tiiiiJ - Memorial University of Newfoundland DAI

NPY. CART A D CCK IDENTIFICATION I WINTER FLOUNDER
(I'LEURONECfES AMERICANUS) A D WINTER SKATE (RAJA OCElliITA):
MOLECULAR CLO I G. TISSUE D1STRIBUTIO AND RESPO SE TO SEASO
A D FASTI G
S1. John's
by
Erin E. MacDonald
A thesis submitted 10 the
School ofGraduate Studies
in partial fulfillment orthe
requirements for the degree of
Master ofScience
Departlllent of Biology
Memorial University of Newfoundland
August 2008
ewfoundland and Labrador

Abstract
In fish, as in all vertebrates, feeding is regulated by complex interactions between
brain and peripheral honnonal signals. Brain signals include neuropeptide Y (NPY) and
cocaine·amphetamine·regulated transcript (CART). which induces and decreases food
intake. respectively. Cholecystokinin (CCK) is a peripheral honnone produced by the
intestine that inhibits appetite. The winter flounder, Plellronecles americallllS (Teleostei)
and the winter skate, Raja ocellata (Elasmobranchii) are two bouom·dwelling marine fish
species inhabiting the coasts of ewfoundland. Both species undergo seasonal cycles in
feeding and growth. Nothing is known about the structure or function of NPY. CART and
CCK in these species or about the role that these peptides might have in mediating
seasonal feeding patterns. In order to characterize PY. CART and CCK in winter
flounder and winter skate, I have identified cDNAs encoding these honnones in both
species using RT·PCR and rapid amplification ofcDNA ends (RACE). Tissue
distribution studies using RT-PCR show that all three peptides are expressed in brain and
peripheral tissues. including gut. Gene expression quantification using real-time RT·PCR
indicates that these peptides might be involved in nutritional and seasonal feeding
adaptations in these two species.

Acknowledgments
I would like to sincerely thank my supervisor Dr. Helene VolkofT for her endless words
ofencouragemcm, especially when (had trouble with my cloning. I'd like to thank my
lab mates Leah Hoskins and Meiyu Xu for answering my cndless questions. (thank my
supervisory committee Dr. Brian Staveley and Dr. Dawn Marshall for all their support
and Dr. Lang's lab for saving me hours ofquanti fication by letting me use their
anoDrop. This work would not havc been possible without funding from SERe and
Memorial University. Last but not least, many thanks to my parents who pretended to
know what I was talking about when ( called to complain that none of my PCRs were
working.
iii

Table of Contents
Abstract..
Acknowledgments..
List orTables..
List or Figures..
Introduction..
Materials and Methods..
Resuhs ...
Discussion .
Lilcrature Cited..
iv
...ii
. iii
. vi
. 7
. 28
. .43
... 81
......99

1--
List of Tables
Table 1
Table 2
Primers used in the cD A cloning. tissue distribution and qPCR analysis
in winter flounder (Plellronectes americanlls).. . ..33
Primers used in the eDNA cloning, tissue distribution and qPCR analysis
in winter skate (Raja ocellata).. .....36

Lisl of Figures
Figure I
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure II
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figurc 19
Figure 20
Figure 21
Figure 22
Figure 23
Figure 24
Figure 25
Predicted amino acid sequence for winter flounder PY ..
Predicted amino acid sequence for winter flounder CART..
Predicted amino acid sequence for winter flounder CCK ..
Predicted amino acid sequence for winter skate NPY .49
Predicted amino acid sequence for winter skate CART..
Predicted amino acid sequence for winter skate CCK ..
PY amino acid sequence alignment.. .
CART amino acid sequence alignment.. .................••••..
CCK amino acid sequence alignment..
Brain tissue distribution for winter flounder ....
Peripheral tissue distribution for winter flounder..
Brain tissue distribution for winter skate .................•....
....45
......46
.........47
.....50
..........51
. 55
............56
..........58
...60
........61
........63
Peripheral tissue distribution for winter skatc... . 64
Winter flounder food consumption.... . 66
NPY expression in winter flounder for winter experiment.. . 68
CART expression in winter flounder for winter experiment.. . 69
CCK expression in winter flounder for winter experiment 70
NPY expression in winter flounder for summer experiment... . 72
CART expression in winter flounder tor summer experiment.. . 73
CCK expression in winter flounder for summer experimcllt.. ..74
NPY expression in winter flounder lor both experiments 76
CART expression in winter flounder for both experimenls 77
CCK expression in winter flounder for both experiments.. . 78
PY expression in winter skate.. . 80
CCK expression in winter skate.... . 81
vi

Inlroduction
In vcrtebrates. as in all living organisms. there is a constanl struggle to achieve
homeostasis. Homeostasis occurs when (he intemal environment is maintained within
endurable limits. This is achieved through the dynamic equilibrium bet\\ccn the nervous
system and the endocrine system. Infonnation about changes that occur in the periphery
ofthe body is relayed via ant-rent signals (both nervous and endocrine) to the central
nervous system. The brain deciphcrs and interprets these peripheral messages and
initiates the appropriate response to maintain homeostasis. In fish. as in all vcrtebrates.
the brain region referred to as the hypothalamus links the nervous system to the endocrine
system. Termed the "master gland". the hypothalamus produces and secretes releasing
honnones that control the secretion ofother honnones from the pituitary gland. Together
these two glands control the animal's major metabolic processes.
In order for energy homeostasis to be established. an animal needs to balance its
energy intake with its energy output. Feeding satisfies energy intake and is rcgulated by
signals to the brain (VolkoIT2006). The balance between signals to the brain to increase
and decrease appetite is intimately controlled by a number of hypothalamic appetite
regulating hOnllOnes. including neuropeptide Y (NPY), orexin. cocainc-amphetamine­
regulated transcript (CART) and cholecystokinin (CCK). Orcxigenic factors. such as
NPY and orexin. stimulate appetite and anorcxigenic factors. such as CART and CCK.
suppress appetitc. Appetite regulation is controlled by a number ofcomplex interactions
between these neuropeptide systems. For example. PY and orcxin act synergistically to
cause an increase in food intake and. in tum they arc both regulated b) CART (Volkoflel

(11.2001). These central systems are also regulated by peripheral endocrine factors. CCK
produced by endocrine cells in the intestine and insulin produced by the pancreas are
peripheral hormones that inhibit food intake by acting in part on brain fceding centers
(VolkolTe, al. 2003).
The brain receives both hormonal (endocrine) and metabolic signals from the
periphery of tile body to initiate or to stop feeding (VolkoIT2006). These signals can
travel via the circulatory system, enter the brain and bind to central receptors or bind to
peripheral receptors and transmit their infonnation via the vagus nerve. The
hypothalamus processes these signals and releases its 0\\11 endocrine signals that travel to
other areas ofthe brain or body and elicit the appropriate response. Many of these
signals have been characterized using molecular cloning paired with gene expression
studies and by peptide injections follo\\cd by measurement of food intake and feeding
behaviour.
NPY was thc first orcxigenic neuropcptidc discovered ovcr 20 years ago. and is
considered the most potcnt orexigenic factor in vertebrates. including fish (Tatcmoto
1982). It has been extensively studied in mammals and characterized in a llumber of !ish
species. CCK and CART have only been discovered in recent years so lillIe infonllation
is known on the structure and function ofthese hOnllOnes.
Research on appetite regulating hormones in fish is important to cstablish a model
ofhormone function and intcractions in vertebrates: especially where so little is currently
kn0\\11 for sollle ofthe most recently discovcred hormones. Studying the neuroendocrine
regulation of food intake in fish will contribute to thc overall understanding of fceding

ehaviour in animals. Structural comparison of honnones and honnone receptors can
provide infonnation on how these structures evohed in fish and mammals. A fish model
may be developed and used to explain human health problems relatcd to the
dysregulation of homeostasis like diabetes and obesity. Fish represent good experimental
model for this type ofstudy because thcy have various important advantagcs over
mammals. They display a wide range of feeding behaviours, diets, and reeding
adaptations making them good candidates to study the evolution of appetitc rcgulating
systems. Fish arc also easier to maintain and submit to repeated sampling without
affecting behaviour or feeding. Infonnation on appetite regulating mechanisms in fish
should provide insights on how to manage thc fceding and growth of fish for the
aquaculture industry.
Studying appetile regulating hormones and feeding
Feeding is a complex behaviour rcgulatcd by a number of factors. TI1Cse include
for example. how thc animal obtains its food. modes of feeding and food dctection and
frequency of fecding (Volkorf el aJ. 2006). In !ish, the study of fceding behavior is a
complex topic since fceding can be altered by environmental conditions. physiological
conditions and genetics. Environmental conditions include photoperiod. temperature.
water salinity and rcaring conditions. For example. some fish species fced Icss in colder
temperatures. or stop fceding altogether in the \\intcr. Some fish specics in captivity
have increased food intake compared to those in thc \\ ild and a longer photoperiod can

cause an increase in food imake (Imsland el al. 200 I). Clearly. there are many factors to
consider \\hen studying appetite regulation.
Infomlation on the neural control offeeding has recently become more available
in fish. Early studies used either electrical stimulation ofthe brain. or brain lesions. In
rodents. lesions in the ventromedial hypothalamus (VMII) increased food intake and
appetite. whereas lesions in the lateral hypothalamic area (L1-IA) decreased food intake
(Horvath et al. 1999). Lesions between the VMI-I and the L1-IA or other brain regions
caused an increase in feeding but not to the same extent as complete VMH lesions
(Tokunaga el 01. 1986). The results ofthese studies finnly support the idea that appetite
is regulated by different areas ofthe brain. In both teleost and elasmobranch fish.
stimulation ofeither the inferior lobes ofthe hypothalamus or the telencephalon has been
shown to induce feeding (Demski el al. \97\: Demski \973: Roberts el al. 1978). These
early studies using electrical brain stimulation and brain lesions have been followed by
more recent studies focused on thc molecular and functional characterization of
ncuropcptides produced by feeding centers within the brain.
Ncurohormones and the hypothalamus
Specific regions can be distinguished within the vertebnltc hypothalamus
(Williams el 01.2001). The arcuate nucleus (ARC). which occupies roughly halfofthe
hypothalamus. displays two distinct but interacting neuron populations: thc ncuropeptide
Y and agouti gene-related protein tpY/AGRP) neurons and the pro-opiomclanocortin
and cocaine-and-amphetaminc·regulatcd transcript (POMe/CART) neurons. PYand
10

AgRP are both appetite stimulating honnones "hereas CART and IlOMe are both
appetite suppressing honnones. The ARC has elaborate connections with other
hypothalamic areas such as the paravcntricular nucleus (PVN). the dorsomedial
hypothalamic nucleus (DMH). the ventromedial hypothalamic nucleus (VHN) and the
lateral hypothalamus (lH). The ARC is one area ofse\en areas ofthe brain that lack the
blood brain barrier. Therefore it is accessed by peripheral hormonal signals from the
body. such as leptin. insulin and glucose.
The PVN is stimulated by neuronal axons projecting from the NPY/AGRP and
POMe/CART ARC nucleus regions (Williams et al. 2001). The VMH is one ofthe
largest hypothalamic nuclei and functions as the appetite inhibiting center. leptin
receptors have been found in abundance in this area. so blood·circulating leptin may be a
good target for this brain area.
Physiologically, appetite is regulated by honnone levels in the blood and neural
inputs that converge or\ the brain. These stimuli are processed by the bmin. and the brain
responds by secreting orexigenic or anorexigenic regulatory hormones. By studying
appetite regulating I>cptides. the mechanisms that regulate homeostasis can be better
understood.
Ncuropcptidc Y
Neuropeptide Y is a member of the peptide family that also includes pancreatic
polypeptide and peptide YV. Each of these peptides has a specific amino acid sequence
that allows it to lake the necessary funclionalthree·dimensional structure called the
II

