an epidemiological study of listeriosis in dairy cattle

AN EPIDEMIOLOGICAL STUDY OF LISTERIOSIS IN
DAIRY CATTLE
by
Hidayet Metin ERDOGAN
A thesis submitted to the University of Bristol in accordance
with the requirements for the degree of Doctor of Philosophy
Division of Animal Health and Husbandry, Department of
Veterinary Clinical Science, University of Bristol
July 1998
i

SUMMARY
The aim of this study was to provide some epidemiological information about
the distribution and the dynamics of Listeria monocytogenes infection in dairy cattle.
In an attempt to determine the frequency of clinical listeriosis in dairy cattle and
risk factors associated with it, a postal questionnaire designed to identify farm level risk
factors associated with disease was sent to a random sample of 1500 dairy farmers in
England in August 1995. The questionnaire included questions about the disease and
farm management practices (feeding, housing and dung disposal, etc.). The farm
prevalence was 12.3% (95% CL, 10.0-14.8) overall 9.3% (95%CL, 7.4-11.7) in milking
cows, 5% (95%CL, 3.6-6.8) in replacement heifers and 1.4% (95% CL, 0.7-2.6) in dairy
calves. The farm prevalence in milking cows was significantly higher than others
(P

In the second part of the study a longitudinal survey of five dairy farms was
carried out to determine the infection rate with Listeria monocytogenes and its
behaviour in the environment, individual cows, pastures, soil, water sources, forage and
bulk milk tanks on the five farms monitored bacteriologically and serologically between
August 96 and May 97. The infection rate varied between farms and months. Two
patterns of infection rate were observed. On 3 farms the highest prevalence of infection
rates were obtained between November and April, around 90% of animals excreted L.
monocytogenes in their faeces during this period whereas on the other 2 farms the
infection rate was lower, around 30% of animals excreted L. monocytogenes (that was
only in March). An ELISA assay employing Listeriolysin O (LLO) was used to
determine seroconversion before, during and after silage feeding and winter housing.
Almost all animals examined on each farm had anti-LLO antibodies to L.
monocytogenes before silage feeding and housing. The antibody level remained
unchanged throughout the study with only a small number of animals exhibiting
changes on only one farm.
Three species of Listeria were isolated from the environmental samples (soil,
grass, silage, water, bedding). The commonest isolate was L. monocytogenes. L.
innocua was less common and the rarest was L. seeligeri. L. monocytogenes was
isolated from bulk milk tank on three farms. Random amplified polymorphic DNA
(RAPD) assays were used to identify the source of infection in dairy cows and to
determine the variation between the strains of different origin. In total 113 isolates (40
from the environment and 73 from the animals) were examined and 12 different RAPD
patterns were obtained. The results indicated that different “strains” exist between and
within farms. There also were similar patterns of RAPD between environmental and
animal strains.
iii

ACKNOWLEDGEMENTS
I gratefully thank to the University of Kafkas, Kars, Turkey, for granting me the
scholarship to carry out this work.
I am grateful to the Heads of the Departments of Clinical Veterinary Science of
Bristol University and Liverpool University for allowing me to use their facilities.
I am particularly thankful to my supervisor, Prof. Kenton Morgan, for his
constant support and encouragement. None of this work would have been possible
without his direction, enthusiasm and vision. I also thank to Drs Peter Cripps and Laura
Green, my other supervisors, for their advice and suggestions whenever needed
I gratefully acknowledge the technical assistant I received from the members of
Bristol University; Clinical Microbiology Unit, especially Geoffrey Werret, for the
development of culture techniques and Dilip Patel for the development of an ELISA
assay, Dr Alasdair MacGowan and Karen Bowker of the Department of Microbiology
of Southmead Hospital, Bristol, for the development of a RAPD assay and finally the
member of Liverpool University; Thelma Roscue for tirelessly making enormous
volumes of culture media every month and Dr Malcolm Bennett and his group for
allowing me to carry out molecular tests in his laboratories and for technical help.
I would like to thank to all members of the epidemiology research group for
inspiring discussions and their friendship, Dr Nigel French, Dr. Eduardo Berriatua, Dr.
Burhan Cetinkaya, Dr. Niki Mouttato, Galip Kaya, Giles Paiba, Connor Carson, Mark
Bronsvolt and especially Saad Al-Sultan for his help with data collection for
longitudinal study and Sue Edwards for checking the reference list.
Thanks are also due to the farmers who took part in the cross sectional and
longitudinal studies.
iv

I would like to thank to Metin Ozturk, Ibrahim Gokce and other Turkish friends
I have made in Bristol and Liverpool for their companionship and making my stay in
the UK pleasant. Thanks are also due to the friends I have made during my stay in
Langford and Leahurst.
My special thanks are to my parents, Arif and Elife, for providing me with
education and support and thanks are also to every single member of my family for their
encouragement and support.
My greatest appreciation and acknowledgement is to my wife, Hilal, for her
patience and understanding.
v

DEDICATION
This thesis is dedicated to my parents Arif and Elife
(Bu calisma hakklarini asla odeyemeyecegim babama ve anneme atfolunur)
vi

DECLARATION
I declare that apart from the advice and assistant acknowledged the work
reported in this thesis is my own and has not been submitted for consideration for any
other degree of qualification.
Hidayet Metin Erdogan
vii

TABLE OF CONTENTS
LIST OF TABLES AND FIGURES viii-xix
CHAPTER 1
General Introduction: a literature review 1-45
1. 1. Listeriosis 1
1. 2. History of Listeria monocytogenes and Listeriosis 1
1. 3. Morphology and culture characteristics 2
1. 4. Taxonomy of Listeria 6
1. 5. Typing of Listeria monocytogenes 9
1. 6. Pathogenesis, infectious dose, virulence and resistance 16
1. 7. Epidemiology 21
1. 8. Clinical signs and pathology 28
1. 9. Diagnosis
32
1. 10. Treatment 34
1. 11. Control 36
1. 12. Listeriosis in people 38
1. 13 The objectives of this study 43
CHAPTER 2
The frequency and some characteristics of clinical
Listeriosis in dairy cattle in England
46-64
2. 1. Introduction 46
viii

2. 2. Materials and Methods 47
2. 2. 1. Study Population 47
2. 2. 2. Study Design 47
2. 2. 3. The Questionnaire 47
2. 2. 4. Data Analysis 48
2. 2. 5. Data processing and analysis 50
2. 3. Results 50
2. 3. 1. Response rate 50
2. 3. 2. The prevalence of listeriosis at farm level 50
2. 3. 3. The incidence of listeriosis at herd level 52
2. 3. 4. Season 53
2. 3. 5. The prevalence of listeriosis in other animals
55
2. 3. 6. Clinical signs associated with reported cases of listeriosis 55
2. 3. 7 Treatment 57
2. 3. 8. Validation of the questionnaire 58
2. 3. 9. Herd size 60
2. 4. Discussion 60
CHAPTER 3
The relationship between farm management practices and clinical
listeriosis in dairy cattle in England: univariate analysis 65-106
3. 1. Introduction 65
3. 2. Materials and Methods 66
3. 2. 1. Study design 66
ix

3. 3. Results:
3. 2. 2. Outcome variables 66
3. 2. 3. Predictor variables 66
3. 2. 4. Data analysis 73
3. 3. 1. Univariate relationship between farm management practices and
listeriosis in dairy cattle (Overall cases ) 74
3. 3. 2. The univariate relationship between farming practices and
clinical listeriosis in milking cows 80
3. 3. 3. The univariate relationship between farming practices and
clinical listeriosis reported in winter months 84
3. 3. 4. The univariate relationship between farming practices and
cases of listeriosis with silage eye (iritis) 88
3. 3. 5. The univariate relationship between farming practices and
nervous signs listeriosis (encephalitis) 92
3. 3. 6. A summary of risk factors associated with
the different forms of disease 96
3. 4. Discussion 98
CHAPTER 4
The multivariate relationship between farm management practices and
clinical listeriosis in dairy cattle in England 107-128
4. 1 Introduction 107
4. 2. Materials and methods 107
4. 2. 1. Model building 109
4. 3. Results 109
x

4. 4. Discussion 125
CHAPTER 5
A pilot study of the bacteriological and
serological techniques used to determine
the infection of cows with Listeria monocytogenes 129-156
5. 1. Introduction 129
5. 2. Materials and methods 133
5. 2. 1. Study design 133
5. 2. 2. Bacteriology 134
5. 2. 3. Serology 139
5. 2. 4. Statistical analysis 143
5. 3. Results 143
5. 3. 1. Results of bacteriology 143
5. 3. 2. Results of serology 150
5. 4. Discussion 153
CHAPTER 6
A study of the dynamic of infection with Listeria monocytogenes,
in herds of milking cows
157-214
6. 1. Introduction 157
6. 2. Materials and Methods 160
6. 2. 1. Study Design 160
6. 2. 2. Farm Management 160
xi

6. 2. 3. Sample size 162
6. 2. 4. Sampling procedure 162
6. 2. 5. Sample preparation and processing 165
6. 2. 6. Measurement of serum antibody to Listeria monocytogenes
165
6. 2. 7. Investigation of source of the bacteria 166
6. 2. 8. Data analysis 170
6. 3. Results 170
6. 3. 1. Bacteriology 170
6. 3. 2. Serology 192
6. 3. 3. RAPD 193
6. 4. Discussion 206
CHAPTER 7
Conclusion 215-218
REFERENCES 219-256
APPENDIX
xii

CHAPTER 1
LIST OF TABLES AND FIGURES
Table 1. 1. Some characteristics of Listeria organisms 5
Table 1. 2. Serovar distribution of Listeria 8
Table 1. 3. Epidemic and sporadic cases of foodborne
clinical listeriosis in people 40
Figure 1. 1. Pathogenesis of L. monocytogenes infection 18
Figure 1. 2. Epidemiology of L. monocytogenes infection 28
Figure 1. 3. Potential pathways of L. monocytogenes transmission to people 42
CHAPTER 2
Table 2. 1. The farm prevalence of listeriosis in dairy cattle
in England in 1994 - 1995 51
Table 2. 2. The proportion of animals affected with listeriosis (animal-year/1000) 52
Table 2. 3. The proportion of animals affected with listeriosis
according to the clinical signs (animal-year/1000) 53
Table 2. 4. Frequency of clinical signs in cases reported
between June 1994 and June 1995 56
Table 2. 5. The frequency of clinical symptoms for the cases reported
57
in three groups of dairy cattle between July 1994 and June 1995
Table 2. 6. Treatment of clinical listeriosis and its result for the cases
reported between July 1994 and June 1995 58
Table 2. 7. The frequency of clinical signs chosen by farmers and
xiii

sensitivity of farmers reporting correct clinical signs 59
Table 2. 8. Herd size in non-affected and affected groups 60
Figure 2. 1. Monthly distribution of cases of listeriosis
between July 1994 and June 1995 54
Figure 2. 2. Monthly distribution of cases showing silage eye 54
Figure 2. 3. Monthly distribution of cases showing nervous signs 55
CHAPTER 3
Table 3. 1. Categorisation of forage analysis 70
Table 3. 2. Univariate relationship between herd sizes and clinical listeriosis
74
Table 3. 3. Effect of forages fed to dairy cattle on the occurrence of listeriosis 76
Table 3. 4. The relationship between listeriosis and duration of feeding grass silage
77
Table 3. 5. The univariate relationship between number of grass cuts and disease 78
Table 3. 6 .Effect of silage quality on listeriosis 78
Table 3. 7. Univariate relationship between housing practices and listeriosis
80
Table 3. 8. Univariate relationship between herd sizes and
81
clinical listeriosis in milking cows
Table 3. 9. The univariate relationship between feeding practices and
82
listeriosis in milking cows
Table 3. 10. The relationship between number of grass cuts and
listeriosis in milking cows 82
xiv

Table 3. 11. The relationship between housing and general management and
listeriosis in milking cows 83
Table 3. 12. Univariate relationship between herd sizes and
clinical listeriosis reported in winter months 84
Table 3. 13. Effect of silage quality on listeriosis in winter months 86
Table 3. 14. The univariate relationship between feeding practices and
cases of listeriosis reported in winter months 86
Table 3. 15. The relationship between housing and general management and
listeriosis reported in winter months 87
Table 3. 16. The univariate relationship between herd sizes and
silage eye 88
Table 3. 17 The relationship between feeding practices and
silage eye (iritis) 90
Table 3. 18 The relationship between housing, general management and
silage eye 92
Table 3. 19. The univariate relationship between herd sizes and
nervous form of listeriosis 93
Table 3. 20. The relationship between feeding, housing and general management
practices and risk of reporting nervous form of listeriosis 94
Table 3. 21. Effect of silage quality on the reporting of
nervous form of listeriosis 95
Table 3. 22. The predictor variables associated with an increased risk of disease 97
Table 3. 23. The predictor variables associated with a decreased risk of disease 98
CHAPTER 4
Table 4. 1. The multivariate relationship between major farming practices and
xv

clinical listeriosis in dairy cattle (preliminary model) 111
Table 4. 2. The multivariate relationship between farming practices and
listeriosis in dairy cattle (overall cases) 114
Table 4. 3. The multivariate relationship between farming practices and
115
listeriosis in milking cows
Table 4. 4. The multivariate relationship between farming practices and
cases of listeriosis occurring in winter months 116
Table 4. 5. The multivariate relationship between farming practices and
117
cases of listeriosis with silage eye
Table 4. 6. The multivariate relationship between farming practices and
cases of nervous signs 118
Table 4. 7. The agreement between the two models for different outcomes 119
Table 4. 8. The multivariate relationship between farming practices and
listeriosis 121
Table 4. 9. The multivariate relationship between farming practices and
122
listeriosis in milking cows
Table 4. 10. The multivariate relationship between farming practices and
listeriosis reported in winter months 122
Table 4. 11. The multivariate relationship between farming practices and
cases of listeriosis with silage eye 123
Table 4. 12. The multivariate relationship between farming practices and
cases of listeriosis showing nervous signs 124
Table 4. 13. The agreement between the models for different outcome variables 125
xvi

CHAPTER 5
Table 5. 1. Date of visits and number of samples collected 133
Table 5. 2. Effect of cold enrichment on the growth quantity of Listeria spp 144
Table 5. 3. Effect of saline on the isolation of Listeria 145
Table 5. 4. Effect of LSEB and NB on the growth of L. monocytogenes 145
Table 5. 5. Monthly excretion rates of Listeria spp. in faeces 147
Table 5. 6. The relationship between housing, silage feeding and
Listeria excretion 149
Table 5. 7. The relationship between age and excretion of L. monocytogenes 149
Table 5. 8. The effect of age on the frequency of animals
becoming Listeria positive 150
Table 5. 9. Effect of different coating temperature on the assay 151
Table 5. 10. Plate plan and Optical densities 151
Table 5. 11. The relationship between frequency of becoming
positive for Listeria and antibody level 152
Table 5. 12. Relationship between age and antibody level 153
Figure 5. 1. Isolation and identification procedure for Listeria spp 136
Figure 5. 2. Effect of cold enrichment on the growth of Listeria 146
Figure 5. 3. Monthly excretion of Listeria spp. and L. monocytogenes 148
CHAPTER 6
Table 6. 1. Some management practices followed by the five farms 161
Table 6. 2. Results of forage analysis 161
Table 6. 3. Age distribution of animals on the farms A, B and C 162
xvii

Table 6. 4. Date of visits and number of animals sampled 163
Table 6. 5. Number of animals tested on more than one occasion 163
Table 6. 6. Dates and numbers of blood samples collected 166
Table 6. 7. Monthly excretion rate of Listeria spp. and
L. monocytogenes in milking cows 172
Table 6. 8. The relationship between silage feeding and housing on the overall
excretion of Listeria spp. and L. monocytogenes 174
Table 6. 9. The relationship between age and excretion of Listeria spp. 175
Table 6. 10. The effect of age on the excretion of Listeria spp.
and Listeria monocytogenes 176
Table 6. 11. Isolation of Listeria spp. from the environment on Farm A 177
Table 6. 12. Isolation of Listeria spp. from the environment on Farm B 179
Table 6. 13. Isolation of Listeria spp. from the environment on Farm C 182
Table 6. 14. Isolation of Listeria spp. from the environment on Farm D 185
Table 6. 15. Isolation of Listeria spp. from the environment on Farm E 188
Table 6. 16. Incidence rate of L. monocytogenes infection by month 191
Table 6. 17. Antibody changes during the period of the study 192
Table 6. 18 The isolates, their origin and their RAPD patterns with the primer 5 194
Table 6. 19. The distribution of the RAPD patterns by their origin and the farms 196
Table 6. 20. Comparison of environmental and animals isolates
obtained at different visits 197
Figure 6. 1. The scheme followed for the collection of environmental samples 164
Figure 6. 2. The monthly excretion of Listeria spp. and
L. monocytogenes in faeces on Farm A 171
Figure 6. 3. The monthly faecal excretion of Listeria spp. and
L. monocytogenes on Farm B 178
xviii

Figure 6. 4. The monthly faecal excretion of Listeria spp. and
L. monocytogenes on Farm C 182
Figure 6. 5. The monthly faecal excretion of Listeria spp. and
L. monocytogenes on Farm D 185
Figure 6. 6. The monthly faecal excretion of Listeria spp. and
L. monocytogenes on Farm E 188
Figure 6. 7. Monthly incidence rate of L. monocytogenes infection 191
Figure 6. 8. The repeatability of RAPD and
discrimination of different species of Listeria 200
Figure 6. 9. The discrimination of isolates of L. monocytogenes
with different primers 201
Figure 6. 10. The distribution of strains in two persistently
infected animals on farm A 202
Figure 6. 11. The RAPD pattern obtained from environmental and
faecal isolates of farm C 203
Figure 6. 12a. The RAPD pattern obtained from
the environmental isolates of farm D 204
Figure 6. 12b. The RAPD patterns obtained from faecal isolates on farm D 205
Figure 6. 13. Animal-environment cycle of L. monocytogenes 214
xix

1. 1. Listeriosis
CHAPTER 1
General Introduction: a literature review
Listeriosis is an infectious disease of man and animals with a world-wide
distribution. It manifests itself in three major clinical forms, meningoencephalitis,
abortion and septicaemia (Hird and Genegeogis 1990). Listeriosis is caused by a
member of the genus Listeria. The majority of the clinical cases are associated with
Listeria monocytogenes infection. Only a few reported cases have been associated with
Listeria ivanovii, Listeria seeligeri and Listeria innocua (McLauchlin 1987).
1. 2. History of Listeria monocytogenes and Listeriosis:
Although Gray and Killinger, in a review published in 1966, date the discovery
of Listeria monocytogenes to the reports from France and Germany in the late
nineteenth century, it was only in 1926 that Listeria was described by Murray, Webb
and Swann. It was implicated in an outbreak of disease in laboratory rabbits and the
bacterium was isolated from the liver of affected individuals. The disease was
characterised by a leukocytosis in which the predominant cells were large mononuclear
cells and the organism was named Bacterium monocytogenesis. In 1927 Piere isolated
an identical organism from lesions in the liver of gerbils and named the organism
1

Listeralla hepatolytica. In the same year Nyfeldt made the first confirmed isolation of
Listeria from man. The organism was recovered from an outbreak of an infectious
mononucleosis-like disease (cited by Gray and Killinger 1966). The first report of the
disease in ruminants was in 1929 when Gill reported a disease of sheep (locally called
"circling disease") in New Zealand and two years later isolated the same organism from
sick sheep and designated it Listeralla ovis (Gill 1937). The first report of listeriosis in
cattle was by Jones and Little in 1934 where it was implicated in what is now known as
“typical Listeriosis”, namely meningoencephalitis. The literature on Listeria and
listeriosis has grown rapidly since that time.
Almost every researcher who isolated this newly discovered bacteria named it
differently which resulted in a list of names all referring to the same organism. In 1940
Pirie proposed the name Listeria monocytogenes for this new bacterium after the
British surgeon and medical pioneer Lord Lister. The adoption of this name concluded
the conflict about the name of this new bacteria. By the 1960s Listeria monocytogenes
had been reported from over 50 species of diseased and healthy animals including dog,
cat, horse, pig, fowl and many domesticated and wild animals (Gray and Killinger
1966).
1. 3. Morphology and culture characteristics:
a) Morphology: Listeria are gram positive, non-sporeforming, non-capsular, short,
regular rods. They are, 0.4-0.5μm in diameter and 0.5-2μm in length with rounded ends.
They are motile with a characteristic tumbling movement, best seen at room
temperature. Fresh mature cultures of Listeria show a typical diphtheroid palisade
formation with V and/or Y shapes either singly or in short chains whereas in very young
or old cultures they may be seen in coccoid forms. In fresh cultures they are always
2

gram positive whereas in old cultures gram staining is irregular (Seeliger and Jones
1986, Lovett 1990).
b) Colony characteristics: Listeria form colonies which are 0.5-1.5mm round,
translucent, with a low convex surface, a fine texture, an entire margin end and a dew-
drop appearance. On agar plates, older colonies, between 3-7 days are larger, 3-5mm in
diameter, with a more opaque centre and rough colonial forms. The colonies appear
bluish grey by normal illumination and a characteristic bluish green sheen is produced
by obliquely transmitted light. Under obliquely transmitted light the colony appearance
is so characteristic that, with a little practice, colonies can easily and quickly be
distinguished even in severely contaminated plates. Colonies may be sticky when
removed from agar plates. After removal of haemolytic colonies they leave a
haemolysed zone while non-haemolytic colonies leave an impression on the agar plate
(Gray and Killinger 1966, Seeliger and Jones 1986, Lovett 1990).
Three of the seven species of the genus Listeria are capable of lysing
erythrocytes. L. ivanovii is markedly haemolytic whereas L. monocytogenes and
especially L. seeligeri are less haemolytic. The haemolytic activity of these species is
used to differentiate them in a modified CAMP test (Christie and others 1944) which
employs Rhodococcus equi as well as Staphylococcus aureus. This test is widely used
for the differentiation of the three species in spite of conflicting results (Vazquez-
Boland and others 1990, McKellar 1993). The haemolytic activity of L. monocytogenes
and L. seeligeri is enhanced when grown adjacent to Staphylococcus aureus whilst no
reaction is observed with Rhodococcus equi. They are therefore CAMP test positive for
S. aureus and negative for R. equi. In contrast L. ivanovii produces large shovel shaped
areas of haemolysis when grown next to R. equi, but no reaction when grown next to S
aureus. It is therefore CAMP test negative for S. aureus and positive for R. equi.
3

Listeriolysin O (Fernandaz-Garayzabal and others 1992a) or phospholipase C (Skalka
and others 1982) are believed to be involved in the reaction seen with S. aureus and
sphingomyelinase is involved in the reaction seen with R. equi (Vazquez-Boland and
others 1989a, Kreft and others 1989). It has been reported that haemolytic activity of
some strains of L. monocytogenes can also be enhanced when grown next to R. equi
(Vazquaz-Boland and others 1990) thus caution should be exercised when interpreting
the results. The rest of the genus is unreactive to CAMP test and uniformly non-
haemolytic.
Some biochemical and physical characteristics of Listeria are given in the Table
1. 1. Speciation of the members of the genus Listeria are made on the basis of these
properties.
d) Antibiotic susceptibility: Although the antibiotic susceptibility of Listeria is
ambiguous in diseased animals, especially in meningoencephalitis, in vitro
examinations reveal them to be susceptible to Tetracycline, Penicillin G, Ampicillin,
Erythromycin, Chloromphenicol, Neomycin, Novobiocin, Cephaloridine but resistant to
Colistin, Sulfate, Nalidixic acid, Polymixin B, Acriflavin and Sulfonamides. Further
investigation is required to develop satisfactory treatment regimes for encephalitic cases
of Listeriosis (Seeliger and Jones 1986, Benedict 1990).
e) Serogroups: The antigenic composition of Listeria has been the subject of intensive
investigations (Gray and Kikllinger 1966, Seeliger 1984). The currently accepted
scheme is based on the findings of Paterson (1940), Donker-Voet (1972) and Seeliger
and Hohne (1979). The serogroups are based upon O (somatic) and H (flagellar)
antigens. The scheme now consists of 16 serovars (Table 1. 2).
4

Table 1. 1. Some characteristics of listeria organisms
monocytogenes ivanovii seeligeri innocua welshimeri grayi murrayi
Gram + + + + + + + +
Catalase + + + + + + +
Oxidase - - - - - - -
urease - - - - - - -
β-haemolysis + ++ +? - - - -
CAMP test
S. aureus + - + - - - -
R.equi - + - - - - -
Utilisation
Aesculin + + + + + + +
Rhamnose + - - v v - v
Glucose + + + + + + +
Xylose - + + - + - -
Mannitol - - - - - + +
Galactose - - - - - + +
Mannoside + - v + + - -
Reduction of
NO3 to NO2
enhancment of
growth by
iron
Mouse
virulance
serovars 1/2a, /2b, 1/2c,
3a, 3b, 3c, 4a,
4b, 4ab, 4d, 4e,
7
- - - - - - +
+ + + + + + +
+ + +v - - - -
1/2b,
4c, 4d,
6b, ud
5 6a, 6b,
4ab, ud
6a, 6b
+ =positive reaction, - = negative reaction, v = variable reaction, ++ = strong haemolysin, +? = weak
haemolysin, +v = variation in pathogenicity, ud = undesignated
1. 4. Taxonomy of Listeria:
5

L. monocytogenes was the only recognised species within the genus Listeria
until 1961 when Listeria denitrificans was included in the genus. Listeria grayi was
included in 1966 and Listeria murrayi in 1971 (Roucort and others 1982). In their
taxonomic investigation of L. monocytogenes Seeliger and Hohne (1979) divided it
into 16 different serogroups (Table 1. 2.). All serotype 5 strains were strongly β-
haemolytic and in 1975 Ivanov, a Bulgarian scientist proposed a separate species,
Listeria bulgarica. L. bulgarica was later named L. ivanovii by Seeliger and colleques
(1984) after Ivanov. Two years later, non haemolytic and non pathogen serotype 6
strains were proposed as a new species, Listeria innocua by Seeliger (1981). Listeria
welshimeri and Listeria seeligeri were included in the genus in 1983 (Rocourt and
Grimont 1983).
The original taxonomic classification of Listeria was based on biochemical and
physical characteristics of the organism. The species are biochemically very similar to
each other but differ in DNA sequences. Recent developments in DNA technology have
extended our knowledge of the bacteria at molecular level. DNA-DNA hybridisation of
Listeria has confirmed that Listeria monocytogenes, innocua, welshimeri, seeligeri and
ivanovii are closely related to each other but still differ at the DNA sequence level
(Rocourt and others 1982, Seeliger and Jones 1986, Farber and Peterkins 1991). The
classification of L. denitrificans , L. murrayi and L. grayi became problematic after the
study of the numerical taxonomic, DNA base composition and DNA-DNA
hybridisation studies (Stuart and Welshimer 1973 and 1974, Rocourt and others 1982).
These studies concluded that these three species were distinct from L. monocytogenes.
However Fiedler and Seger (1983) examined the amino acid sequences of the cell wall
of these species and concluded that the murein variation found in L. grayi and L.
murrayi was also found in L. monocytogenes. The murein content of L. denitrificans
was significantly different from those of other Listeria species which led to exclusion of
6

L. denitrificans from the genus. After serological studies and other related taxonomic
works L. murrayi and L. grayi were kept within the genus (Rocourt and others 1987,
Farber and Peterkins 1991).
At the present time, the genus Listeria has seven species which are L.
monocytogenes, L. ivanovii, L. seeligeri, L. innocua, L. welshimeri, L. murrayi and L.
grayi. Although Listeria monocytogenes is widely considered to be the only pathogen
of people and animals, L. ivanovii has been associated with abortion in sheep and rarely
in cattle (Alexander and others 1992), L. seeligeri has been isolated from cases of
encephalitis in people and L. innocua has been implicated in some encephalitic cases
both naturally and experimentally in ruminants (Walker and others 1994). The other
species are believed to be non pathogenic (McLauchlin 1987).
7

Table 1. 2. Serovar distribution of Listeria
Paterson Seeliger -
Donker-Voet
O antigen H antigen
1 1/2a I II (III) AB
1/2b I II (III) ABC
2 1/2c I II (III) BD
3a II (III) AB
3 3b II (III) IV (XII) (XIII) ABC
3c II (III) IV (XII) (XIII) BD
4a (III) (V) VII IX ABC
4b (III) V VI ABC
4c (III) V VII ABC
4d (III) (V) VI VIII ABC
4 4e (III) V VI (VIII) (IX) ABC
5 (III) (V) VI VIII X ABC
6a (4f) (III) V (VI) (VII) (IX) (XV) ABC
6b (4g) (III) (V) (VI) (VII) IX X XI ABC
7 (III) XII XIII ABC
L. grayi (III) XII XIV E
L.
murrayi
( ) = not always present
(III) XII (XIV) E
8

1. 5. Typing of Listeria monocytogenes:
Epidemiological studies of infectious diseases require methods to differentiate
causative agents beyond the species and subspecies levels. A number of typing methods
have been developed for this purpose based on the genotypic and phenotypic
characteristics of the agent. The implication of L. monocytogenes in epidemic and
sporadic listeriosis made it necessary to develop more discriminating typing techniques
to understand the epidemiology of disease and thus to help epidemiologist develop
preventive measures against L. monocytogenes infection. These techniques include
serotyping (Seeliger and Hohne 1979), biotyping (Ralovich 1993), antibiotic
susceptibility patterns (MacGowan and others 1990a), phage typing (McLauchlin and
others 1986), pyrolysis mass spectrometry (PyMS) (Freemen and others, 1991),
multilocus enzyme electrophoresis (MEE) (Bibb and others, 1990), plasmid typing
(Facinelli and others 1989), restriction endonuclease analysis (REA) (Nocera and others
1990), pulsed field gel electrophoresis (PFGE) (Brosch and others, 1994), ribotyping
(Graves and others, 1991) and random amplified polymorphic DNA (RAPD) (Mazurier
and Wernars 1992). These techniques are required to fulfil three important criteria; (a)
typeability, (b) repeatability or reproducibility and (c) discriminatory power, i.e. ability
to differentiate similar but unrelated strains. As important as these three criteria are cost,
rapidity, ease of the interpretation of the results and ease of performing the techniques
(Maslow and others 1993, Arbeit 1995). Each typing technique has some advantages
and disadvantages. The commonly used techniques are briefly explained below.
Biotyping utilises the metabolic activities expressed by Listeria such as
fermentation of carbohydrates and colony characteristics. This technique is widely used
to differentiate the species and subspecies in the genus Listeria. Although it is an easy
and cheap technique it fails to differentiate distinct strains within L. monocytogens
(Ralovich, 1993).
9

Serotyping is based on the identification of antigenic determinants on the cell
surface. Listeria has O and H antigens as defined by Paterson in 1940 and can be
divided into 16 serogroups (Seeliger and Hohne 1979). This method is widely used
because it is relatively cheap and easy to perform. However serological classification
using polyclonal antiserum is of limited value in epidemiological studies because the
method does not type all strains and few serotypes are implicated, i.e. 1/2a, 1/2b, 4b, in
most of the incidents (Seeliger and Hohne 1979, Farber and Peterkins 1991).
Antibiotic susceptibility of most bacteria is regularly carried out in clinical
microbiological laboratories. Many antibiotics used in agar or automated systems are
now in use (Arbeit 1995). The technique is cheap, inexpensive and easy to interpret but
the major problem with it is that strains can develop resistance to antibiotics. This
method has been used for typing L. monocytogenes (MacGowan and others 1990a).
Since plasmid mediated resistance to Listeria has also been reported (Poyart-Salmeron
and others 1990), its value is open to dispute.
Phage typing utilises viruses capable of infecting or lysing bacterial cells. A set
of bacteriophages were identified for L. monocytogenes (McLauchlin and others
1986). Although this method is more discriminatory and reproducible than serotyping
not all L. monocytogenes strains are typeable because the number of suitable
bacteriophages is limited. Furthermore only few laboratories perform this technique
routinely (Ralovich 1993).
Multilocus enzyme electrophoresis (MEE) utilises the difference in the
electrophoretic mobilities of individual soluble metabolic enzymes. The cellular
proteins of the micro-organisms are separated by gel electrophoresis and individual
enzymes are detected using specific substrates. Variations in electrophoretic mobility
reflect amino acid substitutions that alter the charge of the protein and thereby identify
variations in the chromosomal genes encoding the enzymes. The use of multiple
10

metabolic enzymes ensure that all isolates are typeable and this technique also provides
information on the genetic relationship between strains (Maslow and others 1993,
Arbeit 1995). It has been successfully used to analyse strains of L. monocytogenes
(Bibb and others 1990). However the technique is very demanding and is reported to be
less discriminatory than other techniques (Lawrence and Gilmour 1995, Donachie and
others 1992).
Pyrolysis-mass spectrometry (Py-MS) has originally been developed for the
analysis of insoluble polymeric materials. It has also been used for identifying,
classifying and typing or chemically analysing bacteria (Freeman and others 1990).
After cultivation the strains are smeared on pyrolysis foils, heat dried and pyrolysed at
530 0 C for 4s then the complex mixtures obtained are quantitatively analysed in mass
spectrometry (Freeman and others 1990, Ralovich 1993). The technique has been used
in the field of Listeria to analyse epidemic and sporadic strains and the strains isolated
from sheep (Freeman and others 1991, Low and others 1992a). Py-MS is simple and
cheap but it does not assign permanent type- designations, its assessment of strains is
valid for only strains pyrolysed as a single batch of freshly prepared media. Results may
vary with culture age, incubation conditions and technical factors (Freeman and others
1991, Low and others 1992a).
Plasmid typing is carried out by separating isolated plasmids electrophoretically
in agarose gel to determine their size and numbers. This technique has been used for L.
monocytogenes (Facinelli and others, 1989). However most strains of L.
monocytogenes do not carry plasmids (Perez-Diaz and others, 1982) and therefore this
typing method is not of much value.
Restriction enzyme analysis (REA) uses endonucleases with relatively frequent
restriction sites to digest bacterial chromosomal DNA thereby generating numerous
fragments. These fragments can be separated by size with use of agarose gel
11

electrophoresis. Different strains of the same species have different REA patterns
because of variations in their DNA sequences that alters the number and distribution of
restriction sites. Nocera and others (1990) typed L. monocytogenes with this technique.
They found that although the technique was able to type all strains and was reproducible
it did not completely discriminate between serotype 4b and 1/2b. In general
interpretation of REA is difficult because of the numerous DNA fragments generated.
These frequently overlap or are unresolved in agarose gels. Restriction enzymes are also
expensive (Maslow and others 1993, Arbeit 1995).
Ribotyping is a simplification of REA. Chromosomal DNA digested with
endonuclease is separated by agarose gel electrophoresis. Resulting fragments are
blotted on nitrocellulose or nylon membrane. The fragments containing specific
sequences are then detected by using a labelled ribosomal operons (16S rRNA, 25S
rRNA). It has been used in the field of Listeria (Graves and others 1991, Wiedmann and
others 1996) with varying degrees of success. The technique is robust and easy to
interpret comparing to REA but it is less discriminating than RAPD (Wiedmann and
others 1996).
Pulse field gel electrophoresis (PFGE) is also a variation of REA in which
enzymes with relatively few restriction sites are used to digest bacterial DNA. As a
result fewer but much larger restriction fragments are obtained. These fragments are
then resolved using an agarose gel electrophoresis technique in which the orientation of
electronic field is periodically changed rather than being kept constant as in
conventional agarose gel electrophoresis used for REA. PFGE has been used to type L.
monocytogenes by Brosch and others (1994). Although they were satisfied with the
capacity of the technique to type all the strains tested and its reproducibility they found
differences between the enzymes used (AscI and ApaI) in discriminating subtypes and
also noted that some serotypes were not distinguishable. In general the technique is very
12

demanding and time consuming and the enzymes are expensive (Maslow and others
1993, Arbeit 1995).
RAPD (Random Amplified Polymorphic DNA); method is a variation of the
PCR in which primers of an arbitrarily chosen sequence, rather than two specifically
designed primers, are used (Williams and others 1990). Any length of sequence will
suffice and one or more can be used in reaction mixture. The method has the potential
for typing since it exploits the fact that, for any given oligonucleotide sequence, the
genomes of bacteria are likely to contain many sequences with partial, rather than
complete, homology to the primer. Under non-stringent conditions the primer will
anneal to these sequences with varying degrees of stability, as determined by the
number of H-bonds that can be formed between the primer and a particular partially
homologous sequence. If two such complementary sequences are located close together
on the genome on opposite strands, and both have the same polarity, then PCR
amplification of the intervening sequence can occur under conditions that permit the
primer to anneal to both sequences. The distribution of these partially complementary
sequences is random, and hence the result of PCR is a set of random amplified
polymorphic DNA sequences. Single base change may destroy the ability of a sequence
to anneal to a primer, or may create a new primer banding site. Hence, the pattern of
amplified sequences obtained is primer and strain specific, and constitutes an identity
profile of the organism.
RAPD was first used to study the epidemiology of L. monocytogenes by
Mazurier and Wernars (1992). This was followed by several other attempts with
varying applications (MacGowan and others 1993, O`Donoghue and others 1995,
Wiedmann and others 1994, Wernars and others 1996). RAPD is cheap, very easy to
perform and results are easily interpreted. However before RAPD is used for large scale
typing optimisation of the technique must be done and this may take some time. Boerlin
13

and others (1995) came to the conclusion that RAPD was the best typing technique
when compared with the most commonly used techniques, namely REA, Ribotyping,
Serotyping, Phage typing and MEE.
Several comparisons of the available Listeria typing methods have been made.
Lawrence and Gilmour (1995) used RAPD and MEE to determine the characteristics of
L. monocytogenes in poultry product and processing plants. They concluded that
although MEE was less discriminatory than RAPD it provided information on genetic
relatedness of strains investigated and also added that reproducibility of RAPD was
excellent provided that the method was standardised. In another study, Donachie and his
colleagues (1992) typed strains of L. monocytogenes isolated from sheep by MEE and
PyMS. They found PyMS was more discriminatory, rapid and inexpensive than MEE.
However MEE was more reproducible than PyMS because strains used in PyMS could
not permanently be labelled and this could result in the same strain being considered
different when examined on more than one occasion. Norrung and Gerner-Smidt (1993)
used four typing methods (MEE, Ribotyping, REA and Phage typing) to type isolates of
L. monocytogenes of different origin. Their results indicate that typeability and
reproducibility of RAE, MEE and Ribotyping were 100%. Typeability of phagetyping
was 95% and also reproducibility was less than 100%. They found that different
methods were more discriminatory for different serotypes of L. monocytogenes (REA
for serotype 1, Phage typing for serotype 4 and the combination of RAE and MEE was
more discriminatory for both strains than the use of each technique alone). Boerlin and
colleagues (1995) compared the typing result obtained with RAPD to serotyping,
ribotyping, MEE, REA and Phage typing. They concluded that the discriminatory
power of RAPD was best and that the reproducibility was also good but that if RAPD
was to be widely used the method should be standardised. In another study Boerlin and
colleagues (1997) also used four different typing methods (MEE, REA, PFGE and
14

serotyping) and found that PFGE was the most powerful technique in discriminating
subtypes while MEE and serotyping were less discriminating. Destro and others (1996)
used PFGE and RAPD to trace the contamination of a shrimp processing plant with L.
monocytogenes . They suggested that to reach the best conclusion the two methods
should be used together.
This brief summary of information about typing methods employed in the field
of listeriosis may lead one to conclude that no single method meets the criteria stated
above because each technique lacks one or more important factor. However the
superiority of RAPD over some techniques has been acknowledged (Mazurier and
others 1992, Boerlin and others 1995, Wiedmann and others 1996). Others have
suggested that a combination of two or more techniques will allow the best results
(Norrung and Gerner-Smidt 1993, Destro and others 1996 and Louie and others 1996).
The use of typing methods in epidemiological investigations of listeriosis has
enabled the discrimination of individual strains of L. monocytogenes. An
epidemiological link between contaminated foodstuffs and listeriosis in people has been
established (McLauclin and others 1986, Nocera and others 1990, Norrung and
Skovgaard 1993). Similarly a link between silage (Vazquez -Boland and others 1992,
Baxter and others 1993, Wiedmann and others 1994), bedding (Green and Morgan
1994) and clinical listeriosis in animals has been established using these techniques.
However there is little detail regarding the distribution and temporal occurrence of these
strains in the veterinary field (Low and Donachie 1997).
1. 6. Pathogenesis, infectious dose, virulence and resistance:
a) Pathogenesis: The ways in which L. monocytogenes reaches and causes systemic
illness and disturbances in the brain have long been the subject of interest. The
existence of different forms of clinical listeriosis and their irregular distribution in
15

animals suggests that L. monocytogenes gains entry in several ways. Numerous
naturally occurring epidemic and sporadic cases of listeriosis and experimental studies
have shown the importance of the oral route as the initial exposure site.
The clinical occurrence of encephalitis and experiments carried out by Asahi
and others (1957) and Barlow and McGorum (1985) suggest that encephalitis follows
infection of the brain stem, resulting from L. monocytogenes ascending via cranial
nerves following minute wounds in buccal mucosa, inhalation and conjunctival
contamination. Intranasal infection of sheep with L. monocytogenes (Gill 1933) and
conjunctival inoculation of rabbits (Gray and others 1948) resulted in encephalitis.
Asahi and others (1957) produced encephalitis by instilling L. monocytogenes into the
conjunctiva, lips, gum, parotid region, oral cavity and tongue of mice, rabbits and goats
after breaking the integrity of mucosal membranes, and also by feeding L.
monocytogenes contaminated feed to the animals. Their histopathologic and clinical
examination revealed that encephalitis occurred after instillation of L. monocytogenes
through bruised and wounded membranes and feeding contaminated feed to goat, mice,
rabbits. Mucosal damage played an important role in infecting the trigeminal nerve
which then carried the organism to the brain. Barlow and McGorum (1985) produced
encephalitis in sheep by inoculating L. monocytogenes into the dental cavity and they
also acknowledged the role of the trigeminal nerve in the occurrence of encephalitis.
These studies have contributed to the hypothesis that forages such as grass, silage, grain
awns, straw and hay can break up the integrity of mucosal membranes and allow L.
monocytogenes to penetrate them. Having penetrated the mucosal membrane L.
monocytogenes can then travel along cranial nerves (especially trigeminal nerve) to
reach the brain (Dennis 1993). Subcutaneous injection of mice with L. monocytogenes
also resulted in encephalitis and this points to the role of infected wounds and the
16

transneural spread of the organism (Pohjanvirta and Huttunen 1985). Osebold (1963a)
also suggested that encephalitis might follow a bacteraemic stage.
Septicaemia and latent infection are possible results of being exposed to the
agent by inhalation and ingestion (MacDonald and Carter 1980, Pohjanvirta and
Huttunen 1985, Marco and others 1992, Bracegirdle and others 1994). Following oral
intake the entry of L. monocytogenes has been shown to occur through various cells. It
has been suggested that L. monocytogenes penetrates M cells overlying Payer's patches
(MacDonald and Carter 1980) or intestinal epithelial cells (Racz and others 1972) from
where they disseminate to other organs such as the liver, spleen, kidney, lung, genital
organs and brain. Colonisation in the gut also results in an inapparent infection and
prolonged faecal excretion (reviewed by Radostits and others 1994). In vitro studies
have also demonstrated that L. monocytogenes can penetrate and multiply within
various cells including epithelial cells and fibroblast-like cells (Cossart and Menguad
1989).
Abortion and genital organ infections also occur after ingestion of L.
monocytogenes contaminated feed and a resultant bacteremia. Experimental studies
have shown that after ingestion or parenteral injection of L. monocytogenes the genital
organs and foetus are invaded within 24 hours of the onset of bacteremia. This results in
abortion in 5-10 days (Njoku and Dennis 1973, Low and Renton 1985, Lammerding and
others 1992, reviewed by Radostits and others 1994).
Although more research is required to fully understand the pathogenesis of L.
monocytogenes infection, it is apparent from experimental and recent outbreaks of
Listeriosis in people and animals (Low and Renton 1985, Gitter and others 1986a,
Farber and Peterkins 1991, Schlech 1993) that the initial exposure is via the oral route
and that L. monocytogenes spreads to other organs after colonisation in the intestine
(Figure 1. 1) (Gronstol 1986, MacDonald and Carter 1980).
17

Immunity reducing Septicaemia
factors Abortion
Infected feed Epithelial phase Bacteremia
Neuritis Encephalitis
Figure 1. 1. Pathogenesis of L. monocytogenes infection (Gronstol 1986)
b) Infectious dose: Most of the experimental studies in mice have shown that a variable
number of L. monocytogenes is required for infection to develop, varying between 1.7
x 10 3 and 2.5 x 10 8 organisms (Ferber and Paterkins 1991). In ruminants the results of
experimental studies have also varied, 1.5x10 3 cfu/ml injected into mammary gland
induced mastitis in cattle (Bourry and others 1995), 3x10 7 to 7.5x10 10 cfu/ml injected
into the pulp cavity of sheep produced encephalitis (Barlow and McGorum 1985) and
8x10 9 cfu/ml given orally induced abortion in ewes (Gitter and other 1986a) while 10 6
and 10 10 cfu/ml doses of the organism given orally to sheep and lambs produced no
clinical signs (Low and Donachie 1991, Lhopital and others 1993). The infectious dose
required to trigger disease in naturally occurring listeriosis in ruminants is not known.
c) Virulence: Several virulence determinants of L. monocytogenes have been identified
and all of them are associated with the entry, survival, multiplication and spread of
organism in the host’s cells (Portnoy and others 1992, Sheehan and others 1994).
18

The infection of the host’s cell begins with internalisation of the bacterium
either by host derived phagocytosis in the case of macrophages or by pathogen induced
phagocytosis in the case of non-phagocytic cells (Dramsi and others 1996).
In the process of entry two surface proteins which take part in the induced
internalisation of L. monocytogenes by nonprofessional phagocytic cells have been
identified. These are internalin, and a p60 extracellular protein which are regulated by
genes called inlA and inlB, and iap respectively (Sheehan and others 1994). InlA has
been shown to initiate entry into enterocyte like cell lines by binding to the host cell E-
cadherin receptors, while inlB is required for entry into hepatocytes and some epithelial
cell lines. The receptor for inlB is not known but it is suggested that phosphoinositic
(PI)-3 kinase is required for L. monocytogenes uptake triggered by inlB (Dramsi and
others 1997). In recent years 5 more internalin proteins of unknown functions have been
identified. These are internalin C (inlC), C2 (inlC2), D (inlD), E (inlE) and F (inlF)
(Dramsi and others 1997) and actin polymerase regulated by ActA has recently been
identified as being involved in the entry process by interacting with heparin sulfate-
proteoglycan receptor (Kuhn and Goebel 1997). The studies have shown that strains
lacking these genes failed to enter or adhere to cells (Sheen and others 1994).
Following internalisation, Listeria are trapped within a phagosome where they
produce haemolysin or listeriolysin O, a pore forming thiol-activated cell product and
phospholipase C which together break up the phagosomal membrane so that the Listeria
are released and enter the cell cytoplasm. Listeria then multiply using host cell
nutrients. The production of Listeriolysin O and Phospholipase C is respectively
regulated by genes called hlyA and plcA. (Sheehan and others 1994). Experimental
studies have shown that strains lacking these genes were not able to multiply within the
cell (Portnoy and others 1988, Goebel and others 1988, Camilli and others 1991). The
strategy for survival in a host’s cell is believed to be a major virulence determinant of L.
19

monocytogenes and a prerequisite to successful infection by this bacterium (Dramsi and
others 1996).
After escape from the phagosome L. monocytogenes utilises cytoplasmic
nutrients to sustain its growth within the cell. During the process of multiplication,
actin, a product of actA gene, is produced. This enables the bacterium to move within
the cell. While moving freely the bacterium makes contact with the macrophage
membrane generating a pseudopod organelle. This is then taken up by an adjacent cell.
The life cycle continues in this newly infected cell (Tilney and Portnoy, 1989, Tilney
and Tilney 1993, Southwick and Purich 1996).
d) Resistance: Having briefly explained virulence and its determinants the following is
a brief description of mechanisms of resistance of the host to L. monocytogenes which
involves elements that deal with the organism at each stage of infection. Within first
hours of the internalisation around 90% of invading listeria are killed by phagocytes.
The recruitment of inflammatory cells such as neutrophils is also induced by interleukin
1 produced by infected macrophages. Neutrophils play an important role by limiting L.
monocytogenes access to host’s cells and aborting cell to cell spread by lysing infected
cells. Macrophages activated by phagocytosing L. monocytogenes release interleukin-1,
tumor necrosis factor-α and interleukin 12. TNF-α and IL-12 then stimulate natural
killer cells to produce interferon-γ. INFγ and IL-1 are necessary for macrophages to
express MHC class II molecules and for enhanced listeriocidal activity. The activated
macrophages inhibit the release of the organism from the phagosome. Macrophage
activation and the destruction of L. monocytogenes enable listeria specific antigens to
be presented to T cells which together with the IL-12 production promote the induction
of T helper 1 cells and CD8+ T cells resulting in a protective effect. L. monocytogenes
remaining in the endocytic compartment will be presented through the MHC class II
20

molecules to CD4+ T helper 1 cells and those in the cytoplasmic compartment will be
presented through MHC class I pathway to cytolytic CD8+ T cells. CD4+ T cells turn
mononuclear phagocytes into potent effector cells by producing cytokines which allow
the rapid killing of remaining organisms. Cytolytic CD 8+ T cells provide protection
against infected non-professional phagocytes (Mackannes 1962, Kaufmann 1990,
Portnoy 1992, Kaufmann 1993, Brombacher and Kopf 1996, North and Conlon 1998).
1. 7. Epidemiology
a) Occurrence: Listeriosis is believed to be a sporadic disease, predominantly of
ruminants. Sheep are affected frequently (Low and Donachie 1997) and a change in the
pattern of disease from sporadic cases to outbreaks has been reported (Gitter 1986,
Wilesmith and Gitter 1986, Gitter 1989) Clinical Listeriosis has been reported in a wide
range of animals (more than 50 species) and L. monocytogenes has been isolated from
reptiles, fishes, crustaceans, leeches, snails, arthropods and a variety of birds (pigeon
etc.) (Gray and Killinger 1966, Hyslop 1975). The disease is rarely reported in the
horse, pig, fowl, dog, cat, deer and in wild animals (rodents, birds) (Gray and Killinger
1966, Gitter 1989, reviewed by Radostits and others 1994)
Although Listeriosis is of world wide distribution it has been an important
problem in North America, Europe, Britain, New Zealand and Australia (reviewed by
Radostits and others 1994). In the northern hemisphere, Listeriosis has a distinct
seasonal occurrence with the highest prevalence in the winter months (between
December and May) (Low and Linklater 1985, Ralovich 1987, reviewed by Radostits
and others 1994). Sporadic cases of listeriosis have also been reported throughout the
year. The morbidity is relatively low but mortality is high in the encephalitic form of the
disease (reviewed by Radostits and others 1994). Wilesmith and Gitter (1986) reported
21

a variable number of cases of encephalitis in a survey of 60 flocks with the mean attack
rate being 2.5%. This can be as high as 35% in serious outbreaks. The attack rate for
abortion is reported in the region of 10% (reviewed by Radostits and others 1994).
b) Distribution: L. monocytogenes is ubiquitous in the environment and has been
isolated from a variety of animals and people (Gray and Killinger 1966). It has also
been isolated from the faeces of healthy animals and people which indicates that it can
live in the host’s intestine without causing any clinical illness.
Several studies indicate that a variable proportion of animals excrete L.
monocytogenes in their faeces. Kampelmacher and van Noorle-Jansen (1969) isolated
L. monocytogenes from 15.3% and 6% of cattle kept in two different regions, similarly
van Renterghem and colleagues (1991) isolated it from 20% of cattle faeces samples
examined. In a survey carried out by Husu (1990) between 9. 2 % (indoor period) and
3.1% (outdoor period) of dairy cattle excreted L. monocytogenes in their faeces and the
figures were higher when all Listeria spp. were considered. However Skovgaard and
Morgen (1988) reported the highest excretion rates in cattle faeces 67% Listeria spp.
and 51% L. monocytogenes. It has also been noted that the seasonal distribution of
faecal carriage is the same as that of clinical Listeriosis in northern hemisphere (Husu
1990).
The presence and concentration of L. monocytogenes in nature is believed to be
influenced by environment and climate (Picar-Bonnaud and others 1989). L.
monocytogenes has been isolated from soil, vegetation (soybean, corn, grass, forest,
etc.), cultivated and uncultivated fields (Welshimer 1968, Welshimer and Donker-Voet
1971, Welshimer 1975, Weis 1975). This character of L. monocytogenes led some
researchers to conclude that there was a saprophytic existence of the organism in the
plant-soil environment wherein this environment served as a reservoir (Welshimer and
22

Donker-Voet 1971, Weis and Seeliger 1975, Seeliger 1989). The survival of L.
monocytogenes at 5 0 C was investigated by Dijkstra (1975); the organism was found to
survive for 13 years in milk, 16 years in a brain sample, 12 years in faeces and 12 years
in silage. It is reported to persist for 2 years in dry soil, 11.5 months in damp soil, 2
years in dry faeces, 3 months in sheep faeces, 16.5 months in cattle faeces and up to 7
months on dry straw (reviewed by Radostits and others 1994). Isolation of the organism
from sewage, sewage sludge, and river water has also been reported (Kampelmacher
and Van Noorle-Jansen 1975, Watkins and Sleath 1981, MacGowan and others 1994). It
is also frequently isolated from surface water, bedding, feed, the walls of building and
water (reviewed by Radostits and others 1994).
Infective material also derives from infected animals, faeces, urine, the aborted
foetus, uterine discharges and milk. Carrier animals (both domesticated and wild) can
also introduce the organism into the herd or flock (Fenlon 1985, Dennis 1993).
c. Risk Factors: In addition to the presence of L. monocytogenes a number of
predisposing factors for the disease have been proposed. These include factors which
lower the host’s resistance and factors which increase the infection pressure of the
agent.
Factors which may increase susceptibility of animals to disease include poor
nutritional state, sudden changes to very cold and wet weather, the stress of late
pregnancy and parturition, long periods of flooding with poor access to pasture and
housing, and overcrowded and unsanitary conditions with poor access to feed supplies
(Hyslop 1975, Vandegraaff and others 1981, Barlow and McGorum 1985). Poor flock
management has also been associated with disease in sheep (Meredith and Schneider
1984).
23

