2.14 1 3 R 12.0 6.5 3.25
73 LEGACY/4/TOCTE//GOB/HUMAI10/3/ATAH92/ALELI 0.8 4.0 1.80 1 3 R 10.9 6.0 3.00
CHEVRON 3.4 1 1.5
STANDER 9.6 5.15 13.94 3 3 80S 13.0 4.6 3.0
LEGACY 13.2 6.32 60S 13.0 5.5 3.0
PS = Phenotypic Score 1 = Best; 5 = Worst
- 47 -

Conclusions
Session 2: Pathology and Entomology – Oral presentations
Giving support to research programs and producers in developing countries raises challenges that
sometimes are not only technical. Despite historical fluctuations in resources available for
research, the system implemented has been successful in deploying germplasm and products
highly demanded by the customers – either NARs in developing countries or producers in those
areas. Successful strategies have to be flexible and adapted to the different and highly variable
target areas, and academic recipes most often cannot be directly applied.
The results obtained would have been impossible to reach without the close collaboration with
the NARs as well as the ARIs worldwide. Sometimes the roles of our international research
programs were to serve as catalysts and facilitators for cooperation among these groups. The
unique situation created by the links and networks has allowed the confirmation of the results
found in one location and around the world, an approach that is now being validated with other
working groups from developed countries (e.g. USWBSI). In addition to the developing areas of
the world, the products obtained have also been beneficial to the ARIs and programs present in
developed countries.
References
Anonymous (1984). Control de la roya amarilla y parda en cebada. Colombia, 1975-84.
Programa Nacional de Cereales Menores, Intituto Colombiano Agropecuario, Bogota,
Colombia.
Brodny, U. and M. Rivadeneira. 1996. Canadian Journal of Plant Pathology 18:375-378.
Helm, J.H., H. Vivar, F. Capettini, K. Xi, P. Juskiw, J. Zantinge. 2004. Multiple disease
resistance in barley. In Agronomy Abstracts. 2004 ASA-CSSA-SSSA International Annual
Meetings with the Canadian Society of Soil Science Seattle, Washington - Oct 31 - Nov 4,
2004.
Parleviet, J.E. and H.J. Kuiper. 1977. Neth. J. Plant Pathol. 83:85-89.
Simmonds, N.W. 1984. Principles of crop improvement. Longman, London and New York, pp.
408.
Sharp, E.L. and M. Reinhold. 1982. Plant Disease 66:1012-1013.
Sorkhilalehloo B., J.P. Tewari, F. Capettini, T.K. Turkington, K.G. Briggs, B. Rossnagel, and
R.P. Singh. 2004. Genetical components of resistance in slow-scalding genotypes of barley:
Implications for breeders and pathologists. Presented at the PPSA 2004, Lacombe, Canada.
Sorkhilalehloo, B., J. P. Tewari, T. K. Turkington, F. Capettini, K. G. Briggs, B. Rossnagel, and
R. P. Singh. 2001. Slow-scalding in barley, a novel strategy for disease management. Can. J.
of Plant Path. 23(2):190.
Takeda, K., and H. Heta. 1989. Establishing the testing method and a search for resistant
varieties to Fusarium head blight in barley. Japan. J. Breed. 39:203–216.
Toojinda, T., L.H. Broers, X.M. Chen, P.M. Hayes, A. Kleinhofs, J. Korte, D. Kudrna, H. Leung,
R.F. Line, W. Powell, L. Ramsay, H. Vivar and R. Waugh. 2000. Mapping quantitative and
qualitative disease resistance genes in a doubled haploid population of barley (Hordeum
vulgare). Theoretical and Applied Genetics 101:580-589.
Vales M. I., C. C. Schön, F. Capettini, X. M. Chen, A. E. Corey, D. E. Mather, C. C. Mundt, K.
- 48 -

Session 2: Pathology and Entomology – Oral presentations
L. Richardson, J. S. Sandoval-Islas, H. F. Utz, P. M. Hayes. 2005. Effect of population size
on the estimation of barley stripe rust QTL. Theoretical and Applied Genetics. On press.
Vivar, H.E. 1986. Cereal Improvement Program. ICARDA Annual Report.
Vivar, H.E. 2000. Building multiple disease resistance in a high yielding platform. In.
Proceedings of the 8 th International Barley Genetics Symposium. Adelaide Convention
Center, October 22-27 2000.
Webster, R.K., L.F. Jackson and C.W. Schaller. 1980. Plant Disease 64:88-90.
- 49 -

Session 2: Pathology and Entomology – Oral presentations
Differential response of barley cultivars and accessions to Rhynchosporium
secalis under field conditions
Turkington, T.K. (1), and Xi, K. (2)
1: Lacombe Research Centre/Beaverlodge Research Farm, Agriculture and Agri-Food Canada, Lacombe, AB, T4L 1W1.
turkingtonk@agr.gc.ca
2: Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, C/O Lacombe Research Centre,
Agriculture and Agri-Food Canada, Lacombe, AB, T4L 1W1
Introduction
To ensure an adequate supply of feed many farmers grow barley continuously for several years,
and often it is the same cultivar year-after-year. However, continuous production of the same
resistant barley cultivar places substantial selection pressure on the scald pathogen,
Rhynchosporium secalis [Oudem.] J.J. Davis. Research has shown that there is a tremendous
amount of diversity in the scald pathogen and therefore potential for rapid changes in the
prevalent genotypes of the pathogen in response to the barley cultivars being grown, with some
scald races having the ability to attack either individually or in combination several known
sources of resistance (Tekauz 1991; Xi et al. 2002, 2003). A recent study demonstrated that
barley cultivar rotation can be a potential short-term strategy to help reduce leaf disease levels
and maintain crop productivity for Alberta barley producers where crop rotation options are
limited due to feed requirements or market factors (Turkington et al. 2005). One of the cultivars
used in the study, Kasota has maintained a relatively high level of resistance to the scald
pathogen over a number of sites and years in Alberta (Xi et al. 2003). However, in the cultivar
rotation study, although not statistically significant, there was a tendency for greater scald
severity when Kasota was grown continuously under barley cultivar monoculture (BCM)
compared to its production under barley cultivar rotation or in rotation with triticale. Scald
severity on Kasota was very low (

Materials and methods
Session 2: Pathology and Entomology – Oral presentations
Thirty-three barley accessions and cultivars with major resistance genes were studied for their
differential reactions to R. secalis (Table 1). The 4 scald pathotypes used were derived from
single spores collected from infected leaf material from each of the barley cultivars Kasota,
Seebe, CDC Earl and Harrington collected from several experimental sites. Fertilizer applied to
the experimental area consisted of 202 kg/ha of 13-22-22-0, which was broadcast and
incorporated into worked pea stubble. Hill plots, consisting of 8-10 seeds planted in a single
hole on 0.5 m centers, were arranged in a 4-replicate RCBD for each pathotype. Each pathotype
trial was seeded a minimum of 15 m from another. Weed control was accomplished 8 June,
2004 with a tank mix of Refine Extra ® at 20 g/ha and Puma Super ® at 360 mL/ha. Scald
inoculum was prepared from 2-3 week old cultures grown on lima bean agar. Culture plates
were scraped using reverse-osmosis water and a hand-held battery operated toothbrush. The
spore concentration was adjusted to 10 5 spores/ml and 2.5 L of inoculum for each pathotype was
applied as a fine mist using a compressed air sprayer on 14 June and 28 June, 2004. After spores
were sprayed onto hills, the cut up agar from the scraped plates from each pathotype was
uniformly placed on the respective hills. Hills were rated for percent leaf area diseased (PLAD)
using a 0-9 scale (0 = no disease in the lower, middle and upper canopy, 9 = >50% leaf area
diseased in lower, middle and upper canopy) on 5 August, 2004.
An analysis of variance of the data was conducted separately for each pathotype using the PROC
MIXED procedure of SAS, with block as a random effect and cultivar as a fixed effect (Littel et
al. 1996). For significant effects LSD values were derived to allow for further exploration of
treatment differences. Treatment effects were declared significant at P ≤ 0.05. A rating index
was also derived from the mean cultivar ratings for each pathotype. Absolute differences in
ratings were then calculated among all pathotype combinations and then summed for each
cultivar to derive the rating index. A rating index of 0 indicated that the rating for a cultivar
remained the same among the pathotypes tested; however increasing index values indicated that
ratings changed from one pathotype to the next. Spearman’s rank correlations were calculated
among the mean cultivar ratings for each of the pathotypes and were declared significant at
P

Session 2: Pathology and Entomology – Oral presentations
Table 1. Mean scald severity for barley accessions and Alberta cultivars, scald pathotype field
study, Lacombe, Alberta, 2004.
Pathotype and scald severity (0-9 scale)
Accession/cultivar †
Kasota Seebe CDC Earl Harrington Mean Rating index
Abyssinian 2.5 2.8 2.3 3.0 2.6 2.5
AC Harper 6.5 5.8 6.8 6.3 6.3 3.3
AC Stacey 9.0 4.5 3.8 3.5 5.2 17.3
API/CM67-B//AGER 8.3 6.5 6.5 5.5 6.7 8.3
Atlas 9.0 4.0 3.8 4.3 5.3 16.0
Atlas46 4.5 2.5 4.0 3.8 3.7 6.3
Atlas68 6.5 4.0 6.3 4.8 5.4 9.0
CDC Dolly 9.0 5.5 4.8 4.3 5.9 15.0
CDC Earl 6.3 6.5 9.0 8.5 7.6 10.3
Duke 5.5 5.5 7.5 7.5 6.5 8.0
Falcon 7.0 6.8 5.5 5.8 6.3 5.5
Gatillo-Bar 7.0 2.5 4.0 3.8 4.3 13.8
Harrington 9.0 9.0 8.8 8.3 8.8 2.5
Jaeger 6.8 4.8 8.8 7.5 6.9 12.8
Johnston 5.8 4.8 6.0 4.8 5.3 4.8
Kasota 8.8 4.3 3.8 3.5 5.1 16.3
Kitchin 4.8 4.0 4.3 3.8 4.2 3.3
Leduc 6.3 6.8 7.5 4.5 6.3 9.5
Mahigan 8.8 3.8 4.3 4.0 5.2 15.3
Manny 5.8 1.0 0.8 2.0 2.4 16.0
Modoc 6.0 6.5 8.0 6.5 6.8 6.0
Niobe 6.3 5.3 9.0 7.8 7.1 12.8
Niska 8.5 7.5 4.3 5.8 6.5 14.5
Osiris 3.8 1.5 3.0 2.5 2.7 7.3
Peregrine 7.0 8.0 7.5 7.3 7.4 3.3
Ponoka 8.5 5.0 3.8 3.8 5.3 15.5
Seebe 3.5 3.3 3.3 2.5 3.1 3.0
Shyri 3.8 3.8 3.5 3.8 3.7 0.8
Trebi 7.3 6.5 7.3 7.3 7.1 2.3
Trochu 7.8 6.5 8.0 6.5 7.2 5.8
Turk 3.3 2.8 5.8 4.0 3.9 9.8
Vivar 7.8 7.5 8.3 6.5 7.5 5.5
LSD .05 1.1 1.5 1.3 1.1
Mean pathotype severity 6.6 5.0 5.6 5.1
†
Hudson data not included due to winter growth habit. No symptoms occurred on Hudson with the
Kasota, Seebe, and CDC Earl pathotypes, while trace to low scald levels were observed for the
Harrington pathotype.
- 52 -

Session 2: Pathology and Entomology – Oral presentations
the Seebe pathotype. The lowest levels of scald were observed on Manny, Osiris, Gatillo-Bar,
Atlas46, Turk, Abyssinian, Seebe, Mahigan, and Shyri, while the highest levels were observed
on Harrington, Peregrine, Niska, and Vivar. All other cultivars and accessions had intermediate
diseases levels. For the CDC Earl pathotype, Manny, Abyssinian, Osiris, Seebe, Shyri, Kasota,
AC Stacey, Ponoka, and Atlas had the lowest disease levels, while CDC Earl, Niobe, Harrington,
Jaeger, Vivar, Modoc, Trochu, Duke, Leduc, Peregrine, and Trebi had the highest. The
remaining cultivars and accessions had intermediate levels of disease. For the Harrington
pathotype the lowest levels of disease were observed on Manny, Seebe, Osiris, Abyssinian, AC
Stacey, Kasota, Shyri, Ponoka, Kitchin, Gatillo-Bar, and Atlas46, while the highest levels were
observed on CDC Earl, Harrington, Niobe, Duke, Jaeger, Peregrine, and Trebi. Intermediate
scald levels were observed on the remaining cultivars and accessions.
When averaged over the four separate pathotype experiments, cultivars Manny and Seebe had
among the lowest scald severities, while Harrington, CDC Earl, Vivar, Peregrine, Trochu, Niobe,
and Jaeger had among the highest levels of scald, while the remaining cultivars had intermediate
disease levels. Of the accessions, Abyssinian, Shyri, Osiris, Atlas46 and Turk had among the
lowest disease severities, while API/CM67-B//AGER, Modoc, and Trebi had the highest scald
levels. A greater potential for pathotype specific responses were indicated by the ranking index
for a number of cultivars with higher index values, especially for AC Stacey, CDC Dolly,
Kasota, Mahigan, Manny, and Ponoka. For example, AC Stacey, Kasota, Manny, and Ponoka
tended to have the highest levels of disease with the Kasota pathotype, while CDC Earl, Duke
and Niobe tended to have the highest rating when inoculated with either the CDC Earl or
Harrington pathotype. Accessions with the highest index values included Atlas, which tended to
have the highest rating with the Kasota pathotype. Consistently low ratings over all pathotypes
and lower rating index values occurred for Seebe, Shyri, Osiris, Abyssinian, and Kitchin, while
consistently higher ratings and lower index values occurred for Harrington, Peregrine, and Trebi.
Results from Spearman’s rank correlations suggested that there may be an interaction between
pathotype and cultivar. Confounding with location by cultivar interaction effects may be a
potential concern; however, all four experiments were planted in the same experimental field and
were only spaced 15 to 25 m apart. In addition, seedbed preparations, fertilizer, seeding
methodologies, seeding date, and inoculation protocols were similar. Thus, cultivar differences
were likely more a function of the interaction of pathotype by cultivar rather than location by
cultivar. Cultivar reactions for the Kasota pathotype were not correlated (P>0.05) with those
from the CDC Earl or Harrington pathotypes, while there was a significant low-moderate
correlation with reactions from the Seebe pathotype (P

Session 2: Pathology and Entomology – Oral presentations
The current study identified the occurrence of R. secalis pathotypes with the ability to overcome
some of the most effective sources of scald resistance present in commercially available barley
cultivars grown in Alberta. Of particular concern was the Kasota pathotype which produced
very susceptible field reactions on AC Stacey, CDC Dolly, Kasota, Mahigan, Niska, Ponoka,
API/CM67-B//AGER, and Atlas. In addition, an increased rating was observed on Manny when
inoculated with the Kasota pathotype, which is in contrast with other recent trials where Manny
has maintained a very good reaction to scald. The scald rating on Seebe inoculated with the
Seebe pathotype was low in this trial, whereas other recent observations have shown the
occurrence of susceptible-type reactions for Seebe with other scald pathotypes derived from
Seebe. Further research with the Kasota and Seebe pathotypes and monitoring of Manny and
Seebe reactions are underway. The CDC Earl pathotype produced very susceptible field
reactions on CDC Earl, Jaeger, Modoc, Niobe, Trochu, and Vivar, while the Harrington
pathotype produced susceptible reactions mainly on CDC Earl. The current study also
demonstrated that Abyssinian, Atlas46, Atlas68, Gatillo-Bar, Hudson, Kitchin, Osiris, Shyri, and
Turk may possess useful sources of resistance for future Alberta barley cultivars.
Differential responses within and between pathotypes indicated potential compatible barley
cultivar combinations that could be used as part of short-term cultivar rotation strategies for
disease management. Cultivars that may have potential to produce low to moderate levels of
disease when grown in rotation with Kasota include Seebe, Duke, and Johnston, while AC
Harper, CDC Earl, Leduc, and Niobe may also have some potential. Low to moderate disease
levels may also be possible with Seebe in rotation with AC Stacey, Jaeger, Johnston, Mahigan,
and Manny, while AC Harper, CDC Dolly, CDC Earl Duke, Niobe, Ponoka, and Trochu may
also have some potential. Other cultivars that may be useful in rotations with CDC Earl include
AC Stacey, CDC Dolly, Mahigan, Manny, Niska, and Ponoka.
Acknowledgements
The authors graciously acknowledge the technical assistance of Denise Orr, Noryne Rauhala,
Deb Clark, and Jackie Busaan. The generous funding of the Alberta Barley Commission and
Agriculture and Agri-Food Canada’s Matching Investment Initiative program is also
acknowledged.
Literature cited
Littel, R. C., Milliken, G. A., Stroup, W. W., and Wolfinger, R. D. 1996. SAS System for
Mixed Models. SAS Institute, Cary NC. 656 pp.
Tekauz, A. 1991. Pathogenic variation in Rhynchosporium secalis on barley in Canada. Can. J.
Plant Pathol. 13: 298-304.
Turkington, T.K., Xi, K., Tewari, J.P., Lee, H.K., Clayton, G.W., and Harker, K.N. 2005.
Cultivar rotation as a strategy to reduce leaf diseases under barley monoculture. Can. J. Plant
Pathol. 27: 283–290.
Xi, K., Turkington, T.K., Helm, J.H., and Bos, C. 2002. Pathogenic variation of
Rhynchosporium secalis in Alberta. Can. J. Plant Pathol. 24: 176-183.
Xi, K., Turkington, T.K., Helm, J.H., Briggs, K.G. and Tewari, J.P. 2003. Distribution of
Rhynchosporium secalis pathotypes and cultivar reaction on barley in Alberta. Plant Dis.
87: 391-396.
- 54 -

Session 2: Pathology and Entomology – Oral presentations
Mapping genes for Russian wheat aphid resistance in barley
Shipra Mittal 1 , Lynn Dahleen 2 and Dolores Mornhinweg 3
1 Dept. of Plant Sciences, North Dakota State University, Fargo, ND 58105
2 USDA-ARS, Northern Crop Sciences Lab, Fargo, ND 58105
3 USDA-ARS, Stillwater, OK 74075-2714
Russian wheat aphid (RWA), Diuraphis noxia (Mordvilko), is one of the most serious pests of
grain crops. Russian wheat aphid infestations reduce grain yield and malting quality of barley.
Since it was first identified in Texas in 1986, RWA has caused more than $1 billion in losses in
the Western United States. Two Russian wheat aphid resistant spring barley germplasm lines,
STARS-9301B and STARS-9577B, were developed by USDA-ARS, Stillwater, OK and
released to breeders. Inheritance studies indicated that RWA resistance in STARS-9301B was
controlled by two genes, one incompletely dominant and one dominant with epistatic effects.
RWA resistance in STARS-9577B was suggested to be controlled by dominant alleles at two
loci. The objectives of this project were to confirm the number and effect of genes for RWA
resistance from the above mentioned lines, and to map these genes. In a cooperative effort,
allelism tests were conducted by the USDA-ARS, Stillwater, OK to determine the number of loci
involved. STARS-9301B and STARS-9577B were each crossed to a susceptible spring barley
cultivar, Morex, and generations advanced to produce two F2:3 populations. From each
population, 196 families were used for mapping. Simple sequence repeat (SSR) markers were
screened on the F2:3 populations. A genetic linkage map was constructed from the data with a
LOD of score 3.00 for population developed from STARS-9301B by Morex cross. QTL analysis
was conducted to determine the chromosomal locations and effects of genes involved in RWA
resistance using MapManager QTX. Two major QTL were found on 1H and 3H chromosome.
Work for STARS-9577B is in progress. The genes located for Russian wheat aphid resistance in
STARS-9301B and STARS-9577B can be incorporated in to breeding programs where these
genes can be transferred to susceptible varieties using linked molecular markers to achieve
resistance towards Russian wheat aphid.
- 55 -
Corresponding author: Lynn Dahleen
Email: dahleenl@fargo.ars.usda.gov

Session 2: Pathology and Entomology – Oral presentations
Sequence tagged site markers linked to Septoria speckled leaf blotch
resistance genes in barley (Hordeum vulgare L.)
S.H. Lee and S.M. Neate
North Dakota State University, Dept. Plant Pathology, Fargo, ND 58105
Septoria speckled leaf blotch (SSLB) caused by the pathogen Septoria passerinii is a common
and important leaf disease in barley in the Upper Midwest and adjacent Canadian provinces. The
disease was severe in the 1950s in the north-central region of the United States and Prairie
Provinces of Canada (Buchannon 1961; Green and Dickson 1957), with yield losses of 23-38%
reported in Canada (Green and Bendelow, 1961). Recent yield losses due to SSLB reported by
Toubia-Rahme and Steffenson (1999) are similar to those previously reported in Canada. The
importance of SSLB is increased further due to its effects on grain quality such as reduced kernel
size and malting quality (Green and Bendelow, 1961). All of the major malting and feed barley
cultivars in the Upper Midwest region are susceptible to this pathogen. Development of resistant
cultivars is the preferred method to prevent SSLB epidemics. Thus, it is necessary to map the
genes controlling the resistance and develop molecular markers for use in screening breeding
lines.
To date, three SSLB resistance loci designated Rsp1, Rsp2, and Rsp3 have been identified in
CIho14300, CIho4780, and CIho10644 respectively (Rasmusson and Rogers, 1963). The genes,
Rsp2 and Rsp3, are closely linked with about 3.8% recombination (Rasmusson and Rogers,
1963). The molecular mapping work for resistance genes has been published on Rsp2 and Rsp3
(Zhong et al. 2002). Two AFLP markers linked to Rsp2 were developed and mapped on the short
arm of chromosome 1H(5). Information on map location and molecular markers for Rsp1 is still
lacking. In addition, the AFLP technique has limited use in marker assisted selection (MAS)
because it is laborious, time consuming, expensive, and technically difficult (Neil et al., 1997).
Thus, the aim of this research was to identify randomly amplified polymorphic DNA (RAPD)
markers linked to Rsp genes and convert them into sequence tagged site (STS) markers so that
marker assisted selection (MAS) can be used to develop SSLB resistant cultivars in barley.
We developed six mapping populations by crossing the susceptible cultivars, Robust and Foster,
with the resistant lines, CIho14300 (Rsp1), CIho4780 (Rsp2), and CIho10644 (Rsp3). Robust
comes from the Minnesota barley breeding program and its pedigree is Morex x Manker and
Foster comes from the North Dakota breeding program and its pedigree is Robust/6/Glenn/4/
Nordic//Dickson/Trophy/3/Azure/5/Glenn/Karl. F1 plants were selfed to obtain between 100 and
120 F2 plants. SSLB phenotypes were evaluated in F2 plants and F2.3 families at the seedling and
adult stage in the greenhouse and in the field. Segregation analysis for Rsp1, Rsp2, and Rsp3
genes in two F2 populations of seedlings in the greenhouse showed an approximate segregation
ratio of 3 resistant:1 susceptible in both genetic backgrounds (Table 1). This was confirmed in
analysis of the F2:3 families from Robust x CIho 14300, Robust x CIho 4780, and Robust x CIho
10644 grown in the greenhouse and field at Langdon and Osnabrock, ND (Table 2).
- 56 -

Session 2: Pathology and Entomology – Oral presentations
Table 1. Segregation analysis for Septoria Speckled Leaf Blotch resistance genes Rsp1, Rsp2,
and Rsp3 in F2 populations derived from two susceptible cultivars (Robust and Foster) and three
resistant lines (CIho14300, CIho4780, CIho10644).
Cross
Female (S) x Male (R)
Genes Resistant plants Susceptible plants Expected ratio χ 2
Foster x CIho 14300 Rsp1 93 25 3 : 1 0.92 0.34
Robust x CIho 14300 Rsp1 74 29 3 : 1 0.55 0.46
Foster x CIho 4780 Rsp2 93 27 3 : 1 0.40 0.53
Robust x CIho 4780 Rsp2 85 23 3 : 1 0.79 0.37
Foster x CIho 10644 Rsp3 82 32 3 : 1 0.57 0.45
Robust x CIho 10644 Rsp3 83 32 3 : 1 0.49 0.48
a P < 0.05 = significant deviation from the expected segregation ratio, P > 0.05 = fit to the expected segregation ratio of the F2 population
Table 2. Segregation analysis for Rsp1, 2, and 3 genes in F2:3 families derived from Robust ×
CIho14300, Robust × CIho4780, and Robust × CIho 10644.
Cross Location Plant stages RR b
Robust x
CIho14300
Robust x
CIho4780
Robust x
CIho10644
Langdon a
Osnabrock a
Rr rr Expected ratio χ 2
Adult 18 44 28 1:2:1 2.27 0.32
Adult 19 46 25 1:2:1 0.84 0.66
Greenhouse Seedling 18 50 21 1:2:1 1.56 0.46
Langdon a
Osnabrock a
Adult 25 49 26 1:2:1 0.06 0.97
Adult 31 51 18 1:2:1 3.42 0.18
Greenhouse Seedling 28 57 27 1:2:1 0.05 0.97
Langdon a
Osnabrock a
Adult 25 53 27 1:2:1 0.09 0.96
Adult 21 51 33 1:2:1 2.83 0.24
Greenhouse Seedling 21 52 27 1:2:1 0.88 0.64
a Name of field location in ND, USA
b RR: Homozygous resistant, Rr: Heterozygous resistant, rr: Homozygous susceptible.
c P < 0.05 = significant deviation from the expected segregation ratio, P > 0.05 = fit to the expected segregation ratio of the F2:3 population
To develop molecular markers linked to Rsp genes, 480 10-mer RAPD primers (200 from
University of British Columbia, and 280 from Operon Technologies Inc.) were used to screen
polymorphisms between the two different DNA bulks from resistant and susceptible F2 plants,
and between two susceptible parents and three resistant parents. The RAPD primers that showed
a specific polymorphism between a resistant and susceptible bulk were selected to determine the
genetic linkage between SSLB resistance genes and markers. Three RAPD markers,
UBC285158R, OPAH5545C, and OPBA12314C, associated with Rsp genes, were identified using
bulked segregant analysis in populations of 100-120 F2 individuals. Linkage analysis revealed
RAPD markers UBC285158 (3.8±1.1cM) in repulsion linked to Rsp1, RAPD marker OPAH5545C
(0.9±1.3) in coupling linked to Rsp2, and RAPD marker OPBA12314 (2.4cM) in coupling linked
to Rsp3. A repulsion phase of dominant marker, UBC285158R, for Rsp1 and two coupling phase
of dominant markers, OPAH5545C for Rsp2 and OPBA12314C for Rsp3, showed the expected
segregation ratio 1 resistant:3 susceptible and 3 resistant:1 susceptible in F2 plants (Table 3).
For high reproducibility and ease to use, RAPD markers associated with Rsp genes were
converted into sequence-tagged site (STS) markers, Rsp1158R, Rsp2545C, and Rsp3314C, (Figure 1).
- 57 -
PP
PP
c
a

Session 2: Pathology and Entomology – Oral presentations
Table 3. Chi-square test of segregation ratios with RAPD markers linked to Rsp genes in F2
populations derived from two susceptible cultivars (Robust and Foster) and three resistant lines
(CIho14300, CIho4780, CIho10644).
Cross
Female(S) x Male(R)
Genes RR a
Rr rr
Expected
segregation
χ 2
PP
b Genetic c distance
(cM)
Robust x CIho14300 Rsp1 UBC285158R 22 81 25.75:77.25 0.55 0.46 3
Foster x CIho14300 Rsp1 UBC285158R 25 91 29:87 0.74 0.39 4.5
Robust x CIho4780 Rsp2 OPAH5545C 75 25 75:25 0 1 0
Foster x CIho4780 Rsp2 OPAH5545C 93 27 90:30 0.28 0.6 1.8
Robust x CIho10644 Rsp3 OPBA12314C 84 29 84.75:28.25 0.03 0.87 2.4
a RR: Homozygous resistant, Rr: Heterozygous resistant, rr: Homozygous susceptible.
b P < 0.05 = significant deviation from the expected segregation ratio, P > 0.05 = fit to the expected segregation ratio of the F2 population
c Genetic distances (cM) were analysed by MAPMAKER, LOD>3.0.
500bp
400bp
300bp
300bp
200bp
100bp
M
M
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M
M 1 2 3 4 5 6 7 8 9 10
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 M
A
C
500bp
400bp
300bp
200bp
100bp
500bp
400bp
300bp
200bp
100bp
M 1 2 3 4 5 6 7 8 9 10
11 12 13 14 15 M
11 12 13 14 15 M
Fig. 1 Identification of polymorphisms associated with SSLB resistance genes, Rsp2 and Rsp3, using RAPD
markers (A) OPBA12314C and (C) UBC285158R. The RAPD markers were converted into sequence tagged site (STS)
markers, (B) Rsp3314C and (C) Rsp158R. Lanes are as follows: (A), (B), and (D) = M, DNA size markers in bp; 1,
resistant parent CIho10644 (A and D) and CIho14300 (D); 2, susceptible parent Robust; 3, susceptible parent Foster;
4, F1 plant of Robust×CIho10644 (A and B) and Robust×CIho14300 (C); 5, F1 plant of Foster×CIho10644 (A and
B) and Foster×CIho14300 (C); 6 through 10, F2 resistant plants; 11 through 15, F2 susceptible plants. (C) = M, DNA
size markers in bp; 1, susceptible parent Robust; 2, susceptible parent Foster; 3, resistant parent CIho14300; 4, F1
plant of Robust×CIho14300; 5, F1 plant of Foster×CIho14300; 6 through 15, F2 susceptible plants; 16 through 24, F2
resistant plants.
To determine the existence of STS markers linked to Rsp genes, 21 resistant and 16 susceptible
barley lines identified as resistant or susceptible by Toubia-Rahme and Steffenson (2004) were
evaluated (Table 4). It is not known which resistance genes are present in these lines. Two STS
markers, Rsp1158R in repulsion and Rsp2545C in coupling showed the expected presence or
absence of bands in resistant lines. However, unexpected results were obtained in 7/18
(Rsp1158R) and 9/18 (Rsp2545C) susceptible lines. This may be due to our previous finding that the
markers are not within, but separated from the genes of interest. The STS marker Rsp3314C linked
to Rsp3, amplified a band only in the four resistant lines, Bolron, Feebar, Flynn1, and Vaughn.
The pedigree of CIho10644 containing Rsp3 is Feebar/Kindred. The pedigree of Feebar is
Peatland/Vaughn, and the pedigree of Vaughn is Mariout/Leiorrhynchium or Club Mariout/Lion.
Flynn also comes from a cross between Club Mariout/Lion and Flynn1 is a selection from Flynn.
- 58 -
B
D

Session 2: Pathology and Entomology – Oral presentations
Thus, the lines CIho10644, Feebar, Vaughn, and Flynn1 which gave a band with the STS marker
Rsp3314C contain a genetic background with Rsp3 in one of the parents. This result gives hope
that with further testing the STS marker Rsp3314C can be effectively used in MAS to identify
lines containing Rsp3. The other line testing positive to Rsp3314C, Bolron, is from a cross
Bolivia/Chevron, and has a different genetic background. Bolivia and Chevron need to be tested
with the STS marker Rsp3314C and allelism tests done to determine if they contain Rsp3.
Table 4. Validation of sequence-tagged site (STS) markers and reaction to SSLB for 24 resistant
and 18 susceptible barley lines
Cultivars/Lines
Reaction STS marker
a Atlas54
to
SSLB
R
Rsp1158R +
Rsp2545C Rsp3314C b
- -
Atlas R + - -
Bolron R - - +
CIho4428 R - - -
CIho4439 R + + -
CIho6398 R - - -
CIho9831 R - + -
Custer R + - -
Feebar R + - +
Flynn1 R + - +
Glacier R - - -
Hor2683-84 R + + -
Hor 9471-87 R - + -
Nomini R - - -
ND16092 R + + -
PC11 R - + -
PC84 R + + -
Sp.No:1 R - - -
Starling R - + -
Sussex R - - -
Vaughn R - - +
Bowman S + + -
Carlsberg S - - -
CIho13581 S - + -
CIho4753 S + + -
CIho592 S - - -
CIho0182 S - + -
CIho2947 S + - -
CIho8096 S - + -
Heimdal S - + -
Hiland S + + -
Kindred S + - -
Olli S - - -
Supi 1 S + + -
Trebi S + + -
Velvon S + - -
ZAU7 S + - -
Robust S + - -
Foster S + - -
CIho14300 (Rsp1) R - - -
CIho4780 (Rsp2) R + + -
CIho10644 (Rsp3) R + - +
a
SSLB inoculation and disease assessment was taken as described by Toubia-Rahme and Steffenson (2004).
R: resistant, S: susceptible.
b
Existence of alleles (+) and absence of alleles (-).
- 59 -

Session 2: Pathology and Entomology – Oral presentations
In future work, other RAPD markers linked to Rsp genes will be converted into STS markers,
with emphasis on Rsp1 and Rsp2. The evaluation of selection effectiveness in F3 populations and
the allelism test for Rsp genes with STS markers will be undertaken. The screening of other
resistant sources for resistance genes to SSLB will be performed and validated with the STS
markers associated with Rsp genes.
References
Buchannon, K.W. 1961. Inheritance of reaction to Septoria passerinii Sacc., and Pyrenophora
teres (Died.) Drechsl., and of row number, in barley. Ph.D. thesis, University of
Saskatchewan, Saskatoon, Sask.
Green, G. J. and Bendelow, V. M. 1961. Effect of speckled leaf blotch, Septoria passerinii Sacc.,
on the yield and malting quality of barley. Can. J. Plant Sci. 41: 431-435.
Green, G.J., and Dickson, J.G. 1957. Pathological histology and varietal reactions in Septoria
leaf blotch of barley. Phytopathology, 47: 73–79.
Neil, J., Helen, O. and Howard, T. 1997. Markers and Mapping: We are all geneticists now. New
Phytologist 137(1):165-177.
Rasmusson, D. C. and Rogers, W. E. 1963. Inheritance of resistance to Septoria in barley. Crop
Sci. 3: 161-162.
Toubia-Rahme, H., and Steffenson, B. J. 2004. Sources of resistance to septoria speckled leaf
blotch caused by Septoria passerinii in barley. Can. J. Plant Pathol. 26: 358–364.
Zhong, S., Toubia-Rahme, H., Steffenson, B. J. and Waugh, R. 2002. Molecular mapping of
Septoria speckled leaf blotch resistance in barley. Plant, Animal and Microbe Genomes. X.
Poster. 22.
- 60 -

Session 2: Pathology and Entomology – Poster abstracts
PCR detection and quantification of Fusarium species
Tajinder S. Grewal, Brian G. Rossnagel, Graham J. Scoles
Crop Development Centre/Department of Plant Sciences, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK
S7N 5A8 Canada
Fusarium head blight (FHB) is presently the most significant disease of barley in Canada and many
areas of the world. FHB is caused by many Fusarium species and it is very difficult to correlate
visual symptoms with deoxynivalenol (DON) concentration as symptomless kernels may carry the
pathogen. Conversely many blighted kernels may not be contaminated with DON. Symptoms may
be caused by non-trichothecene producing Fusarium species. Identification of Fusarium species
based on morphological characteristics by growing on selective media is cumbersome and requires
considerable expertise and experience. In addition DON estimation is slow, labour intensive and
expensive and demand for this service outstrips supply. PCR-based assays to quantify fungal DNA
in infected plant tissue could indirectly estimate DON levels. PCR assays have been standardized to
detect Fusarium species with species–specific primers (reported by Parry and Nicholson 1996,
Schilling et al. 1996, Nicholson et al. 1998, Yoder and Christianson 1998, Aoki and O'Donnell 1999,
Williams et al. 2002) using 22 isolates of seven different Fusarium species. The protocol to detect F.
graminearum associated with FHB symptoms produced under artificial and natural infections has
been standardized. Primer-pair Fg16N amplified the desired band (280 bp) in all infected barley
samples from a greenhouse experiment and no band was amplified from uninoculated and uninfected
samples. The vast majority of samples from artificially and naturally infected samples from barley
fields showed the desired band. Protocol to quantify F. graminearum DNA using a competitor DNA
template (obtained from Dr. P. Nicholson, John Innes Centre, Norwich, UK) has been standardized.
Fungal concentration ranging from 1 pg to 100 ng with a constant competitor DNA template
concentration (1fg or 3fg/μl) was evaluated and fungal DNA concentration as low as 100 pg (0.1ng)
was detected. Work is in progress to quantify fungal DNA from FHB infected barley.
References
Aoki, T. and O'Donnell. 1999. Mycologia. 91:597-609.
Nicholson P. et al. 1998. Physiological and Molecular Plant Pathology. 53:17-37.
Parry D. and Nicholson P. 1996. Plant Pathology. 45:383-391.
Schilling A.G. et al. 1996. Phytopathology. 86:515-522.
Williams K.J. et al. 2002. Australian Plant Pathology. 31: 119-127.
Yoder, W. and Christianson, L. 1998. Fungal Genetics and Biology. 23: 68-80.
- 61 -