Ictalllrtls P"l1ctalllS (GcnBank accession number AF267164). dogfish. ScyJiorhifllls
Clmicliia (Conlon el al. 1992). ray. Torpedo marmomlO (Blomqvist elal. 1992) and
lamprcys (Pelromy::ol1 marinlls.lcrhyomy::ol1 gaged) (Montpetit et al. 2005). NPY
shows good conservation among species. Both the human and lo\\cr vertcbrate NPY
gene is locatcd next to the homeobox (hox) gene cluster A (copy A in zebrafish)
(Soderberg et al. 2000). The Hox clusters have been inherited nearly intact for 400
million ycars. By mapping PY gene beside the homobox gene suppons thc theory that
they arose from a common ancestral gene.
PV is a ligand for the G-protein coupled PV-family receptors that consist of
VI. Y2. V4. VS and V6 (Volkoff2006). The VI subfamily is the main subfamily and
includes the VI, Y4. and V6 receptor subtypes. Ofthe 5 identified receptors. YI and VS
appear to be the most biologically important because they regulate the orexigenic effects
ofthc NPY family ofpcptides in mammals.
NI)V receptors have becn identified in fish. and thc majority of them appear to be
mcmbers of the YI family receptors. Three different NPY receptors havc been identified
in zcbmlish. (Danio rerio). which were namcd zYa. zVb and zYe (Arvidsson el (/1.
1998). The Yb was cloned from Atlantic cod and rainbow trOllt (Arvidsson el al. 1998).
Recently. Y2 and Y7 have also been cloned from rainbow trout (Larsson elal. 2006).
The Y4 subtype was cloned in river lamprey (Lampelrajlllviarilis) (Salaneck el (II. 2001).
and YI. V4 and V6 were all identified in the spiny doglish (Sqllallls acmllhias) (Salaneck
er al. 2003). Receptors VS and V6 wcre identified in two coclacanth species. Larimeria
c!laill/mUle and Lalimeria mel1adot!lISis. \\hich are lobed finned fish (Larsson elal. 2007).
13

The presence of theY receptors in the lobed finned fish indicates that there is an early
vcrtcbrate origin for thc NPY receptors. At the same time. thc divcrsity of receptors
found among species indicates there may have been somc difTerentialloss ofgenes in
each \crtebrate class. If receptors are found evolutionarily before and after a particular
species. this species must have undergone its own loss of that receptor encoding gene.
Several studies provide evidence that 11)'1' action is regulated through theY
receptor family. In rodents. NPY injections increase food intake \\hereas treatmcnt with
NPY '1'5 antagonists decreases fceding (Vokosuka el al. 2001). In rodents. ARC PY
mRNA cxpression has been shown to decrease after starvation (Davies et al. 199"'). Rats
deprived of food for a 48 hour period and then fed display a drastic increase in NPV
expression in the hypothalamus especially in thc PVN and to an even grealer extent in the
ARC nucleus (Beck el 01. 1990). In regularly fed rats. when antisense NPV R A is
expressed in the brain there is an overall decrease in fceding and weight gain (Gardincr el
ai, 2005). Similarily Akabayashi and colleagues (Akabayashi ef al. 1994) found that
antisense oligodeoxynllcleotides (DONs) injected in rat bmins resulted in a decrease in
feeding behaviour compared to untreated rats (AkabaYllshi ef al. 1994). NPV must have
a role in apl>ctite regulation.
VI receptor-deficient rats have no major abnormalities in body weight or feeding
early in their lives. But they do display obesity when they arc older. suggesting that the
'1'1 receptor might not be the only receptor controlling food intake (Kushi el al. 1998).
Schamlauscr and colleagues (Schaflhauser el al. 1997) injected '1'5 antagonists or '1'5
antisense DDNs into rats which blocked the PY·induced feeding. suggesting an
14

importam rolc for Y5 in feeding reguhllion. Futhcrmore. an PY analog specifically
dcsigned to bind to Y5 caused an incrcase in food uptake (Hwa eI al. 1999). The Y
family receptors have shown roles in the regulation of feeding yet the exact function of
each receptor is not well defined.
NPY appears to be an orcxigenic factor in fish. Intracerebroventricular (ICY)
injections in channel catfish (lctal/lr/ls pl/ncta/us) (Silverstein er at. 200 I) and goldfish
(Lopez-Patino ef al. 1999) cause an increase in food intake. In addition, ICV injections
of NPY antagonist in starved goldfish decrease fecding (Lopez-Patino cia!. 1999).
Studies that use ICV injections ofNPY are a good indication that NI)Y is orexigenic.
In pacific salmon. OncorhYllclIs sp.. fasted fish display higher PY mR A
expression Icvcls in the brain than fed fish (Silverstein ef 01. 1998). ot only does lack
of food increase NPY expression, but low nutrient diets also cause an increase in NPY
expression in the brain ofgoldfish (Namaware et al. 2002). In goldfish. evidence
suggests that NPY exerts its orexigenic actions through YI and Y5 receptors because
central injections of Y I or Y5 agonists calise dose-dependent feeding (Namaware et al.
2001). When fish wcrc givcn ICV injections of both agonisls together. they displayed a
synergistic elTect and feeding rate increased to higher than the levels reached by one
agonist injection alone (Namaware ef al. 2001). NPY might have other physiological
roles in fish. In dogfish a YI agonist elicited a response in vasoconstriction ovcr the Y2
receptor (Bjenning et al. 1993). Desensitizing one receptor did nol inOuence the reaction
from the olher. It is unclear precisely \\hich receplors regulate feeding in fish due to
evidence in recent experiments that many Y receptors are missing from leleosts.
15

IPY appears to interact with other appetite regulating homlOnes including orexin.
CART. leptin. and insulin. In rats. injections of a PY Y5 receptor antagonist fifteen
minutes before injecting orexin A into the brain significantly decrease orexin-induced
feeding. suggesting that NPY mediates the orexigenic actions oforexins (Dube el a/.
2000). Similar interactions have been demonstrated in fish. as co-injections ofNPY and
orexin A into goldfish brain cause an incrcase in feeding higher than that induccd by
either peptide alone, suggesting a synergy between the two pcptidcs (Volkoff el al. 2001).
In addition. treatment with a NPY receptor antagonist caused an inhibition of orexin­
induced feeding and blockade oforexin receptors results in an inhibition ofNPY induced
feeding (Volkoffel al. 2001). suggesting a close interaction between the two systems
When co-injected with PY and orcxin A or PY and leptin. goldfish have a
lower feeding ratc than that of fish injected with either orexin A or I)Y alone (Volkofr
el al. 2003). In mammals. Icptin receptors have txe-en identitied in the ARC nucleus
(Elias el al. 1999). suggesting that leptin closely regulates NPY synthesis and release.
Indeed. mice with mutated leptin receptors arc obese and have elevated NPY levels
(Korner e/ al. 2001). NPY and insulin seem to have a similar dynamic as k:ptin and
NPY. Insulin. injections into the brain orrats cause a decrease in the secretion of NPY
(Sahu el al. 1995). These interactions among dilTerent appetitc peptides demonstrate the
complexity of the physiological systems surrounding fCt.--ding.
16

Coclline-and amphetamine-regulated transcript
Cocaine-and amphetamine·regulated transcript (CART) \\as first discovered in
rats (Douglass el al. 1995) as the transcript ofa brain mRNA up-regulated following
administration oftwo stimulants. cocaine and amphetamine (Douglass el al. 1995).
CART has been shown to be involved in a number ofphysiological processes such as
appetite regulation. endocrine functions and the stress response (Volkoff2006).
To date. CART has bt..--en cloned from mammals (Douglass el al. 1995: Douglass
el al. 1996: Adams et al. 1999). amphibians (Lazar el al. 2()().t) and fish. including
goldfish (Volkoffet al. 2(01). zebrafish (GenBank accession number BQ-I80503).
spotted green pufferfish, (Tetraodonjltn';atjfis). (GenBank accession number
CR688746). Japanese pufferfish (Fugu genome project. gene SINFRUTOOOOOI29073)
and Atlantic cod (Kehoe el al. 2007). CART was mapped to chromosome 5 in humans
and to chromosome 13 in the mouse (Adams el al. 1999). The CART gene is composed
of three exons and two introns (Douglass el al. 1996). The mammalian prcpro-CART
mRNA can be cleaved to produce two forms orCART (Kuhar el a/. 2002). CART
mRNA is further cleaved into several biologically active forms. including CART (42-89)
and CART (55-102). which are tissue specific (Thim el al. 1999). In goldfish. two
dinerent genes express two different CART isoforms (Volkoff el al. 2001): there is a
70% amino acid identity between the two preproCART forms and 76% identity between
the two mature peptides. When examining CART in a new system its imponant to keep
in mind thai there can be different rOnTIS coded by diflerenl genes. or due to diflerent
splicing.
17

CART mRNA is expressed in a number of regions of the ccntral nervous system
including the hypothalamus. Within the hypothalamus. CART mRNA is expressed in
many fecding areas including the PV . the L1-IA and the ARC. The lalter region displays
thc highest CART expression Icvels and co-localization of CART \\ ith POMC neurons
(Uroberger eill/. 1999: Elias el a/. 1999: Vrang eill/. 1999: Larsen el a/. 2003).
suggesting a role for CART in feeding regulation. Ifthe ARC nucleus is disrupted. there
is a decrease in the immunoreactivity of CART peptidcs suggesting CART peplides
originate in the ARC (Broberger et a/. 1999). In mammals. in addition to the central
nervous system. CART mR A and peptides have been identificd in a number of
pcripheraltissues such as the gastrointestinaltTact (Ekblad eill/. 2003). CART peptides
have been identified in the blood ofrats and monkeys. with CART (55·102) as the
predominant fOOll (Vicentie el a/. 2004). In fish. CART mR A is expressed in brain and
peripheral tissues including gonads and kidney (VolkofT eill/. 2001: Kehoe eill/. 2007).
CART immunoreactivity has also been detected throughout brain and pituitary ofcatfish
(Singru elal. 2007) and in the venom gland ofniquim. (TlUI/as.mphr)'ne nauereri).
(Magalhacs (:'r a/. 2006). The location of CART mRNA has been documented throughout
the body of mammals and fish. yet to date. no CART receptors have been identified in
either mammals or fish.
CART has been shown to be an anorexigenic peptide. In rodents.
intracerebroventricular (ICV) injections ofeither CART (42-89) or CART (55-102) dose·
dependently inhibited food intake for three hours (Vrang el a/. 1999: Zheng el a/. 2001).
PVN-injccted CART (55-1 02) also decreased feeding in rats up to four hours after
18

injection (Wang el al. 2000). Okumura and colleagues (Okumura ef al. 2000) showed
that injections ofCART (55-102) peptide into the cerebrospinal fluid of rats food
deprived for 24 hours not only inhibited food intake but also suppressed gastric acid
secretion and gastric emptying (Okumura el al. 2000). suggesting multiple targets for the
CART peptide. CART knockout mice display higher feeding rates than wild type mice
(Asnicar ef al. 2001). CART has been shown to potentially eITect the function ofthe
antcrior pituitaI)' (Larsen I!I al. 2003). CART peptides produced in E. coli proved
effective at decreasing food intake when injected into rat brains (Couceyro el al. 2003).
When CART is expressed in yeast. several cleaved fomls ofCART are produced and
many of these cause decreased feeding \\hen administered in the brain ofrats. \\ ith
CART (55-1 02) having greater effect than CART (62-76). Fasting causes a decrease in
CART mRNA in goldfish (Vo1koff el al. 200 I) and cod (Kehoe et al. 2007) compared to
fed animals.
CART peptides have been shown to interact with other appetite-regulating
pcptides. Anatomical studies show that CART immunoreactivity is co-localized with
NPY immunoreactive nerve terminals inlhe ARC nucleus and Ihe amygdala (Broberger
el al. 1999). In rodents. ICV or PVN injection of CART blocks NPY-induced fccding.
suggesting that CART interacts with the NPY system and that CART may have a
dominant role over NPY when both peptides are present (Lambert el al. 1998: Wang et
al. 2000). CART is affected by circulating honnone levels in rodents. Lcptin. whose
plasma level is kept proportional to the body fat. enters the brain and binds to leptin
receptors in the ARC nucleus (Elias el al. 1999) therefore aCli\ating the POMC/CART
19

nucleus and causing a decrease in food intake (Kristcnsen 1.'1 01. 1998). In fish. CART
interacls with other pcptides. In goldfish. ICV injection of CART blocks nOI only PY·
induced fceding (VolkofT el 01.2000). but the orexigenic actions oforexin A (VolkofT el
01.2001). Leptin injections have been shown to decrease food intake in goldfish by
increasing CART mRNA expression in the brain (VolkofT el 01. 2001). The complex
inlcractions CART has with other peptides makes it difficult 10 siudy ils precise role in
appetite regulation.
Cholecystokinin
CCK is a linear peptide that is synthesized as a preprohonnone which is later
proteolytically cleaved to produce a family ofpeptides that share Ihe carboxy·temlinal
cnds. Pro-CCK cleavage into smaller pcptides is strictly regulated and is tissue specific
(Vishnuvardhan el al. 2002). In some species. there are several biologically active fonns.
but CCK·8 is the most abundant fonn in mammals (Moran el al. 2004). Pro-CCK has
three sulphated tyrosine residues which arc important for the intcraction ofCCK with its
receptors (Beinfeld 2003). Studies have shown that the amount of CCK excretcd by a
cell can be decreased by changing which residue is sulphated. Thc change in sulphation
"HlSCS a decrease in CCK expression which dcmonstrates the importance of the peptide­
specific sulphated residue (Vishnuvardhan 1.'1 01. 2000). The post translational
modificalions on CCK are vilal to the function ofCeK.
CCKfgastrin.like immunoreaclivity has been shown in Ihe nervous system and gut
ofscvcral fish species including Atlanlic cod (Jonsson 1.'1 al. 1987). starry ray_ (Raja
20