The relationship between age and Listeriosis in animals is unclear. Studies to
date have produced conflicting results. Wilesmith and Gitter (1986) found no
association between age and disease but Nash and others (1995) reported lamb and
yearlings to be at an increased risk. Barlow and McGorum (1985) noted that most cases
occurred in lambs up to 4 months old or in adults of 2 years old. Scott (1993) also
reported a preponderance of cases in 2 year-old ewes.
Pregnancy is well known to be associated with Listeriosis in people and it is
thought that this is associated with a decrease in cell mediated immunity (CMI) (Lorber
1990). The cell mediated immune response is known to play an important role in
resistance to L. monocytogenes infection. Its role in animal Listeriosis is not well
defined.
The sex of animals has not been linked with clinical Listeriosis. However breed
has been reported as a predisposing factor and Angora goats in the USA (Johnson and
others 1996) and Rambouillets sheep in the USA (Nash and others 1995) have been
reported to be more susceptible. No such link is reported for different breeds of cattle.
The infection pressure of L. monocytogenes is influenced by environmental
factors that either favour or hinder its growth and survival. Some factors have been
identified to influence the life cycle of the organism in nature: temperature, pH and
atmosphere. Their influence is often interdependent and of complex nature.
Listeria organisms can multiply from around 0 0 C to between 45 0 C and 50 0 C
with optimal growth being between 30 0 C and 37 0 C (Juntilla and others 1988). The
ability of Listeria to grow at refrigeration temperature poses great concern to human
health. As the temperature decreases the duration of the lag phase increases and at 4 0 C
the lag phase lasts 5 - 10 days. Interestingly these cultures are highly motile, possess
well-developed flagella and are more pathogenic for laboratory animals (Gray and
Killinger 1966, Ralovich 1992). The organism also remains viable after repeated
24

freezing and thawing. The tolerance to this broad range of temperatures makes it
possible for L. monocytogenes to survive and grow indefinitely in the environment.
Studies to date indicate that L. monocytogenes can tolerate a wide range of pH
(3.8-9.2). The relationship between pH and survival and growth of the organism has
been reported in various samples. The survival of L. monocytogenes in three kinds of
soil was investigated and it was found that its survival in peaty soil (pH 5.5), was
shorter (156 days) than chalky (pH 8.3), and a mixture of both (pH 7.9) (1500 days)
(Picard-Bonnaud and others 1989). Similar results were found when silage was studied.
The role of pH in preserving silage will be dealt with below.
Listeria spp. are aerobic or facultatively anaerobic organisms. The growth of L.
monocytogenes was studied under both aerobic and anaerobic conditions at different
temperatures by Buchanan and others (1989). They found that at pH 4.5 the aerobic
growth of L. monocytogenes was dependent on incubation temperatures. An active
growth (an increase in population density) was observed at 19 0 C and 28 0 C. It was also
noted that the bacteria did not grow at 5 0 C and 10 0 C but managed to survive for
extended periods. When the temperature was raised to 37 0 C L. monocytogenes died off
rapidly. Anaerobic preservation of silage is very important. Listeria spp. will continue
to survive in silage exposed to air even if its pH is as low as 3.9 (Fenlon 1986a, 1988).
A study done by Fenlon (1986a) confirms that Listeria could also grow and survive in
anaerobic conditions if the pH is high.
Although the organism is widespread in the environment L. monocytogenes
infections have frequently been associated with the feeding of poor quality silage (Gray
1960a, Palsson 1963, Fenlon 1986b, Wilesmit and Gitter, 1986, Sargison 1993). The
disease is therefore called "silage sickness" (Dennis 1993). However the way(s) in
which silage acts as a risk factor is not clear. It may act as an enrichment medium
allowing the organism to grow excessively (Blenden and others 1967, Fenlon 1986c), or
25

a reservoir from which it spreads to animals and the environment (Fenlon 1985) or
alternatively as an immunsuppressing factor due to substances that it harbours (Gronstol
1980a), though this is disputed (Gitter and others 1986b). However silage appears to
play a role it is virtually impossible to make silage free of L. monocytogenes. The
multiplication of this organism can be kept to a minimum by proper silage making
procedures and also by effectively preserving silage by anaerobic storage, a high
concentration of organic acids and a pH between 4.2- 4.5. Listeria can multiply in
silage above pH 5.0 - 5.5, the critical pH depending on its dry matter content (Irvin
1968, Fenlon 1986a). Growth of the organism increases as silage pH increases
(Gronstol 1979a). Listeria can be present in silage which is poorly fermented but it can
also occur in pockets of aerobic deterioration in otherwise good silage (Fenlon 1986b,
Fenlon 1988). These areas are often indicated by mould growth and occur at the edges
of the silage clamp and in the top few inches of the surface in plastic covered clamps
where air has circulated under the plastic. The risk of contamination of silage with
Listeria is higher when soil is present in the silage. Soil may be picked up from mole-
hills present in the field or get into clamp or silo by other means such as tractor tyres or
from the clamp or silo floor. Soil contamination is indicated when the ash content is
high in the silage content (Fenlon 1988, Gitter 1989). Big bale silage is more prone to
contamination with Listeria because of lower density, poorer fermentation and greater
risk of mechanical damage to the plastic coverings (Fenlon 1986b, Sargison 1993).
Moist preserved feeds are also considered to be a risk for Listerial growth and
Listeriosis (Core and other 1990, Sergeant and others 1991). Cases due to feeding of
moist brewer grains, wet spoiled hay and silage made from orange have been reported
(reviewed by Radostits and others 1994).
The disease can occur 2 - 30 days after silage has been introduced. However, the
time from exposure to disease can vary and appears to depend on the distribution and
26

concentration of the bacteria in the silage. However, listeriosis is a disease of a complex
aetiology and its epidemiology is not fully understood (Donachie and Low 1995). Cases
have also been reported where the pasture was overflooded and poorly drained
(Vandegraaff and others 1981) and also during droughts (Reuter and others 1989).
The current understanding of epidemiology and pathogenesis of disease is
schematised in the Figure 1. 2 (Dennis 1993).
Figure 1. 2. Epidemiology of L. monocytogenes infection (Dennis 1993)
27

1. 8. Clinical signs and pathology
Although Listeriosis is manifested by three major clinical signs;
meningoencephalitis, abortion and septicaemia, only one clinical form of the disease
usually occurs in a group of animals or an individual animal. However an overlap of
clinical forms of disease have been reported (Gitter and Terlecki 1965, Gitter 1986,
Low and Renton 1985, Ohshima and others 1974). In addition to these three major signs
of disease, mastitis (Gitter and others 1980), myelitis (Gates and others 1967, Seamen
and others 1990), iritis and/or keratoconjunctivitis (Kummeneje and Mikkelsen 1975,
Morgan 1977, Bee 1993, Walker and Morgen 1993) have also been associated with L.
monocytogenes .
a) Meningo - encephalitis: This is the most commonly recognised form of Listeriosis in
adult ruminants and is the most common bacterial infection of the Central Nervous
System of adult cattle (Rebhun 1987). Although the clinical picture is similar in all
adult ruminants the course of the disease (1-2 weeks) is longer in cattle (Gitter 1989).
The basic clinical picture combines signs of the "dummy syndrome" with
pressing against fixed objects and unilateral paralysis (reviewed by Radostits and others
1994). In the early stages, animals are depressed, disoriented, febrile, indifferent to their
surroundings and usually separate themselves from the rest of the herd (Dennis 1993).
As a consequence of the destruction in the trigeminal nerve there is usually a
facial paralysis with a drooping ear, dilated nostril, and lowered eyelid on the affected
side. This is more common in cattle than in sheep (Gitter 1989). As a result of facial
paralysis animals become dehydrated and fluid-electrolyte balance deviates from
normal (reviewed by Radostits and others 1994).
28

There is a degree of deviation from normal in the position of head. It may be
retroflexed, ventroflexed or even normal depending on the localisation of the lesions in
the brainstem (reviewed by Radostits and others 1994).
The destruction of vestibulocochlear nuclei results in propulsive circling toward
the affected side. This form of the disease is therefore called "circling disease" (Hird
and Genegeorgis 1990). If the animal walks, it stumbles and moves in circles. There is
ataxia, often with consistent falling to one side (Dennis 1993).
Animals became recumbent and death is due to respiratory collapse. The
morbidity rate is low but the mortality rate is usually high (Rebhun 1987). Cases of
meningo - encephalitis have been reported in calves (Seimiye and others 1992) and in
lambs (Green and Morgan 1994). However meningo - encephalitis is never observed in
calves and lambs whose rumen is not yet functioning (Dennis 1993).
There are usually no remarkable gross lesions in the brain of affected animals
but occasionally slight clouding or pin-point greyish-white foci of the meninges may be
observed. Microscopic lesions are always confined to the pons, medulla and anterior
spinal cord. Both white and grey matter may be involved. In the brain substance and
sometimes in the meninges a remarkable perivascular cuffing with varying degrees of
focal necrosis develops which is typical of Listerial encephalitis. In this area there is
collection of mononuclear cells, oedema, haemorrhage and neurone degeneration. The
organism can be demonstrated in the focal lesions but not in the perivascular cuffs
(Ladds and others 1974, Thomson 1988).
b) Listerial Abortion: Abortions due to Listeria are usually sporadic in cattle. Outbreaks
of abortion have been reported (Osebold and others 1960) but occur more commonly in
sheep and goats. Abortion may occur at any stage of pregnancy but it occurs most
commonly in the last third of gestation (reviewed by Radostits and others 1994). There
29

is seldom clinical illness in the dam. In sheep as well as in cattle the incidence of
abortion in a group is low but may reach as high as 15%. Liveborn offspring are usually
too weak to survive for long (reviewed by Radostits and others 1994). Abortions due to
L. ivanovii have also been reported and are similar to those due to L. monocytogenes
(Alexander and others 1992).
In abortion the pathological picture depends on the stage of pregnancy. If it
occurs in the early stages of the last trimester the placenta is quickly invaded by the
bacteria and the foetus dies as a result of septicaemia. The dead foetus is expelled
within 5 days and by this time autolytic changes cover the minor gross lesions produced
by the organism. Metritis usually occurs and results in retention of the foetal
membranes. If it occurs at a late stage the offspring may be born in the normal way but
is usually unable to survive. In the aborted foetus the lesions are less severe. Gross
lesions are tiny pin-point yellow foci in the liver. Similar foci but visible only
microscopically are seen in the lung, myocardium, kidney, spleen and brain. The
bacteria can be demonstrated in the centre of these focal areas (Ladds and others 1974,
Thomson 1988).
c) Septicaemia: Although it is believed to be a syndrome of young ruminants and
monogastric species outbreaks of septicaemia have been reported both in cattle (Price
1975) and in sheep (Low and Renton 1985). This syndrome comprises depression,
weakness, emaciation, pyrexia and diarrhoea. At necropsy some cases show hepatic
necrosis, gastroenteritis, serofibrinous meningitis and ophthalmitis.
d) Mastitis: Since listeric mastitis goes unnoticed due to lack of clinical illness, mastitis
associated with L. monocytogenes is not well documented (Gitter 1989). In some cases
skin discolorization on the udder or teats and firm and nodular tissue development may
30

e noticed with careful examination. Pain is not observed during examination. The milk
is usually normal (Gitter and others 1980).
L. monocytogenes has been isolated from raw milk. This has important
implications in terms of its transmission to man and animals (Rea and others 1992).
e) Keratoconjunctivitis and/or iritis: Kummeneje and Mikkelsen (1975), Morgan
(1977), Baptista (1979), Watson (1989), Mee and Rea (1993) Walker and Morgan
(1993) and Welchman and others (1997) reported cases of keratoconjunctivitis and /or
iritis associated with silage feeding or L. monocytogenes. They reported a catarrhal
conjunctivitis with epiphora and photophobia and a moderate ophthalmitis with
hydrophthalmis, hypopion and in some cases keratitis. Animals are usually affected
unilaterally. Conjunctivitis is not purulent and corneal changes are minimal. Uveitis is
also reported with the encephalitic form (Ohshima and others 1974). In some cases
blindness is also reported. There is, however, a need to establish the relationship
between L. monocytogenes and iritis or keratoconjuntivitis.
1. 9. Diagnosis
Diagnosis of Listeriosis relies on the combination of clinical signs and
laboratory tests. Haematological examination (Dennis 1993) and serum biochemical
tests (Rebhun and deLahunte 1982) are of limited value especially in the diagnosis of
encephalitic listeriosis because there are no changes in these values to indicate
listeriosis. Cerebrospinal fluid analysis may have a diagnostic value because an increase
in White blood cells (WBC), protein and pressure have been reported (Rebhun and
deLahunte 1982, Aslan and others 1991 and Scott 1993) and isolation of Listeria from
CSF is possible.
31

Bacterial culture is widely used for the diagnosis of Listeriosis along with other
tests. Several selective and non-selective culture media have been developed for
detecting L. monocytogenes in food (Curtis and others 1995) and these have been used
for isolating L. monocytogenes from clinical specimens (Gray and others 1948, Gray
and Killinger 1966, Eld and others 1993). However, the value of bacteriological culture
is disputable, because isolation of L. monocytogenes from clinical specimens does not
necessarily reflect disease due to the fact that successful isolation from brain and faeces
of healthy animals have been reported (Gronstol 1980b, Husu 1990).
Histopathologic examination of organs, especially brains, of Listeria infected
cases is currently the most reliable method for diagnosis of listeric encephalitis.
Immunocytochemical techniques (peroxidase-antiperoxidase) using polyclonal
sera (Domingo and others 1986, Marco and others 1988, Johnson and others 1995) have
been used and compared with bacterial culture methods in the veterinary field. Johnson
and others (1995) have reported the superiority of this technique over bacterial culture
but the use of polyclonal anti-sera must be regarded with caution because of cross-
reaction with other Gram positive organisms (Low and Donachie 1997). McLauchlin
and colleagues (1989) have used this technique using monoclonal sera in diagnosis of
listeriosis in people, but this is not used in the veterinary field. An immunofluoroscent
test using polyclonal anti-sera has also been used for diagnosis (Eveland 1963) but this
test faces the same problems associated with polyclonal anti - sera.
Serological tests are the only tools that can be used to detect L. monocytogenes
infection or traces of infection in live animals. Complement fixation, agglutination,
haemagglutination and precipitation tests (Gray and Killinger 1966) have been used but
lack the predictive value needed for diagnostic use. These tests employ either crude
cells or somatic (O) and flagellar (H) antigen. These antigens have been proved to cross
react with other Gram positive bacteria such as streptococci, staphylococci and
32

enterococci (Gray and Killinger 1966, Peel 1987, Low and Donachie 1997). Attempts
were made to improve the specificity of the agglutination test and to overcome the
cross-reaction problem by pre-treating serum with 2-mercaptoethanol but Larsen and
others (1974) reported a decreased sensitivity after such a treatment. Recently more
specific antigens such as Listeriolysin O (LLO) have been developed for use in
serological assays. ELISA and immunoblot assays employing LLO have successfully
been used in experimental and field studies (Berche and others 1990, Low and others
1992b, Lhopital and others 1993, Baetz and Wesley 1995, Bourry and Poutrel 1996,
Bourry and others 1997). Large scale field trials using such ELISA assays have not yet
been made and cross reaction between LLO and other cytolysins such as Streptolysin O
(SLO), produced by some gram-positive organisms should not be ruled out (Baetz and
Wesley 1995, Gholizadeh and others 1996).
In recent years molecular techniques have increasingly been used for the
detection of L. monocytogenes in food and clinical cases of Listeriosis in people and
animals (Datta 1990, Furrer and other 1991, Wiedmann and others 1994, Walker and
others 1994, Bubert and others 1997). In these tests the primers prepared from genes
that determine virulence factors of L. monocytogenes such as haemolysin (hlyA), p60
extracellular protein (iap) and actin polymerisation (actA) have been used. The use of
PCR in investigating clinical listeriosis in sheep resulted in the detection of L.
monocytogenes from CSF and brain tissues (Wiedmann and others 1994, Wiedmann
and others 1997). However, Peters and colleagues` (1996) attempt to detect L.
monocytogenes in CSF using PCR was not promising, they detected L. monocytogenes
in only 1 of 11 confirmed cases of Listeriosis. Improvements in these techniques should
result in the rapid detection of L. monocytogenes within hours.
33

Differential diagnosis: Listerial meningitis may be confused with bovine spongioform
encephalopathy, the nervous form of ketosis, polioencephalomalacia, lead poisoning,
otitis media and interna, thromboembolic meningoencephalitis, viral encephalitis,
infectious keratoconjunctivitis and abortion and mastitis due to other agents (reviewed
by Radostits and others 1994, Dennis 1993).
1. 10. Treatment
Successful treatment of Listeriosis depends on the clinical form exhibited, the
duration and severity of clinical signs and the species affected (Cooper and Walker
1998). Although the optimal antibiotic treatment regimes for the various forms of
Listeriosis have not been established in experimental and clinical trials (Gellin and
Brrome 1989), cases with non nervous signs (abortion, septicaemia, iritis) respond well
to antibiotic treatments (Low and Renton 1985, Low and Donachie 1997). Success in
treating encephalitic Listeriosis is generally poor and the reported recovery rate is
around 30% in sheep (Donachie and Low 1995). The treatment is less effective in sheep
than cattle because the course of the disease is shorter and more severe in sheep (Dennis
1993). Animals that remain ambulatory are likely to recover (Scott 1992), but
recumbent or comatose animals rarely survive and spontaneous recovery rarely occurs
(Cooper and Walker 1998). The difficulty in treating encephalitic Listeriosis has
resulted in several in vitro and in vivo experimental studies to determine the best
possible treatment regiments. In vitro studies have shown that the majority of
antibiotics, penicillin, ampicillin, erythromycin, rifampicin, chloromphenicol, the
tetracyclines, and the aminogylcosides, with the exception of cephalsporins are effective
against L. monocytogenes (Hof 1991, Khan and others 1975). However, their in vivo
use has proved controversial. Several drugs and their combinations were used in
experimental Listeriosis in laboratory animals. Khan and others (1975) reported that a
34

combination of trimethoprim and tetracycline was more effective than a combination of
trimethoprim and penicillin and these combinations were better than the use of each
antibiotic alone. They also reported that both combinations failed in terms of complete
recovery. Scheld and others (1979) also tried to evaluate the effect of rifampicin,
penicillin, ampicillin and the combinations of gentamicin and penicillin or ampicillin
and the mixture of rifampicin and penicillin. They found that ampicillin had a greater in
vivo bactericidal effect than penicillin and rifampicin and penicillin was better than
rifampicin and the combination of penicillin and rifampicin. Their findings also suggest
that addition of gentamycin to penicillin or ampicillin enhances their bactericidal
activity and ampicillin plus gentamycin was the most effective combination in
experimental listeric encephalitis in rabbit.
Penicillin in high dosages was reported to be successful in treatment of clinical
cases of Listeriosis in cattle (Divers 1996) and was preferred to tetracyclines (Rebhun
and deLahunte 1982). In ovine encephalitis cases prolonged treatment with high doses
of ampicillin and amoxicillin with an amingylcoside are recommended (Scott 1992)
Although antibiotic resistance in clinical isolates is rare (Facinelli and others
1991) resistance to tetracycline, minocycline, trimethoprim, streptomycin (Charpentier
and others 1995), erythromycin (MacGowan and others 1990b) and transferable plasmid
mediated resistance to chloramphenicol, erythromycin, streptomycin and tetracycline
has been reported (Poyart-Salmeron and others 1990). Abortion and encephalitis caused
by multi-resistant strains of L. monocytogenes have been reported in people (Quentin
and others 1990, Tsakris and others 1997). It is not known if multiresistant strains have
been involved in animal Listeriosis but it should be considered where response to the
antibiotics mentioned above is negative.
1. 11. Control
35

Since elimination of L. monocytogenes from the farm environment is not
possible due to its ubiquitous occurrence in nature, the lack of reliable and rapid
methods of detecting the organism when it is present in low numbers and the lack of
understanding of epidemiology of Listeriosis and L. monocytogenes infection, attempts
can only be made to prevent Listeria organisms from multiplying to the level of an
infectious dose, to minimise its presence in the farm environment by improving hygiene
and cleanliness of the farm, and to minimise its intake by animals by preparing
foodstuffs such that L. monocytogenes does not grow. The epidemiology of Listeriosis
in animals is not fully understood (Gray and Killinger 1966, reviewed by Radostits and
others 1994, Donachie and Low 1995) therefore risk factors other than silage feeding
are not known. Where silage is implicated some recommendations can be made. The
proportion of silage in the ration can be reduced, silage feeding can be introduced to the
animals gradually and more attention can be paid to silage making. Spoiled and mouldy
silage should be removed from the feed. When making silage, additives should be used,
soil contamination should be avoided and the silo or clamp should be sealed off as
quickly as possible (Fenlon 1988, reviewed by Radostits and others 1994). It has been
reported that improvement in silage making resulted in a decrease in the incidence of
Listeriosis in Holland (Dijsktra 1986). However, disease has also been reported in some
parts of the world where silage feeding is not practised (Vandegraaff and others 1981,
Aslan and others 1991, Meredith and Schneider 1984). In such circumstances better
farm management practices, such as improvement of nutritional status of animals and
better housing conditions, can also be of some value in preventing disease.
Vaccination: Several attempts have been made to immunise animals against Listeriosis
using killed or live L. monocytogenes. The results obtained using a vaccine prepared
36

from killed or inactivated Listeria have been controversial. The experiments carried out
by Asahi (1963) and Von Koenig and Finger (1982) revealed that vaccines prepared
from killed Listeria organisms did not offer any protection. However Szemeredi and
Padanyi (1989) reported a reduction in the incidence of Listeriosis in sheep immunised
with chemically killed L. monocytogenes. Use of live Listeria organisms as a vaccine
resulted in protection against infection (Asahi 1963, Ivanov and others 1979, Gudding
and others 1989, Linde and others 1995). It significantly reduced the incidence of
listeriosis in the field trials (Gudding and other 1989, Linde and others 1995). Currently
no vaccine is used in the United Kingdom. A vaccine, containing a combination of live
4b and 1/2b strains of L. monocytogenes, is available in some eastern European and
Scandinavian countries. In these countries the vaccine is believed to reduce the annual
incidence of the disease. However, the results of vaccine trials are not satisfactory in
terms of complete protection, the efficacy of the vaccine has not been evaluated and no
experimental model is available to test their efficacy (Donachie and Low 1995, Low
and Donachie 1997).
1. 12. Listeriosis in People
a) Occurrence: The first confirmed report of Listeriosis in people was made in 1929 by
Nyfeld (Gray and Killinger 1966). Listeriosis is caused by predominantly L.
monocytogenes and only three infections caused by L. ivanovii (2) and L. seeligeri (1)
have been reported (McLauchlin 1987). Clinical Listeriosis manifests itself in three
forms; encephalitis and abortion predominantly in adults, and septicaemia in neonates
and rarely in adults (McLauchlin 1987, Farber and Peterkins 1991, Schuchat and others
1991, Schlech 1991). In addition focal infections such as septic arthritis, peritonitis,
liver abscess, endophthalmitis and cutaneous infection, can also occur (Gellin and
Broome 1989). Although reports of clinical Listeriosis have grown in number since its
37

first description, it was only 1980s that L. monocytogenes infection achieved
prominence as a food borne disease (Farber and Peterkins 1991, McLauchlin 1996).
Most cases of clinical listeriosis appears to be sporadic but epidemics have also been
reported in recent years. The annual endemic rates have been reported to be between 2
and 15 cases per million (Farber and Peterkins 1991). The current incidence of clinical
Listeriosis is about 2-3 cases per million per annum in England and Wales with case
fatality rates being between 20 and 40% (McLauchlin 1996). In England and Wales
there was a dramatic increase in the number of cases reported in people in the 1980s
which coincided with an increase in animal Listeriosis reported by Veterinary
Investigation Centre (VIC), in other human disease caused by intestinal pathogens and
use of untreated human sewage sludge and animal slurry on agricultural land
(McLauchlin 1987). A decline in the number of cases has been observed since 1990.
This may be due to improved control measures associated with developments in
isolation and typing methods or increasing public awareness.
b) Risk factors: Listeriosis in people is believed to be a disease of those whose immune
system is suppressed. However, a recent outbreak in the USA has shown that L.
monocytogenes could equally be a potential health problem for immuncompetent
individuals (Dalton and others 1997). Several predisposing factors have been identified
to be associated with the occurrence of clinical Listeriosis. Extremes of age, pregnancy,
malignancy, immunsuppression (HIV infection, organ transplantation) are the major
risk factors (Lorber 1990, Farber and Peterkins 1991, Rocourt 1996).
c) Transmission: The route of transmission of Listeriosis has long been the subject of
debate. Direct contact with infected animals has been shown to be one way of
transmission for the cutaneous form of Listeriosis. 10 cases have been reported in the
UK and 7 cases in the rest of the world (McLauchlin and Low 1994, McLauchlin 1996).
Hospital cross infections during the neonatal period have been reported on 29 occasions
38

in the UK and in 22 instances in the rest of the world (McLauchlin 1996). However L.
monocytogenes is now a well recognised food borne pathogen. Many sporadic and
epidemic cases of Listeriosis have been traced to food (Farber and Peterkins 1991,
Schuchat and others 1991, McLauchlin 1996) and the role of food in the occurrence of
Listeriosis has been established in a case control study (Pinner and others 1992,
Schuchat and others 1992). Some food borne outbreaks and sporadic cases of Listeriosis
are presented in the Table 1. 3.
Table 1. 3. Epidemic and sporadic cases of foodborne clinical Listeriosis in people.
Country Year No. of cases Implicated food
Outbreaks
Canada 1981 41 Coleslaw
USA 1983 49 Milk
USA 1985 142 Soft cheese
United Kingdom 1987-89 >350 Pate
Switzerland 1983-87 122 Soft cheese
Australia 1991 4 Smoked mussels
France 1992 279 Pork tongue
France 1995 17 Soft cheese
Sporadic cases
USA 1987 Raw milk
England 1988 Soft cheese
England 1988 Rennet
USA 1989 Sausage
Italy 1989 Fish
Finland 1989 Mushrooms
Italy 1994 Pickled olives
This table was extracted from a publication by McLauchlin (1996).
The table indicates that a variety of foods has been linked with disease but in the
majority of cases animal products have been implicated. Studies carried out to
determine the presence of L. monocytogenes on vegetables, in nature, in dairy products
39

and meat products have resulted in an enormous number of publications (Johnson and
others 1990, Jay 1996, Kozak and colleques 1996, Beuchat 1996).
L. monocytogenes has frequently been isolated from soil, vegetation such as
corn, soybean plants, grass (Welshimer and Donker-Voet 1971, Weis and Seeliger
1975), sewage sludge (MacGowan and others 1994), river waters, industrial effluent
such as abattoirs, cattle market, poultry packing plants (Watkins and Sleath 1981),
vegetables such as cabbage, cucumbers, potatoes, radishes (Beuchat 1996), salads
containing cabbage, carrots, lettuce, cucumber, onion, leeks, watercress, celery and
fennel (Sizmur and Walker 1988).
Jay (1996) reviewed the overall prevalence of L. monocytogenes in meat and
meat products by combining the results of several studies. The prevalence in meat (fresh
or frozen) was 20% in pork, 16% in beef and lamb and 17% in poultry. He also
estimated a 13% overall prevalence for processed meat such as sausages, bacon, salami,
pate and corned beef.
Kozak and colleagues (1996) reported the prevalence of L. monocytogenes in
raw milk in the same way as Jay. It was 3.1% in the USA, 2.7% in Canada and 4.1% in
Europe. In a national survey carried out in England and Wales by Greenwood and
colleagues (1991) L. monocytogenes was isolated from 3.6% of raw milk samples.
Fenlon and Wilson (1989) examined bulk milk tank for the presence of L.
monocytogenes in Scotland over a period of time and found that 3.8% of samples were
positive for L. monocytogenes. In another study Fenlon and colleagues (1995a) isolated
L. monocytogenes from 25 of 160 bulk milk tank samples. L. monocytogenes
organisms occur in low number in milk and are easily killed at pasteurisation
temperatures (Farber and Peterkins 1991, Kozak and colleagues 1996). However, the
isolation of L. monocytogenes in pasteurised milk and in several milk products such as
cheese, ice cream, yoghurt, (Greenwood and others 1991) suggest that post
40

pasteurisation contamination can occur at the processing plants or retailers (Kozak and
others 1996, Fenlon and others 1996) and outbreaks of Listeriosis due to a such
contamination have been reported (Linnan and other 1988, Dalton and others 1997).
These findings reflect the fact that L. monocytogenes is an environmental
organism with a broad distribution. People are exposed mainly through the oral route
and bacteria are possibly ingested at low dosages daily. The Figure 1. 3. shows the
current understanding of potential ways of transmission for Listeriosis in people.
d) Carrier status: L. monocytogenes is thought to be a normal inhabitant of the
intestinal tract of people. The proportion of human carriers varies from 0.5% to 91.7%
(Ralovich 1987). At any one time, between 5% to 10% of normal healthy population
excrete L. monocytogenes in their faeces (Farber and Paterkins 1991).
Faeces Insects
harvesting, handling
processing
Sewage environment
Animals Water Vegetables People
Plants silage, feed meat, milk, eggs
Soil (cross contamination)
Figure 1. 3. Potential pathways of L. monocytogenes transmission to people (after
Beuchat, 1996)
e) Infectious dose: The number of L. monocytogenes required to cause illness depends
on many factors, the most important appears to be the host’s susceptibility and
genetically determined and phenotypically expressed properties of the pathogen. The
41

infectious dose for the infection in people is not known. From outbreaks and sporadic
cases it can be concluded that the dose varies from 10 2 to 3.4x10 9 with the incubation
period being between less than 24 hours and 23 days (Farber and Peterkins 1991)
f) Control: L. monocytogenes is so widespread that its elimination from our
environment is beyond our technical capacity. But some strict regulations and
management practices such as HACCP (Hazard Analysis Critical Control Points) and
hygiene in processing plants and at home, can be put in place so that L. monocytogenes
does not exceed the level of infectious dose or propagate beyond the host’s ability to
cope with it (Greenwood and others 1991, Farber and Peterkins 1991, Dalton and others
1997).
1. 13 The objectives of this study:
L. monocytogenes has received tremendous attention owing not only to
economic losses and public health concern but also to its use as a model bacterial
pathogen in studying immunology, pathogenesis, behaviour of intracellular pathogens
and their interaction with host. Economic losses due to Listeriosis and L.
monocytogenes have been estimated in some studies. Low and Renton (1985) reported
£5,130 loss due to a single outbreak of Listeriosis in a flock, similarly Nash and
colleagues (1995) estimated that the economic loss would be £6,809 in a Rambouillet
flock after an outbreak with 12% mortality. In countries such as the USA, where “zero
tolerance” policies are applied the loss due to food recall could count for billions of
dollars (Archer 1996). L. monocytogenes infections in people and its consequences are
incalculable. This and the fact that there appears to be a close relationship between
42

human Listeriosis and animal Listeriosis prompted us to investigate this disease and its
cause, L. monocytogenes , in more details in order to determine:
a) the frequency of Listeriosis in dairy cattle in England. The figures on prevalence and
incidence of clinical Listeriosis in dairy cattle were not known at the beginning of this
study. Listeriosis is not a notifiable disease and the only figures available are those
estimated from cases submitted to the Central Veterinary Laboratories (CVL) in most
cases for the diagnoses of other disease such as BSE and Brucellosis. Cases of
Listeriosis other than encephalitis are not usually reported to these centres. Therefore a
cross sectional study using a postal questionnaire was carried out to determine the
prevalence, incidence and some characteristics of clinical Listeriosis in dairy cattle in
England (Chapter 2).
b) risk factors associated with disease at the farm level. The relationship between silage
feeding and L. monocytogenes is established but the exact manner in which silage
plays a role is not known (Wilesmith and Gitter 1986, Gitter 1989). There is an
evidence that farm management may also be important (Meredith and Schneider 1984).
In the cross sectional study we also attempted to identify and test some hypothesises for
farm level risk factor(s) associated with the occurrence of clinical Listeriosis (Chapters
3 and 4).
c) infection rate in individual animals. Several studies have been carried out to
determine carriage status of this organism (Skovgaard and Morgen 1988, Husu 1990).
These studies lacked epidemiological and statistical design and differences were
detected in excretion rate between them. There have been no studies in the United
Kingdom aimed at determining the infection rate in dairy cattle. We therefore conducted
43

a longitudinal study involving five dairy herds to determine the infection rate using
bacteriological and serological tests (Chapters 5 and 6).
d) degree of environmental contamination. L. monocytogenes is well known for its
commonness in the environment. During the longitudinal study we also tried to
determine the degree of the environmental contamination on the farms that we studied
(Chapter 6)
f) source of infection. The use of typing methods has enabled researchers to easily trace
the source of L. monocytogenes in sporadic and epidemic Listeriosis and
epidemiological investigation. In this study we used a molecular typing method
(Randomly amplified polymorphic DNA) to determine the relationship between the
organism and infection on the farms studied (Chapter 6).
44

CHAPTER 2
The frequency and some characteristics of clinical
2. 1. Introduction
listeriosis in dairy cattle in England
Listeriosis is an infectious disease caused by micro-organisms of the genus Listeria
(Farber and Peterkin 1991, reviewed by Radostits and others 1994). Three distinct patterns
of clinical disease are recognised in both animals and people; encephalitis, abortion,
septicaemia. (Gray and Killinger 1966). In addition, mastitis (Gitter and others 1980, Boury
and others 1995), iritis and keratoconjunctivitis (Kummeneje and Mikkelsen 1975, Morgan
1977, Watson 1989, Bee 1993) have also been associated with Listeriosis in ruminants in
recent years.
Listeria has attracted considerable attention owing not only to increased reports of
clinical disease in animals (Gitter 1989) and people (MacLauchlin and others 1991) but
also to its implication as a food-borne pathogen (Schlech, 1991).
Although much progress has been made in the isolation, identification and typing of
listeria the epidemiology of listeriosis remains poorly understood (Donachie and Low
1995). There has been no study of the prevalence and incidence of listeriosis in dairy cattle
46

in Britain. In this part of the study the frequency of listeriosis and its clinical presentation in
dairy cattle in England are presented.
2. 2. Materials and Methods
2. 2. 1. Study Population
A random sample of 1500 dairy cattle farmers in England was selected. The sample
size was calculated from an expected prevalence of 50% with 95% level of confidence, a
desired accuracy of 3% and predicted response rate of 70% (Canon and Roe 1982). This
sample represented 5.8% of the total dairy cattle holdings in England (MAFF 1994).
2. 2. 2. Study Design
This was a cross sectional study in which a postal questionnaire was used to collect
data on the frequency of listeriosis in dairy cattle in England between July 1994 and June
1995.
2. 2. 3. The Questionnaire (Appendix 1)
A self administered, eight-page, postal questionnaire was designed to collect data
about listeriosis from dairy farmers in England. The questionnaire consisted of 7 parts.
Parts one and two were designed to obtain information on the prevalence and incidence of
Listeriosis, part three was designed to estimate herd size, replacement rate and number of
47

dairy calves in July 1994 and June 1995, the remaining parts collected information on farm
level variables which might influence the occurrence of listeriosis. This included questions
on feeding, (type, preparation, storage, feeding regime), housing, (season of housing, type
of housing, type of bedding, storage of bedding, cleaning of house) and general information
(cases of listeriosis in other species of animals, vaccine use etc.).
Pilot questionnaires were tested by sending them to 9 dairy farmers on the 5th of
August, 1995. The questionnaire, covering letter, and a stamped addressed envelope were
sent to farmers on the 25th of August, 1995. Two reminder post cards and second copy of
the questionnaire were sent to non-respondents and a final fourth reminder letter was sent to
the remaining non-respondents on the 23rd of December, 1995 (Appendix 1).
Questionnaires returned after the 12th of January, 1996 were not included in the study.
2. 2. 4. Data Analysis
Two estimates of the frequency of listeriosis were calculated in this study; the farm
level prevalence and the crude within herd incidence rate. They were estimated from
clinical cases reported between July 1994 and June 1995 for three groups of dairy cattle;
milking cows, replacement heifers and dairy calves. For the same groups, the incidence
rates were recalculated for two clinical signs; silage eye and nervous signs.
To calculate the within herd incidence rate the mean numbers of milking cows,
replacement heifers and dairy calves reported in July 1994 and June 1995 were used to
estimate the number of animals at risk in each group. The within herd incidence rate of
listeriosis was calculated separately for herds reporting clinical disease and for all herds.
Respondents who did not know if they had had any cases of listeriosis in any of these
48

groups were excluded from analysis. In calculating the within herd incidence rates for the
different clinical signs those cases where clinical signs were not reported were excluded
from the analysis.
Three alternatives were given for the diagnosis of the disease; veterinary surgeon,
veterinary investigation centre (V.I.C) or self diagnosis. In order to validate diagnosis by
farmers, they were asked to select the clinical signs of listeriosis from a list of eight clinical
signs, two commonly associated with listeriosis (nervous sign and silage eye-
keratoconjunctivitis), four occasionally associated with the disease (abortion, sudden death,
diarrhoea and mastitis) and the remaining two not linked to listeriosis (lameness,
pneumonia). The criterion validity (Abramson 1988) of “self diagnoses” was made by
comparing the reporting of clinical signs by farmers with the combination of veterinary
surgeon or V.I.C. diagnoses. The questionnaire was also externally validated using data on
the frequency of listeriosis collected by Central Veterinary Laboratory (CVL) during
statutory Bovine Spongiform Encephalopathy (BSE) reporting between July 1994 and June
1995.
Information about the month of illness, treatment and its outcome was also
collected. Cases reported to occur over a period of two or more months were divided
equally between the months in order to estimate their seasonal and monthly distribution.
Those cases where no month of diagnosis was given were excluded from analysis. Cases
where clinical signs and treatment were not indicated were also excluded from analysis.
2. 2. 5. Data processing and analysis:
49

All data were numerically coded, entered onto a database (Microsoft Access 2,
Simpson 1994) and analysed using Epi-info version 6 (Dean and others 1994). A Yates
corrected chi squared test was used to compare the differences between proportions. A
Kruskal-Wallis test was used to compare the differences between median values (Dean and
others 1994). A probability of p< 0.05 was accepted as statistically significant.
2. 3. Results:
2. 3. 1. Response rate:
Of the 1500 dairy cattle farmers, 961 returned questionnaires, giving an overall
response rate of 64.1%. 67 of the 961 questionnaires were returned unanswered because the
farmers no longer kept dairy cattle (36 farms) or were unwilling to take part in the study.
These were removed from the study leaving 61.1% usable questionnaires (894/1464).
2. 3. 2. The prevalence of listeriosis at farm level:
Respondents who did not know whether they had clinical listeriosis in any of the
groups of dairy cattle were removed from analysis. 12.3% (93/759) reported clinical
listeriosis in dairy cattle on their farms between July 1994 and June 1995 . Cases were
diagnosed by a veterinary surgeon or V.I.C. on 83.9% (78/93) of the affected farms. When
the overall proportion of farms affected was estimated using only cases diagnosed by a
veterinarian or V.I.C., the proportion was 10.3%. This was not statistically different from
that of 12.3% (P=0.2).
50

The proportions of farms with cases in milking cows, replacement heifers and dairy
calves were 9.3% (71/761), 5% (39/780) and 1.4% (11/781) respectively. The proportion of
farmers reporting listeriosis in milking cows was significantly higher than those in
replacement heifers and dairy calves (P

incidence rate was 4/1000 animal-years (423/104 720) in all herds and 51.4/1000 animal-
years (423/6 017) in affected herds.
The incidence rate was estimated for each group. It was 39.7/1000cow-years
(239/6017) in affected herds and 4.2/1000cow-years (239/56 849) in all herds for milking
cows. For replacement heifers, it was 86.6/1000heifer-years (142/1639) in affected herds
and 7.4/1000heifer-years (142/19174) overall. The incidence rate in dairy calves was
73.7/1000calf-years (42/570) in affected herds and 1.5/1000calf-years (42/28697) in all
herds. The incidence rate in replacement heifers was significantly higher than in milking
cows and dairy calves (P

Table 2. 3. The proportion of animals affected with listeriosis according to the clinical
signs (animal-year/1000)
incidence rate β
silage eye nervous signs
affected all affected all
overall 66.5 (355/5,337) 3.4 (355/104,720) 9.9 (20/2,011) 0.2 (20/104,720)
milking cows 45.6 (194/4,259) 4.2 (194/56,849) 7.7 (14/1,809) 0.25 (14/56,849)
replacement
heifers
148.4 (127/856) 6.6 (127/19,174) 29.7 (6/202) 0.3 (6/19,174)
dairy calves 153.2 (34/222) 1.2 (34/28,697) 0 0
β significant difference between the groups of animals and also between the affected and all herds (P

percentage
50
45
40
35
30
25
20
15
10
5
0
Monthly distribution of cases of Listeriosis
n=403
J F M A M J J A S O N D
MONTH
Figure 2. 2. Monthly distribution of cases showing silage eye
percentage
50
45
40
35
30
25
20
15
10
5
0
silage eye
n=316
J F M A M J J A S O N D
MONTH
Figure 2. 3. Monthly distribution of cases showing nervous signs.
54

percentage
50
45
40
35
30
25
20
15
10
5
0
Nervous signs
n=20
J F M A M J J A S O N D
MONTH
2. 3. 5. The prevalence of listeriosis in other animals:
Farmers were asked whether they had any clinical cases of listeriosis in any other
animals kept on their farms; 1.7% (14/810) reported cases in beef cattle and 4.3% (35/822)
in sheep.
2. 3. 6. Clinical signs associated with reported cases of listeriosis:
Farmers reporting clinical cases between July 1994 and June 1995 were asked to
specify the clinical signs seen in the cases on their farm. No clinical signs were reported for
4.3% (18/423) of the cases. The frequency of clinical signs reported by farmers is given in
the Table 2. 4. The most frequently reported clinical sign was silage eye (83.7%), followed
by nervous signs (4.9%) and abortion (2.5%). In 7.2% (29/403) of the cases both nervous
signs and silage eye were reported. A similar distribution was obtained when the diagnosis
55

was made by a veterinarian or V.I.C. The frequency of clinical signs seen in milking cows,
replacement heifers and dairy calves is also given in Table 2. 5.
Table 2. 4. Frequency of clinical signs in cases reported between June 1994 and June
1995
all diagnosis diagnosed by vet. Or VIC
Clinical signs n=405 (%) n=222 (%)
silage eye 339 (83.7) 177 (79.7)
silage eye and nervous signs 29 (7.2) 12 (5.4)
nervous signs 20 (4.9) 20 (9)
abortion 10 (2.5) 9 (4.1)
mastitis 4 (1) 1 (0.5)
Sudden death 1 (0.2) 1 (0.5)
Diarrhoea 1 (0.2) 1 (0.5)
silage eye and sudden death 1 (0.2) 1 (0.5)
n number of cases
When re-estimated for the three age groups of dairy cattle the distribution of silage
eye was similar in all groups but no cases of Listeriosis showing nervous signs were
reported in dairy calves (Table 2. 5).
Table 2. 5. The frequency of clinical signs for the cases reported in three groups of
dairy cattle between July 1994 and June 1995
56

Milking cows (%) Rep. heifers (%) Dairy calves (%)
Clinical signs n α =238 n ß =146 n α =127 n ß =65 n α =40 n ß =11
silage eye 194 (81.5) 117 (80.1) 111 (87.4) 52 (80) 34 (85) 8 (72.7)
s. eye and n. signs 14 (5.9) 3 (2.1) 9 (7.1) 6 (9.2) 6 (15) 3 (27.3)
nervous signs 14 (5.9) 14 (9.6) 6 (4.7) 6 (9.2) 0 0
abortion 10 (4.2) 9 (6.2) 0 0 0 0
mastitis 4 (1.7) 1 (0.7) 0 0 0 0
Sudden death 1 (0.4) 1 (07) 0 0 0 0
Diarrhoea 1 (0.4) 1 (0.7) 0 0 0 0
s. eye and s. death 0 0 1 (0.8) 1 (1.6) 0 0
α diagnosed by all three given alternatives, self, veterinarian, VIC, ß diagnosed by veterinarian or VIC, n
number of cases
2. 3. 7 Treatment :
91.7% (388/423) of the cases reported between 1994 and 1995 were treated. 95.6%
(371/388) of treated cases recovered, 2.3% (9/388) died and 2.1% (8/388) were culled.
3.6% (15/423) were untreated and for the remaining 4.7% (20/423) treatment was not
reported. When cases were grouped according to these presenting clinical signs recovery
from silage eye was high (99%) while only 68.4% of the cases with nervous signs were
reported to recover. This difference was statistically significant (P

all cases* 403 384 371 (96.6%) 9 (2.3%) 8 (2.1%)
silage eye 339 331 328 (99%) 3 (1%) 0
s. eye and n. signs 29 29 26 (89.7%) 1 (3.4%) 2 (6.9%)
nervous signs 20 19 13 (68.4%) 4 (21.1%) 2 (10.5)
abortion 10 4 4 (100%) 0 0
mastitis 4 0 0 0 4 (100%)
s. eye and s. death 1 1 0 1 0
n number of the cases * excluding those whose clinical signs were not reported
2. 3. 8. Validation of the questionnaire:
The frequency of individual signs selected by farmers is given in the Table 2. 7.
Abortion (57.8%), nervous sign (56.8%), silage eye (49.4%) and diarrhoea (24.1%) were
reported most frequently. Of 894 respondents, 41% (366/894) did not answer this question,
6% (54/894) answered “don`t know” and 53% (474/894) identified one or more clinical
signs of listeriosis. When the diagnosis made by veterinarian or V.I.C. was taken as the
gold standard, the sensitivity of farmers reporting individual symptoms was 67.2% for
silage eye, 49.2% for nervous signs and 21.9% for abortion The sensitivity was high when
more than one clinical signs was reported. It was 96.1% (123/128) for farmers reporting a
combination of nervous signs, silage eye or abortion and 87.5% (112/128) for farmers
reporting nervous signs or silage eye. (Table 2.7).
Table 2. 7. The frequency of clinical signs chosen by farmers and sensitivity of farmers
reporting correct clinical signs.
Frequency of clinical
Clinical signs
signs n α sensitivity of farmers
=474 (%) reporting n β =128 (%)
58

Abortion 274 (57.8%) 28 (21.9%)
Nervous signs 269 (56.8%) 63 (49.2%)
Silage eye 234 (49.4%) 86 (67.2%)
Diarrhoea 114 (24.1%) 8 (6.3%)
Sudden death 87 (18.4%) 12 (9.4%)
Mastitis 38 (8%) 4 (3.1%)
Lameness 26 (5.5%) 0
Pneumonia 21 (4.4%) 2 (1.6%)
N. sign + s. eye + abortion 435 (91.7%) 123 (96.1)
Nervous sign + silage eye 356 (75.1%) 112 (87.5)
α diagnosed by all three given alternatives, β diagnosed only by veterinarian or V.I.C.
During the period between July 1994 and June 1995, 99 cows which developed
nervous signs and were reported to the state veterinary agency under the BSE notification
scheme turned out to be cases of listeriosis on histopathological examination. This
represents 4.1/100 000 cases/cattle in the United Kingdom (except Northern Ireland) (J.
Wilesmith personal communication). For the same period in our survey the number of cases
of Listerisosis reported as culled or dying of encephalitis were 5 and the number of total
dairy cattle population reported between July 1994 and June 1995 was 119,123, giving a
proportion of 4.2/100 000 cases/cattle. This is similar to the proportion estimated from the
statutory reporting of cattle with nervous signs.
2. 3. 9. Herd size:
59

The reported number of milking cows ranged from 8 to 390 in unaffected herds and
23 to 242 in affected herds. The median number of cows in affected herds was significantly
greater than that in unaffected herds (P

with others (Kanuk and Berenson 1975, Vaillancourt and others 1991). Farmer
questionnaires are particularly useful when the disease is easily visible or has distinct
clinical signs. In previous studies we have taken advantages of this to estimate the
prevalence of blowfly strike (French and others 1992) and Johne`s disease (Cetinkaya and
others 1996). Listeriosis differs from these diseases by manifesting itself by three different,
rarely overlapping, syndromes; encephalitis, septicaemia and abortion. In spite of this we
considered that three aspects of listeriosis would make it suitable for a farmer based
questionnaire; its sporadic occurrence, the likelihood that a veterinarian would be involved
in diagnosis and its distinctive name (reviewed by Radostits and others 1994).
A key component in the use of questionnaires as measuring instruments is the
repeatability and validity of these measures.
In this study we have no measure of repeatability but we attempted to validate the
questionnaire in three ways; by asking for the method of diagnosis and stratifying the
results to include only those cases diagnosed by a veterinarian or V.I.C.; by asking farmers
to identify the clinical signs of listeriosis from a list which included signs which were not
typical of listeriosis and by comparing the proportion of culled nervous cases of listeriosis
in our study with the proportion of nervous listeriosis diagnosed at necropsy during
statutory BSE reporting where cows showing any nervous disorder had to be culled during
the same period as our study covered. The majority of the cases were diagnosed by a
veterinarian or V.I.C.. On 83.9% of farms reporting cases between July 1994 and June 1995
diagnoses were made by veterinarian or V.I.C.. When these data were used to calculate the
farm prevalence, the results were within the confidence limits of the overall estimates and
did not statistically differ from them. When we asked farmers to identify clinical signs of
listeriosis the sensitivity of farmers reporting a single correct clinical sign was low ( range
61

from 3.1% to 67.2%) but it was high when three correct signs were examined (96.1%). This
may indicate that the farmers were poor at self diagnosis or alternatively they were only
reporting the clinical signs seen in cases on their farm. On the majority of farms only one
type of clinical sign was seen. However, in view of the fact that there was no significant
difference between the overall proportion and those estimates based on veterinarian and
veterinary investigation centre diagnoses we do not consider that the farmers’ misdiagnoses
introduced bias into the results. The failure of farmers to recognise clinical signs other than
nervous disease and to call a veterinarian may have resulted in an underestimation of true
prevalence. As a further validation measure the proportion of cattle with nervous signs
culled or died in this survey was compared with confirmed Listeria cases submitted to CVL
as suspect BSE cases. Those proportions were remarkably similar. The close similarity of
the results adds credence to the results of this survey.
The influence of non-respondents was not measured but an effort was made to
maximise the response rate by sending a number of reminders to the farmers. The 64.1%
response rate was good for the size of samples used in this study (Vailloncourt and others
1991). However, when compared with the two recent surveys conducted by our group in
which response rates were 74.2% and 78.3% (French and others 1992, Cetinkaya and others
1996) the response rate was lower. The difference in the length, format and content of the
questionnaire might have contributed to this lower response rate (del Garso and Wallop
1975). Our questionnaire consisted of 8 pages and 50 questions, where as Cetinkaya and
others (1996) used 39 questions on 5 pages and French and others (1992) used 15 questions
on 2 pages.
At farm level, Listeriosis in milking cows was reported more frequently than in
other groups of animals. However within the affected herds the highest incidence of disease
62

occurred in replacement heifers and dairy calves. These results suggest that the younger
animals were at greater risk. This is also in agreement with reports of ovine listeriosis
(Gudding and others 1989, Nash and others 1995) and has also been reported for human
listeriosis (Lober 1990).
Silage eye was the most frequent clinical sign reported in this study, this
corresponds to an increasing number of field reports of iritis and/or keratoconjunctivitis
(silage eye) in recent years. Although this is attributed to silage feeding contaminated with
Listeria monocytogenes (Walker and Morgan 1993, Sargison 1994) there has been no
epidemiological investigation of this problem. In naturally occurring cases of listeriosis an
overlap of different forms of clinical signs is rare (Gitter 1989) and in this study only a
small number of such cases were reported.
The seasonal occurrence of listeriosis has long been known (Gray and Killinger
1966), most of cases occurring between January and May (Low and Linklater 1985). In this
survey the occurrence of listeriosis was also seasonal. Most of the cases were reported in
Winter and Spring mostly between January and May. This coincides with two key changes
in management; silage feeding and winter housing (Low and Linklater 1985). Silage
feeding has been identified as an important risk factor for listeriosis but housing also occurs
at a time when the environment may be heavily contaminated with Listeria monocytogenes
(Vandegraaff and others 1981).
In this study the rate of recovery after treatment varied with the clinical presentation
of disease. It was 99% for silage eye and 68.4% for nervous signs. It is suggested that if
treatment is started at an early stage of the clinical disease a high chance of recovery is
possible (reviewed by Radostitis and others 1994). This may have been the case in this
study or success may have been attributed to the fact that clinical signs were mainly non-
63

nervous and therefore easier to treat. A similar statement was made for non-nervous clinical
signs by Low and Linklater (1985).
This is the first study of the frequency of clinical listeriosis in dairy cattle in
England. Although L. monocytogenes is widespread in the environment and animals are
exposed to it only 12.3% of farms had clinical listeriosis in their animals. This may be due
to differences in farm practices. This relationship between the prevalence, incidence of
clinical listeriosis and farm related factors is dealt with in the next two chapters.
64

CHAPTER 3
The relationship between farm management practices and
clinical listeriosis in dairy cattle in England: univariate
3. 1. Introduction:
analysis
Infectious disease is the result of a complex set of interactions between the
infectious agent, host and environment. The infectious agent is an essential component
of disease but it may not be sufficient to trigger disease on its own. Other factors are
also needed for disease to develop. Listeriosis is a good example of this disease process.
Listeria organisms (mainly L. monocytogenes) are necessary causative agents of
disease but the isolation of L. monocytogenes from the brain (Gronstol 1980b) and
faeces (Husu 1990) of healthy individuals suggests that other factors are also involved.
Some other risk factors have been identified both in epidemic and sporadic cases of
human listeriosis; various physiological states of host such as extremes of age and
pregnancy (Ciesielski and others, 1988), underlying conditions such as cancer (Niemen
and Lorber 1980), immunosuppression, such as HIV infection (Jurado and others 1993),
organ transplantation (Lorber 1990) and concurrent infections (Rocourt 1996). However
less is known about the risk factors associated with listeriosis in animals. The
association between silage feeding and the occurrence of Listeriosis is well documented
(Gray 1960a, Wilesmith and Gitter 1986, Fenlon 1988, Sargison 1993) but the exact
65

manner in which silage plays a role is little known. Improper silage making practices
have been suggested as an explanation for this association (Wilesmith and Gitter 1986)
but more work is required to ascertain the role of silage. Stress of housing, pregnancy
and weather have been considered as predisposing factors (Hyslop 1975). Poor flock
management has also been associated with disease (Meredith and Schneider 1984).
However no data is available to quantify these factors.
A postal questionnaire survey was designed to determine the frequency of
clinical listeriosis and the relationship between farm management factors and
occurrence of clinical listeriosis in dairy cattle. The latter is described in this chapter.
3. 2. Materials and Methods:
3. 2. 1. Study design:
Chapter 2.
Information about the questionnaire design and conduct of study is given in the
In studying the relationship between the occurrence of clinical listeriosis and
farm related management factors, only those cases reported between July 1994 and June
1995 were considered. 5 outcome variables and 5 groups of predictor variables were
used.
3. 2. 2. Outcome variables:
(i) Total number of cases (Overall cases): Farms that reported clinical listeriosis in
cattle of any age.
66