Session 2: Pathology and Entomology – Poster abstracts
Can we use Australian identified molecular markers for barley net blotch
resistance in western Canadian barley breeding programs?
Tajinder S. Grewal, Brian G. Rossnagel, Graham J. Scoles
Crop Development Centre/Department of Plant Sciences, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK
S7N 5A8 Canada
Net blotch of barley caused by Pyrenophora teres Drechs. is an important disease in western Canada
(Tekauz 1990) and elsewhere (Steffenson 1997). Two types of leaf symptoms are associated with the
net blotch disease: the net form (NFNB), caused by P. teres f. teres, which causes a dark brown
crisscross venation pattern that sometimes turn chlorotic; and the spot form (SFNB), caused by P.
teres f. maculata, which causes dark brown circular or elliptical spots accompanied by chlorosis of
the surrounding leaf tissue (Khan and Tekauz 1982). Yield losses of 20 to 30 % in susceptible
cultivars have been reported in western Canada (van den Berg 1988) and up to 40 % in other parts of
the world (Khan 1987). More important than yield losses, the pathogen reduces thousand kernel
weight, plumpness and test weight, negatively affecting malting and feed quality. The most effective
and economical method to control this disease is the use of resistant cultivars, however most
commonly grown barley cultivars are susceptible to most isolates of P. teres (Tekauz 1990, 2000).
The variability observed in P. teres and failure to find lines resistant to all isolates suggests breeding
for resistance should emphasize pyramiding resistance genes to develop broad-based durable
resistance. Molecular markers allow breeders to rapidly introgress resistant genes into elite lines and
to pyramid more than one resistant gene into a cultivar. Molecular markers linked to net blotch
resistance in barley have been recently reported from Australia (Cakir et al. 2003, Raman et al. 2003,
Williams et al. 2003). There is need to determine whether we can use Australian developed
molecular markers in western Canadian barley breeding programs. Thirty-nine barley lines were
screened with 6 NFNB (WRS102, WRS858, WRS1607, WRS1906, LO256, LO246) and 4 SFNB
(WRS857, WRS1881, LO233, LO231) isolates at the seedling stage in the U of S, College of
Agriculture Phytotron. Parents of Australian barley mapping populations used to identify/validate net
blotch markers in Australia, western Canadian lines, US lines and one Ethiopian accession and lines
from International collections were included. The majority of the Australian parent lines were
susceptible to western Canadian isolates. Australian 'R' lines Franklin, Alexis, Kaputar, Baudin,
Hamelin were susceptible to the majority of the isolates tested. However, Pompadour, Halcyon, Tilga
and Chebec were resistant to some isolates. Accession CI9214 showed the best overall resistance to
all isolates and several western Canadian lines/cultivars viz. TR253, TR251, TR244, CDC Helgason
and CDC McGwire were resistant to the majority of the isolates. We will evaluate
Pompadour/Stirling, WPG8412/Stirling and Sloop/Halcyon populations to validate Australian NFNB
markers using western Canadian NFNB isolates. For SFNB marker validation, potential populations
are CI9214/Stirling, Keel/Gairdner, Chebec/Harrington and Tilga/Tantangara.
Selected references:
Cakir, M. et al. 2003. Australian J. Agric. Res. 54:1369-1377.
Khan, T.N.1987. Australian J. Agric. Res. 38:671-689.
Raman, H. et al. 2003. Australian J. Agric. Res. 54:1359-1367.
Tekauz, A. 1990. Canadian J. Plant Pathol. 12:141-148.
Williams, K.J. et al. 2003. Australian J. Agric. Res. 54:1387-1394.
- 62 -

Session 2: Pathology and Entomology – Poster abstracts
Selection for improved scald resistance in the Crop Development Centre
barley improvement program
B.G. Rossnagel 1 , D. Voth 1 , T. Zatorski 1 , D.D. Orr 2 and T.K. Turkington 2
1 Crop Development Centre, University of Saskatchewan, Saskatoon, SK, S7N 5A8 and
2 Agriculture and Agri-Food Canada, Lacombe Research Station, Lacombe, AB, T4L 1W1
Scald, caused by Rhynchosporium secalis, is a significant barley disease in western Canada in most
years, especially in the moist regions of Alberta and north west Saskatchewan. Control depends
primarily on genetic resistance in varieties planted and cultural practices including crop rotation and
tillage to bury crop residue. Sources of resistance have been identified; however, many resistance
sources break down rather quickly. Success in using the strategy of genetic resistance to control
scald has been hampered by evolution and pathogenic variability within scald populations. Improved
scald resistance is a part of the Crop Development Centre (CDC) barley improvement program and
involves repeated testing of selected lines in a search for putative sources of resistance as well as to
monitor scald resistance inherent in the program. Annual testing is conducted in collaboration with
T.K. Turkington et al, AAFC, Lacombe at screening nurseries at Lacombe and Edmonton, Alberta.
Scald reaction data has been collected at both locations for more than 10 years. Data from 2000
through 2004 is presented for a number of resistant CDC selections and six check varieties.
Intermediate resistance derived from CDC Dolly is holding but appears to be less effective than it
was initially. Resistance derived from PC11 continues to be effective. Resistance tracing to Arizona
hulless waxy (AzHull) remains effective with a large number of selections from crosses with that
resistance currently being tested at advanced levels in the CDC program. Lines derived from Senor
demonstrate moderately resistant reactions. Resistance from Hordeum spontaneum or H. bulbosum,
introduced to the CDC program via New Zealand accessions, has endured well. Several CIMMYT
lines, notably Calicuchima, 18 IBON-128 and 18 IBON-75 exhibit highly resistant reactions.
Progeny of BT474, a six row CDC breeding line with no apparent resistance source(s) in its pedigree
and now serving as a resistant nursery check, will be screened for scald reaction in 2005 Alberta
nurseries. Several selections from crosses with BT474 have now reached advanced yield test stages
of the CDC program.
- 63 -

Session 2: Pathology and Entomology – Poster abstracts
Selection for improved FHB tolerance in the Crop Development Centre barley
improvement program
B. Rossnagel 1 , D. Voth 1 , T. Zatorski 1 , J. Tucker 2 , W. Legge 2 , and M. Savard 3
1 Crop Development Centre, University of Saskatchewan, Saskatoon, SK, S7N 5A8
2 Agriculture and Agri-Food Canada, Brandon Research Station, Brandon, MB, R7A 5Y3
3 Agriculture and Agri-Food Canada, Eastern Cereal and Oilseed Research Centre, Ottawa, ON K1A 0C6
Continued financial support by the WGRF, CWB and AAFC MII fund to operate a collaborative
Fusarium Head Blight (FHB) screening project, initiated in 2000, at AAFC Brandon, attests to the
serious impact of FHB on both barley growers and users. As complete resistance has not been
observed in barley, genetic resistance from additive action of multiple minor genes offers the greatest
potential against FHB. The Crop Development Centre (CDC) barley improvement program’s
participation in this collaborative project was initially limited to searching for putative sources of
resistance for the breeding program and screening existing breeding lines to select for improved
reaction to FHB. Repeated testing, 2001 to 2004, identified 9 hulled genotypes that consistently
demonstrate DON concentrations comparable to the resistant check CI4196. Two of these lines,
2ND16092 (from NDSU) and HDE84194-622-1 (a Chinese accession from Shanghai Academy)
have been used as parents in the CDC program on the basis of their FHB reaction. 114 selections
from 7 populations derived from 2ND16092 and 65 selections from 2 populations derived from
HDE84194-622-1 will be tested in 2005 for FHB response as Preliminary yield test entries. The
remaining two-rowed hulled CDC lines all share TR251 as a common parent. SB00106, the most
promising in an agronomic sense, also showed promise as an entry in the 2003 and 2004 North
American Barley Scab Evaluation Nursery, where its DON level across all sites was among the
lowest. SB00106 was entered in the Western Two Row Coop Test as TR04378 in 2004 and chosen
to replace CI4196 as the resistant check in the 2005 Brandon FHB nursery. The larger proportion of
hulless, 30 versus 9 hulled lines, repeatedly selected and tested for low DON concentration,
emphasize the relationship between hull removal and DON accumulation. DON concentrations for
all selected hulless lines were lower than the checks. The predominance of several parents (i.e.
CI4196, CDC Freedom and TR251) in the pedigrees of these selections indicate the heritable nature
of the low DON accumulation trait. SH00749, selected from an early cross between CDC Freedom
and CI4196 (population 99T511-03) was in turn used as a parent to improve FHB tolerance. 115
selections from 4 populations derived from SH00749 will be tested in the 2005 FHB nursery as preyield
test entries. The FHB response of several of the best CDC selections for lower DON
accumulation, with few exceptions, seem to hold up well in other FHB screening nurseries.
- 64 -
Dr. B.G. Rossnagel: rossnagel.brian@usask.ca

Session 2: Pathology and Entomology – Poster abstracts
An AFLP derived tightly linked marker for true loose smut resistance (Un8)
Peter Eckstein, Donna Hay, Brian Rossnagel, and Graham Scoles
Department of Plant Sciences/Crop Development Centre, University of Saskatchewan, Saskatoon, SK, CANADA S7N 5A8
True loose smut resistance in barley is conferred by the single dominant gene Un8, and is the major
source of resistance in cultivars bred for western Canada. Since smut is seed borne, conventional
disease screening involves the manual (hand held syringe) inoculation of 10 to 12 florets per spike
(line). Mature seed from inoculated plants is harvested and grown to anthesis before plants can be
evaluated for the presence of smut, a process which needs to be repeated for putative resistant lines
because of potential escapes. Cost estimates for conventional screening are near $5 per line. This
expense and the simple genetics of the resistance make smut resistance an excellent candidate for
marker-assisted selection (MAS). PCR based markers for Un8 (Eckstein et al., 2002) have been in
routine use in the Crop Development Centre barley breeding program for more than five years.
While the markers are robust and simple to use, the 6cM of genetic distance (recombination) renders
approximately 50% of crosses as monomorphic (unscreenable). AFLP on bulked-segregant DNA
samples has generated a polymorphism that is more tightly linked with the resistance in 149 DH lines
from the cross Harrington x TR306. AFLP primers E32-M58 amplify a short fragment of DNA from
the resistant DNA bulk and resistant parent only. This fragment is consistently amplified from
constituent lines of the resistant DNA bulk, is absent from the susceptible lines, and co-segregates
appropriately with the disease reaction in all lines that showed recombination with our previous
marker. Efforts to convert the AFLP polymorphism to a simple PCR-based marker are in progress to
simplify linkage analysis on an additional 367 lines from the same population. The polymorphic
fragment has been isolated, cloned and sequenced, and consists of 40 bases of genomic sequence
from which allele specific PCR-based markers cannot be designed. A 1052bp fragment containing
the original 40 bases has been identified through anchored PCR. This locus has been sequenced from
resistant and susceptible genotypes in order to design allele specific primers. Analysis of sequence to
date indicates that the locus likely has numerous locations in the barley genome and efforts to
identify nucleotide variation between resistant and susceptible genotypes at the Un8 linked locus
continue. This tightly linked marker will be useful in reducing the error percentage in MAS, and will
increase the amount of breeding material that can be evaluated through MAS. Linkage estimates
obtained from the larger population will form the basis for closer examination of the locus and
perhaps the isolation of the gene itself. The eventual isolation of the Un8 gene will allow for the
characterization of previously un-phenotyped materials such as can be done with the Rpg1 resistance
gene (Brueggeman et al., 2002) and markers (Eckstein et al., 2003).
References
Brueggeman, R., Rostoks, N., Kudrna, D., Kilian, A., Han, J., Druka, A., Steffenson, B., and A.
Kleinhofs. 2002. Proc. Natl. Acad. Sci. USA 99:9328-9333.
Eckstein, P.E., Krasichynska, N., Voth, D., Duncan, S., Rossnagel, B.G., and G.J. Scoles. 2002. Can. J.
Plant Pathol. 24:46-53.
Eckstein, P., Rossnagel, B., and G. Scoles. 2003. Barley Genetics Newsletter 33:7-11.
- 65 -

Session 2: Pathology and Entomology – Poster abstracts
Cytological karyotyping of Pyrenophora teres
A.D. Beattie, G.J. Scoles, B.G. Rossnagel
University of Saskatchewan/Crop Development Center, 51 Campus Drive, Saskatoon, SK S7N 5A8
Net blotch, caused by the fungal pathogen Pyrenophora teres, is a common disease of barley that
adversely affects seed quality characteristics like plumpness and test weight. Despite its importance,
there is limited information available about the P. teres genome. Karyotype analysis of this pathogen
was initiated to address this and to provide a foundation for further genetic work including the
creation of a molecular linkage map.
One technique available for karyotyping fungal pathogens is the germ tube burst method (GTBM)
which allows cytogenetic analysis by releasing mitotic metaphase chromosomes from the actively
growing tip of conidial germ tubes. Previous cytological work with fungi focused on meiotic stage
chromosomes present during sexual reproduction, however, the sexual stage of many important
phytopathogenic fungi is either unknown or difficult to induce in the lab, restricting the use of this
method. Pulsed field gel electrophoresis (PFGE) is another popular method of karyotyping fungi
which is useful for estimating the molecular weights of chromosomes, but tends to underestimate
chromosome numbers due to the inability to resolve chromosomes of similar size. The combination
of the GTBM and PFGE make a powerful tool for karyotype analysis.
The GTBM was applied to four isolates of P. teres. A time course analysis was conducted to
determine the conidial germination rate and the point at which the maximum number of germ tube
nuclei were in metaphase. Germination began after 30 min and was near 100% by 120 min. The
proportion of metaphase stage nuclei in germlings reached a maximum of 15% at regular intervals of
60-70 min. Culture media was amended with hydroxyurea to attempt to synchronize mitosis and
increase the proportion of metaphase nuclei, but only a marginal increase was observed. Cells within
the germling contained an average of seven nuclei and the nuclei within each cell appeared to be at
the same mitotic stage. These observations were not significantly different between the four isolates
studied. Nine chromosomes were observed for each isolate after making a minimum of 20
chromosome counts. Observations on chromosome size were recorded. This karyotype analysis
solidifies the only previous estimation of chromosome number in P. teres, made using PFGE. In that
study, only six bands could be resolved, but densitometric analysis of the larger, unresolved bands
led to a chromosome number estimate of nine. This study shows the power of the GTBM to
accurately determine karyotypes in fungi.
Corresponding author: adb164@duke.usask.ca (Aaron Beattie)
- 66 -

Session 2: Pathology and Entomology – Poster abstracts
A molecular linkage map of Pyrenophora teres
A.D. Beattie, G.J. Scoles, B.G. Rossnagel
University of Saskatchewan/Crop Development Center, 51 Campus Drive, Saskatoon, SK S7N 5A8
Genetic linkage maps provide basic information about a species’ genome organisation and are
important tools required for positional cloning of genes. The rice blast pathogen, Magnaportha
grisea, provides a good example of how a linkage map of this fungus has allowed map-based cloning
of several avirulence genes. The goal of this project was to construct a linkage map of the barley net
blotch pathogen, Pyrenophora teres, that will support future mapping studies.
A mapping population of 80 single ascospore progeny were isolated from a cross between parental
isolates WRS 1906 x WRS 1607. The parents were screened with 144 AFLP primer combinations
from which 23 primer pairs were selected to screen across the entire population. Because WRS 1906
is avirulent on the barley variety 'Heartland' while WRS 1607 is highly virulent, the population was
also evaluated for virulence on Heartland and segregated 38 avirulent: 42 virulent (χ2 = 0.2, P =
0.70). This suggested a single gene controlled the avirulent phenotype and this locus was placed on
the linkage map. Finally, the mating type (MAT1/MAT2) locus was mapped on the population using
a set of PCR primers specific to this locus. The map consists of 110 unique loci distributed over 18
linkage groups. Only eight (7.3%) markers displayed a Mendelian segregation ratio different from
1:1. The total map length is approximately 650 cM.
The present chromosome number estimate for P. teres is nine based on pulsed field gel
electrophoresis (PFGE) and cytological observations. This clearly indicates that many of the linkage
groups represent common chromosomes. Currently markers from each linkage group are being
hybridized to PFGE-separated chromosomes in order to assign linkage groups to specific
chromosomes. Mapping of the chromosome telomeres has also been initiated to determine how fully
the current map represents the genome and to better define the region around the avr locus near the
terminus of linkage group 6.
Corresponding author: adb164@duke.usask.ca (Aaron Beattie)
- 67 -

Session 2: Pathology and Entomology – Poster abstracts
The barley stem rust resistance gene Rpg5 encodes NBS-LRR and protein
kinase domains in a single gene
R. Brueggeman 1 , T. Drader 1 , A. Druka 2 , T. Cavileer 3 , B. Steffenson 4 , J. Nirmala 1 , H. Bennypaul 1 , K. Gill 1
and A. Kleinhofs 1,5
1 Washington State University, Crop and Soil Science, Pullman, WA 99163, USA
2 Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, Scotland, UK
3 University of Idaho, Dept. of Biological Sciences, Moscow, ID 83844, USA
4 University of Minnesota, Department of Plant Pathology, St. Paul, MN 55108-6030, USA
5 Washington State University, School of Molecular Biosciences, Pullman, WA 99163, USA
The biotrophic fungus Puccinia graminis causes stem rust of barley. Several major genes for
resistance (i.e. Rpg1-Rpg5) have been described in barley. To understand the molecular basis of stem
rust resistance, we have focused on the isolation and characterization of the genes involved in the
incompatible interactions between barley and Puccinia graminis.
The Rpg1 gene was recently cloned and predicted to code for a receptor-like kinase with dual kinase
domains (Brueggeman et. al., PNAS 99:9328, ’02), representing a novel class of plant disease
resistance genes. A genetic locus believed to contain the barley stem rust resistance genes Rpg5 and
rpg4 was delimited genetically to two BAC clones and completely sequenced. The Rpg5 locus
confers resistance to the rye stem rust pathogen Puccinia graminis f. sp. secalis, isolate 92-MN-90
and the rpg4 locus confers resistance to P. graminis f. sp. tritici pathotype, Pgt-QCC. Annotation of
the BAC sequences revealed several candidate resistance genes. Allele sequencing from resistant
and susceptible cultivars and recombinant lines resulted in a single candidate Rpg5 gene. The Rpg5
gene was confirmed by allele sequencing and it also appears to be required for rpg4-mediated
resistance. This was indicated by the presence of recombinants resistant to isolate 92-MN-90 (Rpg5),
but not to QCC (rpg4). Recombinants resistant to QCC, but susceptible to 92-MN-90 were never
isolated among over 5,000 gametes examined. In-silico translation of the Rpg5 sequence from the
resistant line Q21861 revealed a protein containing NBS-LRR and protein kinase domains, all in one
gene. Several cases are known in the literature where an NBS-LRR gene and a protein kinase gene
are required for resistance to a pathogen, but this is the first case where all three domains are encoded
by a single gene. Further validation of the gene is underway using a viral induced gene silencing
approach as well as complementation by Agrobacterium mediated transformation. Characterization
and validation of this gene will be presented and possible mechanism of resistance discussed.
- 68 -
Robert Brueggeman: bigbass@wsu.edu

Session 2: Pathology and Entomology – Poster abstracts
In vitro selection for pre-screening barley for resistance to Fusarium head
blight
Kumar, K. (1), Xi, K. (1), Helm, J.H. (2), Turkington, T.K. (3), and Jennifer Zantinge (1)
1: Field Crop Development Centre, Alberta Agriculture, Food and Rural Development (AAFRD), 6000 C & E Trail, Lacombe, AB
T4L 1W1
2: Field Crop Development Centre, AAFRD, 5030-50 Street, Lacombe, AB T4L 1W8
3: Lacombe Research Centre, Agriculture and Agri-Food Canada, 6000 C & E Trail, Lacombe, AB T4L 1W1
Cultivation of susceptible wheat and barley cultivars has resulted in FHB epidemics in the Midwest
USA and Manitoba. The use of barley cultivars with genetic resistance to FHB is the most cost
effective and environmentally sound means to manage this disease. However, the limited occurrence
of FHB caused by Fusarium graminearum Schwable in Alberta, especially in the central and
northern regions, requires developing methodology to screen resistance under controlled conditions.
Barley genotypes (Hordeum vulgare L.) with known field reactions to fusarium head blight (FHB)
were used for in vitro ground grain and leaf detached assays. In the ground gain assay, the FHB
reaction of the genotypes was measured based on the extent of mycelial growth of F. graminearum
(PW027) on a mixture of agar and ground grain at room temperature (23±1°C). In addition, the
deoxynivalenol (DON) level in a mixture of F. graminearum biomass and ground grain of each line
was determined using an ELISA-based assay. Fusarium graminearum showed larger colony
diameters (mm) for susceptible ‘AC Lacombe’ and ‘Stander’ compared with resistant genotypes,
‘Chevron’ H94051001, I92130, and H93120, except for resistant CI4196. Fusarium graminearum
produced more DON on susceptible ‘AC Lacombe’ compared to resistant ‘Chevron’, I92130, and
H93120, except for resistant CI4196 and H94051001. Larger colony diameters and higher DON
content were also observed for susceptible genotypes compared with resistant ones in a repeated test
with another 16 barley genotypes. Detached leaves of six barley genotypes were inoculated with
single isolates of F. graminearum (PW027) and F. culmorum (PW0T6) for evaluation of partial
disease resistant (PDR) components at 10°C and 23±1°C, and DON content at 23±1°C. Both isolates
were pathogenic at 23±1°C with shorter incubation period and greater lesion sizes on detached leaves
compared to 10°C. PW027 was more virulent than PW0T6 at both temperatures resulting in shorter
incubation and larger lesions for all barley genotypes but not for spore production. Fusarium
graminearum appeared to better differentiate between resistant and susceptible barley genotypes at
23±1°C compared with F. culmorum. However, there was no clear pattern in DON content between
resistant/tolerant and susceptible genotype. The results of in vitro evaluations tended to agree with
previous field reactions in terms of FHB reaction and DON level of the genotypes. Thus, both in
vitro assays may be alternate selection methodologies for FHB resistance. The detached leaf assay
has the advantage of measuring specific disease components, allowing elucidation of the potential
nature and genetic components of resistance to FHB operating for this assay. The potential of
screening barley embryos of different genotypes against DON as a method of identifying resistant
genotypes was also evaluated. In a preliminary test, 20 days old embryos of susceptible ‘AC
Lacombe’ and resistant H94051001 were evaluated in Murashige Skoog media amended with
different concentrations of DON. DON was found to considerably reduce the embryo weight of ‘AC
Lacombe’ compared with that of H94051001. Further embryo experiments are being carried out,
with screening of more barley genotypes against different DON concentrations.
- 69 -

Session 2: Pathology and Entomology – Poster abstracts
Diversification strategies for barley disease management in Alberta
Turkington, T.K. (1), Xi, K. (2), Clayton, G.W. (1), Harker, K.N. (1), O’Donovan, J.G. (1), and Lupwayi, N. (1)
1: Lacombe Research Centre/Beaverlodge Research Farm, Agriculture and Agri-Food Canada, Lacombe, AB, T4L 1W1;
2: Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, c/o Lacombe Research Centre, Agriculture
and Agri-Food Canada, Lacombe, AB, T4L 1W1
Barley is an important feed grain crop in Alberta that accounts for 40-50% of Canadian production. To
ensure a constant supply of feed many farmers often grow barley continuously for several years; however,
continuous barley production leads to a build-up of plant diseases and a general reduction in yield
potential over the long-term. A three-year experiment was established at Lacombe in 1998 to determine
if barley cultivar rotation could be used to reduce the impact of leaf diseases, while maintaining crop
productivity. Treatments consisted of various sequences of two cultivars with varying degrees of scald
and net blotch resistance, ‘Kasota’, and ‘AC Lacombe’; a previously scald-resistant cultivar ‘CDC Earl’;
a susceptible check, ‘Harrington’; and a non-host, triticale cultivar ‘Wapiti’. Rotations were established
in 1998 with comparisons being made in 1999 and 2000. In 1999, significant rotation differences
occurred for scald and net blotch severity, with disease severity usually highest and yield lowest when a
barley cultivar was grown on its own residue, especially for cultivars other than ‘Kasota’. Statistical
analysis using contrasts indicated that yield and kernel weight were lower, while scald and net blotch
levels were higher for barley cultivar monoculture compared with barley cultivar rotation. In 2000, when
a barley cultivar was grown on its own residue, scald severity was usually highest compared to barley
cultivar rotation. A similar trend was also observed for net blotch, especially for ‘Harrington’ and ‘AC
Lacombe’. Poor stand establishment in some plots precluded the detection of yield differences among
some treatments in 2000. Contrasts for 2000 indicated that higher levels of scald and net blotch, and
decreased kernel and test weights occurred for barley cultivar monoculture compared to barley cultivar
rotation. In both 1999 and 2000, barley planted on triticale residue generally had the highest yield, kernel
weight and test weight, while having the lowest disease levels compared to planting barley on barley
residue. Barley cultivar rotation can be a potential short-term strategy to help reduce leaf disease levels
and maintain crop productivity for Alberta barley producers where crop rotation options are limited due to
feed requirements or market factors. However, continuous production of barley, even utilizing cultivar
rotation, will not provide long-term sustainable leaf disease management, especially for scald. The
summer of 2004 was the third year of a separate trial that was established to look the interactive effects of
agronomic factors such as rotational diversity, seeding rate, and time of silage removal on crop health,
competitiveness, disease levels, productivity and quality in a cereal silage production system. In 2004, all
plots except for the continuous triticale were seeded to the barley cultivar ‘Seebe’. The rotation
treatments of ‘CDC Helgason’ barley/’Pronghorn’ triticale/’Seebe’ and ‘Pronghorn’/’AC Mustang’
oats/’Seebe’ had significantly greater emergence compared to the continuous ‘Seebe’ treatment, which
had the lowest emergence. The remaining rotation treatments had intermediate emergence and were not
significantly different from the continuous ‘Seebe’ rotation. Overall, silage yield on a dry weight basis
was highest for the ‘Pronghorn’/’AC Mustang’/’Seebe’ rotation (8060 kg/ha), intermediate for the ‘CDC
Helgason’/’AC Mustang’/’Seebe’ rotation (7822 kg/ha) and lowest for the remaining rotations (7005-
7279 kg/ha, LSD = 400 kg/ha). The spot-form of net blotch was the main leaf disease present and it was
highest for the continuous ‘Seebe’ rotation (13.8% leaf area diseased on the flag -2 leaf) and lowest for
the ‘Pronghorn’/’AC Mustang’/’Seebe’ rotation (5.9%) with the other rotations having intermediate
disease levels (8.2-11.7%, LSD = 2.1). Rotation had a significant influence on root mass assessed in the
fall. Root mass was highest for the ‘Pronghorn’/’AC Mustang’/’Seebe’ rotation (42.4 g/2 m length of
row), lowest for the continuous ‘Seebe’ rotation (29.1 g), and intermediate for the remaining rotation
treatments (34.4-37.0 g, LSD = 8.2 g). Rotation treatments had an impact on silage yield and this
appeared to be related to crop health as indicated by leaf disease levels and root mass measurements. A
second 3-year cycle of this trial is being repeated starting in 2005.
E-mail: turkingtonk@agr.gc.ca
- 70 -

Session 2: Pathology and Entomology – Poster abstracts
Resistance of western Canadian barley genotypes to scald in Alberta
K. Xi (1), T.K. Turkington (2) and C. Bos (1)
1: Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, c/o Lacombe Research Centre, 6000 C&E
Trail, Lacombe, AB Canada T4L 1W1
2: Agriculture and Agri-Food Canada, Lacombe Research Centre, 6000 C & E Trail, Lacombe, AB Canada T4L 1W1
Barley (Hordeum vulgare L.) production in Alberta has averaged around 6 million metric tonnes
from 2 million hectares annually from 1995 to 1999, and accounted for close to 50% of the total
barley production in western Canada. Scald caused by Rhynchosporium secalis J. J. Davis is one of
the major foliar diseases causing significant yield loss in Alberta as a result of intensive barley
production, and cool and wet environmental conditions that favor disease development. In the
current study, nine barley differentials were grown up in hill plots at multiple sites to monitor scald
development during 1997 – 1999 (Period 1), twelve during 2000 – 2001 (Period 2), and twelve
during 2003 – 2004 (Period 3). Thirty-eight genotypes and commercial cultivars with different levels
of resistance were also evaluated for scald reaction from 2003 to 2004 at these sites. Differentials
Abyssinian, Atlas, Atlas 46, Atlas 68, Hudson, Osiris, Kitchin and Turk were resistant to scald at all
sites, other differentials including Brier, La Mestita, Modoc and Trebi showed intermediate levels of
scald, indicating that the majority of major genes for scald resistance are effective against R. secalis
pathotypes in Alberta. The differentials showed highly significant correlations in scald severity
among all three periods. Period 1 and Period 2 (R 2 =0.86**) were, however, more closely correlated,
compared with Period 1 and Period 3 (R 2 =0.63**), suggesting the development of considerable
variability in R. secalis in response to major genes for resistance during 1997 to 2004 in Alberta.
Analysis from ten station-years of data classified thirty-eight genotypes and cultivars into three major
clusters corresponding to scald reaction: resistant, intermediate and susceptible. Those in Cluster I
that were resistant included AC Stacey, Kasota, Mahigan, Manny, Niobe, Seebe and five other
genotypes from the Field Crop Development Centre. Eighteen commercial cultivars in Cluster II
were intermediate in scald reaction and these included AC Lacombe, CDC Dolly, CDC Earl, CDC
Guardian, CDC Kendall, Falcon, Nisku and Peregrine. The three susceptible barley cultivars
including Harrington were classified into Cluster III with several malting cultivars including AC
Metcalfe, CDC Sisler and Excel, and three feed barleys, AC Bacon, AC Rosser and CDC Candle.
The number of cultivars that were classified to be resistant was up from previous studies. A
substantial number of feed cultivars were classified to be intermediate in resistance in the present
study due partly to the overall moderate level of scald severity during 2003 – 2004 in Alberta.
Changes in R. secalis pathotypes and conducive weather conditions may increase severity, resulting
in breaking down of resistance, as demonstrated in previous study. Given the fact that no malting
cultivar was resistant and only one was classified as intermediate in scald reaction, there is a need to
incorporate scald resistance genes into malting cultivars for production in Alberta.
- 71 -

Session 2: Pathology and Entomology – Poster abstracts
Mapping and molecular marker development of scald resistance in ‘Seebe’
barley
Zantinge, J.L.*, J.H. Helm, Z. Hartman, J.B. Russell, and K. Xi
Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, 5030 – 50th Street, Lacombe, AB T4L 1W8,
Canada. Web Site: http://www1.agric.gov.ab.ca/app21/rtw/selsubj.jsp
Scald (Rhynchosporium secalis) of barley is prevalent in central Alberta, Canada and causes
considerable yield and quality losses. Scald can rapidly change in pathotype composition and
frequency, thereby making it difficult to develop durable scald resistance in barley. Previous studies
have shown that the cultivar ‘Seebe’ carries durable genetic resistance, however, barley breeders
have found this trait difficult to transfer into new barley lines. Therefore, we are trying to develop
molecular markers for scald resistance from ‘Seebe’. Recombinant inbred lines were developed from
the cross of ‘Harrington’ (scald susceptible) and ‘Seebe’ (scald resistant). Progeny of about 175
individual F2 seedlings were advanced by single-seed descent to the F8 generation. Disease
resistance to a major scald race was phenotyped at the seedling stage in a greenhouse. By utilizing
bulked segregant analysis (BSA), resistant and susceptible pooled populations were compared by
AFLP analysis. A total of 255 AFLP primer combinations were used to analyze the genetic
population and several EcoRI-MseI and PstI-MseI fragments were found linked to scald disease
resistance. We are also analyzing this population with SSR markers. Our goal is to map and identify
molecular markers flanking the genes contributing to scald resistance in ‘Seebe’.
Key words: scald resistance, marker development, Hordeum vulgare, barley
*Corresponding author: jennifer.zantinge@gov.ab.ca
- 72 -

Session 2: Pathology and Entomology – Poster abstracts
Breeding for multiple disease and multiple gene resistance in barley
James H. Helm 1 , H. Vivar 2 , F. Capettini 2 , K. Xi 1 , P. Juskiw 1 , and J. Zantinge 1
1 Alberta Agriculture, Food and Rural Development; Field Crop Development Centre, Lacombe Alberta
2 ICARDA/ CIMMYT, Texcoco, Mexico
Combining genes for disease resistance is very difficult, as most breeding programs can only test for
the diseases present at their breeding sites. In addition, pyramiding genes or developing multiple
gene resistance is difficult to detect when testing at only one location. Multiple disease and gene
resistance involves breeding against more than one pathogen and more than one gene per pathogen.
Each pathogen may have several races that are able to attack varieties and render a resistant variety
ineffective in a short period of time, presenting a significant challenge to plant breeders.
Over the years the ICARDA/CIMMYT barley program in Mexico has given us an excellent
opportunity to screen for multiple gene resistance for Scald in barley and at the same time look at
multiple disease resistance to Stripe Rust, Barley Yellow Dwarf Virus, Leaf Rust, and Fusarium
Head Blight (FHB). In Canada not only have we screened for Scald, but have also screened for
Loose Smut and Covered Smuts as well as Net Blotch (net and spot forms), Spot Blotch, and FHB.
Over the last 5 years we have screened over 2000 breeding lines at 4 locations in Canada and 3
locations in Mexico. New combinations of resistance genes have been found with some lines
containing genes for resistance to 5 and 6 diseases. We found multiple gene combinations for scald
resistance that have 3 or more genes and should give durable resistance to this disease in both
countries. In order to classify breeding lines according to resistance gene combinations, we are
currently analyzing overall similarity computed from multivariate disease resistance data and
matching it to the pedigree.
The best lines will be used in the breeding program in order to rapidly incorporate even greater
disease resistance into new varieties for Alberta producers. We will also develop several populations
to begin the process of mapping on as many of these genes as possible. Continuation of this research
is necessary to anticipate and cope with the changes in disease problems likely to occur in the future.
Up to this point in time, stripe rust has not been a problem in Alberta on barley; however, in 2004
this disease was found on barley at Olds, Trochu, Calmar and Lacombe. If this disease continues its
move north it will be devastating to Alberta’s barley crop. FHB also is not presently a problem in
Alberta but seems to be moving west. FHB has cost the barley industry millions of dollars in the
Midwest in the United States and in Manitoba in Canada.
- 73 -

Session 2: Pathology and Entomology – Poster abstracts
Variation in virulence among net blotch isolates infecting barley
Linnea G Skoglund
Busch Agricultural Resources, Inc. 3515 Richards Lake Road, Fort Collins, CO 80525
Pyrenophera teres, causal agent of net blotch of barley, is widely distributed throughout North
American production areas. Previously, researchers have shown variation in virulence of isolates
within and between locations. The purpose of this research was to continue monitoring diversity of
isolates in locations of interest to the BARI barley breeding program. Isolates were collected
randomly from symptomatic plants from 2000 to 2004. A set of 25 differential varieties was
developed based on work of other researchers. Differentials were planted in Rootrainers containing
Metromix 200 and grown in the greenhouse. Isolates were grown on V8 Juice agar at 18C with 12 hr
light per day for 7 days. Plants were inoculated at the 2-leaf stage with a suspension of a single
isolate, incubated in the dark at 18C and 100% RH for 24 hr, and returned to the greenhouse. Plants
were evaluated for disease on a 0 (R) to 9 (S) scale 7-10 days later. To date, 16 isolates have been
characterized on 25 differential varieties. Isolates ranged from the least virulent (PT01/6 from
Bottineau, ND), infecting 5 differentials, to the most virulent (PT04/14 from Minot, ND), infecting
20. Of these 25 differentials, only 2 (9839 and CIHO 5822) were resistant to all isolates and 3
(Alexis, Bonanza and Klages) were susceptible to all isolates. There was no correlation of virulence
to year or location. This study will continue in order to assist breeding programs developing
resistance to net blotch.
Corresponding author: linnea.skoglund@anheuser-busch.com
- 74 -

