경희대학교 동서의학대학원 의 학 영 양 학 과 김 선 아

석 사 학 위 논 문
Human dermal fibroblast cell에서 ascorbic acid, silicon,
lysine 및 proline이 collagen 합성에 미치는 영향
Effect of ascorbic acid, silicon, lysine and proline on collagen
synthesis in the human dermal fibroblast cell(HS27).
지도교수 조 윤 희
경희대학교 동서의학대학원
의 학 영 양 학 과
김 선 아
2006년 2월

Human dermal fibroblast cell에서 ascorbic acid, silicon,
lysine 및 proline이 collagen 합성에 미치는 영향
Effect of ascorbic acid, silicon, lysine and proline on collagen
synthesis in the human dermal fibroblast cell(HS27).
지도교수 조 윤 희
이 논문을 의학영양학 석사학위논문으로 제출함
경희대학교 동서의학대학원
의 학 영 양 학 과
김 선 아
2006년 2월

김선아의 의학영양학 석사학위 논문을 인준함
주심교수 박 유 경 (印)
부심교수 조 여 원 (印)
부심교수 조 윤 희 (印)
경희대학교 동서의학대학원
2006년 2월

Table of Contents
Table of Contents ················································································································ ⅰ
List of Tables ························································································································ ⅲ
List of Figures ······················································································································· ⅳ
Abbreviations ························································································································· ⅴ
Chapter 1. LITERATURE REVIEW ··············································································· 1
Ⅰ. Collagen ······························································································································ 2
Collagen and skin ············································································································· 2
Molecular structure·········································································································· 4
Collagen types ················································································································· 6
Fibrillar Collagens···································································································· 8
Nonfibrillar Collagens···························································································· 10
Basement membrane collagens································································ 11
Short chain collagens·················································································· 12
Fibril-associated collagens······································································· 12
Type I Collagen······································································································ 13
Type III Collagen ···································································································· 15
Collagen synthesis ········································································································· 16
Collagen degradation ····································································································· 23
MMPs·························································································································· 25
Biological properties of collagen ·············································································· 32
- i -

Ⅱ. Collagen and ascorbic acid ························································································ 33
Ascorbic acid ··················································································································· 33
Effect of ascorbic acid on collagen production ·················································· 36
Ⅲ. Collagen and silicon ····································································································· 39
Ⅳ. Prolyl hydroxylase ········································································································ 42
Gene regulation of proly 4-hydroxylase ······························································· 43
Ⅴ. Lyslyl hydroxylase ········································································································ 45
Chapter 2.
Human dermal fibroblast cell에서 ascorbic acid, silicon
lysine 및 proline이 collagen 합성에 미치는 영향 ···················································· 52
ABSTRACT ························································································································· 53
1. 서론 ······································································································································· 55
2. 재료 및 방법 ······················································································································· 57
3. 결과 및 고찰 ······················································································································· 62
4. 요약 및 결론 ······················································································································· 75
5. 참고 문헌 ····························································································································· 77
Appendix ·································································································································· 80
Acknowledgements ··············································································································· 82
- ii -

List of Tables
Table Page
1. Collagen types ·················································································································· 7
2. Proliferation of HS27 cells ·························································································· 63
- iii -

List of Figures
Figure Page
1. The basic structural unit of collagen ······································································ 5
2. Formation of collagen ···································································································· 17
3. Collagen synthesis ·········································································································· 19
4. The intramolecular and intermolecular cross-links of collagen ···················· 22
4. Experimental design ······································································································· 58
5. Proliferation of HS27 cells ·························································································· 64
6. Expression of collagen type Ⅰ ·················································································· 67
7. Densitometer analysis of collagen type Ⅰ Expression ····································· 68
8. Expression of collagen type Ⅲ ·················································································· 69
9. Densitometer analysis of collagen type Ⅲ Expression ····································· 70
10. mRNA expression of prolyl hydroxylase and lysyl hydroxylase ················ 72
11. mRNA expression of prolyl hydroxylase ······························································· 73
12. mRNA expression of lysyl hydroxylase ································································· 74
- iv -

List of Abbreviations
Abbreviations Full name
DMEM Dulbecco's Modified Eagle Media
DMSO Dimethylsulfoxide
FBS Fetal bovine sefum
PBS Phosphate - buffered saline
MTS assay [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy
methoxyphenyl)-2-(4-sulfophenyl)-2H-tetra
zolium colorimetric assay
LH Lysyl hydroxylase
PH Prolyl hydroxylase
PCR Polymerase chain reaction
RT Reverse transcription
SD Standard deviation
SEM Standard error mean
MMP Matrix metalloproteinases
- v -

Chapter I.
LITERATURE REVIEW
- 1 -

Ⅰ. Collagen
Collagen is the most abundant protein (by weight) in animals, accounting
for 30% of all proteins in mammals. Collagen assembles into different
supramolecular structures and has exceptional functional diversity. Collagen
is the major protein of connective tissue, tendons, ligaments, and the
cornea, and it forms the matrix of bones and teeth.
Collagen is a protein with three polypeptide chains. Each chain has 1000
amino acids and contains at least one stretch of the repeating amino acid
sequence Gly-X-Y (where X and Y can be any amino acid but are usually
proline and hydroxyproline, respectively.(van der Rest M, Garrone R. 1991)
Ⅰ-1. Collagen and skin
The skin is the largest organ of the body. It is made up of three distinct
layers: the Epidermis, the dermis and the subcutaneous tissue. Each has its
own unique function, yet are interrelated.
The epidermis, the outer layer, acts as a protective shield. It is comprised
of multiple cell strata that serve to regenerate the skin’s protective function.
The epidermis continuously sloughs keratinated cells of its outer layer, the
stratum corneum, every thirty days or so. This regeneration occurs naturally
through wear and tear such as bathing, friction from clothing and exposure
to the environment.
The middle layer is the dermis, through which blood vessels and nerve
receptors penetrate to the epidermis. In this layer, chemical and enzymatic
- 2 -

kinetic energy is constantly in motion. This motion allows cellular structures
to communicate with each other whereby growth factors and stimulation of
fibroblasts produce collagen, and provide strength and elasticity to the skin.
Sebaceous glands furthermore produce protective oils in the form of an acid
mantle onto the skin’s surface to help protect from infections. Temperature
and pain receptors along with blood vessels are also present.
The third layer is the subcutaneous tissue or fatty layer. This fat layer
serves to insulate the human body and helps the skin to be smooth and
plump. It also acts as a binder between the dermis and underlying tissues,
allowing the body to move as one.
The body's production of collagen in the skin begins dropping around the
age of twenty-five.(Anu Muona, 2001) But, it really picks up speed in the
forties and fifties. Many studies have demonstrated that our skin's natural
production of collagen decreases at a rate of 1% per year after the age of
forty. So, by the time a person reaches fifty-five, they have lost and
additional fifteen percent of their collagen production capacity. By age
seventy, the loss is over thirty percent and climbing.(Sal Martingano, 2002)
The major collagens in skin are types I and III. However, there are minor
collagens too, V, VI, VII, XI, indicating that skin collagen fibrils include several
types and represent heterotypic aggregates that associate to form banded
fibrils (Birk et al., 1986; Mendler et al., 1989). Type VI collagen is known to
associate via the region to which also binds the glycoprotein decorin. Although
the ratio of types I and III collagen in covered human skin remains constant
throughout childhood and young adult life, in the elderly, this ratio changes.
Scanning electron microscopic examination showed a decrease in the number of
collagen fibre bundles with age with a significant variation in the average bundle
- 3 -

width (Lovell et al., 1987). In addition to collagen, the dermal extracellular
matrix also contains proteoglycans, which show age-related differences
(Carrino et al., 2000). In spite of being present in much lower abundance than
collagen, they are important in the physiology of skin. The small proteoglycan
decorin binds to type I collagen and its disruption results in aberrant collagen
fibrils and in a reduction in the tensile strength of skin (Danielson et al., 1997).
Adult human skin contains a truncated form of decorin (Carrino et al., 2003)
referred to as decorunt, which is a catabolic fragment of decorin. The affinity of
decorunt for type I collagen is 100-fold less than that of decorin. This weaker
binding to collagen may alter stability of skin because of changes in the
collagen network.
Ⅰ-2. Molecular structure
The basic unit of collagen, tropocollagen, is a rigid rod-shaped molecule
approximately 3000 Å in length and 15 Å in diameter.(Beard H, Page Faulk
W, Conoche L, et al. 1977) Collagens have two different types of structural
domains: triple helical and globular.(Burgeson R, Nimni M. 1992) Most
collagens consist of two α-1 chains and one α-2 chain. An individual α
-chain is a left-handed helix with approximately 3.3 residues per turn. The
α-chains are twisted together to form a right-handed superhelical structure.
Hydrogen bonds form between residues of the different chains.(Nimni M.
1980) The characteristic structure of both chains is a repeating unit of
three amino acid; one third of all the amino acids in each collagen chain is
glycine(Gly). Proline(Pro) and hydroxyproline(Hyp) follow each other
frequently, and about 10% of the molecule has the sequence Gly-Pro-Hyp.
- 4 -

Figure 1. Triple-stranded helical molecule of collagen
Procollagen is the precursor of tropocollagen. The procollagen molecule
has three pro-α chains arranged in a triple-stranded conformation and
differs from tropocollagen in that it contains six extraglobular tails. The
N-terminal propeptide contains intrachain (but not interchain) disulfide links,
whereas the polypeptides from the C-terminal region are linked to each
other by disulfide bridges. The nonhelical gegions or procollagen are
partially cleaved by procollagen peptidases.(Bornstein P. 1974)
Ⅰ-3. Collagen types
There are 20 collagens identified to date, type Ⅰ being the most abundant
structural protein found in vertebrates(Table 1). The different collagen types
are designated with Roman numerals Ⅰ to XIX. These numerals were
assigned following the order in which they were discovered.
- 5 -

Most authors have classified collagens based on their supramolecular
structures in two main classes: the fibrillar collagens and the nonfibrillar
collagens.(Vuorio E, de Crombugghe B. 1990; Hulmes D. 1992) In addition,
type VIII and type VI collagens are described below, but they have not yet
been classified.
- 6 -

Table 1. Collagen types
α Chains Tissue Distribution
Ⅰ α1(Ⅰ), α2(Ⅰ) Most connective tissues, eg, bone, tendon, skin, lung,
cornea, sclera, vascular system
Ⅱ α1(Ⅱ) Cartilage, vitreous humour, embryonic cornea
Ⅲ α1(Ⅲ)
Ⅳ α1(Ⅳ), α2(Ⅳ), α3(Ⅳ) Basement membranes
α4(Ⅳ), α5(Ⅳ)
V α1(V), α2(V), α3(V)
Extensible connective tissues, eg, skin, lung, vascular
system
Tissues containing collagen Ⅱ, quantitatively minor
componet
VI α1(VI), α1(VI), α1(VI) Most connective tissues, including cartilage
VII α1(VII) Basement-membrane-associate anchoring fibrils
VIII α1(VIII), α2(VIII) Product of endothelial and various tumor cell lines
IX α1(IX), α2(IX), α3(IX)
Tissues containing collagen Ⅱ, quantitatively minor
componet
X α1(X) Hypertrophic zone of cartilage
XI α1(XI), α2(XI), α2(XI)
XII α1(XII)
XIII α1(XIII)
XIV α1(XIV)
Tissues containing collagen Ⅱ, quantitatively minor
componet
Tissues containing collagen Ⅰ, quantitatively minor
componet
Quantitatively minor collagen, eg, found in skin and
intestine
Tissues containing collagen Ⅰ, quantitatively minor
componet
- 7 -

Ⅰ-3.1. Fibrillar Collagens
This group contains the type Ⅰ, Ⅱ, Ⅲ, Ⅴ, and XI collagens. Those
collagens form highly organized fibers and fibrils and provide the structural
support for the body in the skeleton, skin, blood vessels, nerves, intestines,
and the fibrous capsules of organs.(Vuorio E, de Crombugghe B. 1990)
Fibrils are frequently organized into bundles or lamellae, and the size and
higherorder arrangement of fibrils gives rise to tissue-specific,
biomechanical, and other biological properties.(Hulmes D, Wess T, Prockop
D, et al. 1995)
Type Ⅰ collagen is composed of three chains, two identical α-1(Ⅰ) chains
and one different chain, referred to as α-2(Ⅰ). Type Ⅰ collagen is
abundant in bone, tendon, skin, ligaments, arteries, uterus, and cornea, and
comprises between 80% and 99% of the total collagen.(Burgeson R, Nimni
M. 1992) Type Ⅰ collagen is very important as demonstrated by studies of
mutations, where the effect of deletions, insertions, and single amino acid
substitutions have resulted in osteogenesis imperfecta, Ehlers-Danlos
syndromes, and many degenerative diseases. Type Ⅰ collagen is among the
most important stress-carrying protein structures in mammals. For the fibril
to carry out this function, kinks occur in the gap region of the fibrils during
packaging because of the low levels of proline and hydroxylroline, resulting
in a reduced packing density compared with the overlap region.(Fratzl P,
Misof K, Zizak I. 1997)
Type Ⅱ collagen is the major collagen type present in cartilaginous
tissues, although it is also present in significant amounts in other connective
tissue such as the nucleolus pulposus of the intervertebral disk and the
vitreous humor.(Kadler K, Holmes J, Trotter J, et al. 1996) Type Ⅱ collagen
- 8 -

is contains three identical α chains that have chromatographic and
electrophoretic characteristics similar to the α-1 chains of type Ⅰ collagen.
These chains are designate α-1(Ⅱ). Cartilage collagen has a relatively high
hydroxylysine and glycosylate hydroxylysine content, and it is synthesized
during the chondrogenic stages of mesoderm development.(Burgeson R,
Nimni M. 1992)
Type Ⅲ collagen is composed of three identical α-1(Ⅲ) chains. This
collagen has a high content of hydroxyproline and is low in hydroxylysine.
It is a normal constituent of skin (10-20% of the total collagen) and is
found in many other connective tissues. It is associated with type Ⅰ
collagen in lung, heart muscle, uterus, nerves, liver, placenta, umbilical cord,
blood vessels, spleen, gingiva, kidney, lymph nodes, sclera, and other eye
structures, as well as normal bone. Type Ⅲ collagen is correlated with
tissue extensibility and may contribute to elasticity, a unique biological
property associated with this collagen isoform.(Kadler K, Holmes J, Trotter
J, et al. 1996)
Type Ⅴ collagen is more soluble than other collagens. This collagen is
abundant in vascular tissues and typically is found in the interior, but not
the exterior, of the fibril. Its amino acid composition is similar to that of
interstitial collagens except for a high ration of hydroxylysine to lysine and
a low content of alanine. The hydroxylysine isn only partially glycosylated
with glucosygalactose or galactosyl groups.(Burgeson R, Nimni M. 1992) The
chain composition of type Ⅴ collagen is variable: the most common
structure is two α-1(Ⅴ) chains and one α-2(Ⅴ) chain, but homotrimers of α
-1(Ⅴ) have also been detected as well as the heterotrimers α-1(Ⅴ), α-2(Ⅴ)
and α-3(Ⅴ).(Fessler J, Ressler L. 1987) In addition, the structure of the
- 9 -