(ii) Cases in milking cows: Farms reporting at least one case of Listeriosis in milking
cows.
(iii) Cases in winter months: This includes only those farmers reporting cases of
Listeriosis in winter months.
(iv) Cases of silage eye (iritis): Farms reporting silage eye as a clinical sign.
(v) Cases of nervous signs: Farms which reported cases of listeriosis showing nervous
signs.
3. 2. 3. Predictor variables:
The five groups of predictor variables were herd size, feeding practices, forage
making, housing and general management. These included binary, categorical and
continuous variables. Each group of predictor variables had subsets of variables that are
dealt with under the related headings. When continuous variables were categorised the
cut off points for each categories were set according to known biological influences e.
g. pH, number of cuts and wilting.
(i) Herd size:
The herd size reported in July 1994 and June 1995 was used as a categorical
variable with 3 herd sizes:-the number of animals on each farm less than or 50, 51-100,
and greater than 100 animals.
(ii) Feeding practices:
67

a) Type of forages fed to animals: Farmers were asked to state whether they fed any of
the following forages; grass silage, maize silage, hay, feed straw and root crops. These
variables were treated as binary variables except for straw and root crops which were
first treated as binary then categorised according to type (barley, wheat, potatoes, sugar
beet etc.).
b) Source of forages: The farmers were asked about the source of their forages. Three
options were provided; home-made, purchased and other sources. These were treated as
binary variables.
c) Month of feeding forages: To assess the relationship between the duration of feeding
and Listeriosis farmers were asked to state the month in which forage feeding started
and stopped. The duration of feeding forages was used as categorical variable with 4
levels: - less than 6 months, 6 months, more than 6 months and all year around.
d) Methods of feeding forages: These were divided into those used during the outdoor
period and indoor period. A list of feeding methods was given on the questionnaire.
This included ad libitum, on the ground, at the clamp face, in hay racks, off the field, in
ring feeders etc. (Appendix 1). These variables were treated as binary variables for each
forage.
iii) Making forage crops:
68

To assess the relationship between different harvesting practises and the
occurrence of Listeriosis one section of the questionnaire was devoted to acquiring
information about harvest of forages such as month of harvest, type of harvester used
etc.
a) Month of making forages: This variable was categorised into 3 levels:- before and
during May, in June and during and after July.
b) Type of harvesters or mowers used: Farmers were asked about the type of harvester
used for forage. The options given were forage harvesters, discs and drums, mower
conditioner and combine harvester. These variables were used as binary variables for
each forage.
c) Number of cuts made for grass silage and hay: This was a categorical variable.
Farmers reported making up to 4 cuts for grass silage and up to 3 cuts for hay.
d) Duration of wilting or drying forages: The length of wilting or drying of forages was
assessed. This was first treated as a binary variable i.e. whether wilting or drying took
place or not and then categorised according to number of days of wilting or drying (0, 1,
2, and 3 and more days).
d) Type of additives used in the preparation of forages: Farmers were asked about the
type of additives used in preserving their forages. This variable was first treated as a
binary variable (i.e. whether or not additives were used) and then categorised according
to composition of additives. For this 5 categories were used:- enzyme, inoculant, salt
and acid, enzyme and inoculant and a combination of all 4.
69

e) Storage of forages: Information about the method of storing forage crops was
gathered. These are listed in the questionnaire (Appendix 1). Where appropriate the type
of floor used in the storage area was also investigated. These were used as binary
variables.
f) Use of clamp: Farmers were also asked if they used separate clamps for each cut of
grass and whether they sealed the clamp between each cut. These were treated as binary
variables.
g) Analysis of forage crops: Farmers were asked if they had their forages analysed, if
so, they were also asked to provide pH, Dry Matter (DM), Ash and Metabolisable
Energy (ME). This was first treated as a binary variable and then categorised as shown
in the Table 3. 1.
Table 3. 1. Categorisation of forage analysis
Categories pH DM Ash ME
1 11.6
iv) Housing practices:
The questionnaire had a section investigating housing practises. Farmers were
first asked whether animals were housed at any time of the year and then details of
housing and bedding were gathered.
a) Type of housing: Cubicles and loose yard were the alternatives given, the farmers
were also asked to specify any other type of housing if these two were not in use. In
analysing the data these were used as binary variables.
70

) Duration of housing: If animals were housed farmers were asked to specify the
months between which animals were kept in. This variable was categorised as less than
6 months, 6 months, more than 6 months or all year around.
c) Type of floor: The farmers were asked to specify the type of floor of any building,
used to house cattle, from the following list; earth, hard core, concrete, slatted and
others. These were used as binary variables.
d) Use and type of bedding: Farmers were asked if they used bedding and this was used
as a binary variable. They were also asked to select given options; sawdust, straw or
specify other types of bedding material used on their farms. These were treated as
binary variables. Frequency of weekly adding and removing fresh bedding to and the
frequency of cleaning out bedding from the house over the housing period was also
used first as a binary variable and then as a categorical variable.
e) Straw bedding: If straw was used for bedding, the farmers were asked about the
month of making straw (categorical), duration of drying it (categorical), type (barley,
wheat, etc.) (binary) and whether it was big bale or others (binary).
f) Storage of bedding materials: The method of storing bedding was investigated by
asking farmers to identify the method(s) of storage from the followings; storing in a
covered barn, outside covered, outside uncovered and others.
71

g) Disposal of the dung: The farmers were asked about how the dirty bedding material
was disposed. Three alternatives were given; solid manure, slurry and others. These
were binary variables.
h) Storing dung: The farmers were asked if the dung was stored. If it was stored then
they were asked to select one or more of the following storage methods; beneath the
slats, composted, in a slurry tank, in a lagoon and others (Appendix 1). These were used
as binary variables.
i) Spreading dung on the pasture: Farmers were asked if they spread dung on pasture
where animals grazed or where hay and silage were made. This was used as a binary
variable.
v) General management practices:
a) Cases of Listeriosis in other animals: The presence of listeriosis in other animals was
investigated by asking farmers whether they had cases in beef cattle, sheep, goats and
other. These were used as binary variables.
b) Grazing practices: The farmers were asked whether other animals (beef cattle, sheep,
goats and other) grazed the same pasture as dairy cattle. These were treated as binary
variables.
c) Use of vaccine: Farmers were asked if they vaccinated their herds against
Salmonellosis, E. coli, Leptospirosis, Lungworm or other specified vaccines. These
were treated as binary variables.
72

d) Presence of moles: Farmers were asked if they had seen mole hills in the fields where
hay, grass silage and straw were made. This was used as a binary variable.
e) Control of moles: If the mole hills were present, farmers were asked if they
controlled moles and the methods of controlling. These were used as binary variables
and categorical variables respectively .
3. 2. 4. Data analysis
A Yates corrected chi-square test was used to determine differences between
proportions. Odds ratios (OR) were calculated with 95% confidence limit (95%CL).
Categorical data such as duration of wilting, frequency of adding fresh bedding were
first treated as binary variables (the affect of presence or absence on the outcome) and
then categorised and analysed using chi-square tests (2xk contingency tables and chi
square for trend test using scores for each category) (Armitage and Berry, 1988).
3. 3. Results:
3. 3. 1. Univariate relationship between farm management practices and Listeriosis
in dairy cattle (Overall cases ):
73

93 of the total number of respondents (894) reported cases of clinical Listeriosis
in their dairy cattle between June 1994 and July 1995. 26 farm level predictor variables
were associated with disease, 21 with an increased and 5 with a decreased risk.
2.
(i) Herd size:
The overall results of the univariate analysis are also presented in the appendix
There was a statistically significant association between the number of milking
cows in a herd and the occurrence of disease. The risk of reporting disease increased as
the herd size increased (Table 3. 2.).
Table 3. 2. Univariate relationship between herd sizes and clinical listeriosis
Herd
sizes n
June 1995 July 1994
Y N OR P value X Y N OR P value X
M. cows 100 31 141 3.26

listeriosis. Maize silage feeding also increased the risk of disease in dairy cattle and the
Odds Ratio for this variable was 2.4 (95% CL 1.50-3.85). There was also a statistically
significant association between feeding straw when animals were housed and a
decreased risk of reporting disease in dairy cattle (OR 0.38, 95% CL 0.18-0.78). (Table
3. 3).
When the individual types of straw (barley, wheat, wheat and barley and the
combination of wheat, barley, oat and pea) or root crops (beet type, potatoes, brassica
type, kale and others) were taken into consideration there was no association between
these and the occurrence of listeriosis in dairy cattle.
b) Sources of forage: Farmers were given three alternative sources of forage; purchased,
home made and any other sources. There was a statistically significant association
between purchased grass silage (OR 2.91, CL 1.22-6.8) and increased risk of reporting
Listeriosis (Table 3. 3).
c) Methods of feeding forages:
1) outdoor feeding: Feeding maize silage (OR 1.35, CL 1.59-13.04), hay (OR 2.98, CL
1.12-8.23) and straw (OR 3.72, CL 1.25-11.88) in ring feeders when animals were out
were associated with an increased risk of disease (Table 3. 3).
2) indoor feeding: Two methods (feeding forages in ring feeders and on the floor) were
associated with disease. Feeding grass silage (OR 1.93, CL 1.21-3.07), maize silage
(OR 4.96, CL 2.17-11.46) and hay (OR 4.17, CL 1.83-9.61) in ring feeders was
positively associated with disease whereas feeding grass silage (OR 0.23, CL 0.04-0.97)
and hay (OR 0.0, CL 0.0-0.85) on the floor was negatively associated with disease
(Table 3. 3).
75

Table 3. 3. Effect of forages fed to dairy cattle on the occurrence of listeriosis.
Type of forages
Y N OR 95% CL P Value
Grass silage 93 761 ? ? 0.05
Maize silage 39 185 2.4 1.50-3.85

found between the duration of feeding maize silage, hay, straw or root crops and clinical
Listeriosis.
Table 3. 4. The relationship between listeriosis and duration of feeding grass silage
Duration of feeding Grass silage Maize silage
Y N OR P Value X Y N OR P Value X
6 months 52 288 1.78 11 28 1.51
All year 14 70 1.97 0.03 4 10 1.53 0.3
R reference category, X X 2 for trend, OR odds ratio
(iii) Making forage crops:
a) Type of harvesters: Using a mower conditioner in the process of making grass silage
increased risk of reporting disease (OR 2.02, CL 1.21-3.37). This relationship was
statistically significant (Table 3. 3).
b) Number of cuts made for grass silage and hay: Although the relationship between
number of cuts made for grass silage and Listeriosis was not statistically significant
there was an increasing risk of disease as the number of cuts were increased (Table 3.
5).
Table 3. 5. The univariate relationship between number of grass cuts and disease
77

Grass Silage Hay
No of cuts Y N OR P Value Y N OR P Value
1 R 13 145 1.00 36 292 1.00
2 43 382 1.26 3 7 3.48
3 27 180 1.67 0 3 0.00 0.4
4 2 9 2.48 0.09 NA
R X 2
refence category, X for trend, Y number of farmers reporting cases, N number of farmers not
reporting cases, OR Odds Ratio
c) Storage of forages: Different methods of storing forages were evaluated. Preserving
grass silage in big bales (OR 2.19, CL 1.29-3.75), storage of hay outside covered (OR
6.26, CL 1.12-32.13) and straw outside covered (OR 2.68, CL 0.9-7.67) were associated
with an increased risk of disease. These associations were statistically significant except
for storage of straw outside covered (Table 3. 3).
d) Analysis of forage crops: 57.8% (517/894) of the respondents reported having their
forages analysed but not all of these provided complete information. There was an
association between the pH of grass silage and disease. As the pH increased the risk of
reporting disease increased. This was only statistically significant for pH of Clamp1
grass silage (Table 3. 6).
Table 3. 6 .Effect of silage quality on listeriosis (univariate results)
pH of Clamp 1 Y N OR p Value X
1 R (4.2) 10 28 4.29 0.02
R reference category, X X 2 for trend, OR odds ratio
(iv) Housing practices:
78

a) Type of housing : Housing animals in buildings other than cubicles and loose yards
was associated with a decreased risk of disease (OR 0.12, CL 0.01-0.83) (Table 3. 7).
b) Use and type of bedding: Using straw bedding in cubicles increased the risk of
disease (OR 2.56, CL 1.09-6.3) while use of straw in other types of housing decreased
the risk (OR 0.0.0, CL 0.0-0.71) (Table 3. 7).
c) Dung management: Disposal of dung as slurry was associated with an increased risk
of disease (OR 1.73, CL 1.02-2.97). This association was statistically significant.
Similarly, storing manure beneath the slats (OR 13.50, CL 1.74-121.23) was also found
to increase the risk of disease (Table 3. 7).
(v) General management:
a) Cases of Listeriosis in other animals: The presence of listeriosis in beef cattle (OR
32.37, CL 8.07-151.24) and sheep (OR 1.03, CL 1.03-6.25) was associated with
increased risk of disease (Table 3. 7).
b) Vaccine use: Vaccinating dairy cattle against leptospirosis (OR 2.14, CL 1.34-3.42)
was associated with an increased risk of reporting disease (Table 3. 7).
Table 3. 7. Univariate relationship between housing practices and listeriosis
Type of housing Y N OR 95% CL P Value
79

other housing (cow shed) 1 65 0.12 0.01-0.83 0.02
Straw bedding in cubicles 70 484 2.56 1.09-6.3 0.02
Straw bedding in loose yard 31 193 ? ? 0.07
straw bedding in others 0 56 0.0 0.0-0.71 0.02
dung disposal
slurry 71 521 1.73 1.02-2.97 0.04
manure beneath the slats 3 2 13.50 1.74-121.23 0.003
Listeriosis in other animals
Beef cattle 11 3 32.37 8.07-151.24

Herd
sizes n
Y N OR P value x Y N OR P value X
M. cows 100 21 195 2.51 0.02 21 191 2.80

Type of forages
Maize silage 31 193 2.53 1.49-4.29

of disease. Similarly storing feed straw covered outside was also associated with an
increased risk of disease (OR 3.23, CL 0.97-10.09) (Table 3. 9).
(iv) Housing:
a) Type of housing: Housing animals in houses other than loose yards or cubicles was
associated with a decreased risk of disease in milking cows but this was not statistically
significant (OR 0.16, CL 0.01-1.12) (Table 3. 11).
b) Use of bedding: Straw bedding in other types of houses was also associated with a
decreased risk of reporting disease (OR 0.0, CL 0.0-0.95) (Table 3. 11).
Table 3. 11. The relationship between housing and general management and
Listeriosis in milking cows
Housing Y N OR 95% CL P Value
other housing (cow shed) 1 65 0.16 0.01-1.12 0.07
straw bedding in others 0 56 0.0 0.0-0.95 0.04
Listeriosis in other animals
Beef cattle 6 8 15.78 4.73-53.78

a) Cases of Listeriosis in other animals: Listeriosis in beef cattle was associated with an
increased risk of reporting listeriosis in milking cows (OR 15.78, CL 4.73-53.78) (Table
3. 11).
b) Vaccine use: Vaccinating animals against Leptospirosis was associated with an
increased risk of disease in milking cows. (OR 2.41, CL 1.42-4.08) (Table 3. 11).
3. 3. 3. The univariate relationship between farming practices and clinical
Listeriosis reported in winter months.
Cases of listeriosis occurred between October1994 and June 1995 on 76 farms.
18 farm level predictor variables were associated with either an increased (14 variables)
or a decreased (4 variables) risk of reporting cases of listeriosis between October 1994
and June 1995.
(i) Herd size
As the herd size increased the risk of reporting cases of listeriosis in winter
months also increased (Table 3. 12).
Table 3. 12. Univariate relationship between herd sizes and clinical listeriosis
reported in winter months
June 1995 July 1994
Herd
sizes n
Y N OR P value* Y N OR P value X
M. cows 100 24 192 2.44 0.01 22 190 2.44 0.01
n R X 2
number of animals, reference category, X for trend, Y number of farmers reporting cases, N
number of farmers not reporting cases, OR, Odds Ratio.
(ii) Feeding practices:
84

a) Type of forages: Feeding maize silage (OR 1.97, CL 1.17-3.32) and grass silage (OR
not calculated) was associated with an increased risk of reporting disease (Table 3. 14).
b) Source of forages: Purchased grass silage was associated with an increased risk of
disease (OR 2.62, CL 1.00-6.61) (Table 3. 14).
c) Methods of feeding forages;
1) indoor feeding: Feeding grass silage (OR 2.55, CL 1.51-4.32), maize silage (OR
6.37, CL 2.42-17.19) and hay (OR 4.86, CL 2.02-11.97) in ring feeders was positively
associated with disease. Feeding maize silage ad libitum was also found to increase the
risk of reporting disease (OR 3.57, CL 0.96-12.74). Feeding hay on the floor was
negatively associated with disease (OR 0.0, CL 0.0-0.95) (Table 3. 14).
(iii) Making forage crops:
a) Type of harvesters: Using a mower conditioner for making grass silage was
associated with an increased risk of disease (OR 1.91, CL 1.10-3.35) (Table 3. 14).
b) Storage: Preserving grass silage as big bales (OR 2.00, CL 1.13-3.57) and storing
hay outside covered (OR 6.86, CL 1.22-35.41) were found to increase the risk of
reporting disease (Table 3. 14).
c) Analysis of forages: There was an association between increasing pH and increasing
risk of disease reported in winter months, as the pH value increased the risk of reporting
disease also increased (Table 3. 13).
85

Table 3. 13 .Effect of silage quality on listeriosis in winter months
pH of Clamp 1 Y N OR P Value X
1 R (4.2) 10 34 4.29 0.003
R reference category, X X 2 for trend, OR odds ratio
Table 3. 14 The univariate relationship between feeding practices and cases of
Listeriosis reported in winter months
Y N OR 95% CL P Value
Type of forages
Grass silage 76 778 ? ? 0.09
Maize silage 29 195 1.97 1.17-3.32 0.008
source of forages
purchased grass silage 7 29 2.62 1.00-6.61 0.05
methods of feeding : - indoor
ring feeders for grass silage 48 315 2.55 1.51-4.32

) Use of bedding: Using straw bedding in cubicles was associated with an increased
risk of disease (OR 3.0, CL 1.12-8.76) while its use in other house types (OR 0.0 CL
0.0-0.89) was associated with a decreased risk of disease (Table 3. 15).
c) Dung disposal: Disposing of dung as slurry and not storing manure were associated
with an increased risk of reporting disease, but these relationships were not statistically
significant (Table 3. 15). Storing manure beneath the slats increased the risk of
reporting disease in winter months (OR 17.72, CL 2.26-160.7).
Table 3. 15 The relationship between housing and general management and
Listeriosis reported in winter months
Housing Y N OR 95% CL P Value
other housing (cow shed) 1 65 0.15 0.01-1.05 0.057
Straw bedding in cubicles 59 495 3.0 1.12-8.76 0.02
straw bedding in others 0 56 0.0 0.0-0.89 0.03
dung disposal
slurry 58 534 1.71 0.96-3.1 0.06
not storing manure 4 14 3.37 0.87-12.04 0.08
manure beneath the slats 2 3 17.72 2.26-160.7

) Vaccine use: Vaccinating animals against Leptospirosis was also associated with an
increased risk of disease (OR 1.88, CL 1.12-3.15) (Table 3. 15).
c) Mole control: Controlling moles was associated with a decreased risk of reporting
disease (OR 0.49, CL 0.29-0.83) (Table 3. 15).
3. 3. 4. The univariate relationship between farming practices and cases of
Listeriosis with silage eye (iritis).
65 of the respondents reported cases of Listeriosis with silage eye on their farms.
17 of the farm level predictor variables were associated with disease (silage eye).
(i) Herd size:
As the herd size in milking cows increased the risk of disease also increased.
This was only statistically significant for herd sizes reported in July 1994 (Table 3. 16)
Table 3. 16. The univariate relationship between herd sizes and silage eye
June 1995 July 1994
Herd
sizes n
Y N OR P value x Y N OR P value X
M. cows 100 18 198 2.21 0.06 17 195 2.48 0.04
n number of animals, R reference category, X X 2 for trend, Y number of farmers reporting cases, N
number of farmer not reporting cases, OR, Odds Ratio.
(ii) Feeding practices:
a) Type of forages: Feeding maize silage was associated with an increased risk of
reporting silage eye cases (OR 2.12, CL 1.21-3.70) (Table 3. 17).
88

) Source of forages: Home made grass silage was negatively associated with reporting
silage eye in dairy cattle (OR 0.22, CL 0.06-0.84) (Table 3. 17).
c) Methods of feeding;
1) outdoor feeding: The use of ring feeders to feed maize silage (OR 5.0, CL 1.47-
17.98), grass silage (OR 1.98, CL 1.0-4.01), hay (OR 4.08, CL 1.21-15.17) and straw
(OR 5.23, CL 1.38-23.39) were associated with an increased the risk of reporting silage
eye in dairy cattle (Table 3. 17).
2) indoor feeding: The use of ring feeders to feed maize silage (OR 5.06, CL 1.88-
13.94), grass silage (OR 2.72, CL 1.54-4.83) and hay (OR 4.29, 1.67-11.30) increased
the risk of reporting silage eye whereas feeding hay (OR 0.0, CL 0.0-1.17) on the floor
was associated with a reduced risk of reporting silage eye but this was not statistically
significant (Table 3. 17).
(iii) Making forage crops:
a) Type of harvesters: The use of a mower conditioner in the process of making grass
silage was associated with an increased risk of reporting silage eye (OR 1.74, CL 0.97-
3.16) but this was not statistically significant (Table 3. 17).
b) Storage: Preserving grass silage in big bales (OR 4.27, CL 1.99-9.46) and storing hay
outside covered (OR 9.55, CL 1.67-50.3.8) were associated with an increased risk of
reporting silage eye in dairy cattle (Table 3. 17).
Table 3. 17 The relationship between feeding practices and silage eye (iritis)
89

Type of forages
Y N OR 95% CL P Value
Maize silage 26 198 2.12 1.21-3.70 0.006
source of forages
home made grass silage 61 778 0.22 0.06-0.84 0.02
methods of feeding: - outdoor
ring feeders for maize silage 12 36 5.00 1.47-17.98 0.005
ring feeders for grass silage 42 365 1.98 1.0-4.01 0.05
ring feeders for hay 15 115 4.08 1.21-15.17 0.01
ring feeder for straw 17 117 5.23 1.38-23.39 0.009
methods of feeding : - indoor
ring feeders for grass silage 42 321 2.72 1.54-4.83

1.29-18.22) whereas straw bedding in houses other than cubicles and loose yards was
associated with a decreased risk of disease (OR 0.0, CL 0.0-1.05) (Table 3 18).
(v) General management:
a) Cases of Listeriosis in other animals: Reporting cases of Listeriosis in beef cattle
(OR 51.4, CL 12.63-243.04) and in sheep (OR 3.94, CL 1.55-9.71) was associated with
an increased risk of reporting silage eye cases (Table 3. 18).
b) Vaccine use: Vaccinating animals against Leptospirosis was associated with an
increased risk of disease (OR 1.77, CL 1.01-3.10) (Table 3. 18).
c) Mole hills: The presence of mole hills in fields was associated with an increased risk
of reporting silage eye (OR 1.80, CL 1.01-3.23) (Table 3. 18).
Table 3. 18 The relationship between housing, general management and silage eye
Housing Y N OR 95% CL P Value
straw as bedding 62 686 4.79 1.12-29.11 0.03
Straw bedding in cubicles 52 502 4.42 1.29-18.22 0.01
straw bedding in others 0 56 0.0 0.0-1.05 0.05
Listeriosis in other animals
Beef cattle 11 3 51.4 12.63-243.04

Sheep 8 27 3.94 1.55-9.71 0.001
Vaccine use
Leptospirosis 25 216 1.77 1.01-3.10 0.04
Mole hills
mole hill 35 362 1.80 1.01-3.23 0.05
Y number of farmers reporting cases, N number of farmers not reporting cases, OR (95% CL) Odds Ratio
with 95% confidence limit.
3. 3. 5. The univariate relationship between farming practices and nervous signs of
Listeriosis (meningo-encephalitis).
Only 26 farms reported having had cases with nervous signs of Listeriosis and
10 of the predictor variables were associated with reporting this form of the disease.
(i) Herd size:
There was a statistically significant association with herd sizes in all age groups
(milking cows, replacement heifers and dairy calves). As the herd sizes increased the
risk of reporting Listeriosis with nervous signs increased (Table 3. 19).
Table 3. 19. The univariate relationship between herd sizes and nervous form of
listeriosis
June 1995 July 1994
Herd sizes Y N OR P value Y N OR P value
Milking cows 100 12 204 5.78 0.005 X 11 201 4.78 0.009 X
Replacement

100 2 34 2.33 0.01 X 2 22 3.35 0.01 X
Dairy calves 100 3 37 3.05 0.02 X
R reference category, X X 2 for trend, Y number of farmers reporting cases, N number of farm not
reporting cases, OR, Odds Ratio, NA not applicable.
(ii) Feeding practices:
a) Type of forages: Feeding maize silage was associated with an increased risk of
reporting cases of nervous signs (OR 3.11, CL 1.32-7.32) (Table 3. 20).
b) Source of forages: Purchased grass silage was associated with an increased risk of
reporting nervous signs (OR 6.12, CL 1.86-18.88) (Table 3. 20).
Methods of feeding (indoor): Feeding straw (OR 0.31, CL 0.09-1.05) was negatively
associated with risk of reporting cases with nervous signs and this approached statistical
significance (Table 3. 20).
Table 3. 20. The relationship between feeding, housing and general management
practices and risk of reporting the nervous form of Listeriosis
Y N OR 95% CL P Value
Type of forages
Maize silage 13 211 3.11 1.32-7.32 0.005
source of forages
purchased grass silage 5 31 6.12 1.86-18.88

straw outside covered 3 24 4.36 0.89-18.79 0.07
dung disposal
manure beneath the slats 2 3 24.18 2.47-211.43

a) Dung disposal: Storage of manure beneath slats (OR 24.18, CL 2.47-211.43) and in
slurry tanks (OR 8.95, CL 1.15-55.61) were associated with an increased risk of cases
of Listeriosis with nervous signs (Table 3. 20).
(v) General management:
a) Cases of Listeriosis in other animals: The presence of Listeriosis in beef cattle (OR
9.17, CL 1.86-39.51) and in sheep (OR 4.95, CL 1.33-16.78) was associated with an
increased risk of reporting cases with nervous signs (Table 3. 20).
3. 3. 6. A summary of risk factors associated with the different forms of disease
A summary of the predictor variables associated with different outcome
variables is given in Table 3. 22 and 3. 23. Overall 36 predictor variables were
associated with the outcome variables. Table 3. 22. shows that 29 variables were
associated with an increased risk of disease. 4 predictor variables were consistently
associated with all outcome variables, 5 with 4 of them, 6 with 3 of them, 3 with 2 and
the rest with 1 of the outcome variables.
95

In Table 3. 23, 7 predictor variables were associated with a decreased risk of
disease. None of the predictor variables was consistently associated with all of the
outcome variables. Only 1 variable was associated with the 4 of the outcome variables,
3 with 2 of them and the rest with 1 of the outcome variables.
Table 3. 22. The predictor variables associated with an increased risk of disease
Outcome variables
Predictor Variables O MC WC SE NS
herd size + + + + +
Listeriosis in beef cattle + + + + +
feeding maize silage + + + + +
ring feeder for maize silage (indoor) + + + + +
big bale + + + + -
purchased grass silage + + + - +
ring feeders for grass silage (indoor) + + + + -
ring feeders for hay (indoor) + + + + -
96

vaccination against Leptospirosis + + + + -
ring feeders for maize silage (outdoor) + + NA + -
ring feeders for straw (outdoor) + + NA + -
storing hay out covered + - + + -
Listeriosis in sheep + - - + +
straw bedding in cubicles + - + + -
storing manure beneath the slats + - + - +
mower conditioner (grass silage) + - + - -
ring feeders for hay (outdoor) + - NA + -
pH (Clamp1) + - + - -
feeding grass silage + - - - -
ring feeders for grass silage (outdoor) - - NA + -
storing big bale out uncovered - + - - -
duration of feeding grass silage + - - - -
number of cuts for grass silage - + - - -
maize silage ad libitum (indoor) - - + - -
storing straw out covered - + - - -
straw as bedding - - - + -
disposing dung as slurry + - - - -
storing manure in slurry tanks - - - - +
presence of mole hills in the fields - - - + -
O overall cases, MC milking cows, WC cases reported in winter months, SE silage eye, NS nervous
signs. + associated with outcome, - not associated with outcome, NA not applicable.
Table 3. 23. The predictor variables associated with a decrease risk of disease
Outcome variables
Predictor Variables O MC WC SE NS
straw bedding in other housing + + + + -
grass silage on the floor (indoor) + + - - -
hay on the floor (indoor) + - + - -
other types of housing + - + - -
feeding straw (indoor) + - - - -
home made grass silage - - - + -
controlling moles - - + - -
O overall cases, MC milking cows, WC cases reported in winter months, SE silage eye, NS nervous
signs. + associated with outcome, - not associated with outcome.
97

3. 4. Discussion:
In this study we tried to determine the farm level risk factors associated
with different outcome variables. Different variables were associated with different
outcomes. This difference may be due to the small number of farms with some of the
outcome or predictor variables: for example nervous signs of disease were only reported
by 26 farms. Alternatively it may reflect true differences in the models. However we
think this may not be the case because 26 of 36 variables examined were associated
with Listeriosis when the total number of cases “overall” was the outcome. The other
associated variables were closely related to these 26 variables. Of the 36 variables 16
were consistently associated with at least 3 of the outcome variables. This consistency
of associations is in agreement with the Evan’s postulates of disease causation
(Thrusfield 1995).
Feeding grass silage and maize silage was associated with clinical Listeriosis.
The relationship between feeding silage and Listeriosis is well documented (Gray
1960a, Gray and Killinger 1966, Gronstol 1979a, Kalac and Woolford 1982, Fenlon
1986b, Fenlon 1988, Wilesmith and Gitter 1986, Sargison 1993) and disease is therefore
called “silage sickness” (Gray and Killinger 1966, Dennis 1993). However the
determinants of this association are not well known. The possible ways in which silage
may play a role have already been explained in the Chapter 1. Where silage has been
implicated its quality has always been described as “inferior” (Gray 1960a, Fenlon
1988, Sargison 1993). There are several factors that influence the quality of silage.
These factors include the whole silage making process; time and stage of harvesting,
type of harvester used, soil contamination, wilting, method of storing etc. A lack of care
at any of these stages will result in poor quality silage that is manifested by improper
fermentation (aerobic fermentation) where the critical pH (4.2) is exceeded and the
98

suppression of the growth of Listeria organisms is lifted, resulting in rapid
multiplication of L. monocytogenes to the level of the infectious dose (Gronstol 1979a,
Anon 1983, Fenlon 1988, Husu and others 1990a, Sargison 1993). It has been
demonstrated that the multiplication of L. monocytogenes is related to pH. As pH rises
the number and frequency of isolation of L. monocytogenes also increases (Irvin 1968,
Gronstol 1979b, Fenlon 1988). As important as silage quality is the method or methods
of feeding silage. Some clinical forms of Listeriosis (encephalitis, iritis) have been
attributed to physical injuries of mucosal membranes such as buccal or conjunctival
membranes caused by rough forages (Asahi 1957, Dennis 1993). These facts prompted
us to further evaluate the role of silage by gathering information on preparation, the
method and time of feeding and quality. This was done for both grass silage and maize
silage.
The stage of growth or time of cutting grass for silage is known to be important.
(Anon 1983, Wilesmith and Gitter 1986, Gitter 1989). To ensure perfect fermentation
grass must be harvested at the right stage when it contains a sufficient level of
carbohydrates and has a Digestibility (D) value around 70%. This covers the period
between May, June and July (Anon 1983). In our study there was no association
between the month of making silage and disease. This may be explained by the fact that
most of the farms (90%) made silage within the recommended period (May and June for
grass silage or October for maize silage). However the number of times the grass was
cut to make grass silage was associated with an increased risk of Listeriosis in milking
cows. It is known that first cut grass silage achieves better fermentation (Fenlon 1988)
but second or later cuts grass may lack the necessary components (high sugar, correct
dry matter level, 25-30%) to achieve optimal fermentation (Anon 1983, Fenlon 1988).
Another important factor at cutting which helps determine silage quality is soil
contamination. Soil causes butyric acid fermentation which results in higher pH values
99

(Anon 1983, Fenlon 1988). Soil contamination occurs through harvesters or from mole
hills in the field. It is known that some harvesters are more prone to soil contamination
than others (Anon 1983, Gitter 1986, Fenlon 1988). The risk of soil contamination is
reported as high with a flail mower, moderate with mower conditioner and low with
discs and drums (Anon 1983). In this study the use of a mower conditioner was
associated with an increased risk of reporting disease. Another explanation for this
association may be that mower conditioner bruises grass during cutting, resulting in loss
of carbohydrates in grass and poorer fermentation condition. The presence of mole hills
in the field where grass silage is made also increases the risk of soil contamination and
in this study it was associated with an increased risk but only in relation to silage eye.
This was also supported by the negative association between controlling moles and the
risk of Listeriosis reported in winter months, but these two variables were not associated
with other outcome variables. Considerable publicity has been given to the potential
importance of soil contamination as result of mole hills and it is possible that some
reporting bias was introduced into the study by farmers who were aware of this
hypothesis. Ash content is used as a proxy measure of soil contamination. However in
this study there was no association between ash content and disease. A statistically
significant association between increasing pH of clamp 1 silage and increasing risk of
reporting overall cases and cases in winter months was found in this study but this
association was not found with other outcome variables. The value of forage analyses
was questionable because only a small proportion of farms reported complete
information and this made the comparisons difficult.
Storing grass silage as big bales increased the risk of disease. Big bale silage has
been reported to be more prone to L. monocytogenes contamination (Fenlon 1988,
Sargison 1993), because of its very nature it is difficult to maintain conditions for ideal
fermentation (Fenlon 1985, Fenlon 1986a, Fenlon 1988, Fenlon and others 1989, Gitter
100

1989, Sargison 1993). It is also possible that the bags are subjected to physical damage
by birds, mice or other rodents when stored outside and that this results in rapid
deterioration (Fenlon 1985, Sargison 1993). Storing big bales outside uncovered was
associated with an increased risk of reporting Listeriosis in milking cows. Similarly the
association between storing hay outside covered and an increased risk of disease in
milking cows may be due to the fact that outside storage exposed hay to factors (wet,
cold, air and physical damage) that may have led to the propagation of L.
monocytogenes to the level of an infectious dose. But only small number of farms
reported storing their hay outside covered.
In this study feeding maize and grass silage, hay and straw in ring feeders or ad
libitum (indoor or outdoor), increased the risk of disease whereas feeding on the floor
decreased the risk. This may be an effect of the clinical forms of the disease reported in
this study. The predominant clinical sign was silage eye (iritis). Although the exact
relationship between L. monocytogenes and silage eye awaits further studies, the
association between silage feeding and silage eye cases has been acknowledged
(Morgan1977, Watson 1989, Mee and Rea 1989, Sargison 1993, Bee 1993, Welchman
and others 1997). It may well be that animals eating silage in ring feeders were at
greater risk of physically damaging their conjunctival membranes which may have led
to infection by L. monocytogenes (Sargison 1993, Welchman and others 1997). It is
also possible that encephalitis may follow eye infection (Asahi 1957, Dennis 1993).
Another explanation may be that in ring feeding systems animals are in very close
contact with a possibility of animal to animal spread. Alternatively unlike other
methods, ring feeders are not cleaned regularly and silage remaining in the feeder may
have created an ideal environment for L. monocytogenes to multiply. This suggestion is
supported with the finding that feeding forages (hay and grass silage) on the floor was
101

associated with a decreased risk of disease as the floors (feeding passage) are cleaned
after feeding.
The association of grass silage with disease may also be explained by the length
of exposure to L. monocytogenes as an increased duration of grass silage feeding was
associated with an increased risk of disease.
Another finding was that purchased grass silage increased the risk of disease
whilst home made grass silage decreased the risk of reporting silage eye. This may be
explained by the fact that purchased silage would be mainly in the form of big bale
silage or if bought in as clamp silage might be of poor quality because it had been
exposed to air. Air in silage has been associated with an increase in Listeria growth
(Fenlon 1986, Woolford 1990, Fenlon and others 1995b). Alternatively farmers may
sell inferior quality or old silage which is surplus of their own needs.
Feeding straw during housing had a protective effect. Straw feeding may have
played a role by reducing silage intake therefore decreasing the exposure to L.
monocytogenes or the provision feed straw may have reduced the intake of dirty
bedding straw.
Wilesmith and Gitter (1986) suggested that housing animals did not have any
association with the occurrence of ovine Listeriosis. This was also the case in our study
although only a small number of farmers did not house their animals. When different
types of housing were evaluated it was found that housing cattle in buildings (mainly
cow sheds) other than cubicles and loose yards had a protective effect. It is difficult to
provide a biological explanation for this association, it may be due to a confounding
effect.
The use of straw as bedding material and straw bedding in cubicles was
associated with an increased risk of disease. The use of straw as bedding and straw
bedding in cubicles may result in a build up of L. monocytogenes in the environment.
102

L. monocytogenes has been isolated from straw bedding (Husu 1990, van Retrigham
and others 1991) and cases of listeriosis associated with the same serotype as those
found in the bedding material have been reported (Green and Morgan 1994). Housed
animals often eat their bedding and they may have eaten Listeria contaminated dirty
bedding. One likely explanation may be that animals housed in cubicles were more
likely to have eaten their bedding than those housed in loose yards where bedding straw
would be too dirty for a cow to eat.
Environmental contamination with L. monocytogenes may also occur through
the use of manure or slurry as a fertiliser and this was examined in this study. The
disposal of dung as a slurry was associated with disease. This may have been due to
failure of storage to kill or inactivate listeria (Al-Gazali and Al-Azawi 1986). No such
association was seen in farms disposing of dung as manure. There was an association
between storing dung beneath the slats, storing manure in slurry tanks and disease but
only a small number of farmers used these systems.
Larger herd sizes were also associated with an increased risk of Listeriosis. This
may be explained in several ways. Stocking density may have increased the risk of sick
animals coming into contact with others and hygienic conditions may have been poor
owing to overcrowding. Overcrowding and related factors have been reported as
predisposing factors (Hyslop 1975, Meredith and Schnieder 1984, Vandegraaff 1981).
An alternative explanation may be that these herds may have been higher producing
units and therefore animals may have been highly stressed resulting in a decrease of the
host resistance to infection. It is also possible that these farms had a better observation
system whereby quicker veterinary intervention may have occurred when animals
showed signs of disease.
Human Listeriosis due to contact with animals with Listeriosis has been reported
(Gray and Killinger 1966, McLauchlin and Low 1994) but it is not known if direct
103

transmission between animals occurrs. In our study listeriosis in beef cattle and sheep
increased the risk of disease. This may be explained in a number of ways. Dairy cattle
might have contracted the disease from sick beef cattle or sheep by direct contact or
beef cattle or sheep with Listeriosis may have been the source of more pathogenic L.
monocytogenes strains and environmental contamination with these virulent strains
resulted in indirect transmission. Alternatively, farmers who reported cases in beef
cattle and sheep may have had a better knowledge of disease and therefore easily
recognised the signs of disease in their dairy cattle. This association may also be due to
a confounding effect e.g. ring feeders are usually used for beef cattle.
The association between vaccinating animals against Leptospirosis and an
increased risk of Listeriosis is without an obvious biological explanation. It might be
explained by the fact that concurrent infections have been reported to make animals and
human more susceptible to L. monocytogenes (Gray and Killinger, 1966, Rocourt 1996)
or the stress caused by the vaccine may have made animals more susceptible. An
alternative explanation may be that farmers experiencing abortion may have vaccinated
against Leptospirosis with or without advice from a veterinarian because the majority of
cases of abortion are attributed to Leptospirosis in this country without thorough
investigation of actual cause. There may have been even a confusion of name between
the two diseases. Such confusion of name was seen in a study from the USA (Schwartz
1967).
In this study 5 groups of farm level predictor variables were used to determine
their relationship with 5 different outcome variables using univariate analysis
techniques. One of the major drawbacks of univariate analysis is that it does not deal
with confounders. A confounder is a variable that is positively or negatively associated
with both the outcome variable and hypothesised predictor variable that are being
studied. Confounding may result in either overestimation or underestimation of an
104

association (Kirkwood 1988, Thrusfield 1995). This problem is overcome by several
ways i.e. stratifying data to adjust for possible confounders or employing more complex
multivariate techniques. This is dealt with in the following chapter. However there also
are advantages of this technique. In univariate analysis it is possible to examine the
association between all predictor variables and an outcome. All observations obtained
can be used in the univariate analysis whereas in the multivariate analysis missing
values can result in a considerable reduction in the number of observations.
In the analysis of this data, possible confounders were not taken into account but
a number of predictor variables were found to be associated with the outcome variables.
However demonstration of a statistically significant association between a predictor
variable and an outcome variable does not necessarily mean that a relationship is causal.
In a biological sense for a predictor variable to be causal it must be experimentally
proved that it leads to the occurrence of disease. However in the absence of
experimental evidence epidemiological identification of an association is of
considerable value because it indicates a risk factor and removal of such a factor may
result in the reduction of disease (Thrusfield 1995).
In the following chapter the association between the predictor variables and the
different outcome variables is investigated using multivariate techniques.
105

CHAPTER 4
The multivariate relationship between farm management
practices and clinical listeriosis in dairy cattle in England
4. 1 Introduction
In the previous chapter we identified some simple relationships between farming
practices and Listeriosis using univariate techniques. One of the problems with
univariate methods is that they do not have the power to adjust for the effect of
confounding. In this part of the study multivariate techniques are used to provide
quantitative estimates of the relationship between individual predictor variables and the
outcome variable when adjusted for the effect of other predictor variables.
4. 2. Materials and methods:
In studying the multiple relationship between farming practices and clinical
listeriosis in dairy cattle, the predictor variables used were those that were either
significantly associated with disease or had P values of less than 0.25 in univariate
analysis or those that were considered biologically important. Unconditional logistic
regression using EGRET (Statistics and Epidemiology Research Corporation, 1993)
was used to develop statistical models using a forward stepwise technique followed
backwards elimination.

The predictor variables that met our inclusion criteria are listed below.
Forage feeding
Grass silage
Maize silage
Hay
Straw
Root crops
Herd size
cows in 1995
heifers in 1995
Maize silage
fed
source
home made
Housing
housed
cubicles
used
type of bedding
sawdust
straw
General
management
Grass silage
fed
source
purchased
home made
outdoor feeding
fed
ad libitum
in ring feeders
outdoor feeding
fed
in complete diet
in ring feeders
indoor feeding
fed
use of bedding
adding bedding
removing bedding
cleaning out
loose yard
used
indoor feeding
fed
ad libitum
on the floor
in ring feeders
number of cuts
type of harvester
mower conditioner
wilting
ad libitum
on the floor
in complete diet
in ring feeders
in troughs
type of bedding
sawdust
straw
use of bedding
adding bedding
removing bedding
cleaning out
other houses
pasture management
spread dung on the
field
storage
big bale
storage of big bale
outside uncovered
clamp use
separate clamp
sealing clamp
forage analysis
pH of Clamp 1
type of harvester
forage harvester
additive use
used
storage
clamp
dung disposal
solid manure
slurry
storage
not stored
grazing beef cattle
grazing sheep

Listeriosis in others
beef cattle
sheep
4. 2. 1. Model Building:
Vaccine
Leptospirosis
Lung worm
mole hills
in grass silage field
controlling moles
It was not possible to fit all the selected variables in a single model. This caused
us to develop first a preliminary model that included all the major variables like herd
size, types of forages fed to animals, housing, dung disposal variables and general
management as binary variables. The effects of more qualitative aspects of each
variable e.g. method of feeding forage, silage analysis that were statistically significant
in the preliminary model were then investigated in detail by including more explanatory
variables in other models. Finally variables which reduced the statistical power of the
model because of large numbers of missing values, e.g. herd size (84 observations), or
the variables which had strong effect on the model, e.g. cases in beef cattle (reported by
14 farms), were excluded from the data set.
4. 3. Results:
(i) Preliminary Model:
Using the overall cases reported in dairy cattle as an outcome variable a model
was developed to include the variables listed below, namely feeding forages, housing,
dung disposal, general management. Grass silage feeding was not included at this stage
because those who did not feed grass silage did not report any cases of Listeriosis.
The list of variables used in the preliminary model is as follows:

Forage feeding
Maize silage
Hay
Straw
Root crops
Herd size
cows (1995)
heifers (1995)
Housing
housed
dung disposal
solid manure
slurry
Variables associated with disease.
General
management
pasture
management
spread dung on the
field
grazing beef cattle
grazing sheep
Listeriosis in others
beef cattle
sheep
Vaccine
Leptospirosis
Lung worm
mole hills
in grass silage field
controlling moles
Cases of Listeriosis in beef cattle: Listeriosis in beef cattle was associated with an
increased risk of reporting clinical Listeriosis in dairy cattle (OR 26.06, CL 6.84-
99.31)(Table 4. 1).
Cases of Listeriosis in sheep: The presence of Listeriosis in sheep was associated with
an increased risk of disease (OR 3.86, CL 1.57-9.44) (Table 4. 1).
Maize silage feeding: Feeding maize silage (OR 2.7, CL 1.25-3.43) was associated with
an increased risk of reporting clinical Listeriosis in dairy cattle (Table 4. 1).
Vaccination against Leptospirosis: Vaccinating animals against Leptospirosis was
associated with an increased risk of reporting clinical Listeriosis in dairy cattle (OR 1.7,
CL 1.0-2.9) (Table 4. 1).

Grazing sheep on the same pasture: Grazing sheep on the same pasture as dairy cattle
was associated with a decreased risk of disease in dairy cattle (OR 0.58, CL 0.36-0.95)
(Table 4. 1).
Table 4. 1. The multivariate relationship between major farming practices and
clinical Listeriosis in dairy cattle (preliminary model)
N= 690 OR* 95% CL p Value
Listeriosis in beef cattle 26.06 6.84-99.31

indoor feeding
fed
ad libitum
on the floor
in ring feeders
Housing
housed
cubicles
used
type of bedding
sawdust
straw
General
management
1) Overall cases:
number of cuts
type of harvester
mower conditioner
wilting
use of bedding
adding bedding
removing bedding
cleaning out
loose yard
used
type of bedding
pasture management
spread dung on the
field
grazing beef cattle
grazing sheep
storage
big bale
storage of big bale
outside uncovered
sawdust
straw
use of bedding
adding bedding
removing bedding
cleaning out
other houses
Listeriosis in others
beef cattle
sheep
Vaccine
Leptospirosis
clamp use
separate clamp
sealing clamp
forage analysis
pH of Clamp 1
dung disposal
solid manure
slurry
storage
not stored
Lung worm
mole hills
in grass silage field
controlling moles
After adjusting for possible confounders, 9 variables were found to be associated
with either increasing or decreasing risk of reporting listeriosis in dairy cattle.
Cases of Listeriosis in beef cattle: The presence of Listeriosis in beef cattle was
associated with an increased risk of the disease, OR 23.5 (CL 5.5-100) (Table 4. 2).
Cases of Listeriosis in sheep: Listeriosis in sheep was associated with an increased risk
of disease (OR 2.9, CL 1.0-8.2) (Table 4. 2).

Maize silage feeding: When adjusted for possible cofounders feeding maize silage was
still significantly associated with an increased risk of reporting Listeriosis in dairy cattle
(OR 2.1, CI 1.2-3.6) (Table 4. 2).
Use of a mower conditioner: An increased risk of disease was recorded for the farms
who reported having used mower conditioner in the process of grass silage making, OR
3.8 (CL 1.9-7.6) (Table 4. 2).
Ring feeders: Feeding grass silage in ring feeders when animals were housed increased
the risk of reporting Listeriosis, OR 2.4 (CL 1.4-4.2) (Table 4. 2).
Big Bale silage: Preserving grass silage as big bale silage increased the risk of reporting
disease, OR 1.9 ( CL 1.0-3.5) (Table 4. 2)
Wilting: There was linear relationship between wilting grass for silage and clinical
Listeriosis. As the duration of wilting increased the risk of disease decreased (Table 4.
2).
Table 4. 2. The multivariate relationship between farming practices and listeriosis
in dairy cattle (overall cases)
Number of observations=603 OR* 95% CL p Value
cases of Listeriosis in beef cattle 23.5 5.5-100

cases of Listeriosis in sheep 2.9 1.0-8.2 0.04
maize silage feeding 2.1 1.2-3.6 0.01
use of a mower conditioner 3.8 1.9-7.6 3 0.06 0.008-0.5 0.008
not storing manure 2.1 1.1-3.9 0.02
vaccinating against Leptospirosis 1.7 1.0-2.9 0.04
OR adjusted odds ratio, 95% CL, 95% confidence limit, R baseline category was day 0, @ identified when
rerun excluding herd size and cases of listeriosis in beef cattle.
The model was re-run in an attempt to increase the number of observation in the
model. The herd size was first removed which increased the number of observation to
687. This did not result in any changes. Herd size and cases of listeriosis in beef cattle
were then excluded from the model which increased the number of observations to 715.
The same variables as above were still significant with slight changes in odds ratios, in
addition, vaccinating cattle against Leptospirosis was associated with an increased risk
of disease (OR 1.7, CL 1.0-2.9) and not storing manure was also associated with an
increased risk of disease (OR 2.1, 95% CL 1.1-3.9).
2) Milking cows:
Model 1 was used to determine the farm level predictor variables associated
with clinical Listeriosis in milking cows. The presence of Listeriosis in beef cattle and
sheep, feeding maize silage to milking cows, the use of a mower conditioner in the
preparation of grass silage, feeding grass silage in ring feeders when animals were
housed, and the use of vaccine against Leptospirosis were still associated with an

increased risk of Listeriosis in milking cows and in addition storage of big bale silage
uncovered outside was associated with an increased risk of disease (OR 2.0, CL 1.1-3.7)
(Table 4. 3).
When the same model was rerun excluding first herd size and then herd size and
cases of listeriosis in beef cattle respectively, the same predictor variables were
associated with an increased risk of reporting Listeriosis in milking cow (Table 4. 3).
Table 4. 3. The multivariate relationship between farming practices and listeriosis
in milking cows.
Number of observations=603 OR 95% CL p Value
cases of Listeriosis in beef cattle 9.8 2.8-33.7

and controlling moles in fields were associated with a decreased risk of disease in
winter months (OR 0.54, CL 0.3-0.9) (Table 4. 4).
Exclusion of herd size and then herd size and cases of Listeriosis in beef cattle
did not change the results (Table 4. 4).
Table 4. 4. The multivariate relationship between farming practices and cases of
listeriosis occurring in winter months.
Number of observations=603 OR 95% CL p Value
cases of Listeriosis in beef cattle 29 7.6-111

additionally the use of straw bedding in cubicles was associated with an increased risk
of reporting silage eye (OR 2.3 95% CL 1.0-5.2). After the exclusion of herd size and
cases of Listeriosis in beef cattle, preserving grass silage in clamps (OR 2.4, 95% CL
1.0-5.5) and not storing manure (OR 2.1, 95% CL 1.1-4.1) were also associated with an
increased risk of disease but the use of straw bedding in cubicles was no longer
significant (Table 4. 5).
Table 4. 5. The multivariate relationship between farming practices and cases of
Listeriosis with silage eye
Number of observations=603 OR 95% CL p Value
cases of Listeriosis in beef cattle 34.5 8.2-146

Cases of Listeriosis in beef cattle and sheep were associated with an increased
risk of reporting cases of Listeriosis with nervous signs. Controlling moles in fields was
associated with a decreased risk of disease (OR 0.4, 95% CL 0.1-0.9) (Table 4. 6).
No changes in the results were observed after the removal of herd size from the
model but maize silage feeding was associated with an increased risk of reporting cases
of nervous signs (OR 2.9, 95% CL 1.3-6.6) (Table 4. 6) after the removal of herd size
and cases of Listeriosis in beef cattle from the data set.
Table 4. 6. The multivariate relationship between farming practices and cases of
nervous signs.
Number of observations=603 OR 95% CL p Value
cases of Listeriosis in beef cattle 5.2 1.1-25.5 0.04
cases of Listeriosis in Sheep 4.9 1.3-18.9 0.02
controlling moles
Number of observations=715
0.4 0.1-0.9 0.04
@
maize silage feeding 2.9 1.3-6.6 0.01
OR adjusted odds ratio, @ after the exclusion of herd size and cases of Listeriosis in beef cattle.
The results obtained using the model for each different outcome variables were
remarkably consistent. 14 variables were associated with the outcome variables. 12 of
them were associated with an increased risk of disease. Cases of Listeriosis in beef
cattle and sheep were found to be consistently associated with all outcome variables, the
use of a mower conditioner in preparation of grass silage, feeding grass silage in ring
feeders were also consistently associated with the outcome variables with the exception
of nervous signs. Three predictor variables were associated with three different outcome
variables; preserving grass silage as big bales (associated with overall cases, winter
cases and silage eye), maize silage feeding (associated with overall cases, milking cows
and nervous signs) and not storing manure (associated with overall, milking cows and

silage eye), two predictor variables were associated with two outcome variables;
vaccinating against Leptospirosis (associated with overall cases and milking cows) and
the use straw bedding in cubicles (associated with winter cases and silage eye). The rest
of the variables were associated with one outcome variable (Table 4. 7).
2 variables were associated with a decreased risk of disease; wilting grass prior
to ensiling (associated with overall cases and winter cases) and controlling moles in
fields (associated with winter cases and nervous signs). 10 of the 14 predictor variables
were also found significant in the univariate analysis.
Table 4. 7. The agreement between the different outcomes
Predictor variables that Overall MC WC SE NS
increased the risk of disease
cases of Listeriosis in beef cattle* + + + + +
cases of Listeriosis in sheep* + + + + +
use of a mower conditioner* + + + + -
ring feeders for grass silage (indoor)* + + + + -
big bale silage* + - + + -
maize silage feeding* + + - - +
not storing manure + + - + -
vaccinating against Leptospirosis* + + - - -
straw bedding in cubicle* - - + + -
big bale silage out uncovered* - + - - -
grass silage ad libitum (outdoor) - - - + -
clamp grass silage - - - + -
decreased the risk of disease
wilting + - + - -
controlling moles* - - + - +
MC milking cows, WC winter cases, SE silage eye, NS nervous signs, + association with outcome
variables, - no association with outcome variables, * also statistically significant in univariate analysis
(iii) Model 2:

This model was similar to the Model 1 but included only those farmers who fed
maize silage (224 farms reported feeding maize silage). Maize silage related variables
(making, storing, feeding etc.), all housing, dung disposal and general management
variables were also included in the model. The variables used in this model are listed
below.
Forage feeding
Grass silage
Maize silage
Hay
Straw
Root crops
Housing
housed
cubicles
used
type of bedding
sawdust
straw
General
management
1) Overall cases:
Maize silage
fed
source
home made
outdoor feeding
fed
in complete diet
in ring feeders
use of bedding
adding bedding
removing bedding
cleaning out
loose yard
used
type of bedding
sawdust
pasture management
spread dung on the
field
grazing beef cattle
grazing sheep
indoor feeding
fed
ad libitum
on the floor
in complete diet
in ring feeders
in troughs
straw
use of bedding
adding bedding
removing bedding
cleaning out
other houses
Listeriosis in others
beef cattle
sheep
Vaccine
Leptospirosis
type of harvester
forage harvester
additive use
used
storage
clamp
dung disposal
solid manure
storage
not stored
slurry
disposed
Lung worm
Herd size
cows in 1995
heifers in 1995

Cases of Listeriosis in beef cattle: Listeriosis in beef cattle was found to increase the
risk of disease (OR 13.7, CL 1.31-144.0) (Table 4. 8).
Maize silage feeding: During indoor period feeding maize silage in ring feeders (OR
5.09, CL 2.19-11.87) and ad libitum feeding maize silage (OR 3.69, CL 1.04-13.17)
were associated with an increased risk Listeriosis in dairy cattle (Table 4. 8).
Exclusion of herd size and herd size and cases of listeriosis beef cattle did not
alter the results but slight changes in odds ratio were observed.
Table 4. 8. The multivariate relationship between farming practices and Listeriosis
Number of observations=176 OR 95% CL p value
cases of Listeriosis in beef cattle 13.71 1.31-144 0.03
ring feeder for maize silage
(indoor)
5.09 2.19-11.87

Table 4. 9. The multivariate relationship between farming practices and Listeriosis
in milking cows
Number of observations=176 OR 95% CL p value
ring feeder for maize silage (indoor) 6.5 2.48-17.15

4) Silage eye cases:
Cases of Listeriosis in beef cattle: The presence of Listeriosis in beef cattle was
associated with an increased risk of reporting cases of silage eye (OR 35.5, CL 3.08-
409) (Table 4. 11).
Maize silage feeding: Feeding maize silage in ring feeders when animals were housed
(OR 4.37, CL 1.54-12.4) was associated with an increased risk of reporting silage eye
cases (Table 4. 11)
Use of straw bedding: Big bale straw bedding was negatively associated with reporting
silage eye cases (OR 0.18, CL 0.04-0.87) (Table 4. 11)
When herd size and herd size and cases of Listeriosis in beef cattle were
excluded from the model the same variables were still associated with disease (Table 4.
11).
Table 4. 11. The multivariate relationship between farming practices and cases of
Listeriosis with silage eye
Number of observations=176 OR 95% CL p value
cases of Listeriosis in beef cattle 35.5 3.08-409 0.004
ring feeder for maize silage
(indoor)
4.37 1.54-12.4 0.006
big bale straw bedding 0.18 0.08-0.87 0.034
OR adjusted odds ratio, 95% CL, 95% confidence limit.

