Mutational analysis ofsimian virus 40 large T antigen DNA binding ...

The EMBO Journal vol.3 no.13 pp.3247-3255, 1984
Mutational analysis of simian virus 40 large T antigen
DNA binding sites
Katherine A.Jones, Richard M.Myers1 and Robert Tjian
Department of Biochemistry, University of California, Berkeley, CA
94720, USA
'Present address: Department of Biochemistry and Molecular Biology,
Harvard University, Cambridge, MA 02138, USA
Communicated by L.Philipson
We have tested the effects of various mutations within SV40
T antigen DNA recognition sites I and II on specific T antigen
binding using the DNase footprint technique. In addition, the
replication of plasmid DNA templates carrying these T antigen
binding site mutations was monitored by Southern
analysis of transfected DNA in COS cells. Deletion mapping
- of site I sequences defined a central core of 18 bp that is
both necessary and sufficient for T antigen recognition; this
region contains the site I contact nucleotides that were
previously mapped using methylation-interference and
methylation-protection experiments. A similar deletion
analysis delineated sequences that impart specificity of binding
to site II. We find that T antigen is capable of specific
recognition of site II in the absence of site I sequences, indicating
that binding to site II in vitro is not dependent on
binding of T antigen at site I. Site II binding was not
diminished by small deletion or substitution mutations that
perturb the 27-bp palindrome central to binding site II,
whereas extensive substitution of site H sequences completely
eliminated specific site II binding. Analysis of the replication
in COS7 cells of plasmids that contain these mutant origins
revealed that sequences both at the late side of binding site I
and within the site II palindrome are crucial for viral DNA
replication, but are not involved in binding T antigen.
Key words: simian virus 40/large T antigen/protein-DNA
interactions/SV40 origin-dependent replication
Introduction
The early gene product of SV40, large T (tumor) antigen, is a
regulatory protein that controls both the rate of transcription
from the SV40 early promoter and the rate of viral DNA
replication in lytically-infected cells (for review, see Tooze,
1981). T antigen is a 96 000 mol. wt. phosphoprotein
(Tegtmeyer, 1975) that recognizes specific sequences of SV40
DNA at the viral origin of replication (for review see Tjian,
1981). The interaction between large T antigen and SV40
DNA directly mediates the repression of SV40 early transcription
(Rio et al., 1980; Myers et al., 1981b; Hansen et al. 1981;
Rio and Tjian, 1983), and may also account for the observed
stimulation of viral DNA replication by T antigen
(Tegtmeyer, 1975; Shortle et al., 1979; Wilson et al., 1982;
Margolskee and Nathans, 1984). T antigen has been shown to
aggregate into dimers, tetramers, and higher order structures
in solution (Osborn and Weber, 1975; Myers et al., 1981c;
Bradley et al., 1982), to catalyze the hydrolysis of ATP (Tjian
and Robbins, 1979; Giacherio and Hager, 1979; Tjian et al.,
1980), and to form a stable complex with a cellular 53-K pro-
IRL Press Limited, Oxford, England.
tein (Lane and Crawford, 1979; Linzer and Levine, 1979; Mc-
Cormick and Harlow, 1980). A major concern among investigators,
therefore, has been to establish the relationship
between these biochemical properties of T antigen and the
known biological functions carried out by T antigen both
during lytic infection and virally-induced neoplastic transformation.
DNase protection and footprinting experiments have defined
three distinct T antigen binding sites in a region of SV40
DNA adjacent to the SV40 early promoter and overlapping
the SV40 origin of replication (Tjian, 1978, 1979; DiMaio and
Nathans, 1980; Myers and Tjian, 1980; Tegtmeyer et al. 1981;
Tenen et al., 1982). Sequential binding to these three sites is
dictated by different affinities of T antigen for each site;
binding to the highest affinity site (site I) is characterized by a
Kd of 0.5 nM (22° C, 0.15 M NaCl; Myers et al., 1981a).