globular domains of type Ⅴ collagen is significantly larger than in the other
collagen types.(Kadler K, Holmes J, Trotter J, et al. 1996)
Type XI collagen is found in cartilaginous tissues. The predominant form of
type XI collagen is α-1(XI) α-2(XI) α-3(XI). The function of type XI collagen
has not been elucidated; however, it is suspected that it regulates the
diameter or growth of type Ⅱ collagen fibrils.(Eyre D, Wu J. 1987)
It is known that most collagen fibrils are composed of two or more
different collagen types. This has been demonstrated for types Ⅰ and Ⅲ,
types Ⅰ and Ⅴ, and types Ⅱ and XI.(van der Rest M. Garrone R. 1991)
Electron microscopic studies of collagen fibrils show a quarter-stagger
arrangement of the individual collagen molecules, ie, each tropocollagen
molecule overlaps four other tropocollagen molecules.(Vuorio E, de
Crombugghe B. 1990) Recent x-ray diffraction studies show collagen as a
crystal structure based on a quasi-hexagonal packing; however, the
structure of the collagen fibril is not completely elucidated.(Prockop D,
Fertala A. 1998; Misof K, Rapp G, Fratzl P. 1990)
Ⅰ-3.2. Nonfibrillar Collagens
Nonfibrillar collagens are classified according to their molecular
characteristics, supramolecular structures, and types of extracellular
networks in basement membrane collagens, short-chain collagens, and
fibril-associated collagens.(Hulmes D. 1992)
Ⅰ-3.2.1. Basement membrane collagens
The major components of basement membranes are type Ⅳ collagen,
laminins, and heparan sulfate proteoglycans. Type VII collagen is also
- 10 -

incluede in this category because of its association with basement
membranes.
Type Ⅳ collagen consists mostly of two α-1 chains and one α-2 chain.
The α-chains are not proteolytically processed and have high hydroxylysine
and glycosylated hydroxylysine content. There are three domains: a central
triple-helix that is approximately 25% longer than the fibrillar collagens and
that it is interrupted at several positions by short nontriple helical
sequences. These interruptions are sites of increased molecular
flexibility.(Yurchenco P, Schittny J. 1990) The C-terminal globular domain is
a large domain and consists of two homologous internal domains. These
domains on two adjacent molecules become covalently linked by disulfied
exchange to form a dimer. The N-terminal domain represents an additional
triple-helical region, separated from the main triple helix by a kink. These
domains of two adjacent molecules also associate, in interactions that are
stabilized by disulfide and covalent cross-links, forming a tetramer. When
these interactions are present, type Ⅳ collagen forms a flexible
three-dimensional network.(Vuorio E, de Crombugghe B. 1990; Hulmes D.
1992)
Type VII collagen is found beneath stratified squamous epithelia, in close
proximity to the basement membrane. It links the basement membrane to
anchoring plaques in the underlying extracellular matrix. Type VII collagen
has a long triple-helical region with a small globular region at one end that
is removed during assembly and a tridentate structure at the other end.
This type of collagen also presents nonhelical interruptions. Type VII
collagen functions to strengthen the dermal epidermal junction.
- 11 -

Ⅰ-3.2.2. Short chain collagens
This group involves type VIII collagen and X collagens, which have similar
structure and assembly but different distribution and function.
Type VIII collagen has been found in the Descemet's membrane of the eye,
vascular endothelial cells, and some tumor-derived cells. The type VIII
collagen molecule has a triple helical region of 135nm in length, with a
globular region at the C-terminus and a smaller globular region at the
N-terminus. The entire triple-helical domain is encoded by one single exon.
The triple helices have interruptions in the same positions in α-1(VIII) and α
-2(VIII) chains. The function of type VIII collagen is as yet unknown.(Vuorio
E, de Crombugghe B. 1990; Hulmes D. 1992)
Type X collagen is a homotrimeric disulfide-bonded collagen and is the
product of hypertrophic chondrocytes. It is the most specialized of the
collagens, hacing a function related to cartilage mineralization. Its molecular
structure is similar to that of type VIII collagen, especially in the
triple-helical and C-terminal globular regions. Its triple helical domain has
eight interruptions in the gly-X-Y repeat structure. The entire triple helical
domain is encoded by one single exon. The function of type X collagen has
been suggested to play a role in the formation of a framework during
replacement of cartilage by bone and guiding endothelial cells during
angiogenesis.(Hulmes D. 1992)
Ⅰ-3.2.3. Fibril-associated collagens
This subgroup, fibril-associated collagens with interrupted
triple-helices(FACIT), comprises type IX, XII, and XIV collagens. These
collagens attach to the surface of pre-existing fibrils.
- 12 -

Type IX collagen is expressed in cartilages (1-10% of total collagens). It is
a heterotrimer, contains three short triple helical domains with interchain
disulfide bonds, and has a large globular region at the N-terminus of
cartilage α-1(I). The function of type IX collagen remains unknown although
it may have a role in mediating the interaction between type II collagen and
proteoglycans in cartilage. Type IX molecules have been localized on the
surface of cartilage type II collagen fibrils in a periodic distribution.(Vaughan
L, Mendler M, Huber S, et al. 1988) The interaction between type IX and II
collagens is stabilized by covalent intermolecular cross-links.(Eyre D, Wu J.
1987; van der Rest M, Mayne R. 1988)
Type XII collagen is found in dense collagen I-containing connective
tissues such as tendons and ligaments.(Gordon M, Gerecke D, Dublet B, et
al. 1989; Yamagata M, Yamagada K, Yamada S, et al. 1991). The molecule
is a homotrimer of three α-1(XII) chains, where each chain has two
triple-helical eomains. Because of the similarity with type IX collagen, an
analogous function has been suggested: lateral association with type I
collagen on the surfaces of fibrils.(Vuorio E, de Crombugghe B. 1990) Type
XIV collagen is found in skin and tendon. Further studies are necessary to
determine whether structural homology exists with type XII collagen.
Ⅰ-3.3. Type I Collagen
When the term collagen is used, it usually means type Ⅰ collagne, the
most common of the collagens in vertebrates. It comprises up to 90% of the
skeletons of the mammals and is also widespread all over the body: in
addition to bones, it is found in skin, tendons, ligaments, cornea,
- 13 -

intervertebral disks, dentine, arteries and granulation tissues as the main
locations. Even cartilage, which mainly contains type Ⅱ collagen, has been
mentioned to contain some type Ⅰ collagen (Wardale & Duance 1993). It is
also widespread in the animal kingdom, from invertebrates (Exposito et al.
1992) to vertebrates. Type Ⅰ collagen is also important in other respects:
for example, it is used in the gelatin industry and in many biomaterials, and
leather is, in fact, mostly composed of type Ⅰ collagen. The importance of
type Ⅰ collagen for medical research is that it is involved in many human
and animal diseases, including fibrosis, osteoporosis, cancer, atherosclerosis
etc. In spite of or because of the fact that it is widely distributed in the
body the different parts (degradation products) of type Ⅰ collagen molecule
are frequently utilized to monitor physiological changes in tissues as well as
being used as diagnostic tools in various pathological conditions.
Similarly to other fibrillar collagens this molecule comprises three
polypeptied chains (α-chains) which form a unique triple-helical structure. It
is a heterotrimer of two α1(Ⅰ) and one α2(Ⅰ) chains. Among species, the α
1(Ⅰ) chain is more conserved than the α2(I) chain (Kimura 1983). Small
amounts of homotrimer of three α1(I) chains have been found in embryonic
tissues and in some individuals with osteogenesis imperfecta (OI). The bony
fishes also have an α3(I) chain in their type I collagen. Type I collagen
molecule contains an uninterrupted triple helix of approximately 300 nm in
length and 1.5 nm in diameter flanked by short nonhelical telopeptides. The
helical region is highly conserved among species (Chu et al. 1984). The
telopeptides, which do not have a repeating Gly-X-Y structure and do not
adopt a triple helical conformation, account for 2% of the molecule and are
essential for fibril formation (Kadler et al. 1996). The telopeptides are the
- 14 -

most immunogenic regions of type I molecule. The most carboxy-terminal
part of the carboxy-terminal telopeptide of type I collagen α1-chain
D-G-G-R-Y-Y is, however, highly conserved and activates
polymorphonuclear leucocytes (Monboisse et al. 1990). The α2-chain, which
does not have this sequence, also lacks this property. In addition, a specific
property of the carboxyterminal telopeptide is that its α1-chain adopts a
folded conformation with a sharp hairpin turn around residues 13 and 14 of
the 25-residue telopeptide (Orgel et al. 2000). Both telopeptide regions take
part in cross-link formation (see later).
Type I collagen molecules form D-periodic (D = 67 nm, the characteristic
axial periodicity of collagen) cross-striated fibrils in the extracellular space,
giving the tissues their mechanical strength and providing the major
biomechanical scaffold for cell attachment and anchorage of macromolecules.
Many macromolecules such as integrins, fibronectin, fibromodulin and
decorin attach to type I collagen. Type I collagen also interacts with many
cells, such as fibroblasts, and with platelets during blood clotting. In bones
and dentin type I collagen is mineralized with hydroxyapatite crystals. The
process is mediated by non-collagenous proteins after decorin molecules
have been removed from the newly-synthesized collagen molecules (Hoshi
et al. 1999). If the type I collagen gene is mutated, it leads to several
forms of osteogenesis imperfecta (OI), characterized by brittle bones,
Ehlers-Danlos syndrome (EDS), characterized by hypermobility of joints and
abnormalities of skin, or Marfan syndrome, characterized by abnormalities in
arteries (Kadler 1995).
Ⅰ-3.4. Type III Collagen
Type III collagen is the second most abundant collagen in human tissues
- 15 -

and occurs particularly in tissues exhibiting elastic properties, such as skin,
blood vessels and various internal organs. It is a homotrimer composed of
three α1(III) chains and resembles other fibrillar collagens in its structure
and function. Its elastic properties may be due to the disulphide bonds and
the fact that there is no lysyl oxidase-dependent cross-link in the
C-terminal end (Cheung et al. 1983). It is synthesized as procollagen
similarly to type I collagen, but the N-terminal propeptide remains attached
in the mature, fibrillar type III collagen more often than in type I. Mutations
of type III collagen cause the most severe form of Ehlers-Danlos syndrome,
EDS IV, which affect arteries, internal organs, joints and skin, and may
cause sudden death when the large arteries rupture.
Ⅰ-4. Collagen synthesis
The biosynthetic pathway responsible for collagen production is a very
complex one.(Prockop DJ, Kivirikko KI. 1995; Kivirikko KI, Risteli L. 1976)
Each specific collagen type is encoded by a specific gene; the genes for all
of the collagen types are found on a variety of chromosomes. As the
messenger RNA (mRNA) for each collagen type is transcribed from the
gene, or DNA "blueprint," it undergoes many processing steps to produce a
final code for that specific collagen type. This step is called mRNA
processing. Once the final pro-alpha chain mRNA is produced, it attaches to
the site of actual protein synthesis. This step of the synthesis is called
translation. This site of pro-alpha chain mRNA translation is found on the
membrane-bound ribosomes also called the rough endoplasmic reticulum or
rER. Like most other proteins that are destined for function in the
extracellular environment, collagen is also synthesized on the rER.
- 16 -

Figure 2. Formation of collagen
A precursor form of collagen called procollagen is produced
initially.(Bellamy G, Bornstein P. 1971) Procollagen contains extension
proteins on each end called amino and carboxy procollagen extension
propeptides. These nonhelical portions of the procollagen molecule make it
- 17 -

very soluble and therefore easy to move within the cell as it undergoes
further modifications. As the collagen molecule is produced, it undergoes
many changes, termed post-translational modifications.(Prockop DJ, Kivirikko
KI. 1995; Kivirikko KI, Risteli L. 1976) These modifications take place in
the Golgi compartment of the ER.
Collagen, like most proteins that are destined for transport to the
extracellular spaces for their function or activity, is produced initially as a
larger precursor molecule called procollagen.(Bellamy G, Bornstein P. 1971)
Procollagen contains additional peptides at both ends that are unlike
collagen. On one end of the molecule, called the amino terminal end, special
bonds called disulfide bonds are formed among three procollagen chains and
insure that the chains line up in the proper alignment. This step is called
registration. Once registration occurs, the three chains wrap around each
other forming a string-like structure.
- 18 -