5) Nervous signs:
Cases of Listeriosis in sheep: The presence of Listeriosis in sheep was associated with
an increased risk of reporting cases of Listeriosis with nervous signs (OR 10.15, CL
1.3-78.5) (Table 4.12).
Maize silage feeding: Feeding maize silage ad libitum (OR 7.68, CL 1.59-37.08) and in
ring feeders (OR 4.3, CL 1.07-17.9) when animals were housed was associated with an
increased risk of disease (Table 4. 12).
The exclusion of herd size and herd size and cases of Listeriosis in beef cattle
did not alter the results.
Table 4. 12. The multivariate relationship between farming practices and cases of
Listeriosis showing nervous signs
Number of observations=176 OR 95% CL p value
cases of Listeriosis in sheep 10.15 1.3-78.5 0.02
maize silage feeding ad libitum (indoor) 7.68 1.59-37.08 0.01
ring feeder for maize silage (indoor) 4.3 1.07-17.9 0.04
OR adjusted odds ratio, 95% CL, 95% confidence limit.
Overall 7 predictor variables were associated with any of the outcome variables.
Of these 5 were associated with an increased risk of reporting disease and 2 were with a
decreased risk of disease (Table 4. 13). Only feeding maize silage in ring feeders when
animals were housed was associated with all outcome variables. Feeding maize silage
ad libitum when animals were housed was also associated with the outcome variables

with the exception of silage eye cases. Cases of listeriosis in beef cattle were associated
with only two outcome variables (associated with overall and nervous signs) and the
rest were associated with one outcome variable (Table 4. 13). 5 of the 7 variables were
also significant in the univariate analysis. However, the use straw bedding in this model
was associated with a decreased risk of disease.
Table 4. 13. The agreement between the different outcome variables.
Predictor variables that O MC WC SE NS
increased the risk of disease
ring feeders for maize silage (indoor)* + + + + +
maize silage ad libitum (indoor)* + + + - +
cases of Listeriosis in beef cattle * + - - + -
maize silage in complete diet (indoor) - + - - -
cases of Listeriosis in sheep* - - - - +
decreased the risk of disease
big bale straw bedding - - - + -
straw bedding in cubicle* - + - - -
MC milking cows, WC winter cases, SE silage eye, NS nervous signs, + association with outcome
variables, - no association with outcome variables, * also statistically significant in univariate analysis
4. 4. Discussion:
A statistically significant association was found between 19 predictor variables
and the outcome variables using 3 separate models. In the first model major risk factors
were identified and these were investigated in more details in subsequent models. When
different outcomes were considered fewer predictor variables were associated with
cases of Listeriosis showing nervous signs than other outcomes, this may be due to fact
that a small number of farms reported cases of Listeriosis showing nervous signs. Of
these 19 variables 12 were also found to be significant in the univariate analysis. Cases
of Listeriosis in beef cattle and sheep, use of a mower conditioner, maize silage feeding,
big bale silage, storage of big bale outside uncovered, indoor feeding grass silage in ring

feeders, maize silage feeding in ring feeders and ad libitum when animals were housed,
vaccinating animals against Leptospirosis, use of straw bedding in cubicles and
controlling moles in the fields were associated with the disease in both multivariate and
univariate analysis. The ways in which these variables may play a role in the occurrence
of disease have already been dealt with in the previous chapter.
In addition, 7 more variables were statistically associated with the outcome
variables in the multivariate analysis, 1 (grazing sheep on the same pasture and dairy
cattle) in the preliminary model, 4 variables (wilting grass prior to ensiling, storing
grass silage in the clamps, outdoor feeding grass silage ad libitum and not storing
manure) in model 1 and 2 variables (indoor feeding maize silage in a complete diet and
use of big bale straw as bedding) in model 2.
In the previous chapter the importance of proper silage making has been pointed
out. It is known that one of the most important components of perfect silage
fermentation is the carbohydrate concentration of grass which ensures lower pH by
allowing Lactic acid bacteria (LAB) to outgrow other organisms in the silage resulting
in more production of lactic acids. Increases in dry matters mean an increase in
carbohydrate concentration and therefore in the number of LAB (Anon 1983, Fenlon
and others 1995b). One way of achieving an increase in number of LAB is wilting grass
prior to ensilage. In this study wilting grass was associated with a decreased risk of
disease.
Storage of grass silage in clamps and outdoor ad libitum feeding grass silage
were associated with an increased risk of reporting cases of silage eye. This may be
explained in several ways. Silage fed from the clamps may have contained the top of
clamp where the growth of organisms was enhanced due to air exposure and spoilage,
or alternatively animals may have had free access to the clamp where they may have
eaten silage at the clamp face which as explained in the previous chapter, may have

caused damage on the conjunctival membranes allowing L. monocytogenes to penetrate
these membranes. The latter assumption may find some support from the association
found between outdoor ad libitum feeding grass silage and an increased risk of
reporting silage eye in this study. Another explanation for the effect of outdoor ad
libitum feeding may be that the quality of silage would be poorer due to exposure to air
and unfavourable weather conditions therefore the quantity of L. monocytogenes would
be much higher than at the beginning of silage feeding.
Maize silage feeding in a complete diet when animals were housed was
associated with an increased risk of reporting Listeriosis in milking cows. This may
have been due to an increase in the numbers of the organism in the diet because a
complete diet contains several forages including hay, straw, grass silage.
It is known that spreading animal waste on fields plays an important role in
environmental contamination with L. monocytogenes and poses great a health hazard to
animals and humans (Wray 1975, Jones 1980, Pell 1997). In this study there was a
statistically significant association between not storing manure and an increased risk of
disease (overall cases and cases in milking cows). These farms may have spread manure
on the fields where animals were grazing or grass and maize silage, hay or straw was
made. This variable was also included in all the multivariate models but it was not
significantly associated with any of the outcome variables.
An association was found between the use of big bale straw as a bedding
material and a decreased risk of reporting cases of silage eye. This was only significant
in the models 2 where the analysis was restricted to those who fed maize silage. It may
be that baling reduced the exposure of straw to unfavourable weather conditions or
extra contamination with L. monocytogenes originating from other sources, resulting in
the straw being free of L. monocytogenes or harbouring very low numbers of the
organism.

A contradictory finding was made about the use of straw bedding in cubicles.
This was associated with an increased risk of disease in univariate analysis and in model
1. However, it was associated with a decreased risk of reporting Listeriosis in milking
cows in model 2. It may be speculated that the majority of farmers may have had better
management system or cubicle housing system on those farms who fed only maize
silage.
There was a negative association between grazing sheep on the same field as
dairy cattle and the risk of disease. This may have been due to better pasture
management. It may be possible that sheep grazed on the pasture during winter months
when animals were housed. Even if sheep excreted the organism during this period, by
the time that dairy cattle were turned out sheep had long been moved to other fields and
the organism may have decreased significantly in number. It is known that L.
monocytogenes survives in sheep faeces for 3 months (reviewed by Radostits and
others 1994)
The analysis of the questionnaire data has enabled us to identify some important
risk factors for clinical Listeriosis in dairy cattle at farm level. These factors are mainly
related to the infection pressure of the organism. The study has shown the importance of
proper silage making, preservation and methods of feeding. It has also suggested the
importance of better management at housing (e.g. use of bedding, dung disposal) and
some general management factors (e.g. control of moles in the fields, separation of sick
animals). However to reach a better understanding of the disease L. monocytogenes
infection should also be investigated at individual animal level. The next two chapters
consider the infection in dairy cattle and its possible risk factors.

CHAPTER 5
A pilot study of the bacteriological and serological techniques
used to determine the infection of cows with Listeria
5. 1. Introduction:
monocytogenes
Sensitive techniques for the isolation and identification of L. monocytogenes are
essential for the diagnosis of outbreaks and sporadic cases of Listeriosis. They are
also important in epidemiological investigations and in assessing the bacteriological
safety of food.
Listeria grow well on most of the commonly used bacteriological culture media
after initial isolation (Gray and Killinger 1966). However initial isolation from
contaminated materials has always been challenging (Murray and others 1926, Farber
and Peterkin 1991). This difficulty stimulated a search for more selective methods of
isolation which was also fuelled by the increasing number of outbreaks of Listeriosis
in people associated with the consumption of food contaminated with L.
monocytogenes. The aim of these developments was to detect small numbers of L.
monocytogenes, in a shorter period of time and also to increase the probability of
recovering injured organisms (Buchanan, 1990). Several techniques were employed;
direct plating on selective and non-selective agar and the use of selective and non-
129

selective enrichment broth, at refrigeration or higher temperatures, prior to plating
(Curtis and Lee 1995).
Direct plating is rapid but unreliable. The limit of detection is often too low to
recover L. monocytogenes from samples containing small number of bacteria and L.
monocytogenes is outgrown when heavily contaminated samples such as faeces are
examined. This gave rise to a need for an enrichment step prior to plating.
The first enrichment procedure used for Listeria was “cold enrichment”. This was
first advocated by Gray and others (1948) when they found that exposure of the
Listeria negative samples of cow brain in tryptose broth to refrigeration temperature
(4 0 C) prior to plating resulted in growth of L. monocytogenes after a period of up to 3
months. This procedure was the only enrichment procedure used for a number of years
and is still used successfully to examine clinical specimens such as brain (Gray and
others 1950), milk (Larsen 1966) and silage (Gray 1960b, Fenlon 1985). Its major
drawback is that it takes months to reach any conclusion. This makes it unsuitable for
epidemiological investigations and the microbiological examination of food.
The emergence of Listeria as a food borne pathogen resulted in the development
of more rapid selective culture media. These culture media incorporated antibiotics to
which Listeria are resistant. Polymixin B in tryptose phosphate broths (Bojsen-Moller
1972) and trypaflavin and nalidixic acid in Levithal broth (Ralovich and others 1972)
were the first selective liquid media to be developed. Watkins and Sleath (1981) also
developed an enrichment broth containing nalidixic acid and thiocyanate to recover
listeria from sewage. Nalidixic acid was used in all selective enrichment broths to
inhibit Gram negative bacteria. Acriflavin was also used for this purpose. Further
developments were L-PALCAM (van Netten and others 1989) which contains
polymixin, ceftazidine and lithium chloride in place of nalidixic acid and Fraser`s
Broth (Fraser and Sperber 1988) in which Lithium bromide was incorporated in
130

addition to nalidixic acid. Lovett and others (1987) included cyclohexamide in the
FDA (United States Food and Drug Administration) broth to inhibit yeast and moulds.
This original formulation of Lovett and others (1987) was further developed by USDA
(United States Department of Agriculture) to trace Listeria in meat samples (McClain
and Lee 1988).
In parallel to the development of selective enrichment broths, several selective
agars were developed incorporating the same antibiotics. Gray and colleagues (1950)
were again the first researchers to use selective agar by including potassium tellurate
to inhibit Gram negative organisms. McBride and Girard (1960) developed a selective
phenyl ethanol agar containing lithium chloride, glycine and blood. This was the only
commercially available selective agar for a considerable time. A major problem was
its inability to inhibit enterococci. Lee and McClain (1986) later modified McBride
agar by removing glycine and blood, adding moxalactam and glycine anhydride and
increasing the concentration of lithium chloride. Ralovich and colleagues (1971) also
used trypaflavin and nalidixic acid in a serum based agar.
The discovery that Listeria organisms were resistant to higher concentrations of
lithium chloride led to development and modification of many agars and overcame the
problem of enterococcal growth. Most of the agars currently used are a modification of
McBride (McBride and Girard 1960) and the Oxford formulation (Curtis and others
1989a). In addition to antibiotics, one or more indicators for Listeria were also
included in the medium such as aesculin in Oxford agar (Curtis and others 1989),
blood in enhanced haemolysis agar (EHA, Cox and others 1991) and Fenlon Listeria
agar (Fenlon 1985), mannitol and phenol red in PALCAM agar (van Netten and others
1989) and rhamnose in Modified Despeirres agar (Golden and other 1988).
Although the selectivity of media was increased by incorporating antibiotics in the
culture medium it was noticed that highly selective media could also inhibit the
131

growth of some strains of Listeria (Seeliger and Jones 1986, Curtis and other 1989b).
To obtain maximum success in isolation of Listeria a three stage procedure was
recommended (Curtis and Lee 1995); (a) resuscitation or pre-enrichment (selective or
non-selective) (b) selective enrichment and (c) selective plating. This procedure has
been used to isolate Listeria from food (Lewis and Cory 1991, McLain and Lee,
USDA method, 1988), sewage (Watkins and Sleath 1981), clinical samples (Eld and
others 1993) and environmental samples (Fenlon 1985, Husu 1990).
The difficulty in isolating L. monocytogenes means that bacteriological methods
are not always satisfactory when attempting to determine the exposure of animals to
Listeria organisms (Gray and Killinger 1966) and serological techniques have been
used as supplementary tools for this purpose. Specific ELISA tests, employing cell
products involved in pathogenesis such as listeriolysin O, have been used in
experimental studies. No large scale use of these ELISA assays, involving field studies
has, yet been conducted (Berche and others 1990, Low and Donachie 1991, Low and
others 1992b, Gholizadeh and others 1996).
A pilot study involving a dairy herd was carried out to develop and standardise
bacteriological and serological techniques which would be used in a longitudinal
survey of L. monocytogenes infection.
5. 2. Materials and methods
132

5. 2. 1. Study design :
This pilot study was carried out over a 12 month period, between September 1994
and August 1995 and involved a dairy herd of 99 Holstein cows on the University of
Bristol’s farm.
The herd was housed between October, 24th 1994 and April, 12th 1995. Silage
was fed to animals from the beginning of September 1994 to 12th April 1995.
The herd was visited monthly with the exception of February 1995. Rectal faeces
samples were collected from the animals available at the time of each visit using
lubricated (Lubrel, Arnolds, UK) rectal gloves. The first visit was made on 5th
September, 1994 and the last visit was made on 16th August 1995. Samples of silage
were also taken from the cutting face of the clamp on four occasions. The dates of the
visits and the number of samples collected are shown in Table 5. 1.
Table 5. 1. Date of visits and number of samples collected
a) Indoor period b) Outdoor period
Month Date N Month Date N
November 17/11/1994 69 May 17/5/1995 77
December 15/12/1994 74 June 13/6/1995 75
January* 31/1/1995 77 July 18/7/1995 67
February* ND ND August 16/81995 57
March* 7/3/1995 79
April* 12/4/1995 74
Total 373 Total 276
ND not done, N number of animals sampled, * silage samples were also collected
On the 12th of April 1995 the milking cows present on the farm were bled. A total
of 77 sera were prepared and held at -20 0 C until use.
133

5. 2. 2. Bacteriology :
a) Culture procedure: (Appendix 3)
A three stage procedure was used to isolate Listeria. This involved cold
enrichment followed by the use of selective broth culture and selective solid medium at
higher temperatures. This was adapted from the technique described by Fenlon (1985)
and Lewis and Corry (1991).
Samples were first cultured when fresh and then held at 4 0 C for a period of up to
7 weeks to enhance the probability of isolating Listeria by cold enrichment. Samples
which were negative at first culture were re-cultured at predetermined optimal times (at
the 3rd and 7th weeks of cold storage).
An aliquot of the sample was placed into Listeria Selective Enrichment Broth
(LSEB) (Lovett and others 1987) in a universal container to give a final concentration
of approximately 1/10 (w/v) and incubated for 24 or 48 hours at 30 0 C. One loopful of
this broth culture was streaked out on to Listeria Selective Agar (LSA) (Curtis and
others 1989a) and incubated at 30 0 C for 48 hours (Figure 5. 1).
Faecal samples collected in September (30 samples) and in October (70
samples) were cultured without cold enrichment. Listeria spp. were isolated from 3 of
the 100 samples.
To investigate the effect of cold enrichment on the number of isolates, 20
samples were collected in October 1994 and stored at 4 0 C and cultured weekly for 7
weeks and then again on weeks 13, 14 and 15.
The effect of storing the samples at 4 0 C in three liquid media, -saline, LSEB and
NB,- on the growth quantity was compared. The results obtained using these media
134

were also compared with those obtained at 4 0 C in the absence of medium. For this
study the 20 faecal samples collected in October 1994 (20) and an additional 79
samples collected in March 1995 were used. Cold enrichment was carried out by
keeping samples in either saline, LSEB, nutrient broth (NB) or no medium at 4°C and
culturing periodically for up to 7 weeks. Isolation and identification was carried out
according to the methods given below (Figure 5. 1).
b) Identification procedure: (Appendix 3)
At least five colonies of Listeria were picked off the LSA plates and sub-
cultured on 5% Sheep Blood Agar (SBA) or Horse Blood Agar (HBA) plates at 37 0 C
overnight. The following tests were carried out to identify the isolates as Listeria
species:- Gram staining, Catalase test, Motility test, Haemolytic activity, CAMP test
and Carbohydrate utilisation. Information provided in Table 1. 1. was used to aid
identification.
Fresh sample
Re-culture after Cold enrichment
3 weeks at 4 0 C for 7 weeks
135

culturing negative
LSEB (1/10w/v) samples at 4 week
at 30 0 C for 48 h and 7 weeks intervals
Plating on LSA
at 30 0 C for 48 h Identification tests:
Gram staining
Catalase
Oxidase
Motility
Sub-culturing Haemolytic
on SBA CAMP
at 37 0 C for 24h Sugar utilisation
Figure 5. 1. Isolation and identification procedure for Listeria spp.
1) Gram staining: Bacterial colonies smeared onto a clean microscope slide were air
dried, fixed by passing through the Bunsen flame two or three times and placed on a
staining rack. The slides were flooded with Crystal violet for 1 minute, washed under a
running tap, stained with Gram’s iodine for 1 minute and then washed a second time.
The slides were then decolourised with acetone for 15 seconds, washed and counter
stained with Safronin for 30 seconds. The slides were washed, dried and then examined
under a light microscope. Listeria were identified as Gram positive rods with a purple-
blue colour.
2) Haemolytic test: The haemolytic activity of the bacteria was assessed visually after
culture on 5% Sheep (Horse) Blood Agar. Some members of the genus Listeria induce
varying degrees of erythrocyte lysis (L. monocytogenes, L. ivanovii more haemolytic,
136

and L. seeligeri less haemolytic). A haemolytic colony selected from the plate was
inoculated into sterile saline for further tests (CAMP test, Sugar fermentation test etc.)
in order to identify the isolate at the species level.
3) Catalase test: A colony was placed on a microscope slide and a drop of 3% hydrogen
peroxide was added. Listeria have a catalase enzyme which converts hydrogen peroxide
to water and oxygen causing air bubbles to appear on the slide. It is important to note
that catalase negative strains of L. monocytogenes have recently been reported to be
implicated in human Listeriosis (Swartz and others 1991, Bubert and others 1997).
4) Motility test: The motility of Listeria was examined at 25 0 C using a hanging-drop
technique. A bacterial suspension was prepared by adding 2-3 colonies of Listeria to
saline. It was then left at room temperature for 1-2 hours. A drop of the bacterial
suspension was placed on a cover-slip and inverted over a glass ring fixed to a
microscope slide. The preparation was examined under a microscope. Listeria showed a
tumbling movement.
5) CAMP test: An isolate of Staphylococcus aureus and Rhodococcus equi was
streaked in one direction on 5% SBA plates and L. monocytogenes, L. seeligeri and L.
ivanovii were streaked at 90 0 angles to (but not touching) them. After overnight
incubation at 37 0 C the plate was examined for haemolysis. Enhanced haemolysis of L.
monocytogenes and L. seeligeri in the vicinity of S. aureus was observed while
haemolysis of L. ivonavii was enhanced (shovel-shaped haemolysis) in the vicinity of
R. equi.
137

6) Sugar tests: Listeria are capable of producing acid from some carbohydrates
(Rhamnose, Glucose, Xylose, Mannitol,) and reducing nitrate to nitrite. 1% sugar plates
containing different carbohydrates were prepared (Appendix 3) and divided into four
quarters. An isolate of Listeria was streaked out on each quarter and incubated at 37 0 C
overnight. A change in the colour of medium from red to yellow due to acid production
confirmed the presence of Listeria.
7) Storage of isolates: All isolates identified as Listeria spp. were placed on
preservative beads as instructed by the manufacturer (TSC, Lancashire, UK) and kept
at -20 0 C.
c) Investigation of the limit of detection:
The method of Miles-Misra (reviewed by Corry 1982) was used to determine the
detection limit of the culture method used in this study. Briefly a colony of L.
monocytogenes grown on SBA was inoculated into 10ml of LSEB and incubated
overnight at 30 0 C. Twelve tenfold dilutions were prepared. Four 20μl drops from each
dilutions were spotted on quartered LSA plates incubating at 37 0 C for 48 hours and
2ml into 10 g of faeces, previously autoclaved. The mixture was held at 4 0 C and
cultured weekly for three successive weeks and again at the 7th week to determine the
effect of cold enrichment on the limit of detection. The number of colony forming
units in the original suspension was calculated by selecting LSA plates on which
colonies could be easily counted. The weighted mean of the number of colonies in
each quarter was then calculated for 4 different dilutions of the starting inoculum
using the following formula:
cx + cx+1 + cx+2 .+ cx+3..
138

mx =
nx + 10 1 nx+1 + 10 2 nx+2 .+10 3 nx+3..
where cx and nx refer to the counts and number of plates at lowest dilution and cx+1 and
cx+1 etc. refer to successively higher dilution. The best estimate of the mean count in the
starting inoculum was then calculated as below
M= mx x 10 x x y
where y is the number of drops per ml of the dropping pipette.
The values calculated for the bacterial concentration in the original inoculum were
then used to calculate the limit of detection.
1g of known Listeria - positive faeces sample was inoculated into 9ml of LSEB
and incubated at 37 0 C for 48 hours and processed as above. The detection limit was
determined in a similar manner using the same method of calculation.
5. 2. 3. Serology
a) Antigen Preparation :
Serum antibody to L. monocytogenes was detected using an ELISA. The antigen
used in this test was cholesterol precipitated Listeriolysin O (CP-LLO).
This was prepared according to the method of Vazquaz-Boland and others
(1989b) and Jagger (1993) and is described below.
L. monocytogenes serotype 4b was streaked out onto a Horse (Sheep) Blood
Agar plate and incubated at 37ºC for 24 hours. A colony from the plate was inoculated
into 10ml Brain Heart Infusion Broth (BHIB) and incubated at 37ºC for 24 hours. The
growth was harvested by centrifuging the BHIB at 2000g for 20 minutes. The
supernatant was poured off and the pellet was washed twice in sterile phosphate
139

uffered saline (PBS), pH 7.2, centrifuging at 2000g for 20 minutes. The supernatant
was discarded and the pellet was re-suspended in 50ml PBS. This inoculum was placed
within a dialysis membrane previously inserted into 1 litre of BHIB and incubated
overnight, on a shaker, at 37ºC. The contents of the dialysis tube were harvested, after
checking the broth for evidence of contamination, and then centrifuged at 2800g for 20
minutes. The supernatant was pipetted off, filtered through a sterile 0.45µl filter unit
and diluted with an equal volume of 0.20µM L-cysteine (Sigma, Dorset, UK), in PBS
pH 6.0. For every 10ml of mixture 0.5ml of cholesterol (10mg in1ml of ethanol)
(Sigma, Dorset, UK), were added. The mixture was then incubated at 37ºC for 30
minutes on a shaker. The mixture was centrifuged at 25,000g for 30 minutes at 4ºC and
the supernatant discarded. The pellet was washed twice in PBS pH 7.2, centrifuged at
25,000xg for 30 minutes at 4ºC and finally re-suspended in 2ml of Carbonate-
bicarbonate buffer and frozen at -20ºC.
The haemolytic activity of Listeriolysin O obtained above was determined
according to the method of Kreft and others (1989). Briefly 200µl of the Listeriolysin O
was put into a sterile tube and diluted with equal volume of PBS pH 6.0. 10µl of 0.1M
dithioerythritol (Sigma, Dorset, UK) and 10µl of the washed sheep erythrocytes were
added to this mixture and it was incubated at 37ºC for 30 minutes on shaker. A positive
result was one in which complete haemolysis was observed.
b) ELISA assay procedure: (Appendix 3)
The ELISA procedure was adapted from that described by Low and others
(1991) and Jagger (1993) and is described below.
The Listeriolysin O (LLO) antigen was sonicated for 1 minute and diluted to a
working dilution. 100 μl of antigen diluted in Carbonate-bicarbonate buffer, pH 9.6,
(1:50) was used to coat a 96 well microtitre plate (Greiner Laboratories, Glasgow, UK).
140

The plate was incubated at 37ºC overnight. The plate was washed 6 times in PBS
Tween 20, standing for 5 minutes at the last wash. 100µl volumes of blocking buffer
(1% Fetal Calf Serum in PBS) were added to each well and the plate was left at room
temperature for 4-5 hours. The plate was then washed 6 times in PBS Tween and 100µl
of serum diluted 1:50 in PBS were added to each well and incubated at room
temperature for 4-5 hours. The plate was then washed again 6 times and 100µl of
Alkaline phosphatase conjugated Rabbit α Bovine IgG (Sigma, Dorset, UK) diluted
1:5000 was added to each well. The plate was incubated at 4 0 C overnight, washed 6
times and 100µl phosphatase substrate (Sigma, Dorset, UK) (1mg/ml in carbonate-
bicarbonate buffer) was added to each well. After standing for 15-20 minutes the
reading was taken at 405nm absorbance using an ELISA reader (Dynex Tech.,
Guernsey UK).
c) Optimisation of the assay and specificity:
Determination of the optimal antigen and serum: The optimal working dilution of
antigen and positive control serum was worked out using chequerboard titration in
which different two fold dilutions of the antigen were tested against goat hyper-
immune serum. 100μl of coating buffer was put in to each well 100μl of the antigen
was added to the first row of the plate and doubling dilutions were made from 1:2 to
1:256. 100μl hyper-immune serum were put into the first column of the plate and
doubling dilutions made from 1:2 to 1:4096.
Determination of coating conditions: Three different temperatures, 4 0 C, room
temperature and 37 0 C, were used to optimise coating. 100μl of LLO in carbonate
bicarbonate buffer at 1:50 dilution was used to coat 3 identical plates. The ELISA was
done as described earlier.
141

Investigation of non-specific bindings: This was done by inserting an extra step
between coating and adding the sample serum in which Bovine Serum Albumin
(BSA), Fetal Calf Serum (FCS), dried skimmed milk (Marvel) and Pig Albumin were
tested for their capacity to reduce non-specific binding.
Investigating the specificity of the ELISA: A bovine serum sample and goat hyper-
immune serum were incubated with LLO heat killed L. monocytogenes and L.
monocytogenes culture supernatant to investigate whether antibody in the serum was
specific to the L. monocytogenes antigen. LLO was prepared as mentioned before.
The culture supernatant was obtained from BHIB during the process of making LLO.
Listeria organisms were prepared as follows; L. monocytogenes was grown on a blood
agar plate and the growth obtained was suspended in 2ml saline. The mixture was
exposed to heat at 65 0 C for 30 minutes. An equal volume (0.5ml) of the serum was
mixed with an equal volume (0.5ml) of the antigen (LLO), heat killed L.
monocytogenes and culture supernatant. The mixtures were incubated at room
temperature overnight and centrifuged at 20,000 rpm for 50 minutes. The supernatant
was poured into a sterile test tube and filtered through 0.45μl filter unit. The resulting
supernatant was used in the ELISA as described earlier.
5. 2. 4. Statistical analysis:
Epi-info version 6 (Dean and others 1994) was used to analyse the data. A
Yates’ corrected chi squared test was used to compare the differences between
proportions. A Kruskal-Wallis test was used to compare the differences between median
142

values (Dean and others 1994). A probability of P< 0.05 was accepted as statistically
significant.
5. 3. Results:
5. 3. 1. Results of bacteriology:
The effect of extending the incubation period: There was no change in the frequency of
isolating Listeria with the extended incubation period but it enhanced the quality of the
Listeria growth by reducing contamination on the plates.
The effect of cold storage: The samples collected in September (30) and October (70)
were cultured without cold enrichment to detect the presence of the organism. Only 3 of
them were presumably positive for L. monocytogenes. The samples collected in
subsequent months were cold enriched.
Cold enrichment increased the frequency of isolation of Listeria spp especially
after the 3rd week (Table 5. 2.). As the length of cold storage was extended the number
of Listeria isolates increased.
After cold enrichment and weekly culture for 15 weeks, Listeria spp. had been
identified in 18 of the 20 samples. This was taken as a “gold standard” to evaluate the
sensitivity of culture after cold enrichment for different lengths of time. The sensitivity
of culture was 0.72 (13/18) after 3 weeks of cold enrichment and was highest after 7
weeks of cold enrichment (0.94, 17/18). Similar results were found for L.
monocytogenes. The sensitivity of the test was 0.56 (10/18) after 3 weeks of cold
enrichment and 0.61 (11/18) after 7 weeks. When these results of culture after 3 and 7
weeks of cold enrichment were combined the sensitivity was 1 for Listeria spp. (18/18)
143

and 0.94 for L. monocytogenes (17/18). The results are shown in the Table 5. 2. On the
basis of these results it was decided to culture faecal samples immediately after
collection, then after 3 and 7 weeks of cold enrichment.
Table 5. 2. Effect of cold enrichment on the growth quantity of Listeria spp.
weeks of cold enrichment
N = 20 0 1 2 3* 4 5 6 7* 13 14 15
Listeria spp 0 4 9 13 13 12 14 17 15 16 15
(%)
(20) (45) (65) (65) (60) (85) (85) (75) (80) (75)
Sensitivity 0 0.22 0.5 0.72 0.72 0.67 0.78 0.94 0.83 0.89 0.83
monocytogenes 0 4 7 10 10 6 10 11 11 12 13
(%)
(20) (35) (50) (50) (30) (50) (55) (55) (60) (65)
Sensitivity 0 0.22 0.39 0.56 0.56 0.33 0.56 0.61 0.61 0.67 0.72
( ) percentage, 0 cultured when fresh,* high sensitivity and number of isolates, N number of samples
examined
The effect of different storage media during cold enrichment: Saline had an adverse
affect on the growth quantity of Listeria after cold enrichment when compared with
those kept with no media (Table 5. 3.) but this effect was not statistically significant
(P=0.7 for first culture, P=1 for second culture).
Table 5. 3. Effect of saline the isolation of Listeria.
Listeria spp
Culture
Samples in no media Samples in saline
N=20 (%)
N=20 (%)
1 14 (70) 12 (60)
2
N number of samples tested
16 (80) 15 (75)
LSEB and NB were used to increase the chance of obtaining the maximum
number of isolates of L. monocytogenes. 79 samples (collected in March) were used in
this study. Culture was carried out weekly for the first 3 weeks then after 7 weeks of
cold enrichment. Although an increase in number of isolates was observed after the 1st
144

week of cold enrichment these liquid media did not significantly increase the number of
isolates over time. These results are given in the table 5. 4.
Table 5. 4. Effect of LSEB and NB on the growth of L. monocytogenes.
weeks of cold enrichment
0 1 2 3 7
n=79 LSEB NB LSEB NB LSEB NB LSEB NB
Listeria spp.
%
monocytogenes
%
4
5
3
3.7
20
25.3
9
11.3
21
26.5
7
8.8
20
25.3
11
13.9
LSEB Listeria Selective Enrichment Broth, NB Nutrient Broth
22
27.8
9
11.3
21
26.5
9
11.3
23
29.1
11
13.9
22
27.8
9
11.3
24
30.4
10
12.6
The overall results are shown in the Figure 5. 2. This indicates that cold
enrichment improved the detection of Listeria positive samples. For example in
December the proportion of samples in which Listeria were identified was 10.6 % after
fresh culturing, and 70% after 7weeks of cold enrichment.
Figure 5. 2. Effect of cold enrichment on the growth of listeria.
(J* and A* not cultured at 3rd week of cold enrichment, F* not done)
Percentage
100
90
80
70
60
50
40
30
20
10
0
fresh
3 weeks
7 weeks
N D J* F* M A* M J J A
Month
Period of
cold enrichment
145

Detection limit of the method: A single colony inserted into 10ml of LSEB resulted in
the growth of 3.17x10 7 cfu/ml from which 3.17 organisms/ml were isolated by the
culture media as the lowest concentration detected. The lowest concentration of
organisms that could be isolated from the known Listeria positive faecal sample was 7
organisms/g. The faecal samples spiked with each dilution of L. monocytogenes and
subjected to refrigeration temperature were cultured weekly for the first three
successive weeks and then after 7 weeks of cold enrichment for the presence of L.
monocytogenes. It was observed that the sample spiked with 3.17x10 -1 cfu/ml
organisms revealed growth after the second week of cold enrichment.
Pattern and rate of excretion: The results of monthly herd visits are shown in the Figure
5. 2. A total of 99 milking cows were sampled over one year. All animals shed Listeria
spp. at least once during the study, 92.9% (92/99) of the cows excreted L.
monocytogenes in their faeces at some stage whilst 7.1% excreted other Listeria spp.,
mainly L. innocua and on one occasion L. seeligeri.
The proportion of animals excreting Listeria was calculated for each month
(Table 5. 5). The highest proportion was observed in January when 89.9% (69/77) of
the cows were shedding Listeria spp. It remained high during the winter months. The
excretion level decreased in May (16/77, 20.8%) and thereafter. Similarly for L.
monocytogenes, the highest excretion level was in January, 51/77 animals (63.2%) were
shedding the bacteria (Figure 5. 3). The difference between the months was statistically
significant (P

November S 69 49 71 45 65.2 4 5.8
December 74 57 77 49 66.2 8 10.8
January 77 69 89.6 51 66.2 18 23.4
February ND ND ND ND ND ND ND
March 79 41 51.9 28 35.4 13 16.5
April 74 61 82.4 41 55.4 20 27
May 77 16 20.8 16 20.8 0 0
June 75 2 2.6 2 2.6 0 0
July 67 4 6 4 6 0 0
August 57 1 1.8 1 1.8 0 0
NS number of samples, L spp Listeria spp., Lm L. monocytogenes, Li L. innocua, * L. seeligeri on one
occasion, ND not done, S statistically significant difference between months (P

Relationship between housing, silage feeding and excretion rates: Although the silage
fed to the herd during the winter months was generally of good quality (pH 3.9. DM
26.6, Ash 6.7, ME 10.3) both L. monocytogenes and L. innocua were isolated from the
samples of silage. The cows were not sampled before silage feeding commenced. 89.9%
(89/99) of the cows excreted Listeria spp. and L. monocytogenes during silage feeding
while 21.2% (21/99) excreted listeria after silage feeding. This difference was
statistically significant (OR 33.06, 95%CL 13.8-81.6, P

with the exception of March, younger animals were more prone to shed L.
monocytogenes (Table 5. 7).
Table 5. 7. The relationship between age and excretion of L. monocytogenes.
L. monocytogenes
A P
Visits M (IR) (n) M (IR) (n) p value
November S 6 (4-7) 20 5 (4-6) 45 0.1
December 6 (4-6) 17 5 (4-7) 49 0.8
January 5 (3.5-6.5) 8 4 (4-6) 51 0.2
March 4.5 (4-6) 38 5.5 (4-7) 28 0.7
April 7 (5-8) 13 4 (3-6) 41 0.02*
May 5 (4-7) 61 5 (4-8) 16 0.3
June 5 (4-7) 73 4 (4-4) 2 0.4
July 5 (4-7) 63 4.5 (3.5-5) 4 0.25
August 5 (4-7) 56 4 (4-4) 1 0.5
A negative for L. monocytogenes, P positive for L. monocytogenes, M median age IR interquartale
range, n number of animals, * statistically significant
Since there were animals excreting the bacteria on more than one occasion (the
range was from 1 to 7) the relationship between the age of animals and the maximum
number of times Listeria was detected in faeces samples was also assessed. There was a
negative correlation between age and the maximum frequency of detection of Listeria
spp.; the older the animals were the less frequently they became positive, correlation
coefficient was -0.82 (95% CL -2.1-0.6). This was statistically significant (P=0.003)
(Table 5. 8).
Table 5. 8. The effect of age on the frequency of animals becoming Listeria positive
Frequency of positivity
Age N 1 2 3 4 5 6 7
3 20 5 1 5 6 3 0 0
4 22 2 5 2 7 4 1 1
149

5 13 3 3 1 3 1 1 1
6 14 1 4 5 3 1 0 0
7 11 2 2 2 5 0 0 0
8 5 1 1 3 0 0 0 0
9 8 1 1 1 3 2 0 0
10 3 2 1 0 0 0 0 0
11 2 1 1 0 0 0 0 0
13 1 0 1 0 0 0 0 0
Total 99 18 20 19 27 11 2 2
N number of cows in each age category
5. 3. 2. Results of serology:
Coating regime: None of the plates incubated at three temperatures, 4 0 C, room
temperature or 37 0 C, gave rise to non-specific binding with fetal calf serum but the
plate incubated at 37°C gave optical density (OD) value higher than the others (Table
5. 9).
Table 5. 9. Effect of different coating temperature on the assay
Sample serum * Goat hyper-immune serum
B 4 0 C RT 37 0 C 4 0 C RT 37 0 C B
0.052 0.472 0.527 0.711 0.511 0.567 0.732 0.644 0.841 0.727 0.052
0.058 0.339 0.501 0.501 0.452 0.479 0.597 0.666 0.719 0.567 0.052
0.059 0.250 0.411 0.386 0.333 0.369 0.437 0.505 0.512 0.522 0.054
0.058 0.204 0.252 0.262 0.285 0.287 0.359 0.386 0.417 0.382 0.055
0.057 0.134 0.199 0.176 0.204 0.248 0.300 0.337 0.318 0.279 0.054
0.056 0.105 0.168 0.141 0.167 0.211 0.249 0.237 0.242 0.262 0.053
0.054 0.086 0.124 0.112 0.051 0.053 0.052 0.052 0.069 0.069 0.054
0.055 0.073 0.081 0.092 0.051 0.051 0.052 0.053 0.072 0.068 0.054
RT room temperature, B blank
Chequerboard Titration of CP-LLO : The optimum CP-LLO and goat hyperimmune
serum dilutions giving the highest OD were 1:64 and 1:64 respectively.
150

Investigating Non-specific Bindings : Some non-specific binding was still detectable
when BSA, Marvel or Pig Albumin were used whereas this was not detectable when
FCS was used. FCS was used in the blocking step in all subsequent tests.
Investigating Specificity of ELISA: Absorption of hyper-immune serum to L.
monocytogenes with CP-LLO and culture supernatant abolished the antibody activity.
Table 5. 10. indicates that antigen-antibody binding was specific.
Table 5. 10. Plate plan and Optical densities
SD B Sample serum Standard Goat hyper-immune serum B
1 2 3 4 5 6 7 8 9 10 11 12
2 0.055 0.059 0.078 0.063 0.505 0.800 0.833 0.056 0.289 0.057 0.465 0.048
4 0.055 0.058 0.068 0.060 0.554 0.696 0.736 0.058 0.236 0.055 0.406 0.049
8 0.055 0.058 0.061 0.057 0.214 0.568 0.630 0.057 0.173 0.057 0.306 0.051
16 0.055 0.058 0.061 0.058 0.163 0.523 0.493 0.057 0.115 0.057 0.271 0.052
32 0.055 0.057 0.059 0.058 0.121 0.361 0.344 0.057 0.094 0.057 0.211 0.052
64 0.055 0.058 0.058 0.058 0.090 0.268 0.239 0.055 0.075 0.055 0.150 0.052
128 0.052 0.055 0.055 0.056 0.071 0.055 0.054 0.054 0.065 0.054 0.114 0.052
256 0.054 0.055 0.055 0.054 0.062 0.054 0.054 0.054 0.061 0.056 0.86 0.050
SD Serum dilution, B Blank, Columns 2 and 8 treated with LLO, Columns 3 and 9 treated with culture
supernatant, Columns 4 and 10 heat killed Listeria organisms, Columns 5 and 11 untreated serum
(control).
Immune Status of the animals (a field trial of the ELISA) : Blood samples were taken
only once from 77 animals. The OD values obtained were converted to Log values and
then the relationship between age, bacteriological results and antibody level was
investigated. When animals were grouped by the frequency of being positive for
Listeria there was a negative correlation between the frequency of detection of
Listeria and the concentration of the antibody to Listeria. This was statistically
significant (Pearson’s correlation coefficient = -0.35, 95% CL -0.54-0.13, P=0.03).
Animals that became positive for Listeria on 6 and 7 occasions were excluded because
there were very small numbers in these groups (Table 5. 11).
151

Table 5. 11. The relationship between frequency of becoming positive for Listeria
and antibody level
Frequency N=77 EU (range) S
1 11 2.3 (1.8-2.7) 0.3
2 12 2.12 (1.76-2.63) 0.29
3 17 1.97 (1.36-2.7) 0.38
4 23 1.97 (1.46-2.5) 0.25
5 9 1.91 (1.08-2.4) 0.4
6* 2 2.2 (2.14-2.3) 0.1
7* 2 2.05(1.9-2.2) 0.2
N number of cows tested, EU mean log ELISA Unit, S standard deviation, * the difference between the
mean values were significant when these were excluded
There was no association between age and ELISA results (Table 5. 12). However,
there was a non significant positive correlation between age and antibody level
(Correlation coefficient 0.16, 95% CL -0.06-0.37). When animals were grouped by
age the animals under the age 5 (47 of 77 animals) had ELISA values of 2.02 (1.3-2.6)
and the animals over the age of 5 (30 of 77 animals) had similar ELISA values of 2.06
(1.1-2.7).
Table 5. 12. Relationship between age and antibody level
Age N=77 EU* (range) S
3 15 1.92 (1.36-2.5) 0.3
4 20 2.02 (1.48-2.6) 0.3
5 12 2.2 (1.86-2.5) 0.2
6 9 2.1 (1.6-2.7) 0.3
7 9 2.04 (1.08-2.4) 0.3
8 3 1.9 (1.76-2.15) 0.2
9 6 1.9 (1.08-2.4) 0.5
10 3 2.3 (2.05-2.73) 0.4
N number of cows tested, EU* mean log ELISA Unit, S standard deviation
5. 4. Discussion :
152

The primary aim of this pilot study was to develop and standardise techniques
which would allow cattle infected with L. monocytogenes to be detected in a
longitudinal study.
A three stage procedure, cold enrichment prior to LSEB (Lovett and others
1987) and LSA (Curtis and others 1989a) was used to identify animals shedding
Listeria spp. in their faeces. No comparison of LSEB and LSA was made with any other
Listeria isolation media. However the superiority of LSEB and especially LSA has been
acknowledged by other researchers. LSA was found to be more effective in isolating L.
monocytogenes from artificially seeded clinical specimen such as faeces and vaginal
swabs (Curtis and others 1989a) and from food (Tiwari and Aldenrath 1990, Curtis and
Lee 1995) but less effective in isolating the bacteria from silage (Fernandez-Garayzabal
and others 1992b) Cold enrichment was also reported to be inefficient in isolating L.
monocytogenes from food (Pini and Gilbert 1988), faecal samples (Hayes and others
1991) and autopsy material (Eld and others 1993) when compared with liquid selective
enrichment at higher temperatures. The variability between the isolation techniques and
the failure of our attempts to isolate L. monocytogenes from faeces without exposure to
cold storage led us to combine cold enrichment with selective enrichment and selective
plating at higher temperature. This application enabled us to identify more Listeria
positive samples. This is in agreement with other findings. The successful use of cold
enrichment followed by selective media and plating at higher temperature for the
isolation of L. monocytogenes from food by Lewis and Corry (1991) and clinical
specimens by Gray (1948) and Pittman and others (1967), and for epidemiological
investigation by Husu (1990) has been reported.
In conventional cold enrichment procedures a liquid medium (selective or non
selective) has always been used (Gray and Killinger 1966 and Hayes and others, 1991).
The use of NB, Saline and LSEB as cold enrichment media failed to improve the
153

frequency of isolation of L. monocytogenes from faeces when compared with the
samples held at 4 0 C without any medium. Both NB and LSEB increased the number of
positive samples after the first week of cold enrichment but there was no further
increase during the cold enrichment period. In contrast, the use of saline as a cold
enrichment medium had an adverse effect on the growth of Listeria organisms. A
similar effect of saline was stated by Gray and Killinger (1966).
Our results indicate that holding faecal samples at refrigeration temperature
without any liquid media was the better application. The duration of cold enrichment
used by other researchers varied between 1 to several months (Gray 1948, Pittman and
others 1967). We attempted to reduce this time by determining the sensitivity of the
isolation technique at different times of cold enrichment. The best result was obtained
after 7 weeks of cold enrichment when the sensitivity was 100% and 94% for Listeria
spp. and L. monocytogenes respectively.
Investigation of the lowest limit of detection revealed that it was 3.17 cfu/ml for
broth spiked with Listeria organisms and 7 cfu/g for the known Listeria positive faeces
sample. The difference between the two figures could be explained with the nature of
samples as the faecal sample would contain many more bacteria other than Listeria.
After the second week of cold enrichment of faecal samples inoculated with 3.17x10 -1
cfu/ml of L. monocytogenes revealed growth. This supports the idea that cold
enrichment favours the multiplication of Listeria organisms (Gray and Killinger 1966).
This pilot study revealed some preliminary information about the behaviour of
Listeria spp. especially L. monocytogenes. Unlike other researchers we found a very
high excretion level of Listeria spp. and more importantly L. monocytogenes (Skovgaar
and Morgen 1988, Husu 1990). There was also a seasonal pattern of excretion which
coincided with silage feeding, housing and the seasonal occurrence of clinical listeriosis
(Chapter 2). This seasonal variation may have been the result of different feeding
154

practices during the indoor and outdoor periods. Housing may have also played an
important role in the higher excretion rates. In this study it was impossible to
differentiate the effect of these two practices. Both changed at the same time.
No apparent association between age and monthly excretion rate was observed.
However there was a statistically significant association between age and frequency of
detection of the organism. Younger animals shed the organism more frequently than
older animals. This concurs with experimental findings in which it has been shown that
younger animals excrete L. monocytogenes in their faeces for longer period than older
animals (Miettinen and Husu 1991).
In this study the ELISA assay was optimised by carrying out coating with
different concentrations of antigen and at different temperatures and inserting an extra
step to avoid non-specific binding. The specificity of the ELISA assay using different
antigens demonstrated that LLO and antibody binding was specific; antibody activity
was absorbed using LLO, culture supernatant and heat killed organisms. The absorption
of antibody activity using heat killed organisms was surprising because LLO is not
considered to be a cell associated antigen. This result probably reflects the fact that the
heat killed bacteria was prepared from unwashed organisms which contained LLO.
In this study serum samples were collected once and that was at the end of the
silage feeding and housing period. The results indicate that all animals tested seemed to
have antibodies to L. monocytogenes and this supports the results of our bacteriological
investigations. However, it was not possible to determine whether there were animals
exposed to L. monocytogenes before silage feeding or winter housing commenced.
In the following chapter the optimised and standardised culture and ELISA
techniques were used to identify animals infected with L. monocytogenes in a
longitudinal survey.
155

CHAPTER 6
A study of the dynamic of infection with Listeria
6. 1. Introduction:
monocytogenes, in herds of milking cows
L. monocytogenes is ubiquitous in the environment and it is frequently isolated
from healthy or diseased individuals (Gray and Killinger 1966, Farber and Paterkins
1991). One of the routes of transmission of L. monocytogenes infections in people is
the ingestion of contaminated food. Many outbreaks and sporadic cases of Listeriosis
follow the consumption of contaminated foodstuffs (Blenden and others 1987, Ralovich
1987, Lund 1990, Broome and others 1990, Farber and Paterkins1991, McLauchlin
1996).
Contamination can occur at the primary production stage (at farm level), at the
processing stage (factories, slaughterhouses, etc.) or alternatively after the processing
stage (at home, retailers etc.). Many studies have been carried out to determine the
degree of contamination with L. monocytogenes and its isolation pattern at all of these
stages (Fenlon and Wilson 1989, Carosella 1990, Husu and others 1990b, Greenwood
and others 1991, Jacquet and others 1993, Fenlon and others 1995a, Fenlon and others
1996). Studies have also revealed that different strains of L. monocytogenes may be
better adapted to different stages of production and processing (Greenwood and others
157

1991, Boerlin and Piffaretti 1991, Norrung and Skovgaard 1993, Fenlon and others
1996).
At the primary production stage silage has long been associated with L.
monocytogenes infection and is thought to be the source of the organism (Gill 1933,
Gray 1960a, Gray and Killinger 1966, Fenlon 1985, Gitter 1989). The contamination of
the agricultural ecosystem with L. monocytogenes is well documented and L.
monocytogenes is thought to be a saprophytic organism living in a plant-soil
environment (Welshimer 1968, Welshimer and Donker-Voet 1971, Welshimer 1975,
Weis and Seeliger 1975, Watkins and Sleath 1981, van Renterghem and others 1991,
MacGowan and others 1994). Carrier humans and animals are thought to play an
essential role in the contamination of their environment (vegetation, soil, water etc.) and
therefore foodstuffs. However the primary source of contamination is unknown
although it has been the subject of research for many years.
Research has been carried out to determine the excretion rate in humans
(Kampelmacher and van Noorle-Jansen 1969, Lamont and Postlethwaite 1986,
MacGowan and others 1991, Gray and others 1993, MacGowan and others 1994), sheep
(Gronstol 1979b), wild and domesticated birds, (Fenlon 1985, Skovgaard and Morgen
1988, Idia and others 1991, Casanovas and others 1995) pigs, cats, dogs (Iida and others
1991, van Renterghem and others 1991) and cattle (Kampelmacher and van Noorle-
Jansen 1969, Hofer 1983, Skovgaard and Morgen 1988, Husu 1990, Iiada and others
1991, van Renterghem and others 1991, Ueno and others 1996,). These studies have
reported considerable variation in the proportion of animals excreting L.
monocytogenes in their faeces, from 0% in cats (Iida and others 1991) to 64% in sheep
(Gronstol 1979b). The proportions reported for cattle vary between 1.9% (Iida and
others 1991) and 51% (Skovgaard and Morgen 1988). However little attention has been
paid to rigorous epidemiological sampling strategies in the design of these studies.
158

There were no sample size calculations and the studies involved different study
populations. Some studies involved sampling from slaughterhouses (Hofer 1983, van
Renterghem and others 1991) others from freshly excreted cow pats on the farm
(Skovgaard and Morgen 1988). In only three studies was the source of the organism
investigated (Skovgaard and Morgen 1988, Husu 1990, Ueno and others 1995) and in
only two of these was it done by comparing environmental and animal isolates of L.
monocytogenes on the same farms using serotyping and phagetyping methods. The
same strains have been identified in both environmental and animal isolates (Skovgaard
and Morgen 1988 and Ueno and others 1995). But the usefulness of these techniques
has already been disputed by some researchers (Seeliger and Hohne 1979, Ralovich
1993).
Animal derived foodstuffs such as soft cheese have been implicated in human
Listeriosis in England (McLauchlin 1996) and studies have been carried out to
determine the contamination of these products with L. monocytogenes (Greenwood and
others 1991, MacGowan and others 1994). But there have been no studies to determine
carriage rate of Listeria spp. and L. monocytogenes in dairy cattle in England and little
is known about the contamination of their environment.
In a pilot study carried out between September 1994-August 1995 involving
only one dairy farm, a large proportion of animals were found to be excreting Listeria
spp. and L. monocytogenes in their faeces (Chapter 5). However it is known that
differences occur in excretion rate within and between farms (Kampelmacher and van
Noorle Jansen 1969, Skovgaard and Morgen 1988). A longitudinal study was therefore
designed to include five dairy farms in order to investigate the infection rate of L.
monocytogenes in individual milking cows over a 10 month period. Infection was
assessed using bacteriological and serological methods. Factors which might be
159

associated with the infection rate were measured and individual isolates of L.
monocytogenes were identified using molecular typing methods.
6. 2. Materials and Methods:
6. 2. 1. Study Design:
The dairy herds studied in this part of the project were selected from those
served by the Farm Animal Practice of the Faculty of Veterinary Medicine, University
of Liverpool. Initially an explanatory letter was written to all the dairy farmers in the
practice (Appendix 5). Phone calls were made to the same clients to arrange a meeting
to explain what the study would involve, to discuss the project in more details and to
obtain information about their farming practices such as herd size, milking routines,
feeding regimes, housing, and handling facilities. After this process five dairy herds
were selected for the study.
6. 2. 2. Farm Management:
All five farms had similar farming practices; (Table 6. 1) all kept Holstein
milking cows which were milked twice a day (morning and evening) and milk was
stored in a bulk tank until collection. Milk was collected daily on all farms. The cattle
were housed in winter in cubicle houses on straw bedding. Pastures were only grazed by
cows. Grass silage was fed to animals on all farms. On Farms B and E it was fed all
year around and on Farms A, B, and E maize silage was also fed. The cows were also
fed concentrates at milking.
The farmers were interviewed using a questionnaire (Appendix 5) in order to
find out more details about their animals and to record changes in management practices
which took place during the study.
160