adiale). and spiny doglish. (Sqllaillj' acamhia.\·). (Jonsson 1991). bowlin. (A mica cairo).
and bluegill. (Lepomis macrochirus). (Rajjo ef al. 1988). rainbow trout (Barrcncchea el
al. 199-1.). goldfish (Himick el al. 1994). herring (Kamisaka ('I al. 2005). turbot
(Bermudez el al. 2(07) brO\\l1 trout (Bosi el al. 2004) and halibut. (/-liPjJog/osslIs
hippoglosslIs). (Kamisaka el al. 2(01). mRNA sequenccs havc also been detcrmined for
a number of fish species including goldfish (Peyon elal. 1998). rainbow trout (Jensen el
al. 200 I). dogfish (Johnsen el al. 1997). catfish (GcnBank acccssion number BE574232).
ycllO\\1ail. (Serio/a qlli"qlleradiala). (Murashita el al. 2006). puffcrfish (Kurokawa elal.
2003) and Japanese nounder. (Paralichlhys olimcells). (Kurokuwa el al. 2003). Various
forms ofCCK. including CCK-8. are present in fish. In fish. the struclure ofCCK-8
displays spccies·spccifie variation. differing at the amino acid on the sixth residue from
thc C·tcrminus. Atlantic hcrring (Kamisaka £'1 al. 2005) havc a mcthioninc: goldfish
(Pcyon el al. 1998) and Japanesc noundcr (Kurokawa el al. 2003) have a leucine:
rainbow trout (Jcnscn el al. 2001) have either a leucine. asparagine or a threonine and
spoiled rivcr puffer (Kurokawa el al. 2003) havc either a lcucinc or valinc. CCK appears
to have slightly different sequences depending on the species.
CCK, and the related peptidc gastrin. bind to two different receptors; CCK·A
(CCK-I), mainly located in the gastrointestinal tract. and CCK·B (CCK-2) localized to
Ihe brain (Moran el al. 2004). Research performed on Otsuka Long-Evans Tokushima
fatty (OLETIF) Tats has shown Ihal they have a hereditaf)' deficiency in CCK·A receplors
which leads thcm to become obese and hyperphagic (Ka\\allo el al. 1992: Moran el al.
21

1998). These results suggest that lack ofCCK-A receptor results in a satiety deficit
causing the rats to consume larger quantities or rood.
There appears to be only one type orCCK cell receptor in fish (Himick eta/.
1996). CCK binding sites have been round in the brain and gastrointestinal tract of
diflcrent fish species such as goldfish (Himick ef a/. 1996). sea bass (Moons ela/. 1992).
and shark, (/slIrtls o.\),r;ncJllIs). (Oliver ef aJ. 1996). The presence ofonly one receptor in
the more basal vcrtebrates. elasmobranches and tc1eosts. suggests that CCK·A and CCK­
B ofmamals arose later through evolution.
Whilc cholecystokinin (CCK) in vertebrates is primarily secreted from the
endocrine cclls in the small intestine, it is also synthesized in the brain. CCK has a key
rolc in the recdb..1.ck control ofgastrointestinal function such as short tcnn inhibition of
gastric cmptying. acid secretion. stimulation of pancreas. stimulation of the gallbladder
and inhibition of food intake (Moran ela/. 2004). Thus CCK plays a major rolc in the
managcmcnt or food entry into the small intcstinc and in nutrient absorption. CCK can
act as a short-tcrm inhibitor of food intake because it slows the movement or food
through thc digcstivc tract.
In lish. as in mammals. CCK innucnccs digestion and appetitc. In tclcosts, food
cntering the small intcstine causes the release ofCCK. which in turn induce contractions
ofthe gall bladder (Aidman eta/. 1995). This clTce! ean be mimicked by intra-arterial
CCK injections (Aidman eta/. 1995). In salmon. vaseular injections ofCCK cause a
decrease in gastric emptying (Olsson ef a/. 1999) and an increase in gutl1lotility (Forgan
t!f a/. 2007). CCK also innucnces appetitc regulation in fish. In goldfish. both central
22

and peripheral injections of CCK eause a dccrease in food intake (Himick el al. 1994:
Volkolfel al. 2003). Oral administration ofCCK in a gelatin capsulc causes a decrease
in food intake in sea bass (Rubio el al. 2008). Whereas oral administration of a CCK
antagonist causes an increase in food consumption in both trout and sea bass (Gelineau el
al. 2001: Rubio el al. 2008). Peyon and colleagues sho\\ed an increase ofCCK mRNA
Icvels in brain regions such as the hypothalamus and telcncephalon two hours after
feeding (Peyon el al. 1999). A similar time dependcnt increase was shO\\11 in yello\\1ail
\\here CCK mRNA levels increased in the pyloric caeca reaching a maximum level
bet\\een onc and a halfto three hours aftcr feeding (Murashita el al. 2007).
CCK has been shown to interact with Icptin. I)V and orexin in fish. Goldfish
co-injected \\ ith leplin and CCK at doses inefTectivc by thcmselvcs show a decreased
food intakc. suggcsting a synergistic action ofleptin and CCK (VolkofT el al. 2003). In
goldfish. CCK mR A expression in the brain increases following central injcction of
leptin and blockade ofeCK brain receptors inhibits leptin-induced decrease in food
il1wke. suggesting that the actions ofleptin are in part mediated by CCK (VolkofT el ai,
2003). CCK appears to act with other anorexigenic pcptides to decrease lood intake.
Winler flounder (Pleuyollectes americllIIlls)
Winter tlounder (Plellrollecles americmJIIs) is a right-handed tlatfish in the family
Pleural/cclidat!. Winter flounder are botlom-d\\elling fish that spawn in latc \\inter or
early spring in shallow waters. Their eggs are unique because the)' sink to the bottom of
thc watcr and rcmain stuck in clusters (SCOIt cillf. 1988). Larvac arc bom \\ ith a laterally
23

compressed body with one eye on each side of their head. They undergo metamorphosis
around three months after hatching when their body becomes flattened and their left eye
migrates to the right side of their heads (de Montgolfier ef al. 2005). The len side of their
body remains ncar the ocean floor and is usually white, while the right sides colour varies
depending on Ihe colour of the sediment on which they lie. Mature flounder are typically
18 inches in length and two pounds in weight (Litvak 1999: Mercier el al. 2004).
Winter flounder is a euryhaline species and survives in a wide range ofsalinities and is
eurythennic and survives in below O°C water (de Montgolfier el al. 2005).
Winter flounder undergo an onshore offshore movement throughout the year.
depending on their geographic location (Hanson ef al. 1996). OfT the coast of
Newfoundland, they tend to move inshore during the winter and offshore during the
summer. This movement is opposite to that seen in other areas of the world and is
thought to be due mainly to the presence ofantifreeze proteins in the winter flounder
surrounding Newfoundland areas (Gauthier ef (I/. 2005). Antifreeze proteins have been
isolated in winter flounder which help them survive the cold waters (Litvak 1999:
Fredette ef al. 2000; Murray el af. 2002).
Winter flounder is becoming increasingly attractive to consumers and to the
aquaculture industry. In various parts of the world. especially Korea. winter flounder has
bcen gaining popularity lor commercial fisherics due to its high quality meat. il can
wilhstand various salinities and survive allow temperatures (Mercier ef (II. 2004: Cllo
2005). In recent years, increased winter flounder research has been eonductcd in an
attempt to learn how 10 optimize living conditions for commercial usc (de Monlgollicr ef
24

01. 2005). To date. studies on winter 110under research have consequently focused on life
cycle. feeding strategies and juvenile rearing methods.
Winter 110under are well adapted to harsh and changing environments which
makes the species a good candidate as a cold watcr aquaculture species (Plantc el 0/.
2003: de Montgolfier el al. 2005). In addition, winter 110under do not suITer from chronic
stress when in captivity (Plante et 0/. 2003). which pcnnits rapid growth and prevents
unnecessary and premature dcath. In ordcr 10 encctivcly utilizc wintcr !lounder in
aquacuhurc. the establishment ofa successful feeding regime is crucial. An
understanding ofthe regulation of feeding and the development ofcost cnccti\'c diets is
essential for the dcvelopment ofa successful aquaculture not only for maintaining adults
but also for larval gro\\lh and metamorphosis (Ben Khemis et 01.2003: Ilebb el (II. 2003:
Cho 2005: de Montgolfier el 01. 2005). To date. very few studies have examincd the
appetite-controlling mechanisms in this species and the appetite regulating
neurohonnones have ncver been examincd in the winter 110under.
Winter nOllnder presents an additional challenge for aquaculture as these lish
enter a dormant-like stnte during the colder winter months. when feeding and activity are
minimal. Winter flounder spend twice as much time actively swimming at 4.4°C
compared to thc time spent at _1.2°C (He 2003). They decrease feeding in colder
temperatures (Mancil el (II. 1994: Stoner el 01. 1999: Meise el al. 2003). resulting in
weight loss. Intcrestingly. winter 110under spawn immcdiately following \\inter (Scott el
al. 1988). \\hich seems surprising as starvation and weight loss might induce a state of
negativc energy balance that would be detrimcntal to the energetically-demanding
25

activity ofreproduction. The physiological and endocrine mechanisms regulating this
inactive state are to date unknown. Understanding the regulation of this )'early feeding
panem is crucial for the development ofa successful )'eaHound aquaculture.
Winter skate (R"j" ocell,,''')
The winter skate is an oviparous elaslllobranch benthic species from thc family
Rajidae thai can live up to depths of371 m. but prefcr dcpths of 36.6 to 90m (Scott ef al.
1988). Adults have a dcpressed bod)' with a long slender tail and usually grow to a
length 01'30 inches. The winter skate's range extends from the GulfofSt. Lawrcnce to
the south coast of Newfoundland and 10 Ihe SCOlian Shelfand Bay of Fundy (SCOll ef at.
1988). Mating usually occurs in lale winter or spring. Skates la)' eggs in tough cases
which are oftcn referred to as mermaid's purses due to their rectangular shape \\ ilh IWO
hooks coming out from each end. Skales playa role in regulating the trophodynamics of
Weslern Atlantic ecosystems because the)' pre)' largely on the benthic fauna (Scali ef al.
1988).
Until recently. skates have not been the object of a specific fishery. Ilowcver.
large numbers of skates are accidentally caught every year by fisheries using otter trawls,
traps and weirs and these by·catches have led to a decline in skate populations (SCOIt el
al. 1988). Skates have recentl), become the objcct ofspecific fisheries as their mild·
tasting. low in cholesterol meat is sought by consumers (Frisk ef at. 2006). In the past.
winter skate has reccivcd little anention from the scientific community. although they
have been used in biochemical and physiology experiments. Past research on skates has
26

mostly focused on osmoregulation. as thcy are well-adaptcd to cxposure to different
salinities (Sulikowski el al. 2()()4: Treberg el al. 2006). Given the recent interest in these
fish. it is crucial that we gain a better understanding of their life cycle and physiology. in
particular feeding physiology. in order to develop sustainable fisheries and possibly
aquaculture. Currently. there is no infonllation on appetite regulating honnones in winter
skatc.
Objective of Ihis study
Our understanding of the regulation ofappetite in fish is limited as thc majority of
such studies have been pcrfonned on mammals. Fish provide valuable experimental
models for the study of feeding regulation for a number ofreasons. Fish species display
seasonal feeding behaviours which are influenced by water temperature and photoperiod.
This makes them ideal models with which to study the evolution ofappetite regulating
systems. Fish are usually easier to maintain in laboratory settings which facilitates
repeated sampling. Fish are also greal models because they are realistic surrogates for
mammals and humans. Wintcr flounder and winter skates were chosen because they are
both benthic species which allowed us to compare appetite regulation between the two.
As well. wintcr flounder in particular was chosen because it displays seasonal variation in
feeding patterns \\hich could be linked to the regulation ofappetitc honnones.
The goals ofthis study have been to characterize at the molecular level the
appetite·regulating honnoncs NPY. CART and CCK in two species of fish. the winter
flounder and wintcr skatc. The cD A sequences for each honnone \\ere detcnnined
27

using RT-PCR and RACE and then central and peripheral tissue mRNA distributions
were established for each ofthese honnones. The efrects ofstarvation on gene
expression ofbrain NPY and CART and gut CCK \\ere assessed using realtime
quantitative peR. In order to assess the influence ofseason on the feeding physiology of
flounder. gene expression ofthe winter flounder genes \\erc examined under both
summer and winter seasons.
28