Fig 3. Collagen synthesis
- 19 -

One of the first modifications to take place is the very critical step of
hydroxylation of selected proline and lysine amino acids in the newly
synthesized procollagen protein (Figure 2). Specific enzymes called
hydroxylases are responsible for these important reactions needed to form
hydroxyproline and hydroxylysine. The hydroxylase enzymes require Vitamin
C and Iron as cofactors.(Mussini E, Hutton JJ, Udenfriend S. 1967) If a
patient is Vitamin C deficient, then this reaction will not occur. In the
absence of hydroxyproline, the collagen chains cannot form a proper helical
structure, and the resultant molecule is weak and quickly
destroyed.(Bienkowski RS, Baum BJ, Crystal RG. 1978) The end result is
poor wound healing, and the clinical condition is called scurvy.(Hirschmann
JV, Raugi GJ. 1999) The current recommended daily allowance for Vitamin
C is 60mg; however, 200mg may be optimal.(Gross RL. 2000; Ayello EA,
Thomas DR, Litchford MA. 1999)
Some of the newly formed hydroxylysine amino acids are glycosylated by
the addition of sugars, such as galactose and glucose.(Anttinen H, Myllyla R,
Kivirikko KI. 1978) The enzymes that catalyze the glycosylation step,
galactosyl and glucosyl transferases, require the trace metal manganese
(Mn 2+ ). The glycosylation step imparts unique chemical and structural
characteristics to the newly formed collagen molecule and may influence
fibril size.(Kivirikko KI, Myllyla R. 1979) It is of interest to note that the
glycosylation enzymes are found with the highest activities in the very
young and decrease as we age.(Anttinen H, Oikarinen A, Kivirikko KI. 1977)
While inside the cell and when the procollagen peptides are intact, the
molecule is about 1,000 times more soluble than it is at a latter stage when
- 20 -

the extension peptides are removed.(Prockop DJ, Kivirikko KI, Tuderman L,
Guzman NA. 1979) This high degree of solubility allows the procollagen
molecule to be transported easily within the cell where it is moved by
means of specialized structures called microtubules to the cell surface
where it is secreted into the extracellular spaces.(Diegelmann RF,
Peterkofsky B. 1972)
As the procollagen is secreted from the cell, it is acted upon by
specialized enzymes called procollagen proteinases that remove both of the
extension peptides from the ends of the molecule.(Lapiere CM, Lenaers A,
Kohn LD. 1971) Portions of these digested end pieces are thought to
re-enter the cell and regulate the amount of collagen synthesis by a
feed-back type of mechanism.(Lichtenstein JR, Martin GR, Kohn LD, Byers
PH, McKusick VA. 1973; Wiestner M, Krieg T, Horlein D, Glanville RW,
Fietzek P, Muller PK. 1979) The processed molecule is referred to as
collagen and now begins to be involved in the important process of fiber
formation.
In the extracellular spaces, another post-translational modification takes
place as the triple helical collagen molecules (Figure 1) line up and begin to
form fibrils and then fibers. This step is called crosslink formation and is
promoted by another specialized enzyme called lysyl oxidase (Figure
3).(Bailey AJ, Robins SP, Balian G. 1974) This reaction places stable
crosslinks within (intramolecular crosslinks) and between the molecules
(intermolecular crosslinks). This is the critical step that gives the collagen
fibers such tremendous strength. On a per weight basis, the strength of
collagen approaches the tensile strength of steel.
- 21 -

Figure 3. The intramolecular and intermolecular cross-links of collagen
One can visualize the ultrastructure of collagen by thinking of the individual
molecules as a piece of sewing thread. Many of these threads are wrapped
around one another to form a string (fibrils). These strings then form cords;
the cords associate to form a rope, and the ropes interact to form cables.
The structure is just like the steel rope cables on the Golden Gate bridge.
This highly organized structure is what is responsible for the strength of
tendons, ligaments, bones, and dermis.
When the normal collagen in our tissues is injured and replaced by scar
collagen, the connective tissue does not regain this highly organized
structure. That is why scar collagen is always weaker than the original
collagen. The maximum regain in tensile strength of scar collagen is about
70 to 80 percent of the original.(Schilling JA. Wound healing. 1968) Collagen
- 22 -

synthesis and remolding continue at the wound site long after the injury.
The body is constantly trying to remodel the scar collagen to achieve the
original collagen ultrastructure that was present before the injury. This
remodeling involves ongoing collagen synthesis and collagen degradation.
Anything that interferes with protein synthesis will cause the equilibrium to
shift, and collagen degradation will be greater than collagen synthesis. For
example, patients who are malnourished or patients receiving chemotherapy
may experience wound dehiscence, because the wound site will become
weak due to a shift in the balance toward collagen degradation. It is of
interest to note that when wounds in the fetus heal, they do so in such a
manner that the original collagen ultrastructure is achieved.(Mast BA, Flood
LC, Haynes JH, et al. 1991) If only we understood more about the biology
and mechanisms responsible for the rapid and optimal wound healing
response seen in the fetus, we would have greater insight into the
management of adult wounds.(Mast BA, Diegelmann RF, Krummel TM, Cohen
IK. 1974)
Ⅰ-5. Collagen degradation
Collagens can be degraded prior to or after their secretion from the cell.
Secreted collagen is degraded mainly by two different routes: proteolytic
and phagocytotic. Proteolytic degradation occurs mainly through matrix
metalloproteinase (MMP) activity. Magrophages remove ECM components,
however also fibroblasts are able to the phagocytosis and degradation of
collagen fibrils (Everts et al. 1996). Initial fragmentation of insoluble
collagens occurs through mechanical wear, the action of free radicals and
- 23 -

proteinase cleavage. Degradation is continued by specific proteinases and
the resulted collagen fragments are phagocytozed by cells and processed by
lysosomal enzymes. (Cimpean &Caloianu 1997) The proportion of newly
synthesized collagen degraded is about 26 % per day in young adult rats
(Mays et al. 1991), and the most recently synthesized collagen seems to be
more susceptible to degradation than mature collagen (Laurent 1987).
Ⅰ-5.1. MMPs
Matrix metalloproteinases (MMPs) are important components in many
biological and pathological processes because of their ability to degrade
ECM components. They probably have a key role in tumor invasion,
metastasis and angiogenesis. In addition to their role in ECM remodeling,
MMPs may regulate paracrine signals by inactivating directly e.g.
angiotensins I and II, bradykinin and substance P. MMPs can also degrade
fibrinogen and inactivate Factor XII, suppressing the mechanisms for blood
clotting. Because of their role in degradation of interstitial elastic fibers,
MMPs appear to have important roles in the formation of pulmonary
emphysema and intracranial and aortic aneurysms. (Sternlicht &Werb 2001)
Up till now, 24 different vertebrate MMPs have been identified, of which 23
have been found in humans (Visse &Nagase 2003). Sequence homology with
MMP-1, cysteine switch motif PRCGXPD in the propeptide and the
zinc-binding motif HEXGHXXGXXH in the catalytic domain are the special
features that assign proteinases to this family (Visse &Nagase 2003). Even
though many MMPs are known to have wide and overlapping substrate
specificity, MMPs are usually categorized according to their main substrates
- 24 -

into collagenases, gelatinases, stromelysins, matrilysins, membrane-type
MMPs and others.
MMP-1, MMP-8, MMP-13 and MMP-18 are collagenases with the ability
to cleave the native helical structure of interstitial collagens I, II and III
(Cimpean &Caloianu 1997, Kähäri &Saarialho-Kere 1999, Li et al. 2000,
Visse &Nagase 2003). Cleavage products are then susceptible to the action
of other MMPs (Cimpean &Caloianu 1997).
Gelatinases (MMP-2 and MMP-9) degrade denatured collagen, gelatin,
native type IV, V and VII collagens as well as other ECM components
(Collier et al. 1988, Wilhelm et al. 1989, Trocmé et al. 1998, Visse
&Nagase 2003). MMP-2 also digests fibrillar type I and II collagens (Aims
&Quigley 1995, Patterson et al. 2001).
Although stromelysin-1 (MMP-3) and -2 (MMP-10) share substrate
specificities for ECM components and they both activate proMMP-1, MMP-3
is proteolytically more efficient than MMP-10 (Visse &Nagase 2003). The
third stromelysin, MMP-11, differs from the other stromelysins by its
sequence and substrate specificity and it is therefore sometimes grouped
with “other MMPs” (Visse &Nagase 2003).
Matrilysins (MMP-7 and MMP-26) are the smallest MMPs. In addition to
the ECM components digested by them, MMP-7 can also process cell
surface molecules (Visse &Nagase 2003).
Six membrane-type MMPs (MT-MMPs) have been characterized. With the
exception of MT4-MMP, they all have a broad spectrum of substrate
specificity, and they are all capable of activating proMMP-2
(Hernandez-Barrantes et al. 2002, Visse &Nagase 2003). The expression of
- 25 -

MT5-MMP (MMP-24) is restricted to brain, while the other MT-MMPs are
more widely expressed (Visse &Nagase 2003). For their pericellular
fibrinolytic activity, MT-MMPs have an important role in angiogenesis
(Sternlicht &Werb 2001).
Seven MMPs are currently classified into the group of “other MMPs”.
MMP-12 is mainly expressed in macrophages and it degrades a large
variety of proteins (Shapiro et al. 1993). MMP-19 is a novel member
identified from patients with rheumatoid arthritis, therefore initially named
RASI-1 (Kolb et al. 1997). MMP-20 is currently considered a tooth-specific
MMP, with the expression strictly restricted to dental cells in vivo
(Palosaari et al. 2003). MMP-22 is known to be expressed in chicken
embryo fibroblasts, and it seems to digest gelatine (Yang &Kurkinen 1998).
MMP-23 is a transmembrane protein expressed in reproductive tissue (Visse
&Nagase 2003). The expression patterns of the newest member of the MMP
family, MMP-28, suggest functions in skin hemostasis and wound repair
(Illman et al. 2003).
The expression of MMPs is primarily regulated at the level of
transcription, while the proteolytic activity is regulated by latent precursor
activation and inhibition of activity. Cytokines, growth factors and
corticosteroids are known to induce or repress the transcription of MMP
genes (See Table 1 for details) (Windsor et al. 1993, Birkedal-Hansen 1995,
Cimpean &Caloianu 1997, Morin et al. 1999, Singer et al. 1999, Feinberg et
al. 2000, Li et al. 2000, Delany &Canalis 2001, Kang et al. 2001, Mauch et
al. 2002). On the other hand, MMPs are known to regulate the activity of
many cytokines and growth factors (Sternlicht &Werb 2002, Visse &Nagase
- 26 -

2003). While plasmin is a potent activator of various MMPs, the zymogens
can also be activated by other enzymes as well as other MMPs (Bassi et al.
2000, Kotra et al. 2001, Palosaari et al. 2002, Illman et al. 2003). In
addition to its role in inhibition of MMPs, TIMP-2 also has a role in the
activation of MMP-2 (Strongin et al. 1995). The modulators of the latest
MMPs are presently unknown.
MMP-1, MMP-2, MMP-9 and MMP-16 are expressed in bovine skeletal
muscle on mRNA level (Balcerzak et al. 2001), and MMP-1, MMP-2 and
MMP-9 proteins in human skeletal muscle (Singh et al. 2000). Although
MMP-13 and MMP-15 expression are not observed in the bovine muscle,
their mRNAs are found in the RNA extracted from skeletal muscle
connective tissue cells (Balcerzak et al. 2001). Therefore it seems that
MMP-13 and MMP-15 are expressed in skeletal muscle in tiny amounts. In
muscle diseases, also MMP-3, MMP-7, MMP-10 and MMP-11 proteins have
been reported in human skeletal muscle (Schoser &Blottner 1999, Kieseier
et al. 2001). In skeletal muscle, MMPs are primarily expressed by
fibroblasts, although some level of expression has been found to occur also
in satellite cells (Guérin &Holland 1995, Balcerzak et al. 2001). MMP-9 is
expressed in skeletal muscle mainly by infiltrating leukocytes (Kherif et al.
1999, Kieseier et al. 2001).
Ⅰ-5.1.1. MMP inhibition by TIMPs
MMP activity can be specifically inhibited by tissue inhibitors of
metalloproteinases (TIMPs) as well as by non-specific inhibitors including
e.g. α2-macroglobulin, RECK and tissue factor pathway inhibitor-2 (Baker et
- 27 -

al. 2002, Visse &Nagase 2003). Four TIMPs have been characterized and
observed to regulate MMP activity during tissue remodeling (Docherty et al.
1985, Stetler-Stevenson et al. 1989, Apte et al. 1995, Greene et al. 1996).
TIMPs are specific inhibitors that bind MMPs in a 1:1 stoichiometry (Visse
&Nagase 2003). All TIMPs (TIMP-1, -2, -3 and -4) are capable of
inhibiting all MMPs, with the exception that TIMP-1 is a poor inhibitor of
MMP-19 and most of the MT-MMPs (Baker et al. 2002). TIMP-3 appears
to be a more potent inhibitor of MMP-9 than other TIMPs (Sternlicht
&Werb 2001). Although TIMP-2 inhibits MMP-2 in high concentrations, it
has an important role in activating proMMP-2 in a complex with MT1-MMP
(Strongin et al. 1995). MT1-MMP is the most efficient MMP-2 activator;
however, also MT3-MMP, and in some species MT2-MMP, is able to
activate MMP-2 (Sternlicht &Werb 2001). At first, TIMP-2 binds to
MT-MMP and at the same time acts as a receptor for proMMP-2. Then,
another MT-MMP cleaves and activates the bound proMMP-2. Fully active
form of MMP-2 is achieved by removal of the residual portion of the
propeptide by another MMP-2 molecule. (Sternlicht &Werb 2001) TIMP-4
can prevent the activation by displacing TIMP-2 (Hernandez-Barrantes
2002).
In addition to MMP-inhibiting activities, TIMPs have many important
biological functions. TIMPs can promote or inhibit cell growth, depending on
the cell type and inductor (Baker et al. 2002, Visse &Nagase 2003). While
TIMP-1 and TIMP-2 have antiapoptotic activity, TIMP-3 is proapoptotic
(Baker et al. 2002). Great clinical interest is focused on the reduction of
tumor growth by over expression of TIMP-1, TIMP-2 and TIMP-3, although
their use in therapy has so far been disappointing (Whittaker et al. 1999,
- 28 -