4 of the farms had their silage analysed (Table 6. 2). Information on the age of
milking cows was available for three farms (Farms A, B and C) (Table 6. 3).
Table 6. 1. The management practices followed by the five farms
Farm A Farm B Farm C Farm D Farm E
type of herd closed closed closed open open
herd size a 110 90 60 130 160
time of calving all year all year all year all year all year
type of housing cubicles
straw yard
cubicles cubicles cubicles cubicles
start of grass silage 21.9.96 all year 5.10.96 10.11.96 b all year
start of maize
silage
4.1.97 14.10.96 NF NF 30.10.96
start of housing 15.10.96 8.11.96 30.10.96 24.11.96 30.10.96
end of grass silage 30.4.97 all year 30.4.97 1.4.97 all year
end of maize silage 31.3.97 continued d NF NF 30.3.97
end of housing 31.3.97 23.4.97 30.4.97 12.4.97 30.3.97
storage of silage clamp clamp clamp clamp clamp
additives in silage N Y Y Y Y
dung c Y Y Y Y Y
history of
listeriosis
Y N Y N N
a the numbers changed over the period of study, b mix of grass silage and whole wheat crops and bought
in grass silage in February, c dung spread on the field where animals grazed or silage was made from, d
still being fed when the study finished, NF not fed, Y yes, N no
Table 6. 2. Results of forage analysis
Farm A* Farm B Farm C Farm E
GS MS MS C1 C2 C1 C2 GS MS
pH 4.3 4.0 3.5 3.5 3.4 4.3 4.4 4.4 4.0
Ash (%) 7.7 3.5 NK 11.1 8.2 7.0 8.1 9 10
161

DM (%) 23.8 46.0 25.9 21.1 23.2 27.5 27.4 39.5 34.0
D (%) 65.1 78.9 NK 65.8 71.0 NK NK 62.9 69.4
ME (MJ/kg) 10.4 12.4 12.7 11.4 11.4 10.4 10.1 10.1 10.9
GS grass silage, MS maize silage, C1 first cut, C2 second cut, DM dry matter, D digestibilty value, ME
metabolisable energy,* no data available for the Farm D, NK not known.
Table 6. 3. Age distribution of animals on the farms A, B and C
Age* Farm A
Number of animals
Farm B* Farm C*
2 5 5 6
3 25 30 1
4 26 24 1
5 13 15 6
6 12 12 4
7 18 9 5
8 6 3 5
9 5 3 3
10 6 1 4
11 4 4 1
12 1 3 1
13 @ 3 1 4
* age records were not available for some animals and for the farm D and E , @ 13 and greater
6. 2. 3. Sample size:
The sample size required to detect the minimum level of excretion was
calculated from the figure obtained during our pilot study where the lowest excretion
rate was 1.8%. As nearly as all the animals on the farms needed to be sampled in order
to detect this excretion rate with 95% confidence limit (Canon and Roe 1982), it was
decided, for convenience, to sample the whole milking herd.
6. 2. 4. Sampling procedure:
162

a) Faecal samples: Faecal samples were collected freshly from the rectum of animals
and immediately transferred to sterile 60ml universal containers (Sterilin, Staffordshire,
UK). Individual disposable rectal examination gloves (Arnolds, Shropshire UK) and a
lubricant (Lubrel, Arnolds, Shropshire UK) were used for each sampling. Samples were
taken monthly from all milking cows and dry cows present at the time of visit (Table 6.
4). Since cows were leaving and entering the milking herd on all farms during the
survey the frequency of sampling is given in the Table 6. 5.
Table 6. 4. Date of visits and number of animals sampled
Farm A Farm B Farm C Farm D Farm E
Visit D N D N D N D N D N
1 12/8/96 111 14/8/96 90 19/8/96 58 16/8/96 126 21/8/96 141
2 9/9/96 110 11/9/96 96 20/9/96 58 13/9/96 124 19/9/96 138
3 15/10/96 110 9/10/96 95 18/10/96 57 11/10/96 126 17/10/96 155
4 18/11/96 83 13/11/96 78 25/11/96 53 15/11/96 128 27/11/96 145
5 13/12/96 83 11/12/96 79 18/12/96 57 16/12/96 121 20/12/96 139
6 13/1/97 83 15/1/97 80 16/1/97 56 20/1/97 135 23/1/97 128
7 10/2/97 89 12/2/97 81 13/2/97 53 17/2/97 132 20/2/97 135
8 10/3/97 85 12/3/97 80 13/3/97 53 17/3/97 120 20/3/97 155
9 14/4/97 84 16/4/97 81 24/4/97 53 21/4/97 111 1/5/97 158
10 12/5/97 91 14/5/97 78 15/5/97 55 19/5/97 102 ND ND
D = date of visit, N= number of animals sampled, ND = not done
Table 6. 5. Number of animals tested on more than one occasion
Frequency of Number of animals tested
Sampling Farm A Farm B Farm C Farm D Farm E
1 8 2 2 17 11
2 0 5 0 25 13
3 27 18 7 26 12
4 6 5 1 13 15
5 0 0 1 12 21
6 0 8 5 10 29
163

7 4 1 2 21 31
8 1 8 2 9 42
9 0 9 6 10 37
10 78 60 41 59 ND
Total 124 111 67 202 211
ND =not done
b) Environmental samples: Samples of soil, grass, water, silage, bedding and milk were
collected monthly from each farm. Samples of soil and grass were collected from
pastures where animals grazed and where silage was made using the sampling scheme
shown in the Figure 6. 1. During pasture sampling maximum care was taken to avoid
cross-contact between grass and soil. The samples were placed in separate bags.
Silage samples were taken from the clamp face using the same sampling
procedure as that for soil and grass. An individual rectal glove was used for each
sample.
During the housing period bedding samples were also collected monthly from
the cubicles and straw yards.
Water samples were collected monthly from troughs located in the houses, yards
and fields. Monthly bulk tank milk samples were also taken. Sterile 60 ml pots were
used to take water and milk samples.
Figure 6. 1. The scheme followed for the collection of environmental samples
3 7 11
• • •
•2 • 4 • 6 • 8 •10
164

• • •
1 5 9
6. 2. 5. Sample preparation and processing:
Soil, grass, bedding and silage samples were treated as follows; each sample was
first pooled in a sterile bag and mixed well then homogenised in LSEB using a
stomacher (Seward Medical, London, UK) at normal speed for 2 minutes and then the
mixture was transferred to at least three sterile pots. The samples were cultured
immediately and stored at refrigeration temperatures for further culturing as explained
in the Chapter 5.
6. 2. 6. Measurement of serum antibody to Listeria monocytogenes
An ELISA was used to measure serum antibody as described in Chapter 5. Cows
were bled during the first, 5th and last visit i.e. at the start, in the middle and at the end
of the study period. The date of the visits and number of samples taken are given in the
Table 6. 6. The three samples of serum collected from each animal were tested on the
same plate at a 1:50 dilution. Doubling dilutions of a positive (standard) control (goat
hyperimmun serum) and a negative control (fetal calf serum) were used for each plate at
dilutions from 1:50 to 1:6400. A serum sample was considered positive if the optical
density value at 405nm was equal to or greater than three times that of the negative
control serum.
The difference in antibody level between first and second, first and third and
second and third collections was investigated in the following way. The differences
between the OD values measured at each point were calculated for each animal.
165

Negative values (i.e. a decrease in OD values) and positive values (i.e. an increase in
OD values between the two sampling points) were obtained. The maximum positive or
negative changes in OD on each farm were then selected and the lower of these was
taken as the cut off point. Animals with values above this cut off point were then
considered to have undergone a change in antibody level. Antibody levels increased on
some farms and decreased on others.
The plate lay out and the ELISA results are presented in the appendix 6.
Table 6. 6. Dates and numbers of blood samples collected
farm A Farm B Farm C Farm D Farm E
date n date n date n date n date n
1 12/8/96 109 14/8/96 96 19/8/96 61 16/8/96 122 21/8/96 141
2 13/12/96 83 11/12/96 78 18/12/96 55 16/12/98 119 20/12/96 136
3 12/5/97 85 14/5/97 81 15/5/97 54 19/5/97 106 1/5/97 157
n number of samples
6. 2. 7. Investigation of source of the bacteria :
Random amplified polymorphic DNA (RAPD) technique was used to identify
individual isolates of L. monocytogenes. This method was adapted from that described
by MacGowan and others (1993) and O`Donoghue and others (1995). The method was
standardised by using a single bacterial colony for the DNA extraction, standardising
the DNA extraction method, testing the primers ability to differentiate the different
species and finally testing the repeatability of RAPD.
(i) Selection of isolates for RAPD:
166

A total of 944 isolates of L. monocytogenes were obtained over the study
period, because of limitations of time and resources it was impossible to examine all
isolates. A selected number of isolates were therefore tested. All the isolates of L.
monocytogenes from environmental samples (soil, grass, water, bedding, silage) and
milk which were recovered following storage were examined. Faecal isolates recovered
from the first three visits were examined to determine the “strains” present prior to
housing. A representative number of isolates obtained at the visit when the highest
number of animals excreted L. monocytogenes (10% of isolates were randomly selected
where the number of isolates exceeded 10) was taken to determine the isolates present
at the peak of infection. The number and the origin of the animal isolates examined are
given in Table 6. 19.
(ii) L. monocytogenes isolates and culture conditions
All L. monocytogenes isolates used in RAPD were maintained on preservative
beads (TSC, Lancashire, UK) at -20 0 C. Listeria cultures were prepared by inoculating
1-2 beads into 5ml of non-selective broth (peptone water (PW) or LEB with no
antibiotic supplement, Appendix 3) to allow injured organisms to recover and
incubating at 37 0 C overnight. This mixture was transferred to LSEB and incubated
overnight at 37 0 C. A loopful of this broth was then streaked on to 5% SBA and the
plates were incubated at 37 0 C overnight in order to recheck the haemolytic activity of
isolates. A colony was sub-cultured on SBA at 37 0 C overnight. The purity of the plate
was evaluated by further sub-culturing a single haemolytic colony on to SBA at 37 0 C
for 24 hours.
(iii) DNA extraction:
167

A single colony was picked off a culture plate and put into 5ml of sterile LEB
with no antibiotic supplement and incubated at 37 0 C overnight. The culture was
harvested by centrifugation for 5 minutes at 2500 g. The pellet was washed twice with
sterile distilled water and then suspended in 150μl sterile distilled water, boiled for 4
minutes and centrifuged at 1300xg for 30 seconds. The supernatant was used as
template DNA. No attempt was made to quantify the amount of DNA but the total
number of bacteria used to extract DNA was calculated as approximately 4x10 7 cfu/ml.
This was calculated as explained earlier. The same culture conditions and methods were
used prior to DNA extraction so as to standardise the number of bacteria used for
extraction.
(iv) DNA primers:
The primers (primer Universal, 2, 3, 4, 5 and 6) were obtained from the
Department of Medical Microbiology, Southmead Health Services NHS Trust, Bristol.
The primers and their DNA sequence are given below.
Primer -mer DNA Sequence
universal 21 TTATGTAAAACGACGGCCACT
primer 2 21 ATCTGCAGCTGAACGGTCTGG
primer 3 20 CAGAATTCATGCCACGTCCC
primer 4 20 GGGCGTTGTCGGTGTTCATG
primer 5 20 ACAGGTCCAACAAAAGCTGG
primer 6 19 AACAGCACTCTGTTCAGGC
(v) RAPD amplification conditions:
DNA amplification reactions were performed in a reaction mixture containing;
10mM Tris-HCl, pH 9.0, 1.5mM MgCl2, 50mM KCl, gelatin 0.1% w/v, Triton X100
0.1% w/v, 200μM each of dATP, dGTP, dTTP and dCTP (Pharmacia, Hertfordshire,
168

UK), 0.5μM DNA primer, 1 unit Supertaq DNA polymerase (Stratech Scientific,
Cambridge, UK) and 10μl of cell supernatant (final volume 50μl). Single primer
(Cruachem Ltd., Glasgow UK), at concentration of 25μM, was added to each reaction
mixture which was then overlaid with 3-4 drops of liquid paraffin. The mixture was
then placed in a PCR Thermal Reactor (Hybaid, Middlesex, UK) with temperature
programming as follows;
-one cycle at 94 0 C for 3 minutes to denature template DNA,
-four low stringency cycles at 94 0 C for 45 seconds, 26 0 C for 2 minutes, and 72 0 C for 2
minutes with ramp setting of 2, to anneal template DNA and primer,
-thirty cycles at 94 0 C for 45 seconds, 36 0 C for 1 minute, 72 0 C for 2minutes with ramp
default setting,
-finally one cycle at 72 0 C for 5 minutes to extend the reaction with Taq polymerase.
(vi) Test repeatability:
The repeatability of the test was evaluated by using 2 isolates of L.
monocytogenes and 1 isolate of L. innocua in the test on two occasion using the same
procedure.
(vii) Analysis of PCR product:
The PCR products were analysed by electrophoresis in 1% w/v agarose with
TBE buffer (0.089M Tris base, 0.089M orthoboric acid, 0.002M EDTA, pH8.0). 2μl of
loading buffer (containing bromophenol blue 0.25% w/v and sucrose 40% w/v in
distilled water) was added to 10μl of final PCR product and mixed well. 10μl of this
mixture was loaded onto the gel and run at 100-115 volts for about 2-3 hours. The gel
was then soaked in ethidium bromide (0.5mg/L) for about 30 minutes the bands
169

visualised over a UV-Transilluminator. Results were recorded on Polaroid type 665
instant positive/negative film (Polaroid, Hertfordshire, UK).
6. 2. 8. Data analysis:
In estimating the effect of silage feeding and housing on the overall excretion of
Listeria spp. and L. monocytogenes, all animals examined (i.e. animals left or entered
the milking herd included) before, during and after silage feeding and housing were
taken into account and then the proportions of animals positive for the organism before,
during and after housing and silage feeding were estimated and compared.
All data were entered onto a database (Microsoft Access 2, Simpson 1994) and
analysed using Epi-info version 6 (Dean and others 1994). A Yates corrected chi
squared test was used to compare the differences between proportions. A Kruskal-
Wallis test was used to compare the differences between median values (Dean and
others 1994). A probability of P< 0.05 was accepted as statistically significant.
6. 3. Results:
6. 3. 1. Bacteriology :
Farm A:
a) Faecal samples:
A total of 124 milking cows were examined on this farm. Of these, 72.6%
(90/124) shed L. monocytogenes and 1.6% (2/124) other species of Listeria. Animals
170

entered and left the herd over the study period, so that only 78 (62.9%) animals were
examined at all visits and the rest (37.1%) were either removed from or included in the
herd at different times during the survey (Table 6. 5). All 78 milking cows shed L.
monocytogenes at some stage during the study.
The proportion of milking cows excreting Listeria spp. varied between 1% in
September to 96.5% in March (Figure 6. 2). The highest frequencies of excretion were
observed between November and April inclusive. A similar pattern of excretion was
observed for L. monocytogenes (1% in September and 90% in February). The
proportion of animals excreting L. innocua gradually increased and reached the highest
level in December (Figure 6. 2).
The difference between the months was statistically significant (P

100
%
90
80
70
60
50
40
30
20
10
0
L.spp Lm
Li Ls
A S O N D J F M A M
172

Table 6. 7. Monthly frequency of excretion of Listeria spp. and L. monocytogenes in milking cows.
Visits
L spp
(%)
August (A) 5/111
(4.5)
September (S) 1/110
(1)
October (O) 9/110
(8.2)
November (N) 33/83
(39.8)
December (D) 67/83
(80.7)
January (J) 76/83
(91.6)
February (F) 85/89
(95.5)
March (M) 82/85
(96.5)
April (A) 80/84
(95.2)
May (M) 15/91
(16.5)
Farm A Farm B Farm C Farm D Farm E
L. m
(%)
5/111
(4.5)
1/110
(1)
5/110
(4.5)
11/83
(13.3)
21/83
(25.3)
54/83
(65.1)
80/89
(89.9)
67/85
(78.8)
71/84
(84.5)
13/91
(14.3)
L spp
(%)
12/90
(13.3)
10/96
(11.4)
48/95
(50.5)
66/78
(84.6)
43/79
(54.4)
77/80
(96.3)
78/81
(96.3)
61/80
(76.3)
40/81
(49.4)
47/78
(60.2)
L. m
(%)
7/90
(7.7)
6/96
(7.3)
2/95
(2.1)
39/78
(50)
7/79
(8.9)
45/80
(56.3)
69/81
(81.5)
11/80
(13.9)
17/81
(20.9)
11/78
(14.1)
L spp
(%)
3/58
(5.1)
4/58
(6.9)
3/57
(5.3)
28/53
(52.8)
10/57
(17.5)
9/56
(16.1)
4/53
(7.5)
20/53
(37.7)
19/55
(34.5)
1/55
(1.9)
L. m
(%)
1/58
(1.7)
4/58
(6.9)
1/57
(1.8)
1/53
(1.9)
1/57
(1.8)
1/56
(1.9)
L. spp
(%)
2/126
(1.6)
10/128
(8.1)
30/126
(23.8)
1/128
(0.8)
1/121
(0.8)
0 2/132
(1.5)
18/53
(33.9)
1/55
(1.9)
L. m
(%)
L spp
(%)
0 20/141
(14.2)
9/128
(7.0)
27/126
(21.4)
7/138
(5.1)
18/155
(11.6)
0 125/145
(86.2)
1/121
(0.8)
130/139
(93.5)
0 0 107/128
(83.6)
52/120
(43.3)
30/111
(27)
0 6/102
(5.9)
1/132
(0.8)
24/120
(20)
2/111
(2.7)
101/135
(74.8)
123/155
(79.4)
44/158
(27.8)
L. m
(%)
11/141
(7.8)
3/138
(2.2)
6/155
(3.9)
49/145
(33.8)
93/139
(66.9)
62/128
(48.3)
34 (25.4)
40/155
(25.8)
13/158
(8.2)
0 ND ND
P value*

On this farm, grass silage was introduced in September 12 days after the visit
(9/9/1996). By the October visit the proportion of animals shedding Listeria spp. and L.
monocytogenes had increased slightly but was similar to that seen in August before
silage feeding. The cows were housed on the same day as the October visit and by the
November visit the proportion of animals shedding Listeria spp. had increased
significantly. This was mainly due to an increase in the number of animals shedding L.
innocua. The proportion of animals shedding L. monocytogenes continued to increase
in December and showed a significant increase in January 9 days after the introduction
of maize silage. Maize silage feeding ended at the end of March, 14 days before the
April visit and this was also the time when animals were turned out. The proportion of
animals shedding L. monocytogenes was still high in April but it dramatically
decreased in May 12 days after grass silage feeding ended.
The total proportion of examined animals excreting Listeria spp. before (5.4%,
6/111) and after (16.5%, 15/91) grass silage feeding was significantly lower than the
proportion obtained during grass silage feeding (76.9%, 90/117) (p

Table 6. 8. The relationship between silage feeding and housing on the overall excretion of Listeria spp. and L. monocytogenes.
Listeria spp. L monocytogenes
Farm A before during after P value before during after P value
grass silage 6/111 (5.4) 90/117 (76.9) 15/91 (16.5)

The mean age of herd was 5.6 (range 2-14). The relationship between age and
Listeria excretion was investigated by comparing the mean age of cows excreting
Listeria in their faeces with non-excretors. Age had no effect on faecal excretion each
month (Table 6. 9) but the cows excreting Listeria spp. were always younger than non-
excretors. When all the animals examined during the study were taken into account
there was a significant effect of age on Listeria excretion. The mean age of Listeria
shedders was 5 years while it was 7.5 years in non-shedders. This difference was
statistically significant (p

(MA) mean age, (n) number, (R) range, NA not applicable.
Table 6. 10. The effect of age on the excretion of Listeria spp. and Listeria
monocytogenes.
Farm A
N MA (years) Range P Value
Listeria spp. +ve 32 7.5 2-14
-ve 92 5 3-9

Table 6. 11. Isolation of Listeria spp. from the environment on Farm A.
Months
Samples A S O N D J F M A M
Soil 0 0 0 0 Li 0 Li 0 0 0
Grass 0 0 Lm Lm Li 0 Lm 0 Lm Lm
Water 0 0 Lm Li Lm Lm Lm Lm Lm 0
Milk 0 0 0 0 0 Li Li Lm Lm ND
G. Silage NF NF Li 0 Li Li Lm Lm Lm NF
M. Silage NF NF NF NF NF Lm Lm Ls Lm NF
Bedding NH NH NH Lm Lm Li Lm Lm Lm NH
Lm L. monocytogenes, Li L. innocua, Ls L. seeligeri, ND not done, NF not fed, NH not housed.
Farm B:
a) Faecal samples:
A total of 111 animals were examined throughout the study period. 79.3%
(88/111) of the animals excreted L. monocytogenes, 7.2% (8/111) other Listeria spp.
and the rest did not shed Listeria (14.4%, 15/111) during their participation in the study.
Only 54.1% (60/111) of the milking cows were examined at all visits. When only these
animals were taken into account, the proportion of animals shedding L. monocytogenes
was 98.3% (59/60). The remaining animal shed another species of Listeria.
The monthly proportion of animals shedding Listeria spp. varied from 11.4 % in
September to 96.3% in January. A higher proportion of animals were shedding Listeria
organisms in their faeces between October and May with a peak of 96.3% in January
and February. For L. monocytogenes and L. innocua there was a fluctuating rise. The
highest proportion of animals excreting L. monocytogenes and L. innocua was in
February (81.8%) and March (62.5%) respectively. The proportion decreased thereafter
(Figure 6. 3). There was statistically a significant difference between the monthly
178

frequency of excretion (P

housed for 5 days. The proportion of animals shedding Listeria spp. fell in December
and this was mainly due to the decline in cows shedding L. monocytogenes. It rose
again in January associated with an increase in the proportion of animals shedding L.
monocytogenes. The latter reached a peak in February and fell to low level in March
This fall preceded the end of winter housing. Maize silage continued beyond the end of
the study.
The effect of age on excretion was similar to the Farm A (Table 6. 9). The mean
age of cows that were excreting Listeria spp. was lower than non-excretors (Table 6.
10).
b) Environmental samples:
Both L. innocua and L. monocytogenes were isolated from all environmental
samples and milk. L. monocytogenes was isolated from one environmental sample each
month with the exception of October. In February L monocytogenes was detected in all
the environmental samples except grass silage and milk. This was also the time when
the highest proportion of animals were excreting L. monocytogenes (Table 6. 12).
Table 6. 12. Isolation of Listeria spp. from the environment on Farm B.
VISITS
Samples A S O N D J F M A M
Soil 0 0 0 0 Li 0 Lm Li Lm Lm
Grass 0 Lm 0 Li Li 0 Lm Li 0 Lm
Water 0 Lm Li 0 Lm Li Lm Li 0 Li
Milk Lm Li 0 0 0 0 0 0 0 0
G. Silage 0 Lm Li Li Li Li Li Li Li ND
M. Silage NF NF NF Li 0 Lm Lm Lm Lm ND
Bedding NH NH Li Lm Li Lm Lm Li Lm NH
Lm L. monocytogenes, Li L. innocua, Ls L. seeligeri, ND not done, NF not fed, NH not housed.
180

There was no evidence from this farm that grass silage feeding alone was
associated with a high frequency of faecal shedding of Listeria. Grass silage was fed all
year round and in October L. monocytogenes was isolated from it at a time when the
proportion of animals shedding this organism was low.
There was a dramatic increase in the proportion of animals shedding L.
monocytogenes in November but it was difficult to attribute this to any one
management factor as both the introduction of maize silage feeding and housing had
occurred. L. monocytogenes was only isolated from bedding at the November visit.
The peak prevalence of L. monocytogenes excretion in February corresponded
with the highest frequency of recovery from food and environmental samples This was
also the case for L. innocua in March.
The proportion of animals shedding L. monocytogenes declined in March at a
time when maize silage from which L. monocytogenes had been isolated was still being
fed. This continued to be the case in April.
this farm.
Farm C:
L. monocytogenes was isolated from the liver of an aborted foetus in January on
a) Faecal samples:
67 milking cows were examined. 37.3% (25/67) of them shed L.
monocytogenes, 25.4% (17/67) L. innocua and 6.0% (4/67) L. seeligeri. Listeria spp.
were not isolated from the remainder (31.3%, 21/67) during their stay in the herd. When
the animals that left or entered the herd during the study were excluded only 41 (61.2%)
animals were consistently tested. Of these 46.3% (19/41) shed L. monocytogenes,
181

24.4% (10/41) L. innocua and 9.7% (4/41) L. seeligeri. No Listeria were isolated from
the remaining 24.4% (10/41).
The proportion of animals shedding Listeria spp. and L. monocytogenes
varied between 1.9% to 52.8% and 0 to 33.3% respectively. The highest proportion of
cows excreting Listeria spp. and L. monocytogenes was in November and March
respectively (Figure 6. 4). Grass silage was introduced 13 days before the October visit
but the proportion of animals shedding Listeria spp. remained low. The cattle were
housed 26 days before the November visit and by this time the proportion of animals
shedding Listeria spp. had increased to 52.8% (28/53). However the proportion of
animals shedding L. monocytogenes remained low throughout the winter months.
(Table 6. 1). The proportion of animals excreting L. monocytogenes in March was
significantly higher (P

) Environmental samples:
Both L. innocua and L. monocytogenes were isolated from environmental
samples but not from milk. L. monocytogenes and L. innocua were also isolated from
grass and soil during the period when animals were housed (Table 6. 13).
Figure 6. 4. The monthly faecal excretion of Listeria spp. and L. monocytogenes on
Farm C.
100
%
90
80
70
60
50
40
30
20
10
0
L.spp Lm
Li Ls
A S O N D J F M A M
Table 6. 13. Isolation of Listeria spp. from the environment on Farm C.
VISITS
Samples A S O N D J F M A M
Soil 0 0 0 Li Lm 0 0 Li 0 0
Grass Lm 0 0 Li Li 0 Lm 0 0 0
Water 0 0 0 0 Li 0 Lm 0 0 Lm
Milk 0 0 0 0 0 0 0 0 0 0
Grass silage NF NF 0 Lm Lm Li Li Li 0 NF
Bedding NH NH NH Li Lm 0 Lm Li Li NH
Lm L. monocytogenes, Li L. innocua, Ls L. seeligeri, ND not done, NF not fed, NH not housed.
Farm D:
183

a) Faecal samples:
A total of 202 milking cows were examined on this farm. Of these 28.2%
(57/202) shed L. monocytogenes, 18.3 (37/202) L. innocua, 1.5% (3) L. seeligeri and
52% (105/202) no Listeria spp. During the period of the study only 29.2% (59/202)
milking cows were consistently sampled at each visit. The rest (70.2%, 143/202) were
either removed from or included in the milking herd during the survey, therefore were
sampled less frequently (Table 6. 5). Of these 59 animals, 40.7% shed L.
monocytogenes (24/59) 20.3% L innocua (12/59), 3.4% L. seeligeri (2/59) and the rest
(35.6% 21/59) did not excrete any species of Listeria.
When the frequency of excretion was estimated for each month the lowest rates
were observed between November and February inclusive, around 1% of animals shed
Listeria spp. and L. monocytogenes (Figure 6. 5). The highest proportion of animals
excreting Listeria spp. and L. monocytogenes were detected in March (43.3%, 52/120)
and October (21.4%, 27/126) respectively. These figures were significantly higher than
those obtained in other months (P

monocytogenes. By April the proportion of cows excreting L. monocytogenes had
fallen whereas the proportion excreting L. innocua was similar to that seen in March.
Grass silage feeding ended 20 days before the April sampling and winter housing also
ended 9 days before this visit (Table 6. 8). This farm had bought in silage three weeks
before the 8th visit (17/3/1997).
b) Environmental samples:
Listeria was not isolated from soil but L. innocua was isolated from water, grass
and bedding and L. monocytogenes was also isolated from grass, silage, bedding and
milk. Milk samples collected between October and March were persistently positive for
L. monocytogenes. L. seeligeri was isolated from bedding materials on one occasion.
(Table 6. 14). Concentrate bulk feed stored in a shed was sampled on one occasion and
L. monocytogenes was isolated from it.
Figure 6. 5. The monthly faecal excretion of Listeria spp. and L. monocytogenes on
Farm D.
185

%
100
90
80
70
60
50
40
30
20
10
0
L.spp Lm
Li Ls
A S O N D J F M A M
Table 6. 14. Isolation of Listeria spp. from the environment on Farm D.
Visits
Samples A S O N D J F M A M
Soil 0 0 0 0 0 0 0 0 0 0
Grass 0 0 Lm Lm 0 0 0 0 0 Li
Water Li 0 0 0 0 0 0 0 0 0
Milk 0 0 Lm Lm Lm Lm Lm Lm 0 0
Grass silage NF Lm 0 Lm 0 0 0 Lm NF NF
Bedding NH NH NH NH 0 Lm 0 Li Ls NH
Lm L. monocytogenes, Li L. innocua, Ls L. seeligeri, ND not done, NF not fed, NH not housed.
Farm E:
a) Faecal samples:
186

A total of 211 milking cows were examined. 10.9% (23/211) of the animals did
not excrete any species of Listeria, 73.9% (156/211) shed L. monocytogenes, 12.8%
(27/211) L. innocua and 2.4% (5/211) L. seeligeri during their participation in the
study. When the animals examined at all visits were taken into account only 37 animals
were tested, the rest either left or entered the study or not tested at some visits. Of these
37, L. monocytogenes was excreted by 35 milking cows and 2 animals shed L.
innocua.
There was difference in the frequency of excretion each month. The frequency
of excretion of Listeria spp. and L. monocytogenes varied from 5% in September to
95.6% in November (P

was higher during these practices. Similar results were found for L. monocytogenes
(Table 6. 8).
b) Environmental samples:
L. innocua was isolated from all environmental samples including milk on one
occasion but not from maize silage. L. seeligeri was isolated from soil, grass and on one
occasion from maize silage. L. monocytogenes was isolated from soil, grass, water,
grass silage, maize silage and bedding but not from milk. In December when the highest
frequency of excretion was seen, only L. monocytogenes was isolated from
environmental samples (water, grass silage, maize silage and bedding) (Table 6. 15).
Concentrate bulk feed stored in a shed was also sampled once and L. monocytogenes
was isolated.
Figure 6. 6. The monthly faecal excretion of Listeria spp. and L. monocytogenes on
Farm E.
188

100
%
90
80
70
60
50
40
30
20
10
0
L.spp Lm
Li Ls
A S O N D J F M A
Table 6. 15. Isolation of Listeria spp. from the environment on Farm E.
Visits
Samples A S O N D J F M M
Soil 0 0 Li Ls 0 Ls Lm 0 0
Grass 0 0 Li Li 0 Li Ls Li Lm
Water 0 0 0 Lm Lm Li Lm Li Li
Milk 0 0 0 0 0 0 0 Li 0
Grass silage 0 0 Lm Lm Lm Li 0 0 Lm
Maize
silage
NF NF NF Ls Lm 0 Lm 0 NF
Bedding NH NH NH Lm Lm Lm Lm Li Lm
Lm L. monocytogenes, Li L. innocua, Ls L. seeligeri, ND not done, NF not fed, NH not housed.
Overall:
189

The overall proportion of animals excreting Listeria spp. and L. monocytogenes
varied between the farms. The overall proportion of animals excreting Listeria spp. was
significantly higher on farm A, (74.2%, 92/124), B (86.5%, 96/111) and E (89.1%,
188/211) than on farm C (68.7%, 46/67) and D (48%, 97/202) (P

The number of new cases each month and the monthly incidence rate (i.e. the
number of new cases per 100 animal-months at risk) were calculated separately for each
farm (Table 6. 16 and Figure 6. 7).
On Farm A there was a gradual increase in incidence rate until all animals had
become infected. The maximum number of cases in any month occurred in January.
On Farm B there were two peaks; for the incidence rate these occurred in
November and February and for the number of new cases November and January.
December.
On Farm E there was a peak in the incidence rate and number of new cases in
On Farm C the incidence rate showed a small peak in March. The number of
new cases was small with a slight increase in September and highest in March.
On Farm D the incidence rate showed peaks in October and March and the
number of new cases follows a similar pattern.
When compared with management variables the data provide further support for
the association between maize silage feeding and faecal shedding seen using the
prevalence data. The introduction of maize silage in October on Farms B and E is
associated with rapid rise in the number of faecal shedders and incidence rate. On farm
A where maize silage was introduced in January the epidemic curve is less steep
between housing and the introduction of maize silage
Table 6. 16. Incidence rate of L. monocytogenes infection by month.
Visit Farm A (%) Farm B (%) Farm C (%) Farm D (%) Farm E (%)
191

August 5/111 (4.5) 7/90 (7.8) 1/58 (1.7) 0/126 (0) 11/141 (7.8)
September 1/105 (1) 7/89 (7.9) 4/57 (7) 9/124 (7.3) 3/129 (2.3)
October 3/104 (2.9) 1/82 (1.2) 0/52 (0) 26/118 (22) 6/141 (4.2)
November 10/75 (13.3) 33/65 (50.8) 1/48 (2.1) 0/99 (0) 44/128 (34.3)
December 16/65 (24.6) 2/37 (5.4) 1/51 (1.9) 1/96 (1) 58/87 (66.7)
January 33/49 (67.3) 20/36 (55.6) 1/49 (2) 0/110 (0) 15/28 (53.6)
February 18/22 (81.8) 13/18 (72.2) 0/45 (0) 0/107 (0) 8/29 (27.5)
March 2/3 (66.7) 0/8 (0) 16/46 (34.8) 19/97 (19.6) 5/37 (13.5)
April 1/1 (100) 2/10 (20) 0/31 (0) 2/70 (2.9) 5/40 (12.5)
May 1/7 (14.3) 2/7 (28.6) 0/31 (0) 0/65 (0) ND
ND= not done
Figure 6. 7. Monthly incidence rate of L. monocytogenes infection.
%
100
90
80
70
60
50
40
30
20
10
0
Farm A
Farm B
Farm C
Farm D
Farm E
A S O N D J F M A M
Environment:
Listeria spp. were isolated from the samples of soil, grass, water, grass silage,
maize silage and bedding on all farms with the exception of soil on farm D. L.
192

monocytogenes was also isolated from these samples with the exception of soil on
farms A and D and water on farm D.
Listeria spp. were isolated from bulk milk tank on 4 of the 5 farms and L.
monocytogenes was isolated from 3 farms (Farm A, B and D). L. monocytogenes was
persistently isolated from the bulk milk tank between October and March on farm D.
6. 3. 2. Serology
The results of ELISA assays for each farm are presented in the appendix 6.
There were only few animals that were seronegative at the beginning of the study. 0.9%
(1/109), 1% (1/96) and 1.6% (2/122) of animals were seronegative on farms A, B and D
respectively. There were no seronegative animals on farms C and E. The number of
animals that had increased or decreased level of antibodies to L. monocytogenes is
presented in the table 6. 17. A significant number of animals had increased antibodies
on the farm A after the first and second sampling and only few animals were found to
have increased or decreased antibodies on the other farms (Table 6.17).
Table 6. 17. Antibody changes during the period of the study
difference between
collections
first and second 32.9%
(27/82) i
second and third 30.8%
(24/78)i
first and third 42.8%
(33/77)i
Farm A Farm B Farm C Farm D Farm E
1.4%
(1/71)d
1.4%
(1/72)i
1.5%
(1/67)i
3.8%
(2/53)d
15.4%
(8/52)d
9.4%
(5/53)d
9.1%
(7/77)d
5.2%
(5/97)i
1.6
(1/64)d
1.1%
(1/87)i
1.5%
(1/65)d
2.2%
(2/93)d
i number of animals that had increased antibodies, d number of animals that had decreased antibodies
6. 3. 3. RAPD:
193

Repeatability of RAPD was evaluated by repeating the procedure on two
separate occasions. L. monocytogenes (2 strains) and L. innocua (1 strain) were used.
As it is shown in the Figure 6. 8 the same results were obtained on both occasions. The
ability of RAPD to differentiate between different species was also evaluated. For this 2
isolates of L. monocytogenes and an isolate of L. innocua were tested. The result
indicated that the two species were distinct from each other (Figure 6. 8). The results
obtained with all primers used in this study were the same, therefore only the results
obtained with the primer 5 are presented here (Figure 6. 9).
194

Table 6. 18 The isolates, their origin and their RAPD patterns with the primer 5.
Farm A visit* RAPD
Water 3 1
Grass 1 4 2
Maize silage 6 3
Milk 9 4
Grass silage 9 4
Animal 1 1 5
Animal 2 1 5
Animal 3 2 1
Animal 4 3 2
Animal 5 3 5
Animal 6 3 1
Animal 7 7 5
Animal 8 7 3
Animal 1 7 1
Animal 11 7 5
Animal 12 7 6
Animal 13 7 6
Farm B
Milk 1 1
Grass silage 2 6
Grass 1 2 5
Soil 1 7 1
Grass 2 7 5
Bedding 1 7 5
Water 7 7
Maize silage 9 1
Bedding 2 9 6
Soil 2 9 5
Animal 1 1 6
Animal 2 1 1
Animal 3 1 1
Animal 4 1 1
Animal 5 1 6
Animal 6 1 6
Animal 7 2 6
Animal 8 3 2
Animal 9 3 6
Animal 10 3 5
Animal 11 7 1
Animal 12 7 5
Animal 13 7 1
Animal 14 7 1
Silage 1 4 1 2
Soil 5 1 3
Water 1 5 8 4
Silage 2 5 1 5
Bedding 7 9 6
water 2 10 5 7
Animal 1 2 1 8
Animal 1 3 1 9
Animal 2 8 1 10
Animal 3 8 1 11
Animal 4 8 1 12
Animal 5 8 2 13
Farm D Lane #
Silage 1 2 5 2
Grass 4 6 3
Milk 1 3 5 4
Feed 4 6 5
Milk 2 4 5 6
Silage 2 4 6 7
Milk 3 8 5 8
Silage 3 8 5 9
Milk 4 9 5 10
Milk 5 7 5 11
Animal 1 2 2 2
Animal 2 2 1 3
Animal 3 2 1 4
Animal 4 2 2 5
Animal 5 2 1 6
Animal 6 2 5 7
Animal 7 2 2 8
Animal 8 2 10 9
Animal 9 3 10 10
Animal 10 3 10 11
Animal 11 3 10 12
Animal 12 5 5 13
Animal 12 7 11 14
Animal 13 9 5 15
Animal 14 9 6 16
Animal 15 9 2 17
Animal 16 8 1 18
Animal 17 8 1 19
Animal 18 8 1 20
Animal 19 8 1 21
Animal 20 8 6 22
Animal 21 8 1 23
Farm C visit* RAPD Lane @ Farm E visit* RAPD
195

Bedding 1 4 6
Water 1 4 6
Feed 5 1
Maize silage 5 1
Water 2 5 1
Bedding 2 6 6
Bedding 3 6 7
Water 3 7 1
Grass silage 9 1
Animal 1 1 7
Animal 2 1 7
Animal 3 1 7
Animal 4 1 12
Farm E visit* RAPD
Animal 5 1 5
Animal 6 1 7
Animal 7 1 7
Animal 8 1 7
Animal 9 2 12
Animal 10 2 7
Animal 11 3 1
Animal 12 3 1
Animal 13 3 7
Animal 14 3 7
Animal 15 5 6
Animal 16 5 5
Animal 17 5 5
Animal 18 5 1
Animal 19 5 5
* visit on which isolate was made from the environment and faeces, @ Figure 6. 11, # Figure 6. 12a and
12b.
A total of 113 isolates of L. monocytogenes (40 environmental and 73 faecal
isolates) were examined (Table 6. 18). 12 distinct patterns were obtained. 9 different
patterns were detected in environmental isolates and 9 in faecal isolates. 6 patterns were
common to both.
Patterns 1, 5, 6 and 7 were sequentially the most commonly identified in both
samples (Table 6. 19). Patterns 10, 11 and 12 were not detected in environmental
isolates and patterns 4, 8 and 9 were not detected in faecal isolates.
On farms, a maximum 4 environmental patterns and 6 faecal patterns were
identified. Pattern 1 was the most common in environmental (30%) and faecal isolates
(34%). It shared this proportion with pattern 5 in environmental samples (30%). There
were differences between the farms. Pattern 1 was most frequent on farms C and D. The
predominant patterns on farms A, B and E were different. On farm A pattern 5 was most
common, on farm B pattern 6 and 1 were present in similar proportions and on farm E
pattern 7 was predominant (Table 6. 19).
196

Table 6. 19. The distribution of the RAPD patterns by their origin and the farms.
RAPD patterns
O N 1 2 3 4 5 6 7 8 9 10 11 12
Farm A E 5 1 1 1 2 0 0 0 0 0 0 0 0
A 12 3 1 1 0 5 2 0 0 0 0 0 0
Farm B E 10 3 0 0 0 4 2 1 0 0 0 0 0
A 14 6 1 0 0 2 5 0 0 0 0 0 0
Farm C E 6 3 0 0 0 1 0 0 1 1 0 0 0
A 6 5 1 0 0 0 0 0 0 0 0 0 0
Farm D E 10 0 0 0 0 7 3 0 0 0 0 0 0
A 22 8 4 0 3 2 0 0 0 0 4 1 0
Farm E E 9 5 0 0 0 0 3 1 0 0 0 0 0
A 19 3 0 0 0 4 1 9 0 0 0 0 2
Total E 40 12 (30) 1 (2.5) 1 (2.5) 2 (5) 12 (30) 8 (20) 2 (5) 1 (2.5) 1 (2.5) 0 0 0
A 73 25 (34) 7 (9.6) 1 (1.4) 0 14 (19) 10 (14) 9 (12.3) 0 0 4 (5.5) 1 (1.4) 2 (2.8)
113 37 (33) 8 (7) 2 (1.8) 2 (1.8) 26 (23) 18 (16) 11 (9.7) 1 (0.9) 1 (0.9) 4 (3.6) 1 (0.9) 2 (3.9)
O origin, N number of isolates examined, E environment, A animals (faecal isolates), ( ) proportions.
197

All environmental samples were examined in order to compare the RAPD
patterns with those found in faecal isolates. A comparison of environmental and faecal
isolates obtained at the first three visits and the visit when the highest prevalence of
infection observed is given in the table 6. 20.
Table 6. 20. Comparison of environmental and animals isolates obtained at
different visits.
RAPD patterns obtained at
first three visits peak prevalence
environment animal environment animal
Farm A 1, 2 1 2 , 2, 5 3 3, 4 1, 3, 5 2 , 6 2
Farm B 1, 5, 6 1 3 , 2, 5, 6 5 1 2 , 5 3 , 6, 7 1 3 , 5
Farm C 1 1 2 1 2 , 5, 8, 9 1 3 , 2
Farm D 5 3 ,6 3 1 3 , 2 3 ,5,10 4 5 4 1 5 , 2, 5, 6 2 , 11
Farm E 6 2 1 2 , 5, 7 9 , 12 2 1 4 , 6, 7 1, 5 3 , 6
number refers to the pattern, superscript number refers to the number of times a pattern was detected.
Examination of these isolates failed to reveal any obvious relationship between
environmental and faecal isolates or between faecal isolates present before or at housing
and those at peak excretion (Table 6. 20).
On farm A patterns 1 and 2 were present in animals and the environment at the
first three visits (before housing) and pattern 5 was also present in animals. At the
highest prevalence of infection patterns 1 and 5 were still present in faecal isolates, 2
was not detected and the patterns 3 and 6 had appeared. Patterns 1 and 2 were no longer
present, but 3 and 4 were detected.
On farm B patterns 1, 5, 6 were present in the environment and faeces prior to
housing and pattern 2 was also detected in faecal isolates. At the highest prevalence of
infection patterns 1 and 5 were still present in faecal isolates, 1, 5 and 6 were still
present in the environment and pattern 7 was also detected in the environment.
198

On farm C pattern 1 was detected in the faecal and environmental isolates before
housing. This pattern was still common at the highest prevalence of infection but pattern
2 in faeces had appeared. In addition to pattern 1, patterns 5, 8 and 9 were also detected
in the environment.
On farm D pattern 5 was identified in animals and the environment prior to
housing. Pattern 6 was also detected in the environment, and patterns 1, 2 and 10 in
faeces. At the highest prevalence of infection, patterns 1, 2, 5 and 6 were detected in
faeces along with pattern 11. Pattern 5 was the only one detected in the environment.
On farm E, there was no common pattern in the environment and faeces prior to
housing. Pattern 6 in the environment and pattern 1, 5, 7 and 12 in faeces. At the peak
prevalence of infection, patterns 1 and 5 were still present in animals and pattern 6 had
also appeared. Pattern 6 was still present in the environment and patterns 1 and 7 were
also detected.
evaluated.
Repeat faecal and environmental isolates obtained from the farms were also
On farm A, repeat isolates from the same animal (animal 1) on 2 different visits,
6 visits apart (visit 1 and 7), had different patterns (pattern 5 and 1 respectively). 8
isolates obtained from two persistently L. monocytogenes positive animals (4 isolates
from each) were tested in an attempt to determine if the animals were excreting the
same strains. One animal had the same pattern but the second animal had 3 different
patterns (Figure 6. 10).
On farm B, 2 isolates from grass (visits 2 and 7) had the same pattern, pattern 5,
whereas 2 soil isolates (visit 7 and 9) and 2 isolates from bedding (visit 7 and 9) had
different patterns (1 and 5 and 5 and 6 respectively).
On farm C, repeat isolates from the same animal on consecutive visits (visits 2
and 3) had the same pattern, pattern 1. 2 isolates from silage (visits 4 and 5) also had the
199

same pattern, pattern 1, while 2 isolates from water (visits 5 and 10) had different
patterns, patterns 8 and 9 respectively (Figure 6. 11).
On farm D, 2 different patterns were obtained from the repeat isolates from
silage (visits 2, 4 and 8), pattern 5 in silage collected at visits 2 and 8 and pattern 6 in
silage collected at visit 4. Repeat isolates from the same animal (animal 12) on 2
different visits, 2 visits apart (visits 5 and 7), had two different patterns, patterns 5 and
11 respectively. (Figure 12a and 12b).
On the farm E, 2 different patterns were detected in repeat isolates from water,
pattern 6 in the isolate from water collected at visit 4 and pattern 1 in isolates from
water collected at visits 5 and 7. The pattern 6 was detected in bedding collected at
visits 4 and 6 and pattern 7 in bedding collected at visit 7.
L. monocytogenes was isolated from milk on 3 farms (A, B and D). Three
different patterns were obtained from the milk samples, pattern 4 was in milk samples
collected from farm A, pattern 1 in milk from farm B. On farm D the same pattern
(pattern 5) was detected in all of the isolates from milk samples examined. This pattern
was also detected in 2 of the 5 environmental samples and only 3 of the 22 faecal
samples.
200

Figure 6. 8. The repeatability of RAPD and discrimination of different species of
Listeria
Lane 1; λ DNA Marker Lane 3; L. monocytogenes 1, 4; L. monocytogenes 2, 5; L.
innocua, 8; L. monocytogenes 1, 9; L. monocytogenes 2, 10; L. innocua, (universal
primer)
201

Figure 6. 9. The discrimination of isolates of L. monocytogenes with different
primers
Lane 1; λ DNA Marker, Lane 2; Lm1, 4; Lm3, 5; Lm4, 6; Lm5 and 7; Lm6 (primer 2).
Lane 8; Lm1, 9: Lm2, 10; Lm3, 11; Lm4, 12; Lm5 and 13; Lm6 (primer 3).
Lane 14; Lm1, 15; Lm2, 16; Lm3, 17; Lm4 and 18; Lm5 (primer 5).
202

Figure 6. 10. The distribution of strains in two persistently infected animals on
farm A (primer 3).
Lane 4 and 8; λ DNA Marker, Lane 1; animal 1(visit 5), 2; animal 1 (visit 6), 3; animal
1 (visit 8), 5; animal 1 (visit 9), 6; animal 2 (visit 4), 7; animal 2 (visit 6), 9; animal 2
(visit 7), 10; animal 2 (visit 8) and 11; animal 2 (visit 9).
203

Figure 6. 11. The RAPD pattern obtained from environmental and faecal isolates
on farm C (primer 5).
Lane 1; λ DNA Marker, Lane 2, 3, 4, 5, 6 and 7; L. monocytogenes from silage1, soil,
water1, silage2, bedding and water2 respectively and Lane 8, 9, 10, 11, 12 and 13; L.
monocytogenes from animal 1, 1, 2, 3, 4 and 5 (Table 6. 18).
204

Figure 6. 12a. The RAPD pattern obtained from the environmental isolates on
farm D (primer 5).
Lane 1; λ DNA Marker, Lane 2, 4, 5, 6, 7, 8, 9, 10 and 11; L. monocytogenes isolates
from silage1, grass, milk1, feed, milk2, silage2, milk3, silage3, milk4, milk5
respectively (Table 6. 18).
205

Figure 6. 12b. The RAPD patterns obtained from faecal isolates on farm D
(primer 5)
Lane 1; λ DNA Marker, Lane 2, 4, 5, 6 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, and 23; L. monocytogenes isolates from animals 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21 respectively (Table 6. 18).
6. 4. Discussion:
The aims of this study were to investigate the dynamics of L. monocytogenes
infection in dairy cattle and the distribution of the strains of the organism present in the
environment and in faecal samples. These were achieved by conducting a longitudinal
study of five dairy farms in Northwest of England. Five farms were chosen because this
was the maximum number that could be studied within the constraints of the project.
Listeria are widespread in the environment and have been isolated from a variety
of animal species and people (Gray and Killinger 1966). Faecal excretion of Listeria
spp. and L. monocytogenes has been studied in dairy cattle and differences in the
frequency of excretion have been reported between studies and between farms. Reports
vary from a small proportion to 67% for Listeria spp. in different studies
(Kampelmacher and van Noorle Jansen 1969, Ralovich 1987, Skovgaar and Morgen
206

1988, Husu 1990) and from zero to all animals on different farms (Skovgaar and
Morgen 1988, Husu 1990). The use of different culture techniques and media has been
suggested as a reason for these different frequencies (Husu 1990) and the difference
between the farms has been attributed to different feeding practices (Skovgaar and
Morgen 1988, Husu 1990).
In this study too, there were differences between the farms in the proportion of
animals positive for Listeria spp. and L. monocytogenes. It varied from 48% of cows on
farm D to 89.1% on farm E for Listeria spp. and from 28.2% of cows on farm D to
79.3% on farm B for L. monocytogenes. Similarly differences in the monthly frequency
of excretion were also observed between the farms in this study. The monthly frequency
of excretion reported here showed a seasonal pattern but there were two distinct patterns
of excretion. The first pattern seen on farms A, B and E was characterised by the high
frequency of excretion between October and May. This was similar to the pattern
observed in our pilot study (Chapter 5). This seasonality is also similar to that reported
for clinical listeriosis (Chapter 2). A similar seasonality of excretion of Listeria spp. and
L. monocytogenes in faeces was also reported by Husu (1990). However the frequency
of excretion reported in our study was much higher than those observed by Husu
(1990), where the excretion rates for L. monocytogenes were 0.9 % (3.5% for Listeria
spp.) in September and 16.1% in December (19.4% for Listeria spp.).
In contrast to the first group of the farms, the excretion rates on farms C and D
were lower especially between October and April. The use of different culture
techniques would not explain the differences seen between the farms in this study
because the same culture technique was used throughout the study. There are a number
of possible explanations for these differences between farms. They may be related to the
strains of organism, the systems of husbandry or the proportion of susceptible animals.
The difference in frequency of excretion may also be explained by the absence of some
207

of the factors required to initiate or sustain an epidemic on some farms in this study.
The presence of the infectious agent in a sufficient quantity and sufficient proportion of
susceptible animals with close contact are major requirements for an epidemic to occur
(Thrusfield 1995).
On the farms studied the farming practices were similar but there were some
important differences. Grass silage was fed all year round on two farms (farms B and E)
and seasonally on the others (farms A, C and D). Maize silage was not fed on 2 farms
(farm C and D) and the start and finish dates of maize silage feeding were also different
on farms A, B and E. Farm D was a flying herd i.e. there was no internal breeding of
replacement cows. Cows were bought in, milked and then sold at the end of lactation.
Farm E was also an open herd but this farm bought in only 10% of their replacement
heifers and the movement of animals in and out of the herd was more restricted and
controlled. Farm C had the smallest number of animals in their herd.
The frequency of isolation of Listeria organisms from the faeces has been
associated with the prevalence of the organism in feed (Husu 1990). In this study no
measure was made of the number of organisms in the feed but the major difference
between the farms with a high and low monthly prevalence of L. monocytogenes
excretion was in the feeding of maize silage. The farms with a low monthly prevalence
of excretion did not feed maize silage. Maize silage feeding was also identified as a risk
factor for clinical Listeriosis in the questionnaire survey and this provides supporting
evidence for the role of this factor in Listeria infection.
The exact manner in which maize silage may have played a role in the excretion
of the organism is not known. It may have had a direct effect either because of the
numbers of Listeria organisms it contained or because of alterations in the gut flora of
the cow which may have initiated faecal shedding of L. monocytogenes. It may have
contributed indirectly by a build up of L. monocytogenes in the environment. It has
208

experimentally been shown that there is a relationship between the excretion of the
organism in faeces and infectious dose. Lhopital and colleagues (1993) reported that
sheep challenged orally with 6x10 6 did not excrete the organism in any samples
examined (blood, buccal and nasal swabs and faeces) but those challenged with 6x10 10
shed the organism in the samples, including faeces. Although this could not be proved
in our study, the inclusion of maize silage in the diet may have increased the quantity of
Listeria organisms in the diet, as the organism was isolated more frequently from maize
silage than grass silage on farms A, B and E. An alternative explanation may be that the
strains of L. monocytogenes obtained from maize silage were responsible for the
epidemics. However, when the strains obtained from maize silage were compared with
those detected in animals at the highest peak of infection it was difficult to support this.
The strains detected in maize silage were not predominant in faecal isolates obtained at
the peak prevalence of infection on farms A and E and the strain detected in maize
silage and animals on farm B were also predominant in the isolates from faeces on farm
C and D.
It is also possible that the strains of L. monocytogenes on these 2 farms (farm C
and D) may have not been capable of propagating in the environment, feed or cows.
This is unlikely. Pattern 1 was predominant in faecal samples on farms B, C and D and
in the environment on farm C.
The absence of a high prevalence of infection on farms C and D may also have
been due to demographic features of these herds. Farm C was the smallest herd and
therefore the number of contacts with susceptible animals might have been too low to
initiate an epidemic. Farm D was a flying herd which by its nature would contain a
small proportion of young animals. There was a negative association between age and
faecal excretion on the farms where ages were available. This was also a feature of the
pilot study. It was reflected also in the much higher incidence of clinical Listeriosis
209

eported in heifers in the questionnaire survey (Chapter 2). Although the influence of
age on clinical Listeriosis is controversial younger animals have been reported to be
more susceptible (Barlow and McGorum 1985, Nash and others 1995). In this study
younger animals were more likely to excrete the organism in their faeces than the older
animals. This finding contradicts with the finding of Hofer (1983) where the organism
was more frequently isolated from beef cattle older than 5 years. However, in the study
of Hofer the sampling was not statistically based and samples were collected from an
abattoir. It is possible that stress induced shedding contributed to this finding or that the
older animals had taken longer to reach slaughter weight because of intercurrent
disease.
This negative association suggests that animals may became immune to
infection following repeated exposure to Listeria organisms. In our study measurement
of serum antibody indicated that almost all animals had been exposed to Listeria
infection prior to the study. It has experimentally been demonstrated that anti-LLO
antibodies develop after oral challenge (Low and Donachie 1991, Low and others
1992b, Miettinen and Husu 1991) and that antibodies developed against L.
monocytogenes could sustain at higher levels for as long as 4 (Lhopital and others
1993) or 6 (Miettinen and Husu 1991) or 7.5 months after initial exposure (Baetz and
Wesley 1995). This long lasting nature of anti-LLO antibodies may explain the
seropositivity of almost all animals at the beginning of this study. Whilst the
measurement of serum antibody may not correlate with protection against infection
because Listeria is an intracellular organism, it may however be considered as a
measure of exposure to infection or re-infection.
On only one of the farms, farm A, was there an increase in serum antibody
between August and December and December and April. This increase showed a broad
agreement with the proportion of new faecal excretors observed during these two
210

periods. However, on farms B and E there was little change in serum antibody and the
patterns of the epidemics on both of these farms were different to farm A. The incidence
rate on farm A continued to rise throughout the study whereas on farms B and E it
peaked in November and February and December respectively and then fell in spite of
the presence of susceptible animals. It is possible that this occurred because of the
higher level of herd immunity on these farms.
On farms C and D, there was a fall in serum antibody between August and
December. On farm D this coincided with a small increase in the frequency of faecal
shedding although there were differences in the proportions; 9.1% of animals showed a
decrease in serum antibody and 26% of animals showed new infections; on farm C 12%
of animals became faecal excretors for the first time during this period and 3. 8%
showed a decrease in serum antibody.
In the period between December and April there was a further decrease in serum
antibody in 15% of animals on farm C. This coincided with 29% of animals becoming
faecal excretors for the first time.
It is difficult to explain how infection might be associated with a decrease in
antibody titers unless it was a reflection of the immunosuppressive process which
increased the susceptibility to infection. It is more likely that this is a chance
observation as on farm D the new cases occurring between December and April were
associated with an increase in serum antibody.
Serum antibody measurements were included in this study because of concerns
that the presence of L. monocytogenes in faeces represented “intestinal transient” rather
than true colonisation. The increase in serum antibody on farm A indicates that
infection did occur and the association between the start of maize silage feeding and
faecal shedding, but the continuation of faecal shedding beyond the feeding of maize
silage suggest that this is true infection rather than simple transient. A relationship
211

etween increased anti-LLO antibodies and faecal excretion has also been suggested in
an experimental infection of L. monocytogenes (Mietinnen and others 1991).
The sources of infection on these farms were investigated using RAPD test. One
criticism of RAPD is its lack of reproducibility (Wernars and others 1996). The RAPD
technique used in this study had been validated in another laboratory (O’Donoghue and
others 1995). The use of 6 primers allowed internal validation and the experiments
showed that the technique was repeatable. Similar results were reported by other
researchers (Mazurier and Wernars 1992, MacGowan and others 1993, O’Donoghue
and others 1995). Alternative typing methods such as serotyping, ribotyping, restriction
enzyme analysis (REA) multilocus enzyme electrophoresis (MEE) and pulsed field gel
electrophoresis (PFGE), have been used for L. monocytogenes (Ralovich 1993) and a
comparison with RAPD has also been made (Boerlin and others 1995, Louie and others
1996). RAPD was compared with serotyping, ribotyping, MEE and REA by Boerlin and
others (1995). They acknowledged the superiority of RAPD. RAPD was also compared
with ribotyping and PFGE. RAPD and PFGE were found to be the most discriminating
typing methods and their ability to differentiate between strains was comparable (Louie
and others 1996). However PFGE may take several days, it is costly and sophisticated
laboratory equipment is required to perform it. RAPD, on the other hand, is cheap, rapid
(results are obtained within several hours) and easy to perform (O’Donoghue and others
1995, Louie and others 1996).
The wide diversity of L. monocytogenes found on five study farms makes it
difficult to link environmental strains with faecal strains. Because of the lack of
understanding of the population dynamics of strains of L. monocytogenes it is also not
known if temporal distribution of strains occurs (Low and Donachie 1997). This was
also the case in this study.
212