M:llcri:lls lInd MClhods
Animals
Wild \\ inter flounder (Pleurollecles americcIIJlis) and \\ inter skates (Raja ocel/aw)
were collected by divers ofT the shore ofSt. John·s. a city in the province of
Newfoundland and Labrador. and kept in flow through tanks (2x2m tanks for flounder
and -Ix4m tanks for skates) at the Ocean Sciences Centre (Memorial University of
Ne\\ foundland. SI. John·s. L. Canada). Fish \\cre kept under natural photoperiod and
temperature conditions (see below). Fish consisted of both males and females and were
fed frozcn herring twice a week at the same time ofthe day (10:00 NST). Prior to the
starvation experiments. three to four acclimated fed fish \\ere sampled for cloning
purposes (see below). During all samplings. the \\eights of fish were measured. The sex
and sexual maturity was noted for all fish.
£rperimemal Protocol
Flounder-wimer experime11l
Sixty flounder (averagc wcight of 355.7g) were divided into four tanks (15 fish
per tank). and acclimated lor two weeks in flow through water tanks at an average
tcmperature ofOQC. The experiment was conductcd from the 21 s1 of March 2007. to the
2 nd of May. 2007. The fish were fcd as described above. Once acclimated. two tanks
werc food deprived for six weeks and two tanks continued to be ICd at the above­
described conditions. Five flounder were sampled from each tank two. four and six
weeks alier the start ofthe experiment (for a total 01'20 animals per sampling).
29

Flounder-slimmer experiment
Thirty-six flounder (average weight of446.9g) wcrc divided among four tanks
(eight fish per tank). The experiment ran from the Iil of August 2007. to the 29 th of
August 2007. The average water temperature was 11.9°C. As fish arc morc active than
in the winter. they were fed three times a week as contrasted to "\ice for the winter
experiment. Once acclimated. two tanks wcre food deprived for four \\ccks and two
tanks \\erc continued to be fed as above. Two to fivc nounder were sampled from each
tank two and four weeks after the start ofthe experiment. for a total of24 animals.
Skate-Slimmer experiment
T\\enty skates (average weight of 1.86kg) were divided into four tanks and
acclimated for two weeks in now through water tanks al an average tcmperature of
11.4°C. The experiment ran from the 19 th of September 2007 to the )nl ofOctober 2007.
Skates were fed chopped frozen herring three times a week to satiety at the S

tricainc mcthancsulfonate (Syndel Laboratorics. Vancouvcr. British Columbia. Canada)
and killcd by spinal section. Tissues were dissected and immediatcly placcd on ice in
R Alaler (Qiagen Inc.. Mississauga. Ontario. Canada) and stored at _20°C until R A
cxtractions were perfonned.
For brain tissue distribution. individual brains \\cre further dissected and tmal
RNA was isolated from hypothalamus. telencephalon. optic tcctum. and cerebellum. For
gcne expression studies. total RJ'JA was isolatcd from hypothalamus. telenccphalon and
gut in both Oounder and skates. Total R A was isolated using a trizollchlorofonn
extraction \\ith Tri-reagem (BioShop. Mississauga. Ontario. Canada) following the
manufacturers' protocol. Final RNA concentrations wcrc dctcrmined by optical density
reading at 260 nm using a NanoDrop ND-I 000 spectrophotometer (NanoDrop
Technologies Inc .. Wilmington. USA). The quality of RNA samples was assessed by
measuring the ratio of sample absorbance at 260 and 280 nm. RNA samples wilh a ratio
betwcen 1.8 and 2.1 were used.
Clollil/g ofeDNA
Two micrograms of total RNA were subjected to reverse transcription into cDNA
with a dT-adapter primer Crable I and 2) using M-MLV Rcvcrse Transcriptase (New
England Biolabs. Pickering. Ontario. Canada). Fragments of thc unknown sequenccs
\\crc initially obtained by perfonning peR amplifications using dcgcncrate fOfward and
rcverse primers dcsigned in regions of high identity among fish and various vcrtebrate
scquences and the above eDNA. Zero point five micrograms of cD A \\cre used fOf
31

each PCR. Thc annealing temperature was optimizcd for each primcr set. The PCR
reactions were carried out in a volume of25 JlI consisting of IX PCR buffer. 0.2 mM
cach d TP. 2.5 mM MgCh, 0.2 JlM each primcr. and I U ofTaq polymerase (Sigma. St
Louis. Missouri. USA). PCR conditions wcrc: 45 s at 94°C: 29 c)cles of 30 s at 94°C. 30
sat 30°C. 60 s at 72 °C: 2 min at 72 0c. A negativc control was included for each primcr
set by omitting cD A from the PCR reaction. Thc PCR products \\ere clcctrophoresed
in a 1% agarosc gcl in TAE butTer (Tris-acetate-EDTA). Bands of predictcd size were
isolated and purified \\ilh the GenElute Gel Extraction Kit (Sigma. Oak\ ille. Ontario.
Canada). ligated into the pGEM easy vector using the pGEMcasy vcctor system
(Promega. Madison. Wisconsin. USA) and sequenced by the MOBIX Lab (McMaster
University. Ontario. Canada).
32

Tnble I. Primers used in the eDNA cloning. tissue distribution nnd qPCR analysis in
winter flounder (Pleurollecles americanlls).
Primer Sequence!
'I'Y
Degenerate primers
I)Y-F
d PY-R
Primers for 3' and 5' RACE
3'RC·j PYI
3'RC- PY2
S-RC-NI'YI
YRC-NI'Y2
S-RC-NPY3
Specific primers for RT-PCR
NPYF
NPYR
CART
I)rimcrs for 3' and 5' RACE
3"R-CART I
,-R-CART 2
S-R-CART I
S-R-CART2
S-R-CART 3
5- AARCCNGARAAYCC GG. GA3­
5- GTRATNARRTrRATRTARTG 3"
5- GAGGATCTGGCGAAATACTA 3­
5_ CTACTCAGCCCTGAGACAACT 3­
5- ATGTGGATrCAACTTTGATG3­
Y CTCGTGATGAGGTrGATGTAG 3­
S- TGTAGTGTCTCAGGGCTGAG 3"
5- ATGCATCCTAACTTGGTGAG 3"
S- CCACAATGATGGGTCATATC 3"
5- CATrHTGGGARAAGAARTrYGG 3­
5- TACGTGYGAYFTBGGRGAGC 3-
5- CAGGAAGAAGTrGCAGAACG 3"
5- CTCGGGGACAGTCGCACATC ,-
Y CATCTrCCCAATCCGAGCTC 3-
33

Specific primers for nT-PCR
CARTqF
CARTqR
CCK
Degenerate primers
dCCK-F
dCCK-R
Ilrimers for 3' and 5' RACE
3"RC-CCK 1
3"RC-CCK 2
S"RC-CCK I
5"R-CCK 2
S"R-CCK 3
Specific primers for RT-PCR
CCKqF
CCK qR
Adaptor primers
dT-AP
AI'
S" GAGAGTICCGAGGAGCTGAG 3"
5" TITCGACTGAAGCTTCTCCA 3"
5" TGGCDGCYCTBTCCACCAGC 3"
S"CCAKCCCARGTARTCTCTGTC3"
S" CCTCTCCTCTCAGCACCTAG 3"
S" CTCCGACAGCGCCGCTCTGC 3"
5" CAGCCACAGGAAGAGCATIC 3"
S" TGGGGTATCAGCCTCGAGGA 3"
5" GCTGAGAGGAGAGGGGGTGC 3"
S" TTCCTGTGGCTGAGGAGAAT 3"
S" GCACAGAACCTlTCCTGGAG 3"
5" GGCCACGCGTCGACTAGTAC(TI7) 3"
S" GGCCACGCGTCGACTAGTAC 3"
Ilrimers for internal control of RT-peR
EFI
S" CCTGGACACAGGGAClTCAT 3"
EF2
S" CGGTGlTGTCCATC1TGTTG 3"
34

IJrimcrsfor(IIJCR
NPYqF
NPYqR
CARTqF
CARTqR
CCKqF
CCKqR
EFqF
EFqR
BAqF
BAqR
1 A=adcninc
T=thyminc
C=cytosine
G=guanine
Il=T/C/G
K=T/G
11=A!f/C
N=A!r/C/G
R=A/G
y=crr
J)=ArrlG
5' CACGAGACAGAGGTATGGGA 3'
5'GACTGTGGAAGTGTGTCCGT3'
5' GAGAGTTCCGAGGAGCTGAG 3'
5' TTTCGACTGAAGCTTCTCCA 3'
5' 'ITCCTGTGGCTGAGGAGAAT 3'
5' GCACAGAACCHTCCTGGAG 3'
5' CGCTCTGTGGAAGTTTGAGA 3'
5' CAGTCAGCCTGAGAGGTTCC 3'
5' TCCTGACCCTGAAGTATCCC 3'
5' TGTGATGCCAGATC'ITCTCC 3'
35

Table 2. Primers used in the cD A cloning, tissue distribution and qPCR analysis in
winter skate (Raja ocellaw).
Primer Sequence·
Primers for 3' and 5' RACE
3'R-NPYI
3'R-NPY2
S'R·NI)YI
5'R-NPY2
S'R· PY3
Specific primers for RT·PCR
PYF
NPYR
CART
Primers for 3' and 5' RACE
3'R-CART I
3'R-CART 2
5'R-CART I
5'R-CART2
5'R-CART 3
Specific primers for RT·PCR
CARTqF
CARTqR
5' GAGATITGGCCAAGTAlTAYTC 3'
5' TACAAGGCAGAGGTATGG 3'
5' TCACAlTAAAGAAACTGCAG 3'
5'ATCTCTCAGCATCAG1TCAG 3'
5' TAGTGClTCGGGGlTGGATC 3'
5' AACATGAAGTClTGGCTGGG 3'
5' CCACATGGAAGG1TCATCAT 3'
5' CTCGGGGCTlTACATGANGT 3'
5' GANGTrCTGGAGAAACTGCA 3'
5' GGGTCCITITCTCACTGCAC 3'
5' TCCTCCAAATCCTGGGTCCT 3'
5' TCAGGCAGlTACAGGTCCTC 3'
5' GCAGCGAGAAGGAACTGCT 3'
5' GCACACATGTCTCGGATGlT 3'
36

CCK
Degenerate primers
dCCK-F
dCCK-R
I'rimers for 3' and 5' RACE
3"RC-CCK I
3-RC-CCK 2
5"RC-CCK 1
S-R-CCK 2
S-R-CCK 3
Sllccific I)rimcn for RT-peR
CCKqF
CCKqR
Adllptor primers
dT-AP
AI'
I'rimers for internal control of RT-pen.
EFl
EF2
Primers for ql'CR
NPYqF
PYqR
CARTqF
5" GTGGGATCTGTGTGTGYGT 3­
5" CGTCGGCCRAARTCCATCCA 3-
S- CAGGCTGAACAGTGAGCAG 3­
5" AGCAGGGACCCGGCCTAGTG 3­
S- GTAGTAAGGTGCTTCTCTC 3-
5" GCTGGTGCAGGGGTCCGTGC 3­
5" TCCCTCTCGGTCCGTCCGTC 3-
S- CACCTACCTGCACAAAGACAA 3­
S- CCATGTAGTCCCTGTTGGTG 3-
S- GGCCACGCGTCGACTAGTAC(TI7) 3­
S- GGCCACGCGTCGACTAGTAC 3"
5" AAGGAAGCTGCTGAGATGGG 3­
5" CAGCTI-cAAACTCACCCACA 3-
5" CCCGAAGCACTAATGATGAC 3-
S- CATGGAAGG-ITCATCATACCTAA 3­
37
S- GCAGCGAGAAGGAACTGCT 3-