Baker et al. 2002). Although TIMPs inhibit the growth of some cancer cells
in vivo, upregulation of TIMP-1 is often associated with a poor prognosis,
since TIMP-1 may even promote tumor growth in an MMP-dependent or
-independent manner (Sternlicht &Werb 2001).
The TIMPs expressed in skeletal muscle are TIMP-1, TIMP-2 and TIMP-3
(Singh et al. 2000, Balcerzak et al 2001). TIMP-4 appears to be
cardiac-specific (Li et al. 2000), and it has not been found in skeletal
muscle.
Ⅰ-5.2. Other forms of collagen degradation
Degradation prior to secretion occurs in the Golgi apparatus (Laurent
1987). This type of degradation is suggested to represent basal turnover,
while intracellular degradation in lysosomes occurs when the rate of
degradation increases due to the production of defective collagen (Laurent
1987). If the collagen is secreted, degradation may occur either before or
after the incorporation of the collagen molecules into a fibril. Phagocytosis
of collagen fibrils by fibroblasts seems to be continuous process in the
remodeling of the ECM (Everts et al. 1996). After phagocytosis, collagen is
digested in lysosomes by cysteine proteinases such as cathepsin B and/or L
(Everts et al. 1996). Phagocytosis and intracellular digestion is modulated by
cytokines and growth factors, including TNFα, TNFβ , IL-1α and TGFβ (van
der Zee et al. 1995, Chou et al. 1996, Everts et al. 1996).
Ⅰ-6. Biological properties of collagen
Collagen has a number of biochemical and biophysical properties, which
- 29 -

makes it an important biomaterial. Theses properties include: solubility,
strength, mediation of intracellular interactions, controllable stability,
biodegradability, and low immunogenicity.
Collagens is biosynthesized in a manner that allows a soluble collagen to
be secreted by the cells and subsequently be modified to produce various
structural patterns.(Stenzel K, Miyata T, Fubin A. 1974) A greater part of
native collagen is insoluble, but most of the insoluble collagen is solubilized
proteolytic enzymes without destroying the basic, rigid triple-helical
structuer.
A physical-mechanical property of collagen is the high tensile strength and
minimal extensibility that depend on the amount of insolouble collagen
present (number of cross-links) and the interaction with glycoproteins and
proteoglycans. Therefore, collagen has the capability of transmitting tensile
and compressive forces of great magnitude.(Harkness R. 1968)
Collagen is a natural substrate for the support and growth of a variety of
cells and tissues in the body. It works as a framework in conjunction with
other extracellular molecules such as glycosaminoglycans and fibronectin. In
addition, it is thought that collagen may promote wound healing because of
other chemotactic properties, acting as nucleation centers that form fibrillar
structures.(Wood G. 1962)
The chemical properties of collagen depend on the presence of covalent
cross-links, which give collagen a controllable stability. There are two types
of cross-links and the intermolecular cross-links.(Williams D. 1985)
Cross-links can be introduced into soluble collagen in vitro by physical or
chemical reagents, giving it structure and stability.
Collagen is biodegradable, being degraded in vitro by collagenases that
- 30 -

produce clealvage under physiological conditions of pH and
temperature.(Mandl I. 1970) This process is a biological mechanism that,
concomitantly with its biosynthesis, controls growth, morphogenesis, and
repair of collagen.(Williams D. 1985) When collagen is transplanted into
tissues, it degrades leaving no permanent foreign residue. This property can
be reduced of even suppressed by cross-linking.(Panduraga Rao K. 1995)
Collagen has low immunogenicity, particularly when in a purified,
undenatured form.(Timpl R. 1982) The primary antigenic loci of collagen are
locatied at both the C- and N-terminal regions of the molecule in the
nonhelical structures called telopeptides. The weak antigenicity of collagen
has been related to its ability to resist digestion by the usual proteolytic
enzymes(Kirrane J, van Robertson W. 1968) and to the ability of its helical
structure to mask potential antigenic determinants.(Oliver R. 1987)
- 31 -

Ⅱ. Collagen and Ascorbic acid
L-ascorbic acid stimulates procollagen synthesis in cultured human skin
fibroblasts without appreciably altering noncollagen protein synthesis. The
effect is unrelated to intracellular degradation of newly synthesized
procollagne.(Lind J, Stewart CP, Guthrie D. 1953) Levels of mRNA for pro α
-1(I), pro α-2(I), and α-1(III), measured by hybridization with the
corresponding cDNA probes, are elevated in the presence of ascorbic acid,
whereas the level of mRNA for procollagen, measured in a cell-free
translation assay, are specifically increased in the presence of ascorbic acid.
Thus, ascorbic acid appears to control the expression of three different
procollagen genes, each of which is located on a separate chromosome. It is
proposed that intracellularlly accumulated procollagen in ascorbate deficiency
may lead to a traslational repression of procollagen synthesis. Ascorbic acid
may relieve this block by promoting hydroxyproline formation and,
consequently, secretion of procollagen from the cell. The increased level of
procollagen mRNA under the influence of ascorbic acid may be secondary to
increased synthesis of procollagen polypeptides; the control point may be
gene transcription or mRNA degradation.
Ⅱ-1. Ascorbic acid
Unlike most other animals, humans and guinea pigs are unable to
synthesize ascorbic acid by virtue of the fact that they lack L-gulono-γ
-lactone oxidase, the last enzyme in the pathway for synthesis of
L-ascorbic acid from D-glucuronic acid. When humans are deprived of
- 32 -

dietary ascorbic acid, scurvy develops with its attendant connective tissue
manifestations, including poor wound healing and prominent bruising. In
1753, James Lind, a Scottish physician, carefully described scurvy and its
dietary control in a book entitled A Treatise on the Scurvy.(Lind J, Stewart
CP, Guthrie D. 1953) The identification of the dietary factor as ascorbic
acid was reported in 1932.(Svirbely JL, Szent-Györgi A. 1932; Waugh WA,
King CG. 1932) In a remarkable experiment, John Crandon, a Harvard
surgeon, placed homself on an ascorbate-free diet for six months.(Crandon
JH, Lund CC, Dill DB. 1940) Hyperkeratotic skin papules with ingrown hairs
was the first clinical sigh of scurvy, followed by petechiae on the legs after
five months. Poor wound healing occurred when the platelet ascorbate level
fell to zero. Many studies have emphasized the importance of ascorbic acid
in wound healing. Ascorbic acid is concentrated in healing wounds,(Bartlett
MK, Jones CM, Ryan AE. 1942; Abt AF, von Schuching S. 1961) and its
circulating levels are acutely diminished following skin injury.(Crandon JH,
Lennihan R Jr, Mikal S, et al. 1961) Wound dehiscence occurs commonly in
patients with low plasma ascorbate levels.((Crandon JH, Lennihan R Jr, Mikal
S, et al. 1961) Skin appears to be especially vulnerable to ascorbate
deficiency. Among tissues from scorbutic guinea pigs, skin has been found
to be most deficient in its capacity for collagen synthesis,(Bates CJ. 1979)
apparently because ascorbic acid is preferentially depleted from skin to
sustain other bodily functions. In humans, the total pool of ascorbic acid
approaches 20mg/kg or about 1500mg per average body weight; the pool
turns over with a half-life of ten to 20 days.(Hornig D. 1981) Nonsmokers
require 100mg/d and smokers require 140mg/d to maintain a saturated pool.
Gastrointestinal absorption of ascorbic acid utilizes a sodium-dependent,
- 33 -

electroneutral, activetransport mechanism.(Stevenson N. 1974) Ascorbate
requirements are increased in diseased and elderly persons.(Benerjee AK,
Etherington M. 1974; Schorah CJ, Newill A, Scott DL, et al. 1979) It is
unclear whether inadequate absorption and/or abnormal metabolism accounts
for these observations.
Ascorbic acid is essential for growth and maintenance of connective tissue.
it is a cofactor for several hydroxylating enzymes in the body,(Englard S,
Seifter S. 1986, Levine M. 1986) including prolyl hydroxylase and lysyl
hydroxylase, enzymes that hydroxylate prolyl and lysyl residues,
respectively, in the procollagen polypeptide to form hydroxyproline and
hydroxylysine. Hydroxyproloine is essential for maximum stability of the
triple helix and, consequently, for secretion of procollagen from the cell.
Hydroxylysine, on the other hand, participates in cross-link formation and
serves as a site for covalent attachment of galactosyl of glucosylgalactosyl
residues during collagen biosynthesis. A recently discovered function of
hydroxylysine in collagen is to act as an acceptor for phosphate
residues.(Urushizaki Y, Seifter S. 1985) Although the ability of ascorbic acid
to support hydroxylation reactions in collagen biosynthesis has been used as
an explanation for the connective tissue manifestations of scurvy, recent
ecidence suggests that ascorbic acid may also influence the synthesis of
collagne, apparently independentn of hydroxylation.
A notable experiment pointing to this additional effect of ascorbic acid in
collagen biosynthesis was carried out by Jeffrey and Martin.(Jeffrey JJ,
Martin GR. 1966) They cultured embryonic chick long bones in the presence
and absence of ascorbic acid in a defined tissue culture medium. The long
bones cultured in the presence of ascorbic acid achieved a much larger size
- 34 -

than those cultured in the absence of ascorbic acid. The increase in size
was accompanied by increased collagen production.
Ⅱ-2. Effect of ascorbic acid on collagen production
The synthesis of collagen, for which ascorbic acid is essential, proceeds in
the body as one of its major manufacturing enterprise. A person who is
dying of scurvy stops making this substance, and his body falls apart his
joints fail, because he can no longer keep the cartilage and tendons strong,
his blood vessels break open, his gums ulcerate and his teeth fall out, his
immune system deteriorates, and he dies.
Collagen is a protein, one of the thousands of different kinds of proteins in
the human body. Most proteins occur in only small amounts: the various
enzymes, for example, are so powerful in their ability to cause specific
chemical reactions to take place rapidly that only a gram or two or even a
few milligrams may be needed in the body. There are a few exceptions.
There is ia great amount of hemoglobin in red blood cells. There is even
more collagen in the skin, bones, teeth, blood vessels, eye, heart, and, in
fact, essentially all parts of the body. Collagen as strong white fibers,
stronger than steel wire of the same weight, and as yellow elastic networks
(called elastin), usually together with macropolysaccharides, constitutes the
connective tissue that holds our bodies together.
Like other proteins, collagen consists of polypeptide chains; the long chains
of this fibrous molecule contain about one thousand amino-acid residues,
about sixteen thousand atoms. It differs from almost all other proteins in
being substantially composed of but two amino acids, glycine and
hydroxyproline. Collagen is a kind of super-molecule, however, in its
- 35 -

three-dimensional architecture. The polypeptide chains of the two amino
acids, alternating with one another and punctuated by the presence of
certain other amino acids, are coiled in a left-handed helix. Three of these
helical strands are twisted around on another, like strands of a rope, in a
right handed super-helix, to compose the complete molecule.
Understandably, the synthesis of this structure proceeds in steps. While it
has been known for half a century that ascorbic acid is essential to the
manufacture of collagen, the process is only now yielding to inquiry. It
appears that ascorbic acid is involved at every step.
First, a three dimensional stranded structure is assembled, with the amino
acids glycine and proline as its principal components. This is not yet
collagen but its precursor, procollagen. A recent study shows that ascorbic
acid must have an important role in its synthesis. Prolonged exposure of
cultures of human connective-tissue cells to ascorbate induced an eight-fold
increase in the synthesis of collagen with no increase in the rate of
synthesis of other proteins.(Mirad et al. 1981) Since the production of
procollagen must precede the production of collagen, ascorbic acid must
have a role in this step, the formation of the polypeptide chains of
procollagen, along with its better understood role in the conversion of
procollagen to collagen.
The conversion involves a reaction that substitutes a hydroxyl group, OH,
for a hydrogen atom, H, in the proline residues at certain points in the
polypeptide chains, converting those residues to hydroxyproline. This
hydroxylation reaction secures the chains in the triple helix of collagen. The
hyhdroxylation, next, of the residues of the amino acid lysine, transforming
them to hydroxylysine, is then needed to permit the cross-linking of the
- 36 -

triple helices into the fivers and networks of the tissues.
These hydroxylation reactions are catalyzed by two different enzymes:
prolyl-4-hydroxylase and lysyl-hydroxylase. Ascorbic acid also serves with
them in inducing these reaction. It has recently been shown by Myllyla and
his colleagues one molecule of ascorbic acid is destroyed for each H
replaced by OH.(Myllyla et al. 1984)
- 37 -

Ⅲ. Collagen and Silicon
Silicon (Si) is a ubiquitous environmental element found mainly as insoluble
silicates, although small amounts of soluble Si are also present in natural
waters, chiefly as orthosilicic acid [Si(OH)4].(Farmer VC. 1986) Around
neutral pH, orthosilicic acid polymerises at concentrations much above 2
mM, forming a range of silica species from soluble dimers to colloids and
solid phase silica (Iler RK..1979) Some plants and lower animals may
promote this reaction, as they use polymeric silica for structure and
growth.(Cha JN, Shimizu K, Zhou Y, Christiansen SC, Chmelka BF, Stucky
GD, Morse DE. 1999; Kröger N, Deutzmann R, Sumper M. 1999; Sangster
AG, Hodson MJ. 1986) The normal diet contains orthosilicic acid present in
water or following hydrolysis of foods in the gastrointestinal tract,
nonhydrolyzed polymeric silica from plants (Pennington JA. 1991), and
silicates due mainly to soil and dust contamination or as food additives
(Hansen M, Marsden J. 1987; Villota R, Hawkes JG. 1986). Absorption
studies have shown that only orthosilicic acid is in a bioavailable form with
uptake in humans exceeding 50% of the ingested dose (Jugdaohsingh R,
Reffitt DM, Oldham C, Day JP, Fifield K, Thompson RPH, et al. 2000; Reffitt
DM, Jugdaohsingh R, Thompson RPH, Powell JJ. 1999). Fasting
concentrations of Si in plasma are 2-10 M, rising to 20-30 M after meals,
and approximately 700 mol/day is normally excreted in urine.
In 1972, Carlisle (Carlisle EM. 1972) and Schwarz and Milne (Schwarz K,
Milne DB. 1972) first reported that silicon deficiency in chicks and rats led
to abnormally shaped bones and defective cartilagenous tissue, both of
- 38 -

which were restored upon the addition of soluble Si to their diet. This led
to the suggestion that Si may play an important role in connective tissue
metabolism especially in bone and cartilage. The element's primary effect in
bone and cartilage is thought to be on matrix synthesis rather than
mineralization, although its influence on calcification may be an indirect
phenomenon through its effects on matrix components (Seaborn CD, Nielsen
FH. 1994).
Many of these earlier studies and more recent ones on extracellular matrix
formation have been mainly carried out in animals such as chicks
(Jugdaohsingh R, Reffitt DM, Oldham C, Day JP, Fifield K, Thompson RPH,
et al. 2000), rats (Hott M, de Pollak C, Modrowski D, Marie PJ. 1993; Rico
H, Gallego-Lago JL, Hernandez ER, Villa LF, Sanchez-Atrio A, Seco C, et
al. 2000; Schwarz K, Milne DB. 1972), and calves (Calomme MR, Vanden
Berghe DA. 1997). The effects of soluble Si on bone matrix synthesis has
not been confirmed in humans and differences may exist. There is also a
paucity of studies on the effects and the mechanisms of cellular action of
soluble Si on human osteoblasts. Studies of the effects of soluble Si on
human osteoblasts in vitro have been done using Zeolite A (ZA) which is a
silicon-containing compound (Keeting PE, Oursler MJ, Wiegand KE, Bonde
SK, Spelsberg TC, Riggs BL. 1992). Keeting et al. (Keeting PE, Oursler MJ,
Wiegand KE, Bonde SK, Spelsberg TC, Riggs BL. 1992) showed that ZA
stimulated the proliferation and differentiation of cultured cells of the
osteoblast lineage but they failed to demonstrate any effect of ZA on matrix
synthesis. Furthermore, ZA hydrolyzes to release both silicic acid and
aluminium salts, and thus the active component of this compound is not
established. An important aspect of bone formation is the synthesis and
- 39 -

deposition of collagen type Ⅰ, which constitutes 90% of the total organic
extracellular matrix in mature bone, by preosteoblasts or early
undifferentiated osteoblast-like cells (Boskey AL, Wright TM, Blank RD.
1999).
- 40 -