A large number of L. monocytogenes isolates were obtained from the
environment and animals. It was impossible to examine all the isolates because of time
and financial constraints. However the limited results obtained in this study provide
some interesting information. A total of 12 “strains” were identified but on individual
farms this was limited to 5 or 6 different “strains”. The maximum number in
environmental samples was 4 and in faecal samples it was 6. This diversity within the
strains of L. monocytogenes is in accordance with the results reported by other
researchers (Boerlin and Piffaretti 1991, Fenlon and others 1996, Wiedmann and others
1996).
In interpreting the difference between the isolates made at different times care
has to be taken because of the potential influence of the sampling procedure.
Competition between the strains invariably takes place during the enrichment procedure
and the selection of only 5 colonies from a plate means that only “strains” present at a
prevalence of 50% will be detected.
However, given these constraints the results suggest that the predominant faecal
isolates may vary with time. It is possible that the epidemic curves observed for L.
monocytogenes are composite results from a large number of “strains” related epidemic
curves. If this is the case then any potential vaccine against L. monocytogenes infection
would need to incorporate immunogens from a number of different “strains”.
The isolates from milk in the bulk tank on three farms (farm A, B and D)
revealed that each farm had different patterns; the pattern 4 on farm A, 1 on farm B and
5 on farm D. Except for the pattern 4, this pattern 4 was not detected in any other
samples. Both pattern 1 and 5 were also detected in the environmental and faecal
isolates on these farms. This may suggest that milk was contaminated with the organism
either by animals excreting it in milk or the organism got into the tank via
environmental contamination where the refrigeration temperature allowed the organism
213

to propagate. The latter may have been the case on the farm D because the “strain”
detected in the isolates obtained from milk samples was detected in 2 of 5
environmental samples but only in 3 of 22 animal isolates.
The “strains” detected in bedding, water, soil and grass were also seen in faeces
and grass and maize silage on some farms. This is in agreement with the results of other
studies (Skovgaar and Morgen 1988, Ueno and others 1995).
This study has demonstrated that a large proportion of cattle can become
infected and shed L. monocytogenes in their faeces without any apparent clinical
symptom. L. monocytogenes was isolated from the liver of an aborted foetus on farm B
but this isolate was not typed. In spite of the inconclusive analysis of the strains, it also
suggested that environmental contamination and infection of animals with L.
monocytogenes may have been a continuing cycle as illustrated in the figure 6. 13.
grass
faeces
grass silage
soil maize silage
water
Milk
ANIMAL
bedding
214

Figure 6. 13. Animal-environment cycle of L. monocytogenes
215

CHAPTER 7
Conclusion
The aim of this study was to identify risk factors at both the farm level and the
individual animal level which were associated with Listeriosis and L. monocytogenes
infection in dairy cattle. An ultimate aim of epidemiological studies is to control
disease. This can be achieved by a better understanding of the factors associated with
infection and clinical disease.
In this study two observational studies, cross-sectional and longitudinal, were
conducted to determine:
a) the frequency of clinical listeriosis in dairy cattle, its clinical characteristic and risk
factors associated with disease at farm level;
b) the infection rate in individual animals, risk factors associated with it, the degree of
environmental contamination and the source of infection.
In the cross sectional study, a postal survey, was carried out. 12% of dairy
farmers reported clinical Listeriosis and on these farms around 5 out of 100 cattle were
at risk of contracting the disease each year (Chapter 2). The most frequently reported
clinical sign was silage eye. This corresponds with the recent increased number of field
reports of this disease. However there is a need for a detailed investigation to establish
the exact relationship between silage eye and L. monocytogenes and the dynamics of
this relationship.
215

Some important farming practices were identified as risk factors for clinical
listeriosis. These were mainly forage and forage related practices (Chapter 3 and 4).
This study demonstrated that the methods of making and feeding grass silage are an
important component of the association between silage feeding and Listeriosis. Clinical
Listeriosis was associated with the time and stage of harvest (number of cuts made to
grass for grass silage), soil contamination (presence of mole hills in the fields, control of
moles, use of mower conditioner), type of harvesters (mower conditioner), wilting,
storage of grass silage (clamp, big bale silage and storage of big bales outside
uncovered). These factors are also believed to be involved in the production of good
quality silage. These have been discussed in the relevant chapters.
As important as silage quality are the method or methods of feeding silage.
Some clinical forms of Listeriosis (encephalitis, iritis) have been attributed to physical
injuries of mucosal membranes such as buccal or conjunctival membranes caused by
rough forages. In addition to the factors stated above methods of feeding grass silage
were also associated with disease. These were the feeding of grass silage both in ring
feeders and ad libitum feeding during the indoor or outdoor period.
This study has also established an association between maize silage feeding and
disease. Although we gathered information about the preparation of maize silage and its
quality, we failed to identify risk factors in the preparation of maize silage. The methods
of maize silage feeding were significantly associated with disease; maize silage feeding
ad libitum, in ring feeders or in a complete diet during the indoor or outdoor period.
Maize silage feeding is an increasing practice in the UK. There is a need for more
research to establish the factor or factors that influence its quality.
In the second part of the study a longitudinal study, employing bacteriological,
serological and molecular techniques, was carried out. This study demonstrated that a
large proportion of animals excrete L. monocytogenes during the winter months without
216

showing signs of disease. Although the analysis of data collected in this study is not
conclusive some farming practices were associated with the excretion of the organism.
A significant number of isolates of L. monocytogenes were obtained from animals and
the environment over a 10 month period. A complete analysis of these isolates with the
use of newer molecular typing methods (e.g. RAPD) could have provided information
on temporal distribution of the strains of L. monocytogenes and its relation with the
infection in animals but this was not possible because of the time and financial
constraints. However the limited number of isolates examined provided some
information about the distribution of strains obtained from the faeces and the
environment.
The use of animal waste on agricultural land is known to help maintain the
existence of the organism in the farm environment. The importance of dung
management was demonstrated in both the cross-sectional and the longitudinal study.
In this part of the study there were two distinct patterns of excretion on the
farms. The first pattern fitted well with the seasonal occurrence of clinical Listeriosis in
the northern hemisphere but the second pattern was distinct (Chapter 6). As explained
earlier it was difficult to establish why this difference occurred. The main factor
associated with this difference was the feeding of maize silage but it is possible that this
was a confounder. It may have been that different “strains” of L. monocytogenes were
involved in infection on these farms. This could only be explained if all the isolates
made during the study were analysed.
Control of clinical listeriosis is complex due to scarcity of representative
field data and a lack of understanding of its epidemiology. This study indicates that a
large proportion of cattle may excrete the organism without showing overt nervous
signs or silage eye. It is possible that there were more subtle clinical signs and the
217

chance finding of L. monocytogenes in the only 1 of the abortion samples examined
supports this.
L. monocytogenes is also known to be associated with mastitis and the
observation that “strains” of L. monocytogenes which were found in faecal samples
were also found in the bulk tank merits further investigation of udder infection and the
presence of L. monocytogenes in milk.
The isolates collected in this study have partially been identified. Further
analysis of these strains will allow a more detailed analysis of the strain specific
patterns of infection in these herds. The data obtained during the longitudinal study will
also provide empirical data which will be of value in developing theoretical models of
the disease process.
In conclusion, this study has identified farm level risk factors which may be
utilised to try and reduce the incidence of clinical disease. It has provided information
of the longitudinal pattern of infection in dairy herds and has raised a number of
questions about the inter-relationship between strains and between infection and
disease.
218

REFERENCES
Abramson, J.H. (1988) Survey Methods in Community Medicine: An introduction to
epidemiological and evaluative studies. Edinburgh, Churchill Livingstone.
pp. 136.
Alexander, A.V., Walker, R. L., Johnson, B. J., Charlton, B. R. and Woods, L. W.
(1992). Bovine abortions attributable to Listeria ivanovii: four cases (1988-
1990). Journal of American Medical Association; 200: 711-714.
Al-Ghazali, M.R. and Al-Azawi, S.K. (1986) Detection and enumeration of Listeria
monocytogenes in a sewage treatment plant in Iraq. Journal of Applied
Bacteriology, 60, 251-254.
Anon (1983) Grass Bulletin No. 2. Silage. Ministry of Agriculture, Fisheries and Food,
Liscombe, Experimental Husbandry Farm, Dulverton, Somerset, UK.
Arbeit, R.D. (1995) Laboratory procedure for epidemiological analysis of
microorganisms. In Murray, P.R., Baron, E.J.O., Pfaller, M.A., Tenover, F.C.
and Yolken, R.H. (ed.) Manual of Clinical Microbiology, 6th edn. pp. 190-
208.
Archer, D.L. (1996) Listeria monocytogenes: The science and policy. Food Control, 7
(4-5), 181-182.
Armitage, P. and Berry,G. (1988). Statistical methods in Medical Research. Edn 2.
Blackwell Scientific Publications. pp.205, pp.372.
Asahi, O. (1963) Present situation of Listeria vaccine for animal use. In Gray, M.L.
(ed.) Second Symposium of Listeric infection, Montana State College,
Bozeman, pp 49-56.
219

Asahi, O., Hosoda, T. and Akuyama, Y. (1957) Studies on the mechanism of infection
of the brain with Listeria monocytogenes. American Journal Of Veterinary
Research 18, 147-157.
Aslan, V., Turgut, K., Kaya, O. and Sevinc, M. (1991) Cases of listeriosis in cattle.
Hayvancilik Arastimalar Dergisi; 1 (1): 37-39.
Baetz, A.L. and Wesley, I.V. (1995) Detection of anti-Listeriolysin-O in dairy cattle
experimentally infected with Listeria monocytogenes. Journal of Veterinary
Diagnostic Investigation, 7 (1), 82-86.
Baptista , P.J. H. P.(1979) Infectious bovine keratoconjunctivites: A review. British
Veterinary Journal, 135, 225-242.
Barlow, R.M. and McGorum, B. (1985) Ovine listerial encephalitis: Analysis,
hypothesis and synthesis. The Veterinary Record, 116, 233-236.
Baxter, F., Wright, F., Chalmers, R.M., Low, J.C., Donachie, W. (1993)
Characterization by multilocus enzyme electrophoresis of Listeria
monocytogenes isolates involved in ovine listeriosis outbreaks in Scotland
from 1989 to 1991 Applied and Environmental Microbiology, 59, (9), 3126-
3129
Bee, D.J. (1993) Ovine iritis (letter). The Veterinary Record, 132, 200.
Benedict, R. C. (1990) Listeria monocytogenes: Physiology and metabolism. In Miller,
A.J.,. Smith, J.L and Somkuti G.A. (ed.) Foodborne listeriosis. Society for
Industrial Microbiology. Elsevier Science Publishing, Inc. New York. pp 13-
24.
Berche, P., Reich, K.A., Bonnichon, M., Beretti, J.L., Geoffroy, C., Raveneau, J.,
Cossart, P., Gaillard, J.L., Geslin, P., Kreis, H. and Veron, M. (1990)
Detection of anti-Listeriolysin-O for serodiagnosis of human listeriosis.
Lancet, 335 (8690), 624-627.
220

Beuchat, L.R. (1996) Listeria monocytogenes; - incidence on vegetables. Food
Control, 7 (4-5),.223-228.
Bibb, W.F., Gellin, B.G., Weaver, R., Schwartz, B., Plikaytis, B.D., Reeves, M.W.,
Pinner, R.W. and Broome, C.Y. (1990) Analysis of clinical and food-borne
isolates of Listeria monocytogenes in the United States by multilocus enzyme
electrophoresis and application of the method to epidemiologic
investigations. Applied and Environmental Microbiology, 56 (7), 2133-2141.
Blenden, D.C., Gates, G.A. and Khan, M.S. (1968) Growth of Listeria monocytogenes
in a corn silage extract medium. American Journal of Medical Association,
29 (11), 2237-2242.
Blenden, D.C., Kampelmacher, E.H. and Torres-Anjel, M.J. (1987) Listeriosis. Journal
of American Medical Association, 191 (12) 1546-1549.
Boerlin, P. and Piffaretti, J.C. (1991) Typing of human, animal, food, and
environmental isolates of Listeria monocytogenes by multilocus enzyme
electrophoresis. Applied and Environmental Microbiology, 57 (6), 1624-
1629.
Boerlin, P., Bannerman E., Ischer, F., Rocourt, J, and Bille, J. (1995) Typing Listeria
monocytogenes: A comparison of random amplification of polymorphic DNA
with 5 other methods Research In Microbiology, 146, (1), 35-49
Boerlin, P., Boerlin-Petzold, F., Bannerman, E., Bille, J. and Jemmi, T. (1997) Typing
Listeria monocytogenes isolates from fish products and human listeriosis
cases. Applied and Environmental Microbiology, 63 (4), 1338-1343.
Bojsen-Moller, J. (1972) Human Listeriosis. Diagnostic, epidemiological, and clinical
studies. Acta Pathologica Microbiologica Scandinavia, 229 (Suppl. B), 1-
157.
221

Bourry, A. and Poutrel, B. (1996) Bovine mastitis caused by Listeria monocytogenes:
kinetics of antibody responses in serum and milk after experimental infection.
Journal of Dairy Science,79 (12), 2189-2195
Bourry, A., Cochard, T. and Poutrel, B. (1997) Serological diagnosis of bovine, caprine,
and ovine mastitis caused by Listeria monocytogenes by using an enzyme-
linked immunosorbent assay. Journal of Clinical Microbiology, 35 (6), 1606-
1608.
Bourry, A., Poutrel, B. and Rocourt, J. (1995) Bovine mastitis caused by Listeria
monocytogenes - Characteristics of natural and experimental infections
Journal of Medical Microbiology, 43, (2), 125-132
Bracegirdle, P., West, A.A., Lever, M.S., Fitzgeorge,R.B., Baskerville, A. (1994) A
comparison of aerosol and intragastric routes of infection with Listeria spp.
Epidemiology and Infection, 112 (1), 69-79.
Brombacher, F. and Kopf, M. (1996) Innate versus acquired immunity in listeriosis.
Research in Immunology 147 (8-9), 505-511.
Broome, C.V. Gellin, B. and Schwartz, B. (1990) Epidemiology of listeriosis in the
Unites States. In Miller, A.J.,. Smith, J.L and Somkuti G.A. (ed.) Foodborne
listeriosis. Society for Industrial Microbiology. Elsevier Science Publishing,
Inc. New York. pp. 61-65.
Brosch, R., Chen, J.C. and Luchansky, J.B. (1994) Pulsed-field fingerprinting of
Listeriae - Identification of genomic divisions for Listeria monocytogenes and
their correlation with serovar. Applied and Environmental Microbiology, 60
(7), 2584-2592.
Bubert, A., Riebe, J., Schnitzler, N., Schonberg, A., Goebel, W. and Schubert, P. (1997)
Isolation of catalase-negative Listeria monocytogenes strains from listeriosis
222

patients and their rapid identification by anti-p60 antibodies and/or PCR.
Journal of Clinical Microbiology, 35 (1), 179-183.
Buchanan, R.L. (1990) Advances in cultural methods for the detection of Listeria
monocytogenes. In Miller, A.J.,. Smith, J.L and Somkuti G.A. (ed.)
Foodborne listeriosis. Society for Industrial Microbiology. Elsevier Science
Publishing, Inc. New York. pp 85-95.
Buchanan, R.L., Stahl, H.G. and Whiting, R.C. (1989) Effects and interactions of
temperature, pH, atmosphere, sodium chloride and sodium nitrite on the
growth of Listeria monocytogenes. Journal of Food Protection 52 (12), 844-
851.
Camilli, A., Goldfine, H. and Portnoy, D.A. (1991) Listeria monocytogenes mutants
lacking phosphatidylinositol-specific phospholipase-c are avirulent. Journal
of Experimental Medicine, 173 (3), 751-754.
Cannon, R.M. and Roe, R.T. (1982). Livestock Disease Surveys: A field Manual for
Veterinarians. Canberra, Australian Bureau of Animal Health. pp. 21
Carosella, J.M. (1990) Occurrence of Listeria monocytogenes in meat and poultry. In
Miller, A.J.,. Smith, J.L and Somkuti G.A. (ed.) Foodborne listeriosis.
Society for Industrial Microbiology. Elsevier Science Publishing, Inc. New
York. pp 165-173.
Casanovas, L., Desimon, M., Ferrer, M.D., Arques, J. and Monzon, G. (1995) Intestinal
carriage of Campylobacters, Salmonellas, Yersinias and Listerias in pigeons
in the city of Barcelona. Journal of Applied Bacteriology, 78 (1), 11-13.
Cetinkaya, B. Erdogan, H.M. and Morgan, K.L. (1996) Prevalence, incidence and
geographical distribution of Johne’s disease in cattle in England and Wales
border. The Veterinary Record, (in press).
223

Chakraborty, T., Ebel, F., Wehland, J., Dufrenne, J. and Notermans, S. (1994) Naturally
occurring virulence attenuated isolates of Listeria monocytogenes capable of
inducing long term protection against infection by virulent strains of
homologous and heterologous serotypes. FEMS Immunology and Medical
Microbiology, 10 (1), 1-9.
Charpentier, E., Gerbaud, G., Jacquet, C., Rocourt, J. and Courvalin, P. (1995)
Incidence of antibiotic resistance in listeria species Journal of Infectious
Diseases, 172, (1), 277-281.
Christie, R., Atkins, N.E. and Munch-Petersen, N.E. (1944) A note on a lytic
phenomenon shown by group B Streptococci. Australian Journal of
Experiments in Biology and Medical Science, 22, 197-200.
Ciesielski, C.A., Hightower, A.W., Parsons, S.K. and Broome, C.V. (1988) Listeriosis
in the United States: 1980-1982. Archive in Internal Medicine, 148, 1416-
1419.
Cooper, J. and Walker, R.D. (1998) Listeriosis. Veterinary Clinics of North America-
Food Animal Practice, 14 (1), 113-125
Core , M.R., Zamora, E., Leon, L., Cuello, F., Salinas, J., Megias, D., Cubero, M.J.
and Contreras, A. (1990) Isolation and identification of Listeria
monocytogenes in vegetable byproduct silage containing preservative
additives and destined for animal feeding. Animal Feed Science and
Technology 31, 285-291.
Corry, J.E.L. (1982) Quality assessment of culture media by the Miles-Misra method. In
"Quality Assurance And Quality Control Of Microbiological Culture Media.
Git Verlag-Ernst Giebels, Darmstad. pp 21-37.
224

Cossart, P. and Mengaud, J. (1989) Listeria monocytogenes - A model system for the
molecular study of intracellular parasitism. Molecular Biology and Medicine,
6 (5), 463-474.
Cox, L.J. Siebenga, A. Pedrazzini, C. and Moreton, J. (1991). Enhanced Haemolysis
Agar (EHA) an improved selective and differential medium for isolation of
Listeria monocytogenes. Food Microbiology.8:37-49.
Curtis, G.D.W. and Lee, W.H. (1995) Culture media and methods for the isolation of
Listeria monocytogenes. International Journal of Food Microbiology, 26 (1),
1-13.
Curtis, G.D.W., Mitchell, R.G, King, A.F. and Griffin, E.J. (1989a) A selective
differential medium for the isolation of Listeria monocytogenes. Letters in
Applied Microbiology, 8 95-98.
Curtis, G.D.W., Nichols, W.W. and Falla, T.J. (1989b) Selective agents for Listeria can
inhibit their growth. Letters in Applied Microbiology, 8 (5), 169-172.
Dalton, C.B., Austin, C.C., Sobel, J., Hayes, P.S., Bibb, W.F., Graves, L.M.,
Swaminathan, B., Proctor, M.E. and Griffin, P.M. (1997) An outbreak of
gastroenteritis and fever due to Listeria monocytogenes in milk. New
England Journal of Medicine, 336 (2), 100-105.
Datta, A.R., Wentz, B.A, Russell, J. (1990) Cloning of the Listeriolysin-O gene and
development of specific gene probes for Listeria monocytogenes. Applied
and Environmental Microbiology, 56 (12), 3874-3877.
Dean, A.G., Dean, J.A., Coulombier, D., Brendel, K.A., Smith, D.C., Burton, A.H.,
Dicker, R.C., Sullivan, K.M., Fagan, R.F. and Arner, T.G. (1994). Epi-Info,
Version 6: A word processing, database and statistics program for
epidemiology on microcomputers. Center for disease control and prevention,
Atlanta, Georgia, U.S.A.
225

delGarso, L. and Wallop, W. (1975) Questionnaire development: 1. Formulation.
Canadian Medical Association Journal, 136, 583-585.
Dennis, S.M. (1993) Listeriosis (Circling Disease, Silage Sickness) In Forward, J.L.
(ed.). Current Veterinary Therapy-Food Animal Practice 2nd ed. W. B.
Saunders Co. Philadelphia. pp 580-583.
Destro, M.T., Leitao, M.F.F. and Farber, J.M. (1996) Use of molecular typing methods
to trace the dissemination of Listeria monocytogenes in a shrimp processing
plant. Applied and Environmental Microbiology, 62 (5),1852-1853.
Dijkstra, R.G. (1975) Recent experience on the survival of Listeria bacteria in
suspensions of brain, tissue, silage, faeces and milk. In Woodbine, M.
Proceeding of the 6th International Symposium on the Problems of
Listeriosis, Nottingham, Leicester University Press, England. pp 71-73.
Dijkstra, R.G. (1986). A fifteen years survey of isolations of Listeria monoctyogenes
out of animals and the environment in the Northern Netherlands. In Cortieu,
A.L., Espaze, E.P. and Reynaud, A.E. Proceeding of the 9th International
Symposium on the Problems of Listeriosis, Nantes, University of Nantes,
France. pp 291-293.
Divers, T.J. (1996). Penicillin Therapy in Bovine Practice .The compendium. 18
(6):703-709.
Domingo, M., Ramos, J.A., Dominguez, L., Ferrer, L. and Marco, A. (1986)
Demonstration of Listeria monocytogenes with the PAP technique in formalin
fixed and paraffin embedded tissues of experimentally infected mice. Journal
of Veterinary Medicine Series B-Infectious Diseases Immunology Food
Hygiene Veterinary Public Health-Zentralblatt Fur Veterinarmedizin Reihe
B, 33 (7), 537-542.
226

Donachie, W. and Low, J.C. (1995) Ovine listeriosis. In Raw, M.E. and Parkinson, T.J.
The Veterinary Annual. Blackwell Sci. Pub. Cambridge. Vol. 35, pp.304-312.
Donachie, W., Low, J.C., Chalmers, R.M., McLauchlin, J. Freeman, R. and Sisson, P.R.
(1992) Characterisation of Listeria monocytogenes strains isolated from
sheep and silage by serotyping, multilocus enzyme electrophoresis and
pyrolysis mass spectrometry In: Proceeding of the 11th International
Symposium on the Problems of Listeriosis, Copenhagen, Denmark. pp 64-65.
Donald, A.S., Fenlon, D.R. and Seddon, B. (1995) The relationship between
ecophysiology, indigenous microflora and growth of Listeria-monocytogenes
in grass-silage. Journal of Applied Bacteriology, 79 (2), 141-148.
Donker-Voet, J. (1972) Listeria monocytogenes: some biochemical and serological
aspects.Acta Microbiologica Academiae Scientiarum Hungaricae, 19, 287-
291.
Dramsi, S., Dehoux, P., Lebrun, M., Goossens, P.L. and Cossart, P. (1997)
Identification of four new members of the internalin multigene family of
Listeria monocytogenes EGD. Infection and Immunity, 65 (5), 1615-1625.
Dramsi, S., Lebrun, M. and Cossart, P. (1996) Molecular and genetic-determinants
involved in invasion of mammalian-cells by Listeria monocytogenes. Current
Topics in Microbiology and Immunology, 209, 61-77.
EGRET (1993) Epidemiological Graphic Estimation and Testing Package. Statistics and
Epidemiology Research Corp. Washington, Seattle, WA.
Eld, K., Danielssontham, M.L., Gunnarsson, A. and Tham, W. (1993) Comparison of a
cold enrichment method and the IDF method for isolation of Listeria
monocytogenes from animal autopsy material. Veterinary Microbiology, 36
(1-2), 185-189.
227

Eveland, W.C. (1963) Demonstration of Listeria monocytogenes in direct examination
of spinal fluid by fluorescent antibody technique. Journal of Bacteriology, 59,
617-619.
Facinelli, B., Giovanetti, E., Varaldo, P.E., Casolari, P. and Fabio, U. (1991) Antibiotic
resistance in foodborne Listeria. Lancet, 338 (8777) 1272.
Facinelli, B., Varaldo, P.E., Toni, M., Casolari, C. and Fabio, U. (1989) Ignorance
about Listeria. British Medical Journal, 299 (6701), 738.
Farber, J.M. and Peterkin, P.I. (1991) Listeria monocytogenes, a foodborne pathogen.
Microbiological Reviews; 55, 476-511.
Fenlon, D.R. (1986a) Growth of naturally occurring Listeria spp. in silage: A
comparative study of laboratory and farm ensiled grass. Grass and Forage
Science; 41, 375-378.
Fenlon D.R. (1986b) Rapid quantitative assessment of the distribution of Listeria in
silage implicated in a suspected outbreak of listeriosis in calves. The
Veterinary Record; 118, 240-242.
Fenlon D.R. (1986c) Silage as an enrichment medium for Listeria: The implications for
big bale silage. In Cortieu, A.L., Espaze, E.P. and Reynaud, A.E. Proceeding
of the 9th International Symposium on the Problems of Listeriosis, Nantes,
University of Nantes, France. pp 313-316.
Fenlon D.R. (1988) Listeriosis. In Stark, B.A. and Wilkinson, J.M. (ed.). Silage and
Health. Chalcombe Publications, Aberystwyth. pp 7-19.
Fenlon, D.R. (1985) Wild birds and silage as reservoirs of Listeria in the agricultural
environment. Journal of Applied Bacteriology, 59 (6), 537-543.
Fenlon, D.R. and Wilson, J. (1989) The incidence of Listeria monocytogenes in farm
bulk milks in NE Scotland. Acta Microbiologica Hungarica, 36 (2-3), 255-
258.
228

Fenlon, D.R., Stewart, T. and Donachie, W. (1995a) The incidence, numbers and types
of Listeria monocytogenes isolated from farm bulk tank milks. Letters In
Applied Microbiology, 20 (1), 57-60.
Fenlon, D.R., Henderson, A.R. and Rooke, J.A. (1995b) The fermentative preservation
of grasses and forage crops. Journal of Applied Bacteriology, 79, 118S-131S.
Fenlon, D.R., Wilson, J. and Donachie, W. (1996) The incidence and level of Listeria
monocytogenes contamination of food sources at primary production and
initial processing. Journal of Applied Bacteriology, 81 (6), 641-650.
Fenlon, D.R., Wilson, J. and Weddel, J.R. (1989) The relationship between spoilage and
Listeria monocytogenes contamination in bagged and wrapped big bale
silage. Grass and Forage Science; 44 ,97-100.
Fernandez-Garayzabal, J.F. Delgado, C., Blanco, M., Vazquez-Boland, J.A., Briones,
V., Suarez, G. and Dominguez, L. (1992a) Role of potassium tellurite and
brain heart infusion in expression of the hemolytic phenotype of Listeria spp
on agar plates. Applied and Environmental Microbiology, 58 (1), 434-438.
Fernandez-Garayzabal, J.F., Blanco, M., Vazquezboland, J.A., Briones, V., Garcia, J.A.,
Delgado, C., Domingo, M., Marco, J. and Dominguez, L: (1992b) A direct
plating method for monitoring the contamination of Listeria-monocytogenes
in silage. Journal of Veterinary Medicine Series B-Zentralblatt fur
Veterinarmedizin Reihe B-Infectious Diseases Immunobiology Food Hygiene
Public Health, 39 (7), 513-518.
Fiedler, F. and Seger, J. (1983) The murein types of Listeria grayi, Listeria murrayi
and Listeria denitrificans. Systematic and Applied Microbiology, 4 (4), 444-
450.
229

Fraser, J.A. and Sperber, W.H. (1988) Rapid detection of Listeria spp in food and
environmental samples by esculin hydrolysis. Journal of Food Protection, 51
(10), 762-765.
Freeman, R. Goodfellow, M., Gould, F.K. and Hudson, S.J. (1990) Pyrolysis mass
spectrometry (PyMS) for the rapid epidemiological typing of clinically
significant bacterial pathogens. Journal of Medical Microbiology, 32, 283-
286.
Freeman, R., Sisson, P.R., Lightfoot, N.F. and McLauchlin, J. (1991) Analysis of
epidemic and sporadic strains of Listeria monocytogenes by pyrolysis mass-
spectrometry. Letters in Applied Microbiology, 12 (4), 133-136.
French, N.P., Wall, P., Cripps, P.J. and Morgan, K.L. (1992) Prevalence, regional
distribution and control of blowfly strike in England and Wales. The
Veterinary Record, 131, 337-342.
Furrer, B., Candrian, U., Hoefelein, C. and Luethy, J. (1991) Detection and
identification of Listeria monocytogenes in cooked sausage products and in
milk by in vitro amplification of hemolysin gene fragments. Journal of
Applied Bacteriology, 70 (5), .372-379.
Gates, G.A., Blenden, D.C. and Knither, L.D. (1967) Listeric myelitis in sheep. Journal
of the American Veterinary Medical Association; 150, 200-204.
Gellin, B.G. and Broome, C.V. (1989) Listeriosis. Journal of American Medical
Association, 261 (9), 1313-1320.
Gholizadeh, Y., Poyart, C., Juvin, M., Beretti, J.L., Croize, J., Berche, P. and Gaillard,
J. (1996) Serodiagnosis of listeriosis based upon detection of antibodies
against recombinant truncated forms of Listeriolysin-O. Journal of Clinical
Microbiology, 34 (6), 1391-1395.
230

Gill, A.D. (1933) Circling Disease: A meningo-encephalitis of sheep in New Zealand.
Notes on a new species of pathogenic organisms. Veterinary Journal, 89,
258-270.
Gill, A.D. (1937) Ovine bacterial encephalitis (circling disease) and genus Listerella.
The Australian Veterinary Journal; 13, 46- 57.
Gitter, M. (1986) A changing pattern of ovine Listeriosis in Gt. Britain. In Cortieu,
A.L., Espaze, E.P. and Reynaud, A.E. Proceeding of the 9th International
Symposium on the Problems of Listeriosis, Nantes, University of Nantes,
France. pp 294-299.
Gitter, M. (1989) Veterinary aspects of listeriosis. PHLS Microbiology Digest; 6(2), 38-
42.
Gitter, M. and Terlecki, S. (1965) An outbreak of visceral and cerebral Listeriosis in a
flock of sheep in South East of England. The Veterinary Record, 77, 11-15.
Gitter, M., Richardson, C. and Boughton, E. (1986a) Experimental infection of pregnant
ewes with Listeria monocytogenes. The Veterinary Record, 118 (21), 575-
578.
Gitter, M. Stebbing, R. Morris, J.A., Hannam, D. and Harris, C. (1986b) Relationship
between ovine listeriosis and silage feeding. The Veterinary Record, 118,
207-208.
Gitter, M., Bradley, R. and Blampied, P.H. (1980) Listeria monocytogenes infection in
bovine mastitis. The Veterinary Record; 107, 390-393.
Goebel, W., Kathariu, S., Kuhn, M., Sokoloivc, Z., Kreft, J., Kohler, S., Funke, D.,
Chakraborty, T. and Leimeister-Wacher, M. (1988) Haemolysin from Listeria
-Biochemistry, genetics and function in pathogenesis. Infection 16 (S2),
S149-S156.
231

Golden, D.A, Beuchat, L.R. and Brackett, R.E. (1988) Direct plating technique for
enumeration of Listeria monocytogenes in foods. Journal of The Association
of Official Analytical Chemists, 71 (3), 647-650.
Graves, L.M., Swaminathan, B., Reeves, M.W. and Wenger, J. (1991) Ribosomal DNA
fingerprinting of Listeria monocytogenes using a digoxigenin labelled DNA
probe. European Journal of Epidemiology, 7 (1), 77-82.
Gray, J.W., Barrett, J.F.R., Pedler, S.J. and Lind, T. (1993) Fecal carriage of Listeria
during pregnancy. British Journal of Obstetrics and Gynaecology, 100 (9),
873-874.
Gray, M. L. (1960a). A possible link in the relationship between silage feeding and
Listeriosis. Journal of American Veterinary Medical Association, 136, 205-
208.
Gray, M.L. (1960b). Isolation of Listeria monocytogenes from oat silage. Science.
132:1767-1768.
Gray, M.L. and Killinger, A.H. (1966) Listeria monocytogenes and listeric infections.
Bacteriological Reviews. 30, 309-382.
Gray, M.L., Stafseth, H.J. and Thorp, F.Jr. (1950). The use of potassium tellurite,
sodium azide and acetic acid in a selective medium for the isolation of
Listeria monocytogenes. Journal of Bacteriology, 59, 443-444.
Gray, M.L., Stafsth, H.J., Thorp, F., Jr., Sholl, L.B. and Riley., W.F., Jr. (1948) A new
technique for isolating Listerellae from the bovine brain. Journal of
Bacteriology, 55, 471-476.
Green, L.E. and Morgan, K.L. (1994) Descriptive epidemiology of listerial
meningoenchephilitis in housed lambs. Preventive Veterinary Medicine; 18,
79-87.
232

Greenwood, M.H., Roberts, D. and Burden, P. (1991) The occurrence of Listeria
species in milk and dairy products: A national survey in England and Wales.
International Journal of Food Microbiology, 12 (2-3), 197-206.
Gronstol, H. (1979a) Listeriosis in sheep: Isolation of Listeria monocytogenes from
grass silage. Acta Veterinaria Scandinavia; 20, 492-497.
Gronstol, H (1979b) Listeriosis in sheep. Listeria monocytogenes excretion and
immunological state in healthy sheep. Acta Veterinaria Scandinavia; 20, 168-
179.
Gronstol, H. (1980a) Listeriosis in sheep. Listeria monocytogenes in sheep fed hay or
grass silage during pregnancy. Immunological state, white blood cell, total
serum protein and serum iron. Acta Veterinaria Scandinavia; 21, 1-10.
Gronstol, H. (1980b) Listeriosis in sheep. Isolation of Listeria monocytogenes from
organs of slaughtered animals and dead animals submitted for post-mortem
examination. Acta Veterinaria Scandinavia, 21, 11-17.
Gronstol, H. (1986) Listeria. In Gyles, C.L. and Thoen, O.C. (eds.) Pathogenesis of
Bacterial Infection in Animals. Iowa State Univ. Press. pp 49-55.
Gudding, L., Nesse, L.L. and Gronstol, H. (1989) Immunisation against infection
caused by Listeria monocytogenes in sheep; The Veterinary Record, 125,
111-114.
Hayes, P.S., Graves, L.M., Ajello, G.W., Swaminathan, B., Weaver, R.E., Wenger, J.D.,
Schuchat, A. and Broome, C.V (1991) Comparison of cold enrichment and
United States Department of Agriculture methods for isolating Listeria
monocytogenes from naturally contaminated foods. Applied and
Environmental Microbiology, 57 (8), 2109-2113.
Hird, D.W. and Genigeorgis, C. (1990). Listeriosis in food animals: clinical signs and
livestock as a potential source of direct (non food-borne) infection for
233

humans. In Miller, A.J.,. Smith, J.L and Somkuti G.A. (ed.) Foodborne
listeriosis. Society for Industrial Microbiology. Elsevier Science Publishing,
Inc. New York. pp 31-39.
Hof, H. (1991) Therapeutic activities of antibiotics in listeriosis. Infection, 19 (S4),
S229-S233.
Hofer, E. (1983) Bacteriologic and epidemiologic studies on the occurrence of Listeria
monocytogenes in healthy cattle. Zentralblatt fur Bakteriologie
Mikrobiologie und Hygiene Series A-Medical Microbiology Infectious
Diseases Virology Parasitology, 256 (2), 175-183.
Husu, J.R. (1990) Epidemiologic studies on the occurrence of Listeria monocytogenes
in the faeces of dairy-cattle. Journal of Veterinary Medicine Series B-
Zentralblatt fur Veterinarmedizin Reihe B -Infectious Diseases
Immunobiology Food Hygiene Public Health, 37 (4), 276-282.
Husu, J.R., Sivela, S.K. and Rauramaa, A.L. (1990a) Prevalence of Listeria species as
related to chemical quality of farm ensiled grass. Grass and Forage Science,
45 (3), 309-314.
Husu, J.R., Seppanen, J.T., Sivela, S.K. and Rauramaa, A.L. (1990b) Contamination of
raw-milk by Listeria monocytogenes on dairy farms. Journal of Veterinary
Medicine Series B-Zentralblatt fur Veterinarmedizin Reihe B-Infectious
Diseases Immunobiology Food Hygiene Public Health, 37 (4), 268-275.
Hyslop, N.St.G. (1975) Epidemiologic and immunologic factors in listeriosis. problem
of listeriosis. In Woodbine, M. Proceeding of the 6th International
Symposium on the Problems of Listeriosis, Nottingham, Leicester University
Press, England. pp 94-105.
234

Iida, T., Kanzaki, M., Maruyama, T., Inoue, S. and Kaneuchi, C. (1991) Prevalence of
Listeria monocytogenes in intestinal content of healthy animals in Japan.
Journal of Veterinary Medical Science, 53 (5) 873-875.
Irvin, A.D. (1968) The effect of pH on the multiplication of Listeria monocytogenes in
grass silage media. The Veterinary Record, 82, 115-116.
Ivanov, I., Graganov, M. and Dikova, T. (1979) Study on the active immunoprophylaxis
of sheep listeriosis. In Ivanov, I. (ed.) Proceeding of the Seventh International
Symposium on the Problems of Listeriosis. pp 324-333. Sofia, National
Agroindustrial Union, Centre for Scientific Information.
Jacquet, C., Rocourt, J., and Reynaud, A. (1993) A study of Listeria monocytogenes
contamination in a dairy plant and characterisation of the strains isolated
International Journal of Food Microbiology, 20, (1), 13-22.
Jagger, T.D. (1993) Clinical and immune responses of lambs infected with Listeria
monocytogenes. MSc thesis. University of Edinburgh.
Jay, J.M. (1996) Prevalence of Listeria spp in meat and poultry products. Food Control,
7 (4-5), 209-214.
Johnson, G.C., Fales, W.H., Maddox, C.W. and Ramosvara, J.A. (1995) Evaluation of
laboratory tests for confirming the diagnosis of encephalitic listeriosis in
ruminants. Journal of Veterinary Diagnostic Investigation, 7 (2), 223-228.
Johnson, G.C., Maddox, C., Fales, W., Wolff, W.A., Randle, R., Ramos, J., Schwartz,
H., Heise, K., Baetz, A.L., Wesley, I.V. and Wagner, D. (1996)
Epidemiologic evaluation of encephalitic Listeriosis in goats. Journal of the
American Veterinary Medical Association, 208 (10), 1695-1699.
Johnson, J.L., Doyle, M.P. and Cassens, R.G. (1990) Listeria monocytogenes and other
Listeria spp in meat and meat products: A review. Journal of Food
Protection, 53 (1), 81-91.
235

Jones, F.S. and Little, R.B. (1934) Sporadic encephalitis in cows. Archive in Pathology,
18, 580-581.
Jones, P.W. (1980) Animal health today-Problems of large livestock units. Disease
hazard associated with slurry disposal. British Veterinary Journal, 136, 529-
542.
Juntilla, J.R., Neimele, S.I. and Hirn, J. (1988) Minimum growth temperature of Listeria
monocytogenes and non-haemolytic Listeria. Journal of Applied
Bacteriology; 65, 321-327.
Jurado, R.L., Farley, M.M., Pereira, E., Harvey, R.C., Schuchat, A., Wenger, J.D.,
Stephens, D.S. (1993) Increased risk of meningitis and bacteremia due to
Listeria monocytogenes in patients with human immunodeficiency virus
infection. Clinical Infectious Diseases, 17 (2), 224-227.
Kalac, P. and Woolford, M.K. (1982) A review of some aspects of possible association
between the feeding of silage and animal health. British Veterinary Journal,
138, 305-320.
Kampelmacher, E.H. and van Noorle-Jansen, M.L. (1969) Isolation of Listeria
monocytogenes from faeces of clinically healthy humans and animals.
Zentralblatt für Bakteriologie, Mikrobiologie und Hygiene. Abt. 1: Originale.
Reihe A, 211, 353-359.
Kampelmacher, E.H. and van Noorle-Jansen, M.L. (1975), Occurrence of L.
monocytogenes in effluents. In Woodbine, M. Proceeding of the 6th
International Symposium on the Problems of Listeriosis, Nottingham,
Leicester University Press, England. pp 66-70.
Kanuk, L. and Berenson, C. (1975) Mail surveys and response rates: A literature
review. Journal of Marketing Research, 12, 440-453.
236

Kaufmann, S.H.E. (1990) Immunity to bacteria. Current opinion in Immunology, 2,
353-359.
Kaufmann, S.H.E. (1993) Immunity to intracellular bacteria. Annual Review of
Immunology, 11, 129-163.
Khan, M.A., Seaman, A. and Woodbine, M. (1975) Synergic drug treatment in
experimental Listeriosis. In Woodbine, M. Proceeding of the 6th
International Symposium on the Problems of Listeriosis, Nottingham,
Leicester University Press, England. pp 52-57.
Kirkwood, B.R. (1988) Essentials of Medical Statistics. Blackwell Scientific
Publications, London. pp. 161.
Kozak, J., Balmer, T., Byrne, R. and Fisher, K. (1996) Prevalence of Listeria
monocytogenes in foods; - incidence in dairy-products. Food Control, 7 (4-
5), 215-221.
Kreft, J., Funke, D., Haas, A., Lottspeich, F. and Goebel, W. (1989) Production,
purification and characterisation of haemolysin from Listeria ivanovii and
Listeria monocytogenes Sv 4b. FEMS Microbiology Letters; 57, 197-202.
Kuhn, M. and Goebel, W. (1997) Responses by murine macrophages infected with
Listeria monocytogenes crucial for the development of immunity to this
pathogen. Immunological Reviews, 158 57-67.
Kummeneje, K. and Mikkelsen, T. (1975) Isolation of Listeria monocytogenes type 04
from cases of keratoconjunctivates in cattle and sheep. Nordisk
Veterinaermedicin, 27, 144-149.
Ladds, P.D., Dennis, S.M. and Njoku, C.O. (1974) Pathology of listeric infection in
domestic animals. The Veterinary Bulletin; 44, 68-74.
Lammerding, A.M., Glass, K.A., Gendronfitzpatrick, A.and Doyle, M.P.(1992)
Determination of virulence of different strains of Listeria monocytogenes and
237

Listeria innocua by oral inoculation of pregnant mice. Applied and
Environmental Microbiology, 58 (12), 3991-4000.
Lamont, R.J. and Postlethwaite, R. (1986) Carriage of Listeria monocytogenes and
related species in pregnant and non-pregnant women in Aberdeen, Scotland.
Journal of Infection, 13, (2), 187-193.
Larsen, H.E. (1966) Isolation techniques for Listeria monocytogenes: primary
cultivation and cold incubation technique. Proceeding of the Third
International Symposium on Listeriosis. Bilthoven, The Netherlands. pp 43-
48.
Larsen, S.A., Feeley, J.C. and Jones, W.L. (1974) Immune response to Listeria
monocytogenes in rabbits and humans. Applied Microbiology 27, 1005-1013.
Lawrence, L.M. and Gilmour, A.(1995) Characterization of Listeria monocytogenes
isolated from poultry products and from the poultry-processing environment
by random amplification of polymorphic DNA and multilocus enzyme
electrophoresis. Applied and Environmental Microbiology, 61 (6), 2139-
2144.
Lee, W.H. and McClain, D. (1986) Improved Listeria monocytogenes selective agar.
Applied and Environmental Microbiology, 52 (5), 1215-1217.
Lewis, S.J. and Corry, J.E.L. (1991) Comparison of a cold enrichment and the fda
method for isolating Listeria monocytogenes and other Listeria spp from
ready-to-eat food on retail sale in the UK. International Journal of Food
Microbiology, 12 (2-3), 281-286.
Lhopital, S., Marly, J., Pardon,P. and Berche, P. (1993) Kinetics of antibody production
against Listeriolysin-O in sheep with listeriosis. Journal of Clinical
Microbiology, 31 (6), 1537-1540.
238

Linde, K., Fthenakis, G.C, Lippmann, R., Kinne, J. and Abraham, A. (1995) The
efficacy of a live Listeria monocytogenes combined serotype 1/2a and
serotype 4b vaccine. Vaccine, 13 (10), 923-926.
Linnan, M.J., Mascola, L., Lou, X.D., Goulet, V., May, S., Salminen, C., Hird, D.W.,
Yonekura, M.L., Hayes, P., Weaver, R., Audurier, A., Plikaytis, B.D., Fannin,
S.L., Kleks, A. and Broome, C.V.(1988) Epidemic listeriosis associated with
Mexican-style cheese. New England Journal of Medicine, 319 (13) 823-828.
Lorber, B. (1990) Clinical listeriosis -Implications for pathogenesis. In Miller, A.J.,.
Smith, J.L and Somkuti G.A. (ed.) Foodborne listeriosis. Society for
Industrial Microbiology. Elsevier Science Publishing, Inc. New York. pp 41-
49
Louie, M., Jayaratne, P., Luchsinger, I., Devenish, J., Yao, J, Schlech, W. and Simor, A.
(1996) Comparison of ribotyping, arbitrarily primed PCR, and pulsed-field
gel-electrophoresis for molecular typing of Listeria monocytogenes. Journal
of Clinical Microbiology, 34 (1), 15-19.
Lovett, J. (1990) Taxonomy and general characteristics of Listeria spp. In Miller, A.J.,.
Smith, J.L and Somkuti G.A. (ed.) Foodborne listeriosis. Society for
Industrial Microbiology. Elsevier Science Publishing, Inc. New York. pp 9-
12.
Lovett, J., Francis, D.W. and Hunt, J.M. (1987) Listeria monocytogenes in raw-milk
detection, incidence, and pathogenicity. Journal of Food Protection, 50 (3),
188-192.
Low, J.C. and Donachie, W. (1991) Clinical and serum antibody responses of lambs to
infection by Listeria monocytogenes. Research in Veterinary Science; 51,
185-192.
239

Low, J.C. and Donachie, W.A. (1997) Review of Listeria monocytogenes and listeriosis
The Veterinary Journal, 153, (1), 9-29.
Low, J.C. and Renton, C.P.(1985) Septicemia, encephalitis and abortion in a housed
flock of sheep caused by Listeria monocytogenes type 1/2. The Veterinary
Record; 116, 147-150.
Low, J.C., Chalmers, R.M., Donachie, W., Freeman, R., Mclauchlin, J. and Sisson, P.R.
(1992a) Pyrolysis mass-spectrometry of Listeria monocytogenes isolates from
sheep Research in Veterinary Science, 53, (1), 64-67.
Low, J.C., Davies, R.C. and Donachie, W. (1992b) Purification of listeriolysin O and
development of an immunoassay for diagnosis of listeric infections in sheep.
Journal of Clinical Microbiology; 30 (10), 2705-2708.
Low. C. and Linklater, K. (1985) Listeriosis in sheep. In Practice, 7, 66-67.
Lund, B.M. (1990) The prevention of foodborne Listeriosis. British Food Journal, 92,
13-22
MacDonald, T.T. and Carter, P.B. (1980) Cell-mediated immunity to intestinal
infection. Infection and Immunity, 28 (2), 516-523.
MacGowan, A.P., Holt, H.A., Bywater, M.J. and Reeves, D.S. (1990a) Invitro
antimicrobial susceptibility of Listeria-monocytogenes isolated in the UK and
other Listeria species. European Journal of Clinical Microbiology &
Infectious Diseases, 9 (10), 767-770.
MacGowan, A. P, Reeves, D.S. and Mclauchlin, J. (1990b) Antibiotic resistance of
Listeria monocytogenes. Lancet, 336 (8713) 513-514.
MacGowan, A.P., Bowker, K., Mclauchlin, J., Bennett, P.M. and Reeves, D.S. (1994)
The occurrence and seasonal-changes in the isolation of Listeria spp in shop
bought food stuffs, human feces, sewage and soil from urban sources.
International Journal of Food Microbiology, 21 (4), 325-334.
240

MacGowan, A.P., Marshall, R.J., MacKay, I.M. and Reeves, D.S. (1991) Listeria fecal
carriage by renal-transplant recipients, hemodialysis-patients and patients in
general practice its relation to season, drug therapy, foreign travel, animal
exposure and diet. Epidemiology And Infection, 106 (1), 157-166.
Macgowan, A.P., O’Donaghue, K., Nicholls, S., Mclauchlin, J., Bennett, P.M. and
Reeves, D.S (1993) Typing of Listeria spp by random amplified polymorphic
DNA (RAPD) analysis. Journal of Medical Microbiology, 38, (5), 322-327.
Mackaness, G.B. (1962) Cellular resistance to infection. Journal of Experimental
Medicine, 116, 381-406.
Marco, A., Ramos, J.A., Dominguez, L., Domingo, M and Gonzalez, L. (1988)
Immunocytochemical detection of Listeria monocytogenes in tissue with the
peroxidase-antiperoxidase technique. Veterinary Pathology, 25 (5), 385-387.
Marco, A.J., Prats, N., Ramos, J.A., Briones, V., Blanco, M., Dominguez, L. and
Domingo, M. (1992) A microbiological, histopathological and
immunohistological study of the intragastric inoculation of Listeria
monocytogenes in mice. Journal of Comparative Pathology, 107 (1), 1-9.
Maslow, N.J., Mulligan, M.E. and Arbeit, R.D. (1993) Molecular epidemiology:
Application of Contemporary Techniques to the Typing of Microorganisms.
Clinical Infectious Disease, 17, 153-164.
Mazurier, S.I. and Wernars, K. (1992) Typing of Listeria strains by random
amplification of polymorphic DNA. Research in Microbiology, 143 (5), 499-
505.
Mazurier, S.I., Audurier, A., Marquetvandermee, N., Notermans, S. and Wernars, K.
(1992) A comparative-study of randomly amplified polymorphic DNA
analysis and conventional phage typing for epidemiologic studies of listeria-
monocytogenes isolates. Research in Microbiology, 143 (5), 507-512.
241