CARTqR
CCKqF
CCKqR
EF qF
EF qR
I A=adcninc
T=thymine
C=c)'tosinc
G=guaninc
B:T/C/G
K=T/G
H=Aff/C
N=ArfiC/G
R=NG
y=crr
D=Arr/G
5" GCACACATGTCTCGGATGTT 3"
5" CACCTACCTGCACAAAGACAA 3"
5" CCATGTAGTCCCTGTrGGTG 3"
5" GAACATGATrACCGGCACCT 3"
5" TrCAAACTCACCCACACCAG 3"
38

Cloning will/erflounder neliropeplide )'
A small fragment of the unknown sequence was isolated by performing PCR
amplifications using degenerate forward and rcverse primers (dNPY-F. and -R. Table I).
Once the short fragments were isolatcd and sequenced (see abovc), gene-specific primers
were designed for both Y and 3' end amplification The 3' ends ofcDNA \\ere
amplified by the techniquc of3' Rapid Amplification ofCD A Ends (3'RACE).
Brieny, brain mRNA was subjected to reverse transcription as described abovc and the
cD A submined to two rounds ofnested PCR. firstly 3'RC-NPYI and secondly with dT­
AP, and 3'RC- PY2 and AP (Table I). The PCR products \\ere electrophoresed on a
gel, and the bands ofexpected size were isolated, purified, cloncd. and sequenced as
described abovc. To isolate the 5" portion of the eDNA. YRACE \\as used. The first
strand ofcDNA was generated from mRNA with reversc transcription reaction with the
gene specific primer 5'RC-NPYI based on the scquence cloned from the )'RACE then
the eDNA was purified to remove primers and unincorporated dNTrs using a Montage
PCR Millipore kit (Bedford, MA. USA). A polyA tail was added to the 3' end of the
eDNA using Terminal Deoxynucleotidyl Transferase (Invitrogen. Burlington, Ontario.
Canada). The product was then amplilied using two rounds of nested PCR using first
YRC-NPY2 and dT-AP and then 5'RC-NPY3 and AP. The product was electrophoresed
011 a gel. isolated. purified. cloned and sequenced as described previously.
39

Cloning wimerjlowuler CART
In order to isolate flounder CART, a protocol similar to the above was used
except that the initial fragment was obtained using 3' RACE and the degenerate primers
(dT-AP and 3'R-CARTI and AP and 3'R-CART2) in two rounds of nested PCR.
Cloning willferjlollnder CCK
Flounder CCK was isolated as described for winter !lounder NPY (with CCK
specific primers. Table I).
Cloning winrer skare NP)'
Skate NPY was isolated as described for winter llounder CART above (with skate
NPY specific primers. Table 2).
Cloning wimer skale CA RT
Skate CART was isolated as described for winter flounder CART above (with
skate CART specific primers. Table 2).
Cloning winter skale CCK
Skate CCK was isolated as described for winter llounder NPY above (with skate
CCK specific primers. Table 2).
40

Sequence analysis
DNA and deduccd amino acid sequenccs wcre examincd by the Basic Local
Alignment Search Tool (BLAST) availablc from the ational Center for Biotcchnology
Information (NCBI) wcbsite (www.l1cbi.nlm.l1ilr.gov). Muhiple alignmcnts ofamino acid
sequences wcre performed using ClustalW software (w\l'w.ebi.ac.ukJdllsw/lI'l).
Assessme11l o/brail1 and tisslle distributiol1 by RT·PCR
Total RNA from brain. gills. heart. gut. liver. spleen. kidney. muscle. skin and
gonads and from distinct brain regions (olfactof)' bulbs. tclencephalon. optic tcelOm·
thalamus. hypothalamus. cerebellum. posterior brain and spinal cord) were isolated as
described above. The first strand ofeDNA was generated from IWO micrograms of RNA
subjccted to reverse transcription with dT-adaptcr primer using M·MLV Reverse
Transcriptase (Ncw England Biolabs). NPY. CART and CCK wcre amplificd using gcnc
specitic primers (rable 1.2) that were designed based on our c10ncd sequences. The
PCR cycling conditions for all reactions werc 30 cycles. 94·C for 30 s. anncaling
temperaturc lor 45 s, and 72'C for 60 s. The annealing temperature was optimized for
each primer set. PCR products were electrophoresed on a 1% agarose gel with TAE
butTer and visualizcd using the Epichemi Darkroom Biolmaging System (UVP. Upland.
CA. USA) cquipped with a l2·bit cooled camera. Image processing and analysis \\ere
pcrfOnlled using LabWorks 4.0 software (UVP). Elongation factor· I alpha (EF·I a) was
used as a control gene. Primers \\ere designed based on winter noundcr and little skate
41

which cDNAs wcre rcplaced b)' water was included. In addition a mching curve was
eonductcd at the cnd ofeach qPCR cxperiment to cnsurc amplilicalion ofonI)' one
product. Initial validation experiments were conducted to dctenllinc optimal primer
annealing temperatures and to ensure that PCRs \\cre rcproducible (O.98>R 2 >I.02) and
that all primcr pairs had cquivalent PCR efficiencies. The rcfcrence gene EF 1-0. was
tested to verify that starvation did not afTC(:t its expression levcl. as demonstrated by
similar Ct (cycle threshold) values.
Data Analysis ofreal time peR
The gene of interest was nonnalizcd to the reference gene (EFI-a) and expression
levels were compared using the relativc Ct (6.6.CT) method. Amplification. dissociation
curves and gene expression analysis were performed using the Realplcx 1.5 software
(Eppcndorl). Each expression levcl was then expressed as a percentage relative to the
control group which was set at 100%. By doing this. samples that were run in separate
qilCR experiments could be compared to each other. Finally. genc expression levels
were compared using student Hests in the GraphPad Instat sonware program (GraphPad
Soltware Inc.).
43

attctccgctggcca::gcaqgc:cccgctqqccccgcagagATGGAGAGTTCCGAGGAGCT 60
H. E 5 SEE L 8
GAGCCGCAGAGCGCTGCGGGACTTCTACCCCAAAGGTCCGAACCTGACCAGCGAGAAGCA 120
S R. R A L R. 0 F Y P K G P N L T S E K 0 28
I
GCTGCTCGGAGCTCTGCAGGAAGTTCTGGAGAAGCTTCAGTCGAAACGTCTTCCTCTGTG 180
L L GAL 0 E V L E K LOS K R. L P L W 48
I
GGAGAAGAAGTTTGGTCAAGTCCCCACGTGCGATGTGGGGGAGCAGTGTGCCGTGAGGAA 240
E K K F G 0 V P T C 0 V G E 0 C A V R K 68
AGGAGCTCGGATTGGGAAGATGTGCGACTGTCCCCGAGGAGCGTTCTGCAACTTCTTCCT 300
GAR. I G K H CDC P R. G A FeN F F L 88
GCTGAAGTGCTTATGAgcctcagatctgaatgtagtcatgtaaagtaaagaaaagtgtctcacgattcc 369
L K C L • 93
etttgtaaaaaaaaaaaaaaaaaaaaaaa
Figurc 2. Prcdicted amino acid sequence for wintcr Oounder CART. Untnmslated
regions are in small case Ictters, putative introns arc indicated by arrows and the amino
acids for thc CART precursor are in bold. Amino acids that code for the predicted
translated mature peptide are shaded in grey. The stop codon is indicated by a star (.).
46
396

aagtactctcctcagtctcacacactcctccaacacgcggaacctct t t tctcacq 56
ATGTCTGTGTGTGCGTGCTGCTGGCGTCCTGTGTACGAGCTGCTTGGGGCACCCCCTCTC 116
M Lev R A A G V L C T S C L G H P L S 20
CTCTCAGCACCTAGAAGAGGGCCAGCGCTCTGTCTCCGCTGCCTCTGAAGCCCTCCTCGA 116
S Q H LEE G Q R S V S A A SEA L L E 40
GGCTGATACCCACAGCCTGGGAGAGCCCCACCTCCGACAGCGCCGCTCTGCCCCCCAGCT 236
A D T H S L G E P H L R Q R R SAP Q L 60
GAATGCTCTTCCTGTGGCTGAGGAGAATGGAGACACCCGGGCCAACCTCAGCGAGCTGCT 296
N ALP V A E ENG D T RAN L S ELL 80
I
GGCCAGACTCATCTCCTCCAGGAAAGGTTCTGTGCGCAGAAACTCAACGGCGTACAGCAA 356
A R LIS S R K G S V R R N S T A Y S K 100
AGGACTGAGCCCCAACCACCGGATAGCAGACAGGGACTACTTGGGCTGGATGGATTTCGG 416
G L 5 P N H R I A D R D Y L G W lot D F G 120
CCGCCGCAGCGCAGAGGAGTACGAGTACTCCTCGTAaaaaaaaaaaaaaaaaa 469
R R S A E EYE Y 5 S • 131
Figurc 3. Prcdicted amino acid sequencc for winter flollnder CCK. Untranslated regions
arc in small case leiters. putative introns arc indicated by ;:IffOWS and amino acids are in
bold. Amino l.lcids that eode for the translated maturc CCK·8 peptidc arc shaded in grey.
The stop codon is indicated by a star ('").
47

Il'imer skal£' NPr CARTand CCK
Winter skate NPY is a 695 bp sequence (GcnBank Accession number EU684052)
that includes a 76 bp S-UTR and a 325 bp 3'UTR (Figure 4), The open reading frame
contains 98 amino acids which encode for prepro PY, The I)Y precursor sequence has
three putative exons that arc divided by two introns located after nucleotides 264 and
348.
A parlial sequence was oblained for winter skate CART, which displays a 549 bp
sequence (unpublished) with a 345 bp 3'UTR. The 5'UTR and Ihe start codon have not
yet been identified (Figure 5), The open reading frame has 95 amino acids. The CART
precursor sequence has three putative exons that arc divided by two introns located after
nucleotides 96 and 177,
Winter skate CCK is a 536 bp sequence (GenBank Accession number E 684054)
wilh a 78 bp S-UTR and a 107 bp 3'UTR (Figure 6), The open reading frame has 115
amino acids which encode for preproCCK. CCK has IWO putative exons that arc divided
by one intron located after amino acid 302 bp,
48

a ca9 tcccgaccagct caacacacccggcacagegccggcaacacagcaacacagr:g9 I)8
gcagtcat t tacctgcagcgATGAACAGCGGAATCTGCGTGTGCGTGCTTCTGGCCGTGC 118
MNSGICVCVLLAVL14
TGTCCTCTGGCGGCCTGGCGCGGCCGGACGGAGCCACCGAGAGGGACGGGGAGCGGCCGC 178
SSG G L A R P 0 GAT E R D G E R P H 34
ACGGACCCCTGCACCAGCGGCCCCTGAGAGAAGCACCTTACTACGGCCTCCTGAAGCCCA 238
G P L H Q R P L REA P Y Y G L L K P R 54
GGCTGAACAGTGAGCAGGGACCCGGCCTAGTGGCCTTGCTGGCCACCTACCTGCACAAAG 298
L N SEQ G P G L V ALL A t Y L H K D 74
8
ACAACACTGGATCGCGGGCTGGGACAGTCCGCAGCGTGGATGCCTCCCACAGGATCACCA 358
N T G S RAG T V R S V D ASH R I T N 94
ACAGGGACTACATGGGGTGGATGGACTTCGGGCGGCGCGGCGCGGAGGATTACGATTACC 438
R D Y H G W H D F G R R G A E 0 Y. D Y. P 114
CCTccTAAgaggcggccgeea tecatcactcagceceggccctg tacagaaga t tcagcc 478
S • 116
cgtctgctcaaagctctccttccaeaeaeccttcacaaaaaaaaaaaaaaaaa aa 536
Figure 6. Predicted amino acid sequence for winter skate CCK. Untmnslated regions are
in small ease letters. putative introns arc indicated by arrows and the amino acids are in
bold. Amino acids that code for the mature peptide CCK·8 arc shaded in grey. The stop
codon is indicated by a star (.).
51

Sequence anlllyses
NP)'
Thc amino acid sequences of winter flounder NPYand winter skate NPY were
aligned with sequences from other fish species and with one mammal sequence (Figure
7). Wimer flounder NPY has 53 to 96% amino acid similarity to NPY from other fish
species. with highest similarity (96%) to the bastard halibut and orange spoued grouper.
The winter skate NPY has low sequence similarity to teleost fish and mammalian
sequence (around 5()o1o). but shared a relatively high degree of similarity with the elcctric
my NI'Y (81%) (Figure 7).
CART
Amino acid sequences ofwinter flounder CART and winter skate CART were
aligned with other fish species and a mammalian sequcnce (Figure 8). Winter flounder
CART has 65 to 84% amino acid similarity to other fish species. with thc grcatest to
Atlantic cod. Winter skate CART displayed 47 to 53% amino acid similarity. with
goldfish CART having the highest similarity (Figure 8).
CCK
Amino acid sequences ofwinter flounder CCK and winter skme CCK were
aligned \\ith sequences from other fish species and onc mammalian species (Figure 9).
Winter flounder CCK showed an amino acid similarity ranging from 38% to 91 %. with
51

the highest similarity to halibut CCK. Winter skate CCK displayed 34 to 46% amino
aeid similarity. with the highest similarity to dogfish CCK (Figure 9).
53