Session 2: Pathology and Entomology – Poster abstracts
Assessment of artificial inoculation methods and deoxynivalenol levels in
barley lines representing various candidate sources of resistance to
Fusarium head blight
Geddes, J. (1), Eudes, F. (1), Legge, B. (2), Tucker, J. (2)
1: Agriculture and Agri-Food Canada, Lethbridge, AB T1J 4B1
2: Agriculture and Agri-Food Canada, Brandon, MB R7A 5Y3
Fusarium Head Blight (FHB) is one of the most devastating diseases affecting the production of
barley and other cereal grains throughout Canada and the world. FHB infection results in drastic
decreases in crop yield and severe reduction in grain quality. The most common species causing
FHB in North America is Fusarium graminearum (Schwab). The fungus produces mycelical
extensions that rapidly spread among the florets, leaving shrivelled kernels and floral pieces covered
with a pink or white film of mycelium displaying elevated deoxynivalenol (DON) levels. 19 barley
lines representing FHB candidate resistance and susceptible sources were point inoculated or spray
inoculated in the greenhouse with 40,000M/ml of F. graminearum macroconidia. Following
inoculation barley plants were kept at 24°C and 95% humidity for 3 days to favour disease
establishment and were then returned to normal growing conditions at 21°C without humidity control
(45%). 18 days post-inoculation heads were collected and spikelets displaying symptoms of FHB
infection were rated for progression of the disease. These lines were also evaluated in the Brandon,
MB nursery from 2000-2004. The number of discoloured spikelets produced by point inoculation,
indoor spray inoculation, and disease and DON assessment were compared for each of the 19 lines.
Barley lines representing candidate sources of FHB resistance or susceptible FHB sources showed
varying degrees of symptoms due to fungal infection in the three tests. Barley lines representing
more or intermediate FHB resistant sources showed consistent levels of resistance in the three tests.
Artificial inoculation methods and DON quantification enable us to rate the level of resistance of the
barley lines, with confidence. A higher level of FHB resistance will guarantee lower risks for the
farmer associated with crop losses due to reduced grain yield, low quality grain, and DON
contamination.
- 75 -

Session 2: Pathology and Entomology – Poster abstracts
Reactions of barley lines to leaf rust, caused by Puccinia hordei
Y. Sun (1), J. D. Franckowiak (2), and, S. M. Neate (1)
(1) Department of Plant Pathology, North Dakota State University, Fargo, ND 58105;
(2) Department of plant sciences, North Dakota State University, Fargo, ND 58105 USA.
Resistant barley cultivars are the most economical and efficient means of controlling leaf rust caused
by Puccinia hordei G. Otth. However, changing virulence in P. hordei has rendered ineffective
many of the known resistance genes. In this study, isolates ‘Race 8’, ‘90-3’, ’90-15’, ‘89-3’, and
‘Neth 202’ of P. hordei were used in the greenhouse to differentiate resistance genes in a collection
of 82 selected barley lines. These lines exhibited resistance in the previous tests against isolate ‘Race
8’ at the seedling stage. Barley line ‘C2-02-134-2-2’ exhibited low reaction types to all the tested leaf
rust isolates, suggesting that in addition to an already introduced resistance gene, Rph15, it possesses
one or more new resistance genes. The F2 population of a cross made between ‘C2-02-134-2-2’ and a
susceptible line ‘ZA47’ which was challenged with isolate ‘Race 8’, segregated into a 15:1 resistant
to susceptible ratio (X 2 =0.853) based on disease reaction. The 15:1 segregation ratio indicates that
‘C2-02-134-2-2’ possesses two genes, Rph15 and a new single dominant resistance gene. In the F2,
the Rph15 phenotype (00;) was separated from the new resistance gene phenotype (0;12-). To isolate
the new gene from Rph15, the 10 F2 plants bearing the new phenotype were transplanted and selfed
and the F3 will be screened for homogeneity of disease reaction. The identification of the new
resistance gene(s) and incorporation of them into barley cultivars will add in reducing yield losses
due to leaf rust.
- 76 -

Chair
Patricia Juskiw
Session 3: Malting and Brewing Quality
Tuesday, July 19, 2005 – a.m.
Session 3: MALTING AND BREWING QUALITY
Presenters
Rob McCaig, Canadian Malting Barley Technical Centre
Berne Jones, USDA
Marta Izydorczyk, Grain Research Laboratory, Canadian Grain Commission
Michael Edney, Grain Research Laboratory, Canadian Grain Commission
Jim Helm, Field Crop Development Centre
- 77 -

Session 3: Malting and Brewing Quality – Oral presentations
Brewing and Malting: Where are we and more importantly, where are we
going?
Rob McCaig
Canadian Malting Barley Technical Centre
Brewing
• There is a tremendous amount of change taking place in the industry
• Most of industrialized nations declining in production, slack being taken up by Asia (China,
Vietnam), India, Mexico, Columbia, Russia – growth in these areas approaching double
figures
• World beer production growing at a steady pace
• In terms of production area, North America has declined from 24% of beer produced in 1998
to 17% today, while Asia and South America have split that new volume
• China is now number 1 beer producer in the world
- 78 -

Session 3: Malting and Brewing Quality – Oral presentations
• 64% of the beer produced in Asia is brewed in China, growth is in double digits for past 5
years
• The brewing world is in a major consolidation phase – bigger is better, more economical,
global brands
2002 Global brewers ranking 2005 Global Brewers Ranking
1 Anheuser-Busch 122.4 million hl Inbev 143.6 million hl
2 SABMiller 110 million hl, SABMiller 133.5 million hl,
3 Heineken 92.9 million hl, Anheuser-Busch 128.1 million hl
4 Interbrew 92 million hl Heineken 94.5 million hl,
5 Carlsberg 68.6 million hl Molson Coors 49 million hl
6 Companhia de Bebidas das Americas 55 Carlsberg 35.8 million hl
million hl
7 Scottish and Newcastle group 45 million hl Scottish Courage 32.4 million hl
8 Grupo Modelo 33.4 million hl Grupo Modelo 33.4 million hl
9 Coors 32.4 million hl Kirin 30 million hl
10 Kirin 30.7 million hl BBH 30 million hl
The future “supercompanies and their affiliates”?
Continent Inbev SABMiller AB Heineken
NA
Modelo
Labatt
Miller AB Molson Coors
SA Ambev
Bavaria/Kaiser
Europe Interbrew
Guinness
Rest of World
China
Asia
Interbrew
Guinness
Scottish
Courage
CRE
SAB
Scottish
Courage
Tsingdoa
Harbin
Heineken
Coors/Bars
Heineken
Africa
Guinness SAB/Castal Fosters Heineken
Oceania
Fosters
Total Volume (hL) 330 220 180 180
- 79 -

Session 3: Malting and Brewing Quality – Oral presentations
• World beer consumption continues to increase
• Per-capita volume in China is very low (18 L per annum),
- 80 -

Session 3: Malting and Brewing Quality – Oral presentations
• Many factors affect consumption in the mature markets including:
o Demographics
o Lifestyle
o Drinking and Driving
o Growth of Other Beverages
o Price (Taxes)
• Aging population trend
• Growth of travel = growth of imports
• Decline in per capita consumption – trend to wine, coolers
• Tax burden on beer
o Look at Happoshu growth in Japan
• Current and Future brewing trends
o Breweries are Traditional Incremental changes – no breakthroughs
o Economic considerations High gravity, more use of adjuncts, hulless barley
o Increased “quality”
o Use of technology – on-line / at-line, NIR, Neural Networks, electronic nose
o Energy use reduction - Wort Boiling
o Environmental Issues - D.E. Replacement
- 81 -

Malting
Session 3: Malting and Brewing Quality – Oral presentations
• Also going through consolidation
• Malting barley trade is increasing yearly, but fluctuates according to the harvest
Million tonnes
7,000
6,000
5,000
4,000
3,000
World Malting Barley Outlook
2,833
4,493
5 yr ave
= 3 801 MT
5,600
6,400
2,000
1994-95 1997-98 2000-01 2006-07
2011-12
- 82 -

16
12
8
4
0
Million
tonnes
11.7
13.0
15.6
Session 3: Malting and Brewing Quality – Oral presentations
Canadian Barley Production
13.5
12.7
13.2 13.2
10.8
7.3
10 year average
= 12.6 MT
12.5
13.0
1994-95 1996-97 1998-99 2000-01 2002-03 2004-05
• Selectable average for malting barley in Canada around 2 million tones
• Two-row is taking over, less 6-row
• Six-row mostly goes to the US
1.6
1.2
0.8
0.4
0.0
Canadian Malting Barley Exports
0.53
0.47
96-97 98-99 00-01 02-03 04-05
0.20
0.15
0.70
0.30
6R 2R
- 83 -
0.45
0.05

Session 3: Malting and Brewing Quality – Oral presentations
Major Markets for Canadian Malting Barley
1997-01 2002-2003 2003-2004
Canada 1,070 570 981 (90% 2R)
U.S.A. 600 200 420 (58% 6R / 42% 2R )
China 470 43 460 (96% 2R)
S. Africa 20 85 71 (2R Metcalfe)
South America 12 0 124 (2R Metcalfe)
Japan 42 30 22 (B1602 / 2R)
Mexico 51 4 22 (90% 2R)
Total 2,265 932 2,100
Percentage
70
60
50
40
30
20
10
0
Percentage of Barley Area by Variety Type
1999 2000 2001 2002 2003 2004
Year
- 84 -
Two-row malting
Six-row malting
Feed
Hulless

Session 3: Malting and Brewing Quality – Oral presentations
Company Location Capacity(MT)
Canada Malting Calgary, Alberta 260,000
(Conagra) Thunder Bay, Ontario 130,000
Montreal, Quebec 80,000
Prairie Malt Biggar, Saskatchewan 220,000
(Cargill)
Rahr Malting Alix, Alberta 140,000
IMC Winnipeg, Manitoba 92,000
Total 922,000
- 85 -

Malting Future Trends
Session 3: Malting and Brewing Quality – Oral presentations
• A search for meaningful analysis
o Does the current analysis meet the brewers needs?
o Brewing problems are seldom explained by malt analysis --- the heterogeneity
problem
o Kirin and SAB have specific tests for yeast flocculation
o Haze prediction?
• No blending to meet specification
• Continuing slow expansion of specialty malts
• Using Biotechnology
o Speed up breeding cycle
o Genome mapping – QTL, marker assisted selection
o New quality characteristics
• More varieties to choose from
• Proprietary varieties
• How many varieties?
• Shorter variety lifespan
• Higher extract - hulless barley, etc.
• Biotechnology solutions to present problems
• A breakthrough GM barley – fusarium resistant?
Industry Future Trends
• Single malt - Single Wort - Single Yeast
• Engineering Solutions to Wort Separation
• Engineering Solutions to Flavour Stability
• Division Between Large and Small Production Units
• Fewer “gimmicks”
• A Functional Food?
o You are what you eat
o Beneficial effects of alcohol
o Antioxidants – polyphenols
o Medicinal properties of hops
- 86 -

Session 3: Malting and Brewing Quality – Oral presentations
The endoproteinases of barley and malt and their endogenous inhibitors
Berne L. Jones
RR1, Box 6, Kooskia, Idaho
Introduction
During the malting and brewing processes, a portion of the barley proteins must be degraded to
amino acids and small peptides. Among other problems, if too little protein hydrolysis occurs
there will be insufficient low molecular weight nitrogenous compounds in the wort for optimal
yeast nourishment. Alternatively, too much hydrolysis will deplete the wort of proteins that are
necessary for good beer foam formation, mouth feel, etc. The endoproteinases of barley and malt
are the enzymes that initially catalyze the hydrolysis of the insoluble barley storage proteins, and
thus play major roles in determining whether or not a given barley variety will be useful for
malting and brewing. It is imperative that we understand how, when, and why these enzymes
function if new barleys with improved malting quality are to be developed or if malting or
brewing methods are to be efficiently altered to produce worts that have improved soluble/
insoluble protein levels. The mixture of proteins, peptides and amino acids that ends up in a wort
due to these endoproteolytic activities is termed its ‘soluble protein’ or ‘SP’ level.
To understand the protein hydrolysis that occurs during malting and mashing it is necessary to
study not only the endoproteinases but also groups of proteins, called proteinase inhibitors, that
interact with the proteinases and control their activities. Ungerminated barley contains only
relatively small amounts of both endoproteinase enzymes and their protease inhibitors. During
the germination process the proteolytic activities increase many fold and the endogenous
proteinase inhibitor content increases to a lesser extent.
Barley malt contains multiple representatives of each of the four commonly occurring proteinase
types, i.e. those belonging to the aspartic, cysteine, serine and metalloproteinase classes. Early
studies on barley and malt indicated that the cysteine and metalloproteinases were probably the
main ones responsible for hydrolyzing protein during seed germination and that the grain
probably contained endogenous inhibitors that could inhibit the activities of members of both of
these enzyme classes. The members of each of the four proteinase types can be specifically
inhibited by one of four chemicals. These chemical inhibitors and their target proteases are: E-
64 (cysteine proteinases), o-phenanthroline or o-phen (metalloproteinases), pepstatin A (aspartic
proteases) and PMSF (serine enzymes).
Enzyme purifications and analyses
Several laboratories have purified and characterized different barley and malt endoproteinases, as
listed in Table 1. Of these purified enzymes, some of the cysteine and metalloproteinases were
able to hydrolyze hordein protein preparations. The hordeins are the main storage proteins of
barley and are presumably the major proteins that need to be hydrolyzed during seed germination
and malt mashing. None of the purified aspartic or serine class enzymes hydrolyzed these
storage proteins. Using the substrates gelatin and edestin, over 40 proteinase activities were
detected using 2-D IEF x PAGE gels.
- 87 -

Session 3: Malting and Brewing Quality – Oral presentations
During these and other purification and characterization studies, nearly all of the enzyme activity
analyses were carried out at abnormally low pH values and in the presence of added reducing
agents, because these conditions usually yielded maximal activity values. It is now known that
these low pH and reducing conditions lead to artificially high cysteine and aspartic proteinase
activities and underestimate the serine and metalloproteinase activities. In addition, many of the
activity measurements did not yield true initial enzyme reaction rates and
Table 1. Barley/Malt enzymes that have been purified
Enzyme class # purified, (# distinct enzymes) hydrolyze hordeins?
1
Cysteine 5, (3) Yes
Aspartic 1, plus 4 processing variants No
Serine 2, (2) No
Metallo A group, 3 major and 6 minor forms Yes
1 Some enzymes were purified by multiple researchers
often the proteins that were used as substrates were not readily hydrolyzed by members of all of
the proteinase classes. For these reasons, many of the endoproteinase activity measurements that
have been made with both crude and purified barley/malt endoproteinases have not really been
very relevant to what actually occurs during the malting of barley grains and in brewery mashes.
The effects of pH and redox agents on malt proteinases
After it was discovered that the pH values and redox states of mashes strongly affected their
proteolytic activities, quantitative studies were carried out to measure how these variables
affected the protein solubilization that occurred during mashing (1). Mashing is carried out at
about pH 5.9 in North America and the pH inside germinating barley grains is around 4.8, so
experimental mashes were carried out at pH values that varied from 5.0 to 6.6. Over this pH
range the mash proteolytic activity varied by over 7 fold and the SP levels of the final worts
ranged from 4.8% to 7.0%, with the pH 5.9 value being 5.7%, which is a normal value for the
varieties tested. This demonstrated several things; 1) that the SP level of a wort can be strongly
and easily varied by adjusting the pH of its mash, 2) that any extract or mash proteinase activity
measurements that are made at pH values below 5.9 are not relevant to what really happens in a
mash and 3) that the rate of protein hydrolysis during malting, at pH 4.8, is probably much
slower than what it is during mashing.
The addition of cysteine, a weak reducing agent, to mashes increased their proteolysis rates by
over 3 fold and their wort SP levels were raised from 5.5% to 7.3% (1). These effects were
negated when oxidizing agents were added to the mashes together with the cysteine, and similar
effects were found when stronger reducing agents were added to mashes. This shows that, as
with pH adjustments, the presence of redox agents in mashes can strongly shift the SP levels of
their worts. Many of the previously measured proteolysis rates, determined in the presence of
reducing agents, were probably incorrect. It has been proposed that redox reactions may
naturally occur in seeds during germination. If so, that would probably influence the rate at
which protein solubilization occurs during both malting and mashing.
- 88 -

Session 3: Malting and Brewing Quality – Oral presentations
How the various malt proteinase classes affect wort soluble protein levels
Based on the early proteinase activity measurements, the dogma had become accepted that the
great majority of the protein solubilization that occurred during malting and mashing was due to
the cysteine class proteinase activities, with possibly some contribution from the aspartic and
metalloproteinases. When the effect of pH and reducing agents on soluble protein levels was
noticed, however, it seemed possible that this perceived preponderance of cysteine proteinase
activity was an artifact, because these enzymes are the ones that would have been most strongly
activated by both the low pH and strongly reducing conditions. The serine and metalloproteinase
activities would actually have been reduced under the low pH conditions.
When is the soluble protein of worts released?
In order to ascertain the relative contributions of the malting and mashing steps to the release of
SP to worts, barleys and malts were extracted and mashed in the presence and absence of
chemical proteinase inhibitors (2). With both Morex (6-rowed) and Harrington (2-rowed)
barleys about 32% of the wort SP was already soluble in ungerminated barley grains, 46% was
solubilized during malting and the final 22% was released during mashing at pH 6.0. This
indicates that while the majority of the protein hydrolysis occurred during malting, almost a
quarter of the wort SP was solubilized during mashing, when conditions for altering the
proteolytic activities that control its release can be readily regulated.
The contributions of the various endoproteinase classes to wort soluble protein levels
To determine what portion of the final wort SP content was contributed by each of the four
protease classes, mashes were carried out in the presence of each of the four class-specific
chemical inhibitors (2). The results are shown in Table 2. These show that, under
Table 2. The inhibition of soluble protein formation by class-specific inhibitors during mashing
Protease class % inhibition 1
Cysteine 3
% inhibition, ASBC mash 2
Morex Harrington Average Morex Harrington
12 12 12 12 11
Aspartic 7 9 8 5 6
Serine 1 4 3 0 3
Metallo 9 14 12 13 16
1
Average of mashing with 3 malt concentrations.
2
Average of 3 experiments.
3
Inhibitors were, respectively, E-64, pepstatin A, PMSF and o-phen.
these standard mashing conditions, the cysteine class proteinases are not the only ones that
release SP into the worts. Because of the complexity of these experiments there was substantial
variation in the results obtained, but it is obvious that the metalloproteinases released as much SP
as the cysteine proteinases, that the aspartic enzymes released SP, but at a slower rate, and that
the serine proteases hydrolyzed little or no protein.
- 89 -

Session 3: Malting and Brewing Quality – Oral presentations
These findings correlate fairly well with the results obtained by the researchers who purified and
characterized the various barley/malt proteinases. The two enzyme classes whose purified
members hydrolyzed barley storage proteins, the cysteine and metalloproteinases, apparently
catalyze the majority of the hydrolysis of the storage proteins into SP and the serine proteinases,
neither of whose purified forms hydrolyzed hordein preparations, also did not release SP during
mashing. On the other hand, even though the one aspartic proteinase that has been studied in
depth has only been shown to hydrolyze one non-plant protein, enzymes of this class apparently
do hydrolyze proteins during mashing, but at a slower rate than either the cysteine or
metalloproteinases. This indicates that there are probably other, still unpurified, aspartic class
proteases in malt that carry out this hydrolysis. This hypothesis is strengthened by the fact that
electrophoretic studies have demonstrated that several aspartic class proteinases occur in malt.
These SP-releasing aspartic protease forms still need to be purified and characterized.
From these recent findings, as well as from the 1970 report that showed that malt contained
substantial levels of metalloproteinases, it is obvious that the question of how proteins are
solubilized during mashing needs to be reconsidered. The large apparent contribution of the
metalloproteinases to the formation of SP shows that these enzymes need to be studied in detail.
To date, only a single in-depth study of the barley/malt metalloproteinases has been carried out
and very few metalloproteases from any plants have been studied.
Barley and malt proteins that inhibit their endogenous endoproteinases
In the early 1960s it was noted that the addition of unmalted cereal flours to mashes led to worts
that would not ferment. This problem was traced to the fact that the worts did not contain
enough low molecular weight nitrogenous compounds to support good yeast growth. This low
wort nitrogen problem was in turn traced back to the fact that ungerminated wheat and barley
both contained compounds that inhibited the abilities of certain of the malt endoproteinases to
hydrolyze storage proteins into SP. It was eventually ascertained that these endogenous
proteinase inhibitors interfered with the activities of the cysteine class and metalloproteinases.
Metalloproteinase inhibitors. Because the significance of the contribution of the
metalloproteinases to SP formation during mashing has only recently been demonstrated, the
metalloproteinase inhibitors have scarcely been studied. However, in view of the facts discussed
above, which show that these enzymes probably play a major part in SP production, both these
proteinases and their endogenous inhibitors obviously deserve to be studied in detail. The malt
metalloproteinases have proven to be particularly recalcitrant to purification and characterization
and one reason for this could be that they bind to their endogenous inhibitors as soon as extracts
are prepared, and are thus rendered inactive.
Cysteine protease inhibitors. Conversely, the inhibitors of the cysteine proteases, the other main
enzymes responsible for SP formation during mashing, have been studied in depth and two of
them have been purified, identified and characterized in detail (2). Both are proteins that belong
to the lipid transfer protein (LTP) family. The major form is apparently a form of LTP1 that has
been slightly modified and the other is LTP2. Two other inhibitory fractions have been isolated
from barley malt and they also appear to be contain altered forms of LTP1. The amount of the
inhibitory LTP1 increases about 3 fold during malting and the protein binds strongly to the
cysteine endoproteinases, whose concentrations increase even more strikingly during malting.
- 90 -

Session 3: Malting and Brewing Quality – Oral presentations
The LTP1-enzyme complex is readily broken when heated to 100 o C, upon which the enzyme is
inactivated and precipitated. The heating does not, however, affect the inhibitory LTP1
molecule, and this characteristic has been used to develop an LTP1-enzyme ‘affinity’ method for
concentrating and partially purifying the endogenous inhibitors of the cysteine and serine
proteinases of malt. It has not been possible to dissociate the LTP1- cysteine endoproteinase
complex without inactivating the enzymes that are involved.
When added to mashes the purified LTP1 inhibitor strongly inhibited their endoproteolytic
activities and lowered the SP content of the resulting worts, so increasing or reducing its
concentration in mashes could provide a ‘natural’ method for altering the SP contents of worts.
It is not known whether or not the LTP molecules interact with the endoproteinases inside
germinating barley seeds. If so, then altering the natural concentrations of these molecules
would presumably also affect the amount of SP that is released during malting. Because the
cysteine proteases are very active in producing SP, adjusting the levels of their natural inhibitors
should have a significant effect on wort compositions.
Serine proteinase inhibitors. It has been known for many years that barleys and malts both
contained a family of proteins that have been called the ‘chloroform-methanol’, or ‘CM’,
proteins. Because one of these proteins clearly acted as an inhibitor of the bovine serine
proteinase called trypsin, these proteins have also been called ‘trypsin/α-amylase inhibitors’ and
it had been proposed that some of them might inhibit the activities of barley serine proteinases.
However, none had been shown to affect the barley enzymes. In my laboratory we purified a
barley serine proteinase called SEP-1 and showed that barley contained proteins that inhibited its
activity. Using the proteinase-inhibitor affinity method discussed above, we purified, isolated
and characterized four of the most effective SEP-1 inhibitors and showed that they were all
members of the CM protein family. The barley contained additional SEP-1 inhibitors that were
apparently less potent and these have not yet been studied.
Because the serine endoproteinases do not appear to directly contribute to the hydrolysis of
proteins during mashing, these inhibitors would presumably not affect the SP content of mashes.
However, they could affect wort compositions by indirectly controlling the proteolysis that
occurs during the germination/malting process, since their true functions in the grain are still
unknown.
Summary
Due to the use of inaccurate analytical methods, most of the past dogma that related to the
solubilization of proteins during malting and mashing is probably incorrect. The cysteine
proteinases do not uniquely control the formation of SP, but share this duty with the aspartic and,
to an even greater extent, the metalloproteinases. A good, inclusive study of the malt
metalloproteinases needs to be carried out, including a determination of what the
metalloproteinase inhibiting compounds of malt are that were reported many years ago. In
addition, it always needs to be remembered that it is not simply the presence of the barley/malt
endoproteinases that controls the amount, and probably the type, of SP that occurs in worts. By
controlling the activities of these enzymes, the various proteinaceous endogenous inhibitors
could, and probably do, determine what proteins are really hydrolyzed during mashing and,
possibly, during malting.
- 91 -

Session 3: Malting and Brewing Quality – Oral presentations
This report is a greatly condensed version of two papers that are in press/submitted to J. Cereal
Sci. (3,4) and any interested parties should consult them when they are published.
References
(1) Jones, B.L. and Budde, A.D. The effect of reducing and oxidizing agents and pH on malt
endoproteolytic activities and on malt mashes. J. Agric. Food Chem. 2003, 51, 7504-7512.
(2) Jones, B.L. and Budde, A.D. How various malt endoproteinase classes affect wort soluble
protein levels. J. Cereal Sci. 2005, 41, 95-106.
(3) Jones, B.L. Endoproteases of barley and malt. J. Cereal Sci. 2005, In Press.
(4) Jones, B.L. The endogenous endoproteinase inhibitors of barley and malt. J. Cereal Sci.
2005, Submitted.
- 92 -

Session 3: Malting and Brewing Quality – Oral presentations
Molecular structure and degradation patterns of endosperm cell walls from
barley differing in hardness and beta-glucan and protein contents
M.S. Izydorczyk (1), A. Lazaridou (2), T. Chornick (1), L. Dushnicky (1)
1. Grain Research Laboratory, CGC, Winnipeg, MB, Canada; email:mizydorczyk@grainscanada.gc.ca
2. Department of Food Science, University of Manitoba, Winnipeg, MB, Canada
Introduction
The walls surrounding the cells of the starchy endosperm of barley must be effectively degraded
during malting if problems with extract yield, wort and beer filtration, and beer clarity are to be
avoided. While it is possible to select barley varieties for malting on the basis of low levels of
beta-glucans, there is no clear relationship between beta-glucan content and malt quality.
Although beta-glucans are the major constituents of the endosperm cell walls, other
polysaccharides may also contribute to the overall quality of malting barley. The coexistence of
several biopolymers in the cell walls, their spatial organization, and the nature of interactions
(cross-linking) among them might contribute to the mechanical strength, permeability, and
solubility, and therefore to enzymic susceptibility of cell walls during malting. The influence of
composition and properties of the endosperm cell walls on kernel hardness has not been studied
in detail, although some relationships between hardness and cell walls have been suggested.
The objectives of this study were (1) to examine compositional and structural differences in
endosperm cell wall components derived from barley grains varying in hardness, protein and
total beta-glucan contents, (2) to investigate the enzymic degradation of isolated barley
endosperm cell walls, and (3) to determine how the differences in composition and morphology
of the cell walls influence their solubility, susceptibility to enzymatic hydrolysis, and degradation
patterns.
Materials and methods
Three malting barley samples (cv. Metcalfe) were grown in 2003 in 3 different locations in
Canada (A: Davidson, SK; B: Hythe, AB; C: Hamiota, MB). Grain hardness was measured with
the SKCS 4100 (Perten Instruments Inc., IL). Endosperm cell walls were isolated from a fiber
rich fraction obtained by roller milling of pearled barley, followed by pin milling and dry
sieving. Wet sieving (with 1% sodium dodecyl sulfate in 70% ethanol), homogenization and
sonication were used to purify the endosperm cell wall material (CWM). Monosaccharide and
phenolic acid composition was determined by high-performance reverse phase and anion
exchange chromatography (HPAEC), respectively (Izydorczyk et al. 1998 and Cyran et al.
2002).
The endosperm cell walls were sequentially extracted with water at 65 o C (WE), saturated barium
hydroxide (BaE), water (Ba/WE), and 1N sodium hydroxide (NaE) at 25 o C. The residue
remaining after the sequential extraction was designated RES. The fine structure of beta-glucan
was investigated by lichenase digestion and HPAEC (Izydorczyk et al. 1998). Monosaccharide
and glycosidic linkage composition was determined by HPLC and GC- MS (Izydorczyk et al.,
1998), respectively. Samples were prepared for SEM by mounting them onto aluminum stubs
covered with double-sided carbon adhesive discs and allowed to set for 24 h. The mounted
- 93 -

Session 3: Malting and Brewing Quality – Oral presentations
samples were placed in a Hummer VII (Anatech, Ltd.) sputter coater and coated with 50 nm of
gold and examined with a JEOL JSM-6400 SEM at 10 KV.
Results and discussion
The endosperm cell walls were obtained from barley samples differing in grain hardness, protein
and beta-glucan contents (Table 1). The general morphological features of the inner surface of
the walls can be seen in Figure 1. The inner wall surface of sample A appeared deeply pitted
with indentations made by small and large starch granules. These indentations were less
pronounced in the walls of samples B, and C. Sample C also contained areas with an uneven and
folded surface, possibly representing imprints of dense protein matrix rather than starch granules.
The thickness of the cell walls ranged from 0.5 to 1.6, 0.5-1.7 and 0.8-2.3 um for samples A, B,
and C, respectively.
Table 1. Composition and hardness of barley grains
Sample Protein Starch Beta- Soluble Arabinoxylans Hardness
% % glucan % Beta-glucan % %
index
A 10.8 61.3 4.2 2.3 5.8 59.25
B 11.8 58.9 4.6 1.7 5.6 68.88
C 17.1 54.8 4.8 2.6 5.4 61.70
A B C
Figure 1. SEM photographs of cell walls isolated from Metcalfe grown in Davidson, SK (A),
Hythe, AB (B), and Hamiota, MB (C).
The isolated cell walls contained very little starch (< 1 %) and proteins (~6%) and were built up
mainly from glucose, xylose, arabinose, mannose and small amounts of galactose (Fig. 2). The
intact endosperm cell walls of sample A contained the least amount of beta-glucans and the
highest amount of arabinoxylans and mannose-containing polysaccharides. The walls of sample
C contained the highest amount of beta-glucans, in agreement with the highest content of these
polymers in the barley grain. The endosperm cell walls of sample A contained the highest
amount of phenolic acids (ferulic, coumaric and diferulic), but the arabinoxylans in the walls of
sample B were more cross-linked than those in samples A and C (Table 2).
The treatment of the CWM with water at 65 o C solubilized mostly beta-glucans, whereas the
treatment with saturated barium hydroxide extracted mostly arabinoxylans (Fig. 3). The extract
obtained with water after the barium hydroxide treatment contained about 60% beta-glucans and
~35% arabinoxylans. The least soluble extract obtained with NaOH (NaE) and the residue
- 94 -

Session 3: Malting and Brewing Quality – Oral presentations
remaining after all extractions (RES) contained approximately equal parts of beta-glucans,
arabinoxylans and mannose-containing polysaccharides.
% mol of total sugars
80
70
60
50
40
30
20
10
0
Arabinose
Galactose
Glucose
Xylose
Mannose
A-CWM
B-CWM
C-CWM
Figure
2. Monosaccharide composition in the CWM. Figure 3. Sugar profile in various extracts
Table
2. Distribution of phenolic acids in CWM
A B C
Total phenolic acids, g/100g CWM 0.34 0.24 0.17
Total FA a , g / 100g CWM 0.28 0.20 0.15
Total DFA b , g / 100g CWM 0.0096 0.0092 0.0055
FA/Xyl x 10000 c
119 128 110
(DFA/Xyl)x10000 d
2.0 3.0 2.0
a b c d
ferulic acid; dehydrodiferulic acid; moles of FA per 10,000 moles of Xyl; moles of DFA per
10,000 moles of xylose residues
% mol of total sugars
100%
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%
WE BaE BaWE NaE RES
Galactose
Mannose
Arabinose
Xylose
Glucose
Following
the extraction of the endosperm cell walls with water, the surface indentations due to
starch granules could no longer be seen. It appears that the water-soluble beta-glucans may be
layered onto the surface of the walls rather than being distributed throughout the wall structure as
suggested by Fincher (1975). Following the extraction of arabinoxylans from the waterextracted
CWM the definition of endosperm cells disappeared. The NaOH extraction caused
further pitting and corrosion of the wall material.
- 95 -

Session 3: Malting and Brewing Quality – Oral presentations
A detailed analysis of oligosaccharides released by lichenase digestion of beta-glucans revealed
some differences in the structural features of these polymers among the samples. Beta-glucans in
the cell walls of sample B had the highest ratio of 3-O--D-cellobiosyl-D-glucose (DP3) to 3-O--
D-cellotriosyl-D-glucose (DP4) and a slightly lower level of oligosaccharides of DP 5-9,
representing a more cellulose-like region of the beta-glucans. On the other hand, the DP of
longer cellulosic fragments in this sample was higher than in sample A and C. Sample B had the
lowest ratio of β-(1→4) to β-(1→3) linkages. Beta-glucans originating from sample C clearly
had the greatest amount of glucose residues linked via β-(1→4) linkages, which was confirmed
by the highest ratio of β-(1→4) to β-(1→3) linkages and the lowest DP3/DP4 ratio.
Table 3. Structural features of beta-glucans
DP(5-9) a
Ratio Longer cellulosic
fragments b
DP3/DP4 a
Sample %
A 2.11 7.8 DP 10-24
B 2.28 7.7 DP 10-28
C 2.10 8.2 DP 10-25
a
found in water-soluble digests from lichenase treatment
b
found in water-insoluble precipitates released after lichenase treatment
Monosaccharide and glycosidic linkage analyses revealed that arabinoxylans in the cell walls of
sample A were less substituted than those in sample B and C (Table 4). Arabinoxylans in the
cell walls of sample A had the highest amount of unsubstituted but the smallest amount of
doubly substituted xylose residues. The least soluble polysaccharide of the endosperm cell
walls, present in the NaE and remaining in the residue, differed substantially from those found in
the WE, BaE, and BaWE (Table 5). The linkage analysis revealed the presence of lowly
substituted arabinoxylans, beta-glucans with a high ratio of β-(1→4) to β-(1→3) linkages, and
the presence of glucomannans and/or(galacto)glucomannans. The highest amounts of lowly
substituted arabinoxylans and mannose-containing polysaccharides were found in sample A
whereas the highest amount of beta-glucans with cellulose-like features was found in sample C.
Table 4. Structural features of arabinoxylans
Sample Xyl/Ara a
Usub/Sub
Xyl b
Doubly/Sing Xyl c
A 1.74 1.76 0.97
B 1.54 1.46 1.28
C 1.44 1.14 2.43
a
Ratio of xylose to arabinose residues
b
Ratio of unsubstituted xylose to substituted Xylp
c Ratio of doubly to singly substituted xylose residues
- 96 -

Solubilized CHO
(% total present in CWM)
Session 3: Malting and Brewing Quality – Oral presentations
Table 5. Structural features of NaE fraction in CWM of various samples.
A B C
Ratio Unsub/Sub Xylp 2.54 1.98 1.40
Ratio Xyl/Ara 2.8 2.4 2.0
→4 Manp 1→ (%mol) 32 20 12.5
Ratio (1→4)/(1→3) Glc 3.20 3.4 3.9
The enzymic degradation of endosperm cell walls was investigated by treating buffered
suspensions of isolated cell wall fragments (previously extracted with water at 45 o C) with malt
extracts and determining the amount, monosaccharide composition and molecular size
distribution of the soluble carbohydrate products. The water solubility of the CWM in 45 o C
ranged from 24% for sample B, through 27% for sample A, to 41% for sample C.
Approximately 20% of the CWM, remaining after the initial water extraction, was solubilized
with the malt enzymes. Substantially more beta-glucans than arabinoxylans or mannosecontaining
polysaccharides were solubilized with water at 45 o C (Figure 4). Interestingly, the
majority of mannose containing polymers was solubilized during digestion of CWM with the
malt enzymes. Almost equal amounts of arabinoxylans (~10%) were solubilized with water and
with the malt enzymes. Overall, the solubility and digestibility was lower for sample B than for
A and C. Both high- and low-molecular weight (HMW and LMW) materials were released
from the CWM during digestion with malt extracts. The monosaccharide analysis revealed the
HMW malt digest contained mostly glucose, xylose and arabinose, whereas the LMW malt
digest contained glucose and mannose. Differences in the molecular structure of beta glucans
and arabinoxylans extracted with water compared to those solubilized with the malt enzymes
were also observed.
90
80
70
60
50
40
30
20
10
0
90
Solubilization at 45
80
o C/H2O Solubilization with malt extract
Glc Ara + Xyl Man
70
60
50
40
30
20
10
A B C
0
Glc Ara + Xyl Man
Figure 4. Amount of solubilized carbohydrates during solubilization with water and digestion
with malt extract of the CWM.
- 97 -