Ⅳ. Prolyl hydroxylase
Collagen prolyl 4-hydroxylases (P4Hs, EC 1.14.11.2) are located within the
lumen of the endoplasmic reticulum and catalyze the formation of
4-hydroxyproline by the hydroxylation of prolines in -X-Pro-Gly-
sequences in collagens and more than 15 other proteins that have
collagen-like domains (Kivirikko and Myllyharju, 1998; Kivirikko and
Pihlajaniemi, 1998; Myllyharju and Kivirikko, 2001). P4Hs have a central
role in the biosynthesis of collagens, as 4-hydroxyproline residues are
essential for the formation of the collagen triple helix. In addition, a novel
and distinct family of cytoplasmic prolyl 4-hydroxylases playing a critical
role in the regulation of the hypoxia-inducible transcription factor HIF a has
recently been identified (Bruick and Mc- Knight, 2001; Epstein et al., 2001).
No overall amino acid sequence homology is detected between the collagen
and HIF P4Hs, with the exception that the catalytically critical residues are
conserved.
Collagen P4Hs from all vertebrate sources studied are α2β2 tetramers in
which the β subunit is identical to protein disulfide isomerase (PDI)
(Kivirikko and Myllyharju, 1998; Kivirikko and Pihlajaniemi, 1998). Several
isoforms of the catalytic a subunit are found in human and mouse tissues,
Caenorhabditis elegans and Drosophila melanogaster (Veijola et al., 1994;
Helaakoski et al., 1995; Annunen et al., 1997, 1999; Friedman et al., 2000;
Hill et al., 2000; Winter and Page, 2000; Abrams and Andrew, 2002;
Riihimaa et al., 2002). Successful production of active recombinant P4H by
coexpression of the a and PDI/β subunits in insect cells (Vuori et al., 1992)
- 41 -

and yeast (Vuorela et al., 1997) has made it possible to study the molecular
and functional properties of various P4Hs in detail, and to develop
high-level recombinant expression systems for human collagens in insect
cells, yeasts and plants (Lamberg et al., 1996; Myllyharju et al., 1997;
Vuorela et al., 1997; Toman et al., 2000; Nokelainen et al., 2001a; Merle et
al., 2002).
Ⅳ-1. Gene regulation of prolyl 4-hydroxylase
The main function of prolyl 4-hydroxylase is to produce stable
triple-helical collagen, and therefore a good correlation is found between
the rate of collagen synthesis and the amount of active enzyme
tetramer(Kivirikko et al. 1992). In most cells and tissues, the PDI
polypeptide is produced in a 10-100 fold excess over the α(Ⅰ) subunit, and
the regulation of the active enzyme tetramer thus mainly occurs through
regulation of the amount of the α subunits(Kivirikko et al. 1992) Several
papers have reported that high lactate levels and low oxygen tension can
stimulate prolyl 4-hydroxylase α(Ⅰ) subunit have been shown to increase
2-3 fold after an 8h exposure to hypoxia, and return to basal level after
reoxygenation, indication that the α(Ⅰ) subunit gene is a target for the
hypoxia-inducible transcription factor-1α(Takahashi et al. 2000). Under
normal physiological conditions, the level of procollagen production may be
affected by the availability of cofactors for polyl 4-hydroxylase (Myllylӓ et
al. 1977; Myllyӓ et al. 1978; Kivirikko et al. 1992)
Cells seem to have a mechanism by which recognize unhydroxylated
nonhelical collagen molecules and rapidly degrade them in the intracellular
space (Breul et al. 1980; McLauhglin & Bulleid 1998). The molecular
- 42 -

mechanism leading to this retention has been postulated to be mediated
either by prolyl 4-hydroxylase itself (Kao et al. 1979; Walmsley et al.
1999) or by collagen binding protein HSP47 (Nagata, 1996; Nagata, 1998;
Tasab et al. 2000). Also BiP has been shown to retain mutant collagen
chains in the ER(Chessler & Byers, 1992)
- 43 -

Ⅴ. Lysyl hydroxylase
Lysyl hydroxylase (protocollagen-lysine 2-oxoglutarate 5-dioxygenase, E.C.
1.14.11.4) catalyzes the hydroxylation of lysine residues in X-Lys-Gly
triplets in collagens and other proteins with collagenous domains (Kivirikko
et al. 1992, Kivirikko &Pihlajaniemi 1998).
It was suggested at an early stage in collagen research that hydroxylation
of lysine and proline residues might be catalyzed by a single enzyme,
protocollagen hydroxylase (Kivirikko &Prockop 1967). The reaction
mechanism of lysyl hydroxylase is in fact very similar to that of prolyl
4-hydroxylase, requiring similar substrates and the same cosubstrates
(Kivirikko &Pihlajaniemi 1998). It was demonstrated later, however, that
these two enzymatic activities involve two separate enzymatic sites
(Weinstein et al. 1969) and that purified proline hydroxylase does not act on
lysine residues (Halme et al. 1970). Kivirikko and Prockop (1972) partially
purified lysyl hydroxylase from chick embryos by DEAE cellulose
chromatography and gel filtration and showed that it is indeed a separate
enzyme from prolyl hydroxylase. It was further purified from chick embryos
and chick embryo cartilage by conventional methods (Ryhänen 1976), and
subsequently by an affinity chromatography procedure involving concanavalin
A-agarose (Turpeenniemi et al. 1977). Finally, it was purified to
homogeneity from chick embryos and human placental tissues by means of
two affinity column procedures (Turpeenniemi-Hujanen et al. 1980, 1981).
Lysyl hydroxylase catalyzes the hydroxylation of lysine in -X-Lys-Gly-
sequences in collagens and other proteins with collagen-like sequences. The
- 44 -

esulting hydroxylysine residues have tso important functions: they act as
attachment sites for carbohydrate units and are essential for the stability of
the intermolecular collagen cross-links. LH is a homodimer with a subynit
molecular weight of approximately 82000(for a recent review, see Kivirikko
and Pihlajaniemi, 1998). Three isoenzymes of human LH have so far been
cloned and characterized(Hautala et al., 1992; Yeowell et al., 1992;
Valtacaara et al., 1997, 1998; Passoja et al., 1998; Ruotsalainen et al.,
1999; Yeowell and Walker, 1999).
Deficiency in LH1 activity leads to the type Ⅵ variant of the
Dhlers-Danlos syndrome, which includes a number of connective tissue
abnormalities(Steinmann et al., 1993; Kivirikko and Pihlajaniemi, 1998).
Several mutations in the LH1 gene have been characterized in patients with
this disease (Hyland et al., 1992; Hautala et al., 1993; Ha et al., 1994;
Pousi et al., 1994, 1998; Heikkinen et al., 1997; Brinckmann et al., 1998;
Walker et al., 1999). Duplication of seven exons in the gene is a common
mutaion and explains approximately one-fifth of the cases (Hautala et al,
1993; Pousi et al., 1994; Heikkinen et al., 1997). This duplication is caused
by an Alu-Alu recombination in introns 9 and 16, which contain many Alu
repeats(Heikkinen et al., 1994; Pousi et al., 1994). The genes for LH1, LH2
and LH3 have been assigned to 1p36.2-36.3 (Hautala et al., 1992), 3q23-24
(Szpirer et al., 1997) and 7q36 (Valtavaara et al., 1998), but no data are
available on the structures of the LH2 and LH3 genes. Also, no disease has
so far been demonstrated to be due to mutations in either of these two
genes.
- 45 -

Literature Cited
Anttinen H, Myllyla R, Kivirikko KI. Further characterization of
galactosylhydroxylysyl glucosyltransferase from chick embryos. Amino acid
composition and acceptor specificity. Biochem J 175:737-742, 1978
Anttinen H, Oikarinen A, Kivirikko KI. Age-related changes in human skin
collagen galactosyltransferase and collagen glucosyltransferase activities.
Clin Chim Acta 76:95-101, 1977
Ayello EA, Thomas DR, Litchford MA. Nutritional aspects of wound healing.
Home Health Nurse 17:719-30, 1999
Bailey AJ, Robins SP, Balian G. Biological significance of the intermolecular
crosslinks of collagen. Nature 251:105-9, 1974
Baughan L, Mendler M, Huber S, et al. D-periodic distribution of collagen type
Ⅸ along cartilage fibrils. J Cell Biol. 106:991-997, 1988
Bellamy G, Bornstein P. Evidence for procollagen, a biosynthetic precursors of
collagen. Proc Natl Acad Sci USA 68:1138-1142, 1971
Bienkowski RS, Baum BJ, Crystal RG. Fibroblasts degrade newly synthesised
collagen within the cell before secretion. Nature 276:413-416, 1978
Bornstein P. The biosynthesis of collagen. Annu Rev Biochem. 43:567-603,
1974
Bostom AG, Cupples LA, Jenner JL, Ordovas JM, Seman LJ, Wilson PW,
Schaefer EJ, Castelli WP. Elevated plasma lipoprotein(a) and coronary heart
disease in men aged 55 years and younger. A prospective study. Framingham
Study, Epidemiology and Biometry Program, Framingham, Mass., USA. JAMA
276(7):544-8, 1996
Burgeson R, Nimni M. Collagen types. Molecular structure and tissue
distribution. Clin Orthop. 282:250-272, 1992
Burgeson R. New collagens, new concepts. Annu Rev Cell Biol. 4:551-577,
- 46 -

1988
Burgeson RE. The collagens of skin. Curr Probl Dermatol 17:61-75, 1987
Clore JN, Cohen IK, Diegelmann RF. Quantitation of collagen types I and III
during wound healing in rat skin. Proc Soc Exp Biol Med 161:337-40, 1979
Diegelmann RF, Peterkofsky B. Inhibition of collagen secretion from bone and
cultured fibroblasts by microtubular disruptive drugs. Proc Natl Acad Sci USA
69:892-6, 1972
Eyre D, Wu J. Type or 1α2α3α collagen. In; Structure and Function of Collagen
Types. New york: Academic Press 261-281, 1987
Fessler J, Fessler L. Type Ⅴ collagen. In: Structure and Function of Collagen
Types. New York: Academic Press 81-103, 1987
Fratzl P, Misof K, Zizak I, Fibrillar structure and mechanical properties of
collagen. J Struct Biol. 122:119-122, 1997
Fujita T; Takaoka A; Izumi M; Takahashi M. Association of an acute reduction
in lipoprotein(a) with coronary artery restenosis after percutaneous
transluminal coronary angioplasty. Circulation 96(1):166-73, 1997
Golub LM, Lee HM, Ryan ME, Giannobile WV, Payne J, Sorsa T. Tetracyclines
inhibit connective tissue breakdown by multiple non-antimicrobial
mechanisms. Adv Dent Res 12:12-26, 1998
Gordon M, Gerecke E, Dublet B, et al. Type Ⅶ collagen. A large multidomain
molecule with partial homology to type Ⅸ collagen. J Biol Chem.
264:19772-19778, 1989
Graham MF, Diegelmann RF, Elson CO, et al. Collagen content and types in the
intestinal strictures of Crohn's disease. Gastroenterology 94:257-65, 1988
Gross J, Harper E, Harris ED, et al. Animal collagenases: Specificity of action,
and structures of the substrate cleavage site. Biochem Biophys Res Commun
61:605-12, 1974
Gross RL. The effect of ascorbate on wound healing. Int Ophthalmol Clin
40:51-7, 2000
- 47 -

Harkness R. Treatise on Collagen. New York: Academic Press 248-253, 1968
Hirschmann JV, Raugi GJ. Adult scurvy. J Am Acad Dermatol 41:895-910, 1999
Hulems D, Wess T, Prockop D, et al. Radial packing, order, and disorder in
collagen fibrils. Biophys J. 68;1661-1670, 1995
Hulmes D. The collagen superfamily-Diverse structures and assemblies. Essays
Biochem. 27:49-67, 1992
Johanna Myllyharju. Prolyl 4-hydroxylase, the key emzymes of collagen
biosynthesis. Matrix Biology 22:15-24, 2003
Kadler K, Holmes J, Trotter J. Collagen fibril formation. Biochem J. 316:1-11,
1996
Kagan H, Trackman P. Properties and function of lysyl oxidase. Am J Respir
Cell Mol Biol. 5:206-210, 1991
Kirrane J, van Robertson W. The antigenicity of native and tyrosylated
neutral-salt-soluble rat collagen. Immunololy. 14:139-148, 1968
Kivirikko KI, Myllyla R. Collagen glycosyltransferases. Int Rev Connect Tissue
Res 8:23-72, 1979
Kivirikko KI, Risteli L. Biosynthesis of collagen and its alterations in
pathological states. Med Biol 54:159-186, 1976
Lapiere CM, Lenaers A, Kohn LD. Procollagen peptidase: An enzyme excising
the coordination peptides of procollagen. Proc Natl Acad Sci USA 68:3054-8,
1971
Lichtenstein JR, Martin GR, Kohn LD, Byers PH, McKusick VA. Defect in
conversion of procollagen to collagen in a form of Ehlers-Danlos syndrome.
Science 182:298-300, 1973
Mandl I. Collagenases. 1sted. New York: Gordn and Breach 1-16, 1970
Mast BA, Diegelmann RF, Krummel TM, Cohen IK. Scarless wound healing in
the mammalian fetus. Surg Gynecol Obstet 174:441-451, 1992
Mast BA, Flood LC, Haynes JH. Hyaluronic acid is a major component of the
matrix of fetal rabbit skin and wounds: Implications for healing by
- 48 -

egeneration. Matrix 11:63-8, 1991
Miller EJ, Gay S. The collagens: An overview and update. Methods Enzymol
144:3-41, 1987
Misof K, Rapp G, Fratzl P. A new molecular model for collagen elasticity based
on synchrotron X-ray scattering eveidence. Biophys J. 72:1376-1381, 1990
Mussini E, Hutton JJ, Udenfriend S. Collagen proline hydroxylase in wound
healing, granuloma formation, scurvy, and growth. Science 157:927-9, 1967
Nimni M. The molecular organization of collagen and its role in determinaing the
biophysical properties of the connective tissues. Biotheology. 17:51-82,
1980
Oliver R. Scars and collagen implantation. Burns. 13:S49-S55, 1987
Panduraga Rao K. Recent developments of collagen-based materials for medical
applications and drug delivery systems. J Biomater Sci Polym Ed. 7:623-645,
1995
Pauling L. Rath M. Immunological evidence for the accumulation of
lipoprotein(a) in the atherosclerotic lesion of the hypoascorbemic guinea pig.
Proc Natl Acad Sci USA Dec 87:9388-9390, 1990
Pauling, L, Rath M. Solution to the puzzle of human cardiovascular disease: Its
primary cause is ascorbate deficiency leading to the deposition of
lipoprotein(a) and fibrinogen/fibrin in the vascular wall. J. Orthomolecular
Medicine 16(3&4): 125-133, 1999
Pauling, L; Rath, M. Hypothesis: lipoprotein(a) is a surrogate for ascorbate.
Proc Natl Acad Sci USA Aug 87(16):6204-6207, 1987
Prockop D, Fertala A. The collagen fibril: The almost crystalline structure. J
Struct Biol. 122:111-118, 1998
Prockop DJ, Kivirikko KI, Tuderman L, Guzman NA. The biosynthesis of
collagen and its disorders (first of two parts). N Engl J Med 301:13-23, 1979
Prockop DJ, Kivirikko KI. Collagens: Molecular biology, diseases, and potentials
for therapy. Annu Rev Biochem 64:403-434, 1995
- 49 -