McBride, M.E. and Girard, K.F. (1960) A selective method for the isolation of Listeria
monocytogenes from mixed bacterial populations. Journal of Laboratory
Clinical Medicine, 55, 153-157.
McClain, D. and Lee, W.H. (1988) Development of USDA-FSIS method for isolation
of Listeria monocytogenes from raw meat and poultry. Journal of The
Association of Official Analytical Chemists, 71 (3) 660-664.
McKellar, R.C. (1993) Novel mechanism for the camp reaction between Listeria
monocytogenes and Corynebacterium equi. International Journal of Food
Microbiology, 18, 77-82.
McLauchlin, J. (1987) Listeria monocytogenes, recent advances in the taxonomy and
epidemiology of listeriosis in humans. Journal of Applied Bacteriology,. 63
(1), 1-11.
McLauchlin, J. (1996) the relationship between Listeria and Listeriosis. Food Control,
7 (4-5), 187-193.
McLauchlin, J. and Low, C.J. (1994) Primary cutaneous listeriosis in adults: an
occupational disease of veterinarians and farmers. The Veterinary
Record,135, 615-617.
McLauchlin, J., Audurier, A. and Taylor, A.G. (1986) The evaluation of a phage-typing
system for Listeria monocytogenes for use in epidemiological-studies.
Journal of Medical Microbiology, 22 (4), 357-365.
McLauchlin, J., Hall, S.M., Velani, S.K. and Gilbert, R.J. (1991) Human listeriosis and
pate - a possible association. British Medical Journal, 303 (6805), 773-775.
McLauchlin, J., Samuel, D. and Taylor, A.G. (1989) The use of monoclonal-antibodies
to demonstrate Listeria monocytogenes in post mortem tissue using a direct
immunofluorescence technique, and to detect a soluble antigen in CSF
242

supernatants using an ELISA. Acta Microbiologica Hungarica, 36 (2-3), 303-
308.
Mee, J.F. and Rea, M. (1989) Baled silage associated with uveitis in cows (letter). The
Veterinary Record, 124, 25.
Meredith, C.D. and Schneider, D. J.(1984) An outbreak of ovine listeriosis associated
with poor management practice. Journal of the South African Veterinary
Association; 55, 55-56.
Miettinen, A. and Husu, J. (1991) Antibodies to Listeriolysin-O reflect the acquired
resistance to Listeria monocytogenes in experimentally infected goats. FEMS
Microbiology Letters, 77 (2-3), 181-186.
Miettinen, A., Husu, J. and Tuam, J.(1990) Serum antibody response to Listeria
monocytogenes, Listerial excretion and clinical characteristics in
experimentally infected goats. Journal of Clinical Microbiology, 28(2), 340-
343.
Ministry of Agriculture, Fisheries And Food (MAFF) (1994) 1994 Census. MAFF
Agricultural Census Branch.
Morgan, J.H. (1977) Infectious keratoconjunctivitis in cattle associated with Listeria
monocytogenes. The Veterinary Record; 100, 113-114.
Murray, E.G.D., Webb, R.A. and Swann, M.B.R. (1926) A disease of rabbits
characterised by a hitherto undescribed Bacillus bacterium monocytogenes
(n.sp.). Journal Of Pathology; 29, 407-439.
Nash, M.L., Hungerford, L.L., Nash, T.G. and Zinn, G.M. (1995) Epidemiology and
economics of clinical listeriosis in a sheep flock. Preventive Veterinary
Medicine, 24 (3), 147-156.
243

Nieman, R.E. and Lorber, B. (1980) Listeriosis in adults: A changing pattern. Report of
eight cases and review of the literature, 1968-1978. Review of Infectious
Diseases, 2, 207-227.
Njoku, C.O. and Dennis, S.M. (1973) Listeric abortion studies in sheep. IV
Histopathologic comparison of natural and experimental infection. Cornell
Veterinarian, 63, 211-219.
Nocera, D., Altwegg, M., Lucchini, G.M., Bannerman, E., Ischer, F., Rocourt, J. and
Bille, J. (1993) Characterization of Listeria strains from a foodborne
listeriosis outbreak by rDNA gene restriction patterns compared to 4 other
typing methods European Journal of Clinical Microbiology & Infectious
Diseases, 12 (3), 162-169.
Nocera, D., Bannerman, E., Rocourt, J., Jatonogay, K. and Bille, J.(1990)
Characterisation by DNA restriction endonuclease analysis of Listeria
monocytogenes strains related to the Swiss epidemic of listeriosis. Journal of
Clinical Microbiology, 28,(10), 2259-2263.
Norrung, B. and Gernersmidt, P. (1993) Comparison of multilocus enzyme
electrophoresis (MEE), ribotyping, restriction enzyme analysis (REA) and
phage typing for typing of Listeria monocytogenes. Epidemiology and
Infection, 111 (1), 71-79.
Norrung, B. and Skovgaard, N. (1993) Application of multilocus enzyme
electrophoresis in studies of the epidemiology of Listeria monocytogenes in
Denmark. Applied and Environmental Microbiology, 59 (9), 2817-2822.
North, R.J. and Conlan, J.W. (1998) Immunity to Listeria monocytogenes. Chemical
Immunology, 70, 1-20.
O’Donoghue, K., Bowker, K., McLauchlin, J., Reeves, D.S., Bennett, P.M. and
MacGowan, A.P.(1995) Typing of Listeria monocytogenes by random
244

amplified polymorphic DNA (RAPD) analysis. International Journal of Food
Microbiology, 27 (2-3), 245-252.
Ohshima, K., Mira, S., Mumakunai, S. and Chihaya, Y.A. (1974) Case of bovine
cerebral listeriosis with ocular lesions. Japanese Journal of Veterinary
Science; 36, 183-185.
Osebold, J.W. (1963a) Some aspects of the pathogenesis of Listeriosis. In Gray, M.L.
(ed.) Second Symposium of Listeric infection, Montana State College,
Bozeman, pp 109-113.
Osebold J.W. (1963b) Some thoughts on the epidemiology of Listeriosis. In Gray, M.L.
(ed.) Second Symposium of Listeric infection, Montana State College,
Bozeman, pp 141-144.
Osebold, J.W., Kendrick, J.W. and Njoku-Obi, A. (1960) Cattle abortion associated
with natural Listeria monocytogenes infection. Journal of the American
Veterinary Medical Association, 137, 221-226.
Pallson, P.L. (1963) Relation of silage feeding to Listeric infection in sheep. In Gray,
M.L. (ed.) Second Symposium of Listeric infection, Montana State College,
Bozeman, pp 73-84.
Paterson, J.S. (1940) The antigenic structure of organisms of the genus Listerella.
Journal of Pathology and Bacteriology, 51, 427-436.
Peel, M. (1987) A study of the protein antigens of Listeria monocytogenes. PhD Thesis.
Faculty of Veterinary Medicine, Royal (Dick) School of Veterinary Studies.
University of Edinburgh.
Pell, A.N. (1997) Manure and Microbes: Public and Animal Health Problem. Journal of
Dairy Science, 80, 2673-2681.
Perez-Diaz, J.C, Vicente, M.F. and Baquero, F. (1982) Plasmids in Listeria. Plasmid, 8,
(2), 112-118.
245

Peters, M., Pohlenz, J., Jaton, K., Ninet, B. and Bille, J. (1995) Studies of the detection
of Listeria monocytogenes by culture and PCR in cerebrospinal fluid samples
from ruminants with listeric encephalitis. Journal of Veterinary Medicine
Series B-Zentralblatt Fur Veterinarmedizin Reihe B-Infectious Diseases and
Veterinary Public Health.. 42 (2), 84-88.
Picard-Bonnaud, F., Cottin, J. and Carbonnelle, B. (1989) Persistence of Listeria-
monocytogenes in 3 sorts of soil. Acta Microbiologica Hungarica, 36 (2-3),
263-267.
Pini, P.N., Gilbert, R.J. (1988) A comparison of 2 procedures for the isolation of
Listeria monocytogenes from raw chickens and soft cheeses. International
Journal of Food Microbiology, 7 (4), 331-337.
Pinner, R.W., Schuchat, A., Swaminathan, B., Hayes, P.S., Deaver, K.A., Weaver, R.E.,
Plikaytis, B.D., Reeves, M., Broome, C.V. and Wenger, J.D. (1992) Role of
foods in sporadic Listeriosis. 2. Microbiologic and epidemiologic
investigation. JAMA-Journal of the American Medical Association, 267 (15),
2046-2050.
Pirie, J.H.H. (1940) Listeria: change of name for a genus of bacteria. Nature, 145, 264.
Pittman, B. and Cherry, B.W. (1967) Isolation of Listeria monocytogenes from brains of
Rabies-negative animals. American Journal of Veterinary Research, 28 (124)
779-785.
Pohjanvirta, R. and Huttunen, T. (1985) Some aspects of murine experimental
listeriosis. Acta Veterinaria Scandinavica, 26, 563-580.
Portnoy, A.D., Jacks, P.S. and Hinrich, D.J. (1988) Role of haemolysin for the
intracellular growth of Listeria monocytogenes. Journal Of Experimental
Medicine; 167, 1459-1471.
246

Portnoy, D.A. (1992) Innate immunity to a facultative intracellular bacterial
pathogen.Current Opinion in Immunology, 4 (1), 20-24.
Portnoy, D.A., Chakraborty, T., Goebel, W. and Cossart, P. (1992) Molecular
determinants of Listeria monocytogenes pathogenesis. Infection and
Immunity, 60 (4), 1263-1267.
Poyart-Salmeron, C., Carlier, C., Trieucuot, P., Courtieu, A.L. and Courvalin, P.(1990)
Transferable plasmid-mediated antibiotic-resistance in Listeria
monocytogenes. Lancet, 335 (8703), 1422-1426.
Price, H.H. (1975) Outbreak of septicemic listeriosis in a dairy herd. Veterinary
Medicine/Small Animal Clinician; 76 (1), 73-74.
Quentin, C., Thibaut, M.C., Horovitz, J. and Bebear, C. (1990) Multiresistant strain of
Listeria monocytogenes in septic abortion. Lancet, 336, (8711), 375.
Racz, P., Tenner, K. and Mero, E. (1972) Experimental Listeria enteritis. I. An electron
microscopic study of the epithelial phase in experimental Listeria infection.
Laboratory Investigation, 26, 694-700.
Radostits, O.M., Blood, D.C. and Gay, C.C. (1994) Veterinary Medicine 8th Ed.
Bailliare Tindall, Philadelphia, London. pp 660-666.
Ralovich, B. (1992) Data for the properties of Listeria strains. Acta Microbiologica
Hungarica; 39 (2), 105-132.
Ralovich, B. (1993) Detection and epidemiological typing of Listeria strains-Diagnostic
methods for Listeria infection. Acta Microbiologica Hungarica 40 (1), 3-38.
Ralovich, B., Emody, L., Malovics, I., Mero, E. and Forray, A. (1972). Methods to
isolate L. monocytogenes from different materials. Acta Microbiologica
Academiae Scientiarum Hungaricae, 19, 367-369.
Ralovich, B., Forray, A., Mero, E., Malovics, I. and Szazados, I. (1971). New selective
medium for isolation of Listeria monocytogenes. Zentralblatt für
247

Bakteriologie, Mikrobiologie und Hygiene. Abt. 1: Originale. Reihe A.
216:88-89.
Ralovich, B.S. (1987).Epidemiology and significance of Listeriosis in the Europian
countries. In Schonberg, A.(ed.) “Listeriosis joint WHO/ROI consultation on
prevention and control”.pp:21-55. Instut fur Veterimedizin Des Bundes.
Berlin.
Rea, M.C., Cogen, T.M. and Tobin, S.(1992) Incidence of pathogenic bacteria in raw
milk in Ireland. Journal Of Applied Bacteriology; 73, 331-336.
Rebhun, C.W. and deLahunta, A. (1982) Diagnosis and treatment of bovine listeriosis.
Journal of the American Veterinary Medical Association, 180 (4), 395-398.
Rebhun, W.C. (1987) Listeriosis. Veterinary Clinics North America: Food Animal
Practice; 3, 75-83.
Reuter, R., Bowden, M. and Palmer, M. (1989) Ovine listeriosis in south coastal
Western Australia. Australian Veterinary Journal; 66, 223-224.
Rocourt, J. (1996) Risk factors for listeriosis. Food Control, 7, (4-5), 195-202.
Rocourt, J. and, Grimont, P.A.D. (1983) Listeria welshimeri sp. nov. and Listeria
seeligeri sp. nov. International Journal of Systematic Bacteriology, 33 (4),
866-869.
Rocourt, J., Grimont, F., Grimont, P.A.D. and Seeliger, P.R. (1982) DNA relatedness
among serovars of Listeria monocytogenes-sensu lato. Current
Microbiology, 7, (6), 383-388.
Rocourt, J., Wehmeyer, U., Cossart, P. and Stackebrandt, E. (1987) Proposal to retain
Listeria murrayi and Listeria grayi in the genus Listeria. International
Journal of Systematic Bacteriology, 37 (3), 298-300.
Sargison, N. (1993) Health hazard associated with the feeding of big bale silage. In
Practice; 2, 291-297.
248

Scheld, W.M., Fletcher, D.D., Fink, F.N. and Sande, M.A. (1979). Response to Therapy
in an Experimental Rabbit Model of Meningitis Due to Listeria
monocytogenes .The Journal of Infectious diseases.140 (3):287-294.
Schlech, W.F. (1991) Listeriosis: - Epidemiology, virulence and the significance of
contaminated foodstuffs. Journal of Hospital Infection, 19 (4), 211-224.
Schlech, W.F. (1993) An animal model of foodborne Listeria monocytogenes virulence
effect of alterations in local and systemic immunity on invasive infection.
Clinical and Investigative Medicine-Medecine Clinique et Experimentale, 16
(3), 219-225.
Schuchat, A., Deaver, K.A., Wenger, J.D., Plikaytis, B.D., Mascola, L., Pinner, R.W.,
Reingold, A., Broome, C.V. and the Listeria group. (1992) Role of foods in
sporadic Listeriosis. 1. Case-control study of dietary risk factors. JAMA-
Journal of the American Medical Association, 267 (15), 2041-2045.
Schuchat, A., Swaminathan, B. and Broome, C.V. (1991) Epidemiology of human
Listeriosis. Clinical Microbiology Reviews, 4 (2), 169-183.
Schwartz, J.C. (1967) Incidence of Listeriosis in Pennsylvania livestock. Journal of
American Veterinary Medical Association, 151 (11), 1435-1437.
Scott, P.R. (1992) Analysis of cerebrospinal fluid from field cases of some common
ovine neurological diseases. British Veterinary Journal, 148 (1), 15-22.
Scott, P.R. (1993) A field study of ovine Listerial meningoencephalitis with particular
reference to cerebrospinal fluid analysis as an aid to diagnosis and prognosis.
British Veterinary Journal, 149 (2), 165-170.
Seamen, J.T., Carrigan, M.J., Cockram, F.A. and Carter, G.L. (1990) An outbreak of
listerial myelitis in sheep. Australian Veterinary Journal; 67(4), 142-143.
249

Seeliger, H.P.R. (1981) Apathogenic Listeria: L. innocua sp. n. (Seeliger and Schoop,
1977). Zentralblatt für Bakteriologie, Mikrobiologie und Hygiene. Abt. 1:
Originale. Reihe A, 249, 487-493.
Seeliger, H.P.R. (1984) Modern taxonomy of the Listeria group relationship to its
pathogenicity. Clinical and Investigative Medicine-Medecine Clinique Et
Experimentale, 7, (4) 217-221.
Seeliger, H.P.R. (1989) Listeriosis, man-made? Acta Microbiologica Hungarica, 36 (2-
3) 107-111.
Seeliger, H.P.R. and Hohne, K. (1979) Serotyping of Listeria monocytogenes. In
Bergen, T. nad Norris, J.R. (ed.) Methods in Microbiology, Vol.13, pp.31-49.
New York, Academic Press.
Seeliger, H.P.R. and Jones, D. (1986) Genus Listeria Pierie 1940. In: Sneath, Mair,
Sharpe and Holt (eds). Bergey’s Manual of Systemic Bacteriology. Williams
& Wilkins, Baltimore 2, p.1235-1245.
Seeliger, H.P.R., Rocourt, J., Schrettenbrunner, A., Grimont, P.A.D. and Jones, D.
(1984) Listeria ivanovii sp. nov. International Journal of Systematic
Bacteriology, 34 (3), 336-337.
Seimiya, Y., Ohshima, K. Itoh., H. and Murakami, R. (1992) Listeric septicemia with
meningitis in neonatal calf. Journal of Veterinary Medical Science, 54 (6),
1205-1207.
Sergeant, E.S.G., Love, S.C.T. and McInnes, A. (1991) Abortions in sheep due to
Listeria ivanovii. Australian Veterinary Journal; 68(1), 39.
Sheehan, B. Kocks, C., Dramsi, E., Gouin, A.D. Klarsfeld Mengaud, J. and Cossart, P.
(1994) Molecular and genetic determinants of the Listeria monocytogenes
infectious process. Current Topics in Microbiology and Immunology, 192,
184-216.
250

Simpson, A. (1994) Microsoft Access 2. 2nd ed. Sybex Inc. San Francisco.
Sizmur, K. and Walker, C.W. (1988) Listeria in prepacked salads. Lancet, 1 (8595),
1167.
Skalka, B. and Smola, J. (1982) Hemolytic properties of exosubstance of serovar 5
Listeria monocytogenes compared with beta-toxin of Staphylococcus aureus
Zentralblatt fur bakteriologie mikrobiologie und hygiene series a-medical
microbiology infectious diseases virology parasitology, 252 (1), 17-25.
Skovgaard, N. and Morgen, C.A. (1988) Detection of Listeria spp in feces from
animals, in feeds, and in raw foods of animal origin. International Journal of
Food Microbiology, 6 (3), 229-242.
Southwick, F.S. and Purich, D.L. (1996) Intracellular pathogenesis of listeriosis. New
England Journal of Medicine. 334 (12), 770-776.
Stuart, S.E. and Welshimer, H.J. (1973) Intrageneric relatedness of Listeria Pirie.
International Journal of Systemic Bacteriology, 23, 8-14.
Stuart, S.E. and Welshimer, H.J. (1974) Taxonomic reexamination of Listeria Pirie and
transfer of Listeria grayi and Listeria murrayi to new genus, Murraya.
International Journal of Systemic Bacteriology, 24, 8-14.
Swartz, M.A., Welch, D.F., Narayanan, R.P. and Greenfield, R.A. (1991) Catalase
negative Listeria monocytogenes causing meningitis in an adult - clinical and
laboratory features. American Journal of Clinical Pathology, 96 (1), 130-133.
Szemeredi, G.Y. and Padanyi, M. (1989), A ten year’s experience with inactivated
vaccine against Listeriosis of sheep. Acta Microbiologica Hungarica,36 (2-3)
327-330.
Thomson, R.G. (1988) Special Veterinary Pathology. B. C. Decker Inc. Philadelphia.
Thrusfield, M. (1995) Veterinary Epidemiology. 2nd ed. Blackwell Scientific
Publications, London.
251

Tilney, L.G. and Portnoy, D.A. (1989) Actin-filaments and the growth, movement, and
spread of the intracellular bacterial parasite Listeria monocytogenes. Journal
of Cell Biology, 109 (4), 1597-1608.
Tilney, L.G. and Tilney, M.S. (1993) The wily ways of parasite: induction of actin
assembly by Listeria. Trends in Microbiology, 1, 25-31.
Tiwari, N.P. and Aldenrath, S.G. (1990) Isolation of Listeria monocytogenes from
food-products on 4 selective plating media. Journal of Food Protection, 53
(5), 382-385.
Tsakris, A. Papa, A. Douboyas, L. and Antoniadis, A. (1997) Neonatal meningitis due
to multi-resistant Listeria monocytogenes. Journal of Antimicrobial
Chemotherapy, 39, 553-554.
Ueno, H., Yokota, K., Arai, T., Muramatsu, Y., Taniyama, H., Lida, T. and Morita, C.
(1996) The prevalence of Listeria monocytogenes in the environment of
dairy farms. Microbiology and Immunology, 40 (2), 121-124.
Vaillancourt, J.P., Martineau, G., Morrow, M. Marsh, W. and Robinson, A. (1991)
Construction of questionnaires and their use in Veterinary Medicine.
Proceeding of the Society of Veterinary Epidemiology and Preventive
Medicine, London. pp. 94.
Van Renterghem, B., Huysman, F., Rygole, R. and Verstraete, W. (1991) Detection and
prevalence of Listeria monocytogenes in the agricultural ecosystem. Journal
of Applied Bacteriology, 71 (3), 211-217.
Vandegraaff, R., Borland, N.A. and Browning, J. W. (1981) An outbreak of listerial
meningo-encephlitis in sheep. Australian Veterinary Journal; 57, 94-96.
VanNetten, P., Perales, I., Vandemoosdijk, A., Curtis, G.D.W. and Mossel, D.A.A.
(1989) Liquid and solid selective differential media for the detection and
252

enumeration of L. monocytogenes and other Listeria spp. International
Journal of Food Microbiology, 8 (4), 299-316.
Vazquez-Boland, J.A., Domingez, L., Rodriguez-Ferri, E.F. and Suarez, G. (1989a)
Purification and characterisation of two Listeria ivanovii cytolysin, a
sphingomyelinase C and a thiol-activated toxin (Ivonolysin O). Infection and
Immunity; 57(12), 3928-3935.
Vazquez-Boland, J.A., Dominguez, L, Rodriguez-Ferri, E.F., Fernandez-Garayzabal,
J.F. and Suarez, G. (1989b) Preliminary evidence that different domains are
involved in cytolytic activity and receptor (cholesterol) binding in
Listeriolysin-O, the Listeria monocytogenes thiol-activated toxin. FEMS
Microbiology Letters, 65, (1-2), 95-99.
Vazquez-Boland, J.A., Dominguez, L., Blanco, M., Rocourt, J., Fernandez-Garayzabal,
J.F., Gutierrez, C.B., Tascon, R.I. and Rodriguezferri, E.F. (1992)
Epidemiological investigation of a silage-associated epizootic of ovine
listeric encephalitis, using a new Listeria selective enumeration medium and
phage typing. American Journal of Veterinary Research, 53 (3), 368-371.
Vazquez-Boland, J.A., Dominguez, L., Fernandez, J.F., Rodriguezferri, E.F., Briones,
V., Blanco, M. and Suarez, G. (1990) Revision of the validity of CAMP tests
for Listeria identification - Proposal of an alternative method for the
determination of hemolytic-activity by Listeria strains. Acta Microbiologica
Hungarica, 37 (2), 201-206.
Von Koenig, C.H.W. and Finger, H. (1982) Failure of killed Listeria monocytogenes
vaccine to produce protective immunity. Nature, 297 (5863) 233-234.
Walker, J.K. and Morgan, J.H. (1993) Ovine ophtalmitis associated with Listeria
monocytogenes. The Veterinary Record, 132, 636.
253

Walker, J.K., Morgan, J.H., McLauchlin, J., Grant, K.A. and Shallcross, J.A. (1994)
Listeria innocua isolated from a case of ovine meningoencephalitis.
Veterinary Microbiology; 42, 245-253.
Watkins, J. and Sleath, K.P. (1981) Isolation and enumeration of Listeria
monocytogenes from sewage, sewage sludge and river water. Journal of
Applied Bacteriology; 50, 1-9.
Watson, C.L. (1989) Bovine iritis (letter). The Veterinary Record, 124, 411.
Weis J. (1975) Incidence of Listeria monocytogenes on plants and in soil. In Woodbine,
M. Proceeding of the 6th International Symposium on the Problems of
Listeriosis, Nottingham, Leicester University Press, England. pp 61-65.
Weis, J. and Seeliger, H.P.R. (1975) Incidence of Listeria monocytogenes in nature.
Applied Microbiology, 30 (1) 29-32.
Welchman, D.D., Hooton, J.K. and Low, J.C. (1997) Ocular disease associated with
silage feeding and Listeria monocytogenes in fallow deer. The Veterinary
Record, 140 (26), 684-685.
Welshimer, H.J. (1968) Isolation of Listeria monocytogenes from vegetation. Journal of
Bacteriology, 95 (2), 300-303.
Welshimer, H.J. (1975) Listeria in nature. In Woodbine, M. Proceeding of the 6th
International Symposium on the Problems of Listeriosis, Nottingham,
Leicester University Press, England. pp. 59-60.
Welshimer, H.J. and Donker-Voet, J. (1971) Listeria monocytogenes in nature. Applied
Microbiology, 21 (3), 516-519.
Wernars, K., Boerlin, P., Audurier, A., Russell, E.G., Curtis, G.D.W., Herman, L. and
Vandermeemarquet, N. (1996) The WHO multicenter study on Listeria
monocytogenes subtyping -Random amplification of polymorphic DNA
(RAPD). International Journal of Food Microbiology, 32 (3), .325-341.
254

Wiedmann, M., Arvik, T., Bruce, J.L., Neubauer, J., delPiero, F., Smith, M.C., Hurley,
J., Mohammed, H.O. and Batt, C.A. (1997) Investigation of a listeriosis
epizootic in sheep in New York state. American Journal of Veterinary
Research, 58 (7), 733-737.
Wiedmann, M., Bruce, J.L., Knorr, R., Bodis, M., Cole, E.M., Mcdowell, C.I.,
McDonough, P.L. and Batt, C.A. (1996) Ribotype diversity of Listeria
monocytogenes strains associated with outbreaks of listeriosis in ruminants:
Journal of Clinical Microbiology, 34 (5), 1086-1090.
Wiedmann, M., Czajka, J., Bsat, N., Bodis, M., Smith, M.C., Divers, T.J. and Batt, C.A.
(1994) Diagnosis and epidemiologic association of Listeria monocytogenes
strains in 2 outbreaks of listerial encephalitis in small ruminants. Journal of
Clinical Microbiology, 32 (4), 991-996.
Wilesmith, J.W. and Gitter, M. (1986) Epidemiology of ovine listeriosis in Great
Britain. The Veterinary Record; 119, 467-470.
Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990)
DNA polymorphisms amplified by arbitrary primers are useful as genetic-
markers. Nucleic Acids Research, 18 (22), 6531-6535.
Woolford, M.K. (1990) A review: The detrimental effects of air on silage. Journal of
Applied Bacteriology, 68, 101-116.
Wray, C. (1975) Survival and spread of pathogenic bacteria of veterinary importance
within the environment. The Veterinary Bulletin, 45 (8), 543-550.
255

APPENDIX 3
PREPARATION OF BACTERIOLOGICAL MEDIUM:

LSEB (Listeria Selective Enrichment Broth):
Listeria enrichment broth base (Oxoid, code:CM862) 18g
Sterile Distilled Water
500ml
Autoclave at 115atm for 20 minutes
Cool to 50 0 C
Dissolve a vial of Listeria selective enrichment supplement (Oxoid, code:SR141E) in
2ml of ethanol or distilled water and add to 500ml of LEAB
Dispense into 30ml sterile universal containers
LSA (Listeria Selective Agar, Oxford formulation):
Listeria agar base (Oxoid, code:CM856) 28g
Sterile Distilled Water
500ml
Autoclave at 115atm for 20 minutes
Cool to 50 0 C
Dissolve a vial of Listeria selective supplement (oxford formulation) (Oxoid,
code:SR140E) in 2ml of ethanol or distilled water and add to 500ml of LAB.
Pour 20ml into sterile petri dishes
Sugar Plates (SP):
Solution A:
Nutrient Agar Base (Oxoid, code: CM3) 12.6g
Sterile Distilled Water 450ml
Phenol red (Sigma, code:P-4633) 0.2% w/w
Autoclave at 115atm for 20 minutes
Cool to 50 0 C
Solution B:
Sugars* 5g (2%v/w)
Sterile Distilled Water 50ml
Autoclave at 115atm for 20 minutes
(except for Xylose which should be filter sterilised)

Cool to 50 0 C
Mix Solution A with Solution B and then pour 20ml into petri dishes.
* Sugars used in fermentation test are Glucose (BDH, code: 10117), Rhamnose (BDH,
code: 38057), Mannitol (BDH, code: 10330) and Xylose (BDH, code:103723A)
Blood Agar (5%):
Sheep Blood Agar Base (Oxoid, code:CM854) 20g
Sterile Distilled Water 500ml
Autoclave at 115atm for 20 minutes
Cool to 50 0 C
Add 5% sheep blood or horse blood and pour 20ml into petri dishes.
Brain Heart Infusion Broth (BHIB):
Brain Heart Infusion Broth Base (Oxoid, code:CM225) 37g
Sterile Distilled Water 1000ml
Autoclave at 115atm for 20 minutes
Cool to 50 0 C
Peptone Water (PW):
Peptone Water (Oxoid, code:CM9) 15g
Sterile Distilled Water 1000ml
Dispense in to 5ml test tubes.
Autoclave at 115atm for 20 minutes
Store at 4 0 C until use
Liquid growth medium for RAPD:
Listeria enrichment broth base (Oxoid, code:CM862) 18g
Sterile Distilled Water 500ml
Dispense 5 ml into 5ml test tubes
Autoclave at 115atm for 20 minutes
Store at 4 0 C until use.

APPENDIX 4
PREPARATION OF SOLUTION FOR SEROLOGY:

Phosphate buffered saline (PBS; 10x concentrate), pH
NaCl 80g
KCl 2g
Na2HPO4 11.5g
KH2PO4 2g
Sterile Distilled Water 1000ml
PBS Tween 20
PBS 10x concentrate 500ml
Tween 20 2.5ml
Sterile Distilled Water 5000ml
Coating Buffer (pH 9.8):
Na2C03 1.59g
NaHC03 2.93g
Sterile Distilled Water 1000ml

APPENDIX 1
THE QUESTIONNAIRE, COVERING LETTERS AND REMINDERS USED IN
THE CROSS-SECTIONAL STUDY

APPENDIX 2
THE OVERALL RESULTS OF UNIVARIATE ANALYSIS

Abbreviations:
n
number of animals,
R
reference category,
X X 2 for trend,
Outcome variable being “overall” cases
Y number of farmers reporting cases,
N number of farm not reporting cases,
OR, (95% CL) Odds Ratio with 95% confidence limit,
*statistically significant,
M median,
IR, interquartale range,
NF number of farms.
Herd size: Milking cows
June 1995 July 1994
Herd Size n Y N OR p Y N OR p
100 31 141 3.26

Grass silage
Y N OR (95% CL) p Value
fed 93 761 ? 0.05*
source
home made 89 750 0.3 (0.1-1.3) 0.1
purchased 9 27 2.9 (1.2-6.8) 0.01*
outdoor feeding
fed 77 567 1.7 (0.9-3.0) 0.1
ad libitum 9 50 1.4 (0.6-3.1) 0.5
on the ground 1 18 0.4 (0.0-2.9) 0.5
in complete diet 9 71 0.9 (0.4-2.0) 0.9
in ring feeders 55 352 1.5 (0.9-2.7) 0.14
in troughs 16 157 0.7 (0.4-1.3) 0.25
in hay racks NA
off the field 2 23 0.6 (0.1-2.9) 0.7
indoor feeding
fed 92 750 1.4 (0.2-28.7) 0.8
ad libitum 17 107 1.4 (0.7-2.5) 0.35
at the clamp face 23 158 1.3 (7-2.1) 0.46
on the floor 2 67 0.2 (0.04-0.97) 0.04*
in complete diet 12 89 1.1 (0.6-2.2) 0.8
in ring feeders 53 310 1.9 (1.2-3.1) 0.004*
in troughs 27 242 0.9 (0.5-1.4) 0.6
in hay racks NA
off the field NA
duration of feeding
6 months 52 288 1.78
All year 14 70 1.97 0.03*
Grass silage

Month of making
Y N OR (95% CL) p Value
May and before 59 411 1.00
June 23 250 0.64
July and after 6 64 0.63 0.08 X
number of cuts
type of harvester
1 R 13 145 1.00
2 43 382 1.26
3 27 180 1.67
4 2 9 2.48 0.09 X
forage harvester 58 468 1.0 (0.7-1.7) 0.9
discs and drums 33 287 0.9 (0.6-1.5) 0.75
mower conditioner 68 437 2.0 (1.2-3.4) 0.005*
combine harvester 2 3 5.6 (0.6-42) 0.16
wilting
wilted 89 749 0.40 (0.1-1.5) 0.22
additive use
days 0 R 4 12 1.00
1 61 487 0.38
2 23 181 0.38
3 5 78 0.19 0.12 X
used 34 267 1.1 (0.7-1.7) 0.8
inoculant 10 73 0.9 (0.4-1.99) 0.9
inoculant and
enzyme
16 84 1.7 (0.9-3.1) 0.1
enzyme 0 14 0.0 (0.0-3.4) 0.4
acid and salt 5 73 0.5 (0.2-1.4) 0.25
combinations 3 23 1.07 (0.3-3.8) 0.8
Grass silage

storage
Y N OR (95% CL) p Value
clamp 76 585 1.3 (0.8-2.4) 0.35
silo 2 15 1.1 (0.0-5.2) 0.7
big bale 71 453 2.2 (1.3-3.8) 0.002*
storage of big bale
in covered barn 2 11 1.2 (0.0-5.8) 0.8
outside covered 11 83 0.8 (0.4-1.7) 0.68
outside uncovered 57 332 1.5 (0.8-2.9) 0.26
floor of storing area
compacted soil 1 9 0.9 (0.0-6.8) 0.7
concrete 69 534 0.9 (0.4-2.4) 0.9
clamp use
separate clamp 38 252 1.4 (0.9-2.2) 0.16
sealing clamp 33 312 0.8 (0.5-1.3) 0.36
Forage analysis
Grass silage: Clamp 1
NF Median IR p Value
pH no cases 178 4.1 3.9-4.4
cases 23 4.0 3.9-4.2 0.08
DM no cases 183 26.7 23.8-32.3
cases 23 26.0 22.9-29.9 0.4
Ash no cases 138 8.0 6.8-9.1
cases 19 7.9 7.1-8.9 0.8
ME no cases 181 11.0 10.5-11.4
Grass silage: Clamp 2
cases 23 10.8 10.4-11.0 0.2
NF Median IR p Value

pH no cases 82 4.1 3.9-4.3
cases 11 4.1 3.9-4.5 0.8
DM no cases 82 28.6 24.6-31.9
cases 11 30.5 21.9-34.1 0.6
Ash no cases 69 7.9 6.9-8.8
cases 11 8.0 7.5-8.4 0.6
ME no cases 80 10.9 10.6-11.3
Grass silage: Clamp 3
cases 11 10.6 10.3-11.0 0.2
NF Median IR p Value
pH no cases 19 4.1 3.9-4.4
cases 4 4.3 4.1-4.5 0.4
DM no cases 20 30.2 24.4-34.8
cases 4 26.5 23.9-28.9 0.3
Ash no cases 17 8.0 7.3-8.9
cases 4 8.4 7.4-10.0 0.7
ME no cases 20 11.0 10.8-11.2
Grass silage: Big bale
cases 4 10.5 10.2-10.5 0.003*
NF Median IR p Value
pH no cases 16 4.9 4.3-5.3
cases 2 4.6 4.2-4.9 0.5
DM no cases 18 34.2 30.0-45.0
cases 2 31.2 27.5-34.9 0.4
Ash no cases 12 7.2 3.9-8.5
cases 2 8.0 6.5-9.5 0.5
ME no cases 18 10.5 10.1-10.8
Maize silage
cases 2 10.1 9.3-10.9 0.9
Y N OR (95% CL) p Value
fed 39 185 2.4 (1.5-3.9)

source
home made 38 182 0.6 (0.1-16.3) 0.8
purchased 0 6 0.0 (0.0-4.6) 0.5
outdoor feeding
fed 24 104 1.3 (0.6-2.7) 0.6
ad libitum 1 7 0.6 (0.0-5.4) 1.0
on the ground 0 1 0.0 (0.0-79.3) 0.3
in complete diet 7 37 0.8 (0.3-2.2) 0.7
in ring feeders 16 32 4.5 (1.6-13.0) 0.002*
in troughs 5 39 0.4 (0.1-1.4) 0.2
indoor feeding
fed 38 175 0.7 (0.2-3.4) 0.8
ad libitum 5 11 2.4 (0.7-8.3) 0.2
at the clamp face 2 11 0.9 (0.0-4.6) 0.8
on the floor 0 14 0.0 (0.0-1.8) 0.16
in complete diet 10 51 0.9 (0.4-2.2) 0.9
in ring feeders 23 46 4.9 (2.2-11.5)

discs and drums 2 2 4.9 (0.5-51.9) 0.28
mower conditioner 0 4 0.0 (0.0-7.6) 0.8
combine harvester 0 2 0.0 (0.0-20.2) 0.8
additive use
used 20 99 0.97 (0.5-2.1) 0.9
inoculant 9 35 1.3 (0.5-3.2) 0.7
inoculant and
enzyme
5 38 0.6 (0.2-1.7) 0.3
enzyme 3 20 0.7 (0.2-2.6) 0.7
acid and salt 2 3 3.3 (0.2-29.5) 0.5
combinations 1 3 1.6 (0.0-20.5) 0.8
storage
clamp 38 168 3.85 (0.5-81.2) 0.28
silo 1 2 2.4 (0.0-35.7) 0.9
big bale NA
floor of storing area
compacted soil 2 9 0.98 (0.0-5.3) 0.7
concrete 33 145 1.1 (0.3-3.4) 0.8
Forage analysis: Maize silage
NF Median IR p Value
pH no cases 36 3.9 3.8-5.5
cases 2 4.7 3.5-5.8 0.9
DM no cases 38 30.8 27.1-34.4
cases 2 26.9 23.5-30.2 0.3
Ash no cases 25 5.0 3.8-6.2
cases 2 3.8 3.5-4.1 0.2
ME no cases 36 11.0 10.7-11.3
Hay
cases 2 10.8 10.7-10.9 0.5
Y N OR (95% CL) p Value
fed 40 391 0.8 (0.5-1.3) 0.9

source
home made 34 345 0.8 (0.3-2.1) 0.7
purchased 7 60 1.2 (0.5-2.95) 0.8
outdoor feeding
fed 26 223 1.3 (0.6-2.7) 0.6
ad libitum 0 9 0.0 (0.0-5.5) 0.6
on the ground 4 31 1.2 (0.3-4.0) 0.9
in complete diet 2 6 3.2 (0.4-19.1) 0.4
in ring feeders 19 111 2.98 (1.1-8.2) 0.02*
in troughs 3 32 0.8 (0.2-3.1) 0.9
in hay racks 4 65 0.5 (0.1-1.5) 0.25
off the field 1 13 0.7 (0.0-5.4) 0.9
indoor feeding
fed 33 336 0.8 (0.3-2.0) 0.7
ad libitum 0 7 0.0 (0.0-8.4) 0.8
on the floor 0 52 0.0 (0.0-0.85) 0.03*
in complete diet 1 10 1.0 (0.0-8.3) 0.6
in ring feeders 22 109 4.2 (1.8-9.6)

July 9 105 0.86
after July 10 72 1.39 0.5 X
number of cuts
type of harvester
1 R 36 292 1.00
2 3 7 3.48
3 0 3 0.00 0.4 X
discs and drums 19 223 1.0 (0.5-2.3) 0.3
mower conditioner 14 117 1.3 (0.6-2.6) 0.6
wilting
wilted 34 335 0.9 (0.3-2.5) 0.9
storage
days 0 R 6 52 1.00
1 0 3 0.00
2 1 7 1.24
3 33 325 0.88 0.8 X
in covered barn 35 365 0.5 (0.2-1.6) 0.3
outside covered 3 5 6.3 (1.1-32.1) 0.03*
outside uncovered 2 7 2.9 (0.0-16.2) 0.4
Straw
Y N OR (95% CL) p Value
fed 44 378 1.0 (0.6-1.6) 0.9
type

source
barley 27 251 0.93(0.6-1.6) 0.8
barley and wheat 6 34 1.6 (0.6-4.6) 0.5
wheat 5 40 1.2 (0.4-3.5) 0.9
combinations 6 53 1.1(0.4-2.9) 0.9
home made 18 156 0.99 (0.5-1.95) 0.9
purchased 26 235 0.9 (0.4-1.8)
outdoor feeding
fed 25 220 0.9 (0.5-1.9) 0.9
ad libitum 4 17 2.3 (0.6-8.2) 0.3
on the ground 1 19 0.4 (0.0-3.4) 0.7
in complete diet 2 25 0.7 (0.1-3.3) 0.8
in ring feeders 20 114 3.7 (1.3-11.9) 0.01*
in troughs 1 40 0.2 (0.0-1.4) 0.1
in hay racks 3 28 0.9 (0.2-3.6) 0.8
indoor feeding
fed 28 31 0.4 (0.2-0.8) 0.006
ad libitum 2 10 1.8 (0.0-9.9) 0.7
on the floor 4 67 0.7 (0.2-2.4) 0.8
in complete diet 2 31 0.8 (0.3-2.4) 0.8
in ring feeders 10 95 1.3 (0.5-3.0) 0.8
in troughs 4 66 0.6 (0.2-1.99) 0.5
in hay racks 6 48 1.5 (0.5-4.2) 0.5
Straw
duration of feeding
Y N OR (95% CL) p Value

6 months 5 99 0.32
All year 5 35 0.89 0.13 X
Month of making
July and before 6 58 1.00
August 8 116 0.67
September 3 26 1.12 0.5 X
type of harvester
combine harvester 1.2 (0.6-2.3)
drying
dried 21 178 1.02 (0.52-2.0) 0.9
storage
days 0 R 23 199 1.00
1 12 78 1.33
2 6 49 1.06
3 3 51 0.51 0.5 X
in covered barn 30 295 0.6 (0.3-1.3) 0.2
outside covered 6 21 2.68 (0.9-7.67) 0.08
outside uncovered 3 29 0.9 (0.2-3.25) 0.9
Root crops
Y N OR (95% CL) p Value
fed 16 116 1.2 (0.7-2.3) 0.6
type
beet type 5 49 0.5 (0.1-1.9) 0.4

source
potatoes 2 11 1.4 (0.-7.7) 0.9
brassica type 2 31 0.4 (0.1-1.9) 0.4
kale 3 10 2.5 (0.5-11.6) 0.4
combinations 4 15 2.5 (0.6-10) 0.3
home made 14 74 3.97 (0.8-27.0) 0.1
purchased 2 32 0.4 (0.1-1.9) 0.3
outdoor feeding
fed 13 64 3.5 (0.9-16.7) 0.08
ad libitum 2 1 11.5 (0.7-358.3) 0.1
on the ground 1 11 0.4 (0.0-3.6) 0.7
in complete diet 1 5 0.98 (0.0-10.5) 0.61
in ring feeders 1 5 0.98 (0.0-10.5) 0.6
in troughs 3 14 1.1 (0.2-5.2) 0.8
off the field 8 28 2.1 (0.5-8.4) 0.4
indoor feeding
fed 7 64 0.6 (0.2-2.0) 0.5
on the floor 0 15 0.0 (0.0-2.7) 0.3
in complete diet 1 8 1.2 (0.0-12.8) 0.6
in ring feeders 1 6 1.6 (0.0-19) 0.8
in troughs 5 32 2.5 (0.4-20.6) 0.5
Root crops
duration of feeding
Y N OR (95% CL) p Value
6 months 2 121 1.27

All year 1 3 2.53 0.3 X
storage
clamp 5 27 1.5 (0.4-5.3) 0.7
silo 0 2 0.0 (0.0-32.4) 0.6
Housing
Y N OR (95% CL) p Value
housed 91 775 1.5 (0.3-9.6) 0.8
duration of housing
not housed 2 26 1.00
6 months 23 269 1.11
all year 1 9 1.44 0.26 X
Bedding: Sawdust
Y N OR (95% CL) p Value
used 12 146 0.6 (0.3-1.3) 0.2
source
home made 0 1 0.0 (0.0-234.8) 0.1
purchased 12 135 ? 0.6
storage
in a covered barn 11 121 2.5 (0.3-53.9) 0.6
outside covered 0 10 0.0 (0.0-7.1) 0.75
Bedding: Straw
Y N OR (95% CL) p Value
used 85 668 2.2 (0.9-5.7) 0.09
source
home made 34 257 1.1 (0.7-1.7) 0.9
purchased 56 472 0.8 (0.5-1.3) 0.4
storage

in a covered barn 73 595 0.8 (0.4-1.5) 0.5
outside covered 6 55 0.9 (0.3-2.2) 0.9
outside uncovered 13 85 1.2 (0.6-2.4) 0.6
month of making
drying
July 8 63 1.00
August 28 193 1.14
September 3 41 0.58 0.5 X
dried 34 264 1.02 (0.62-1.6) 0.9
days 0 R 51 396 1.00
1 7 73 0.74
2 11 82 1.04
3 16 109 1.14 0.7 X
big bale straw 26 163 1.4 (0.8-2.3) 0.3
type of straw
wheat 18 110 1.34 (0.7-2.5) 0.4
barley 10 106 0.77 (0.35-1.66) 0.6
combinations 12 85 1.2 (0.57-2.47) 0.7
Type of housing: Cubicles
Y N OR (95% CL) p Value
used 77 608 1.5 (0.8-2.9) 0.2
type of floor
earth 13 88 1.2 (0.6-2.4) 0.7
hard core 6 62 0.7 (0.3-1.9) 0.6
concrete 55 461 0.8 (0.5-1.4) 0.5

slatted 0 21 0.0 (0.0-1.9) 0.2
type of bedding
sawdust 12 122 0.7 (0.4-1.5) 0.4
straw 70 484 2.6 (1.1-6.3) 0.02*
use of bedding
adding fresh bedding 77 584 ? 0.15
removing dirty bedding 70 521 1.9 (0.8-5.1) 0.2
cleaning out 15 165 0.7 (0.3-1.2) 0.2
Type of housing: Loose yards
Y N OR (95% CL) p Value
used 31 221 1.3 (0.8-2.1) 0.3
type of floor
earth 5 20 1.9 (0.6-6.2) 0.36
hard core 5 42 0.8 (0.3-2.5) 0.9
concrete 21 162 0.8 (0.3-1.9) 0.66
type of bedding
sawdust 0 7 0.0 (0.0-5.8) 0.8
straw 31 193 ? 0.07
use of bedding
adding fresh bedding 30 199 3.3 (0.4-69.6) 0.4
removing dirty bedding 5 60 0.7 (0.2-1.8) 0.6
cleaning out 20 161 0.7 (0.3-1.6) 0.45
Type of housing: Others
Y N OR (95% CL) p Value
used 1 65 0.12 (0.0-0.83) 0.02*
type of floor
earth 0 3 0.0 (0.0-527) 0.02*
hard core 0 1 0.0 (0.0-7248)

sawdust 0 16 0.0 (0.0-2.73) 0.3
straw 0 56 0.0 (0.0-0.7) 0.01*
use of bedding
adding fresh bedding 0 57 0.0 (0.0-2.8) 0.3
removing dirty bedding 0 56 0.0 (0.0-3.2) 0.3
cleaning out 0 37 0.0 (0.0-14.1) 0.9
Dung disposal: Solid manure
Y N OR (95% CL) p
disposed 44 371 1.04 (0.7-1.6) 0.9
storage
not stored 4 14 2.6 (0.7-8.95) 0.2
beneath the slats 3 2 13.5 (1.7-121.2) 0.003*
composted 27 217 1.13 (0.6-2.3) 0.8
in a slurry tank 2 8 2.2 (0.0-11.7) 0.6
in a lagoon 9 64 1.2 (0.5-2.9) 0.75
Dung disposal: Slurry
Y N OR (95% CL) p Value
disposed
storage
71 521 1.73 (1.0-2.97) 0.03*
not stored 13 84 1.2 (0.6-2.3) 0.75
beneath the slats 3 53 0.4 (0.1-1.4) 0.16
composted 1 8 0.92 (0.0-7.5) 0.66
in a slurry tank 26 191 1.0 (0.6-1.7) 0.9
in a lagoon 27 196 1.0 (0.6-1.8) 0.9
General management
pasture management
Y N OR (95% CL) p Value
spread dung on the field 65 594 0.8 (0.5-1.3) 0.4
grazing beef cattle 17 194 0.7 (0.4-1.3) 0.25
grazing sheep 44 437 0.8 (0.5-1.2) 0.22
Listeriosis in others
beef cattle 11 3 32.4 (8.1-151.2)

Vaccine
Salmonellosis 2 19 0.9 (0.0-4.2) 0.9
E. coli 2 11 1.6 (0.0-7.8) 0.9
Leptospirosis 39 202 2.1 (1.3-3.4)

APPENDIX 5
THE QUESTIONNAIRE AND THE EXPLANATION LETTER USED IN THE
LONGITUDINAL STUDY

APPENDIX 6
THE OVERALL RESULTS OF ELISA

Abbreviations:
1 first blood sampling
2 second blood sampling
3 third blood sampling
ODs optical densities (beneath the thick black line)
B blank wells
S standard (positive) control serum
N negative control serum
Farm A:
Plate 1 Layout and ODs
B 1 1 1 2 1 3 2 1 2 2 2 3 1 3 2 S N B
B 4 1 4 2 4 3 5 1 5 2 5 3 3 3 6 1 S N B
B 7 7 2 7 3 8 8 2 8 3 6 2 6 3 S N B
B 9 1 9 2 9 3 10 1 10 2 10 3 11 1 11 2 S N B
B 12 1 12 2 12 3 13 1 13 2 13 3 11 3 14 1 S N B
B 15 1 15 2 15 3 16 1 16 2 16 3 14 2 14 3 S N B
B 17 1 17 2 17 3 18 1 18 2 18 3 19 1 19 2 S N B
B 20 1 20 2 20 3 21 1 21 2 21 3 19 3 22 1 S N B
0.124 1.035 1.001 1.290 1.210 1.489 1.156 0.954 1.057 0.743 0.168 0.142
0.111 0.567 0.546 0.551 0.573 0.495 0.684 0.641 0.743 0.435 0.121 0.120
0.108 0.546 0.535 0.723 0.685 0.607 0.643 0.591 0.663 0.425 0.107 0.119
0.114 0.632 0.730 0.666 0.552 0.541 0.572 0.688 0.680 0.304 0.107 0.114
0.105 0.696 0.774 0.761 0.602 0.609 0.459 0.649 0.615 0.240 0.099 0.119
0.114 0.736 0.717 0.683 0.724 0.659 0.747 0.611 0.742 0.208 0.098 0.121
0.111 0.846 0.859 0.551 0.647 0.748 0.788 0.773 0.838 0.188 0.101 0.122
0.122 0.928 0.889 0.887 1.251 1.338 1.441 0.820 0.522 0.182 0.107 0.129
Plate 2 Lay out and ODs
B 23 1 23 2 23 3 24 1 24 2 24 3 25 1 25 2 S N B
B 26 1 26 2 26 3 27 1 27 2 27 3 25 3 28 1 S N B
B 29 1 29 2 29 3 30 1 30 2 30 3 28 2 28 3 S N B
B 31 1 31 2 31 3 32 1 32 2 32 3 33 1 33 2 S N B
B 34 1 34 2 34 3 35 1 35 2 35 3 33 3 36 1 S N B
B 37 1 37 2 37 3 38 1 38 2 38 3 36 2 36 3 S N B
B 39 1 39 2 39 3 40 1 40 2 40 3 41 1 41 2 S N B
B 42 1 42 2 42 3 43 1 43 2 43 3 41 3 44 1 S N B
0.107 0.476 0.779 1.079 1.176 1.100 1.163 1.021 1.258 0.593 0.138 0.124
0.215 0.491 0.692 0.650 0.916 0.972 0.773 0.897 0.751 0.560 0.121 0.117
0.116 0.559 0.705 0.863 0.851 0.812 0.647 0.530 0.680 0.356 0.117 0.120
0.106 0.635 0.643 0.752 0.685 0.670 0.725 0.640 0.684 0.406 0.112 0.119
0.102 0.501 0.565 0.593 0.845 0.821 0.815 0.748 0.493 0.247 0.105 0.119
0.090 0.561 0.729 0.740 0.860 0.686 1.017 0.728 0.705 0.226 0.105 0.126
0.089 0.588 0.581 0.738 0.694 0.839 0.735 0.575 0.669 0.169 0.110 0.128
0.101 0.594 0.759 0.775 0.769 0.915 0.881 0.841 0.578 0.155 0.106 0.125
Plate 3 Layout and ODs

B 45 1 45 2 45 3 46 1 46 2 46 3 47 1 47 2 S N B
B 48 1 48 2 48 3 49 1 49 2 49 3 47 3 50 1 S N B
B 51 1 51 2 51 3 52 1 52 2 52 3 50 2 50 3 S N B
B 53 1 53 2 53 3 54 1 54 2 54 3 55 1 55 2 S N B
B 56 1 56 2 56 3 57 1 57 2 57 3 55 3 58 1 S N B
B 59 1 59 2 59 3 60 1 60 2 60 3 58 2 58 2 S N B
B 61 1 61 2 61 3 62 1 62 2 62 3 63 1 63 2 S N B
B 64 1 64 2 64 3 65 1 65 2 65 3 63 3 66 1 S N B
0.126 0.773 0.904 0.973 1.072 1.125 1.056 0.982 0.789 0.438 0.145 0.218
0.122 0.879 0.858 0.886 0.755 1.058 0.678 0.668 0.867 0.536 0.191 0.146
0.126 0.774 0.684 0.876 0.790 0.713 0.598 0.687 1.027 0.446 0.126 0.149
0.117 0.749 0.717 0.842 0.994 0.907 0.779 0.638 0.670 0.339 0.122 0.141
0.119 0.795 0.544 0.691 0.872 0.986 0.952 0.864 0.839 0.262 0.115 0.141
0.131 0.684 0.807 0.793 0.806 0.961 0.949 0.759 0.824 0.230 0.128 0.154
0.120 0.944 0.816 0.858 0.538 0.925 0.801 0.807 0.653 0.207 0.118 0.167
0.152 0.714 0.810 0.847 0.763 0.797 0.854 0.759 0.875 0.199 0.125 0.160
Plate 4 Layout and ODs
B 67 1 67 2 67 3 68 1 68 2 68 3 69 1 69 2 S N B
B 70 1 70 2 70 3 71 1 71 2 71 3 72 1 72 2 S N B
B 73 1 73 2 73 3 74 1 74 2 74 3 75 2 75 3 S N B
B 76 1 76 2 76 3 77 1 77 2 77 3 78 1 78 2 S N B
B 79 1 79 2 79 3 80 1 80 2 80 3 81 1 81 2 S N B
B 82 1 82 2 82 3 83 1 83 2 83 3 84 1 84 2 S N B
B 85 1 85 2 85 3 86 1 86 2 86 3 87 1 88 1 S N B
B 89 3 90 3 91 3 92 3 93 3 94 3 95 3 96 1 S N B
0.127 0.757 0.459 1.010 0.928 0.821 0.860 0.967 0.868 0.588 0.145 0.110
0.118 0.703 0.809 0.815 0.620 0.849 0.712 0.758 0.879 0.402 0.120 0.108
0.124 0.586 0.609 0.512 0.762 0.833 0.792 0.584 0.705 0.323 0.124 0.111
0.139 0.833 0.858 0.869 0.620 0.704 0.693 0.640 0.777 0.254 0.109 0.119
0.141 0.651 0.659 0.773 0.708 0.421 0.741 0.676 0.704 0.242 0.110 0.115
0.117 0.661 0.670 0.765 0.689 0.809 0.707 0.799 0.842 0.212 0.110 0.125
0.123 0.512 0.687 0.682 0.600 0.702 0.608 0.849 0.791 0.178 0.106 0.133
0.125 0.175 0.363 0.889 0.722 0.751 0.941 1.027 0.836 0.145 0.111 0.140
Plate 5 Layout and ODs
B 97 1 98 1 99 1 100 1 101 1 102 1 103 1 104 1 S N B
B 105 1 106 1 107 1 108 1 109 1 110 1 111 1 112 1 S N B