Acknowledgment
Session 3: Malting and Brewing Quality – Oral presentations
The financial support from NSERC is gratefully acknowledged.
References
Izydorczyk, M. S., Macri, L.J., MacGregor, A.W. (1998). Carbohydr. Polym., 35, 249-258.
Cyran, M., Izydorczyk, M. S., and MacGregor, A. W. (2002). Cereal Chem., 79, 359-366.
Fincher, G.B. (1975). J. Ins. Brew., 81, 116-122.
- 98 -

Session 3: Malting and Brewing Quality – Oral presentations
Amino acid levels in wort and their significance in developing malting barley
varieties
Edney, M.J. 1 *, Legge, W.G. 2 and Rossnagel, B.G. 3
1 Grain Research Laboratory, Canadian Grain Commission, Winnipeg, R3C 3G8 Canada
2 Brandon Research Station, Agriculture and Agri-Foods Canada, Brandon, R7A 5Y3 Canada
3 Crop Development Centre, University of Saskatchewan, Saskatoon, S7N 5A8 Canada
*Corresponding author: medney@grainscanada.gc.ca
Introduction
High levels of grain protein are the greatest restriction to increasing the selected malting barley
pool in western Canada. International markets traditionally aim for less than 11.5 % protein in
malting barley, but barley exported from Canada averaged greater than 12 % over the past 10
years (Fig 1). Higher protein barley is undesirable because of reduced potential fermentable
extract which restricts the amount of beer that can be made from a barley’s malt. Canadian
barley breeders, therefore, are often encouraged to develop varieties with potential for low
protein. However, a certain level of barley protein is required to make a quality malt and protein
is actually limiting in barley from some parts of the world. Canadian malting barley has a
reputation for excellent quality, specifically high fermentability, which is indirectly a result of
higher protein barley. Soluble protein in malt, resulting from hydrolysis of barley protein during
malting and mashing, contributes to foam retention in the final beer and the amino acids and
small peptides resulting from further degradation of the soluble protein, are essential for yeast
nutrition during fermentation. Barley protein also provides greater potential to produce adequate
levels of starch-degrading enzymes (Fig 2) which are essential for trouble-free fermentations
(Evans et al 2003). The higher levels of protein in Canadian malting barley, therefore, contribute
to excellent fermentation potential and adequate levels of foam positive proteins but some
reduction in protein could still increase the amount of barley selected in western Canada.
Figure 1. Average protein content of 2-rowed malting barley exported from Canada,
1995-2004.
Protein (%DM)
13.0
12.5
12.0
11.5
11.0
10.5
11.5 % - Maximum International Standard
1995
1996
1997
1998
1999
- 99 -
2000
2001
2002
2003
2004

Session 3: Malting and Brewing Quality – Oral presentations
Any initiative to genetically reduce barley protein levels must proceed with caution, especially if
extreme changes are expected. Altered barley must still have the potential to provide adequate
levels of soluble malt protein for efficient fermentation and adequate beer quality. To ensure
adequate protein degradation, breeding programs presently rely on percentage of soluble protein
in Congress extract and Kolbach index. These values give some indication of adequate levels of
degraded protein for beer foam as well as of nitrogenous nutrients for yeast. Free amino nitrogen
(FAN), a measurement of amino acids and peptides, provides more specific information on
nitrogenous nutrient status, but is seldom monitored. Fermentability and foam potential are not
considered directly in breeding programs.
Figure 2. Diastatic power versus on protein levels in Canadian-grown Harrington barley.
Diastatic power (°L)
r 2 195
185
175
165
155
145
135
125
115
105
95
= 0.575***
10.0 10.5 11.0 11.5 12.0 12.5 13.0
Barley protein (%DM)
Data source: Langrell & Edney 1995 – 2004
The importance of monitoring free amino acid levels in malts of breeder lines has received
limited attention. Levels are seldom even monitored in commercial malts because they are
considered to be relatively constant in extracts made from malts of different varieties (Jones &
Pierce 1964). These levels are also not considered to be limiting to fermentability in all-malt
worts. However, they can be limiting in high-gravity and high-adjunct brewing (O’Connor-Cox
& Ingledew 1989) and a recent study found significant relationships between several individual
amino acids and fermentability in commercial malts (Yin et al 2004). The present study
investigated the importance of monitoring free amino acids, versus other malt quality parameters,
for determining fermentation potential in malting barley breeding programs.
Materials and Methods
A doubled haploid population (54 covered and 54 hulless lines) was used to compare levels of
free amino acids and indeces of protein degradation to fermentability. The population was
produced by anther culture techniques at Agriculture and Agri-Food Canada Brandon from the
cross, TR251/HB345. TR251 is a covered breeding line with good malting potential while
HB345 is a hulless breeding line with good agronomic traits and the allele for heat stable betaamylase
(sd2H). The 108 lines along with two replicates of each parent, were grown at Hamiota,
Manitoba in 2002. Samples of the lines and parents (500 grams) were micromalted in a Phoenix
Automated Micromalting machine (Adelaide, SA, Australia) according to the following
- 100 -

Session 3: Malting and Brewing Quality – Oral presentations
schedule: Wet steep 6h, Air rest 2h, Wet steep 4h, Air rest 12h, Wet steep 4h, Air rest 4h, Wet
steep 4h, Air rest 4h, Wet steep 4h (steeping at 13°C); Germination 100h (15°C), Kiln 12h @
55°C, 6h @ 65°C, 2h @ 75°C, 4h @ 85°.
Standard methods of the ASBC (American Society of Brewing Chemists 1992) were used to
prepare and analyse fine grind Congress malt extracts. Analysis of free amino acids was based on
the method of Garza-Ulloa et al (1986) and was performed on a Beckman 7300 High
Performance Amino Acid Analyzer (Beckman Coulter, Inc., Fullerton, CA 92834-3100).
A small scale method for measuring apparent attenuation limit (AAL) was used to determine the
fermentation properties of the samples. The method incubated 40 ml of EBC wort (European
Brewery Convention 1998) with 160 mg dried yeast (Mauribrew lager yeast, Toowoomba,
Australia) at 25°C for 24 hours (Logue 1997).
Table 1. Average malt quality of the 108 malt samples studied
Barley Fine Soluble
Protein Extract Protein FAN ß-Glucan DP α-Amylase AAL Alcohol
% % % mg/L ppm °L DU % v/v%
Average 13.8 82.5 6.33 262 137 185 59.2 80.8 3.5
Maximum 15.8 87.6 7.58 335 466 306 81.1 85.7 3.9
Minimum 12.0 76.1 5.53 202 29 107 21.7 71.9 2.9
Results and Discussion
The 108 samples showed a range in quality from very poor to excellent (Table 1) which is
similar to what breeders would experience when screening lines for quality in their programs. As
a result of the range in quality, fermentability was affected by a number of different malt quality
factors, thus, masking, to some extent, direct effects of protein degradation and amino acids on
fermentability.
Figure 3. Effect of levels of serine on fermentability of the 108 malt
samples studied.
Apparent Attenuation Limit (%)
r 2 88
86
84
82
80
78
76
74
72
70
= 0.332***
45 55 65 75 85 95 105
Serine (mg/mL)
- 101 -

Session 3: Malting and Brewing Quality – Oral presentations
Soluble protein and FAN were found to have insignificant correlations with fermentability
(r 2 =0.014 and 0.039 respectively). The sum of all individual free amino acid did show a higher
correlation coefficient but still insignificant (r 2 =0.112). Individual levels of both serine and
cysteine were found to correlate highly, significantly with fermentability for the samples tested
(Fig 3 & 4). Serine levels also correlated well (r 2 =0.441***) with α-amylase levels and levels of
both serine and α-amylase were significantly lower in hulless versus covered samples (Edney et
al 2004). This suggested that the serine/fermentability correlation was related to α-amylase
levels, which are known to affect fermentability, and not serine directly. However, serine has
been shown by others (Yin et al 2004) to be related to fermentation which, in combination with
the significant cysteine correlation, and to a lesser extent, tryptophan and phenylalanine
(r 2 =0.186* and 0.174*, respectively), still supported the monitoring of amino acids as an
indication of fermentation potential.
Conclusions
Figure 4. Effect of levels of cysteine on fermentability of the 108 malt
samples studied.
Apparent Attenuation Limit (%)
r 2 88
86
84
82
80
78
76
74
72
70
= 0.339***
0.0 2.0 4.0 6.0 8.0 10.0
Cysteine (mg/mL)
Percentage of soluble protein in a wort, Kolbach index and FAN levels provided no information
on the nitrogenous nutrient status of the worts with respect to fermentability for the breeding
population studied. Individual amino acids did explain some of the variability in fermentation,
despite masking by other parameters such as levels of enzymes and ß-glucan, suggesting that
monitoring of free amino acid could be of benefit. However, the cost of such testing with early
generation lines would be prohibitive, although, monitoring at final stages, just prior to
commercialization, might be warranted. This would be especially important in altered lines with
low levels of barley protein.
- 102 -

References
Session 3: Malting and Brewing Quality – Oral presentations
American Society Of Brewing Chemists (1992). Methods of Analysis, 8th ed. The Society, St.
Paul, MN.
European Brewery Convention (1998). Analytica-EBC. Verlag Hans Carl Getränke-Fachverlag,
Nürnberg, Germany.
Edney, M.J., Legge, W.G., Rossnagel, B.G., Collins, H.M. (2004). Malting quality of a
hulless/covered doubled haploid barley population. Proceedings International Barley
Genetics Symposium, Brno, Czech Republic, June 20-26 (eds. J. Spunar, J. Janikova) CD-
ROM pp 418-424.
Evans, S.E., Van Wegen, B., Ma, Y., Eglinton, J. (2003). The impact of the thermostability of aamylase,
ß-amylase, and limit dextrinase on potential wort fermentability. J. Am. Soc. Brew.
Chem. 61:210-218.
Garza-Ulloa H., Cantú R.G., Gajá A.M.C. (1986). Determination of amino acids in wort and beer
by reverse-phase high-performance liquid chromatography. J. Am. Soc. Brew. Chem. 44:47-
51.
Jones, M., Pierce, J.S. (1964). Absorption of amino acids from wort by yeasts. J. Inst. of Brew.
70:307-315.
Langrell, D.E., Edney, M.J. (1995 – 2004). Quality of western Canadian malting barley.
Canadian Grain Commission, Winnipeg, MB.
Logue S.J. (1997). The Waite Barley Quality Evaluation Laboratory Barley Quality Report,
University of Adelaide.
O’Connor-Cox, W.S.C., Ingledew, W.M. (1989). Wort nitrogenous sources – Their use by
brewing yeasts: A review. J. Am. Soc. Brew. Chem. 47:102-108.
Yin, X.S., Strasser, G.H., Ladish, W.J. (2004). Wort amino acid composition of different barley
varieties and effect on nitrogen assimilation, Proceedings World Brewing Congress, San
Diego, CA, July 25-28 CD ROM.
- 103 -

Session 3: Malting and Brewing Quality – Oral presentations
Commercialization of Near Infrared Reflectance Spectroscopy (NIRS) for
screening breeding lines in the breeding program and screening grain lots in
a malt plant
James H. Helm, Lori Oatway and Patricia Juskiw
Alberta Agriculture Food and Rural Development – Field Crop Development Centre, 5030-50 Street, Lacombe, Alberta
T4L 1W8 Canada
Plant breeding is a long-term commitment that puts together the agronomic, disease resistance
and quality characteristics into an economically viable cultivar. However, for malt quality, the
cost and time required for testing is both expensive and limiting so only a small part of the
breeding program can be screened. The malting tests are also destructive and require larger seed
samples that are not available in the early generations of a breeding program.
During the commercial malting process the maltster also combines grain lots into the malt house
and increases the variability of the grain. A rapid test of the whole grain will allow the
variability of the grain to be predicted and controlled before the barley even enters the malt
house. This will improve overall quality of the final malt.
The Field Crop Development Centre (FCDC) began a joint project with Canada Malting in
Calgary in 1996. The objective was to develop NIRS calibrations for the primary quality factors
used by the Malting and Brewing industry to measure malting quality. These included Grain
Protein, Fine Extract, Diastatic Power, Alpha-Amylase, Total Malt Protein, Soluble Malt Protein,
Wort B-Glucan, Malt Friability, Homogeneity, and Viscosity.
NIRS is an excellent tool to screen large numbers of whole grain samples in a short period of
time. For over 20 years the FCDC has used NIRS to screen for feed quality and presently screens
over 35,000 samples every year. NIRS is a non-destructive test, requiring as little as 25 grams of
seed, allowing the breeder to screen material at a very early stage in the breeding program.
Materials and Methods
The development of the Malting Quality equations were done on breeding samples representing
everything from feed barley to the best malting quality available. Samples were selected at the
FCDC and scanned on a FOSS 6500 Spectrophotometer. The samples were then sent to Canada
Malting. Canada Malting malted these samples in a Phoenix micro malt plant using 150 g of
seed. They used a standard cycle in the phoenix plant and the samples were fully modified.
Data was sent back to the FCDC to be used for calibration development.
The final research calibration set consisted of approximately two hundred samples per year for
five years beginning in 1996. After 2001, samples were added each year in order to strengthen
the calibration. In order to insure that we had maximum variation both genetically and
environmentally we eliminated redundant samples; therefore, not all samples were used to build
the calibration. All the equations developed are based on whole grain, unmalted barley.
- 104 -

Session 3: Malting and Brewing Quality – Oral presentations
The FCDC has successfully used these calibrations to predict malting quality on whole grain
samples from the breeding program since 1998. In 2002 be began the process of adding
commercial malt samples into the equations. The commercial samples came from three malt
houses at Canada Malting in Calgary and from Rahr Malt in Alix, Alberta. The barley samples
were taken from lots before malting and the malt analysis came from the same malting company
that produced the finished malt.
Results
The commercial malt samples represented a narrow range of variability in the original
calibrations. This was expected as these were all malt varieties selected by the malt house. In
general the commercial samples contained much more variability within the sample compared to
the original research samples. Figures 1, 2, 3 and 4 show the relationship of the commercial
malts in the overall calibration sets. By adding them into the calibration set we reduced the
accuracy slightly but improved the consistency (Table 1). This translated into slightly different
RSQ and Standard Error of Calibration (SEC).
Table 1. Relation between the research calibration based on micro malt data (MM)
and the commercial calibration (CM) for the characteristics measured.
Constituent N Min Max SEC* RSQ
Value Value
Fine Extract - MM 767 73.6 85.5 0.60 0.91
Fine Extract - CM 994 74.0 85.7 0.57 0.91
Diastatic Power - MM 369 68 217 6.72 0.93
Diastatic Power - CM 662 68 224 8.04 0.90
Total Malt Protein - MM 905 6.1 19.0 0.27 0.98
Total Malt Protein - CM 1049 6.6 18.6 0.25 0.98
B-Glucan - MM 262 0 623 32.88 0.93
B-Glucan - CM 495 0 580 34.83 0.91
It is evident to us that the success of the calibrations has been the wide segregating variation we
had in the genetic research samples, which allowed us to build upon with commercial samples.
Because of the variability in commercial malts which is also increased due to the lot size in the
malt house and the variability introduced by both the steeping and killing processes we will see
final commercial malts have a greater variance and would expect them to differ from research
malts from a pure source. This should not reduce the usefulness of this technology to the malting
industry but can only help them to determine how to blend lots to meet optimum quality through
there malting process. It also allows breeding programs to screen for malt quality cheaply and
quickly at early stages in the breeding program.
- 105 -

NIR PRediction Values
NIR Prediction Values
Session 3: Malting and Brewing Quality – Oral presentations
Figure 1. NIR Calibration Equation for Total Malt Protein showing FCDC
& Conagra Steep Samples.
20
18
16
14
12
10
8
85.5
83.5
81.5
79.5
77.5
75.5
73.5
71.5
8 10 12 14 16 18 20
Laboratory Values
FCDC Samples
Conagra Steep
Figure 2. NIR calibration data for Fine Extract showing FCDC samples &
Conagra steep samples.
71.5 73.5 75.5 77.5 79.5 81.5 83.5 85.5
Laboratory Values
- 106 -
FCDC Samples
Conagra Steep Samples

NIR Prediction Values
NIR Prediction Values
Session 3: Malting and Brewing Quality – Oral presentations
Figure 3. NIR calibration data for Diastatic Power showing FCDC samples
and Conagra steep samples.
230
210
190
170
150
130
110
700
600
500
400
300
200
100
90
70
0
70 90 110 130 150 170 190 210 230
Laboratory Values
FCDC samples
Conagra Steep
Figure 4. NIR calibration data for Wort B-Glucan showing FCDC samples
and Conagra Steep samples.
0 100 200 300 400 500 600 700
Laboratory Values
- 107 -
FCDC Samples
Conagra Steep

Session 3: Malting and Brewing Quality – Poster abstracts
The differences in fermentable carbohydrates of major Canadian malting
barley varieties and their effects on fermentation
Yueshu Li 1 , Rob McCraig 1 , Ken Sawatzky 1 , Aleks Egi 1 and Michael Edney 2
1. Canadian Malting Barley Technical Centre, Winnipeg, R3C 3G7 Canada
2. Grain Research Laboratory of the Canadian Grain Commission
Abstract
The fermentable carbohydrates of the major Canadian malting barley varieties were monitored
during malting and brewing processes. It was observed that the fermentable carbohydrate
compositions of the congress wort were varietal dependent, while the fermentable carbohydrate
compositions of the finished wort were both varietal and mashing condition dependent. The overall
malt modification affected malt carbohydrate composition, and malt’s brewing performance and final
beer quality.
NanoMash: A novel procedure for research mashing of limited-quantity
barley malts
Laurie A. Marinac and Mark R. Schmitt*
USDA Agricultural Research Service, Cereal Crops Research Unit, 501 Walnut St., Madison, WI 53726
The ASBC Malt-4 extract analysis method (Congress Mash) provides a standard set of conditions for
generating an unhopped wort commonly used to evaluate the malting quality performance of
experimental malts. However, the method requires specialized instrumentation and relatively large
quantities of malt. These requirements prevent researchers without access to the specialized
instrumentation and particularly those with limited sample availability from generating Congress
worts for malting quality analysis and other research uses. Use of a commercially available device
allows agitation of small volume samples through orbital mixing while heating or cooling them using
a Peltier temperature controlled block. Controlling the device to follow the Congress mash
temperature profile offers the possibility of conducting a mashing cycle at a significantly reduced
scale. Adaptation of standard ASBC wort analysis methodology to microtiter plate and other
reduced-scale methodology allows provision of several key parameters for worts generated from
size-limited samples. While not intended to supplant standard ASBC methodology, this small-scale
mashing protocol significantly lowers the sample requirements and extends the potential for malt
analysis to research programs where it may not have been previously feasible.
*Corresponding author: 608-262-4480, markschmitt@wisc.edu
- 108 -

Session 3: Malting and Brewing Quality – Poster abstracts
Comparison of hull peeling resistance of barley and malt in western
Canadian two-row barley lines
W.G. Legge 1 , J.S. Noll 2 , and B.G. Rossnagel 3
1 Agriculture and Agri-Food Canada, Research Centre, P.O. Box 1000A, R.R. #3, Brandon, Manitoba R7A 5Y3;
2 Agriculture and Agri-Food Canada, Cereal Research Centre, 195 Dafoe Road, Winnipeg, Manitoba R3T 2M9;
3 Crop Development Centre, University of Saskatchewan, 51 Campus Drive, Saskatoon, Saskatchewan S7N 5A8.
Hull peeling resistance in barley and malt is desired by the malting and brewing industry. A group of
15 two-row malting barley (Hordeum vulgare L.) lines and one feed cultivar were used to compare
these traits in Canadian two-row barley and determine their relationship to other agronomic traits,
including grain yield, kernel plumpness, test weight and kernel weight. Barley samples from
standard yield test plots at two sites in each of Manitoba and Saskatchewan during 1999 and 2000
were evaluated for % hull peeling on a weight basis direct from the plot combine (RPWB) and after
inducing peeling with an air-blast de-huller (APWB). Micromalted samples were evaluated for %
hull peeling of the malt “as is” (RPWM) and after air-blast de-hulling (APWM). Analyses of
variance over years and locations indicated that hull peeling of barley and malt were strongly
influenced by environmental factors, particularly year. However, the single largest source of
variance for RPWM and APWM was the genotypic component, indicating that heritability and
response to selection would be higher in malt than barley. Genotypic effects were lowest for RPWB,
but still highly significant (P

Session 3: Malting and Brewing Quality – Poster abstracts
Elimination of barley colour defects in Australia
Glen Fox 1 , Maria Sulman 1 and Kevin Young 2
1 Department of Primary Industries & Fisheries, Toowoomba, Qld 4350 Australia
2 GxE Crop Research, PO Box 1704, Esperance, WA 6450, Australia
Grain colour defects including staining and black point have been a problem for Australian barley
growers for a number of years, resulting in thousands of tonnes of malting barley being downgraded
each year. Over the last decade, research has been conducted investigating many aspects of these
disorders, including objective assessment, biochemical evaluation, crop management, storage effects
and resistance breeding. A number of breeding lines have been identified with resistances to both
forms of colour defects. The black point tissue has been extracted with high levels of phenolic acids
(namely ferulic and coumaric acids) being present suggesting the dark pigmentation may be a large
polyphenolic compound. Black pointed grain also has an impact on germination rate. Markers for
black point resistance coincide with markers for dormancy and pre-harvest sprouting amylase. The
effects on fungal contamination results in a dark staining on the grain. A number of factors impact of
the degree of staining including pre-harvest rainfall, timing of the rainfall event and pre-existing level
of resistance. Husk content also appears to have an impact on the final appearance of the grain.
Markers for husk content also coincide with genetic regions for dormancy and pre-harvest sprouting.
The improvement of grain quality at intake can be delivered through two options; 1. the development
of barley varieties with resistance to these grain defects as resistance to black point and staining has
been shown to be heritable and 2. optimising early harvest strategies and cool-air drying on-farm.
glen.fox@dpi.qld.gov.au
Characterization of barley tissue-ubiquitous beta-amylase2
Suzanne E. Clark 1 , Patrick M. Hayes 2 , and Cynthia A. Henson 1,3
1 Dept. of Agronomy, University of Wisconsin-Madison,
2 Dept. of Crop and Soil Science, Oregon State University, and
3 UDA-ARS Cereal Crops Research Unit, Madison, WI
There are two barley β-amylases genes, encoding important starch degrading enzymes. The
endosperm-specific β-amylase (Bmy1), the more abundant isozyme in cereal seeds, has been
thoroughly characterized. The lesser abundant β-amylase2 (Bmy2), has not been biochemically
characterized from any cereal seeds. Characterization of Bmy2 from two commonly grown barley
(Hordeum vulgare L.) cultivars, ‘Morex’ and ‘Steptoe’, was a major objective of this study. The
bmy2 cDNAs were sequence, expressed in Escherichia coli, and the recombinant enzymes (rBmy2)
characterized. The relative hydrolysis rates of various a-D-glucans and the pH activity optima of
‘Morex’ and ‘Steptoe’ rBmy2s were the same and not significantly different from barley rBmy1.
The ‘Morex’ rBmy2 was 7 o C more thermostable than the ‘Steptoe’ rBmy2, determined by
differences in their T50 values, and is more thermostable than any reported wild type β-amylase1.
Three amino acid differences were identified between the two Bmy2 sequences and the contributions
to enzyme thermostability evaluated by site-directed mutagenesis. Examination of mutant enzymes
with one amino acid substitution revealed that each of the three residues contributed ~3 o C to the
thermostability of the ‘Morex’ wild type rBmy2. Mutant enzymes with two amino acid substitutions
contributed ~5.6 o C and the triple amino acid mutant enzyme contributed ~8.7 o C to thermostability.
To date, no quantitative trait loci (QTL) for malting quality traits have been associated with the bmy2
locus. Should an association be discovered, the ‘Morex’ bmy2 allele, containing D238, M337 and
Q362, provides a discrete signature of a thermostable β-amylase2 that could be targeted for marker
assisted selection.
Corresponding author: cahenson@wisc.edu
- 110 -

Session 3: Malting and Brewing Quality – Poster abstracts
Barley seed osmolyte concentration as an indicator of preharvest sprouting
Cynthia A. Henson 1,2 , Stanley H. Duke 2 , Paul Schwarz 3 , Rich Horsley 3 , and Charles Karpelenia 1
1 USDA-ARS Cereal Crops Research Unit, Madison, WI 53706,
2 Department of Agronomy, University of Wisconsin, Madison, WI 53706,
3 Department of Plant Sciences, North Dakota State University, Fargo ND 58105
This study was conducted to test the hypothesis that barley seed osmolyte concentrations can be used
as an indicator of preharvest sprouting (PHS). Osmolyte concentrations from the 2002 Minnesota
and North Dakota crops were compared to pearling and other techniques for assessment of PHS.
Approximately 30% of the seed evaluated were sprouted. Samples were evaluated for osmolyte
concentrations, pearling, and Stirring Number, while smaller subsets were evaluated using other
methodologies. Osmolyte concentrations correlated well with pearling (r=0.822, P

Session 3: Malting and Brewing Quality – Poster abstracts
Relationships among malt fermentability and malt quality parameters under
the influence of barley β-amylase heat stable allele
Blanca Gómez* 1 , Héctor Acevedo 2 , and Ana Clara López 3
1 Malting Unit, Cereal Department, Laboratorio Tecnológico del Uruguay, Av. Italia 6201 CP 11500, Montevideo, Uruguay
2 Quality Laboratory, Malteria Oriental S.A. Abrevadero 5525, Montevideo, Uruguay
3 Biotechnology Department, Laboratorio Tecnológico del Uruguay, Av. Italia 6201 CP 11500, Montevideo, Uruguay.
Starch hydrolysis during germination is achieved by the action of four major enzymes, -and βamylase,
limit dextrinase and -glucosidase. This hydrolysis produces fermentable sugars required
for yeast nutrition in brewing. Fermentability is a critical quality parameter for brewing that affects
the level of alcohol produced by yeast, and is typically assessed in malt extracts by determining the
change in specific gravity after small scale fermentation, referred to as apparent attenuation limit.
Diastatic power is a measure of the capacity of the malt to degrade starch into fermentable sugars and
is primarily determined by β-amylase activity. Although diastatic power is a reasonable predictor of
fermentability, it does not always accurately estimate the level of fermentable sugar generated during
mashing or the subsequent fermentability of the resultant wort. β-amylase is one of the major
proteins found in the starchy endosperm, which rapidly loses activity at mashing temperatures above
55ºC. Two alleles with different β-amylase enzyme thermostability are distinguished with the
insertion/deletion of a palindromic 126-pb sequence in intron III of β-amy1 gene. Increased
thermostability results in more efficient starch degradation. Barley cultivars with high thermostability
β-amylase allele will achieve high levels of fermentability without a good malt modification. On the
other hand, barley cultivars with low thermostability β-amylase allele will achieve high levels of
fermentability if they achieve high levels of malt modification. The objective of this study was to
determine the influence of heat stable β-amylase allele in the relationship between fermentability and
quality parameters. We characterized 40 commercial malting barley varieties from different
countries. The malt quality data used in the correlations studies come from the average of the results
obtained by 50 laboratories. The quality malt parameters analyzed were: Fine Grind Extract, Total
Nitrogen, Hartong 45, Diastatic Power, Wort Viscosity, Alpha-Amylase, Friability, Free Amino
Nitrogen, Final Attenuation Apparent and Soluble β-Glucans. Significant correlations were obtained
from the statistical point of view, but values of R square explained less than 20 % of the variability
among the parameters. In general, barley varieties that present high thermostability β-amylase allele
showed better qualitative levels of fermentability and malt modification than the varieties with low
thermostability β-amylase allele. From these results we conclude that the fermentability is not easily
predicted from quality parameters, therefore the use of β-amy1 allele in barley breeding program is
necessary to improve fermentability levels in malting barley grains. More studies are needed to
understand all the properties that influence malt fermentability and how they interact.
- 112 -
*Corresponding author: bgomez@latu.org.uy

Session 4: Breeding, Agronomy, and Germplasm
Tuesday, July 19, 2005 – p.m.
Session 4: BREEDING, AGRONOMY, AND GERMPLASM
Chairs
Joseph Nyachiro and Bill Chapman
Presenters
Dale Clark, Western Plant Breeders
Mike Grenier, Canadian Wheat Board
George Clayton, Agriculture & Agri-Food Canada, Lacombe Research Centre
Anthony Anyia, Alberta Research Council
Mario Therrien, Agriculture & Agri-Food Canada, Brandon Research Centre
Patricia Juskiw, Field Crop Development Centre
- 113 -

Barley ecology and management
Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Clayton, G.W. 1 , O’Donovan, J.T. 2 , Irvine, R.B. 3 , Harker, K.N. 1 , Turkington, T.K. 1 Lupwayi, N.Z. 2 , and
McKenzie, R.H. 4
Agriculture and Agri-Food Canada, 1 Lacombe, 2 Beaverlodge, Alberta, 3 Brandon, Manitoba, Canada; and
4 Alberta Agriculture, Food and Rural Development, Lethbridge, AB
Background and Objectives
Short-term experiments can lead to low input management recommendations that are profitable
in the short-term, however, it is doubtful if such practices would continue to be profitable due to
carryover effects of uncontrolled weeds and diseases. Many cow/calf producers in central
Alberta plant continuous barley for silage and seed, limiting agro-ecosystem diversity and
favouring pest outbreaks. The objective of this experiment was to determine the cumulative
effects of seeding rate, barley type, rotations and herbicide rate on wild oat management and
disease. Barley variety/seeding rate/herbicide rate combinations were seeded in 2003 on
previous barley (2001) and canola (2002) stubble to evaluate the rotational and seeding rate
impact on reducing input costs and minimizing the risk associated with disease pressure under
continuous barley situations.
Methods
Field experiments were conducted at Beaverlodge, Fort Vermilion and Lacombe, Alberta and
Brandon, Manitoba in 2001, 2002 and 2003. Two barley varieties, Peregrine (short) and AC
Bacon (tall), were seeded at 200 and 400 seeds per m 2 in the continuous barley each year. Barley
seeded at 100 seeds per m 2 is equivalent to approximately ¾ bushel, however, this can change
every year depending on barley type, variety and seed weight. In addition, hulled barley emerges
at approximately 75% of seeds planted, whereas, hull-less barley emerges at approximately 60%
of seeds planted. Planting by number of seeds per ft 2 or m 2 ensures the targeted plant
establishment. Rotational barley included a canola crop that replaced the short and tall barley in
2002. Herbicide treatments were applied at full, half (H) and quarter (Q) recommended rate.
Results from trials at Beaverlodge and Fort Vermilion were similar in nature to those in
Lacombe. Only Lacombe and Brandon results are shown.
Results
Lacombe
Weed Biomass and Grain yield
Continuous barley had wild oat biomass that was 2.5 times that of rotational barley. Tall barley
with a high seeding rate and a quarter of the recommended herbicide rate significantly reduced
wild oat biomass compared to short barley with a low seeding rate and a quarter of the
recommended herbicide rate in continuous and rotational barley (Fig. 1a). Wild oat biomass was
increased 11 times and 23 times when short barley was grown compared to tall barley at half and
a quarter of the recommended herbicide rate, respectively. Grain yield was 8% higher from
rotational barley than continuous barley (Fig. 1b). Grain yield increased with the high seeding
rate compared to the low seeding rate for both the short and tall barley.
- 114 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Brandon
Weed Biomass and Grain yield
Tall barley with a high seeding rate and half the recommended herbicide rate significantly
reduced wild oat biomass compared to short barley with a low seeding rate and half the
recommended herbicide rate. Only tall barley and high seeding rate reduced wild oat biomass at
the quarter herbicide rate compared to the other treatments (Barley*seed rate* herbicide rate,
P

Wild Oat Biomass (kg/ha)
3500
3000
2500
2000
1500
1000
500
0
Herbicide Rate
Seeding Rate
Grain Yield (kg/ha)
7000
6500
6000
5500
5000
4500
4000
3500
3000
2500
2000
1500
1000
500
0
Herbicide Rate
Seeding Rate
A
Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
H Q H Q H Q H Q H Q H Q H Q H Q
Continuous Barley Rotational Barley
Short Barley Tall Barley
Short Barley Tall Barley
H Q H Q H Q H Q H Q H Q H Q H Q
200 400
Continuous Barley Rotational Barley
Short Barley Tall Barley
200 400
B
Short Barley Tall Barley
200 400 200 400 200 400
200 400 200 400 200 400
Fig.1. Relationship between barley rotation (barley/barley), barley type (short vs tall), herbicide
rate (H=50% recommended and Q = 25% recommended) and seeding rate (200 and 400 seeds
planted per m 2) on (a) wild oat biomass (kg/ha – 1000 kg = ½ ton/acre) and (b) grain yield (kg/ha
- 1000 kg = ~20 bushels) in 2003 at Lacombe, Alberta.
- 116 -