Electron microscopy studies suggest that predominantly tetrameric
forms of T antigen are stably bound at each site (Myers
et al., 198 1c). Many of the original observations on the DNA
binding properties of the adenovirus-SV40 D2 hybrid protein
have subsequently been confirmed using wild-type T antigen
isolated from different sources, and the interaction has been
evaluated in a variety of DNA binding assays including
DNase protection, immunoprecipitation, DNase footprinting
and methylation protection (Rio et al., 1980; DiMaio and
Nathans, 1980, 1982; Myers et al., 1981b; McKay, 1981;
McKay and DiMaio, 1981; Tenen et al., 1982, 1983; DeLucia
et al., 1983; Tegtmeyer et al., 1983; Lewton et al., 1984). In
addition, the guanine and phosphates in contact with T antigen
at sites I and II have been evaluated by alkylationinterference
(Jones and Tjian, 1984). In this report, the interaction
between T antigen and SV40 DNA templates containing
a variety of binding site mutations is monitored using the
DNase footprinting technique (Galas and Schmitz, 1978) as
an alternative method for the identification of T antigen
recognition sequences within each binding site. We also compare
the in vitro binding results with the ability of these mutant
templates to support origin-specific DNA replication in
transfected COS7 cells.
Results
The interaction of T antigen with specific SV40 DNA binding
sites creates a sequential pattern of DNase I footprint protection,
as illustrated in Figure 1. The highest affinity site, binding
site I, spans -30 bp (5185-5215). Binding site II extends
approximately from the site I boundary at base pair 5215
through base pair 15, a region of 45 bp. Binding site II
overlaps the SV40 origin of replication and the early RNA
start sites, and abuts the early promoter 'TATA' sequence.
Methylation-protection experiments (Tjian, 1978) have defined
areas of close protein contact to a 15-bp subset of each
binding site and methylation-interference experiments have
further defined contact points within these sites (Jones and
Tjian, 1984). These experiments have shown that both bind-
3247

K.AJones, R.M.Myers and R.Tjian
-46 'O/52*X.
late
-
. ~ ~
a
SoWw
__
- -~~ml -
slo Wm
_1--N.
- -~~~~~~~
;a 11 -ttM5
f-i
TATA
III
Ill
11 _
Fig. 1. DNase I footprint protection of wild-type SV40 origin sequences by D2 protein. A DNA fragment containing the EcoRII-G fragment of the SV40
origin was 5' end-labelled at either the EcoRI site (late strand) or at the HindlII site (early strand), mixed with various concentrations of D2 protein and
treated with DNase. The resulting DNA fragments were subjected to denaturing polyacrylamide gel electrophoresis and analyzed by autoradiography. The
fragment labelled on the late strand (left panel) was incubated with D2 protein at the following concentrations: 0 nM (lane 1), 6.25 nM (lane 2), 12.5 nM
(lane 3), 18.75 nM (lane 4), 25 nM (lane 5) and 37.5 nM (lane 6). The fragment end-labelled at the early strand (right panel) was incubated with D2 protein at
the following concentrations: 0 nM (lane 1), 12.5 nM (lane 3) and 25 nM (lane 4); lane 2 displays guanine sequence markers for this strand. A schematic
representation of the SV40 origin fragment is presented below the panels.
ing sites contain two hexanucleotide contact sequences
(G)GCCTC, located 6 bp apart in site I. Within site II, one
hexanucleotide sequence is in an inverted orientation and two
turns of the helix away from the site I contacts (assuming a
B-DNA helical conformation), and a second set of weaker
contacts is located at an additional distance of 5 bp and
follows the same orientation as the site I contacts. The effects
of binding site sequence alterations on the recognition by T
antigen have now been evaluated using DNase footprint and
filter binding techniques (Galas and Schmidt, 1978; Myers
and Tjian, 1980). The mutant binding site templates used in
this study are illustrated in Figure 2. These mutations fall into
four classes: deletions that extend into site I sequences (dl 2,
3, 4); deletions extending into site II sequences from both early
and late directions (dl 22, 18, 23, A, 12) and an external site
II deletion (dl 1); internal site II substitutions (X 8, pIN 4);
and insertion mutants that separate binding sites I and II (pIN
43, 41).