Prockop DJ. What holds us together? Why do some of us fall apart? What can
we do about it? Matrix Biol 16:519-28, 1998
Sandell L, Boyd C. Extracellular Matrix Genes. Orlando: Academic Press 1-270,
1990
Schilling JA. Wound healing. Physiol Rev 48:374-423, 1968
Seyedin S, Rosen D. Matrix proteins of the skeleton. Curr Opin Cell Biol.
2:914-919, 1990
Stenzel K, Miyata T, Rubin A. Collagen as a biomaterial. Annu Rev Biophys
Bioeng. 3:231-253, 1974
Stubbs P; Noble M; Collinson P; O'Connor B Moseley D; Seed M. A prospective
study of the role of lipoprotein(a) in the pathogenesis of unstable angina. Eur
Heart J Apr;18(4):603-7, 1997
Tikka L, Elomaa O, Pihlajaniemi T. Human alpha 1 (XIII) gene. J Biol Chem.
266:17713-17719, 1991
Timpl R, Engel J. Type Ⅵ collagen. In: Structure and Function of Collagen
Types. New York: Academic Press 105-143, 1987
Timpl R. Antibodies to collagen and procollagen. Methods Enzymol.
82:472-498, 1982
van der Rest M, Garrone R. Collagen family of proteins. FASEB J 5:281428-23,
1991
van der Rest M, Mayne R. Type Ⅸ collagen proteoglycan from cartilage is
covalently cross-linked to type Ⅱ collagen. J Biol Chem. 263:1615-1618,
1988
Vuorio E, de Crombugghe B, The family of collagen genes. Annu Rev Biochem.
59:837-872, 1990
Wiestner M, Krieg T, Horlein D, Glanville RW, Fietzek P, Muller PK. Inhibiting
effect of procollagen peptides on collagen biosynthesis in fibroblast cultures.
J Biol Chem 254:7016-7023, 1979
Williams D. Biocompatibility of Tissue Analogs. Boca Raton: CRC Press 5-134,
- 50 -

1985
Wood G. The heterogeneity of collagen solutions and its effect on fibril
formation. Biochem J. 84:429-435, 1962
Yager DR, Zhang LY, Liang HX, Diegelmann RF, Cohen IK. Wound fluids from
human pressure ulcers contain elevated matrix metalloproteinase levels and
activity compared to surgical wound fluids. J Invest Dermatol 107:743-748,
1996
Yamagata M, Yamada K, Yamada S, et al. The complete structure of type ?
collagen. J Cell Biol. 115:209-221, 1991
Yurchenco P, Schittny J. Molecular architecture of basement membranes.
FASEB J. 4:1577-1590, 1990
- 51 -

Chapter II.
Human dermal fibroblast cell에서 ascorbic acid, silicon,
lysine 및 proline이 콜라겐 합성에 미치는 영향
- 52 -

Human dermal fibroblast cell에서 ascorbic acid, silicon, lysine 및
proline이 콜라겐 합성에 미치는 영향
김 선 아
경희대학교 동서의학대학원 의학영양학과
Effect of ascorbic acid, silicon, lysine and proline on collagen synthesis in the
human dermal fibroblast cell(HS27).
Kim Sun Ah
Department of Medical Nutrition, Graduate School of East-West Medical
Science, Kyung Hee University, Seoul 130-701, Korea
ABSTRACT
Collagen I and III are the major components of skin and contain plenty of
lysine and proline, which are hydroxylated with ascorbic acid, oxygen, Fe 2+ ,
ketoglutarate and silicon, ultimately maintaining the strength and elasticity of
the triple helix organization. In this study, we investigated the effect of
various nutrients, such as ascorbic acid, silicon, lysine, proline and Fe which
function as cofactor or building blocks in proline and lysine hydroxylation,
- 53 -

on collagen synthesis. When the physiological concentrations of ascorbic
acid (0-100μM), silicon (0-50μM), lysine (0-150μM), proline (0-300μM) and
Fe(0-50μM) were treated at human dermal fibroblast cells(HS27 cells) for
either 3 or 5 days, ascorbic acid and silicon at the low concentration (5-10
μM) increased the expression of collagen I and III proteins by 115-1300%
without increasing cell proliferation. 3 day treatment of Fe increased the
expression of collagen I and III proteins up to 300%, but it also increased
cell proliferation by 160%. Lysine and proline only increased cell
proliferation without increasing the expression of collagen proteins
When the mRNA expression of porlyl hydroxylase (PH) and lysyl
hydroxylase (LH) were determined in each treated cells by RT-PCR, 5μM
treatment of ascorbic acid and silicon for 3 days highly increased mRNA
expression of either PH or LH selectively (150-2000%). 20μM treatment of
Fe for 3 days increased mRNA expression of LH by 200%. Taken together,
our data demonstrate that of several nutrients, which involved in protein
synthesis and elasticity of collagens, ascorbic acid is the most effective for
expression of collagen I and III proteins with selective increased expression
of PH mRNA. Silicon was the second best for these process with selective
increased expression of LH mRNA. Although HS27 cell proliferation was
increased at certain degree, Fe also seems to increase these process with
small but certain degree of increased mRNA expression of LH.
key words: human dermal fiboroblast, collagen, prolyl hydroxylase, lysyl
hydroxylase
- 54 -

1. 서론
피부는 탄력성을 지닌 고체의 성질과 점성을 가지는 유체의 성질을 동시에 지닌
복잡한 신체 기관이며 이로 인해 가지게 되는 피부의 기계적 특성을 점탄성
(viscoelastic property)이라 한다. 피부의 기계적인 성질은 여러 외부적 차이에 의
해서도 영향을 받지만 내부 요인들에 의해서도 영향을 받는데 주로 진피 층의 변화
로 말미암은 것이다. 진피 세포 사이의 collagen, elastin은 피부의 점탄성 유지에
중요한 역할을 하는 것으로 알려져 있으며 1,2,3) collagen이 부족하면 피부에서는 탄
력과 보습력이 떨어지고 주름이 생기는 등 피부노화가 나타난다. Collagen은 진피
세포외 기질의 대부분을 차지하며 피부 섬유화의 주된 구성성분으로 피부 건조 중
량의 75%를 차지한다. 체내 collagen은 20가지 type으로 나눠지는데 피부 진피에
는 type Ⅰ collagen이 80~85%, type Ⅲ collagen이 10~15% 4,5) , type Ⅴ, Ⅵ, Ⅶ
collagen이 소량으로 존재하며, 나머지 5% 정도가 type Ⅳ collagen으로 표피 진
피 경계부에 분포한다.
Collagen 합성은 ascorbic acid, oxygen, Fe 2+ , α-ketoglutarate, silicon을 조효
소로 hydroxylation 과정을 거치는데 2,3,6) collagen을 합성하는 효소인
hydroxylase는 2가 상태의 철분(Fe 2+ )과 느슨하게 결합하고 있어야 활성형 효소로
작용하며 3가 상태로 변하면 활성이 없어진다. 5) Ascorbic acid가 hydroxylase의
철분을 환원형인 Fe 2+ 로 유지시켜 효소를 활성화시키며 7), lysine과 proline이 각각
hydroxylation되어 triple helix 구조를 취하는데, proline이나 hydroxyproline이
많은 부분을 차지하며 그 구조를 안정화 시킨다고 알려져 있다. 6) Hydroxylysine은
hydroxyproline에 비해 양적으로 적으나 collagen 특유의 아미노산으로 triple
helix 안정화 뿐 아니라 collagen 합성의 최종단계인 섬유의 숙성, 즉
cross-linking의 형성에 중요한 역할을 하며 8) 이 단계에 미량원소인 silicon이 효소
의 활성을 조절하여 collagen을 안정화시킨다 9) .
- 55 -

이에 본 연구에서는 human dermal fibroblast cell에서 collagen 합성에 관여하는
ascorbic acid와 silicon, lysine, proline 및 Fe를 농도별로 처리하여 세포의 증식
및 collagen 합성, collagen 합성 관련 효소의 발현에 미치는 영향을 알아보고자
하였다.
- 56 -

1. 세포배양
2. 재료 및 방법
Human fibroblast cell(HS27)을 경희대학교 동서의학대학원 한약리학 교실(김선
여 교수님)에서 분양받아 본 연구실에서 계대 배양하여 사용하였다. Polystyrene
세포 배양접시에 부착시키고 10% FBS(Gibco, USA)를 첨가한 DMEM(Gibco,
USA)을 사용하여 배양하였다. 배양시 습도는 95%, 온도는 37℃를 유지하면서 5%
CO₂를 계속 공급하였다. 10)
2. 재료 및 시약
실험에 사용한 ascorbic acid, silicon, lysine, proline 및 Fe은 SIGMA에서 구입
하여 사용하였다(ascorbic acid: A4544, silicon; sodium silicate solution:
338443, L-lysine: L5501, L-proline: P5607, Fe: Ferric citrate: F6129)
- 57 -

- 58 -
treatment
3 or 5 days
cell seed after 24hrs after 3 or 5days
3 or 5
days
human dermal fibroblast cell
cell harvest
Ascorbic acid Silicon Lysine Proline Fe
(0,5,10,50,100μM) (0,5,10,25,50μM) (0,50,100,150μM) (0,100,200,300μM) (0,5,10,20,30,50μM)
측정 Parameter
● 세포 증식
● collagen type Ⅰ&Ⅲ 합성
● collagen 합성 관련 효소 lysyl hydroxylase, prolyl hydroxylase 발현
Figure 3.1. Experimental design

3. 세포의 증식측정
Human fibroblast cell의 증식 측정은 단기간에 대량 검색이 가능한 MTS[3
-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-
2H-tetrazolium) colorimetric assay 방법(Cell Titer 96 Aqueous One Solution
Cell Proliferation Assay: Promega)을 사용하여 측정하였다. 96 well plate에
0.2×10⁴cells/well의 농도로 분주하고 24시간 후에 ascorbic acid, silicon,
proline, lysine을 농도별로 투여하여 3일 또는 5일간 배양하였다. 3일 또는 5일째
되는 날 MTS(40㎕/well) 시약을 첨가하고 2시간 30분 동안 37℃에서 배양한 후
MTS가 formazan으로 분해되는 양을 ELISA reader를 이용하여 490nm에서 흡광
도를 측정하여 결정하였다. 본 실험에 사용한 ascorbic acid는 0-100μM로 처리하
였는데 이는 혈청 내 ascorbic acid 농도 45μM 11) , 피부 내 농도인 7.6μM/g을 기
준으로 하였다 12) . Silicon과 Fe(Fe 2+ : Ferrous ion)은 0-50μM로 사용했고 이는 각
각 혈청 내 농도 5-20μM 13) , 6.27-32.23μM 14) 을 기준으로 하여 사용 농도를 정하
였다. Lysine는 0-150μM, proline은 0-300μM 로 사용하였고 각각 혈청 내 농도
71-151μM 15) , 200-300μM 16) 을 기준으로 하여 정하였다.
4. Collagen type Ⅰ과 Ⅲ의 합성 측정
진피세포의 대표적인 collagen인 collagen Type Ⅰ과 Ⅲ의 합성을 western blot
analysis에 의해 관찰하였다. Ascorbic acid, silicon, proline, lysine을 3일 또는 5
일간 처리한 cell을 RIPA buffer(20mM Tris-HCl, pH8, 150mM NaCl, 10mM
NaPO , 10% glycerol, 100μM Na VO , 100μM ammonium molybdate, 1%
NP-40, 0.1% SDS)에 4℃ 상태로 풀어놓고 원심분리하여 상층액을 단백질 추출액
- 59 -

으로 준비하였다. 단백질 양은 bovine serum albumin을 표준으로 하여 Bradford
assay (Bio Rad)를 이용하여 595nm에서 흡광도를 측정하여 결정하였다.
준비된 단백질을 4x sample buffer에 혼합하고 95℃에서 5분간 가열한 다음
10% SDS-PAGE(polyacrylamide gel electrophoresis)에서 전기 영동시킨 후
Hybond ECL nitrocellulose membrane에 흡착시켰다. 1차 항체(Collagen Type
Ⅰ antibody: Sigma-aldrich co. Steinheim, Germany, Collagen Type Ⅲ
antibody: Sigma-aldrich co. Steinheim, Germany)는 5% skim milk, 0.1%
Tween-20을 함유한 PBS에 희석시켜서 4℃에서 16시간 동안 반응시킨 후, 0.1%
Tween-20을 함유한 PBS로 15분씩 3차례 세척하였다. Blocking solution으로
1:5000배로 희석시킨 peroxidase - conjugated anti-IgG 이차 항체와 실온에서 1
시간 동안 반응시킨 후 0.1% Tween - 20을 함유한 PBS로 3차례 세척하고 발색
은 ECL hyperfilm으로 확인하였다. 각 Band의 intensity는 imaging densitometer
(model GS-700, BIO-RAD, USA)를 사용하여 정량화하였다.
4. collagen 합성 관련 효소의 발현 변화
4.1 Reverse Transcription(RT)
배양한 cell에서 Trizol reagent(Gibco 15596-026)를 이용하여 RNA를 분리하고
파장 260nm에서 정량하였다. Total RNA 10㎕(0.5㎍/㎕)를 65℃에서 10분간 가열
하고 4℃에서 10분 동안 방치한 후 1㎕ oligo(dT)15 primer (0.5㎍/㎕), 1㎕
M-MLV RT (10unit/㎕; promega, USA), 1㎕ RNase inhibitor (20-40unit/㎕;
promega, USA), 10㎕ 5X RT buffer(250mM Tris-HCl, pH8.3, 375mM KCl,
15mM MgCl2), 5㎕ 2.5mmol/L dNTP mixture, 0.1% diethylpyrocarbonate
(DEPC) 증류수를 첨가하여 37℃ 에서 1시간 동안 가열하여 cDNA를 합성하였다.
- 60 -