Grain Yield (kg/ha) Wild Oat Biomass (kg/ha)
3500
3000
2500
2000
1500
1000
500
0
Herbicide Rate
Seeding Rate
6000
5500
5000
4500
4000
3500
3000
2500
2000
1500
1000
500
0
Herbicide Rate
Seeding Rate
A
Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
H Q H Q H Q H Q H Q H Q H Q H Q
Continuous Barley Rotational Barley
Short Barley Tall Barley
Short Barley Tall Barley
H Q H Q H Q H Q H Q H Q H Q H Q
200 400
Continuous Barley Rotational Barley
Short Barley Tall Barley
200 400
B
Short Barley Tall Barley
200 400 200 400 200 400
Seeds m 2
200 400 200 400 200 400
Fig.2. Relationship between barley rotation (barley/barley), barley type (short vs tall), herbicide
rate (H=50% recommended rate and Q = 25% recommended rate) and seeding rate (200 and 400
seeds planted per m 2) on (a) wild oat biomass (kg/ha – 1000 kg = ½ ton/acre) and (b) grain yield
(kg/ha - 1000 kg = ~20 bushels) in 2003 at Brandon, Manitoba.
- 117 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Carbon isotope discrimination as a selection criterion for improved water
use efficiency and productivity of barley on the prairies
Anyia, A.O. (1), Archambault, D.J. (1), Slaski, J.J. (1), and Nyachiro, J.M. (2)
1: Environmental Technologies, Alberta Research Council Inc., P.O. Bag 4000, Vegreville, Alberta, T9C 1T4
2: Field Crop Development Centre, Alberta Agriculture Food and Rural Development, Lacombe, Alberta, T4L 1W8
Abstract
This study was done to evaluate the application of carbon isotope ( 13 C) discrimination (∆) as a
selection criterion for improving water use efficiency (WUE) and productivity of barley on the
Canadian prairies. Ten genotypes were subjected to drought at the jointing stage to study the
relationship between ∆, WUE and barley productivity. Drought caused considerable reductions
in aerial biomass and grain yield of all genotypes examined. Significant genotypic variation was
found in WUE. Significant correlations were found between ∆, and WUE as well as ∆ and aerial
biomass and grain productivity, which highlight the potential of ∆ (leaves or seeds) as a rapid
and reliable method for evaluating WUE and productivity of barley. Genotypes (Manny, Trochu
and Seebe) with the highest WUE (low ∆) under drought conditions showed performance
comparable to the genotypic average under well-watered conditions. This suggests the potential
for improving WUE under drought conditions without yield penalties when conditions are
optimum. More research is needed to test this technique under field conditions and to establish a
standard protocol that can be used to develop new, improved, water use efficient barley varieties.
Introduction
When pests and diseases are effectively controlled, moisture stress is the major limitation of crop
yield across the Canadian prairies. Producers often rely on varieties selected for high yield that
are adapted to several environments. Yields, however, do vary within and between locations and
years reflecting differences in seasonal distribution and severity of water deficit. In water-limited
environments, crop yield is a function of water use, water use efficiency (WUE) and the harvest
index (Passioura, 1977). Water use efficiency or water productivity is defined as aerial biomass
yield/water use. Crop management or the behavior of various cultivars due to intrinsic
differences can influence water use efficiency. Water use efficiency is a trait that has been
proposed as a criterion for yield improvement under drought (Rebetzke et al., 2002, Condon and
Richard 1992). Breeding for improved WUE has, however been limited for a long time by lack
of screening methodology. Farquhar et al. (1982) found that the extent to which C3 plants
discriminate against the carbon isotope 13 C during carbon assimilation was related to their water
use efficiency.
This study was done to evaluate the use of 13 C discrimination as a selection tool for identifying
water use efficient and drought tolerant barley.
Materials and Methods
Six 6-row and four 2-row barley genotypes were used for the study. The 6-row genotypes were:
AC-Lacombe, Kasota, Manny, Trochu, Tyto and Vivar. The 2-row cultivars were: CDC Dolly,
Niobe, Ponoka and Seebe.
- 118 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
The experiment was performed in a greenhouse with photoperiod of 16 hours using natural light
supplemented with sodium halide light bulbs. Day and night temperature ranged from 20 to 32°C
and 14 to 20°C, respectively while relative humidity was from 10 to 70% throughout the
experiments. Large pots (30cm tall by 27 cm diameter) were used for the study. The pots were
filled with 8 kg of soil mix containing field soil and peatmoss in a 1:3 ratio. All pots were
flushed with 4 L of tap water and allowed to drain for two days before seeding. Tensiometers
(Irrometer) were installed in selected reference pots to monitore soil water potential. The 10
barley genotypes were compared under two irrigation treatments which were either well-watered
(WW) or water stressed (WS). Six seeds of each genotype were planted per pot, which were
thinned to 4 seedlings per pot two weeks after emergence. Fertilizer application was done 3
weeks after seeding at 112 kgN/ha, 39 kgP2O5/ha, 85 kgK2O/ha and 13 kgS/ha equivalents. Each
genotype was replicated 4 times and all pots were completely randomised.Water stress (drought)
was imposed at the jointing stage by withholding irrigation until the soil moisture content was
approximately 10 volume% compared to 30 volume% of the well watered treatments. These
moisture levels were then maintained until grain maturity. A 2cm layer of perlite was put on each
pot to reduce surface evaporation. Water use was monitored by weighing the pots regularly and
replacing the amount of water lost.
At the heading stage, leaf laminas of plants of each genotype were harvested and dried at 70°C
for 48 hours. Dried samples were ground to pass a 1-mm sieve and the carbon isotope
composition of each cultivar was determined by mass spectrometry. At maturity, plants were
harvested and aerial biomass, grain yield and its components were assessed. Seeds of each
genotype were sampled and processed for determination of carbon isotope composition.
Data were analyzed using SAS, version 10.0 (SAS Institute, Cary, NC) software. A linear
correlation analysis was used to examine the mean genotypic relationships between traits using
the CORR procedure.
Results and Discussion
Among the 6-row barley genotypes, significant differences were observed within each irrigation
treatment in WUE and 13 C discrimination. For ∆-seeds and ∆-leaves, extreme cultivars differed
by 1.72 and 1.91, respectively, under drought and by 1.61 and 1.22, respectively, under wellwatered
conditions (data not shown). Among the 2-row genotypes, no significant differences
were found in WUE, but 13 C discrimination (∆-seeds and ∆-leaves) was significantly different
under both watering conditions. For ∆-seeds and ∆-leaves, extreme cultivars differed by 2.35 and
1.27, respectively, under drought and by 0.94 and 1.15, respectively under well-watered
conditions (data not shown).
Among the 6-row barley genotypes, WUEDM was strongly correlated with both ∆-seeds and ∆leaves
under drought (Fig. 1 & 2). Aerial dry matter production (DM) and grain yield were also
strongly correlated with ∆-seeds (Figs. 3 & 4). Similar correlations were observed among the 2row
barley cultivars under drought, except grain yield and ∆-seeds, which showed no
relationship (Figures not shown).
- 119 -

Water use efficiency (dm)
4.6
4.4
4.2
4
3.8
3.6
3.4
3.2
3
Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
y = -0.7035x + 16.957
R 2 = 0.9347
17.5 18 18.5 19 19.5 20
13C discrimination of seeds (per mil)
Figure 1: Relationship between 13 C discrimination of seeds and WUE (based on dry
matter/water use) of 6-row barley under water stress.
Water use efficiency (dm)
4.6
4.4
4.2
4
3.8
3.6
3.4
3.2
3
y = -0.4525x + 13.573
R 2 = 0.5821
20.5 21 21.5 22 22.5 23
13C discrimination of leaves (per mil)
Figure 2: Relationship between 13 C discrimination of leaves and WUE (based on dry
matter/water use) of 6-row barley under water stress
- 120 -

Aerial dry matter (g/plant)
19
18
17
16
15
14
13
12
11
10
Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
y = -2.7471x + 66.828
R 2 = 0.7762
17.5 18 18.5 19 19.5 20
13C discrimination of seeds (per mil)
Figure 3: Relationship between 13 C discrimination of seeds and aerial dry matter of 6-row barley
under water stress
Grain yield (g/plant)
9
8
7
6
5
4
3
2
y = -1.5929x + 35.51
R 2 = 0.445
17.5 18 18.5 19 19.5 20
13C discrimination of seeds (per mil)
Figure 4: Relationship between 13 C discrimination of seeds and grain yield of 6-row barley
under water stress
- 121 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
The relationship between ∆ and WUE have been studied extensively in several species and the 2
traits have been reported to be negatively associated (Farquhar and Richards 1984, Condon et al.,
1990, Read et al., 1991, Ebdon et al., 1998, Teulat et al., 2001, Rebetzke et al., 2002). High
correlations have been reported between ∆ and aerial biomass or grain yield (Johnson and
Bassett, 1991; Acevedo, 1993; Condon and Richards, 1993; Teulat , 2001).
Variation in ∆ in cereals is known to arise from variation in photosynthetic capacity as well as
stomatal conductance (Condon et al., 1990; Morgan and LeCain, 1991). Some studies have
shown that when stomatal conductance is the main source of variation in WUE and when water
supply does not impose a major limitation on crop growth, a high WUE may be disadvantageous
(Condon et al., 2002). A review by Condon et al., (2002) suggests that improved WUE may be
useful in stored-moisture environments where within-season rainfall makes up a relatively small
proportion of the total water available for growth.
Results obtained in the present study indicate that significant variation exists in WUE amongst
the barley genotypes examined. The strong correlations between ∆ and aerial biomass highlight
the potential of ∆ as a measure of productivity in barley subjected to drought in a greenhouse.
There is a need to screen more genotypes and to verify the usefulness of ∆ (leaves or seeds) in
breeding programs under field conditions.
References
Acevedo, E. 1993. Potential of carbon isotope discrimination as a selection criterion in barley
breeding. p. 399–417. In J.R. Ehleringer et al. (ed.) Stable Isotopes and Plant Carbon-Water
Relations. Academic Press, San Diego, CA.
Condon, A.G. and R.A. Richards 1992. Broad sense heritability and genotype x environment
interaction for carbon isotope discrimination in field-grown wheat. Aust. J. Agric. Res.
43:921–934.
Condon, A.G., and R.A. Richards, 1993. Exploiting genetic variation in transpiration efficiency
in wheat: An agronomic view. p. 435–450. In J.R. Ehleringer et al. (ed.) Stable Isotopes and
Plant Carbon-Water Relations. Academic Press, San Diego, CA.
Condon, A.G., G.D. Farquhar, and R.A. Richards 1990. Genotypic variation in carbon isotope
discrimination and transpiration efficiency in wheat. Leaf gas exchange and whole plant
studies. Aust. J. Plant Physiol. 17:9–22.
Condon, A.G., R.A. Richards. G.J. Rebetzke, and G.D. Farquhar 2002. Improving intrinsic
water-use efficiency and crop yield. Crop Sci.42:122-131.
Ebdon, J.S., A. M. Petrovic and T. E. Dawson 1998. Relationship between carbon isotope
discrimination and evapotranspiration in Kentuckey bluegrass. Crop Sci. 38: 157-162.
Farquhar, G.D., and R.A. Richards 1984. Isotopic composition of plant carbon correlates with
water-use efficiency of wheat genotypes. Aust. J. Plant Physiol. 11: 539–552.
Farquhar, G.D., M.H. O'Leary, and J.A. Berry. 1982. On the relationship between carbon isotope
discrimination and the intercellular carbon dioxide concentration in leaves. Aust. J. Plant
Physiol. 9: 121–137.
Johnson, D. A., and L. M. Bassett 1991: carbon isotope discrimination and water use efficiency
in four cold season grasses. Crop Sci. 31, 457-463.
- 122 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Morgan, J.A. and D.R. LeCain 1991. Leaf gas exchange and related leaf traits among 15 winter
wheat genotypes. Crop Sci. 31: 443–448.
Passioura, J.B. 1977. Grain yield, harvest index, and water use of wheat. J. Aust. Inst. Agric. Sci.
43: 117–120.
Read, J.J., D.A. Johnson, K.H. Asay and., L. L. Tieszen 1991. Carbon isotope discrimination,
gas exchange, and water-use efficiency in crested wheat grass clones. Crop Sci. 31, 1203-
1208.
Rebetzke, G.J., A.G. Condon, R.A. Richards, and G.J. Farquhar 2002. Selection for reduced
carbon-isotope discrimination increases aerial biomass and grain yield of rainfed bread
wheat. Crop Sci.42: 739-745.
Teulat B., O. Merah and D. This 2001. Carbon isotope discrimination and productivity in field
grown barley genotypes. J. Agron. Crop Sci. 187: 33-39.
- 123 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Twenty-five years of male-sterile-facilitated recurrent selection in barley
Mario C. Therrien
AAFC Brandon Research Centre, Box 1000A, RR#3, Brandon, MB Canada R7A 5Y3
Using a phenotypic marker-assisted system developed by Falk and Kasha (1982), a Male-Sterile
Facilitated Recurrent Selection (MSFRS) program was initiated at the Agriculture and Agri-Food
Canada research facility in Brandon, Manitoba, in 1980. The purpose was to develop germplasm
that would accumulate additive genetic effects for beneficial traits, including (horizontal) disease
resistance and improved grain and biomass yield. After 25 cycles of recurrent selection,
involving multiple genotypes from global sources, 4 populations have been developed
demonstrating improved levels of disease resistance, to multiple pathogens that are prevalent in
the Northern Great Plains, when compared to conventionally bred genotypes. As well, one sixrow
forage cultivar has been developed, with high biomass production and grazing tolerance, as
well as several elite lines showing promise as future forage cultivars. Several hulless lines have
also been produced showing markedly reduced levels of deoxynivalenol (DON) mycotoxin,
incited by the pathogen Fusarium graminearum. The MSFRS program is a low-cost approach to
long-term germplasm enhancement that can be applied to direct development of forage barley as
well as parental lines demonstrating multiple disease resistance in a single background.
Introduction
In the late 1960’s, a number of researchers around the world began to investigate the possibility
of introgressing numerous traits in barley using naturally occurring genic male sterility from
several sources. Under certain conditions, barley could be made to out-cross in the field in a
manner similar to that of rye (Secale cereale L.). Hockett and Eslick (1970) observed that
enough out-crossing could take place, in barley, to provide for a useful tool in developing
Composite Cross populations for use in germplasm improvement and, possibly, direct cultivar
development. This approach would be advantageous over conventional crossing by virtue of
being able to generate potentially large quantities of hybrid seed, under the right conditions,
without much labour input and allow for relatively rapid production of multi-way crosses. In
North America, multi-way crosses, for agronomically useful traits, were successfully produced,
in the form of Male-Sterile-Derived Composite Cross populations (Ahokas and Hockett, 1981).
To ensure that hybrid seed could be easily identified, the male-sterility genes were linked to
visual genetic markers, including orange lemma and shrunken endosperm characters (Falk and
Kasha, 1982). These developments allowed for practical recurrent selection breeding in the field.
Materials and Methods
In 1980, hybrid seed was obtained from Dr. E.F. Hockett, Montana State University that was
produced from a long-standing (20 yr) composite cross population (CC XXXIII) containing the
msg6 male sterile gene. At the same time, elite germplasm containing the male-sterile msg6, and
the linked genes for orange lemma (o) and shrunken endosperm (sex), were obtained from Dr.
D.E. Falk, Guelph University. Controlled crosses were made in the greenhouse in 1980 and 1981
involving male-sterile and male fertile plants between both the CC XXXIII and marker
populations. Marker-tagged male sterile progeny, from this initial cross, were then crossed to 102
elite barley lines varying widely in genetic background and agronomic performance. Each set of
- 124 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
crosses was maintained separately, in isolation from other barley, in the field and allowed to
hybridize freely over 3 successive seasons, from 1982 to 1984. This initial work was conducted
by Dr. R.B. Irvine, who preceded the author as breeder at the Brandon Research Centre.
From 1985 to 1990, elite lines were introduced to each successful field population with the aim
of increasing the level of hybrid seed production in the field and reducing the incident of ergot
(Claviceps purpurea). Initial hybrid seed set was 5%, on average, and ergot infection was
approximately 1% of male sterile spikes. Of the original 102 populations, only four populations
were selected that could consistently produce a relatively high level of hybrid seed and
acceptably low levels of ergot infection, in an agronomically acceptable background.
Commencing in 1991, cultivars and elite lines were used as recurrent male parents in a MSFRS
program using each of the four marker-assisted male sterile populations. After 4 cycles of
recurrent selection, male fertile offspring were then placed in head row selection nurseries and
selected on phenotype and then evaluated as lines in replicated field trials. During recurrent
selection, offspring were subjected natural field pathogens which exerted moderate selection
pressure for resistance to multiple pathogens in an environment favouring the development of
multiple pathogens. The local environment also favoured selection against lodging in most years.
Results and Discussion
It was noted, since early in the production of lines from the MSFRS populations, that the
material tended to be late, seed production tended to be sub-standard, but an abundance in
biomass. This lent itself to development of forage type barley for use mainly in silage. Our
program also produced forage lines from conventional crosses, in parallel. We then evaluated
performance of MSFRS forage lines against conventionally bred lines to determine what
advantages, if any, the MSFRS approach would have over the (more labour-intensive)
conventional ear-to-row pedigree method.
We first examined level of disease resistance of at least 500 lines from each of the two breeding
methods, for resistance to a number of diseases. Table 1 compares the standard (Std) population
vs. the Male-Sterile Derived (MSD) population for general leaf diseases in the field (LeafDis),
Net Blotch (Nblot) and Spot Blotch (Sblot) in disease nurseries, Fusarium Head Blight (FHB),
and the associated mycotoxin deoxynivalenol (DON), in the FHB nursery, Common Root Rot
(CRR) in a field nursery, as well as two races of Net Blotch (Net857 and Net858), one race of
Scald (Scld1493), and QCCJ Stem Rust (Stemrst), from laboratory inoculation.
Table 1.
Comparison of disease reactions of approx. 500 standard cross vs. MSD over 4 years (2001-2004):
Entry LeafDis Nblot Sblot FHB DON CRR Net857 Net858 Scld1493 Stemrst
Std 5.5 4.0 2.7 3.7 29.1 62.4 4.5 8.2 8.8 7.0
MSD 4.8 3.6 2.3 3.4 24.7 61.5 4.4 7.6 8.8 6.4
- 125 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Results show that, except for Scald, the MSD population consistently had lower disease
incidence scores than Std populations selected in the same environments. In the case of FHB,
several hulless selections demonstrated very low DON levels that may be released as cultivars in
the near future (data not shown), based on their DON levels and overall agronomic performance.
Thus, breeding for disease resistance using MSFRS can be advantageous over conventional
approaches for some major diseases in barley.
The second advantage for MSFRS is in the development of high biomass forage barley. Figure 1
compares yield gain, vs. the check variety Virden, of conventional vs. MSFRS barley lines over
14 years of testing. By 2004, conventionally bred forage lines produced a yield advantage, over
Virden, of approx. 8%, whereas the MSFRS lines averaged a 25% yield gain. This dramatic
improvement in yield is off-set by susceptibility to lodging that is generally severe. However,
each population has produced a few lines with good to excellent resistance to lodging. One of
these lines, tested as FB006, is slated to be released as a cultivar in 2005. FB006 has an average
12.5% yield advantage over Virden with improved forage quality. Several other selections show
equal or greater promise.
Fig.1
Relative Yield gain
130.0
125.0
120.0
115.0
110.0
105.0
100.0
Comparison of mean annual yield gain - conventional vs MSFRS - in 6R barley (Bdn)
%ck
%std
1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004
Year
- 126 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
In conclusion, MSFRS is a very useful breeding tool for long-term germplasm development
where multiple disease resistance is desired and direct production of high-yielding forage
cultivars is a goal of the breeding effort.
References
Ahokas, H., and Hockett, E.F. (1981). Performance tests of cytoplasmic male-sterile barley at
two different latitudes. Crop Sci. 21(4): 607-611.
Falk, D.E. and K.J. Kasha. (1982). Registration of a shrunken endosperm, male-sterile
germplasm to facilitate hybridization in barley.
Hockett, E.F. and Eslick, R.F. (1970). Natural outcrossing on genetic male sterile barley. Crop
Sci. 10(2): 152-154.
- 127 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Measuring phyllochrons in barley to use for seeding date recommendations
Pat Juskiw, Jim Helm and Joseph Nyachiro
Field Crop Development Centre, 5030 50 th Street, Lacombe AB T4L 1W8
Introduction
A phyllochron is the interval between one leaf appearance and the next, and can be measured
using calendar or growing degree days. It is a measurement of plant development that can be
used to assess how the plant has responded to environmental conditions or to predict how it is
going to respond.
In a previous study on the effects of seeding dates in central Alberta, grain yields of barley
varieties were found to decline as seeding was delayed from early May to mid-June (Juskiw et al.
2003; Fig. 1). What was interesting from this study was that there was a link between rapid leaf
development (short phyllochron) and ability to have less yield loss under late seeded conditions.
The link was independent of maturity of the variety.
The objective of this study was to determine the phyllochrons of barley varieties recently
released by Field Crop Development Centre with the potential to use this information to make
seeding date recommendations.
Materials and Methods
This study was conducted with plants grown in pots in growth cabinets (Conviron Model PTR15,
Controlled Environments Limited, Winnipeg, MB) at 20/15 o C, 16/8 h and approx. 450 μ-moles
m -2 s -1 . Pots were filled with Promix BX (Premier Horticulture Inc., Rivier-du-Loup, PQ), a
general purpose growing medium of sphagnum peat moss, perlite, vermiculite, limestone and
wetting agent. Pots were watered twice weekly with water and once weekly with fertilizer
solution. The varieties used in the study were Kasota, Manny, Niobe, Ponoka, Trochu, Tyto, and
Vivar. Kasota, Manny, Tochu, and Vivar are six-rowed, hulled feed types. Niobe and Ponoka
are two-rowed, hulled feed types. Tyto is a six-rowed, hulless feed type. Five seeds were
planted per pot and thinned to two plants per pot at the 3-4 leaf stage. Leaf counts of the main
stem were made on Mondays, Wednesdays, and Fridays from emergence to the flag leaf fully
emerged. Final leaf counts of the main stem were recorded.
Leaf counts were regressed against Growing Degree Days (GDD, 0 o C basis) using Proc GLM of
SAS (SAS Institute, Inc., Cary NC). Phyllochrons were determined as the inverse of the GDD
regression co-efficient. As well phyllochrons of individual leaves were determined by dividing
growing degree days by leaf count for each sampling time.
Results and Discussion
Excellent fits of leaf number versus GDD were found for all seven cultivars (Fig. 2). Differences
in phyllochrons of these seven varieties were found (Table 1). Kasota, Trochu and Tyto had
relatively rapid phyllochrons; while Ponoka had a slow phyllochron. The values determined in
this study were higher than those reported in Juskiw and Helm (2003) that may reflect a slowing
- 128 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
of response under lower light intensities in the growth cabinet versus the field.
Table 1. Phyllochrons and final leaf numbers of seven barley varieties.
Variety Phyllochron (GDD leaf -1 ) Final Leaf Number
Kasota 77 8.75
Manny 87 8.00
Niobe 87 9.75
Ponoka 92 9.43
Trochu 74 9.87
Tyto 72 11.00
Vivar 81 9.00
The combination of final leaf number and phyllochron can be used to predict relative maturity
(in crop modeling a certain number of phyllochrons are assigned to emergence, head emergence,
completion of stem elongation, and kernel filling). At a very simplistic level we used final leaf
number times phyllochron to come up with a leaf development duration to see how well this was
related to relative maturity based on values from the Alberta Agriculture, Food and Rural
Development Agdex100/32 (2005) (Table 2). While Tyto had a rapid phyllochron, when this
was combined with its high leaf number, it resulted in a long leaf development duration that was
also reflected in its maturity. Kasota combined a rapid phyllochron with low leaf number to
have a short leaf development duration that reflected its early maturity. Using phyllochron to
estimate maturity would over-estimate the maturity for Niobe; and under-estimate that of Manny
and Vivar. Further study is needed to reconcile such differences if phyllochrons are to be used
for predictive purposes.
Table 2. Leaf development duration and its relationship to maturity for seven barley varieties.
Variety Maturity (d) z
Duration of leaf
development (GDD)
Relationship of maturity/Leaf
GDD duration
Kasota 94 670 early/early
Manny 97 700 mid/early (?)
Niobe 97 850 mid/late (?)
Ponoka 100 870 late/late
Trochu 96 730 mid-early/mid-early
Tyto 98 790 mid-late/mid-late
Vivar 98 730 mid-late/mid-early (?)
z
Maturities from Alberta, Agriculture, Food and Rural Development (2005).
While there was good fit of the linear regression of leaf number versus GDD, when phyllochrons
were estimated using the leaf count at each sampling time, we found that the phyllochrons for the
- 129 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
first two leaves were often slower than for subsequent leaves (Fig 3.). There were two distinct
patterns: 1) six-rowed cultivars had slow initial phyllochrons followed by more rapid initiation of
subsequent leaves; and 2) two-rowed cultivars, especially Niobe, had more rapid initiation of the
first two leaves followed by slower initiation of subsequent leaves. What effect these differences
in initiation rates would have on competition needs further study.
As a final point, we took our long term yield data from 1998 and 2002 at Lacombe and Stettler
and compared yield differences between early and late May planting dates for the varieties under
study (Fig. 4 and 5). This was just a quick look to see if a recommendation based on rapid
phyllochrons would be valid. The late planting was generally before the end of May at either
location and would not be considered extremely late, so the data is of limited value. Our
recommendation based on phyllochrons would be that Tyto, Trochu and Kasota would be the
varieties of choice. However Trochu had one of the greatest drops in yield from early or mid-
May plantings to the late May planting. Overall, Ponoka, Tyto and Vivar had the least yield
reductions with the later planting. While we would like to make a clear-cut recommendation to
plant Tyto, Trochu or Kasota when faced with late seeding, further field work is needed to
confirm or refute the phyllochron, late-seeding yield response relationship.
References
Alberta Agriculture, Food and Rural Development. 2005. Varieties of Cereals and Oilseed
Crops for Alberta - 2005. Agdex 100/32.
Juskiw, P.E. and Helm, J.H. 2003. Barley response to seeding date in central Alberta. Can. J.
Plant Sci. 83:275-281.
Yield as a percent of
mean site yield of 6.57
t/ha
40
30
20
10
0
-10
-20
-30
-40
-50
Early May Mid-May Late May Mid-June
Abee Harrington Jackson Noble Virden
Figure 1. Effects of seeding date of relative yield of five barley varieties (from Juskiw and Helm 2003).
- 130 -

Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
Figure 2. Regression of leaf counts against accumulated GDD for seven spring barley varieties.
Figure 3. Phyllochron estimates for individual leaves for seven spring barley varieties.
- 131 -

Yield as a
percent of
site mean
yield of 6.7
t/ha
Yield as a
percent of
site mean
yield of 6.2
t/ha
Session 4: Breeding, Agronomy, and Germplasm – Oral presentations
40
30
20
10
0
-10
-20
-30
30
25
20
15
10
5
0
-5
-10
-15
-20
Early Late
Kasota
Manny
Niobe
Ponoka
Trochu
Tyto
Vivar
Figure 4. Yield response to seeding dates at Lacombe from 1998 to 2003 (where early was the
first week of May and late was the last week of May).
Mid Late
Kasota
Manny
Niobe
Ponoka
Trochu
Tyto
Vivar
Figure 5. Yield response to seeding dates at Stettler from 1998 to 2003 (where mid was the
second week of May and late was the last week of May).
- 132 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Russian wheat aphid resistant barley – cultivar and germplasm release
D.W. Mornhinweg 1 , P.P. Bregitzer 2 , D.A. Obert 2 , F.B. Peairs 3 , D. Baltensperger 4 and R. Hammon 3
1 USDA-ARS, Stillwater, OK,
2 USDA-ARS, Aberdeen, ID,
3 Colorado State University,
4 University of Nebraska
RWA continues to be a devastating pest of barley in the high and dry areas of the Western U.S.A.
Screening of the entire National Small Grains Collection in Aberdeen Idaho by the USDA-ARS in
Stillwater identified 115 accessions with some level of resistance ranging from 2 to 6 on Webster’s
scale of 1 to 9 where 1 is immune and 9 is dead. Resistant germplasm lines were developed from
each accession and two of these lines, STARS 9301B and STARS 9577B were released in 1993 and
1995 respectively. A long term prebreeding project was initiated at the USDA-ARS in Stillwater to
develop adapted germplasm lines by bringing multiple sources of resistance into barley cultivars and
elite lines of both state and federal barley breeders across the country. These breeders as well as
extension personal from several states have been involved in field testing of the 62 prebred
germplasm lines now ready for release. A detailed description of these lines and a time table for their
release will be presented. Along the way several feed barley cultivars have also been developed.
The first RWA-resistant barley cultivar, Burton, has released by USDA-ARS in Aberdeen in
conjunction with USDA-ARS in Stillwater and several other cooperators. Burton, a 2-rowed, hulled,
spring barley, has shown excellent performance in irrigated and dryland areas both in the presence
and absence of RWA. Three, 2-rowed, spring, feed barleys, developed by the USDA-ARS in
Stillwater and Aberdeen and which are adapted to the extremely arid conditions of the western high
plains are currently in seed increase and planned for release this fall. A new biotype, RWA2,
identified in Colorado in the summer of 2003, has been found to damage all currently grown wheat
cultivars developed for resistance to the original biotype, RWA1. All germplasm lines and cultivars
slated for release from this program have been found to be resistant to RWA2 as well as RWA1.
- 133 -
Do. Mornhinweg@ars.usda.gov

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
BARMS: A new relational database for barley breeding programs
D. B. Cooper and Bruce Westlund
Busch Agricultural Resources Inc., Ft. Collins, CO U.S.A. 80524
Breeding programs generate large amounts of phenotypic data on parents, segregating populations
and derived experimental lines. There currently are very few commercially available databases that
are specifically designed for use in plant breeding programs.
After conducting an initial study of existing database options that were permitted on our corporate
computer systems, it was decided that we should develop a proprietary data solution based on the
Oracle TM relational database software engine. The development process was done in stages that were
user tested and then refined to meet the requirement standards and user acceptance. The Barley Ag.
Research Management System (BARMS) went live in February of 2004 and has routinely used by
our barley breeding programs since.
One of most difficult problems in interpretation of multi-location, multi-year data from agricultural
experiments is separating the relative contributions of genetics (G), environment (E) and G x E
interaction. This can be especially critical when comparing ‘un-balanced’ data sets from lines at
different stages of trialing that have not been grown in the same number of station x years. One
partial solution to such data sets is to adjust all observations relative to one or more check cultivars.
Phenotypic data is stored in BARMS in standard units of measure (i.e. Yield in Bu/A, Plant height in
cm) and can be queried in that standard format or in alternate units of measure (i.e. Yield in Kg / ha,
plant height in inches). Data for all traits can also be retrieved on a 1-99 RP (Relative Phenotypic)
scale where data is set relative to three known check cultivars. The six-row breeding program uses
Morex, Robust and Legacy; the two-row breeding program uses Harrington, B1202 and Merit as the
three comparator checks. Data points where an experimental line appears in the same trial with all
three of the respective checks will be used to calculate a line RP for that trait on a 1-99 scale. In this
form environmental and G x E interactions are minimized and the RP value represents a best linear
unbiased estimate of the true genotypic contribution. These RP scores can be used to evaluate lines
from un-balanced data sets on a more equitable basis.
We designed a SELECTION MODULE in BARMS that permits selections to be made using both
independent culling with upper and lower limits on single trait values as well as index selection
based on weighted sum of squares of deviation of multiple trait values from defined targets. It is
believed that BARMS is the only software program to permit simultaneous use of both selection
protocols.
We developed a CROSS COMPARISON MODULE that permits multi-trait evaluation of parental
phenotypic data in all possible pair-wise combinations as a predictor of future overall success of the
resulting progeny of a cross.
We automated our malt quality laboratory equipment to directly upload evaluation results into the
BARMS database. This has reduced the manual entry time and increased accuracy of the micromalting
data coming from our laboratory.
- 134 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Mapping and molecular marker development of seed dormancy in a barley
population derived from ‘Samson’ barley
J.L. Zantinge*, J.M. Nyachiro, S. Chisholm, J.H. Helm, P.E. Juskiw and D.F. Salmon
Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, 5030-50 Street, Lacombe, AB T4L 1W8,
Telephone: (403) 782-8692, Fax: (403) 782-5514 Web Site: http://www1.agric.gov.ab.ca/app21/rtw/selsubj.jsp
Wet field conditions just prior to harvest can cause pre-harvest sprouting in barley (Hordeum vulgare
L.) resulting in significant economic losses especially in barley genotypes with low seed dormancy.
Conversely, malting barley varieties with too high dormancy levels can result in inconsistent
germination, creating problems in the malt house. Seed dormancy is defined as when viable kernels
fail to germinate under optimum conditions of moisture, oxygen, and temperature. Phenotypic
selection for sprouting resistance is challenging because the dormancy trait is controlled by multiple
genes and influenced by the environment. Developing molecular markers linked to dormancy would
be one method of selecting for desirable levels of seed dormancy in barley. Our objective is to
identify, map and develop potential molecular markers linked to genes affecting dormancy in
‘Samson’ barley. Several recombinant inbred lines (RILs) were created by crossing ‘Samson’ derived
lines, having high dormancy, with hulless barley varieties ‘Falcon’ and ‘Phoenix’. Dormancy levels
were calculated using a weighted germination index (WGI) on the RIL population of 239 lines,
originally derived from crossing ‘Phoenix’ and ‘Samson’. This phenotyped population is currently
being analysed with SSR markers and AFLP analysis. As expected, initial results suggest multiple
QTLs throughout the barley genome, with the most apparent marker linkages associated with seed
dormancy occurring on chromosomes: 2H, 3H, 4H, 5H, and 6H.
Key words: seed dormancy, marker development, Hordeum vulgare, barley
- 135 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Genotypic variations in preharvest sprouting resistance and seed dormancy
in barley
Nyachiro* J.M., J.L. Zantinge, J.H. Helm, P.E. Juskiw and D.F. Salmon
Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, 5030 – 50 St., Lacombe, AB T4L 1W8
Web Site: http://www1.agric.gov.ab.ca/app21/rtw/selsubj.jsp
*Corresponding author: joseph.nyachiro@gov.ab.ca
Seed dormancy is a vital agronomic trait related to seed quality because it determines resistance to
preharvest sprouting (PHS). The aim of this study was to evaluate if there are any genotypic
differences in spike sprouting and seed dormancy among advanced breeding lines (genotypes) of
barley and determine if there is any association between spike sprouting and whole seed dormancy.
Five separate tests comprised of 103 advanced breeding lines and registered barley varieties were
seeded in the field in 2004 in 8-row plots of 1 x 2.5 m in three replicates arranged in a randomized
complete block design. Three intact spikes, mainly from the primary tillers, were evaluated for
resistance to sprouting resistance in a rain simulator at 18 o C. Sprouting was rated visually on a 1-5
scale (1= no visible sprouting, 5= 100% sprouted) and ratings were converted to spike sprouting
indices (SSI) that took into account the promptness of spike sprouting. The genotypes were
designated as resistant (R) to sprouting if they had a SSI range of 3.0 to 4.0; moderately resistant
(MR) if 4.1 to 5.0; susceptible (S) if 5.1 to 6.0; and very susceptible (VS) if >6.0. Also whole seeds
for each line were tested for seed dormancy based on a weighted germination index (WGI).
Continuous variations were observed both in the SSI and WGI among genotypes. There were
genotypic differences in tendency for spike sprouting ranging from 3.1 (R) to 7.3 (VS). For the SSI,
the hulless barley varieties ranged from 3.5 to 5.9, the 2-rowed ranged from 4.7 to 6.5 and the 6rowed
ranged from 3.8 to 6.5. There were wide variations in WGI ranging between 0 (no seed
germination) and 1 (100% seed germination). For the WGI, the hulless barley varieties ranged from
0.2 to 1, the 2-rowed ranged from 0.1 to 0.9 and the 6-rowed ranged from 0 to 0.8. The cultivars
Vivar and Xena (feed barley) consistently appeared to have good resistance to spike sprouting. The
correlation between the WGI and SSI (r = 0.37), although significant (P > 0.01), appear to be weak.
- 136 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Using growing degree days to estimate maturity in small grain cereals
Juskiw, P., Helm, J., Salmon, D., and Nyachiro, J.
Field Crop Development Centre, 5030 50 th Street, Lacombe, AB, T4L 1W8
For over thirty years, maturities of small grain cereals have been estimated at Field Crop
Development Centre by using dry-down rates and moisture contents at harvest. Maturity is estimated
to occur at 35% moisture content. Indicator plots of each crop type have been used each year at each
plot site to determine a linear rate of dry-down based on Julian days. However ever year, there can
be problems in getting the indicator plots harvested during the linear phase of dry-down so we
wanted to develop a estimate for dry-down that could be used over a wide range of environmental
conditions. In previously reported work, standardized rates of dry-down using growing degree days
(GDD=Σ[(Tmin+Tmax)/2] and growing season precipitation were developed for barley, spring and
winter triticale, spring and winter wheat, and winter rye. In 2004, data were collected to determine
the validity of our GDD-based rates of dry-down. We compared GDD-based maturities with
maturities based on the indicator plot dry-down rates. For barley, our best correlation (r=0.80)
between maturities using the two methods (n=5,181) was found when the dry-down rate included
both GDD and growing season precipitation, however the closest fit based on similar range and mean
maturities was found using a mean rate of dry-down based solely on GDD. The 2004 data confirmed
over a wide range of environments, that using a standardized rate of dry-down based on GDD was
valid. The 2004 data will be incorporated into updated GDD and GDD plus precipitation rates of
dry-down, and a final decision will be made on the method of determining maturities from 2005
onwards.
patricia.juskiw@gov.ab.ca
Twelve years of barley-based rotations
Juskiw, P., and Westling, D.
Field Crop Development Centre, 5030 50 th Street, Lacombe, AB, T4L 1W8
In 1988 a barley-based rotation was begun at Lacombe. There were eleven four-year rotations that
were run for twelve years (three complete cycles). After the12 years, a uniformity trial was run
planting all plots to Niska, six-row feed barley. Soil NO3N, PO4P, Na, K, and SO4S were measured
in the fall of 1999, with the only significant rotation effect being found on soil nitrogen levels. When
green manure followed three years of triticale N levels were the highest, but when green manure
followed barley-canola-winter wheat levels were not significantly elevated. A year of fallow did not
elevate nitrogen levels. Protein, acid detergent fiber, neutral detergent fiber, and relative feed value
of the biomass harvest after anthesis (about the soft-dough stage) were not affected by rotation.
Highest post-anthesis (PA) biomass yields were found when the previous year had been fallow, green
manure or alfalfa. The lowest PA yields were following barley (although barley the previous year
was not the sole determinant of low yields as other rotations with barley the previous year had
intermediate yields). Grain yields and test weights were not affected by rotation. However both
kernel weights and percent plumps were positively influenced by barley-barley-canola-fallow, winter
wheat-green-manure-barley-canola, and barley-barley-alfalfa-alfalfa rotations; while continuous
barley and canola-winter wheat-peas-barley had negative effects on these traits. Grain protein levels
were highest following continuous barley, wheat-canola-barley-barley and triticale-triticale-triticalegreen
manure; and lowest following triticale-barley-peas-barley and barley-winter rye-barley-canola.
Rotations that led to high soil N levels did not always translate into high protein levels in the grain;
and this combined with higher percent plump and kernel weights may mean we need to rethink our
recommendation for malting barley production. Further investigation is warranted.
- 137 -
Patricia.Juskiw@gov.ab.ca