3248
mEN
.3Y
-1
early
2 3 A
2A
I-
-m-
I
II
RIM RU
Binding to site I: effect of binding site deletions
The interaction between T antigen and residual site I sequences
in deletion mutants dl 2, dl 3 and dl 4 was examined
using both the nitrocellulose filter binding and DNase I footprinting
techniques. A template lacking early site I sequences
to base pair 5192 was found to bind T antigen with an efficiency
of 95% that of a wild-type template (containing all
three binding sites) in the nitrocellulose filter assay (mutant
dl 4, Figure 3). In contrast, deletion from the late side of site I
to base pair 5207 or 5195 reduced binding in this assay (dl 2,
dl 3; Figure 3). Mutant dl 2 removes only one guanine contact
from site I sequences, whereas the more severely affected mutant
dl 3 removes one complete hexanucleotide contact sequence
plus intervening nucleotides between the two site I
hexanucleotides. These results were confirmed by DNase
footprinting shown in Figure 4. The binding of T antigen to
site I in mutant dl 4, which retains all contact nucleotides,
confers protection of the 9 bp of bacterial DNA replacing the
deleted SV40 site I sequences. Binding to the extensively
i

518.0 5190 5200 52105,0 5240 0 2
AAGCTTTI T(;CAAAAGCCTACCCCTCCAAAAAA(;CCTCC-1 CACTACTTCTCGAAM1 ACC1 CA(;A(:(;CC(;A(;(:( (;( ( dac1(1(( Al AAA A
0 a 0 0 0 0 0 0 0
TTCGAAAAACGTTTTCGGATCCCGAGGTTTTTTCGGAGGAGTGATGAAGACCTTATCGAGTCTCCCGC1'CCGCC(;GAGGCUGAGACG'I'A'I 1 A
A A
Hi-d 2BgII
dl 2 5207
dl 3
di14
dl14
s
51951
s5204
dl22 5204.
dl 18
pIN43.
pIN41-
d123
dli1
piN 4A
S -1I
5215 -
-~~0
5238 l5243
523%CCI'CGAC.,
GCACCTCC
'~kWWWAWVW'---
u rn I 5241
d 12 523:P
T antigen binding and DNA replication mutants
Fig. 2. Nucleotide sequences of the wild-type and mutant SV40 origin templates used in these studies. The sequence of both strands of the wild-type origin is
shown, with the HindIII (base pair 5182) and BgII (base pair 5243) restriction sites marked. The SV40 BBB base pair numbering system is used (Buckman et
al., 1980) and the approximate DNase footprint boundaries for each site are indicated by parentheses on the schematic template above the sequence. The solid
bars within the parentheses represent the areas where guanine residues are protected from DMS methylation by the D2 protein. The number of the last SV40
base pair contained in each deletion mutant is given, and in all deletion mutants the SV40 DNA sequences are abutted to bacterial pBR322 DNA. Mutants
pIN 43 and pIN 41 contain insertions of 65 bp of bacterial polylinker DNA insertion between binding sites I and II. These two mutants differ only in the
junction between bacterial and SV40 site II sequences. Mutant pIN4 contains a substitution of sequences between base pairs 5220 and 9 (Rio and Tjian,
1983).
deleted mutant dl 3 is much less localized but appears to be
centered about the single contact hexanucleotide sequence
that remains in this mutant construction (Figure 4). Site I
binding to mutant dl 2, which contains all contact nucleotides
except one, appears normal at the T antigen concentrations
used in this experiment. These experiments establish that sequences
between base pairs 5192 and 5220 are required for the
recognition of site I by T antigen; this region includes the sequences
(5191 -5208) of close protein contact determined by
methylation-protection and alkylation-interference experiments.