NPY.
CART
CCK
EF
Figure 10. RT-I'CR distribution ofNI'Y (300 bp). CART (123 bp). CCK (87 bpj and EF
(201 bp) in different brain regions or tile winter Ooundcr. Samples were visualized by
electrophoresis on a 1% agarose gel stained with clhidium bromide. L. New England
BioJabs peR maker: I. hypothalamus; 2. telencephalon: 3. optic tectum; 4. cerebellum.
60

NPY
CART
CCK
EF
=_ _tiiiiJ-.... · ..
----------
_......---..-...
=---------
Figure II. RT-PCR distribution orNPY (300 bp). CART(123 bp). CCK (87 bp) and EF
(201 bp) in different peripheral tissues of the winter flounder. Samples were visualized
by electrophoresis on a 1% agarose gel stained with cthidiul1l bromidc. L. New England
Biolabs peR maker: I. gill; 2, heart: 3. stomach; 4. gut; 5. splcen; 6, liver: 7, kidney: 8.
muscle: 9. gonad.
61

I\'PY
=---
CART
CCK,i=;5:;$
EF I
Figure 12. RT-PCR distribution of PY (285 bp). CART (92 bpj. CCK (120 bpj and EF
(247 bp) in difTerent brain regions ofthe winter skate. Samples were visualized by
electrophoresis on a 1% agarose gel stained wilh cthidium bromide. L. New England
Biolabs peR maker; I, hypothalamus; 2. telencephalon: 3. optic teclum; 4, cerebellum.
63

NPY
CART
CCK
EF
L
--- -.. ... .-ii
---------
Figure 13. RT-PCR distribution ofofNPV (285 bp). CART (92 bp). CCK (120 bp) and
EF (247 bp) in different peripherallissues ofthe winter skate. Samples were visualized
by electrophoresis on a 1% agarose gel stained with clhidium bromide. L. New England
Biolabs peR Illnkcr: I. gilL 2. heart; 3. stomach: 4. gut: 5. spleen; 6, liver: 7. kidney: 8.
muscle; 9. gonad.

Food intake
Flounder consumed an average 01'2.12 ± 0.2 g of food per fish per feeding during
thc \\intcr (O"C) and an average of 12.7 ± 0.89 g of food per fish per fceding during the
summer (IIOC). which was significantly higher compared to thc winter experiment
(Figure 14).
Skates held in the summer (IIDC) consumed an average of 59.19 g ± 6.1 of food
per fish per feeding. 0 experimcnt "as conducted in thc \\inter months for skates.
65

16
:§ 14
." 12
"E
;:
c
o
10
8
6
."
g 4
IL 2
0-+------'----""'"'--'--------'
Winter Experiment Summer Experiment
Figure 14. Avcrage food consumed by flounder at each feeding was higher in the
SUllllller experiment compared to the winter experiment. Flounder consumed a
statistically higher amount of food in the summer compurcd to the winter (1'

Gene Expression
I:.jftc/s oIstorm/ion 011 gene expressiol1" WimerjlOlll/der will/er experimenl
Based on the results from the tissue distribution. the highest expression ofNPY.
and CART was most frequently found in the hypothalamus and in the gut for the CCK
which is why gene expression was done on these tissues. There were no significant
differences in NPY expression in the hypothalamus of flounder between fed fish and
starved at either two. four or six weeks of starvation (Figure 15). The NPY expression
levels were similar at two, four and six weeks for both fed and starved groups (Figure 15)
CART expression levels in the fed group were significantly higher in fed two
weeks compared to starved four weeks. fed six weeks and starved six weeks (p

:."'ffecis ojslarmiion on gene expression: Winler jlmmder slimmer experimenl
At both two and four weeks ofstarvation. NI)Y expression in the hypothalamus of
noundcr was significantly higher in fasted fish compared to fed fish (Figure 18). While
in fed fish. NPY expression levels were similar at two and four \\eeks. In fastcd fish.
therc \\as a significant increase in PY expression at four wecks compared to fish at two
\\eeks.
Thcre \\cre no significant changes in CART mRNA expression in the
hypothalamus ofthe winter nounder bet\\cen the fed and staf\ ed groups at either two or
four \\eeks of staf\'ation or between both collections (Figure 19).
CCK mR A Icvels were similar in fed fish at two and four \\eeks. There was a
significant decrease in CCK expression in the gut ofstaf\'cd fish at four weeks compared
to starved fish at two weeks. Thcre wcre no significant differences in CCK expression
between fed and fasted fish at either two or four weeks (Figure 20).
71

l:.JleC:ls ofsellsOil 01/ gene expressioll
When cxamining the effect different seasons havc on honnonc expression we
found a significant decrease in PY expression in the winter noundcr hypothalamus in
the summer experimcnt compared to lhe winter experimcnt (Figure 21). In contrast there
\\ere no differences in CART expression between summer and winter in lhe nounder
hypothalamus (Figure 22). When honnone expression was looked at in lhe periphery we
found a significanl increase in CCK expression in the winter nounder gut in the summer
experiment compared to the winter experiment (Figure 23). There are changes occurring
between seasons in the homlone profile ofthe winter nounder.
75

Iliscussion
Cloning
Wimer flounder NP>'. CARTand CCK
The cDNA sequences for winter nounder NPY. CART and CCK were
successfully cloned and characterized for Ihe first time.
As in other fish species. the winter flounder PY gene appears 10 ha\e four exons
and three possible polyadenylation sites. Winter flounder preproNPY shows a relatively
high degree of homology with NPY ofother fish. The highest sequence similarity is
found with another flat fish. the baslard halibut (96%) and with orange spotted grouper
(96%). \\hilc winter flounder and trout NPY sequences ha\e 80% similarity. Further
examination shows that the majority of the mature peptide is extremely \\ell conserved.
with a stretch of20 amino acids possessing 100% identity with othcr tdeosts (Figure 7).
The high sequence similarity ofwinter flounder preproNPY and mature NI'Y with other
fish NPY sequences may indicate that NPY in wintcr flounder has conserved
physiological roles as in those related fish species.
Winter flounder preproCART cDNA has 84% amino acid similarity with cod
preproCART. 83% similarity to goldfish CART 11 and 79% similarity to zebrafish
sequenccs (Figurc 8). The winter flounder CART cDNA starts with the characteristic
MESS amino acid sequence found in all vertebrate CARTs but appears to lack the
subsequcnt 28 amino acid residues. This is the first report ofa "short" proCART
sequence. Prior to now. CART has been cloned in a small number of manunalian and
82

lish species. Further studies will be needed to detenlline the physiological significance. if
any. of this shaner sequence.
There is good conservation ofthe arrangement ofcystcine residues \\ ithin CART
proteins between species. The location ofthe six cysteine residues is identical in all
species (Figure 8). Cysteine residues are essential for the three dimensional structural
conformation ofa protein because oftheir thiol group. The t\\O sulfurs located in the
thiol groups can form a disulfide bond \\ hich is required to make the folded biologically
active foml of the protein. When rats are injected with unfolded CART peptides there is
no decrease in feeding behaviour which demonstrates that these disulfide bonds are
essential for the biological activity of CART (COUCC) ro et al. 2003). The complete
conservation ofthe cysteine residues in different animals suggests the structured
characteristics of CART may be conserved between species.
Winter Oounder CCK gene appears to havc two introns and onc exon. detenllined
by comparing winter Oounder CCK with other fish CCK sequcnces. The winter Oounder
prcproCCK scquenee shows 91% scquence simililrity with its relativc the bastard halibut.
When comparing the mature peptide sequence. CCK-8. there is 100% sequence similarity
with other tcleosls. and only one amino acid diftcrence with other species (Fig. 9). Some
tcleosts. such as the rainbow trout have marc than onc foml ofCCK. but the current
cxperimental results suggest thcre is only onc form or CCK in wintcr Ooundcr (Jensen el
al. 2001). The extremely well conserved mature peptide and nucleotide sequence
consef"mion \\ith related species suggests the physiological function ofthc peptidc may
be \\ell conservcd.
83

among all species. is evidence that the cloncd fragment is wintcr skate CART and
suggests similar physiological functions across the taxa.
The cloned winler skate CCK sequence contains Iwo exons and one intron.
Winler skale preproCCK shows a very low degree of similarity \\ ilh CCKs from other
fish: the highest sequencc similarity is 46% similarity 10 spiny dogfish CCK. anolher
elasmobranch. On the other hand. there is a very high degree ofidentity bcmeen the
mature CCK-8 regions among all species. with only one variable amino acid. These facts
indicate that the cloned sequence is indeed" intcr skatc CCK and that CCK must have
conserved biological functions among fish species.
Tissue OiSlribUlion
IVillferjlollnder
NP)'
Using RT-PCR NPY expression was examined in four brain regions and in eight
peripheral tissues. High levels ofNPY mRNA expression were found in the winter
flounder lorebrain including the hypothalamus. telencephalon and optic tectum with
lower levcls in the cerebellum. High NPY expression in the forebrain has previously
been shown in other fish species including salmon. sea bass. catfish. sole and goldfish
(Peng et al. 1994: Silverstein et {II. 1998: Cerda-Reverter el al. 2000: Marchetti et al.
2000: Leonard el (II. 2001: Rodriguez-Gomez el al. 2001: Namu\\are et al. 2002). High
forebrain NPY expression is consistent \\ ith its role in the regulation of feeding
( amaware et al. 2002). in processing olfactory inputs (Pironc ellll. 2003) and in the
85

..-------------------------_.----
control of pituitary secretions (Cerda-Reverter el al. 2000: Rodrigucz·Gomez el a1.
2001).
PY mR A expression was detected in the gill. heart. stomach. gut. splcen. liver.
kidney. muscle and gonad. This widespread distribution ofNPY has been shown in
sc\cral fish species and is consistent with the putative role ofNI)Y in a number of
physiological functions. NPY has been shown to induce coronary artery contraction
(Bjcnning et al. 1993). cause contractions in gut arteries (Presion et 0/. 1998). increase
heart rale (Xiang 1994). and act on cells that secrete somalosHlIin for the regulation of
puberty in sea bass (Peyon el al. 2003). The expression of I)Y in the gonad has been
pre"iously shown and implicated in the regulation of reproduction (Peng el (II. 1994:
Leonard el al. 2001: Gaikwad el al. 2005).
Ilo\\cvcr. onc ofthe major functions ofNPY is relatcd to thc regulation of
feeding. This important role is reOcctcd by high NPY mRNA exprcssion Icvels in both
brain and gastroilllcstinal tract (Kchoe el al. 2007). In addition. periphcral administration
ofNPY causcs an incrcase in food intakc (Kiris GA (Kiris 2007).
CART
Similar to NPY expression. CART mRNA exprcssion was also more pronounced
in the forcbrain rcgions. thc hypothalamus. tclencephalon and optic tectum compared to
the cerebellum. CART immunoreactivity (Singru el al. 2007) and CART mRNA
expression (VolkotTel al. 2001: Kehoe el al. 2007) have both been shown in brain
regions including thc hypothalamus. telenccphalon and optic tectum ofothcr tish species.
86

CART mRNA expression was found in the cerebellum of tile wintcr l1ounder. \\hich
contrasts with cod where no CART mRNA expression was found in this area (Kehoe e/
al. 2007). The diverse expression ofCART in the winter flounder brain suggests that it
has many physiological roles. induding a role in the control of feeding. In goldfish and
cod. thc expression of CART mRNA in the hypothalamus and tclencephalon decreases
\\hcn fish arc fasted (Volkoffe/ al. 2001: Kehoe et al. 1007) consistent \\ith the
anorexigenic properties ofCART.
Winter flounder CART mRNA expression was high in the gut. liver. kidney and
gonad compared to a lower expression in gill. heart. stomach. spleen and muscle. CART
mRNA expression has been found in the lx)\'ine ovary. \\herc it inhibits estradiol
production (Kobayashi el al. 20(4). CART mRNA expression has been found
throughout the rat central nervous system (Couceyro el al. 1997). In goldfish CART
mRNA expression has been shown in the gill. kidney and gonad but not in the liver. gut
or the muscle (VolkoIT el al. 2001). In cod. CART mRNA cxprcssion is only found in
the brain and the ovary (Kehoe el al. 2007). It thus appears that CART mRNA
expression in winter Hounder has a more widespread distribution among peripheral
tissues than that found in any other species examined to date. In particular. previous
studies have detected CART peptides in the gut (Couceyro el al. 1998: Kuhar el a/.
1999). yct until now CART mRNA has not been found in the gastrointestinal tract. This
discovcry of CART mRNA in the gut of Hounder suggests that CART might act as a
brain·gut peptide.
87