4.2 Polymerase Chain Reaction (PCR)
Prolyl hydroxylase(EC 1.14.11.2) 17) 의 primer (sense; 5' CCACAGCAGAGGAA
TTACAG 3‘, anti-sense; 3' ACACTAGCTCCAACTTCAGG 5') 18) 를 각각 1㎕(0.
5㎍/㎕)씩 가하고 합성된 cDNA에 0.1% DEPC-Water와 함께 PCR-premix tube
((주)바이오니아)에 첨가하여 Denaturation은 95℃에서 30초, annealing은 72℃에
서 30초, extention은 72℃에서 2분동안 30cycle로 진행하였다 18) . Lysyl hydroxyl
ase(E.C. 1.14.11.4) 19) 의 primer (sense; 5' GGAACCTGGCCTATGACACCCT 3',
anti-sense; 5' TGCCATGCTGTGCCAGGAACT 3')를 이용하여 cDNA를 합성하
고 denaturation 94℃ 30초, 52℃에서 45초간 annealing, extention 72℃에서 30
초간 총 40cycle로 진행하였다 20) .
PCR 생성물은 3.0% agarose gel 에서 확인하였고 18,20) PCR 생성물의 양을 imagi
ng densitometer (Labworks ver.4.6 (image acquisition and analysis software),
UVP, CA)를 사용하여 측정하였다.
5. 통계분석
실험 결과는 SPSS 통계 프로그램을 이용하여 분석하였으며 그 결과는 평균 표준
오차로 표시하였다. 대조군과 처리군 간의 세포 증식 증가 효과에 대한 유의성은
general linear model (GLM)의 Duncan's multiple range test를 이용하여 p

3. 결과 및 고찰
3.1. HS27 cell에서 ascorbic acid, silicon, lysine, proline 및 Fe 처리가 증식에
미치는 효과
HS27 cell에 ascorbic acid, silicon, lysine, proline 및 Fe의 처리 후 세포 증식
을 측정하였다(Table 3.1, Figure 3.2).
Ascorbic acid는 처리 농도 및 기간에 상관없이 HS27 세포의 증식에 변화를 초
래하지 않았고, silicon은 25μM의 3일 처리에서 80.5%까지 증식이 감소하였다. 그
러나 5일간 처리에서는 효과가 없었다. Lysine은 100μM의 3일 처리에서 246.9%
까지 현저히 증가하였고, 5일 처리에서는 50μM 농도에서 207.1%까지 증가하였다.
Proline은 3일 처리에서는 증식이 감소하였으나 5일간 처리한 100μM 농도에서
247.9%까지 증가하였다. Fe은 30μM을 3일 처리한 결과 162.5%까지 증가하였고,
10μM의 5일 처리에서는 164%까지 증식이 증가하였다.
Ascorbic acid는 각각 24시간, 96시간 처리한 S. Murad 등의 연구에서도 cell의
증식에 영향을 미치지 않는 것으로 나타났다 19) . Ascorbic acid와 silicon은 cell 증
식에 미치는 효과가 매우 미비한 것으로 보이며, lysine, proline 은 cell의 증식을
현저하게 증가시키는 역할을 하는 것으로 여겨진다. Fe도 lysine과 proline에는 미
치지 못하지만 세포 증식에 효과가 있는 것으로 나타났다.
- 62 -

Table 3.1. Proliferation of HS27 cells
treatment
Ascorbic acid
Silicon
Lysine
Proline
Fe
concentration
(μM)
0 100 ± 0.3 a
5 99.1 ± 12.3 a
10 109.6 ± 9.7 a
50 106.0 ± 7.7 a
100 116.9 ± 9.6 a
0 100 ± 0.2 ab
5 106.9 ± 6.6 a
10 100.7 ± 4.6 ab
25 80.5 ± 3.9 c
50 89.0 ± 6.2 bc
0 100 ± 0.1 b
50 185.2 ± 39.1 ab
100 246.9 ± 73.7 a
150 178.2 ± 22.3 ab
0 100 ± 0.1 a
100 92.5 ± 4.0 ab
200 75.8 ± 8.5 b
300 81.7 ± 6.3 b
0 100 ± 0.2 c
5 114.5 ± 8.1 c
10 122.5 ± 9.6 bc
20 133.8 ± 16.1 abc
30 162.5 ± 9.9 a
50 155.1 ± 15.7 ab
- 63 -
proliferation (% control)
3days 5days
100 ± 0.4 a
103.6 ± 7.0 a
105.1 ± 3.7 a
108.2 ± 10.3 a
100.8 ± 7.6 a
100 ± 0.2 a
87.3 ± 5.9 a
101.1 ± 8.8 a
92.9 ± 12.7 a
94.9 ± 9.2 a
100 ± 0.1 b
172.7 ± 30.2 ab
187.0 ± 47.4 ab
207.1 ± 38.9 a
100 ± 0.1 b
247.9 ± 33.8 a
192.0 ± 19.2 a
175.0 ± 32.4 ab
100 ± 0.3 ab
153.6 ± 23.5 ab
164.1 ± 32.0 a
117.6 ± 22.8 ab
112.4 ± 15.7 ab
89.5 ± 10.1 b
1) Value are mean ± S.E.(%) (ascorbic acid, n=8; silicon, n=8; lysine, n=7; proline, n=7; Fe, n=8)
2) HS27cells were plated at 0.2×10 4 cells/well. After 24hrs, each treatment were added at indicated concentration to
HS27 cells. After 3 or 5 days, cells were trypsinized, MTS solution was added and absorbance was measured at
490nm.
3) Values with the different superscripts in the same column are significantly different at P

- 64 -
2) Values with the different superscripts in the same column are significantly different at P

3.2. HS27 cell에서 ascorbic acid, silicon, lysine, proline 및 Fe 처리에 의한
collagen type Ⅰ과 Ⅲ의 발현 변화
HS27 cell에서 ascorbic acid, silicon, lysine, proline 및 Fe의 농도별 처리가
collagen type Ⅰ과 Ⅲ의 발현에 미치는 효과를 살펴보았다 (Figure 3.1, 3.3, 3.4,
3.5, 3.6).
Collagen type Ⅰ의 발현에서 ascorbic acid는 3일 처리에서 대조군에 비해 10μ
M 농도에서 130%까지 증가하였으나 고농도에서는 감소하였다. 반면 5일 처리는
농도 의존적으로 collagen type Ⅰ의 발현을 현저하게 증가시켜 증가 최대치는
1331%였다. 3일간의 silicon 처리는 collagen type Ⅰ의 발현에서 115%까지 발현
증가 효과를 나타냈으나 5일처리는 발현이 억제되었다. 3일간의 lysine 처리는
140%까지 발현을 증가시켰고 proline의 처리는 처리 기간에 무관하게 3일과 5일처
리에서 collagen type Ⅰ의 발현을 억제시켰다. Fe의 처리에서는 20μM을 3일 처
리한 결과 323%까지 증가하였고, 5μM의 5일 처리에서 158%까지 증가하였다.
Collagen type Ⅲ의 발현은 ascorbic acid 5μM농도의 3일처리에서 135%까지 증
가하였고, 5일처리에서는 10μM에서 182%까지 증가하였으나 고농도에서는 감소하
였다. Lysine도 ascorbic acid와 같은 경향을 나타내어 3일간 처리에서 260%까지
발현이 증가하였고 5일 처리에서는 160%까지 증가하였다. Silicon과 proline 처리
에 의해서는 collagen type Ⅲ의 발현이 감소되었다. Fe는 30μM의 3일 처리에서
158%까지 증가하였고 5일 처리에서는 185%까지 증가하였다.
Ascorbic acid와 silicon을 처리한 경우 ascorbic acid의 피부 내 농도인 7.6μM과
silicon의 혈청 내 농도인 5-20μM 수준에서 collagen 발현이 가장 많이 증가하였
다. Lysine의 처리에 의해서도 collagen의 발현은 현저히 증가하였지만 세포의 증
식 결과도 증가하였으므로(Table 3.1, Figure 3.2) 이는 세포의 증식에 의한 것으
로 보인다. Fe도 세포의 증식과 함께 collagen의 발현이 증가하였지만 lysine과
proline보다 증식에 미치는 영향이 적고 collagen 합성을 증가시키는 역할은 큰 것
- 65 -

으로 보인다. 그러므로 이 결과는 human dermal fibroblast cell에서 ascorbic
acid와 silicon은 세포의 증식 없이 collagen 단백질의 발현을 증가시키는 반면,
lysine과 proline은 세포 증식의 야기로 말미암아 collagen의 발현을 증가시키는 것
으로 보여진다. Fe도 세포의 증식과 병행하여 collagen 합성이 증가하였으나 세포
증식율에 비해 collagen 합성 증가율이 높으므로 어느정도 collagen의 합성을 증가
시키는 것으로 여겨진다. 그러므로 collagen 합성에 관여하는 여러 영양소 중
ascorbic acid, silicon, lysine, proline 및 Fe의 처리군에서 ascorbic acid가
collagen 합성에 가장 효과적이고 Fe와 silicon도 어느 정도 collagen 합성을 증가
시키는 것으로 여겨진다.
- 66 -

ascorbic acid
silicon
lysine
proline
Fe
Figure 3.3. Expression of collagen type Ⅰ
3days 5days
HS27cells were treated with ascorbic acid(0, 5, 10, 50, 100μM), silicon(0, 5, 10, 25, 50μM),
lysine(0, 50, 100, 150μM), proline(0, 100, 200, 300μM) and Fe(0, 5, 10, 20, 30, 50μM) for 3 or
5 days were subjected to SDS-PAGE and immunoblotting with collagen type Ⅰ specific
antibodies.
0 5 10 50 100
0 5 10 25 50
0 50 100 150
0 100 200 300
0 5 10 20 30 50
concentration(μM)
- 67 -
0 5 10 50 100
0 5 10 25 50
0 50 100 150
0 100 200 300
0 5 10 20 30 50
concentration(μM)

- 68 -
Densitometer analysis: The signal intensity from a treatment of 3 or 5 days were quantified the integrated area were percentized to the signal
observed in control cells (100%).
Figure 3.4. Densitometer analysis of collagen type Ⅰ Expression
concentration(μM)
concentration(μM)
% control
% control
3days 5days

ascorbic acid
silicon
lysine
proline
Fe
Figure 3.5. Expression of collagen type Ⅲ
3days 5days
HS27cells were treated with ascorbic acid(0, 5, 10, 50, 100μM), silicon(0, 5, 10, 25, 50μM),
lysine(0, 50, 100, 150μM), proline(0, 100, 200, 300μM) and Fe(0, 5, 10, 20, 30, 50μM) for 3 or
5 days were subjected to SDS-PAGE and immunoblotting with collagen type Ⅲ specific
antibodies.
0 5 10 50 100
0 5 10 25 50
0 50 100 150
0 100 200 300
0 5 10 20 30 50
0 5 10 20 30 50
concentration(μM) concentration(μM)
- 69 -
0 5 10 50 100
0 5 10 25 50
0 50 100 150
0 100 200 300

- 70 -
Densitometer analysis: The signal intensity from a treatment of 3 or 5 days were quantified the integrated area were percentized to the signal
observed in control cells (100%).
Figure 3.6. Densitometer analysis of collagen type Ⅲ expression

3.3. HS27 cell에서 ascorbic acid, silicon, lysine, proline 및 Fe 처리에 의한
collagen 합성 관련 효소의 변화
HS27 cell에서 ascorbic acid, silicon, lysine, proline 및 Fe의 농도별 처리가
collagen 합성 관련 효소인 prolyl hydroxylase와 lysyl hydroxylase의 발현에 미
치는 효과를 살펴보았다.(Figure 3.7, 3.8, 3.9)
Prolyl hydroxylase의 mRNA 발현은 ascorbic acid의 3일 처리와 5μM의 5일
처리에서 증가하였으며 특히, 50μM의 3일 처리에서 처리하지 않은 군에 비해 21
배까지 증가하였다. Silicon, lysine, proline의 처리에서는 처리 기간에 상관없이
대체로 효과가 없었다. Fe는 30μM의 3일 처리에서 감소하였으며, 5일처리에서 농
도 의존적으로 감소하다 고농도에서 증가하였다.
Lysyl hydroxylase의 mRNA 발현에서 ascorbic acid와 lysine은 대체로 효과가
없는 것으로 나타났고, silicon은 5μM의 3일 처리에서 처리하지 않은 군보다 6배까
지 증가하였으며 5일 처리에서는 10μM 농도에서 4배까지 증가하였다. Proline의 3
일 처리는 lysyl hydroxylase의 발현을 감소시켰으며 5일 처리에서는 효과가 없었
다. Fe은 20μM의 3일 처리에서 증가하였으며 5일처리에서는 prolyl hydroxylase
와 마찬가지로 감소하다 증가하는 경향을 나타냈다.
Ascorbic acid의 처리는 collagen 합성 증가(Figure 3.3, 3.4, 3.5, 3.6)와 함께
prolyl hydroxylase의 발현을 증가시키는 역할을 하며 silicon은 collagen의 합성
증가와 함께 lysyl hydroxylase의 발현을 증가시켰다.
- 71 -

Ascorbic acid
Silicon
Lysine
Proline
Fe
PH
LH
GAPDH
PH
LH
GAPDH
PH
LH
GAPDH
PH
LH
GAPDH
PH
LH
GAPDH
3days 5days
0 5 10 50 100 0 5 10 50 100
0 5 10 25 50 0 5 10 25 50
0 50 100 150 0 50 100 150
0 100 200 300 0 100 200 300
0 5 10 20 30 50 0 5 10 20 30 50
concentration(μM)
concentration(μM)
Figure 3.7. mRNA expression of prolyl hydroxylase and lysyl hydroxylase
- 72 -