Clearly the filter binding results could be misleading if the
interaction of T antigen with additional binding sites on the
template contributes to the retention of the fragment on
nitrocellulose filters, since site II sequences are deleted in
mutants dl 2 and dl 3 (not bound to the filter) and retained in
mutant dl 4 (retained on the filter, Figure 3). In order to
assess the contribution of multiple binding interactions to the
filter assay, the interaction of T antigen with an isolated site I
fragment derived from mutant pIN 41 was evaluated using
the filter-binding technique (site II sequences were removed
by nuclease digestion within the linker region between sites I
and II and the site I fragment was purified by gel electrophoresis).
T antigen complexes with the isolated site I
_
i
sn221- @
[ 1AI_ (mgnl )
Fig. 3. Filter binding assay of site I mutant origin templates. Various concentrations
of R284 T antigen were incubated with 5' end-labelled (Hinfdigested)
mutant or wild-type DNA fragments for 10 min at 22° C and
passed through nitrocellulose filters. DNA fragments tested were derived
from wild-type (wt), dl 4, dl 2, dl 3, and control pBR plasmid DNA (c).
3249

K.A.Jones, R.M.Myers and R.Tjian
dl 2 d13
2 3 A 5 6 11 3 4 5 t
dl 3 &
dl 4_ _.
dl4 wt
IL U
B1%
Fig. 4. DNase footprint protection of site I in wild-type and mutant templates by D2 protein. DNA fragments were 5' end-labeled at the Hinf site (base pair
5135). The left panel shows the protection patterns for templates dl 2 and dl 3 in each case lane 1 contains guanine sequence markers and lanes 2-6 contain
the DNase pattern in the presence of 0 nM, 12 nM, 15 nM, 20 nM and 30 nM of R284 T antigen, respectively. A schematic representation of each template
is presented below the autoradiograms.
fragments were retained by nitrocellulose filters with a 900/o
efficiency relative to wild-type fragments containing all three
binding sites (data not shown). These results indicate that
filter binding is an accurate measure at least of site I binding,
and that mutants dl 2 and dl 3 are defective for site I binding
in this assay whereas mutant dl 4 is not.
Binding to site II in the absence of site I
We previously reported that isolated site II sequences are not
effectively bound to nitrocellulose in the presence of T antigen
even at concentrations exceeding that required for DNase
footprint experiments (Myers et al., 1981b). With this assay
we detected only low levels of specific binding of T antigen or
Ad2D2 protein to templates lacking site I sequences
(including mutants dl 22, dl 18, and dl 23; Figure 2), indicating
that site II recognition is altered in the absence of site
I. These mutant DNAs were re-examined using the DNase
footprinting technique. Surprisingly, and in contrast with our
results obtained using the filter-binding assay, specific binding
to site II sequences was observed using mutants lacking
site I sequences (Figure 5, dl 22 and dl 18). Wild-type levels of
protection from DNase digestion were also observed in
mutants that contain polylinker DNA insertions that separate
binding sites I and II (Figure 5, pIN 41 and pIN 43), and independent
interactions were observed at both sites I and II.
To eliminate the remote possibility that T antigen binding to
site I was able to facilitate binding to site II even across a
distance of 65 bp, the binding capacities of these mutants
were re-evaluated after the removal of site I sequences.
Plasmid pIN 41 or pIN 43 was cut at restriction sites in the
polylinker sequence between sites I and II and in the vector
3250
wt
dl 2
is
-1114D-
AM.
am
::.: do
.": tw ..
40 do-
40.....
1;.:- MD
A 7
I
I
-..- 4m
we
Im4m. --
Q-41M.-
qm 4m 400
4m Ift. -..
*a -- ,,
""Mo-
WAM
"W ". %% 4ft ,,
qft *ft ftb " ,a .,
NW ". -..-
l
.p
00
DNA, and the site II fragment was isolated by gel electrophoresis.