CCK
Winter flounder CCK mR A expression levels appeared to be highest in the
hypothalamus. telencephalon and optic tectum and lower in the cerebellum. The mRNA
expression oreeK in the brain offish has been widely documented (Pc)on eta!. 1998:
Kurokawa ef al. 2003: Murashita el al. 2006). In trout. three diOcrcnt fonns oreeK
mR A arc found in the brain CCK·L. CCK· and CCK·T (Jensen et al. 2001) whereas
mammals only express one foml ofCCK. CCK mRNA levels in the brain ha\c also been
shown to change in response 10 feeding. In goldfish and )'cllo\\1ail. CCK mRNA
increases after a meal (Peyoo e/ 01. 1999: Murashita el a/. 2007).
Winter nounder CCK mRNA was expressed in all the pcripherallissues
examined. for example gill. hean. stomach. gut. spleen. liver. kidney. muscle and gonad.
Slightly higher expression was found in the liver and relatively lower expression was
found in the muscle. CCK mRNA in yellowtail is tound in stomach. pyloric cacca (a sac
used 10 increase gut surface area). anterior intestine. postcrior intcstine, and rectum
(Murashita el a/. 2006). In trout the threc dilTcrent lorms orCCK mRNA arc expressed
throughout the fish including the stomach, intestine. liver and muscle (Jcnsen e/ al.
2001). The mRNA expressions orCeK in the gill. heart and splecn that were lound in
winter llounder have not been previously noted in othcr fish species. In response to
fceding. CCK mRNA levels increase in the yellowtail digestive tract. pyloric caeca.
following a meal (Murashita el al. 2007). The prcsence ofeCK mRNA in this area of
thc digestive tract suggests a role as an appetite homlonc.
88

patterns were similar 10 those found in previous studies in cod and goldfish (VolkofT el
(11.2001: Kehoe el (II. 2007). CART mR A expression in the brain decreases with
fasting. so its presence in the brain supports its role as a brain-gut peptide (Volkofret (II.
2001).
CART mRNA expression showed relatively constant expression in all ofthe
peripheral tissues examined. Similar to winter nounder. CART mRNA has not been
previously detected in the gut of mammals and fish. only CART peptides (Couceyro et al.
1998: Kuhar el al. 1999).
CCK
CCK mR A expression was found in the \\ inter skate hypothalamus.
telencephalon. optic tectum and cerebellum. Not including winter flounder. CCK mRNA
expression has to date not been identified in the fish cerebellum. On the other hand. its
high expression in the hypothalamus and telencephalon has been well documented
(Peyon el al. 1998; Kurokawa er al. 2003: Murashita el al. 2006). In addition. CCK
binding sites have been found in the brain ofelasmobmnchs (Oliver ef al. 1996). and
CCK mRNA levels in the brain change in response to reeding (Peyon el al. 1999:
Murashita el al. 2007) suggesting CCK peptides have a role in the brain gut regulation of
feeding and digestion.
CCK mRNA expression in the winter skate was found in all the pcriphcraltissues
tested. \\ ith higher expression in the gut. liver and kidney. CCK can cause gallbladder
contraction in the killifish (ilonkanen el (II. 1988). inhibit gastric secretions in cod
90

(Holstcin 1982). increase gut motility in dogfish (Aidman el al. 1989) and cod (Forgan el
al. 2007) and slow gastric emptying in trout (Olsson el al. 1999). suggesting its role in
appetite regulation. The presence ofCCK mRNA in the gastrointestinal tract combined
\\ith evidence ofa role ofCCK in the regulation ofdigesti\ e functions supports the role
ofCCK in appetite regulation.
Sw,wwr)' oftisslle distribution and cloning
The sequcnces and tissue distribution of I !)Y. CART and CCK mRNA in winter
flounder and winter skate have been successfully detcnnined. Sequcnce comparison and
cxamination of the literature suggests a rolc in appetite regulation for each of these
hOnllOneS in these fish. With this infomlalion. experiments \\ere designed to examine thc
effect ofstarvation on the expression ofthese threc appetite hormones in both fish
species. In thc future. a screening of neuropcptidc expression with relation to season may
givc more insight into their roles in appetitc regulation.
Effccls of St:lrv:llion on Cene Expression
Winterjloll/uter wimer experimenl
Ovcr the course of the winter experiment. samples were tokcn cvcry two weeks.
mRNA from the hypothalamus and gut was isolatcd and used to examine the effects of
stanution on the expression ofNPY. CART and CCK.
NPY mR A expression in the hypothalamus displa) ed no change between either
collections. or bet\\cen starved and fed fish. These results diner from prcvious studies in
91

salmon and goldlish that show that PY expression in the brain increases in starvcd fish
compared to fcd fish (Silverstein el al. 1998: Namaware el af. 2000: amaware el al.
2001). In goldfish. mRNA expression in the hypothalamus and telencephalon was high
before feeding and decreased after feeding (Namawarc el af. 2000) and was shown to be
regulated by macronutrient content (Namaware el af. 2002). In the chinook and coho
salmon mRNA expression in the forebrain increased in fasted fish compared to fed fish
(Silverslein el af. 1998). Similar to our results. in cod. ho\\c,",er. NPY mR A expression
in the brain does not change in response to starvation (Kehoe el af. 2007). Similar to cod.
winter Oounder is capable ofwithstanding long periods of fasting in the \\ ild. The lack
ofchanges in PY expression could be indicativc ofthis feeding adaptation. A longer
period of fasting might be necessary to induce changes in NPY expression.
It is also important to note that during the \\ inter experiment. winter Oounder ate
very little food (-2 g per feeding). which may be an indicator ofother physiological
processes. Winter nounder have been previously observed to undergo a dormaney·like
phase in the colder winter months where their movement and food consumption decrease
(Mortell el al. 1994: Stoner ef af. 1999: Meise ef af. 2003). Winter tlounder in the winter
showed vcry liule swimming activity in the tanks compared 10 onimals held in the
summer (personal observation). The fact that there was no change in mRNA expression
ofNPY in starved fish compared to fcd fish may be related to the inactivity of winter
Ilounder in the winter ll10nlhs and possibly a "shutdown" of the NPY system.
During the \\inter. mRNA expression ofCART in the hypothalamus was not
allccled by starvation at 2. 4 or 6 weeks. These results contrast with prc\ ious studies in
92

goldfish showing that CART brain mRNA levels decrease in response to starvation
(Volkoff el al. 2001). Similar to NPY expression. the absence of variation in CART
expression might be due to the donnant-like state ofthe animals and a shutdown of
nonnal regulatory functions that are controlled by the brain. Intcrcstingly. CART mR A
Icvels in fed fish decreased from week 2 to wcek 6. The reasons for this deeline are
unclear as one \\ould expect the mRNA expression ofCART to remain constant in the
fed group. CART mRNA presence in the ovary has been pre\ iously implicated in
reproduction (Volkoff el al. 2001: Kobayashi el al. 2004: Kehoe el 01.2007) and winter
nounder are kno\\ll to spa\\ll in the winter (Scott el al. 1988).
CCK mR.!'JA expression was examined in the gut of \\ inter nounder for the winter
experiment. There were no significant changes in CCK mR A expression. In fact. the
expression ofCCK in the gut was so low that it was very difficult to quantify. CCK has
been well documented as a digestion regulating peptide in fish (Honkanen el al. 1988;
Aidman el (II. 1989: Olsson el al. 1999; Olsson el al. 1999; Forgan el al. 2007) as well as
acting as a satiety factor (Himick ef (II. 1994; VolkolT el al. 2003). In yeIlO\\1ail. there
was ,1Il &0 fold higher expression ofCCK mRNA levels in the brain compared to the
pyloric caeca (Murashita et al. 2006). which might have been a bettcr area to examine
CCK mRNA expression. The low expression levels of CCK in winter nounder suggest
that other regulatory processes must be occurring in the winter months to induce low
activity and low feeding rates. In the winter months carp have been shown to slow not
only their heart contractions in response to the cold water but also to produce different
types ofmyosin in the hean compared to the summer (Vomanen 1994; Tiitu V 2001).
93

Other fish species such as RutUlis rutUlls. also undergo fasting during the winter months
(Mendez G 1993) accompanied by metabolic depression (I-Iolker 2003) and a reliance on
energy reserves in white muscle (van Dijk PLM 2002). This evidence that adaptations to
cold water occur in other fish species suggests that winter flounder could be undergoing
similar physiological changes. All energy is focused on surviving the \\ inter and not
eating. due to lack ofprey and also the harshness of winter. The ph) siological functions
in\'ol\ed in survi\"ing the cold may override the appetite regulatory functions. especially
since food is not available.
Wimer flounder slimmer experiment
In the summer experiment. mRNA expression ofNPY in the hypothalamus was
higher in the starved animals compared to the fed animals at both two and four weeks of
strav3tion. The higher expression ofNPY mRNA in the brain of starved fish is similar to
expression patlcnls found in other fish (Silverstein et al. 1998: Narnaware ef al. 2001).
The higher expression ofNPY mRNA in starvcd fish supports a rotc for NPY as an
appetitc regulating peptide.
In the Slimmer, CART mRNA expression in the hypothalamus did not change
signilicantly over the course of the experiment. CART mRNA tended to be lower in the
starved group compared to the fed group aftcr four weeks of starvation. but this decrease
\\as not significant. In both goldfish and cod (VolkolT el al. 2001: Kehoe el al. 2007).
brain CART mRNA expression levels decrease following starvation. so it was expected
thai CART mR A in the hypothalamus would also decrease in starved flounder
94

compared to fed flounder. CART mRNA expression in the hypothalamus was relatively
low. and lo\\er than PY. It is possible that dinerences in expression levels were too
small to be detected by real-time quantitative PCR.
There \\ere no significant differences in gut CCK expression le\els between fed
and Slan.ed animals. These results contrast \\ith prcvious studies showing decreases in
CCK gut levels fo!lo\\;ng fasting in scvcral fish species. including )eIlO\\1ail. dogfish and
rainbow trout (Aidman el al. 1989: Olsson ci 01. 1999: Murashita et al. 2006). 1100\ewr.
CCK cxpression levels were lower in fasted animals after four \\ccks ofstan.ation
compared to two weeks ofstan.'ation. suggesting that CCK might be involved in the
regulation ofdigestive processcs and feeding in winter floundcr. IfCCK is an
anorexigenic peptide then one would expect that the longer the stan.'ation period the
lowcr the amount ofCCK production.
Eflec, q(sea.w/1 Oil XCIIi! expression in wimerflounder
In order to examine the elTecls of season on gene expression. I compared thc
exprcssion ofNPY. CART and CCK in led animals in the wintcr and the summcr.
NIlY mRNA expression was significantly lower in the led lish in the summer
compared to thc winter. As food consumption is higher in the summer compared to the
winh:r and NPY has been shown to be an orexigcnie peptidc in fish. one \\Quld have
expected an increase in NPY expression in summer animals. Iligh NPY expression
levels in the \\ inter might be indicative ofa stimulation ofappetitc-related NPY pathways
in thc brain by an empty gut and a down regulation on NPY receptors within the brain. If
95

fOod is nonnall)' not accessible in the winter there is no point wasting valuable energy
rescrves telling the bOOy that it nccds food. As well no PY expression differences
between fcd and starved fish in the winter wcre found and )ct thc diflerences were clear
in the summer. There must be othcr regulatory factors occurring during the winter in
winter nounder \\hid are overriding thc appetite regulatory functions of PY.
There \\cre no significant differences in CART mRNA expression in the
hypothalamus of winter nounder in the winter experiment compared to the summer
experiment. The lack ofdifference in CART mR A expression could be due to small
sample size and higher variability ofCART expression compared to NPY or to lowcr
expression levels ofCART. CART mRNA expression is higher in the tclencephalon
compared to other brain regions in cod. catfish and goldfish (Namawarc el (II. 2000:
Leonard el (II. 2001: Kehoe el (II. 2007). CART mRNA expression might also be higher
in thc winter nounder telencephalon and this could be whcre the effect ofstarvation is
more cvidcnt. Another factor to consider is the cloned CART sequence itsclf. Goldfish
has two forms ofCART. I and 11, and CART I is more sensitive to feeding studies
compared to the other (VolkolT el (II. 200 I). Winter nounder may also have two versions
ofCART and we only cloned one of them. Finally. it is also possible that CART may not
have a strong role in feeding regulation in winter noundcr because not only was thcre no
dilTcrence in CART mRNA expression between seasons. but there was no dilTercnce
bcl\\cen slarved and fed winter nounder in the summer experiment.
CCK gut mRNA expression was higher in fed winter nounder in the summer
compared to the winter. Given that fish had higher food consumption and \\cre fed 10
96