- 73 -
2) The signal intensity from a treatment of 3 or 5 days were quantified the integrated prolyl hydroxylase and GAPDH ratio were
percentized to the signal observed in control cells(% control).
1) Values with the different superscripts in the same column are significantly different at P

- 74 -
2) The signal intensity from a treatment of 3 or 5 days were quantified the integrated lysyl hydroxylase and GAPDH ratio were
percentized to the signal observed in control cells(% control).
1) Values with the different superscripts in the same column are significantly different at P

4. 요약 및 결론
피부 진피 세포외의 주요 기질인 콜라겐 I 과 III은 lysine과 proline을 다량 함유
하고 있으며, lysine과 proline의 hydroxylation 과정을 통하여 triple helix 구조의
탄력 및 강도를 유지하는데 ascorbic acid, oxygen, Fe 2+ , ketoglutarate 및
silicon의 영양소가 조효소의 역할을 한다. 콜라겐의 구성 아미노산 및 이들 아미노
산의 hydroxylation 과정에 조효소의 역할을 하는 영양소의 처리가 진피 세포의 콜
라겐 합성 및 관련 효소의 발현에 미치는 영향을 알아보고자 하였다. 혈장 및 피부
내의 각 관련 영양소의 혈중 및 피부내의 농도를 기준으로, ascorbic acid(0-100μ
M), silicon(0-50μM), lysine(0-150μM) 및 proline(0-300μM)을 human dermal
fibroblast cell (HS27 cell)에 각 농도별로 3일 또는 5일간 처리한 후 세포의 증식
을 비롯하여 콜라겐 Ⅰ과 Ⅲ 단백질 및 관련 효소의 발현을 측정하였다.
1. 5-10 μM의 ascorbic acid 및 silicon의 3일 또는 5일 처리는 HS27세포의 증식
을 수반하지 않고 콜라겐 I 과 III 단백질의 발현을 증가시켰는데 ascorbic acid
에 의한 콜라겐 합성 증가가 silicon에 비해 더욱 높았다. 5일간의 lysine 처리
와 3일간의 Fe 처리는 세포 증식과 병행하여 콜라겐 III의 발현을 증가시킨 반
면 proline은 모든 농도에서 HS27세포의 증식 및 콜라겐 I 과 III의 발현에 영향
을 미치지 않았다.
2. RT-PCR로 측정한 prolyl hydroxylase 효소의 mRNA 발현은 ascorbic acid의 3
일 또는 5일 처리에서 증가하였으며 silicon과 lysine, proline은 대체로 효과가
없었다. Fe의 처리에서는 감소하는 경향을 보였다. Lysyl hydroxylase 발현은
ascorbic acid, lysine를 비롯한 proline, lysine의 모든 농도별 처리에 의해서
- 75 -

변화되지 않았으며 Fe에 의해서는 대체로 감소하였고, silicon의 처리에서 증가
하였다.
3. Silicon보다는 ascorbic acid 처리에 의해 콜라겐 합성이 더욱 현저히 증가되었
는데 이는 prolyl hydroxylase의 mRNA 발현 증가와 병행되었으며 silicon에 의
한 콜라겐 단백질의 증가는 lysyl hydroxylase의 mRNA 발현과 병행하여 증가
하였다. 콜라겐의 구성 단백질인 lysine과 hydroxylation 과정에 조효소로 작용
하는 Fe에 의한 콜라겐 단백질의 증가는 모두 세포 증식이 병행되었지만 Fe의
경우 세포 증식율보다 콜라겐 합성율이 더 높았으므로 콜라겐 합성의 선택적 증
가에 어느 정도 효과가 있는 것으로 여겨진다. Proline은 진피세포에서 콜라겐
합성에 영향을 미치지 않았다.
HS27 세포에서 콜라겐 I 과 III의 발현은 ascorbic acid 및 silicon 처리에 의해 증가되
었는데, 이는 ascorbic acid의 피부 내 농도(7.6μM)와 silicon의 혈청 내 농도(5-20
μM) 수준에서 이루어졌다.
이상의 결과 ascorbic acid, silicon, lysine, proline 및 Fe 중 세포의 증식 없이 콜라
겐 합성에 가장 효율적인 영양소는 ascorbic acid이며 silicon과 Fe도 콜라겐 합성을
어느 정도 증가시키는 역할을 하는 것으로 보인다. 또한 ascorbic acid와 silicon은 콜
라겐의 triple helix에 관여하는 효소의 발현을 증가시킴으로써 피부 탄력에도 영향을
미칠 것으로 보인다.
- 76 -

참고문헌
1. Ishikawa T, Ishikawa O, Agache P, et al. Measurement of skin elastic
properties with a new suction device(Ⅰ): Relationship to age, sex and
the degree of obesity in normal individuals. J Dermatol(Tokyo)
22:713-717, 1995
2. Elsner P, Wilhelm D, Maibach HI. Mechanical properties of human
forearm and vulvar skin. Br J Dermatol 122:607-614, 1990
3. Jemec G, Jemec B, Jemec BIE. The effect of superficial hydration on
the mechanical properties of human skin in vivo. Plast Reconstr Surg
85:100-103, 1990
4. Uitto J, Olsen DR, Fazio MJ. Extracellular matrix of the skin; 50 years
process. J Invest Dermatol 92(4s):61-77, 1989
5. Nimni ME, Harkness RD: Molecular structure and functions of Collagen.
In Nimni ME(eds): collagen. Florida, CRC Press 1:3, 1993
6. Burer EA, Uitto J. Skin collagen in health and disease. Edinburgh,
Churchill Livingstone 474, 1982
7. Sheldon R. Pinnell, Saood Murad, Douglas Darr, Induction of Collagen
Synthesis by Ascorbic acid. A Possible Mechanism. Arch Dermatol
123 :1684-1686, Dec 1987
8. Kaisa passoja, Kato rautavuoma, Leena ala-kokko. Cloning and
characterization of a third human lysyl hydroxylase isoform. Proc. Natl.
Acad. Sci. USA;95: 10482-10486, September 1998
9. Seaborn C. Silicon deprivation decreases collagen formation in
- 77 -

wounds and bone, and ornithine transminase enzyme activity in liver.
Biol Trace Elem Res 89(3):251-61, 2002
10. Shingo Tajima, Sheldon R, Pinnell, Ascorbic acid preferentially enhances
type Ⅰ and Ⅲ collagen gene transcription in human skin fibroblasts. J
Derma Sci 11:250-253, 1996
11.Walingo KM, Role of vitmin C (ascorbic acid) on human health - A
review, African Journal of Food Agriculture and Nutritional
Development(AJFAND) 5(1):1-13, 2005
12. S. Murad, D. Grove. Regulation of collagen synthesis by ascorbic acid.
Proc. Natl. Acd. Sci. USA 78(5):2879-2882, May 1981
13. D.M. Reffitt, N. Ogston, R. Jugdaoshingh. Orthosilicic acid stimulates
collagen type Ⅰ synthesis and osteoblastic differentiation in human
osteoblast-like cells in vito. Bone 32:127-135, 2003
14. Beth Anne Jurkiewics, The role of free radicals, iron, and antioxidants
in ultraviolet radiation-induced skin damage. Graduate college of the
university of Iowa, August 1995
15. C. Dionisi-vici, L. De Felice, El Hachem. Intravenous immune globulin in
lysinuric protein intolerance. J. Inher. Metab. Dis, 21:95-102, 1998
16. David J. Grainger, Sri Aitken. A microtitre format assay for proline in
human serum or plasma. Clinica Chimica Acta. 343;113-118, 2004
17. Johanna Myllyharju, Prolyl 4-hydroxylases, the key enzymes of collagen
biosynthesis. Matrix Biology 22;15-24, 2003
18. Michael Fӓhling, Andrea Perlewitz, Anke Doller , Bernd-Joachim Thiele.
Regulation of collagen prolyl 4-hydroxylase and matrix
metalloproteinases in fibrosarcoma cells by hypoxia. Comparative
Biochemistry and Physiology, Part C 139;119-126, 2004
- 78 -

19. Katsuhiro Uzawa, Heather N. Yeowell, Kazyshi Yamamoto. Lysine
hydroxylation of collagen in a fibroblast cell culture system. Biochemical
and Biophysical Research Communications 305;484-487, 2003
20. Katsuhiro Uzawa, Wojciech J. Grzesik. Differential expression of human
lysyl hydroxylase genes, lysine hydroxylation, and cross-linking of type
Ⅰ collagen during osteoblastic differentiation in vitro. Jour. of bone and
mineral research 14;8:1272-1280, 1999
- 79 -

Appendix 1. 2005년도 한국 영양학회 추계학술대회 포스터 발표
발표일: 2005. 10. 5
장소: 경주 콩코드 호텔
Human dermal fibroblast cell에서 ascorbic acid, silicon, lysine 및 proline이
콜라겐 합성 및 관련 효소의 발현에 미치는 영향
김선아, 조윤희, 경희대학교 동서의학대학원 의학영양학과
피부 진피 세포외의 주요 기질인 콜라겐 I 과 III은 lysine과 proline을 다량 함유
하고 있으며, ascorbic acid, oxygen, Fe 2+ , ketoglutarate 및 silicon의 영양소가
조효소의 역할을 하는 lysine과 proline의 hydroxylation 과정을 통하여 triple
helix 구조의 탄력 및 강도를 유지한다. 이에 본 연구에서는 콜라겐의 구성 아미노
산 및 이들 아미노산의 hydroxylation 과정에 조효소의 역할을 하는 영양소의 처리
가 진피 세포의 콜라겐 합성 및 관련 효소의 발현에 미치는 영향을 알아보고자 하
였다. 이를 위하여 혈장 및 피부내의 각 관련 영양소의 혈중 및 피부내의 농도를
기준으로, ascorbic acid(0-100μM), silicon(0-50μM), lysine(0-150μM) 및
proline(0-300μM)을 HS27세포 (human dermal fibroblast cell)에 각 농도별로 3
일 또는 5일간 처리한 후 세포의 증식을 비롯하여 콜라겐 Ⅰ과 Ⅲ 단백질 및 관련
효소의 발현을 측정하였다.
5-10 μM의 ascorbic acid 및 silicon의 3일 또는 5일 처리는 HS27세포의 증식
을 수반하지 않고 콜라겐 I 과 III 단백질의 발현을 증가시켰는데 ascorbic acid에
의한 콜라겐 합성 증가가 silicon에 비해 더욱 높았다. 5일간의 lysine 처리는 세포
증식과 병행하여 콜라겐 III의 발현을 증가시킨 반면 proline은 모든 농도에서
HS27세포의 증식 및 콜라겐 I 과 III의 발현에 영향을 미치지 않았다. RT-PCR로
측정한 prolyl hydroxylase 효소의 mRNA 발현은 5μM의 ascorbic acid의 3일 또는
- 80 -

5일 처리에 의해 증가하였으나 silicon, proline, lysine의 처리에 의해서는 변화되
지 않았으며, lysyl hydroxylase 발현은 ascorbic acid를 비롯한 silicon, proline,
lysine의 모든 농도별 처리에 의해서 변화되지 않았다. 이상의 결과는 HS27 세포
에서 콜라겐 I 과 III의 발현은 ascorbic acid 및 silicon 처리에 의해 증가되었는데, 이
는 ascorbic acid의 피부 내 농도(7.6μM)와 silicon의 혈청 내 농도(5-20μM) 수준
에서 이루어졌다. Silicon에 비해 ascorbic acid 처리에 의해 콜라겐 합성이 더욱
현저히 증가되었는데 이는 prolyl hydroxylase mRNA 발현 증가와 병행되었다.
Silicon에 의한 콜라겐 단백질의 증가는 관련 효소의 발현 증가 보다는 효소의 활
성이나 stability 증가에 의한 것으로 여겨지고, 콜라겐의 구성 단백질인 lysine에
의한 콜라겐 단백질의 증가는 세포 증식이 병행되어 콜라겐 합성의 선택적 증가 효
과는 없는 것으로 여겨진다. Proline 또한 진피세포에서 콜라겐 합성에 영향을 미
치지 않았다.
- 81 -

Acknowledgements
2년여의 짧다면 짧고 길다면 긴 시간이 흘러 이렇게 결실을 맺게 되었습니다. 지
금의 제가 있기까지 인도해주신 하나님께 감사드립니다. 부족한 저를 끝까지 믿어
주시고 기도와 격려를 아끼지 않으신 엄마, 아빠, 할머니, 할아버지 감사합니다! 그
리고 추운 겨울 군복무하느라 고생하는 주환이! 우리 가족 모두 사랑합니다~!
늘 좋은 말씀과 힘나는 찬양으로 용기를 주신 고흥식 목사님! 감사합니다! 건강하
세요! 실수 많고, 모자람 많은 저에게 아낌없는 가르침을 주신 조윤희 교수님께 깊
은 감사를 드립니다. 부족한 논문에 좋은 조언 많이 해주신 박유경 교수님, 조여원
교수님, 감사합니다!
힘든 학교생활에 좋은 친구로 함께 울고웃고.. 옆에 있어준 정민이, 영심이! 그리
고 동기들 Our babies! 고맙고, 사랑한다~ 우리 잘살자!! 대학원으로의 길로 이끌
어주고 따뜻한 조언과 격려 아끼지 않고 해준 경호오빠, 인석오빠 너무너무 고마
워~ 즐거운 랩실생활의 원동력이 되어준 정은이(많은 도움이 되지 못해 미안해~),
인경이, 영란이, 주영언니, 정우오빠, 원철오빠! 덕분에 좋은 추억 많이 만들고 가
요~ 모두 고마워요~
힘들 때마다 기도와 격려로 힘이 되어준 민현언니, 금화언니, 혜진이, History
Maker 찬양단 식구들, 믿음구역 식구들, Glory 식구들, 작년 사랑구역 식구들!! 모
두모두 고맙고~사랑해~
한없이 부족한 논문을 보며 ‘배움엔 끝이 없다’는 것을 느낍니다. 일일이 열거하지
못하지만 이 논문이 나오기까지 도움을 주신 모든 분들, 감사드립니다. 앞으로 日新
又日新하여 더욱 정진하겠습니다.
- 82 -