The isolated site II fragment was found to bind T
antigen as effectively as a wild-type DNA fragment (Figure
6A); an extensive titration of site II binding at lower T antigen
concentrations failed to reveal any significant difference in
the binding affinities of these templates (data not shown). We
also observed specific site II binding to a fragment containing
a larger deletion of sequences on the early side of site II (deletion
mutant dl 12; Figure 6B), although in this case we cannot
rule out the possibility of a relatively small decrease (2- to
4-fold) in affinity for site II in the mutant relative to the wildtype
template. Therefore, we conclude that the filter-binding
assay is not accurate in the detection of specific site II protein-
DNA complexes, and that the DNase protection assay widely
used to monitor binding (Myers et al., 1981b; Tegtmeyer et
al. 1983) appears to be unreliable when used to monitor site II
binding because this procedure relies on nitrocellulose filter
retention of protein-site II complexes.
Binding to site II: effect of binding site mutations
Because the affinity of T antigen for site II appears to be
largely independent of adjacent site I binding, we decided to
map the nucleotides responsible for site II recognition directly,
using DNase footprint analysis of DNA fragments containing
site II sequence alterations. No specific site II protection
was observed using a mutant which contains site I but in
which 33 bp of site II are substituted by bacterial DNA (mutant
pIN 4; Figure 7), indicating that nucleotides within the
substituted region of base pair 5220 to 9 are specifically required
for site II recognition. However, DNA fragments that
contain either a 4-bp deletion (5239- 5242) or an 8-bp
-J

dl 22
goose
2 3 4
........I~
_
I_ 4
a
_
'a 3..
dl18
* 3 4
FE
to.
m .I
_+r I
Ii
II
11 _
_
plN43 plN41
1 2 3 4 2 3 a
I-i
13
ii
sow_
I
I UI.I -.e .
Al-,.
NO
Ls I-.:,
WA.
I* .-
f o
Ws m -w
l wt
dl22
I ~~~~~~~~~~~~~~~~If
ll~~~~~~~~~~~~
d118
i
pIN43 i - -_ _ __ _
pIN41
I
T antigen binding and DNA replication mutants
Fig. 5. DNase I footprint analysis of mutant site II templates deleted of site I sequences. DNA fragments were 5' end-labeled on the late strand at the EcoRI
site. Lanes 1-4 show the DNase pattern obtained in the presence of 0 nM, 12.5 nM, 25 nM and 37.5 nM of D2 protein, respectively. A schematic representation
of the mutants is presented below the autoradiograms.
substitution (5239- 5246) within site II were found to be
unaffected for site II binding (dl 1 and pX 8; Figure 7). This
result was surprising because these two mutants disrupt the
symmetry of the 27-bp palindrome central to binding site II.
Nevertheless, both of these mutants contain the 'major' hexanucleotide
contact sequence identified in interference experiments
(Jones and Tjian, 1984). Although the spacing or
sequence of the 'weaker' hexanucleotide contacts is altered in
the mutants, we note that this sequence is directly repeated
and may provide an altemate set of contact nucleotides for T
antigen. The site II binding affinities for these mutants also
appear to be equal in DNase footprint titrations at lower T
antigen concentrations (data not shown). Finally, a fragment
that contains only the early half of site II was found to bind T
antigen but confer DNase protection only to the residual site
II sequences (mutant dl A, data not shown), indicating that T
antigen requires sequences within both halves of binding site
II in order to provide the complete footprint protection
observed for site II in the wild-type template.