satiety in the summer and that CCK acts as an anorexigenic peptide in !ish. higher levels
ofCCK in the fed fish in the summer were expected. The cxpression levels ofCCK in Ihe
winter \\cre so low they were almost undetectable. This 10\\ expression in the winter
again emphasizes the fact that there musl be other regulatol') funclions occurring during
the \\inler months. or no regulation at all.
The low expression ofCCK in addition to relatively constant expression of PY
and CART in the winter is indicative Ihat Ihe fish are nol responding to stanation in the
winler as they do in Ihe summer. A number of fish. including winter flounder. have been
shown to display both decreased growth rales and food consumption in colder water
compared to wanner water (Martell et a/. 1994: Stoner el a/. 1999: Meise el a/. 2003:
Kehoe et al. 2007). It is noteworthy that during the \\inler. winter flounder produce
antifreeze proteins to protect Ihemselves from freezing (Gauthier el a/. 2005).
Metabolites have been shown to affect feeding as glucose administration and
hyperglycemia causes slower feeding and a decrease in food intake (Banos el (1/ 1998:
Kuz'mina 2005). [t is possible that high antifreeze protein levels an'cct appetite related
hormonal systems. This may be another factor to consider when examining food intake
with future studies.
Skare experiment
Only the summer experiment was conductcd for skate because or lack of
availability of winter skates in the winter. This experiment had one sampling because
only a small number ofanimals were available.
97

There were no significant ditTerences in I)Y expression in the hypothalamus of
fed ,\ inter skates compared to starved winter skates. This could be largely due to the
length ofstarvation. In goldfish PY. mRNA le\els increased aner 72 hours of food
deprivation ( amaware e/ al. 2001) "hereas in salmon. NPY mRNA levels changed atter
two 10 three weeks starvation (Silverstein ellil. !998). Winter skates li\e mostly on the
ocean floor unlike goldfish and salmon which spend most of the time in the water
column. Thus a diOerent starvation regime may be required to examine mRNA
expression in winter skate. like examining the eOect ofa longer stal"\ation period.
Gut CCK mRNA expression was significant!) higher in the slan'cd fish compared
to the fed fish. As for NPY this unexpected result could be due to the short duration of
the study. or the physiology and life history of the "inter skate. The majority of the fish
used in feeding experiments are telcosts. and the elasmobranchs may ha\e slightly
ditTerent appetite regulatory systems because the teleosts are a more recent evolutionary
lineage and display ditTerent life histories.
Gel/eral c:onclllsio!l.\
My results suggest that there arc many factors othcr than appetite regulation
contributing to the differences in winter llounder NPY. CART and CCK expression
betwcen the winter months and the summcr months. Futurc studies are ncedcd to
ex'lminc what exactly causes the lack offceding and activity during the winter. ifit is
temperature related alone or if more factors comc into play. such as maintaining energy
98

for reproduction. The mechanisms regulating the dormant like state also need further
examination.
One definite conclusion is that as morc fish sIX--cies arc examined it is evident that
fish arc pro\ ing to be much more diverse in their feeding habits than was originally
predicted \\ hen appetite studies were solely conducted on mammals. Fish exhibit diverse
phylogeny. morphology. ecology. behaviour. migration and reproductive strategies \\hich
9 each must be considered when studying species specific appetitc regulation mechanisms.
99

Bjcnning. c.. . Ilazon. A. Balasubramaniam. S. Ilolmgrcn and J. M. Conlon (1993).
"Distribution and activity ofdogfish NPY and peptidc YY in thc cardiovascular
system ofthe common dogfish." American Journal ofPhvsiology 26"(6 Pt2):
RI 119-24.
Bjcnning. c.. S.lIolmgren and A. P. Farrell (1993). "Neuropeptide Y potcntiates
contractile response to norepinephrine in skate coronary artery." American
Journal of Phvsiologv 265(2 Pt 2): H66I·5.
Blomq\'isl. A. G.. C. Soderberg. I. Lundell. R. J. Milner and O. Larhammar (1992).
"Strong cvolutionary conservation of neuropeptide Y: sequences ofchicken.
goldfish. and Torpedo marmora/a 0 A clones." I)rocccdings of the National
Academv of Sciences ofthe nited States ofAmerica 89(6): 2350·4.
Bosi. G.. A. Di Giancamillo. S. Arrighi and C. Domeneghini (200-t). "An
immunohistochemical study on the neuroendocrine system in the alimentary canal
ofthe brown troul. Salfllo mil/a. L.. 1758." General and Comparative
Endocrinologv 138(2): 166-181.
Broberger. c., K. Holmberg. M. J. Kuhar and T. 1-loHell (1999). "Cocainc· and
amphetaminc-regulated transcript in the rat vagus ncrvc: A putative mediator of
cholecystokinin-induced satiety." Proceedings ofthe National Academv of
Sciences ofthe United States of America 96(23): 13506-11.
Ccrda-Reverter. J. M.. I. Anglade. G. Martinez·Rodriguez. D. Mazurais. J. A. Munoz­
Cucto. M. Carrillo. O. Kah and S. Zanuy (2000). "Characterization of
neuropeptide Y expression in the brain ofa percifonn fish. the sea bass
(DicemrarcJllIs labmx)." Journal ofChemical Neuroanatomy 19(4): 197·210.
Cerda-Revcrter. J. M. and D. Larhammar (2000). "Neuropeptidc Y family of peptides:
structure. anatomical expression. function. and molccular evolution."
Biochemistry and Cell Biology 78(3): 371·92.
Chiba. A. (2000). "Immunohistochemical celltypcs in the terminal ncrve ganglion ofthe
cloudy dogfish. Scyliorhinlls tOrlcame. with special regard to neuropeptide
YIFMRFamide-immunoreactive cells." Neuroscience Letters 286(3): 195-8.
Cho. S. 1-1. (2005). "Compensatory growth ofjuvenile nounder Paralichlhys olil'(fcells L.
and changes in biochcmical composition

1I0nkanen. R. E.. J. W. Crim and J. S. I)atton (1988). "Eflccts ofcholecyslokinin peptides
on digeslive enzymes in killifish in vivo." Comparativc BiochememistD' and
Physiologv A 89(4): 655-60.
Ilorvath. T. L.. S. Diano and A. . van den 1)01 (1999). "Synaplic illteraction between
hypocretin (orexin) and neuropeptide Y cells in the rodent and primate
hypolhaiamus: a novel circuit implicated in metabolic and endocrine regulations."
Journalof euroscience 19(3): 1072-87.
Ilwa.1. J.. M. B. Winen. P. Williams. L. Ghibaudi. 1. Gao. B. G. Salisbul)'. D. Mullins.
F. lIamud. C. D. Strader and E. M. Parker (1999). "Acti\alion ofthe NPY Y5
reeeplor regulates bolh feeding and energy expenditure." American Journal of
Phvsiologv 277(5 Pt 2): R1428-34.
Imsland. A. K. and T. M. Jonassen (2001). "Regulation ofgro\\1h in lurbot
(,x'opJuhaJmlls mw;;mus Rafinesque) and Atlantic halibut (flipfJOglossus
hipfJOglosslIs L.): aspects ofenvironment x genotype imcractions." Re\'ie\\s in
Fish Biolog\' and Fisheries 11(1): 71-90.
Jensen. II.. I. J. Rourke. M. Moller. L. Jonson and A. II. Johnsen (2001). "Identification
and distribulion ofCCK-related peptides and mR As in the rainbow trouL
OncorhYllchus mykiss." Biochimica and Biophysica aCla 1517(2): 190-201.
Johnsen. A. I-I.. L. Jonson. I. J. Rourke and 1. F. Rehfeld (1997). "Elasl1lobranchs express
separate cholecystokinin and gaslrin genes." Proceedings oflhc 'alional
Acadenw of Sciences ofthe United States ofAmerica 94(19): 10221-10226.
Jonsson. A. C. (1991). "Regulalory I)eptides in lhe Pancreas 01'2 Species of
Elasmobranchs and in lhe Brockmann Bodics of4 Teleost Species." Cell and
Tissue Research 266(1): 163-172.
Jonsson. A. c.. S. Holmgren and B. Holstein (1987). "Gastrin Cck-Like
Immunoreactivity in Endocrine-Cells and Nerves in the Gastroinlcstinal-Tracl of
the Cod. Gadlls mor/1IIa, and the Effect of Pcptides of tile Gastrin Cck Family on
Cod Gastrointcstinal Smooth Muscle." General and Comparative Endocrinology
66(2): 190-202.
Kamisaka. Y.. O. Drivenes. T. Kurokawa. M. Tagawa.1. RonncsHld. M. Tanaka and 1. V.
Ilelvik (2005). "Cholecystokinin mRNA in AtlmHic herring. Cll/pea harellgllsmolecular
cloning, charactcrization. and distribution in the digestive tract during
thc early life stages." Peptides 26(3): 385-393.
Kamisaka. Y.. G. K. Totland, M. Tagawa. T. Kurokawa. T. Suzuki. M. Tanaka and I.
Ronneslad (2001). "Ontogeny ofcholecystokinin-immunoreactive cells in lhe
digcstive tract of Atlantic halibut. /lipp()g/()s.\"IIs hipp0J{/onlis. larvae." General
and Comparativc Endocrinology 123( I): 31-37.
Kawano. K.. T.I-lirashima. S. Mori. Y. Saitoh. M. Kurosuilli and T. Natori (1992).
"Spontaneous Long-Tcrm Hyperglycemic Rat with Diabelic Complications ­
Olsuka Long-Evans Tokushima Fatty (Oletl) Strain." Diabetcs 41(11): 1422­
1428.
Kchoe. A. S. and H. VolkotT(2007). "Cloning and charactcrization ofncuropcptide Y
(NPY) and cocaine and amphclamine rcgu13lcd transcripl (CART) in Allamic cod
10-l

Volkofl 1-1. and R. E. Peter (2001). "Interactions bch\CCn orexin A. NPY and galanin in
the control of food intake of the goldlish. Carmsills aura/lis." Regulatorv
Peptides 101(1-3): 59-72.
Volkofl: H. and R. E. Peter (2(06). "Feeding Behavior ofFish and Its Control." Zebrafish
3(2): 131-140.
Vomanen. M. (1994). "Seasonal and temperature·induced changes in m)osin heavy chain
composition ofcrucian carp hearts." American Journal ofPhvsiologv 267(6 Pt2):
RI567-73.
Vrang. N.. M. Tang-Christensen. P. J. Larsen and P. Kristensen (1999). "Recombinant
CART peptide induces c-Fos expression in central areas involved in control of
feeding behaviour." Brain Research 818(2): 499·509.
Wang. C.. C. J. Billington. A. S. Levine and C. M. Kotz (2000). "Effect of CART in the
hypothalamic paraventricular nucleus on feeding and uncoupling protein gene
expression." euroreoort 11(14): 3251-5.
Williams. G.. C. Bing. X. J. Cai. J. A. Harrold. P. J. King and X. 1-1. Liu (2001). "The
hypothalamus and the control ofenergy homeostasis: difTerent circuits. difTerent
purposes." Phvsiologv and Behaviour 7..1(4·5): 683·701.
Xiang. H. (1994). "Comparative aspects ofthe role of neuropcptide Y in the regulation of
the vertebrate hean." Cardioscience 5(4): 209·13.
Yokosuka. M.. M. G. Dubc. P. S. Kalra and S.I>. Kalra (2001). "The mPVN mediates
blockade ofNPY·induccd feeding by a Y5 receptor antagonist: a c-FOS analysis."
Peplides 22(3): 507-14.
Zhcng. II.. C. Patterson and 1-1. R. Berthoud (2001). "Fourth ventricular injection of
CART peptide inhibits short-tenn sucrose intake in rats." Brain Research 896(1­
2): 153-6.
111