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Development of winter hulless barley varieties as a high value crop
W.S. Brooks*, C.A. Griffey and M.E. Vaughn
Virginia Polytechnic Institute and State University, Blacksburg, VA
Prior to the early 1990’s winter barley cultivars released and grown in the U. S. mid-Atlantic region
were traditional hulled feed barley types. Traditional hulled barley has been grown for centuries in
the mid-Atlantic region on many farms as feed for all classes of livestock. Demand for low-fiber,
high-energy grains by the vertically integrated swine and poultry industries, and availability of
brewer’s distilled grains for beef and dairy industries have resulted in greatly reduced demand for
traditional feed barley in recent years. In the mid 1990’s, the Virginia Tech Breeding Program
realized that survival of winter barley as a viable crop was dependent on development of
commercially acceptable winter hulless barley cultivars having high value traits for specific end uses.
During the past 10 years, the Virginia Tech barley breeding program has developed hulless lines that
yield 314-1129 kg ha -1 higher than initial winter hulless lines developed. Many lines have improved
straw strength and grain plumpness and have better resistance to prevalent diseases. Meanwhile,
increased interest in the use of hulless barley varieties having high energy and digestibility in
manufacturing food and fuel products, as well as feed, has accentuated our desire to develop winter
hulless barley varieties having greater marketability in both domestic and foreign markets.
Additionally, barley grain contains health-related compounds similar to those found in oats,
therefore, adding to its appeal in the health-food sector. The use of barley in ethanol production may
soon become a reality and would provide a viable market for hulless barley produced in the mid-
Atlantic region. We also have collaborated with nutritionists and chemists to characterize and
improve the nutritional and compositional quality of hulless barley via breeding for specific end uses.
The breeding program’s first major achievement was the release of the winter hulless barley cultivar
Doyce in 2003. In collaboration with the USDA-ARS Eastern Regional Research Center, data on
chemical and nutritional composition, including protein, starch, lipid and beta glucan concentration,
have been obtained on most barley lines in our replicated yield trials. To date, significant progress
already has been made in the development of winter hulless barley lines. We have developed more
than 3,000 winter hulless barley populations. This year (2005), we will advance over 350 hulless
populations and evaluate 325 pure lines in yield tests and select pure lines among nearly 9,000
hulless headrows. Over one hundred advanced winter hulless barley lines are being evaluated in four
states (Maryland, Pennsylvania, Kentucky and Delaware). Doyce hulless barley being produced in
2005 will be evaluated in pilot studies for its potential use in ethanol production and as an improved
feed component in poultry rations.
*Corresponding Author: Phone: 540 231-7624, Email: wybrooks@vt.edu
- 138 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Multiple dominant and recessive marker stock development
Robert I. Wolfe
A set of genetic marker stocks for barley, Hordeum vulgare, have been developed. Dominant alleles
of several genes are in one doubled haploid stock. A master recessive doubled haploid has matching
recessive alleles.
Dominant alleles in the master dominant stock with matching recessive alleles in the master
recessive: Blp Vrs1 Pre2 Zeo1 Wst7 Btr Alm Pub Kap Hsh Srh Raw1 Rob Wax Nud Lks2.
Several more multiple recessive stocks are available. A genetic male sterile is present in a recessive
background, similar to the above master recessive, for each of the seven chromosomes. Also
incorporated on the appropriate chromosomes are five surface wax mutants, five dwarfs, and a few
other recessive alleles.
Recessive alleles in the chromosomal stocks:
1H msg1 cer-e ert-b nec1
1H trd
2H msg2 gsh6 eog lig
3H msg5 uzu
3H als
4H msg24 glf1 lbi2 yhd(alm is not present in this stock)
5H msg19 ert-g
6H msg36 gsh4
6H cul2 dsp9
7H msg10 gsh3 brh1
These barley stocks are moderately early maturing. They were grown and selected in western
Canada, with alternate generations in growth chamber and greenhouse.
Reference: 1996 Special Issue - Barley Genetic Newsletter. Vol. 26.
The author is grateful to Mr. Les Shugar for producing the doubled haploid versions of the master
dominant and recessive stocks.
- 139 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Genetic male sterile and xenia assisted reciprocal recurrent selection
Robert I. Wolfe
Two pairs of barley populations were developed to illustrate the potential for genetic male sterile
and xenia assisted reciprocal recurrent selection. They carry the following alleles:
1a) msg1, Sex1, yellow aleurone, btr1, cer-e, vrs1, nud
1b) msg2, sex1, blue aleurone, btr1, rob, vrs1, nud
2a) msg1, Sex1, yellow aleurone, btr1, cer-e, Vrs1, nud
2b) msg2, sex1, blue aleurone, btr1, rob, Vrs1, nud
These barley lines are spring habit, and have been selected in central Alberta.
The idea is to speed up selection for yield and agronomic performance by completing a full cycle of
reciprocal recurrent selection per year.
Unfortunately, the blue aleurone has proven unsatisfactory for this purpose. Its genetics are too
complex, and when blue aleuroned lines are crossed onto lines carrying the yellow aleurone, the blue
aleurone does not consistently colour up the resulting seeds.
If a practical working system is to be developed the blue aleurone should be replaced by a gene with
two easily identifiable alleles having strong xenia penetrance. A possible candidate is Wax wax,
perhaps with the closely linked gsh3 for use as a field identifier. Wax wax can be used in
hulled barley, whereas aleurone colour could not. Identification of waxy versus starchy seed would
be somewhat tedious, but doable. Normal versus yellow starch might also work if it could be
inserted into barley as a single gene effect. The Sex1 sex1 gene is acceptable, along with rob as a
field identifier.
This noted, following is an explanation of the concept. There are two generations a year, a crossing
generation and a yield test. Two spring barley populations are developed, either two-row or six-, and
pure for either btr1 or btr2. They must carry a different genetic male sterile, such as msg1 and msg2.
In the crossing generation, in a winter nursery, seeds from the two populations are inter-planted close
enough to inter-pollinate and far enough apart to produce several tillers per plant. Each population is
normally 50% sterile and 50% heterozygous for sterility. Only seed from the genetic male sterile
plants is harvested. The seed from each plant is identified as inter- or intra-population seed.
Inter-population seed is planted in a hill yield test in the area for which it is to be adapted, with
several seeds per hill, each hill being from one plant. The conditions must mimic as closely as
possible a farmer's field for selection to be useful. The parent plants from the winter nursery are
ranked according to hill performance, and intra-population seed from the best ones sent south for the
next crossing nursery.
New elite germplasm can be incorporated and added to each population.
After a few cycles, F2 seed from the best yield test hills can be entered into the standard breeding
system in use in the program.
- 140 -

Session 4: Breeding, Agronomy, and Germplasm – Poster abstracts
Isoyield analysis of barley cultivar trials in the Canadian Prairies
Rong-Cai Yang 1,2* , Daniel Stanton 2,3 , Stanford F. Blade 4 , James Helm 5 and Dean Spaner 2
1 Policy Secretariat, Alberta Agriculture, Food and Rural Development, Room 300, 7000 – 113 Street, Edmonton, AB, Canada
T6H 5T6;
2 Dept. of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB, Canada T6G 2P5;
3 Pioneer Hi-Bred Ltd., 330 – 127 Street S.W., Edmonton AB, Canada T6W 1A3;
4 International Institute of Tropical Agriculture, c/o Lambourn Ltd., Carolyn House, 26 Dingwall Road, Croydon CR9 3EE United
Kingdom;
5 Field Crop Development Centre, Alberta Agriculture, Food and Rural Development, Lacombe, AB, Canada T4L 1W8
Classification of test sites for cultivar trials into groups with similar within-group site performance
and response (isoyield groups) is an important step towards identification of appropriate cultivars that
are best suitable for different productivity levels in farm fields. The objective of this presentation is
to determine isoyield environments in the Canadian prairies based on the analysis of cultivar trials
consolidated from individual provinces for barley (Hordeum vulgare L.). Yields for the analysis
were taken from 324 replicated trials sown at 84 sites across the prairies during 1995 – 2003. The
combined use of regression and cluster analyses of the data normalized for averaging the multi-year
unbalanced data led to a stratification of the 84 sites into 13 isoyield groups. A comparison was
made of the distributions of the variability among and within groups according to three modes of
grouping: isoyield groups, soil zones and agroecoregions. There was more variability among isoyield
groups and correspondingly less within the groups than that among and within soil zones and
agroecoreions. Similar contrasting pattern existed for the variance components involving genotypeenvironment
interaction (GEI) though the GEI variability was generally small under all three modes
of grouping. Relationships of site sensitivity (regression coefficient) and stability (coefficient of
determination) with site productivity were shown to be a useful aid for selecting a subset of test sites
in an effort to improve efficiency and quality of future cultivar testing. Thus, the isoyield analysis
should be a valuable tool for a meaningful subsetting of heterogeneous environments and for a
reduced GEI impact in cultivar testing and recommendation.
*email: rongcai.yang@gov.ab.ca
- 141 -

Chair
Jennifer Zantinge
Session 5: Biotechnology and Genomics
Wednesday, July 20, 2005 – a.m.
Session 5: BIOTECHNOLOGY AND GENOMICS
Presenters
Gary Muehlbauer, University of Minnesota
Peter Eckstein, University of Saskatchewan
Nora Lapitan, Colorado State University
Tajinder Grewal, University of Saskatchewan
Kavitha Madishetty, University of California Riverside
Andris Kleinhofs, Washington State University
- 142 -

Session 5: Biotechnology and Genomics – Oral presentations
Applications of GeneChips for barley improvement
Gary J. Muehlbauer 1 , David F. Garvin 2 , Kevin Smith 1 , Jayanand Boddu 1 and Seungho Cho 1
1 Department of Agronomy and Plant Genetics, University of Minnesota, St. Paul, MN 55108;
2 Plant Science Research Unit, United States Department of Agriculture-Agricultural Research Service, St. Paul, MN 55108
Abstract
The use of RNA profiling has recently become a powerful tool to examine genome-wide
transcript accumulation. The commercial release of the Barley1 Affymetrix GeneChip probe
array has provided the resource to conduct RNA profiling of 22,439 barley genes in a single
experiment. We have focused primarily on using the Barley1 GeneChip to (1) physically map
barley genes to chromosomes; (2) to examine the RNA profiles in barley infected with Fusarium
graminearum, and (3) as a proof of concept for targeting markers to genomic regions. In this
article, we will describe these applications of the Barley1 GeneChip and discuss some of our
results.
Introduction
High-throughput RNA profiling technologies are useful tools for examining the expression of
thousands of genes in parallel. Traditionally, gene expression studies have relied on methods
and technologies that examine one to a few transcripts at a time. Thus, RNA profiling
technology provides a substantial increase in the number of transcripts compared to more
classical methods. In 2003, the barley1 Affymetrix GeneChip probe array was fabricated and
provided a new resource for barley geneticists to conduct high throughput RNA profiling
experiments in barley (Close et al., 2004). This article summarizes the development of the
barley1 GeneChip, and applications to barley research and improvement.
The barley1 GeneChip
A USDA-IFAFS grant to a group of U.S. barley geneticists (Andris Kleinhofs, Timothy Close,
Roger Wise, Rod Wing and Gary Muehlbauer) provided the funding to develop RNA profiling
technology in barley. The genomics company Affymetrix (Santa Clara, CA), which specializes
in the development of GeneChip probe arrays, was chosen to develop this resource for the barley
research community. The design of the Barley1 GeneChip probe array was based on
approximately 350,000 barley expressed sequence tags (ESTs) developed through an effort of
barley geneticists in the U.S. (R. Wing, A. Kleinhofs, R. Wise, and T. Close), Scotland (R.
Waugh), Japan (K. Sato), Finland (A. Schulman) and Germany (A. Graner). These barley gene
sequences were condensed into an exemplary set of sequences for the GeneChip design. The
finished product was the Barley1 GeneChip probe array, which represents 22,439 barley genes
and thus provides the resource to examine transcript accumulation of all of these genes in
parallel (Close et al., 2004).
The 22,439 genes are represented on the Barley1 GeneChip in the form of 22,439 probe sets.
These probe sets are comprised of 11 matched and mismatched pairs of 25-mer oligonucleotides.
Most of the oligonucleotides were designed from the 3’ end of each exemplar sequence (Close et
al., 2004). Hybridization of labeled RNA to each probe set is determined and raw numerical
- 143 -

Session 5: Biotechnology and Genomics – Oral presentations
values representing the amount of transcript accumulation are obtained. These values can be
examined with a variety of computer programs and statistical packages to address specific
questions relating to transcript accumulation.
Each GeneChip experiment results in a tremendous amount of data. To house these data, to
conduct data analysis, and to provide a resource for future comparative analysis the MIAME
(minimum information about a microarray experiment) compliant BarleyBase
(http://barleybase.org/; Shen et al., 2005) database has been established. BarleyBase is an online
public repository for raw and normalized expression data for Affymetrix GeneChip data.
Currently, data from multiple Barley1 GeneChip experiments are housed on this site.
Uses of microarray technology
There are multiple uses of microarray technology including: (1) examining the response to
abiotic and biotic stresses; (2) high-throughput gene mapping; (3) determining gene expression
patterns associated with malting; (4) identifying tissue-specific gene expression; (5) determining
gene expression differences in defined mutant backgrounds; (6) gene cloning; and (7) targeting
markers to genomic regions. In this article, we will discuss our work with the Barley1 GeneChip
to (1) physically map barley genes to chromosomes; (2) to examine the RNA profiles in barley
infected with Fusarium graminearum, and (3) as a proof of concept for targeting markers to
genomic regions.
Results And Discussion
High-throughput physical mapping
We developed an approach to utilize the Barley1 GeneChip to physically map large numbers of
barley genes to chromosomes. We are using the wheat-barley addition lines to assign barley
genes to chromosomes. These disomic chromosome addition lines were developed through wide
hybridization between the donor Betzes barley (Hordeum vulgare L.) and the recipient Chinese
Spring wheat (Triticum aestivum) (Islam et al., 1981). These genetic stocks contain all 21 wheat
chromosome pairs and a single chromosome pair from barley. Wheat-barley disomic addition
lines have been developed for six of the seven barley chromosomes including 1(7H), 2(2H),
3(3H), 4(4H), 6(6H) and 7(5H), and ditelosomic addition lines harboring 13 of the 14 barley
chromosome arms have been generated (Islam et al., 1981). Our objectives were to use the
wheat-barley addition lines in combination with the Barley1 GeneChip to assign barley genes to
chromosomes. The basic idea is as follows: transcripts detected in Betzes and the addition lines,
but low or no detection in Chinese Spring were derived from Betzes and the barley gene
encoding the transcript was assigned to a specific donor barley chromosome.
We examined transcript accumulation in seedling tissues of Betzes barley, Chinese Spring wheat
and wheat-barley chromosome addition lines carrying barley chromosome 2H, 3H, 4H, 5H, 6H,
or 7H. By examining only those transcripts that were detected in Betzes and one or more of the
addition lines, we identified 482, 331, 352, 392, 246 and 421 transcripts in the addition lines
carrying barley chromosome 2H, 3H, 4H, 5H, 6H and 7H, respectively. Based on these results,
we assigned 2,224 genes to barley chromosomes. Our results were validated through extensive
genomic PCR and by in silico comparisons to the wheat and rice genomes. We found that our
physical map positions were highly syntenic with the wheat and rice genomes and that our
- 144 -

Session 5: Biotechnology and Genomics – Oral presentations
genomic PCR results were consistent with our GeneChip interpretations. We also examined
transcript accumulation in ditelosomic addition lines carrying the long and short arm of
chromosome 6H and assigned 139 and 105 genes to chromosome 6HL and 6HS, respectively.
The chromosome 6H ditelosomic addition line results validated the location of 244 out of the
246 genes assigned to chromosome 6H. Therefore, we have substantially increased the number
of genetic markers for use in marker-assisted selection, map-based cloning and for scaffolds for
full-genome sequencing. Our results show that this is an efficient method to physically map
barley genes to chromosomes.
Fusarium head blight of barley
Fusarium head blight (FHB) of barley is caused by F. graminearum and related Fusarium
species. FHB is a major disease problem for barley growers in the United States and in the
barley growing regions of the world (Parry et al., 1995). Trichothecenes mycotoxins, such as
deoxynivalenol (DON) are produced by the fungus during infection and accumulate in the
harvested grain grain. Barley grain containing measurable levels of DON results in reduced
malting quality. Therefore, our goals are to understand the interaction between barley and F.
graminearum with the intent to identify genes that provide resistance to FHB. Our approach is
to use the Barley1 GeneChip to gain an understanding of the interaction between barley and F.
graminearum during infection and to use the gene expression data to direct marker development
for FHB resistant QTL-containing regions of the genome.
Transcript accumulation in Morex during Fusarium graminearum infection
Four replications of spikes from the FHB susceptible barley cultivar Morex at 1, 2, 3, 4, and 6
days after F. graminearum and water inoculation and a fifth replication at 1 and 3 days after F.
graminearum and water inoculation were sampled for RNA isolation. RNA profiles were
examined at these treatment/timepoints using the Barley1 GeneChip. Three hundred and fifty
seven transcripts were differentially expressed between F. graminearum-and mock (water)
inoculated barley spikes at one or more time points. The differentially accumulating transcripts
were placed into two subgroups. One subgroup of 182 transcripts was identified based on the
presence versus absence test of transcripts between F. graminearum and mock-inoculated spikes
and referred to as qualititatively-induced during infection. The other subgroup of 175 transcripts
was identified as significantly induced between F. graminearum- and mock-inoculated barley
spikes and referred to as quantitatively-induced during infection. The transcript accumulation
from all detected genes was greater in the F. graminearum-treated plants, there were no
transcripts that were down regulated in this experiment. These transcript accumulation patterns
were validated via RNA gel blot analysis
Examination of the transcript accumulation profiles resulted in the following three major
observations. (1) There are three major stages of disease progression: an early stage between 0-2
days after inoculation (dai), an intermediate stage between 2-4 dai; and a late stage between 4-6
dai. (2) Most of the induced genes were identified at 3 dai during the intermediate stage,
indicating that this is an important host response timepoint. (3) We observed upregulation of the
tryptophan biosynthetic pathway. This observation demonstrates a specific biochemical host
response to infection. These observations provide the theoretical basis for a better understanding
of the plant response to infection.
- 145 -

Session 5: Biotechnology and Genomics – Oral presentations
Transcript accumulation in contrasting alleles at the Chromosome 3H DON accumulation QTL
To identify potential genes that are involved with FHB resistance and markers that are linked to a
DON accumulation resistant QTL, we examined transcript accumulation in a barley nearisogenic
line (NIL) pair carrying resistant and susceptible alleles at the DON resistant
chromosome 3H (BIN 6) QTL. The DON resistant QTL was identified in the
Fredrickson/Stander recombinant inbred line population (Smith et al., 2004). An NIL pair
carrying resistant and susceptible alleles at the chromosome 3 DON QTL was provided by Kevin
Smith (University of Minnesota).
We used the Barley1 GeneChip to examine transcript accumulation in plants carrying the
resistant and susceptible alleles at the chromosome 3H DON QTL at 48 and 96 hours after
inoculation. We identified seven genes that are differentially expressed in the lines containing
the differing alleles at the barley chromosome 3H QTL. These transcript accumulation
differences were due solely to genotype not the treatment. No genes were identified that
exhibited differential transcript accumulation between the contrasting alleles due to F.
graminearum infection.
Based on the allelic differences in the NIL pairs carrying the resistant and susceptible alleles,
some of the 7 differentially expressed genes may map to the chromosome 3H QTL region. We
mapped two of the seven genes on the Fredrickson/Stander mapping population in the
chromosome 3H DON accumulation QTL region. Our results show that the Barley1 GeneChip
can be used to identify allelic differences that can be converted into genetic markers that target
specific regions of the genome.
Impact of trichothecene accumulation on barley gene expression
F. graminearum infection of barley results in the fungus synthesizing trichothecene mycotoxins.
These mycotoxins are a major detriment to grain quality, especially for grain intended for use as
malt. In wheat, the ability of F. graminearum to synthesize trichothecenes increases the
virulence of the fungus (Proctor et al., 1995). Loss-of-function mutations in the Tri5 gene, the
first committed step in the trichothecene biosynthetic pathway, results in the inability of the
fungus to synthesize trichothecenes and a reduction of virulence on wheat. To determine the
host response to trichothecene accumulation in barley, we examined the transcript accumulation
profiles in Morex barley inoculated with a wildtype strain of F. graminearum, the Tri5 mutant
and water at 48 and 96 hours after inoculation.
Examination of the transcript accumulation data revealed three classes of genes that respond
differentially to trichothecene biosynthesis. We identified 37 genes that were only expressed in
barley during Tri5 mutant infection (no trichothecene accumulation), and 96 genes that were
only expressed during wildtype infection (trichothecene accumulation). We also identified 27
genes that are statistically significantly upregulated in wildtype-infected plants versus Tri5
mutant infected plants. These results show that there are genes that are specifically upregulated
and downregulated during trichothecene accumulation. Further analysis and annotation of the
genes is ongoing.
- 146 -

Acknowledgements
Session 5: Biotechnology and Genomics – Oral presentations
Support for this research was from grants to GJM and DFG from U.S. Barley Genome Project,
and grants to GJM from the U.S. Wheat and Barley Scab Initiative and the USDA-IFAFS.
"This material is based upon work supported by the U.S. Department of Agriculture, under
Agreement No. (PI should enter the applicable agreement number here). This is a cooperative
project with the U.S. Wheat & Barley Scab Initiative." All such materials must also contain the
following disclaimer unless the publication is formally cleared by USDA: "Any opinions,
findings, conclusions, or recommendations expressed in this publication are those of the
author(s) and do not necessarily reflect the view of the U.S. Department of Agriculture."
References
Close, T. J., S.I. Wanamaker, R.A. Caldo, S.M. Turner, D.A. Ashlock, J.A. Dickerson, R.A.
Wing, G.J. Muehlbauer, A. Kleinhofs and R.P. Wise. 2004. A new resource for cereal
genomics: 22K barley GeneChip comes of age. Plant Physiol. 134: 960-968.
Islam, A. K. M. R., K. W. Shepherd, and D. H. B. Sparrow. 1981. Isolation and characterization
of euplasmic wheat-barley chromosome addition lines. Heredity 46: 16 l-174.
Parry, W.D., P. Jenkinson, and L. McLeod. 1995. Fusarium ear blight 9scab) in small grain
cereals – a review. Plant Pathol. 44:207-238.
Proctor, R.H., T.M. Hohn, S.P. McCormick. 1995. Reduced virulence of Gibberella zeae
caused by disruption of a trichothecene toxin biosynthetic gene. Mol. Plant-Microbe
Interact. 8: 593-601.
Shen, L., J. Gong, R.A. Caldo, D. Nettleton, D. Cook, R.P. Wise and J.A. Dickerson. 2005.
BarleyBase—an expression profiling database for plant genomics. Nucl. Acids Res. 33
(Database issue): D614-D618.
Smith, K.P., C.K. Evans, R. Dill-Macky, C. Gustus, W. Xie and Y. Dong. 2004. Host genetic
effect on deoxynivalenol accumulation in Fusarium head blight of barley. Phytopath. 94:766-
771.
- 147 -

Session 5: Biotechnology and Genomics – Oral presentations
Molecular characterization of barley for variety description and identification
Peter Eckstein, Donna Hay, Brian Rossnagel, and Graham Scoles
Department of Plant Sciences/Crop Development Centre, University of Saskatchewan, Saskatoon, SK, CANADA S7N 5A8
In Canada, the protection of a barley variety under Plant Breeders Rights requires the candidate
variety be shown to be distinct, uniform and stable (DUS). To demonstrate that a variety meets
these requirements, the variety is described by a series of morphological/botanical
characteristics. The combination of phenotypic characteristics unique to a variety becomes the
legal basis to assess its distinctiveness, uniformity and stability. The limitations to the current
system are many. Phenotypic descriptions need to be determined by experienced personnel at
varying times throughout the season, and need to be duplicated over at least two field seasons.
The process is often long and expensive. Since descriptions are comparative in nature (to two or
three reference varieties chosen by the Plant Breeder) the descriptions are often subject to
interpretation and may be described differently in subsequent evaluations. If variety identity is
challenged, the material needs to be grown either in the field or a growth facility along with the
reference varieties included at registration, and the characteristics may appear different when
grown under different conditions.
Since the advent of DNA fingerprinting technology, the opportunity exists to replace the current
phenotypic description of a plant variety with molecular characterization. Several technologies
exist that could be serve the purpose, all with inherent advantages and disadvantages. The
advantages of all of these technologies however are the non-subjective nature of the descriptive
data, and the stability of molecular data.
To demonstrate that molecular characterization can be used to describe a new variety, a project
on 23 hulless barley varieties was begun. Hulless barley was chosen as the “model” because of
the simple genetics of this crop species, the relatively small number of varieties in this class
registered in Canada, and Breeder Seed of all varieties was readily available. The project
investigates the ability of AFLP technology to establish distinctiveness and uniformity of
molecular data within a variety. AFLP analysis as chosen as a model because it allows for the
generation of many bands (examines numerous loci) at one time providing an overall “picture”
of the variety.
Materials and Methods
DNA was extracted from 4-5 seeds from Breeder Seed of each variety using a CTAB based
protocol (Procunier et al., 1991). AFLP DNA fingerprinting was performed according to the
standard protocol of Vos et al. (1995), on 500ng of genomic DNA. DNA templates were
prepared using EcoRI and MseI restriction enzymes, and amplified with primers having three
selective bases. Amplified fragments were separated on 6% denaturing polyacrylamide gels (50
cm length) and visualized by staining with silver nitrate.
- 148 -

Results and Discussion
Session 5: Biotechnology and Genomics – Oral presentations
Twenty-three hulless barley varieties are currently registered in Canada and originate from five
institutions (see below).
Variety Institution
AC Bacon Agricuture and Agri-Food Canada, Brandon, Manitoba
AC Hawkeye Agricuture and Agri-Food Canada, Brandon, Manitoba
CDC Silky Crop Development Centre, Saskatoon, Saskatchewan
Falcon Field Crop Development Centre, Lacombe, Alberta
Jaeger Field Crop Development Centre, Lacombe, Alberta
Peregrine Field Crop Development Centre, Lacombe, Alberta
Tyto Field Crop Development Centre, Lacombe, Alberta
AC Alberte AAFC, ECORC, Ottawa, Ontario
CDC Dawn Crop Development Centre, Saskatoon, Saskatchewan
CDC Freedom Crop Development Centre, Saskatoon, Saskatchewan
CDC Gainer Crop Development Centre, Saskatoon, Saskatchewan
CDC McGwire Crop Development Centre, Saskatoon, Saskatchewan
CDC Speedy Crop Development Centre, Saskatoon, Saskatchewan
Condor Field Crop Development Centre, Lacombe, Alberta
Merlin Western Plant Breeders, Bozeman, Montana
Phoenix Field Crop Development Centre, Lacombe, Alberta
Tercel Field Crop Development Centre, Lacombe, Alberta
CDC Alamo Crop Development Centre, Saskatoon, Saskatchewan
CDC Candle Crop Development Centre, Saskatoon, Saskatchewan
CDC Fibar Crop Development Centre, Saskatoon, Saskatchewan
CDC Rattan Crop Development Centre, Saskatoon, Saskatchewan
HB803 Western Plant Breeders, Bozeman, Montana
HB805 Western Plant Breeders, Bozeman, Montana
AFLP analysis was performed using three selective primer combinations. On average, each
combination amplified 50 to 60 bands per sample. Since gels were silver stained, some of the
bands were likely complementary strands of the same fragment, therefore the number of loci
actually tested is less than this number. Of the three randomly chosen selective primer
combinations tested, each combination alone was able to amplify a set of fragments and generate
enough polymorphism to distinguish the 23 varieties. Thirteen bands were required to uniquely
characterize the varieties using primer combination E35-M49 (Figure 1), nine bands and 12
bands were required for primer combinations E38-M61 and E37-M62 respectively. These sets of
bands constitute the “discriminatory set” for that primer combination. In all cases, the bands
included in the “discriminatory set” were major bands that amplified strongly and consistently
from amplification to amplification and gel to gel. Minor bands, which are especially prevalent
with silver staining, and are inconsistent from one amplification to the next, were not considered.
In all three test cases, additional polymorphic bands were available but not required. These
bands may be included in the “discriminatory set” as required when new varieties are put
forward. Conversely bands presently used in the set may be removed as the polymorphic bands
are read in different combinations and varieties are de-registered.
- 149 -

Session 5: Biotechnology and Genomics – Oral presentations
1 2
3
4 5 6
7 89
*
10
11
Figure 1. AFLP generated banding patterns using primers E35-M49 on DNA templates from
23 hulless barley varieties. The circled numbers indicate the bands required to distinguish all
23 varieties. Bands marked with an asterisk identify additional polymorphism.
The accurate identification of varieties by a series of bands requires that a variety is uniform for
a given banding pattern. Most barley varieties are purified for phenotype based on evaluation of
a number of individual rows of plants (approximately 200), the seed for each row originating
from a single spike. While the resulting Breeder Seed is essentially homogeneous for visual
phenotypic characteristics, DNA fingerprinting has the ability to detect heterogeneity that cannot
- 150 -
*
*
12
*
13
*
*

Session 5: Biotechnology and Genomics – Oral presentations
be identified visually. Many varieties therefore may not be uniform for their DNA banding
patterns. We examined intra-varietal uniformity in the candidate variety CDC Cowboy. Of the
200 Breeder Seed long rows tested, banding uniformity was high, with little variation in overall
banding pattern and no variation amongst major bands. The small amount of variation detected
among relatively minor bands could be accommodated by disregarding these bands and not
including them in the discriminatory set for this variety.
For future candidates, the variety could be purified for a given molecular characterization at the
time of Breeders Seed production. This principle was demonstrated in the candidate oat variety
CDC Weaver. Two hundred long rows were assessed using AFLP primer combination E37-M62
which is able to efficiently discriminate between several oat varieties. Our analysis revealed that
12 rows showed variation at one or more of nine polymorphic loci, all major bands that could be
used to constitute the discriminatory set for oat. The seed of these 12 rows was discarded and is
not represented in the Breeder Seed. Of the 12 molecular discards, five rows varied at multiple
loci, and were part of six molecular discards that would also have been discarded based on visual
phenotype. In addition, one locus (major band) was segregating (nearly 50:50) amongst the
rows. The even segregation of this band amongst the long rows necessitated that the banding
pattern could not be purified for this locus without possibly changing the character of the
candidate variety. This band therefore could not be included in the discriminatory set for this
variety.
Applying the same principle to CDC Cowboy, five rows should have been discarded on the basis
of banding pattern and one of these rows was one of seven rows eliminated from the Breeder
Seed based on phenotype. The small number of discards necessitated by banding pattern
variation is unlikely to change the overall agronomic or quality profile of the variety.
While we have been able to demonstrate that AFLP technology is able to establish varietal
distinctness and uniformity in barley (and hexaploid oat with a more complicated genome),
several other genotyping technologies could be used. Those best suited are likely to be
microsattelite (SSR) and single nucleotide polymorphism (SNP) analysis. The ability of all of
the technologies to establish distinctness among large groups of cultivars, and uniformity in
previously registered varieties needs to be considered. In addition, stability of the banding
patterns, where variation in banding pattern may be due to seed purity issues, mutations over
time, or errors intrinsic to the fingerprinting technology itself will need to be addressed.
Nonetheless, DNA based identification systems can easily meet the standards set by the current
system and merit further investigation.
Acknowledgements
This research is funded in part by the Western Grain Research Foundation (WGRF) and the
Canadian Seed Growers Association (CSGA). We thank the barley breeders from various
organizations for providing us with Breeder Seed samples of their respective varieties.
References
Procunier, J.O., Jie, X., and K.L. Kasha. 1991. Barley Genet. Newsl., 20:74-75.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van Der Lee, T., Hornes, M., Frijters, A., Pot, J.,
Peleman, J., Kuiper, M., and M. Zabeau. 1995. Nucl. Acid Res., 23:4407-4414.
- 151 -

Session 5: Biotechnology and Genomics – Oral presentations
Transcriptional profiling of gene expression during malting in barley
Nora Lapitan 1 , Anna-Maria Botha-Oberholster 1 , Timothy J. Close 2 , and Christopher Lawrence 3
1 Department of Soil and Crop Sciences, Colorado State University, Fort Collins, CO 80523;
2 University of California, Riverside, CA 92521;
3 Virginia Bioinformatics Institute, Virginia Tech, Blacksburg, VA, 24061
Abstract
Malt is a major raw material for the production of beer, and during the malting process barley
grains are germinated under strictly-controlled conditions. Malting is a complex process that
involves many enzymes. Four enzymes known to be important in malting are α-amylase, βamylase,
α-glucosidase, and limit dextrinase. The goal of this project is to isolate specific gene
sequences and allelic variants of genes involved with the malting process. This includes known
genes as well as undiscovered genes. To investigate the determining factors of malting quality,
RNA expression patterns in different stages of micromalting (i.e, steeping, germination, kilning)
in the 6-row cultivar ‘Morex’ was studied through hybridization of RNA against the 22K
Barley1 Affymetrix GeneChip probe array. A subset of candidate genes that appear to be
important in malting was identified. Expression patterns of these genes were then compared
among the 6-row cultivars, ‘Morex’ and ‘Legacy’, and the 2-row cultivars, ‘Harrington’ and
‘Merit.’ Genes that were differentially expressed between 2-row and 6-row cultivars, as well as
among individual cultivars were identified.
Introduction
DNA arrays have been successfully utilized in plants to help decipher biochemical pathways
involved in complex traits. Two recent studies investigated pathways involved in the responses
of Arabidopsis thaliana against infection by cucumber mosaic virus strain Y (1) and barley
against attack by Blumeria graminis f. sp hordei (2). Both studies identified genes of unkown
function which appear to be important in the plant’s defense response against the pathogens.
Malting quality of barley involves several traits that show quantitative variation (3). The number
of QTLs (>150) that have been associated with malting quality phenotypes indicate the
involvement of many more genes than the four major genes known to be important in seed
germination and malting. Based on the hypothesis that the observed differences at the trait level
are due to differences in the expression of the underlying genes, cDNA array technologies could
be deployed to monitor gene expression in different genotypes and to identify genes contributing
to complex traits such as malting (4). Based on an analysis of 1400 ESTs, between 17 and 30
candidate genes were identified for each of six malting quality parameters analyzed (4). These
genes include well known malting related genes, as well as others with unknown function. This
study was conducted to identify candidate genes that may be important determinants of malting
quality in barley using the Barley 1 Gene Chip probe array containing 22,792 barley genes (5).
There were two specific objectives: 1) to identify genes that are highly regulated during malting
in the cultivar ‘Morex’, and; 2) identify genes that show expression level polymorphisms among
four malting cultivars.
- 152 -