B 113 1 114 1 115 1 116 1 117 1 118 1 119 1 B S N B
B B B B B B B B B S N B
B B B B B B B B B S N B
B B B B B B B B B S N B
B B B B B B B B B S N B
B B B B B B B B B S N B
0.126 0.702 1.017 1.052 0.970 0.368 0.669 1.023 1.108 0.585 0.133 0.097
0.116 1.092 1.063 1.012 0.431 0.540 0.789 0.953 1.128 0.665 0.132 0.108
0.109 1.000 1.058 0.912 0.803 1.011 0.904 0.768 0.099 0.437 0.122 0.106
0.120 0.113 0.117 0.108 0.105 0.112 0.103 0.098 0.110 0.559 0.120 0.103
0.117 0.116 0.107 0.108 0.115 0.106 0.102 0.098 0.108 0.398 0.111 0.101
0.122 0.119 0.117 0.117 0.112 0.119 0.124 0.101 0.109 0.299 0.099 0.098
0.111 0.115 0.116 0.123 0.125 0.132 0.114 0.104 0.102 0.180 0.115 0.100
0.119 0.118 0.126 0.129 0.131 0.139 0.125 0.106 0.117 0.149 0.118 0.104
Farm B
Plate 1 Layout and ODs
B 1 1 1 2 1 3 2 1 2 2 2 3 3 1 3 2 S N B
B 4 1 4 2 4 3 5 1 5 2 5 3 6 1 6 2 S N B
B 7 7 2 7 3 8 8 2 8 3 9 1 9 2 S N B
B 10 1 10 2 10 3 11 1 11 2 11 3 12 1 12 2 S N B
B 13 1 13 2 13 3 14 1 14 2 14 3 15 1 15 5 S N B
B 16 1 16 2 16 3 17 1 17 2 17 3 18 1 18 2 S N B
B 19 1 19 2 19 3 20 1 20 2 20 3 21 2 21 3 S N B
B 22 1 22 2 22 3 23 1 23 2 23 3 24 2 24 3 S N B
0.161 1.130 1.368 1.039 0.854 1.359 1.109 1.175 1.188 0.986 0.179 0.115
0.134 1.215 1.389 0.464 1.045 1.271 1.408 1.134 1.126 0.724 0.150 0.119
0.148 0.735 0.932 0.810 0.817 0.943 1.013 1.128 1.263 0.679 0.125 0.113
0.133 1.303 1.300 1.130 1.180 1.189 1.182 1.030 0.999 0.377 0.118 0.119
0.139 1.164 1.066 1.033 1.193 0.823 1.151 1.170 0.840 0.323 0.109 0.114
0.166 1.260 1.038 0.643 0.504 0.671 0.662 1.082 1.074 0.234 0.106 0.114
0.139 1.234 1.135 1.235 0.948 0.970 1.140 1.078 1.068 0.200 0.114 0.110
0.159 1.139 0.994 1.319 1.121 1.172 1.343 1.286 1.156 0.136 0.103 0.114
Plate 2 Layout and ODs
B 25 1 25 2 25 3 26 1 26 2 26 3 27 1 27 3 S N B
B 28 1 28 2 28 3 29 1 29 2 29 3 30 2 30 3 S N B
B 31 1 31 2 31 3 32 1 32 2 32 3 33 2 33 3 S N B
B 34 1 34 2 34 3 35 1 35 2 35 3 36 2 36 3 S N B

B 37 1 37 2 37 3 38 1 38 2 38 3 39 2 39 3 S N B
B 40 1 40 2 40 3 41 1 41 2 41 3 42 2 42 3 S N B
B 43 1 43 2 43 3 44 1 44 2 44 3 45 1 45 3 S N B
B 46 1 46 2 46 3 47 1 47 2 47 3 48 3 49 1 S N B
0.179 1.526 0.648 0.589 0.699 1.396 1.173 1.132 1.357 0.872 0.192 0.136
0.168 1.671 1.735 0.549 1.519 1.399 1.246 1.382 1.093 0.794 0.140 0.117
0.173 1.556 1.305 0.965 1.670 1.266 1.031 1.274 1.310 0.580 0.135 0.121
0.209 1.581 1.745 1.486 1.526 1.337 1.095 1.245 1.509 0.428 0.282 0.112
0.171 1.573 1.285 1.662 1.504 0.900 1.227 1.108 1.159 0.411 0.119 0.119
0.161 1.633 1.383 1.472 1.433 0.847 1.275 0.928 1.170 0.248 0.120 0.122
0.213 1.686 1.637 1.623 1.394 1.411 1.567 1.448 1.322 0.201 0.120 0.126
0.156 1.341 1.308 1.628 1.439 1.528 1.184 1.212 0.965 0.149 0.120 0.149
Plate 3 layout and ODs
B 50 1 50 2 50 3 51 1 51 2 51 3 52 1 53 1 S N B
B 54 1 54 2 54 3 55 1 55 2 55 3 56 1 57 1 S N B
B 58 1 58 2 58 2 59 1 59 2 59 3 60 1 61 1 S N B
B 62 1 62 2 62 3 63 1 63 2 63 3 64 1 65 1 S N B
B 66 1 66 2 66 3 67 1 67 2 67 3 68 1 69 1 S N B
B 70 1 70 2 70 3 71 1 71 2 71 3 72 1 73 1 S N B
B 74 1 74 2 74 3 75 1 75 2 75 3 76 1 77 1 S N B
B 78 1 78 2 78 3 79 1 79 2 79 3 80 1 81 1 S N B
0.160 1.685 1.670 1.586 1.360 1.522 1.003 1.269 1.596 1.018 0.261 0.147
0.151 1.515 1.319 1.265 1.375 1.397 1.136 1.495 1.140 0.766 0.169 0.148
0.149 1.387 1.536 1.323 0.968 1.476 1.468 1.433 1.371 0.762 0.148 0.145
0.149 1.551 1.541 1.452 1.352 1.431 1.086 1.214 1.484 0.449 0.161 0.152
0.143 1.029 1.540 1.367 1.451 1.429 0.974 1.542 1.294 0.370 0.155 0.135
0.146 1.265 1.314 1.322 1.440 1.340 1.286 1.490 1.244 0.219 0.146 0.139
0.155 1.391 1.280 1.432 1.549 1.375 0.955 1.484 1.727 0.198 0.158 0.139
0.155 1.670 1.594 1.691 1.530 1.535 1.528 1.612 1.339 0.962 0.137 0.131
Plate 4 Layout and ODs
B 82 1 82 2 82 3 83 1 83 2 83 3 84 1 84 2 S N B
B 85 1 85 2 85 3 86 1 86 2 86 3 84 3 B S N B
B 87 1 87 2 87 3 88 1 88 2 88 3 89 1 90 3 S N B
B 91 1 91 2 91 3 92 1 92 2 92 3 93 1 94 3 S N B
B 95 1 95 2 96 3 97 1 97 2 97 3 98 1 99 3 S N B
B 100 1 100 2 100 3 101 1 101 2 101 3 102 1 103 3 S N B

B 104 1 104 2 104 3 105 1 105 2 105 3 106 1 106 3 S N B
B 107 1 107 2 107 3 108 1 108 2 108 3 109 3 110 3 S N B
0.186 1.524 1.909 1.589 1.843 1.537 1.869 1.557 1.848 0.967 0.232 0.135
0.194 1.413 1.511 1.515 1.763 1.592 1.548 1.079 0.132 0.917 0.250 0.144
0.185 0.787 1.636 1.802 1.454 1.738 1.494 1.465 1.359 0.787 0.155 0.156
0.191 1.726 1.458 1.861 1.420 1.306 1.537 1.547 1.631 0.391 0.141 0.134
0.179 1.293 1.445 1.869 1.607 1.464 1.577 1.302 1.331 0.374 1.660 0.137
0.177 1.401 1.388 1.857 1.683 1.431 1.405 1.451 1.578 0.294 0.163 0.145
0.177 1.436 1.208 1.690 1.507 1.493 1.560 1.495 1.402 0.223 0.146 0.149
0.172 0.649 0.673 1.412 1.453 1.194 1.635 1.393 1.520 0.199 0.140 0.151
Farm C
Plate 1 Layout and ODs
B 1 1 4 1 7 1 10 1 13 1 16 1 19 1 22 1 S N B
B 1 2 4 2 7 2 10 2 13 2 16 2 19 2 22 2 S N B
B 1 3 4 3 7 3 10 3 13 3 16 3 19 3 22 3 S N B
B 2 1 5 1 8 1 11 1 14 1 17 1 20 1 23 1 S N B
B 2 2 5 2 8 2 11 2 14 2 17 2 20 2 23 2 S N B
B 2 3 5 3 8 3 11 3 14 3 17 3 20 3 23 3 S N B
B 3 1 6 1 9 1 12 1 15 1 18 2 21 1 24 2 S N B
B 3 2 6 2 9 2 12 2 15 3 18 3 21 2 24 3 S N B
0.154 1.275 1.582 1.459 1.671 1.620 1.853 1.760 1.503 1.459 0.341 0.165
0.142 1.173 1.323 1.686 1.748 1.817 1.953 2.009 1.585 0.919 0.249 0.165
0.151 1.161 1.433 1.751 1.292 1.410 1.506 1.485 1.142 0.738 0.184 0.152
0.139 1.414 1.440 1.440 1.610 1.428 1.502 1.684 1.680 0.571 0.164 0.164
0.140 1.374 1.514 1.514 1.561 1.533 1.433 1.759 1.347 0.334 0.132 0.170
0.134 1.188 0.930 0.930 1.477 1.604 1.210 1.423 0.963 0.225 0.132 0.175
0.166 1.417 1.175 1.093 1.300 1.472 1.232 1.416 1.359 0.258 0.141 0.190
0.168 1.341 1.263 1.131 1.379 1.531 1.495 1.761 1.588 0.262 0.154 0.178
Plate 2 Layout and ODs
B 25 1 28 1 32 1 36 1 40 1 44 1 48 1 51 1 S N B
B 25 2 28 2 32 2 36 2 40 2 44 2 48 2 51 2 S N B
B 25 3 28 3 32 3 36 3 40 3 44 3 48 3 51 3 S N B
B 26 1 29 1 33 1 37 1 41 1 45 1 49 1 52 1 S N B
B 26 2 29 2 33 2 37 2 41 2 45 2 49 2 52 2 S N B
B 26 3 29 3 33 3 37 3 41 3 45 3 49 3 52 3 S N B
B 27 1 30 1 34 1 38 1 42 1 46 2 50 1 50 3 S N B

B 27 2 31 1 35 2 39 2 43 2 47 3 50 2 53 1 S N B
0.137 1.251 1.181 1.334 1.590 1.480 1.300 1.318 1.765 0.976 0.263 0.173
0.303 1.002 1.315 1.124 1.383 1.188 1.210 1.206 1.321 0.748 0.193 0.128
0.321 1.195 1.268 1.347 1.593 0.996 1.053 1.019 1.187 0.616 0.145 0.113
0.125 1.353 1.606 1.498 1.400 1.076 1.361 1.242 1.237 0.385 0.133 0.121
0.118 1.615 1.772 1.378 1.321 0.902 1.054 1.113 1.290 0.284 0.124 0.115
0.122 1.429 1.766 1.564 1.222 0.830 1.254 1.245 1.273 0.192 0.114 0.123
0.129 1.701 1.454 1.312 1.419 1.412 1.429 1.296 1.401 0.165 0.113 0.134
0.133 1.503 1.458 1.653 1.462 1.126 1.266 1.333 1.341 0.176 0.130 0.181
Plate 3 Layout and ODs
B 54 1 56 1 58 1 60 1 62 1 64 1 66 1 B S N B
B 54 2 56 2 58 2 60 2 62 2 64 2 66 2 B S N B
B 54 3 56 3 58 3 60 3 62 3 64 3 66 3 B S N B
B 55 1 57 1 59 1 61 1 63 1 65 1 67 1 B S N B
B 55 2 57 2 59 2 61 2 63 2 65 2 67 2 B S N B
B 55 3 57 3 59 3 61 3 63 3 65 3 67 3 B S N B
B B B B B B B B B S N B
B B B B B B B B B S N B
0.132 1.401 1.244 0.936 1.072 1.161 1.390 1.293 0.122 0.994 0.196 0.136
0.234 1.166 1.244 0.806 0.928 1.214 1.252 0.903 0.119 0.610 0.163 0.126
0.111 1.224 1.211 0.781 0.803 0.944 1.076 1.109 0.123 0.518 0.144 0.131
0.123 0.952 0.902 1.250 1.233 0.998 0.875 1.495 0.112 0.360 0.134 0.168
0.116 1.191 0.868 1.185 1.263 0.889 1.045 1.211 0.116 0.261 0.129 0.137
0.115 1.271 1.048 1.441 1.101 1.264 1.239 1.144 0.105 0.235 0.120 0.133
0.111 0.116 0.112 0.118 0.116 0.122 0.114 0.118 0.113 0.171 0.124 0.135
0.127 0.120 0.125 0.139 0.134 0.143 0.143 0.138 0.138 0.179 0.135 0.186
Farm D
Plate 1 Layout and ODs
B 1 1 1 2 1 3 2 1 2 2 2 3 3 1 3 2 S N B
B 4 1 4 2 4 3 5 1 5 2 5 3 3 3 6 1 S N B
B 7 1 7 2 7 3 8 1 8 2 8 3 6 2 6 3 S N B
B 9 1 9 2 9 3 10 1 10 2 10 3 11 1 11 3 S N B
B 12 1 12 2 12 3 13 1 13 2 13 3 11 2 14 1 S N B
B 15 1 15 2 15 3 16 1 16 2 16 3 14 2 14 3 S N B
B 17 1 17 2 17 3 18 1 18 2 18 3 19 1 19 2 S N B

B 20 1 20 2 20 3 21 1 21 2 21 3 19 3 22 1 S N B
0.162 1.639 1.347 1.260 1.322 1.139 0.943 0.876 1.001 0.592 0.162 0.121
0.163 1.740 1.530 1.537 1.648 1.073 1.309 1.208 1.137 0.639 0.202 0.134
0.159 2.209 2.051 1.856 1.577 1.605 1.310 1.309 1.470 0.422 0.141 0.124
0.140 1.731 1.943 1.817 1.944 1.548 1.711 1.686 1.394 0.328 0.127 0.113
0.143 2.021 2.079 2.054 1.930 1.597 1.555 1.801 1.420 0.273 0.123 0.130
0.129 1.981 2.043 1.744 1.787 1.701 1.737 1.197 1.259 0.180 0.124 0.136
0.136 2.210 2.151 2.055 1.879 2.048 1.870 1.714 1.658 0.169 0.118 0.125
0.132 2.194 2.170 2.010 2.149 2.117 1.935 1.789 2.113 0.183 0.119 0.132
Plate 2 Layout and ODs
B 23 1 23 2 23 3 24 1 24 2 24 3 25 1 25 2 S N B
B 26 1 26 2 26 3 27 1 27 2 27 3 25 3 28 1 S N B
B 29 1 29 2 29 3 30 1 30 2 30 3 28 2 28 3 S N B
B 31 1 31 2 31 3 32 1 32 2 32 3 33 1 33 2 S N B
B 34 1 34 2 34 3 35 1 35 2 35 3 33 3 36 1 S N B
B 37 1 37 2 37 3 38 1 38 2 38 3 36 2 36 3 S N B
B 39 1 39 2 39 3 40 1 40 2 40 3 41 1 41 2 S N B
B 42 1 42 2 42 3 43 1 43 2 43 3 41 3 44 1 S N B
0.109 1.091 1.179 1.181 1.298 1.243 1.178 1.105 0.990 0.785 0.196 0.131
0.120 1.417 1.502 1.558 1.142 1.472 1.368 1.310 1.040 0.602 0.164 0.117
0.132 1.648 1.523 1.489 1.271 1.294 1.205 1.367 1.387 0.660 0.144 0.133
0.125 1.685 1.594 1.681 1.598 1.839 1.007 1.929 1.945 0.438 0.148 0.128
0.169 2.059 1.883 1.970 2.096 1.865 1.132 1.971 1.879 0.328 0.134 0.142
0.141 1.698 1.734 1.958 1.815 1.860 2.071 1.529 1.789 0.238 0.131 0.133
0.132 2.045 2.218 2.137 2.006 1.397 1.877 1.462 1.563 0.193 0.119 0.132
0.129 1.786 2.052 2.106 2.005 1.557 1.606 1.429 1.506 0.148 0.117 0.142
Plate 3 Layout and ODs
B 45 1 45 2 45 3 46 1 46 2 46 3 47 1 47 2 S N B
B 48 1 48 2 48 3 49 1 49 2 49 3 47 3 50 1 S N B
B 51 1 51 2 51 3 52 1 52 2 52 3 50 2 50 3 S N B
B 53 1 53 2 53 3 54 1 54 2 54 3 55 1 55 2 S N B
B 56 1 56 2 56 3 57 1 57 2 57 3 55 3 58 1 S N B
B 59 1 59 2 59 3 60 1 60 2 60 3 58 2 58 3 S N B
B 61 1 61 2 61 3 62 1 62 2 62 3 63 1 63 3 S N B
B 64 1 64 2 64 3 65 1 65 2 65 3 66 1 66 2 S N B
0.151 2.112 1.909 1.954 1.890 0.606 1.515 2.171 1.910 1.455 0.273 0.210
0.175 2.207 1.888 1.891 1.418 1.416 1.423 1.787 1.985 1.057 0.199 0.142

0.150 1.838 1.194 1.855 1.834 1.194 1.537 1.977 2.058 0.796 0.148 0.136
0.140 2.287 2.153 2.071 2.078 1.792 1.827 1.868 2.092 0.709 0.151 0.130
0.137 2.486 2.603 2.086 2.172 2.100 2.121 2.109 1.918 0.589 0.209 0.131
0.143 2.496 2.246 2.318 1.298 1.844 2.037 2.116 2.423 0.657 0.152 0.196
0.131 1.798 1.597 1.510 2.134 1.847 1.103 1.737 2.296 0.540 0.149 0.134
0.151 2.072 1.233 0.789 1.445 1.217 1.680 2.017 2.030 0.192 0.132 0.135
Plate 4 Layout and ODs
B 67 1 67 2 68 1 68 2 69 2 69 3 70 2 70 3 S N B
B 71 1 71 2 72 1 72 2 73 2 73 3 74 2 74 3 S N B
B 75 1 75 2 76 1 76 2 77 2 77 3 78 2 78 3 S N B
B 79 1 79 2 80 1 80 2 81 2 81 3 82 2 82 3 S N B
B 83 1 83 2 84 2 84 3 85 2 85 3 86 2 86 3 S N B
B 87 1 87 2 88 2 88 3 89 2 89 3 90 2 90 3 S N B
B 91 1 91 2 92 2 92 3 93 2 93 3 94 2 94 3 S N B
B 95 1 95 2 96 1 96 2 97 2 97 3 98 2 98 3 S N B
0.132 1.268 1.122 1.662 1.157 1.434 1.139 1.222 1.127 0.774 0.182 0.176
0.140 1.271 1.502 1.452 1.176 0.969 1.277 1.204 1.239 0.654 0.237 0.122
0.125 1.269 1.599 1.331 0.649 1.513 1.345 1.402 1.569 0.593 0.169 0.130
0.136 1.753 1.456 1.517 1.383 1.272 1.357 0.794 1.728 0.366 0.164 0.128
0.115 1.481 1.702 1.572 1.359 1.331 1.321 1.744 1.802 0.249 0.139 0.135
0.128 1.466 1.444 1.317 1.229 0.826 1.768 1.818 1.789 0.227 0.134 0.124
0.116 1.452 1.494 1.577 0.900 0.873 1.251 1.733 1.888 0.201 0.180 0.148
0.126 1.205 1.551 1.499 1.458 1.768 1.696 0.783 2.020 0.147 0.134 0.143
Plate 5 Layout and ODs
B 99 2 99 3 100 2 100 3 101 B B B S N B
B 102 2 102 3 103 2 103 2 104 B B B S N B
B 105 2 105 3 106 2 106 3 107 B B B S N B
B 108 2 108 3 109 2 109 3 110 B B B S N B
B 111 2 111 3 112 2 112 3 B B B B S N B
B 113 2 113 3 114 1 114 2 B B B B S N B
B 115 2 115 3 116 3 117 3 B B B B S N B
B 118 2 118 3 119 3 120 3 B B B B S N B
0.116 0.711 0.803 0.549 0.902 0.621 0.137 0.138 0.157 1.049 0.284 0.173
0.121 1.114 0.715 0.920 0.657 0.858 0.117 0.140 0.131 0.752 0.289 0.141
0.141 1.086 1.022 1.405 1.162 1.829 0.154 0.143 0.137 0.677 0.188 0.178
0.147 1.157 1.337 1.270 1.588 1.221 0.156 0.137 0.130 0.572 0.168 0.173

0.169 1.157 1.134 1.467 1.356 0.145 0.126 0.170 0.147 0.339 0.145 0.171
0.155 1.458 1.644 1.794 1.819 0.145 0.140 0.130 0.140 0.254 0.150 0.173
0.145 1.383 1.988 1.375 1.179 0.143 0.135 0.129 0.143 0.203 0.141 0.168
0.120 1.452 1.523 1.727 1.208 0.143 0.140 0.131 0.130 0.178 0.133 0.138
Plate 6 Layout and ODs
B 121 1 129 1 137 1 145 1 153 1 161 1 169 2 177 3 S N B
B 122 1 130 1 138 1 146 1 154 1 162 1 170 2 178 3 S N B
B 123 1 131 1 139 1 147 1 155 1 163 1 171 2 179 3 S N B
B 124 1 132 1 140 1 148 1 156 1 164 1 172 2 180 3 S N B
B 125 1 133 1 141 1 149 1 157 1 165 1 173 2 181 3 S N B
B 126 1 134 1 142 1 150 1 158 1 166 2 174 2 182 3 S N B
B 127 1 135 1 143 1 151 1 159 1 167 2 175 2 183 3 S N B
B 128 1 136 1 144 1 152 1 160 1 168 1 176 2 184 3 S N B
0.116 0.971 0.996 1.088 0.805 1.093 1.102 1.795 0.928 0.878 0.221 0.135
0.178 1.153 0.893 1.148 1.187 1.261 1.228 1.366 1.278 0.660 0.252 0.123
0.123 1.012 1.349 1.415 0.583 0.598 1.514 1.330 1.433 0.527 0.176 0.140
0.118 1.355 1.455 1.139 1.546 1.393 1.317 1.583 1.560 0.394 0.152 0.151
0.123 1.479 1.838 1.065 1.129 1.603 1.016 1.581 1.601 0.314 0.137 0.132
0.110 1.232 1.254 1.408 1.209 1.318 0.467 0.729 0.687 0.248 0.140 0.257
0.109 1.108 1.337 1.227 1.640 1.538 1.359 1.617 1.815 0.203 0.155 0.191
0.120 0.893 1.243 1.017 1.943 1.752 1.597 1.438 1.549 0.192 0.160 0.146
Farm E
Plate 1 Layout and ODs
B 1 1 1 2 1 3 2 1 2 2 2 3 3 1 3 3 S N B
B 4 1 4 2 4 3 5 1 5 2 5 3 6 1 6 3 S N B
B 7 1 7 2 7 3 8 1 8 2 8 3 9 1 9 2 S N B
B 10 1 10 2 10 3 11 1 11 2 11 3 12 1 12 3 S N B
B 13 1 13 2 13 3 14 1 14 2 14 3 15 1 15 3 S N B
B 16 1 16 2 16 3 17 1 17 2 17 3 18 1 18 3 S N B
B 19 1 19 2 19 3 20 1 20 2 20 3 21 1 21 3 S N B
B 22 1 22 2 22 3 23 1 23 2 23 3 24 1 24 3 S N B
0.109 0.565 1.334 1.547 1.565 1.885 1.575 1.180 1.257 0.795 0.119 0.105
0.108 1.235 1.347 1.189 1.195 1.137 0.980 1.130 1.072 0.827 0.132 0.110
0.105 1.378 1.476 1.330 1.186 0.977 0.949 0.983 1.012 0.614 0.135 0.108
0.111 1.679 1.616 1.363 1.101 1.037 0.817 1.166 1.271 0.504 0.129 0.106

0.102 1.537 1.612 1.434 1.456 0.881 1.361 1.476 1.449 0.306 0.116 0.111
0.105 1.390 1.496 1.549 1.009 1.184 1.200 1.208 1.289 0.244 0.217 0.102
0.108 1.582 1.415 1.335 1.252 1.385 1.214 1.124 1.189 0.183 0.102 0.106
0.111 1.700 1.521 1.591 1.404 1.518 1.367 1.443 1.528 0.145 0.112 0.107
Plate 2 Layout and ODs
B 25 1 25 2 25 3 26 1 26 2 26 3 27 1 27 2 S N B
B 28 1 28 2 28 3 29 1 29 2 29 3 30 1 30 2 S N B
B 31 1 31 2 31 3 32 1 32 2 32 3 33 1 33 2 S N B
B 34 1 34 2 34 3 35 1 35 2 35 3 36 1 36 2 S N B
B 37 1 37 2 37 3 38 1 38 2 38 3 39 1 39 3 S N B
B 40 1 40 2 40 3 41 1 41 2 41 3 42 1 42 2 S N B
B 43 1 43 2 43 3 44 1 44 2 44 3 45 1 45 3 S N B
B 46 1 46 2 46 3 47 1 47 2 47 3 48 1 48 3 S N B
1.305 1.338 1.205 1.139 1.293 1.330 1.257 1.406 1.480 0.775 0.162 0.121
0.105 1.279 1.308 1.249 1.553 1.342 1.518 1.190 1.417 0.777 0.153 0.117
0.104 1.313 1.350 0.107 1.154 1.514 1.372 1.241 1.330 0.753 0.156 0.117
0.107 1.367 1.417 1.478 1.275 1.704 1.029 1.021 1.188 0.576 0.144 0.120
0.106 1.789 1.593 1.600 1.216 1.392 1.486 1.661 1.474 0.473 0.130 0.119
0.104 1.439 1.477 1.406 1.267 1.480 1.413 1.247 1.602 0.291 0.127 0.119
0.107 1.362 1.501 1.469 1.422 1.597 1.504 1.348 1.516 0.223 0.120 0.121
0.113 1.624 1.641 1.615 1.767 1.511 1.475 1.412 1.343 0.182 0.131 0.123
Plate 3 Layout and ODs
B 49 1 49 2 49 3 50 1 50 2 50 3 51 1 51 3 S N B
B 52 1 52 2 52 3 53 1 53 2 53 3 54 1 54 3 S N B
B 55 1 55 2 55 3 56 1 56 2 56 3 57 1 57 3 S N B
B 58 1 58 2 58 3 59 1 59 2 59 3 60 1 60 3 S N B
B 61 1 61 2 61 3 62 1 62 2 62 3 63 1 63 3 S N B
B 64 1 64 2 64 3 65 1 65 2 65 3 66 1 66 3 S N B
B 67 1 67 2 67 3 68 1 68 2 68 3 69 1 69 2 S N B
B 70 1 70 2 70 3 71 1 71 2 71 3 72 1 72 3 S N B
0.117 1.994 1.876 1.864 1.653 1.562 1.682 1.652 1.453 1.182 0.203 0.132
0.114 1.965 1.727 1.693 1.396 1.650 1.531 1.637 1.639 0.940 0.175 0.131
0.110 1.394 1.318 1.395 1.285 1.085 1.184 1.282 1.371 0.625 0.137 0.125
0.107 1.310 1.439 1.460 1.214 1.386 1.271 1.298 1.715 0.510 0.138 0.124
0.104 1.459 1.621 1.362 1.272 1.466 1.519 1.640 1.757 0.358 0.126 0.126
0.111 1.580 1.581 1.575 1.227 1.585 1.546 1.612 1.768 0.237 0.118 0.128
0.122 0.808 1.367 1.308 1.301 1.422 1.441 1.633 1.576 0.220 0.128 0.131
0.125 1.292 1.249 1.050 1.646 1.687 1.585 1.493 1.677 0.172 0.139 0.132

Plate 4 Layout and ODs
B 73 1 73 2 73 3 74 1 74 2 74 3 75 1 75 2 S N B
B 76 1 76 2 76 3 77 1 77 2 77 3 75 3 78 1 S N B
B 79 1 79 2 79 3 80 1 80 2 80 3 78 2 78 3 S N B
B 81 1 81 2 81 3 82 1 82 2 82 3 83 1 83 2 S N B
B 84 1 84 2 84 3 85 1 85 2 85 3 83 3 86 1 S N B
B 87 1 87 2 87 3 88 1 88 2 88 3 86 2 86 3 S N B
B 89 1 89 2 89 3 90 1 90 2 90 3 91 1 91 2 S N B
B 92 1 92 2 92 3 93 1 93 2 93 3 91 3 94 1 S N B
0.114 1.404 1.642 1.547 1.324 1.728 1.382 1.119 1.116 0.260 0.133 0.123
0.581 1.186 1.275 1.226 1.124 1.179 1.014 1.202 1.031 0.254 0.121 0.109
0.108 0.576 0.814 1.180 0.883 0.891 1.037 0.847 0.814 0.326 0.117 0.111
0.104 1.249 1.159 1.167 1.094 1.062 0.937 1.037 0.875 0.191 0.111 0.110
0.099 1.324 1.240 1.323 1.128 1.259 1.147 1.039 1.031 0.156 0.104 0.104
0.106 1.354 1.041 1.135 1.175 1.160 1.102 1.307 1.096 0.148 0.104 0.101
0.104 1.407 1.302 1.284 1.241 1.430 1.138 1.092 1.092 0.139 0.105 0.103
0.111 1.170 0.956 1.327 1.210 1.300 1.225 0.558 0.917 0.164 0.105 0.116
Plate 5 Layout and ODs
B 95 1 95 2 96 1 96 3 97 2 97 3 98 2 98 3 S N B
B 99 1 99 2 100 1 100 3 101 2 101 3 102 2 102 3 S N B
B 103 1 103 2 104 1 104 3 105 2 105 3 106 2 106 3 S N B
B 107 1 107 3 108 1 108 3 109 2 109 3 110 2 110 3 S N B
B 111 1 111 3 112 1 112 3 113 2 113 3 114 2 114 3 S N B
B 115 1 115 3 116 1 116 3 117 2 117 3 118 2 118 3 S N B
B 119 1 119 3 120 1 120 3 121 2 121 3 122 2 122 3 S N B
B 123 1 123 3 124 1 124 3 125 2 125 3 126 2 126 3 S N B
0.101 1.446 1.496 1.356 1.377 1.373 1.462 1.268 1.183 0.912 0.131 0.139
0.102 1.665 1.653 1.333 0.944 1.559 1.288 0.692 1.172 0.711 0.115 0.111
0.105 1.722 1.591 1.547 1.361 1.312 1.221 1.082 1.228 0.541 0.116 0.106
0.104 1.943 1.845 1.872 1.376 1.322 1.000 1.365 1.621 0.464 0.183 0.109
0.101 1.699 1.650 1.448 1.226 1.329 1.156 1.061 1.463 0.264 0.122 0.494
0.101 1.013 0.533 1.575 1.422 1.428 1.514 1.265 1.397 0.197 0.116 0.110
0.102 1.563 1.664 1.720 1.536 1.522 1.466 0.852 1.303 0.181 0.108 0.114
0.115 1.402 1.350 1.144 1.609 1.545 1.299 1.318 1.359 0.137 0.112 0.111

Plate 6 Layout and ODs
B 126 2 126 3 127 1 127 2 128 1 128 2 129 2 129 3 S N B
B 130 2 130 3 131 2 131 3 132 1 132 2 133 1 133 2 S N B
B 134 2 134 3 135 2 135 3 136 2 136 3 137 2 137 3 S N B
B 138 2 138 3 139 2 139 3 140 2 140 3 141 2 141 3 S N B
B 142 2 142 3 143 2 143 3 144 2 144 3 145 2 145 3 S N B
B 146 2 146 3 147 2 147 3 148 1 148 2 149 1 150 1 S N B
B 151 2 151 3 152 2 152 3 153 1 153 2 154 1 155 1 S N B
B 156 2 156 3 157 2 157 3 158 1 158 2 159 1 160 1 S N B
0.107 0.985 1.114 1.190 1.281 0.926 0.933 0.982 1.016 0.870 0.114 0.099
0.110 1.193 1.008 1.095 0.922 1.450 0.928 0.765 1.305 0.569 0.113 0.102
0.104 0.500 1.110 1.065 0.801 0.904 1.036 0.788 1.082 0.466 0.109 0.099
0.106 1.054 1.146 1.357 1.287 1.164 1.226 1.016 0.997 0.294 0.105 0.097
0.109 0.746 1.025 1.161 0.704 1.120 0.980 1.098 1.302 0.223 0.100 0.100
0.107 0.862 0.994 1.203 1.183 0.968 1.319 0.937 1.369 0.190 0.098 0.091
0.108 1.136 1.198 1.298 1.457 1.279 1.497 1.084 0.951 0.149 0.093 0.096
0.105 0.665 1.174 1.148 1.386 1.030 1.094 1.013 1.257 0.117 0.084 0.095
Plate 7 Layout and ODs
B 161 1 169 1 177 1 185 2 193 3 201 3 209 3 B S N B
B 162 1 170 1 178 1 186 2 194 3 202 3 210 3 B S N B
B 163 1 171 1 179 1 187 2 195 3 203 3 211 3 B S N B
B 164 1 172 1 180 1 188 2 196 3 204 3 B B S N B
B 165 1 173 1 181 1 189 2 197 3 205 3 B B S N B
B 166 1 174 1 182 1 190 2 198 3 206 3 B B S N B
B 167 1 175 1 183 1 191 2 199 3 207 3 B B S N B
B 168 1 176 1 184 1 192 2 200 3 208 3 B B S N B
0.102 1.204 0.786 0.563 1.018 1.505 1.632 0.910 0.126 0.835 0.134 0.118
0.103 1.166 1.011 0.978 0.790 0.981 0.360 0.439 0.110 0.664 0.121 0.114
0.097 1.184 1.044 0.966 1.066 1.439 0.937 0.292 0.115 0.438 0.116 0.110
0.091 0.893 0.664 1.073 1.238 1.164 1.135 0.100 0.105 0.307 0.112 0.110
0.083 1.106 1.005 1.392 1.198 1.209 1.127 0.107 0.611 0.222 0.108 0.114
0.092 0.920 0.172 1.731 1.336 1.281 1.291 0.105 0.119 0.197 0.111 0.108
0.089 1.148 0.637 1.234 1.256 1.327 1.477 0.138 0.115 1.905 0.110 0.115
0.110 1.690 0.436 1.319 1.097 1.436 1.319 0.108 0.630 0.132 0.111 0.111

UNIVERSITY OF BRISTOL
LISTERIOSIS IN DAIRY CATTLE
PART A : CASES OF LISTERIOSIS
1. Have you ever had any cases of listeriosis in your :- milking cows/heifers ?
Yes No Don’t know
(please circle one)
No Don’t know
No Don’t know
IF NO OR DON'T KNOW PLEASE GO TO QUESTION 3
replacement heifers ? Yes
dairy calves ? Yes
2. Who made the diagnosis of listeriosis in your :- milking cows/heifers
? Self Vet. V.I.centre
(please circle)
Vet. V.I.centre
Vet. V.I.centre
3. Which of the following are symptoms of listeriosis ?
replacement heifers ? Self
dairy calves ? Self
nervous signs

(please circle one or more)
lameness
silage eye
sudden death
diarrhoea
abortion
pneumonia
mastitis
IF YOU HAVE NEVER HAD CASES OF LISTERIOSIS PLEASE GO TO PART C OF THE
QUESTIONNAIRE
PART B : CASES OF LISTERIOSIS:--BETWEEN JULY 1994 AND JUNE 1995
1. Between 1st July 1994 and 30th June 1995
How many cases of listeriosis did you see in your :- milking
cows/heifers ? ______________
______________
______________
replacement heifers ?
dairy calves ?
2. Please provide details, in the table below, of any cases of listeriosis seen from July 1994-
June 1995.
Month
of illness
Status
M-milking
cow/heifer
H-replacement
heifer
C-dairy calf
Other
(please specify)
Pregnant
Y-yes
N-no
D-don't know
Housing
C-cubicle
L-loose yard
O-outside
Other
(please specify)
Symptoms
N-nervous
A-abortion
S-silage eye
M-mastitis
D-sudden death
Other
(please specify)
Diagnosed
by
S-self
V-vet
VI-VI centre
Treated
Y-yes
N-no
D-don't know
Res
R-r
D-d
C-c
Oth
(ple

PART C : HERD SIZE :--BETWEEN JULY 1994 AND JUNE 1995
1. How many milking cows/heifers were there in your herd ? on 30th June 1995
______________
on 1st July 1994
______________
2. How many replacement heifers were there in your herd ? on 30th June 1995
______________
on 1st July 1994
______________
3. Between 1st July 1994 and 30th June 1995 how many dairy calves were born ?
______________
PART D : FORAGE CROPS FED:--BETWEEN JULY 1994 AND JUNE 1995
1. Which of the following did you feed to your herd between 1st July 1994 and 30th June
1995 ?
(please tick or complete the following boxes)
Grass silage Maize silage Hay Feed Straw
(please specify type)
2. What was the source of the forage crops ?
(please tick the appropriate boxes)
Root crops
(please specify type)
Other
(please speci
Source Grass silage Maize silage Hay Feed Straw Root crops Oth
home made
purchased
other
(please specify)

3. From 1st July 1994 to 30th June 1995 between which months did you feed your herd ?
(please state the month for each)
Grass silage Maize silage Hay Feed Straw Root crops Other
4. When the cows were outside how did you feed forage crops to your herd ?
(please tick the appropriate boxes)
Feeding
not fed
ad libitum
on the ground
in a complete diet
in ring feeders
in hay racks
in troughs
off the field
other
(please specify)
Grass silage Maize silage Hay Feed
Straw
5. When the cows were housed how did you feed forage crops to your herd ?
(please tick the appropriate boxes)
Feeding
ad libitum
at the clamp face
on the floor
in a complete diet
in ring feeders
in hay racks
in troughs
other (please specify)
Grass silage Maize silage Hay Feed
Straw
Root crops O
Root crops Ot
PART E : MAKING FORAGE CROPS FED:--BETWEEN JULY 1994 AND JUNE 1
1. In which month did you make or harvest the forage crops fed between 1st July 1994 and
30th June 1995 ?
(please state in the following boxes)
Grass silage Maize silage Hay Feed Straw Root crops Other
2. How many grass cuts did you make for
grass silage ?
1 2 3

(please circle one for each)
3. What type of mower or harvester did you use ?
(please tick the appropriate boxes)
and
hay ?
1 2 3
Type of mowers or harvesters
forage harvester
discs or drums
mower conditioner
combine harvester
other
(please specify)
Grass silage Maize silage Hay Feed St
4. For how long did you wilt, dry or leave the forage crops in the field ?
(please circle one or state other)
please circle one
other
(please specify)
Grass silage Hay Feed Straw
0 ½ 1 2 3 days 0 ½ 1 2 3 4 5 6 7 days 0 ½ 1 2 3 4 5 6 7 d
5. What type of additives or treatments did you use ?
(please give the trade names or tick the appropriate boxes)
Additives/Treatments Grass silage Maize silage Hay Feed
Straw
please specify
trade names or type
none
6. How did you store grass silage, maize silage and root crops ?
(please tick the appropriate boxes)
Root cr
Type of storage Grass silage Maize silage Root crops
clamp
silo
big bale
other

(please specify)
IF YOU DID NOT USE A CLAMP OR SILO PLEASE GO TO QUESTION 10
7. If you used a clamp or silo please describe the floor type.
(please tick the appropriate boxes)
Type of floor
compacted soil
concrete
other
(please specify)
Grass silage Maize silage Root crops
8. Did you use separate clamps or silos for each grass cut ?
Don’t know
(please circle one)
9. If you used the same clamp or silo for more than one cut
did you seal the clamp or silo between each cut ?
Don’t know
(please circle one)
Yes No
Yes No
10. How did you store hay, straw and big bale silage if fed ?
(please tick the appropriate boxes)
Type of storage
in a covered barn
outside covered
outside uncovered
other
(please specify)
Hay Feed Straw Big bale silag
11. Did you have your forage analysed ?
(please circle one)
Yes No Don’t know
12. IF YES, please provide details of analysis of the forage fed between July 1994 and June
1995 ?
(please state the results in the appropriate boxes)
Forage
Clamp - 1
Clamp - 2
Clamp - 3
Big bale
Maize silage
Hay
pH DM Ash ME
PART F : HOUSING :--BETWEEN JULY 1994 AND JUNE 1995
1. From 1st July 1994 to 30th June 1995

etween which months were your milking cows/heifers housed ?
2. Which type of housing did you use for your milking cows/heifers ?
cubicle
(please circle one or more)
______________
loose yard
other (please specify)
______________
3. Please provide details of the type of floor
(please tick the appropriate boxes)
Type of floor
earth
hard core
concrete
slatted
other
(please specify)
Cubicle Loose yard Other
4. What type of bedding did you use ?
(please tick the appropriate boxes)
Type of bedding
none
sawdust
straw
other
(please specify)
Cubicle Loose yard Other
5. What was the source of the bedding ?
(please tick the appropriate boxes)
Source
home made
purchased
other
(please specify)
Sawdust Straw Other
6. For home made straw bedding in which
month was it made ? ______________
(please complete)
how long was it left in the field ? ______________
No
was it big bale ?(please circle) Yes
what type of straw was it ? (please specify) ______________

7. How did you store the bedding ?
(please tick the appropriate boxes)
Type of storage
in a covered barn
outside covered
outside uncovered
other
(please specify)
Sawdust Straw Other
8. How many times each week did you add fresh bedding when the cows were housed ?
(please state the frequency per week)
Cubicle Loose yard Other
please circle one
other
(please specify)
1 2 3 4 5 6 7 times 1 2 3 4 5 6 7 times 1 2 3 4 5 6 7 t
9. How many times each week did you remove the dirty bedding when the cows were
housed ?
(please state the frequency per week)
Cubicle Loose yard Other
please circle one
other
(please specify)
0 1 2 3 4 5 6 7 times 0 1 2 3 4 5 6 7 8 9 times 0 1 2 3 4 5 6 7 t
10. How many times was the bedding cleaned out completely while the cows were housed ?
(please state the frequency per housing period)
Cubicle Loose yard Other
please circle one
other
(please specify)
0 1 2 3 4 5 times 0 1 2 3 4 5 6 7 8 9 times 0 1 2 3 4 5 tim
11. How did you dispose of the dung ?
(please circle one or more)
12. Where did you store the dung ?
(please tick the appropriate boxes)
solid manure
slurry
other (please specify)
______________
Type of storage Solid manure Slurry Other

not stored
beneath the slats
composted
in a slurry tank
in a lagoon
other
(please specify)
13. Did you spread the dung on your pasture ?
Don't know
(please circle one)
Yes No
PART G : GENERAL INFORMATION:--BETWEEN JULY 1994 AND JUNE 1995
1. Did you have any cases of listeriosis in beef cattle ? :
Yes No Don’t know
(please circle one or more) sheep ? :
Yes No Don’t know
Yes No Don’t know
goat ? :
other (please specify)
______________
2. Did any of the following species graze Beef cattle
the same pasture as your dairy herd ? Sheep
(please circle and specify) Other (please specify)
3. Against which of the following diseases None
______________
were your milking cows/heifers vaccinated ? Salmonellosis
(please circle one or more) E. coli
Leptospirosis
Lungworm
Other (please specify)
______________

4. Were there mole hills in the field where you made hay ?
: Yes No Don’t
know
(please circle) grass silage?: Yes
No Don’t know
straw ? :
Yes No Don’t know
5. What did you use to control moles ? Nothing
(please circle and specify) Chemicals (please
specify)
______________
Other (please specify)
______________
Thank you very much for filling in this questionnaire. Please return it to us
using the stamped addressed envelope provided.

STUDY OF LISTERIOSIS IN DAIRY CATTLE
Dear Sir / Madam,
At Bristol Veterinary School we are working on Listeriosis in dairy cattle, trying to improve
its diagnosis and to find out more details of the risk factors associated with the disease, which
will help to improve its control. As a part of our study we need to get some background
information and would be grateful if you could help us.
Enclosed is a questionnaire which asks you about your farm and dairy herd. Please fill it in
even if you did not have or have never had any cases of Listeriosis on your farm.
All information will be treated confidentially and will be used only for our study.
Many thanks for your co-operation.
Yours sincerely
H. M. Erdogan, DVM
P. J. Cripps, BSc, MSc (Epid), BVSc, PhD, MRCVS
L. E. Green, BVSc, MSc (Epid), PhD, MRCVS
K. L. Morgan, BA, VetMB, PhD, MRCVS

STUDY OF LISTERIOSIS IN DAIRY CATTLE
Dear Sir / Madam
We are conducting a study on Listeriosis in dairy cattle. This questionnaire is a part of our
study. We are currently pretesting the questionnaire and would be most grateful if you could fill
in and state any comments on the questionnaire and any difficulty you faced while filling in.
Thanks very much for your help.
Yours sincerely
H. M. Erdogan, DVM
P. J. Cripps, BSc, MSc (Epid), BVSc, PhD, MRCVS
L. E. Green, BVSc, MSc (Epid), PhD, MRCVS
K. L. Morgan, BA, VetMB, PhD, MRCVS

STUDY OF LISTERIOSIS IN DAIRY CATTLE
Dear Sir/ Madam,
The response rate in this study is now 60%.
We need a response rate of 70% in order to obtain information which will help to prevent
Listeriosis in cattle.
Please help us to do this by completing your questionnaire over the Christmas period and
returning to us. We will close the study on the 12th January 1996.
It is important that you return the questionnaire even if you have not had any cases of
Listeriosis in your herd.
We need your help and thank you in anticipation.
Merry Christmas
Yours sincerely
H. M. Erdogan, DVM
P. J. Cripps, BSc, MSc (Epid), BVSc, PhD, MRCVS
L. E. Green, BVSc, MSc (Epid), PhD, MRCVS
K. L. Morgan, BA, VetMB, PhD, MRCVS

UNIVERSITY OF LIVERPOOL
STUDY OF LISTERIOSIS IN DAIRY CATTLE
I would like to ask you some questions about the history of listeriosis on your farm. I may have
already asked some of these questions partially but for completeness I will ask them again.
1. Have you ever had any cases of listeriosis in your :-milking cows/heifers? Yes No
(please circle one) replacement heifers? Yes No
dairy calves? Yes No
2. If yes, could you please state when the last case was seen in your milking
cows?_____________
_____________
_____________
3. If you had a case of listeriosis,
which of the following symptoms were seen in listeriosis case(s) ?
nervous signs
(please circle one or more)
silage eye
sudden death
diarrhoea
abortion
mastitis
in your replacement heifers?
in your dairy calves?

Now I would like to get some details about feed, feeding and feed preparation.
4. Between 30th July 1996 and 1st May 1997 which of the following did you feed to your
milking cows?
(please state the exact dates)? -on what date did you start feeding ……..?
-on
what date did you stop feeding ……..?
Date
Type of forage Fed Started Stopped
Grass silage
Maize silage
Hay
Feed Straw (please specify type)
(barley, wheat, etc.)
Root crops (please specify type)
(sugar beet, etc.)
Others (please specify type)
Concentrate(please specify type)
5. What was the source of forage crops FED between 30th July 1996 and 1st May 1997?
( please circle one or more)
Grass silage: Home made
Bought in
Maize silage: Home made
Bought in

Concentrate :
_______________(from which company)
Hay : Home
made Bought in
Feed Straw : Home made
Bought in
Root crops : Home made
Bought in
Others : Home
made Bought in
6. In which month did you make or harvest forage crops FED between 30th July 1996 and
1st May 1997?
(please specify month)
Grass silage:
______________________
Maize silage:
______________________
Hay :
______________________
Feed Straw :
______________________
Root crops :
______________________
Others :
______________________
7. What type of treatment or additives did you use? Grass silage :
______________________
(please specify it)
Maize silage :
______________________
Hay :
______________________
Feed Straw :
______________________

Root crops :
______________________
Others :
______________________
8. Were there mole hills in the field where you made hay ? : Yes
No Don’t know
(please circle) or
grass silage?: Yes
No Don’t know
or
straw ? : Yes
No Don’t know
9. For how long did you wilt, dry or leave the forage crops FED between July 1996 and May
1997 in the field ?
(please circle one or state other)
please circle one
other
(please specify)
10. Did you have your forage analysed?
Grass silage Hay Feed Straw
0 ½ 1 2 3 days 0 ½ 1 2 3 4 5 6 7 days 0 ½ 1 2 3 4 5 6 7 d
Yes No
11. Can you please give us a copy of all analyses?
Yes No
12. If no, please provide details of analysis of the forage FED between 30th July 1996 and
1st May 1997?
(please state the result in the appropriate boxes)
Forage pH DM Ash ME
Clamp - 1
(Grass Silage)
Clamp - 2
(Grass Silage)
Maize silage

Hay
Now I have some questions to ask about housing and bedding.
13. From 30th July 1996 to 1st May 1997
Start End
between which months were your milking cows housed at night only?
__________ __________
(please state the EXACT DATE)
and
between which months were they housed day and night?
__________ __________
14. What type of straw bedding did you use?
Big bale
(please circle one)
Small bale
Other (please specify)
_________________
15. What was the source of the bedding straw used between 30th July 1996 and 1st May
1997?
(please circle one or more)
Bought in
16. If bought in where did you get your bedding straw?
________________
(please state from what part of country)
Home made
17. How often did you add fresh bedding each week?
1 2 3 4 5 6 7 8 9 10
(please circle one)
18. How often did you remove dirty bedding each week?
1 2 3 4 5 6 7 8 9 10
(please circle one)

In this section I will be asking questions about dung disposal and field management.
19. How did you dispose of the dung ? solid manure
(please circle one or more)
slurry
specify)
______________
20. Where did you store the dung ?
(please tick the appropriate boxes)
other (please
Type of storage Solid manure Slurry Other
not stored
in a slurry tank
in a lagoon
other
(please specify)
21. What fertiliser did use on the field that your milking cows grazed Dung
: Yes
No
between 30th July 1996 and 1st May 1997?
Artificial
: Yes
No
(please
specify)
____________
22. Please specify the source of the fertiliser used ? Dung
:_______________
:_______________
(from which company) Artificial
23. Did you spread human sludge on the field from sewage works?
Yes No
24. If human was used, where did you get human sludge?
________________

25. When was animal dung spread on the field
between 30th July 1996 and 1st May 1997? (exact date)
________________
________________
________________
26. Did cattle graze the fields after dung spread? Yes No
27. What dates did you spread human sludge on the field ______________
between 30th July 1996 and 1st May 1997?
(please give exact dates) ______________
_____________
28. Did cattle graze the pasture after slurry spread? Yes No
29. If yes, when did cattle graze the field? _______________
30. Did any of the following species graze
the same pasture as your dairy herd ?
(please circle and specify)
I would like to move on to ask you about water supply.
Beef cattle
Sheep
Other (please specify)
______________
31. What was the source of water on your farm? Mains
Bore hole
Well
32. If the source of water was mains could you please indicate from which companies did you
get water?
…………………………………………………………………………………………………
I now have some question about milk storage and collection.

33. Which days of the week bulk tank milk was collected by dairy?
-Monday -Tuesday -Wednesday -
Thursday -Friday -Saturday -Sunday
34. How often milk was collected by dairy?
-Daily -Every other day -Weekly -Fortnightly
-Monthly -Other (please specify)___________
35. Did you clean bulk milk tank between each collection? Yes No
36. If no, how often the bulk milk tank was cleaned ?
-Daily -Every other day -Weekly -Fortnightly
-Monthly -Other (please specify)___________
37. Do you use disinfectant or sterilising agent when cleaning your bulk tank? Yes No
38. If yes, what disinfectant steriliser did you use? __________________
Now I would like to ask some question about your dry cows.
39. Were your dry cows separated from your milking cows? Yes No
40. Between 30th July 1996 and 1st May 1997 which of the following did you feed to dry
cows?
(please state the exact dates)? -on what date did you start feeding …..?
-on what date did you stop feeding……?
Date
Type of forage Fed Started Stopped
Grass silage
Maize silage
Hay
Feed Straw (please specify type)
(barley, wheat, etc.)
Root crops (please specify type)
(sugar beet, etc.)
Others (please specify type)

Concentrate(please specify type)
41. Between July 1996 and May 1997 where did you house your dry cows ?
between which months they were housed at night only?
Between which months they were housed day and night?
Date
NIGHT DAY
Start End Start End
Type of housing
Cubicle
Loose yard
Straw yard
Others (please specify)
In this section I would like to ask some questions about diseases and their treatments
42. If you used any treatment or vaccine against any disease between 30th July 1996 and
1st May 1997,
could you please answer the following questions? (if necessary please use back of the
page)
-which vaccines did you use?
-which groups of animals did you vaccinate? (please give ID)
-when did you vaccinate?
Treatment or Vaccine
(please specify)
Animal ID Date of administration
43. If you had any clinical problem between 30th July 1996 and 1st May 1997, could you
please answer the following questions? (if necessary please use back of the page)
-did any animal suffer from any illness? Yes No
-if yes, could you give me a list of the animals, their ID?
-what was the date of illness?

-what was used to treat?
-what was the result?
Animal
ID
Clinical illness
(i.e. mastitis,
salmonellosis etc.)
Date of illness Treated
Y= Yes
N= No
Finally I shall be asking some questions about your own health or health of your family or
anybody working on the farm.
Result
R= Recovered
D= Died
C= Culled
44. Did you or your family or any worker have any illness
between 30th July 1996 and 1st May 1997? Yes No
45. If yes could please state the illness and its duration in the table below?
who had illness?
when did it start? (exact date)
how long did it last?
Illness
Person Started Duration
46. What type of dairy herd do you have? Open

Closed
Other (please specify)
_________________
47. Could you please provide information on the age, stage of lactation, pregnancy, and
annual milk yield of the milking cows kept in your herd between 30th July 1996 and 1st May
1997?
THANK YOU VERY MUCH FOR TIME TO COMPLETE THIS QUESTIONNAIRRE