Materials and Methods
Session 5: Biotechnology and Genomics – Oral presentations
Plant Material and Micromalting
Four barley cultivars were used: ‘Harrington’, ‘Legacy’, ‘Merit’, and ‘Morex’. One hundred
grams of seed from each cultivar were micro-malted at Busch Agricultural Resources, Inc., Fort
Collins, CO. Three sets of all cultivars were separately germinated. Samples for ‘Morex’ were
collected at 4 stages: 1) steeping (14 0 C for 48h), 2) Day-2 (48h germination, 20 0 C) malting; 3)
Day-4 malting ((96 h germination, 20 0 C) and 4) after kilning (22 hrs). For the other three
cultivars, samples were collected at Day-2 and Day-4. Dry seed was used as control.
RNA Extraction and Hybridization
Total RNA was prepared from a bulk of 5 seeds per sample using TRIzol Reagent (Gibco BRL
Life Technologies, Rockville, MD) and tested for quality by denaturing gradient gel
electrophoresis. Isolated total RNA samples were processed as recommended by Affymetrix, Inc.
(Affymetrix GeneChip Expression Analysis Technical Manual, Affymetrix, Inc., Santa Clara,
CA). All starting total RNA samples were quality assessed prior to beginning target
preparation/processing steps by running out a small amount of each sample (typically 25-250
ng/well) onto a RNA Lab-On-A-Chip (Caliper Technologies Corp., Mountain View, CA) that
was evaluated on an Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA). Singlestranded,
then double-stranded cDNA was synthesized from the poly(A)+ mRNA present in the
isolated total RNA (10 ug total RNA starting material each sample reaction) using the
SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen Corp., Carlsbad, CA ) and poly
(T)-nucleotide primers that contained a sequence recognized by T7 RNA polymerase.A portion
of the resulting ds cDNA was used as a template to generate biotin-tagged cRNA from an in
vitro transcription reaction (IVT), using the BioArray High-Yield RNA Transcript Labeling Kit
(T7) (Enzo Diagnostics, Inc., Farmingdale, NY). Fifteen μg of the resulting biotin-tagged cRNA
was fragmented to strands of 35-200 bases in length following prescribed protocols (Affymetrix
GeneChip Expression Analysis Technical Manual). Subsequently, 10 ug of this fragmented
target cRNA was hybridized at 45°C with rotation for 16 hours (Affymetrix GeneChip
Hybridization Oven 640) to probe sets present on the Barley1 GeneChip probe array. The
GeneChip arrays were washed and then stained (SAPE, streptavidin-phycoerythrin) on an
Affymetrix Fluidics Station 450, followed by scanning on a GeneChip Scanner 3000.
Experimental Design and Data analysis
To identify genes that are highly regulated during malting (Objective 1), RNA from 4 different
stages of micro-malted ‘Morex’ and dry seed were hybridized onto the Barley 1 GeneChip probe
array. Three replications per time point were conducted. For comparison of gene expression
profiles among cultivars, RNA from Day-2 and Day-4 from ‘Legacy’, ‘Harrington’ and ‘Merit’
was hybridized to Barley 1 GeneChip array. Two replications per genotype/time point were
performed. The data were quantified and analyzed using GCOS 1.1.1 software (Affymetrix, Inc.)
and/or ArrayAssist’s gcRMA (Iobion Informatics, Inc.) using default values (Scaling, Target
Signal Intensity = 500; Normalization, All Probe Sets, and Parameters, were set at default
values). Statistical analysis was done using limma (Linear models for microarray data) (Smythe
et al., 2005, http://bioinf.wehi.edu.au/limma) and hierarchical clustering and Bioconductor
software (6)
- 153 -

Session 5: Biotechnology and Genomics – Oral presentations
Quantitative RT-PCR
Quantitative RT-PCR was done using the QuantiTect ® SYBR ® Green RT-PCR system (Qiagen
Inc., Valencia, CA, USA) and the Cepheid Smart Cycler (Cepheid, Sunnyvale CA, USA).
Primers were designed using the specific barley sequences on the Barley1 GeneChip probe array.
Results and Discussion
Transcript profiling of genes expressed during different stages of malting in barley
In order to better understand malting and possibly discover novel genes involved in this process,
we employed the Affymetrix Barley 1 GeneChip probe array for transcriptional profiling of gene
expression during malting. We began by looking at the main stages of malting using ‘Morex’ as
a model and then compared the gene expression in these different malting stages to dry seed as
control. The malting stages included steeping, Day-2 and Day-4 germination, and after kilning.
To evaluate technical and biological variability, we analyzed replication clusters for both the
control and the different malting stages. The scatter plots showed that the same genes clustered
in similar orders indicating that the replications gave highly reproducible results.
Gene expression at each of the four malting stages examined was compared against dry seed
expression profiles. Four hundred eighty seven genes were identified which showed 5000-fold
greater signal intensity than dry seed at a significance level of P

Session 5: Biotechnology and Genomics – Oral presentations
Table 1. Partial list of genes significantly expressed in Morex after 24 h (steeping) and 96 h (day 4) of
micromalting compared to dry seed (P < 0.0001) grouped according to function
________________________________________________________________________
Starch degradation
alpha-amylase [Hordeum vulgare subsp. vulgare]; Alpha-amylase type a isozyme precursor (1,4-alpha-d-glucan
glucanohydrolase) (amy1) (low pi alpha amylase); Beta-amylase (1,4-alpha-D-glucan maltohydrolase); Iso-amylaselike
protein
Sucrose metabolism/energy production
2-oxoglutarate/malate translocator (clones OMT134 and OMT106), mitochondrial membrane - proso millet;
Phosphoglycerate kinase, cytosolic pir||TVWTGY; phosphoglycerate kinase (EC 2.7.2.3), cytosolic – wheat;
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
Inhibitors of hydrolytic enzymes
Alpha-amylase/subtilisin inhibitor precursor (BASI) pir||S04860 alpha-amylase/subtilisin inhibitor precursor –
barley; bowman-birk type trypsin inhibitor pir||TIBHB trypsin inhibitor (Bowman-Birk) - two-rowed barley
Temperature stress response
cold acclimation protein WCOR413 - wheat gb|AAB18207.1| cold acclimation protein WCOR413 [Triticum
aestivum]; heat shock protein HSC70-1, cytosolic [imported] - spinach gb|AAA62445.1| heat shock protein
Stress response/defense
23 kd jasmonate-induced protein pir||S22514 jasmonate-induced protein 1 – barley; chitinase (EC 3.2.1.14) CH11,
acidic - maize (fragment) gb|AAA62420.1| (L16798) class I acidic chitinase [Zea mays]; (1->3,1->4)-beta-glucanase
isoenzyme II (EC 3.2.1.73) [Hordeum vulgare]
Senescence
Ethylene-inducible protein [Oryza sativa] Putative pyridoxine/pyridoxal 5-phosphate
S-adenosylmethionine synthetase 1 (Methionine adenosyltransferase 1) (AdoMet synthetase 1
Cell division and growth
Tubulin beta-2 chain (Beta-2 tubulin) gb|AAD20179.1| beta-tubulin 2 [Eleusine indica]; ubiquitin / ribosomal
protein CEP52 - rice dbj|BAA02154.1| ubiquitin/ribosomal polyprotein [Oryza sativa]
Cell division and growth
Tubulin beta-2 chain (Beta-2 tubulin) gb|AAD20179.1| beta-tubulin 2 [Eleusine indica]
ubiquitin / ribosomal protein CEP52 - rice dbj|BAA02154.1| ubiquitin/ribosomal polyprotein [Oryza sativa]
Lipid metabolism
glyoxalase I [Oryza sativa (japonica cultivar-group)]; lipid transfer protein precursor 1 - barley (fragment)
emb|CAA42832.1| LTP 1 [Hordeum vulgare]; omega-6 fatty acid desaturase [Sesamum indicum]
Oxygen reactive enzymes
CAD11966.1 2e-34 glutathione-S-transferase, I subunit [Hordeum vulgaresubsp. vulgare]
ascorbate peroxidase [Hordeum vulgaresubsp. Vulgare
Amino acid metabolism
phosphoethanolamine methyltransferase [Triticum aestivum]; serine acetyltransferase [Oryza sativa (japonica
cultivar-group)]
Protein destination
Adenosylhomocysteinase (S-adenosyl-L-homocysteine hydrolase) (AdoHcyase); cathepsin B-like cysteine
proteinase (EC 3.4.22.-) - wheat (fragment); Cysteine proteinase EP-B 1 precursor pir||JQ1111; cysteine proteinase
(EC 3.4.22.-) EP-B 1 precursor –barley
protein synthesis
40s ribosomal protein s11 gb|aac14469.1| ribosomal protein s11 [glycine max]; ribosomal protein s30 homolog;
protein id: at4g29390.1 [arabidopsis thaliana]; 60s acidic ribosomal protein p0 pir||t04309 acidic ribosomal protein
p0 – rice; ef-1 alpha [oryza sativa] dbj|baa23659.1| ef-1 alpha [oryza sativa
Cell wall degradation
(1->3,1->4)-beta-glucanase isoenzyme II (EC 3.2.1.73) [Hordeum vulgare]; arabinoxylan arabinofuranohydrolase
isoenzyme AXAH-I [Hordeum vulgare]
Signal transduction
adenosine kinase [Zea mays]; small Ran-related GTP-binding protein [Triticum aestivum]
Unknown or unclear
______________________________________________________________________________________
- 155 -

Session 5: Biotechnology and Genomics – Oral presentations
Comparative expression profiles among four malting barley cultivars
The expression profiles of three other cultivars at Day-2 and Day-4 malting were investigated
and compared with the same stages in ‘Morex’. Expression patterns of the subset of genes
(identified in the study above) that appeared to be important in malting were analyzed in these
cultivars. Other genes showing significant levels of expression but were not highly expressed in
‘Morex’ were identified in the three cultivars. Among the highly expressed genes, 8.4% had at
least a two-fold greater level of expression in ‘Morex’ and ‘Legacy’ than in the 2-row cutivars
‘Harrington’ and ‘Merit’. Fructokinase and peptidylprolyl isomerase are examples of genes in
this category. Conversely, 11.9% of the genes had at least 2-fold greater level of expression in
the 2-row cultivars than in the 6-row cultivars. Acid phosphatase, and defensin are examples of
genes in the latter group. There were also some genes that were significantly expressed in one
cultivar only. These genes may be involved in determining malting quality differences between
2-row and 6-row cultivars or among the cultivars.
In summary, candidate genes that appear to be important in malting or malting quality
differences between cultivars were identified using the Barley 1 GeneChip probe array.
Validation of these candidate genes will be important. Association with malting quality
phenotypes is one approach. Genetic mapping and co-localization of candidate genes with QTLs
for malting quality phenotypes will provide further evidence for their possible roles in malting.
Acknowledgments
This work was partially funded by Anheuser Busch and the US Barley Genome Project. We
thank the following collaborators: Dr. Blake Cooper for providing genetic materials and for
valuable discussions on strategies and malting quality phenotypes; Dr. Jolanta Menert for
providing malted tissues and input on experimental design; Drs. Hari Iyer and Ann Hess for
support with the statistical analyses; J.T. Svensson, and E.M. Rodriguez from Dr. Close’s lab for
technical support with RNA quality assessments.
References
1) R. Marathe, Z. Guan, R. Anandalakshmi, H. Zhao, S.P. Dinesh-Kumar, Plant Mol Biol 55,
501 (Jul, 2004).
2) R.A. Caldo, D. Nettleton, R.P. Wise, Plant Cell 16, 2514 (Sep, 2004)
3) S.E. Ullrich, F. Han, B.L. Jones, J. Am. Soc. Brew. Chem. 55, 1 (1997).
4) E. Potokina et al., Mol. Breed. 14, 153 (2004).
5) T.J. Close et al., Plant Physiol 134, 960 (Mar. 2004).
6) R.C. Gentleman et al., Genome Biol 5, R80 (2004)
- 156 -

Session 5: Biotechnology and Genomics – Oral presentations
Molecular marker assisted introgression of loose and covered smut
resistance into CDC McGwire hulless barley
Tajinder S. Grewal, Brian G. Rossnagel, Graham J. Scoles
Crop Development Centre/Department of Plant Sciences, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK
S7N 5A8 Canada
True loose smut (Ustilago nuda (Jens.) Rostr.) and covered smut (U. hordei (Pers.) Lagerh.) of
barley result in yield reductions from 0.2 to 0.8 % in western Canada (Thomas and Menzies
1997). The smuts can be controlled by seed treatment, sowing disease-free seed or growing
resistant cultivars. Seed treatment with fungicides is effective but adds cost and the pathogens
may become resistant (Ben-yephet et al. 1975, Leroux and Berthier 1988). Furthermore, seed
treatment is not an option for organic production. Resistant cultivars are generally recognized as
the most economical and preferred method of control. However, breeding for smut resistance is
expensive as screening is time, labour and space consuming and frequent escapes makes it
necessary to screen putative resistant lines several times to confirm resistance. As both diseases
infect the inflorescence, simultaneously screening is not possible. Molecular Marker Assisted
Selection is a good alternative to combine resistance to both diseases at once.
CDC McGwire is a high yielding hulless barley cultivar but susceptible to true loose and covered
smut. Loose smut resistant lines in a CDC McGwire background with resistance from TR251
(Run8) were developed. Run8 confers resistance to most known races of U. nuda in western
Canada (Thomas and Menzies 1997). Similarly, covered smut resistant lines (having the Ruhq
gene) in a CDC McGwire background were available with resistance from Q21861. Ruhq shows
resistance to western Canadian isolates of U. hordei (Grewal et al. 2004). Each of these lines
had 50% of their background from CDC McGwire.
A sequence characterized amplified region (SCAR) marker linked to the loose smut resistance
gene Run8 has been developed (Eckstein et al. 2002). Similarly, a SCAR marker linked to
covered smut resistance in Q21861 has been developed (Ardiel et al. 2002). This project was
initiated to introgress the Run8 and Ruhq into CDC McGwire using molecular markers.
Materials and Methods
Breeding line SH00752 (CDC McGwire/TR251) was crossed with breeding line SH01470 (CDC
McGwire/Q21861). Two strategies were used to introgress covered and loose smut into CDC
McGwire i.e. doubled haploidy and marker-assisted backcrossing.
Doubled haploidy
SH00752 X SH01470 F1 seeds were used to produce doubled haploids. Thirty five DH plants
were produced using microspore culture and tested with UhR450 and Un8700R SCAR markers as
described by Ardiel et al. (2002) and Eckstein et al. (2002), respectively. The 35 DH lines were
tested for covered and loose smut reactions.
Covered smut screening: For inoculation, disease screening and evaluation, the techniques used
were as reported earlier (Ardiel et al. 2002, Grewal et al. 2004). The 35 DH lines (population
- 157 -

Session 5: Biotechnology and Genomics – Oral presentations
MC0181) were inoculated with a mixture of U. hordei isolates along with the original parents
(Q21861, CDC McGwire, TR251) and susceptible check (CDC Candle). All lines were screened
in the field in summer 2003 at the Preston Plots, U of S, Saskatoon. Covered smut infection was
evaluated as percent infected heads. In fall 2003, 21 putative resistant lines (showing

Session 5: Biotechnology and Genomics – Oral presentations
Table 1. Phenotype and Genotype Data of 35 Doubled-Haploid Lines
Barley lines Test Covered smut reaction* UhR450 Un8 Loose smut reaction**
Field 2003 GH 2003 Field 2004 covered Loose GH Field GH
% infected % infected % infected smut smut 2003 2004 2004
heads plants heads marker marker
CDC Candle check 48.5 75.0 65.1 No No S S S
Q21861 parent 0.4 0.0 0.1 Yes No S S S
TR251 parent 8.1 17.6 2.5 No Yes R R R
CDC McGwire parent 10.5 16.7 4.4 No No S S S
MC0181-01 SH00752/SH01470 1.1 8.3 0.2 Yes Yes R R R
MC0181-02 0.6 0.0 0.1 Yes Yes S
MC0181-03 15.8 No No S
MC0181-04 4.1 No Yes R R R
MC0181-05 0.0 0.0 0.0 Yes No S
MC0181-07 6.5 No No S
MC0181-08 0.0 0.0 0.3 Yes Yes R R R
MC0181-09 0.0 0.0 0.0 No No R R R
MC0181-10 3.6 No Yes R R R
MC0181-11 4.7 No Yes R R R
MC0181-14 0.0 0.0 0.0 Yes Yes R S R
MC0181-15 0.9 0.0 0.0 Yes Yes R R R
MC0181-18 0.0 0.0 0.0 Yes Yes R R R
MC0181-21 19.9 No Yes R R R
MC0181-22 18.7 No Yes R R R
MC0181-23 3.2 No No S
MC0181-24 0.0 0.0 0.0 Yes Yes R R R
MC0181-25 11.7 No No S
MC0181-26 8.8 No No S
MC0181-27 13.7 No Yes R R R
MC0181-28 0.0 7.1 0.0 Yes Yes R R R
MC0181-29 0.0 0.0 0.0 Yes Yes R R R
MC0181-30 0.0 0.0 0.0 Yes Yes R R R
MC0181-31 0.0 0.0 0.0 Yes Yes R R R
MC0181-32 0.0 0.0 0.0 Yes Yes R R R
MC0181-33 0.0 0.0 0.0 Yes Yes R R R
MC0181-34 3.3 No No S
MC0181-37 0.0 0.0 0.0 Yes Yes R R R
MC0181-40 3.0 No No S
MC0181-45 1.3 0.0 0.2 No No S
MC0181-46 0.6 0.0 0.1 No No S
MC0181-47 14.0 No Yes R R R
MC0181-48 2.6 5.5 0.0 Yes No S
MC0181-49 0.0 0.0 0.0 Yes No S
MC0181-50 0.0 0.0 0.0 Yes No S
*In field, covered smut evaluated as % infected heads; in greenhouse, evaluated as % infected plants.
**R - no infected head; S - any infected head. Loose smut inoculations were performed in the field and
inoculated seeds were grown in the greenhouse for disease development and vice versa.
- 159 -

Session 5: Biotechnology and Genomics – Oral presentations
Loose smut screening showed TR251 resistant (no infected head) and Q21861 and CDC
McGwire susceptible. Twenty-one DH lines showed resistance and for 33/35 lines the
phenotype and genotype data agreed. Resistant lines were screened twice to confirm their
resistance. All but one were resistant in the two subsequent tests.
Testing of putative resistant DH lines three times against covered smut and loose smut, showed
12 lines resistant to both the diseases and positive for both markers, proving indirect selection
using molecular markers is feasible. All 12 lines are being tested for agronomic and quality traits
during 2005.
Marker-assisted Backcrossing
Plants were genotyped in each generation and plants positive to both markers were backcrossed
to CDC McGwire. The number of BC1F1, BC2F1 and BC3F1 plants genotyped are shown in Table
2 and plants segregated in a 1:2:2:1 ratio for the markers as expected for two independent loci. In
the BC3F2 generation, a high number of plants were positive to either Un8 and/or UhR450
markers because these are dominant, thus we were unable to distinguish between homozygous
and heterozygous plants. These plants were screened with SCAR marker Un8700S and RAPD
marker OPJ10450 to identify the plants homozygous for the markers.
Table 2. Genotyping of Backcrossed Plants with Un8 and UhR450 Markers
Generation Total plants
screened
Positive to both
markers
Run8 UhR450 No marker
BC1F1 166 27 79 68 46
BC2F1 240 61 119 115 67
BC3F1 103 22 51 52 21
BC3F2 186 99 136 131 18
Evaluation of 10 lines against covered smut in the field in 2004 and twice in the greenhouse
indicated all were resistant (Table 3). These lines, along with the parents and the check, were
tested twice against loose smut. All lines were resistant. These lines are being tested again in
the field for loose and covered smut to exclude the possibility of escapes.
Blind selection based on the markers was conducted until the BC3F2. In every generation, plants
for backcrossing were selected based only on genotype. We were fortunate to have markers
linked to susceptible alleles, thus were able to identify homozygous plants for resistance to both
diseases in the BC3F2. The resistance of BC3F3 , BC3F4 and BC3F5 lines to both covered and loose
smut proves MAS is practical. These lines are more than 93% similar to CDC McGwire as we
started with 50% CDC McGwire in each parent. Phenotypically, they are very similar to CDC
McGwire. These lines are being tested in BC3F6 generation against loose and covered smut to
confirm reactions. Lines showing resistance to both the diseases are being evaluated in 2005
yield trials. As these lines are very similar to CDC McGwire limited testing should be required to
detail overall performance. This material may be released as a new cultivar - fully smut resistant
hulless barley! Release of these MAS-improved cultivars will demonstrate the power of this
technology. These results confirm that molecular markers can assist in rapid introgression of
disease resistance genes into elite lines with considerable savings in time and cost.
- 160 -

Session 5: Biotechnology and Genomics – Oral presentations
Table 3. Screening of Backcrossed Lines against Loose Smut and Covered Smut
Barley lines Test Loose smut* Covered smut reaction**
Field 2004 Gh winter 2004 Gh Spring 2004
Fall 2004 Spring 2005 % infected heads % infected plants % infected plants
CDC Candle check S S 65.1 87.5 71.4
Q21861 parent S S 0.1 0.0 0.0
TR251 parent R R 2.5 35.7 37.5
CDC McGwire parent S S 4.4 50.0 25.0
SH041241 R R 0.0 6.7 0.0
SH041242 R R 0.0 0.0 0.0
SH041243 R R 0.0 5.9 0.0
SH041244 R R 0.0 0.0 0.0
SH041245 R R 0.0 0.0 0.0
SH041246 R R 0.0 0.0 0.0
SH041247 R R 0.0 0.0 0.0
SH041248 R R 0.4 0.0 0.0
SH041249 R R 0.0 0.0 7.1
SH041250 R R 0.0 0.0 5.6
*R - Resistant, no infected head; S - Susceptible, one or more infected heads.
**In field, covered smut was scored as % infected heads; in greenhouse, scored as % infected plants.
Acknowledgements
We are grateful to Doug Voth and Tom Zatorski for their assistance in field and greenhouse
experiments, to Shelley Duncan and Mandy Mac for crossing and to Donna Hay for her
assistance in genotyping and to Peter Eckstein for his technical advice. The work was funded in
part by the Saskatchewan Agriculture Development Fund and the WGRF Check-off.
References
Ardiel, G.S., Grewal, T.S., Deberdt, P., Rossnagel, B.G. and Scoles G.J. 2002. Theor. Appl.
Genet. 104: 457-464.
Ben-yephet, Y., Henis, Y. and Dinoor, A. 1975. Phytopathology 64: 51-56.
Eckstein, P.E., Hay, D., Rossnagel, B.G. and Scoles, G.J. 2004. In Proc. 9 th International Barley
Genetics Symposium, Brno, Czech Republic, 20-26 June, 2004. pp. 259-262.
Eckstein, P.E., Krasichynska, N., Voth, D., Duncan, S., Rossnagel, B.G. and Scoles, G.J. 2002.
Can. J. Plant Pathol. 24: 46-53.
Grewal, T.S., Rossnagel, B.G. and Scoles, G.J. 2004. Can. J. Plant Pathol. 26 (2): 156-166.
Leroux, P. and Berthier, G. 1988. Crop Prot. 7: 16-19.
Thomas, P.L. and Menzies, J.G. 1997. Can. J. Plant Pathol. 19: 161-165.
- 161 -

Session 5: Biotechnology and Genomics – Oral presentations
Coupling expressed sequences and bacterial artificial chromosome
resources to access the barley genome
Kavitha Madishetty 1 , Jan T. Svensson 1 , Pascal Condamine 1 , Jie Zheng 2 , Steve Wanamaker 1 , Ming-Cheng
Luo 3 , Tao Jiang 2 , Stefano Lonardi 2 and Timothy J. Close 1 *
1 Dept. of Botany & Plant Sciences, 2 Dept. of Computer Sciences, University of California, Riverside, CA, 92521, 3 Dept. of
Agronomy & Range Science, University of California, Davis, CA, 95616
*Corresponding Author: TJC: (951) 827-3318; E-mail: timothy.close@ucr.edu
Abstract
Barley is an important cereal crop with a size of approx. 5300 Mb per haploid genome. This is
too large to be considered for whole-genome sequencing. But barley genome resources including
the Morex BAC library, abundant ESTs, and 22K microarray enable researchers to access the
barley genome. We aim to couple these resources to accelerate a transition to comprehensive
physical mapping and sequencing of the barley “gene-space”. We utilized unigene sequences to
design more than 12,600 36-mer “overgo” probes to identify Morex barley BAC clones that
carry expressed genes. These BAC clones will be fingerprinted to create BAC contigs, and a
minimal set will be identified. In Phase I of this project, 21,161 BACs identified in our own
work and that of A Kleinhofs, G Muehlbauer, R Wise, P Hayes, K Gill, N Stein, MA Saghai
Maroof and co-workers were fingerprinted, with 13,067 BACs assembled into 2262 contigs
comprising ca 9.4% (470 Mb) of the genome. These results are available through the “The
Barley Genome” website http://phymap.ucdavis.edu:8080/barley/. In Phase II, more than 7700
abiotic stress related genes (drought, salinity, low temperature or ABA treatment) were identified
using the Affymetrix Barley1 GeneChip. In total ~7000 overgos have been used as of June 2005.
Of these, about 2149 overgo probes were related to an objective to genetically map 1000 genes
associated to abiotic stress. For the purpose of anchoring these abiotic stress related regions on
the genetic map, we investigated single feature polymorphisms (SFPs) using the Barley1
GeneChip data using Morex, Steptoe, Oregon Wolfe Barley (OWB) dominant and OWB
recessive. We also developed a single nucleotide polymorphisms (SNPs) database from
HarvEST:Barley EST sequences. A high throughput method for SNP mapping with R Waugh
and N Rostoks (Scottish Crop Research Institute; SCRI) and N Stein, R Varshney and A Graner
(Institute of Plant Genetics and Crop Plant Research; IPK) is in progress. Polymorphisms, and
genetic and physical map data, will be added to HarvEST:Barley (http://harvest.ucr.edu). Phase
III has a goal of probing the BAC library with the remaining ~5500 overgos to identify around
60,000 gene-bearing BACs in all, and to fingerprint and align them into contigs to derive a
physical map of the overall minimal set.
Introduction
Triticeae genomes contain at least 80% of repetitive DNA (Bennet and Leitch, 1995), which has
so far prevented the Triticeae from becoming the focus of large-scale genomic sequencing
projects. In recent years, however, a number of barley genomic resources such as ~400,000 ESTs
representing about 70% of all genes, the 6.4X Morex BAC library (Yu et al. 2000), cDNA
libraries, several widely used mapping populations, a 22K microarray and its diploid nature have
made barley a model Triticeae crop to access its genome.
- 162 -

Session 5: Biotechnology and Genomics – Oral presentations
The most commonly used probes for screening arrayed libraries have been sub-cloned DNA
fragments, PCR amplified products (Xu et al. 1998) or DNA oligonucleotides (Klein et al. 2000).
A novel approach for making probes, developed by Ross et al. (1999), has the advantage of
oligonucleotides and also yields slightly larger probes with better hybridization kinetics and
higher specific activity of labeling. These probes, termed overgos are made by annealing two 24bp
oligonucleotides with an 8-bp overlapping region at the 3’ end and filling in the overhanging
bases with Klenow enzyme and radiolabeled nucleotides. Multiplexing of overgos enables the
hybridization of large numbers of probes in a single experiment. For example, 10,642 overgos
designed from ESTs were applied to 165,888 maize BACs in a 24×24×24 experimental design
with an 88% success rate (Gardiner et al. 2004).
In our effort to isolate a large number of BAC clones from gene rich loci in the barley genome,
we have developed a novel strategy that integrates the technical advantages of currently available
library screening methods. We modified the labeling protocol and developed stringent criteria for
the selection of sequences used for overgo probes. We developed software that can extract
overgos from unique as well as popular sequences from the HarvEST:Barley database.
Following this approach, we designed a total of 12,661 “overgos”. The “OligoSpawn” website
http://oligospawn.ucr.edu provides access to elements of our oligo design algorithms. We have
been able to pool >200 overgo probes per hybridization for highly parallel hybridization-based
screening of the Morex barley BAC library.
Materials and Methods
Barley BAC library. The library was derived from DNA of cultivar Morex using restriction
endonuclease HindIII. This library consists of 313,344 individual clones stored in 816 384-well
microtiter plates. This library provides about 6.3 haploid genome equivalents with an average
insert size is 106 kb. The library is arrayed on 17 high-density DNA filters for screening by
hybridization (http://www.genome.clemson.edu).
Oligonucleotide probe design. A computer program “OligoSpawn” was used to design the
overgo probes used in this study (Zheng et al. 2004, http://www.oligospawn.ucr.edu). A total of
18,766 overgos were designed from the probesets used in 22K barley GeneChip (Close et al.
2004), and of these 9500 were selected for the present studies. The rest of the overgos (around
2600 for this project) were designed from unigenes that were not covered as probesets on the
barley gene chip. These latter probes were chosen on the basis of functional categories of the
unigenes from which they were derived.
Oligonucleotide probes and probe pairs. All barley oligonucleotide primers were purchased
from Illumina Inc. (San Diego, CA). Each oligonucleotide was synthesized as a 22-mer at 25
nmol scale, dissolved in 250 μl of TE buffer, and diluted 50-fold in the final probe pair mix
(final concentration 1 μM).
Oligonucleotide probe labeling. Ten microliters of each probe pair mix was labeled in a separate
well of a 96-well PCR microplate with 10 μl of freshly prepared master mix composed of 4.0 μl
of 2.5X Overgo Labeling Buffer, 1.0 μl 2 mg/ml acetylated bovine serum albumin (BSA)
- 163 -

Session 5: Biotechnology and Genomics – Oral presentations
(Promega), 0.125 μl of all the four radioactive nucleotides ( [α- 32 P] dATP, [α- 32 P] dCTP, [α- 32 P]
dGTP and [α- 32 P] dTTP) each at a concentration of 10 μCi/μl (~ 3000 Ci/mmol) (Perkin Elmer)
and 1 unit of Klenow enzyme (New England Biolabs). A dNTP solution composed of 10 mM
each of four non-radioactive dNTPs was used for cold chase. An oligonucleotide pair with
sequences 5’-AACGGGCGAGTGATGTAAAATA-3’ and 5’-
TGATGGGATCGGGCTATTTTAC-3’ was used as background overgo to light up all of the
bacterial clones. Labeling reactions were carried out at room temperature for 1 h followed by
addition of 5 μl of the cold chase solution to each of the reaction tubes. Later, all the reactions
were pooled and probes were denatured at 95°C for 5 min and immediately transferred to the
hybridization tubes containing prehybridized high density BAC membranes.
High-density filter hybridization. Hybridization was performed in 40 ml of Church’s buffer at
60°C for two nights in a hybridization oven. After hybridization, membranes were extensively
washed in solutions with increasing stringency starting with 2 liters of 4X SSC with 0.1% SDS
followed by 2 liters of 1.5X SSC with 0.1% SDS and finally with 2 liters of 0.75X SSC with
0.1% SDS at 50°C. Membranes were then sealed in plastic wrap and exposed to Kodak X-ray
films (Kodak BIOMAX MS Double Emulsion, 24 x 30 cm) at -80°C for 5-6 days.
Results
Phase I
As the initial step to compile all the barley resources, all of the available BAC addresses from
major barley genomic researchers were collected. A total of 21,616 BAC addresses were
compiled from seven sources including those identified from our own work and that of A
Kleinhofs, G Muehlbauer, R Wise, P Hayes, K Gill, N Stein, MA Saghai Maroof and coworkers.
The majority of these BAC clones were identified using mapped cDNA probes, while
most of the others were recognized using EST-derived overgo probes. In Phase I of this project,
an attempt was made to fingerprint all of these BACs, with 15,513 clones ultimately used for
FPC assembly. Of these, 13,067 BACs assembled into 2262 contigs, while 2446 were singletons.
These 2262 contigs account for 470 Mb which is about 9.4% of the barley genome. All data is
publicly available at the “Barley Genome” website http://phymap.ucdavis.edu:8080/barley/
providing access to BAC contig data.
Phase II
The strategy that we have developed consists of identifiying gene-containing BAC clones
through hybridization to pools of overgos designed from EST-derived unigene sequences in the
HarvEST:Barley database. We design overgos using algorithms available through the
OligoSpawn website (http://oligospawn.ucr.edu). OligoSpawn provides efficient selection of two
types of oligos, namely unique and popular, from large unigene datasets. In the context of BAC
library screening, unique oligos serve to unambiguously link one gene to BAC clones, while the
purpose of popular oligos is to identify the largest possible list of gene-bearing BAC clones
using the smallest number of probes. In order to obtain oligos for many genes of interest, and to
probe selectively by functional category, we created a local information management software
called oSearch. The majority of the overgos were derived from probesets on the Affymetrix
barley GeneChip that were up- or down-regulated during abiotic stress including salinity,
drought, low temperature or ABA treatment. This software recommends a 36-mer for each
unigene or probeset and lists all unigenes represented by a given 36-mer.
- 164 -

Session 5: Biotechnology and Genomics – Oral presentations
Using oSearch we have generated a total of 12,661 overgos to be used in this work. Through
early June 2005, a total of about 7000 overgos had been used, generally in pools of 96 to 300
simultaneous probes, most often 192 probes per pool. The reading of positive BAC addresses
from all these hybridizations using Incogen’s High Density Filter Reader software
(http://www.incogen.com) is in progress. Interestingly, results using 96 popular overgos
detected about 4000 positive BAC clones, which is about 40 per overgo, about 6-7 times the
expected frequency of probes representing unique genes. This result seems to validate our
hypothesis that popular overgos provide economical screening of genomic libraries for genebearing
clones that carry sequences found in numerous genes. Another result from screening the
BAC library with 576 overgos, a mixture of unique and popular, identified more than 5000
positive BAC clones with an average of 9.2 clones per probe (Figure 1).
Percent New
100%
80%
60%
40%
20%
0%
Percent New BACs vs Total BACs
PhI 3 4 5 6 7 8 9 10111213
Pools
35000
30000
25000
20000
15000
10000
5000
0
Total # BACs
Percent New
Total BACs
Figure 1: This chart shows the percent new BACs in each pool for this first 13 pools that we
used, as well as the total number of BACs that were identified up to that point.
In order to tie the physical map of BAC clones to the genetic linkage map, around 1000 genes
with unambiguous BAC address and contigs will be mapped. To identify and map these unigenes
we developed a two-pronged approach based on single nucleotide polymorphisms (SNPs) and
single feature polymorphisms (SFPs). SNP discovery was done “in silico” using a relaxed
assembly (#32) from HarvEST:Barley and 36 pairwise comparisons between eight barley
genotypes. This resulted in 12,615 eSNPs in 3509 unigenes, of which 29 of 32 (91%) randomly
chosen eSNPs were validated by direct sequencing. Of these 3509 unigenes, only the subset in
the abiotic stress list has been further considered for our mapping purposes. We combined our
list of SNPs with others provided by collaborators N Rostocks and R Waugh at SCRI and N
Stein, R Varshney and Andreas Graner at IPK. SNPs from 565 and 217 unigenes were provided
by SCRI and IPK, respectively, the former list being mainly a subset of the abiotic stress unigene
list that we previously shared with our SCRI colleagues. The collective list of SNPs was used to
design of an Illumina Oligo Pool Assay (OPA). The OPA is a high throughput genotyping
- 165 -

Session 5: Biotechnology and Genomics – Oral presentations
platform designed to genotype 1536 loci simultaneously. Among these, we hope to map as many
as 1000 related to abiotic stress in order to accomplish our abiotic stress gene mapping objective.
We plan to genotype 96 maplines each from Steptoe x Morex, Barke x Morex, and Oregon
Wolfe Barley (OWB) dominant and recessive parents. Also 96 different cultivars, landraces and
elite lines will be examined. Designs have been finalized for the Illumina OPA chip. To identify
the BAC clones corresponding to these ~1000 abiotic stress genes, about 2149 corresponding
overgo probes have been used to screen the BAC library filters.
For our second approach we investigated single feature polymorphisms (SFPs) using the
Affymetrix Barley1 GeneChip hybridized with labeled cRNA from the parents of each of three
barley mapping populations: OWB dominant x OWB recessive, Steptoe x Morex, Barke x
Morex. We developed a detection method using the robustified projection pursuit (RPP) method
in order to evaluate the overall differentiations of signal intensities of probe sets comparing two
genotypes and to measure the individual contribution of each probe, from which the probes
covering polymorphisms (SNPs or INDELs) can be identified (Cui et al., submitted). We
randomly selected SFP-containing unigenes for sequence validation and found that 59 of 72 were
validated (82%). A total of 2090 SFPs were detected of which 844 (722 probe sets) were abiotic
stress responsive as defined by our expression data. A 12,000 probe Nimblegen array was
designed to further test the performance of SFPs and optimize SFP representation. The results
from the Nimblegen chip indicate that a 25-mer with the polymorphic nucleotide(s) positions
within a central region of 6-18 nucleotides is best suited for obtaining higher signal intensity
differences between the polymorphic parents.
References
Bennet MD, Leitch IJ. 1995. Nuclear DNA amounts in angiosperms. Ann Bot 76: 113-176.
Close TJ, Wanamaker S, Caldo RA, Turner SM, Ashlock DA, Dickerson JA, Wing RA,
Muehlbauer GJ, Kleinhofs A, Wise RP. 2004. A new resource for cereal genomics: 22K
barley GeneChip comes of age. Plant Physiology 134: 960-968.
Cui X, Xu J, Asghar R, Condamine P, Svensson JT, Wanamaker S, Stein, N, Roose M, Close TJ.
2005. Detecting single-feature polymorphismn through high density oligonucleotide
microarray. (Submitted to Bioinformatics)
Gardiner J, Schroeder S, Polacco ML, Sanchez-Villeda H, Fang Z, Morgante M, Landewe T,
Fengler K, Useche F, Hanafey M, Tingey S, Chou H, Wing R, Soderlund C, Coe EH Jr.
2004. Anchoring 9,371 maize expressed sequence tagged unigenes to the bacterial artificial
chromosome contig map by two-dimensional overgo hybridization. Plant Physiol 134:1317–
1326.
Klein PE, Klein RR, Cartinhour SW, Ulanch PE, Dong J, Obert JA, Morishige DT, Schlueter
SD, Childs KL, Ale M, Mullet JE. 2000. A high-throughput AFLP-based method for
constructing integrated genetic and physical maps: progress toward a sorghum genome map.
Genome Res 10:789-807.
Ross MT, LaBrie T, McPherson J, Stanton VM. 1999. Screening large-insert libraries by
hybridization. In Current protocols in human genetics (ed. Ann Boyl), pp.5.6.1-5.6.52.
Wiley, New York.
- 166 -

Session 5: Biotechnology and Genomics – Oral presentations
Xu J, Daichang Y, Domingo J, Ni J, Huang N. 1998. Screening for overlapping bacterial
artificial chromosome clones by PCR analysis with an arbitrary primer. Proc Natl Acad Sci
USA 95:5661-5666.
Yu Y, Tomkins JP, Waugh R, Frisch DA, Kudrna D, Kleinhofs A, Brueggeman RS, Muehlbauer
GJ, Wise RP, Wing RA. 2000. A bacterial artificial chromosome library for barley (Hordeum
vulgare L.) and the identification of clones containing putative resistance genes. Theor Appl
Genet 101:1093-1099.
Zheng J, Close TJ, Lonardi S, Jiang T. 2004. Efficient selection of unique and popular oligos for
large EST databases. Bioinformatics 20:2101-2112.
- 167 -

Session 5: Biotechnology and Genomics – Oral presentations
Analysis of barley necrotic mutants in relation to disease
resistance/susceptibility
A. Kleinhofs 1 , N. Rostoks 2 , L. Zhang 1 and B. Steffenson 3
1Dept. Crop and Soil Sciences and School of Molecular Biosciences, Washington State University, Pullman, WA 99164-6420,
USA
2Scottish Crop Research Institute, Invergowrie, Dundee, DD2 5DA, United Kingdom
3Department of Plant Pathology, University of Minnesota, St. Paul, MN 55108-6030, USA
Plants respond to pathogen attack with complex signaling and defense mechanisms including
hypersensitive response, which results in rapid cell death. Numerous mutants, resulting in
unregulated cell death, have been identified in many species. In barley, such mutants are called
"necrotic" while in Arabidopsis they are labeled "lesion mimic" to suggest their involvement in
mimicking response to pathogen attack. Lesion mimic or necrotic mutants have been extensively
characterized in maize (reviewed in Johal et al., Bioessays 17:685, 1995) and Arabidopsis (reviewed
in Lorrain et al., Trends Plant Sci. 8:263, 2003). In barley, the most famous necrotic mutant is mlo
(Wolter et al., Mol. Gen. Genet. 239:122, 1993), but otherwise such mutants have received only
limited attention. The wild-type Mlo gene encodes a unique membrane anchored protein with six
membrane-spanning helices and a postulated dual negative control function in leaf cell death and
onset of pathogen defense (Buschges et al., Cell 88:695, 1997). The recessive mlo allele confers
durable broad-spectrum resistance to almost all known isolates of the biotrophic fungal pathogen
Erysiphe graminis f. sp. hordei (powdery mildew) (Jorgensen, Euphytica 63:141, 1992). However,
all mlo lines are hyper-susceptible to the hemibiotrophic fungi Bipolaris sorokiniana (teleomorph
Cochliobolus sativus) and Magnaporthe grisea (Kumar et al., Phytopath. 91:127, 2001; Jarosch et al.,
Mol. Plant-Microbe Interact. 12:508, 1999). Since the survival of hemibiotrophic pathogens in their
necrotrophic phase depends on host cell death, the lack of Mlo gene function may antagonize plant
defenses to these organisms. The simplest interpretation of these observations may be that increased
susceptibility to cell death, as in necrotic mutants, may be antagonistic to biotrophic organisms and
favor necrotrophic organisms. Here we report the identification of fast neutron induced mutants
FN085 and FN338 as allelic to the barley nec1 locus. By homology to the Arabidopsis Hlm1 gene,
the Nec1 gene encodes the cyclic nucleotide-gated ion channel (CNGC) 4 protein (Rostoks et al.,
submitted). This protein belongs to a family of proteins that are weakly selective cation channels,
permeable to K + , Na + and/or Ca ++ and regulated by cyclic nucleotides and calmodulin. In
Arabidopsis the hlm1 allele confers increased resistance to Pseudomonas syringae pv. tomato
(Balague et al., Plant Cell 12:365, 2003). We tested these mutants and several other necrotic mutants
for their reaction to stem rust Puccinia graminis f. sp. tritici (B. Steffenson, unpublished). The
CNGC4 mutants FN085, in susceptible cv. Steptoe background, and FN338, in resistant cv. Morex
background, did not differ from the wild-type in their reaction to the stem rust pathotype MCC, thus
this mutation did not affect susceptibility or resistance to the pathogen. Surprisingly four other fast
neutron-induced necrotic mutants, all in susceptible cv. Steptoe background, showed remarkable
resistance to the stem rust pathotype MCC, while several others showed no change in their response
when compared to the wild-type. In order to identify the genes involved, the four resistant mutants
were subjected to analysis on the Barley 1 Affymetrix microarray. Preliminary data indicate that
several genes are deleted in each mutant. These could be multiple deletions at several loci or due to
one large deletion. To simplify the analysis, the mutants were backcrossed to wild-type and
reselected for new analysis on the microarray. The mutants are also being tested for response to
different pathogens.
- 168 -

Session 5: Biotechnology and Genomics – Poster abstracts
A TaqMan ® fluorescent reporter probe replaces gel electrophoresis for the
Rpg1 SCAR marker in molecular marker-assisted selection
Peter Eckstein, Donna Hay, Brian Rossnagel, and Graham Scoles
Department of Plant Sciences/Crop Development Centre, University of Saskatchewan, Saskatoon, SK, CANADA S7N 5A8
The markers for the barley stem rust resistance gene Rpg1 (Eckstein et al, 2003) are based on DNA
sequence of the isolated gene (Brueggeman et al, 2002) and as such are “perfect” markers, being able
to distinguish between resistant and susceptible alleles without recombination. While linkage based
markers cannot reliably be used to predict the phenotype of plant lines that have not previously been
disease tested, the Rpg1 marker can be used in this fashion. The marker is routinely used in our
breeding program and has replaced the need for our local rust nursery. The disease reaction of
candidate varieties is confirmed only at the Co-op testing level. In addition, the marker is routinely
used to determine the presence or absence of rust resistance in previously uncharacterized materials.
As such, the marker is highly useful in the breeding program. The present limiting step in our
MMAS program remains the analysis of PCR products by gel electrophoresis. We are investigating
the use of TaqMan ® fluorescent reporter probes for allelic discrimination in quantitative real-time
PCR (qRT-PCR) to replace gel electrophoresis. The Rpg1 markers are ideal as a model since the
markers are highly robust and the primers are highly selective due to the 3nt insertion/deletion event
in the gene that determines gene functionality and which form the discriminatory basis for the PCR
primers. A TaqMan ® probe has been designed with the aid of Beacon Designer 4.0 such that the
PCR primers are discriminatory and the fluorescent probe itself is universal to both the resistant and
the susceptible PCR test. Amplification of the locus, and the amplification mediated increase in
fluorescence, is determined by the selective sense primers (specific for either the resistant allele or
the susceptible allele). The probe sequence (Rpg1TMP, see below) lies 19 nucleotides downstream
of the non-selective primer on the anti-sense strand. The non-selective primer (Rpg1TMR, see
below) has been redesigned to amplify a short 120bp fragment for more efficient qRT-PCR assays.
PCR amplification conditions are currently being optimized. Cost of the TaqMan ® probe is $0.07 per
test, which is less than the cost of gel electrophoresis (based on 96 samples per gel). In addition,
with fewer steps in the screening process there is less potential for error, and the fluorescent detection
of PCR products eliminates one of the steps of the MAS process that is not amenable to automation.
Rpg1TMP 5’ FAM-TTTGGTATAGCTCTCCTTTCCTGCC-Black Hole Quencher1 3’
Rpg1TMR 5’ TACACGCTCAGTAAACTCTT 3’
Brueggeman, R., Rostoks, N., Kudrna, D., Kilian, A., Han, J., Druka, A., Steffenson, B., and A.
Kleinhofs. 2002. Proc. Natl. Acad. Sci. USA 99:9328-9333.
Eckstein, P., Rossnagel, B., and G. Scoles. 2003. Barley Genetics Newsletter 33:7-11.
- 169 -

Session 5: Biotechnology and Genomics – Poster abstracts
Genetic analysis of preharvest sprouting in barley
S.E. Ullrich*, J.A. Clancy, H. Lee, F. Han, K. Matsui, I.A. del Blanco
Dept. of Crop & Soil Sciences, Washington State University, Pullman, WA 99164-6420, USA
Preharvest sprouting (PHS) can be a problem in barley production, especially of malting barley. Rain
or even very high humidity from near physiological maturity onward can cause sprouting in spikes.
This has very serious consequences for malting grain, since rapid and complete germination is
critical. Much information has been gained by studying the genetic control of dormancy (measured as
percent germination) in barley. The objective of this study is to determine if the germplasm
developed and QTLs discovered in previous research of dormancy can be applied or related to the
genetic control of PHS. PHS was measured in this study as ‘PHS score’ based on visual sprouting in
mist chamber-treated spikes at 0 and 14 d after physiological maturity and as ‘alpha-amylase
activity’ in kernels taken from mist chamber-treated spikes that showed little or no visible sprouting
at physiological maturity (0 d). Germination percentage was also measured at 0 and 14 days after
physiological maturity. Many QTLs for dormancy have been previously mapped, most of which are
minor and inconsistently expressed across environments. Consistently expressed major and minor
dormancy QTLs were previously mapped to barley chromosomes 1 (7H), 4 (4H), and 7 (5H) in the
U.S. Barley Genome Project Steptoe (dormant) / Morex (non-dormant) doubled haploid mapping
population. Evaluation of this population grown in two environments (greenhouse and field) for PHS
score revealed QTL regions on all chromosomes, except chromosome 6 (6H) and for alpha-amylase
activity on all seven chromosomes from one or both environments. However, many of the QTLs
identified were minor in effect. QTL effects for all traits analyzed ranged from 4 to 36%. The two
major dormancy QTLs previously identified on chromosome 7, as well as, the minor ones on
chromosomes 1 and 4 were confirmed in this study. Some of the PHS score and alpha-amylase QTLs
coincide with known dormancy QTLs, but there appear to be QTLs unique to PHS, as well. Some
PHS alpha-amylase activity QTLs coincide with known malt-derived alpha-amylase activity QTLs,
but some do not. The major chromosome 7 dormancy QTLs detected from this cross are expressed
during PHS, but several previously identified minor dormancy QTLs appear to be more important
during preharvest sprouting than during after-ripening or after-harvest dormancy conditions.
Whereas, the literature frequently equates dormancy and preharvest sprouting, it appears there is
some difference in genetic control of these two somewhat opposite traits. Both traits are complexly
inherited, but with some overlap and some uniqueness in gene expression. In addition, several
relatively major genes seem to stand out in expression with many minor genes presumably
interacting or adding to the expression of the two traits. This study continues with two other mapping
populations previously analyzed for dormancy. Ultimately, key QTLs will be identified, which
should benefit the breeding efforts of both six-row and two-row barley for a suitable balance between
the tendencies for preharvest sprouting and dormancy.
* Corresponding author, e-mail address
- 170 -

Session 5: Biotechnology and Genomics – Poster abstracts
Effects of ethylene in barley (Hordeum vulgare L.) tissue culture regeneration
Jha, Ajay K. 1 , Lynn S. Dahleen 2 and Jeff C. Suttle 2
1 Department of Plant Sciences, North Dakota State University, Fargo, ND 58105. 2 USDA-ARS, Fargo, ND 58105
Ethylene is a gaseous plant hormone that regulates numerous cellular processes from germination to
flowering and senescence. It is produced under stress conditions such as tissue culture and can be
physiologically significant in-vitro due to enclosed conditions. This study was conducted to
determine genotype-dependent ethylene production and its role in regeneration of barley (Hordeum
vulgare L.) callus. Six barley cultivars were examined and found to produce different amounts of
ethylene during culture. The highest regeneration was observed in cultivars generating the most
ethylene. Ethylene production was correlated with regeneration rates (r 2 = 0.90625). There were no
significant genotype by stage interactions for either ethylene production or green plant regeneration.
The media was modified by adding the ethylene precursor, ACC (1-amino-cyclopropane-1carboxylic
acid) or the ethylene antagonist silver nitrate (AgNO3) to the media at different stages of
callus culture to determine the effects of ethylene during plant regeneration. Highest regeneration in
Morex was observed when AgNO3 was added to maintenance stages (M-1, M-2) and lowest
regeneration when AgNO3 was applied to the regeneration stage compared to the control. In Golden
Promise, AgNO3 added throughout the second maintenance and regeneration stages showed the
highest regeneration compared to control. Regeneration was significantly affected with addition of
ACC in Morex and highest when ACC was added at the second maintenance stage. Golden Promise
did not show improved regeneration when ACC was added at any time. Regeneration was highest for
the control. Further manipulation of ethylene synthesis and/or action will be used to identify critical
timing and duration for ethylene to effects on plant regeneration from recalcitrant genotypes.
Ethylene exposure for briefer time periods will help pinpoint the specific stages when ethylene
should be manipulated.
Corresponding author: Lynn Dahleen
e-mail: dahleenl@fargo.ars.usda.gov
- 171 -

Session 5: Biotechnology and Genomics – Poster abstracts
Validation of select diastatic power QTL in elite Western U. S. six-rowed
spring barley germplasms
D. Hoffman, A. Hang, and D. Obert
USDA-ARS Small Grains and Potato Germplasm Facility, 1691 South 2700 West Aberdeen, Idaho 83210
Barley is a major commodity in the western US., especially when utilized for malt production. Spring
six-rowed barley germplasm adapted to the western US. is often low in diastatic power (DP), an
important malting trait. DP quantitative trait loci (QTL) and linked markers have been identified in a
spring six-rowed mapping population grown in western environments, but these QTL have not been
validated in elite western six-rowed backgrounds and the QTL are based on restriction fragment
length polymorphism (RFLP) markers. The objectives of this study were to validate DP QTL in
populations containing elite western germplasm and to identify polymerase chain reaction (PCR) -
based markers linked to select DP QTL.
Low DP spring six-rowed cultivars or elite lines were crossed to ‘Morex’, a high DP 6-rowed barley,
or to SM#42, a high DP line of the ‘Steptoe’/Morex mapping population. . F1 plants were
backcrossed to the adapted, low DP lines two or three times, and segregating lines were developed
from the backcrossed populations. The low DP parents and backcross-derived segregating lines were
genotyped with PCR-based markers closely aligned to five DP QTL with large effects on
chromosomes 1H, 4H, and 7H. Lines homozygous for the PCR-based markers and parental checks
were planted in 4-m rows at Aberdeen, ID. Quality analysis to determine DP levels was performed
by the Cereal Crops Research Unit, Madison, WI. Nearly all the low DP parental lines had marker
alleles that resembled either Steptoe or Morex with regard to DNA fragment size. Two lines from
Utah State University had DP-negative marker alleles for all loci except the one on the short arm of
chromosome 4H. Some had more DP-positive alleles with a few DP-negative alleles, while others
had similar numbers of DP-positive and DP-negative alleles. Also, some heterogeneity within lines
was detected. We plan to determine if relationships between marker genotype and DP can be
identified in the advanced populations and if other traits are affected by DP marker selection. This
study should provide useful information for the development of six-rowed malting barleys in the
western U.S.
- 172 -

Session 5: Biotechnology and Genomics – Poster abstracts
The barley stem rust resistance gene product RPG1 is specifically degraded
upon infection with the stem rust fungus Puccinia graminis f. sp. tritici
pathotype MCC
J. Nirmala1 , B. Steffenson2 and A. Kleinhofs1& 3*
1 Department of Crop and Soil Sciences Washington State University, Pullman, WA-99164-USA
2 Department of Plant Pathology, University of Minnesota, St Paul, MN 55108, USA
3 School of Molecular Biosciences, Washington State University, Pullman, WA 99164, USA
Disease resistance in plants, mediated by the gene-for-gene mechanism, involves the direct or
indirect recognition by the R-gene product of specific effector molecules produced by the pathogen.
This recognition triggers a series of signals regulating an elaborate series of defense mechanisms by
the plant. In order to understand the role of the recently cloned barley stem rust resistance gene
product RPG1 (Brueggeman et al. 2002) in resistance to the stem rust fungus Puccinia graminis f. sp.
tritici, we investigated the fate of the RPG1 protein in response to infection with the P. graminis f.
sp. tritici avirulent pathotype MCC. Different barley lines with varying levels of resistance were
challenged with the avirulent pathotype MCC and sampled at 0, 12, 16, 20, 24 and 36h postinfection.
The extracts were immuno-precipitated with an RPG1-specific antibody. The precipitate
was subjected to SDS-PAGE, and RPG1 was visualized by western blot analysis. Though the
endogenous transcript levels of Rpg1 remained unchanged upon infection with the avirulent
pathotype MCC (Rostoks et al. 2004), the RPG1 protein disappeared to undetectable levels 20-24h
post-infection. The disappearance of the RPG1 protein was localized to the infected tissue and did
not spread to the adjoining leaves. The RPG1 protein was shown to be stable in cyclohexamide
translation inhibited leaves for up to 48 hrs. These results suggest that the localized disappearance of
RPG1 protein is due to proteolysis, probably by the avr-gene product. Since the mere absence of the
RPG1 protein does not result in resistance, the degradation products or the process of degradation
may trigger the signaling resulting in resistance to the stem rust infection.
- 173 -
* andyk@wsu.edu Tel: 1-509-335-4389

Session 5: Biotechnology and Genomics – Poster abstracts
Saturation mapping of barley chromosome 2H Fusarium head blight
resistance QTL
Christina Maier 1 , Deric Schmierer 1 , Thomas Drader 1 , Richard Horsley 2 , and Andris Kleinhofs 1,3
1 Dept. of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420, USA
2 Dept. of Plant Sciences, North Dakota State University, Fargo, ND 58105-5051, USA
3 School of Molecular Biosciences, Washington State University, Pullman, WA 99164-4660, USA
Outbreaks of fusarium head blight (FHB), caused by Fusarium graminearum, within the past two
decades have caused large economic losses to farmers in North Dakota and northwestern Minnesota
due to the reduced quality of harvested barley by blighted kernels and significant levels of
deoxynivalenol (DON), a mycotoxin produced by the fungus. Field practices and chemical control
have had limited success, putting greater importance on a genetic approach for control. Two
quantitative trait loci (QTL) each for lower FHB severity and plant height, and one major QTL each
for DON accumulation and days to heading were mapped with recombinant inbred lines obtained
from a cross between CIho 4196, a two-rowed resistant cultivar, and Foster, a six-rowed susceptible
cultivar (Horsley et al., submitted). These loci reside in the barley chr. 2H region flanked by the
markers ABG306 and MWG882A (bins 8-10). In an attempt to saturate this region with markers, 29
rice chr. 4 BAC clones with synteny to this region were blasted against the barley expressed
sequence tag (EST) database. To date, 41 of the ESTs picked by this method have been mapped to
this region. Nine other genes, identified based on microarray analysis of the wheat-barley 2HL
addition line and comparison to Betzes and Chinese Spring controls (courtesy of Gary Muehlbauer),
were also mapped to this region on the Foster x CIho 4196 RFLP map. To date, there are a total of
26 unique loci and 67 markers in this major FHB QTL region on chr. 2. Eighteen markers have been
hybridized to the 6x cv. Morex barley BAC library, identifying 131 BAC clones as part of the
physical map of the region. Three cleaved amplified polymorphic sequences (CAPS) markers were
designed for the major FHB resistance QTL in this region, two flanking and one in the middle, to aid
in development of isolines containing fragments of this region from CIho 4196 in a Morex cultivar
background.
Christina Maier: cmaier@wsu.edu
- 174 -

Session 5: Biotechnology and Genomics – Poster abstracts
Map-based cloning efforts of the barley spot blotch resistance gene Rcs5
Thomas B Drader1 , Kara A Johnson2 , Robert S Brueggeman1 , Hye Ran Kim3 , Dave Kudrna3 , Rod Wing3 ,
Brian Steffeson4 , and Andris Kleinhofs1, 5
1 Crop and Soil Science, Washington State University, Pullman, WA 99164, USA
2 USDA, Washington State University, Pullman, WA 99164, USA
3 Plant Sciences Department University of Arizona, , Tucson, AZ 85721-0036, USA
4 Department of Plant Pathology, University of Minnesota, St. Paul, MN 55108-6030, USA
5 Molecular Biosciences, Washington State University, Pullman, WA 99164, USA
The Rcs5 gene confers seedling resistance to barley spot blotch, caused by the fungus Cochliobolus
sativus. Spot blotch is a common and economically important foliar disease of barley in the
Midwestern United States. Genetic mapping localized the resistance gene between the markers
MWG622 and KAJ154 on the short arm of chromosome 1(7H). A BAC clone physical contig was
constructed consisting of 4 clones, 053N3, 612G14, 452P9, and 808M17. Subclone shotgun libraries
of BAC clones 612G14 and 808M17 were constructed and sequenced by the Arizona Genomics
Institute. Sequence assembly resulted in 25 contigs ranging from 1kb to 28.5kb for 808M17 and 7
contigs ranging from 0.6kb to 63.7kb for 612G14. Analysis of the contigs' sequence by a gene
prediction program (FGENESH) with limits within monocot genomic DNA yielded 40 putative
genes, 22 with protein homology. Of the 22 protein hits, 19 had equivalent Triticeae EST's. The
BAC contig overlap between 612G14 and 452P9 as well as the overlap between 452P9 and 808M17
left an unsequenced gap of ~15kb. The BAC 452P9 38kb NotI subclone, TBD001, covers this region
and contains markers KAJ108B.2 and KAJ154, which flank a high recombination region with 11
crossovers and potentially the Rcs5 gene. The subclone TBD001 sequencing is in progress. Physical
and genetic mapping of predicted genes will delimit the region of interest. Putative candidate genes
will be sequenced from resistant and susceptible cultivars.
- 175 -
Corresponding author: tdrader@wsu.edu

Session 5: Biotechnology and Genomics – Poster abstracts
A gene tagging system for Hordeum vulgare
François Eudes 1* , André Laroche 1 , Michele Frick 1 , Jennifer Geddes 1 and Laurian Robert 2
Agriculture and Agri-Food Canada, 1 Lethbridge Research Centre, Lethbridge, Alberta T1J 4B1, Canada and 2 Eastern Cereal and
Oilseed Research Centre, Ottawa, Ontario K1A 0C6, Canada
An efficient system for production of knockout plants for functional analysis and gene tagging in
cereals would be a significant complement to current cereal genome analyses. Tos17, a rice
retrotransposon activated by tissue culture, has been successfully used for generation of knockout
plants in rice. More recently, it was reported that Tos17 insertions were predominately located
within coding sequences and thus provide a unique system to develop knockout plants at a relatively
high frequency. Retrotransposons have the advantage over other transposon systems of yielding
stable mutations and low copy numbers which facilitate the identification of genes. Using a novel
approach that enables the cultivar-independent regeneration of fertile monocots, transgenic barley T0
was efficiently obtained, and confirmed by southern blot. Results suggest that Tos17 is a very
efficient system to generate knockout plants in cereals. Under vegetative growth, the integrated rice
retrotransposon Tos 17 is inactive based on the absence of retrotransposase activity in barley leaves
and stems. Under tissue culture conditions, the retrotransposase activity was stimulated and readily
detected via a reverse transcription-PCR assay. A modification in the number of Tos17 copies in
barley genomic DNA (from callus tissues) was detected. We also regenerated fertile plants C0, from
4-5 months callus culture, with novel Tos17 insertion sites. Using real time PCR, we report an
increased copy number in C0 barley genome, and new phenotype in offspring C1. We will discuss the
advantages of this new system for development of knockout plants in cereals and possible impact for
genomic studies in barley.
*Corresponding author: eudesf@em.agr.ca
- 176 -

Session 5: Biotechnology and Genomics – Poster abstracts
Unraveling the mysteries of germination using SAGE (Serial Analysis of
Gene Expression)
Toni Pacey-Miller, Jessica White, Allison Crawford, Peter Bundock, Giovanni Cordeiro, Daniel Barbary and
Robert Henry
Grain Foods CRC, Ltd., Centre for Plant Conservation Genetics, Southern Cross University, Lismore Australia 2480
The processes involved in malting are still somewhat a mystery on a genetic level. SAGE (Serial
Analysis of Gene Expression) is a technique that allows rapid, detailed analysis of thousands of
transcripts in a cell. The process of SAGE relies on two principles. Firstly, a small sequence of
nucleotides from the transcript, called a “tag” can effectively identify the original transcript from
whence it came. Secondly, linking these tags allows rapid sequencing analysis of multiple transcripts.
By examining the transcripts expressed at any time in the cell it is possible to determine which genes
and their related proteins are being expressed at that moment in time. In this study the gene
expression profile of germinating (malting) barley is being examined at seven intervals over a time
course of 120 hours post steeping. This will be compared to a baseline of dry ungerminated seed. The
identification of genes for improved malting quality can be identified and examined using SAGE and
ultimately used for commercial improvement.
- 177 -
E-mail: tpacey@scu.edu.au

Shafeek Ali
Alberta Agriculture, Food & Rural Development
Farm and Rural Programs Branch
E-mail: shafeek.ali@gov.ab.ca
John Allen
FOSS
E-mail: jallen@fossnorthamerica.com
Jim Anderson
Agricore United / Proven Seed
E-mail: janderson2@agricoreunited.com
Anthony Anyia
Alberta Research Council
Environmental Technologies
E-mail: anyia@arc.ab.ca
Ed Armstrong
Alberta Barley Commission
E-mail: bettyed@telusplanet.net
Erin Armstrong
Brewing and Malting Barley Research Institute
E-mail: earmstrong@bmbri.ca
Monica Baga
University of Saskatchewan
Department of Plant Sciences
E-mail: monica.baga@usask.ca
Byung-Kee Baik
Washington State University
Dept. of Crop and Soil Sciences
E-mail: bbaik@wsu.edu
Darren Barber
Quality Assured Seeds
E-mail: dbarber@qas-online.com
Phil Bregitzer
U.S. Dept. of Agriculture, Agricultural Research
Service
National Small Grain Germplasm Research Facility
E-mail: pbregit@uidaho.edu
Participants
Participants
- 178 -
Wynse Brooks
Virginia Polytechnic and State University
Crop & Soil Environmental Sciences Dept.
E-mail: wybrooks@vt.edu
Peter Burnett
Canadian Grain Commissin
Grain Research Lab
E-mail: pburnett@grainscanada.gc.ca
Giselle Camm
University of Saskatchewan
E-mail: giselle.camm@usask.ca
Flavio Capettini
CIMMYT / ICARDA
Mexico
E-mail: f.capettini@cgiar.org
Bill Chapman
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: bill.chapman@gov.ab.ca
Ravindra Chibbar
University of Saskatchewan
Department of Plant Sciences
E-mail: ravi.chibbar@usask.ca
Dale Clark
Western Plant Breeders
E-mail: dclark@westbred.com
George Clayton
Agriculture & Agri-Food Canada
Lacombe Research Centre
E-mail: claytong@agr.gc.ca
Blake Cooper
Busch Agricultural Resources Inc.
E-mail: blake.cooper@anheuser-busch.com
Lynn Dahleen
USDA-ARS
Red River Valley Agricultural Res. Ctr.
E-mail: dahleenl@fargo.ars.usda.gov

Jim Downey
SeCan Association
E-mail: j.downey@sasktel.net
Peter Eckstein
University of Saskatchewan
Department of Plant Sciences
E-mail: peter.eckstein@usask.ca
Mike Edney
Canadian Grain Commission
E-mail: medney@grainscanada.gc.ca
Steven Edwardson
North Dakota Barley Council
E-mail: ndbarley@ndbarley.net
Charles Erickson
USDA - ARS
E-mail: nsgcce@ars-grin.gov
Patricia Fair
Rahr Malting Canada Ltd.
E-mail: pfair@rahr.com
Clif Foster
Alberta Barley Commission
E-mail: cfoster@albertabarley.com
Glen Fox
Queensland Dept. of Primary Industries and Fisheries
Australia
E-mail: glen.fox@dpi.qld.gov.au
Jennifer Geddes
Agriculture & Agri-Food Canada
and University of Lethbridge
E-mail: jennifer.geddes@uleth.ca
Blanca Gomez
Laboratorio Tecnologico del Uruguay
Uruguay
E-mail: bgomez@latu.org.uy
Mike Grenier
Canadian Wheat Board
E-mail: mike_grenier@cwb.ca
Participants
- 179 -
Tajinder Grewal
University of Saskatchewan
Dept. of Plant Sciences
E-mail: tajinder.grewal@usask.ca
Richard Groven
North Dakota Barley Council
E-mail: ndbarley@ndbarley.net
Russell Gwozdz
Rahr Malting Canada
E-mail: rgwozdz@rahr.com
Alan Hall
Alberta Agricultural Research Institute
E-mail: alan.hall@gov.ab.ca
Neil Harker
Agriculture & Agri-Food Canada
Lacombe Research Centre
E-mail: harkerk@agr.gc.ca
Scott Heisel
American Malting Barley Association
E-mail: sheisel@execpc.com
Jim Helm
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: james.helm@gov.ab.ca
Cynthia Henson
USDA, ARS, MWA, Cereal Crops Research Unit
Department of Agronomy, University of Wisconsin
E-mail: cahenson@wisc.edu
Andrea Hilderman
Canadian Wheat Board
E-mail: andrea.hilderman@cwb.ca
David Hoffman
USDA - ARS
E-mail: dhoffman@uidaho.edu
Lee Jackson
University of California
Dept. of Plant Sciences
E-mail: lfjackson@ucdavis.edu

Ian John
Rahr Malting Canada Ltd.
E-mail: ijohn@rahr.com
Ian Johnson
University of Alberta
E-mail: ijohnson@ualberta.ca
Berne Jones
E-mail: bhjones@bmi.net
Rich Joy
Rahr Malting Canada
E-mail: rjoy@rahr.com
Patricia Juskiw
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: patricia.juskiw@gov.ab.ca
Andris Kleinhofs
Washington State University
Dept. of Crop and Soil Sciences
E-mail: andyk@wsu.edu
Krishan Kumar
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: krishan.kumar@gov.ab.ca
Nora Lapitan
Colorado State University
E-mail: nlapitan@lamar.colostate.edu
Seonghee Lee
North Dakota State University
E-mail: seonghee.lee@ndsu.edu
Bill Legge
Agriculture & Agri-Food Canada
Brandon Research Centre
E-mail: blegge@agr.gc.ca
Yueshu Li
Canadian Malting Barley Technical Centre
E-mail: yli@cmbtc.com
Kavitha Madishetty
University of California Riverside
E-mail: kavithak@ucr.edu
Participants
- 180 -
Linda Malcolmson
Canadian International Grains Institute
E-mail: lmalcolmson@cigi.ca
Laurie Marinac
USDA-ARS
Cereal Crops Research Unit, Wisconsin
E-mail: lmarinac@wisc.edu
Douglas McBain
Western Barley Growers Association
E-mail: dmcbain@therockies.ca
Robert McCaig
Canadian Malting Barley Technical Centre
E-mail: rmccaig@cmbtc.com
Wayne McProud
Plant Breeders 1 Inc.
E-mail: PB1@moscow.com
Shipra Mittal
North Dakota State University
E-mail: mittals_2001@yahoo.com
Do Mornhinweg
USDA-ARS
Oklahoma
E-mail: do.mornhinweg@ars.usda.gov
Al Morris
Agricore United
E-mail: amorris@agricoreunited.com
Gary Muehlbauer
University of Minnesota
E-mail: muehl003@umn.edu
Stephen Neate
North Dakota State University
E-mail: stephen.neate@ndsu.edu
Jesper Nielsen
Alberta Barley Commission
E-mail: kryger@telusplanet.net

Joseph Nyachiro
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: joseph.Nyachiro@gov.ab.ca
Lori Oatway
Field Crop Development Centre
E-mail: lori.oatway@gov.ab.ca
Don Obert
USDA-ARS
E-mail: dobert@uidaho.edu
Brian Otto
Alberta Barley Commission
E-mail: botto@telusplanet.net
Toni Pacey-Miller
Centre for Plant Conservation Genetics
Southern Cross University, Australia
E-mail: tpacey@scu.edu.au
Anja Pekkarinen
Miller Brewing Co.
E-mail: pekkarinen.anja@mbco.com
Hong Qi
Centre for Agri-Industrial Technology
Processing Division, Alberta Agriculture, Food &
Rural Development
E-mail: hong.qi@gov.ab.ca
Blaine Recksiedler
Saskatchewan Agriculture and Food
E-mail: brecksiedler@agr.gov.sk.ca
Jeff Reid
SeCan Association
E-mail: jreid@secan.com
Brian Rossnagel
Crop Development Centre
University of Saskatchewan
E-mail: brian.rossnagel@usask.ca
Participants
- 181 -
Mark Schmitt
USDA-ARS
Cereal Crops Research Unit, Wisconsin
E-mail: markschmitt@wisc.edu
Linnea Skoglund
Busch Agricultural Resources, Inc.
E-mail: linnea.skoglund@anheuser-busch.com
Kevin Smith
University of Minnesota
E-mail: smith376@umn.edu
Yongliang Sun
North Dakota State University
E-mail: yongliang.sun@ndsu.edu
Robert Sutton
Rahr Malting Canada Ltd.
E-mail: bsutton@rahr.com
Andy Tekauz
Agriculture & Agri-Food Canada
Cereal Research Centre, Winnipeg
E-mail: atekauz@agr.gc.ca
Mario Therrien
Agriculture & Agri-Food Canada
Brandon Research Centre
E-mail: mtherrien@agr.gc.ca
Kelly Turkington
Agriculture & Agri-Food Canada
Lacombe Research Centre
E-mail: turkingtonk@agr.gc.ca
Steven Ullrich
Washington State University
Dept. of Crop and Soil Sciences
E-mail: ullrich@wsu.edu
Richard Ulmer
Anheuser-Busch Inc.
St. Louis
E-mail: richard.ulmer@anheuser-busch.com

Participants
Doug Voth Tom Zatorski
Crop Development Centre Crop Development Centre
University of Saskatchewan University of Saskatchewan
E-mail: doug.voth@usask.ca E-mail: zatorski@sask.usask.ca
Bruce Westlund Ruurd Zijlstra
Busch Agricultural Resources Inc. University of Alberta
E-mail: bruce.westlund@anheuser-busch.com Dept. of Agricultural, Food & Nutritional Sciences
E-mail: ruurd.zijlstra@ualberta.ca
Bob Wolfe
Field Crop Development Centre
(Retired)
Peter Woloshyn
Crop Diversification Division
Alberta Agriculture, Food & Rural Development
E-mail: peter.woloshyn@gov.ab.ca
John Wozniak
Alberta Barley Commission
E-mail: jwoz.lakag@mcsnet.ca
Les Wright
Busch Agricultural Resources Inc.
E-mail: les.wright@anheuser-busch.com
Kequan Xi
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: kequan.xi@gov.ab.ca
Rong-Cai Yang
Alberta Agriculture, Food & Rural Development
Policy Secretariat
E-mail: rongcai.yang@gov.ab.ca
Terry Young
Alberta Barley Commission
E-mail: tcyoung@yourlink.ca
Jennifer Zantinge
Field Crop Development Centre
Alberta Agriculture, Food & Rural Development
E-mail: jennifer.zantinge@gov.ab.ca
- 182 -