Replication of mutant plasmids in COS7 cells
The plasmids used in the binding studies above were tested
for their ability to replicate in COS7 cells, a monkey cell line
transformed with an origin-defective SV40 virus (Gluzman et
al., 1980; Gluzman, 1981). COS7 cells produce constitutive
__-_ '
II
levels of T antigens (Gluzman, 1981) sufficient to allow
replication of plasmids containing the SV40 origin of replication
(Myers and Tjian, 1980). Wild-type and mutant origin
plasmid DNA was introduced into COS7 cells by the DEAEdextran
transfection procedure (McCutchan and Pagano,
1968) and small mol. wt. DNA was isolated by the Hirt lysate
procedure (Hirt, 1967) from the cells at 0, 12 and 48 h. Supercoiled
and relaxed circular molecules were separated by
agarose gel electrophoresis, transferred to nitrocellulose
(Southern, 1975), and hybridized to radioactivity-labelled
pBR322 DNA. In all cases, trace amounts of input supercoiled
and relaxed circular DNA could be seen at 0 h. At 12 h
after transfection, no supercoiled molecules were observed
and trace amounts of relaxed circular DNA were present. In
the case of plasmids containing the wild-type origin (pSV01),
a large increase in the amount of supercoiled molecules was
observed at 48 h, indicating that the plasmid replicated. Densitometry
of autoradiograms was carried out comparing the
levels of pSV01 and mutant supercoiled DNA accumulating
at 48 h in transfected COS7 cells. The results are summarized
in Table I. Mutants dl 4 and dl 22, which lack portions of T
antigen binding site I, replicate at wild-type levels in COS7
cells. Mutant dl 18, which lacks binding site I but contains the
region between sites I and II, replicates 4- to 5-fold less effi-
3251

K.AJones, R.M.Myers and R.Tjian
ll
A.
pIN pIN
d2183 43 41 rwt.
l 2 3 1 2 3 1 2 3 1 2
*? 's
w
l_-ai~
_ _ a
~ ~ ~ ~ a
...^. am m*
.
o0ama
"
11 11
B. w.t.
G 1 2 34
Ukm-.
a d-,_g
abg_i
as
so-
_ r.
aiam.0
_ pk
_j-_m_0 u
Hg. 6. DNase footprint analysis of mutant site II templates. (A) The DNase pattern for mutant and wild-type SV40 DNA, 5' end-labeled on the early strand.
The wild-type DNA fragment was incubated in the absence of D2 protein (wt, lane 1), or with 25 nM D2 protein (lane 2). The site II fragments for mutants
pIN 41, pIN 43, and mutant dl 18 were incubated in the absence of D2 protein (lane I in each panel) or at D2 concentrations of 25 nM (lane 2) and 50 nM
(lane 3). (B) The DNase I footprint analysis of wild-type and mutant dl 12 DNA fragments in the presence of R284 T antigen at the following concentrations:
0 nM (lane 1), 19 nM (lane 2), 28 nM (lane 3) and 57 nM (lane 4).
ciently than wild-type DNA. Mutants pIN 43 and pIN 41,
which contain a 65-bp insertion between sites I and II, do not
replicate at all in COS7 cells and no replication of mutants dl
23, dl 2, dl 1, X8, pIN 4, or dl A was observed. Thus, most of
binding site I can be removed without affecting origin function.
However, when site I is completely removed, the origin
is moderately defective. Mutations that remove both site I
and the sequences between sites I and II or that separate sites
I and II by inserted bacterial sequences completely destroy the
ability of the origin to replicate. Likewise, mutations affecting
only binding site II destroy origin function.
Discussion
Here we describe the effects of various DNA template
modifications on the interaction of SV40 T antigen with binding
sites I and II at the SV40 origin of replication. While we
find that the nitrocellulose filter-binding and DNase footprint
protection assays are equally suited for the analysis of site I
binding, we observe no specific nitrocellulose filter retention
of T antigen-site II complexes in the absence of binding site I.
The observation that deletion mutant dl 23 (Figure 2) is not
retained on nitrocellulose filters in the presence of T antigen
(Myers and Tjian, 1980) originally led to the conclusion that
either sequences within site I or the binding of T antigen to
site I promotes binding to site II, possibly in a manner consistent
with positive cooperativity as observed in the binding of X
repressor to adjacent binding sites at the ORM operator. Here
we report that specific site I binding, apparently identical to
3252
JW;!- ....
Q
-b
d112
/ 1 2 3 4 G
_4 'an
4 _a
the site II binding interactions observed with wild-type
templates can be detected in the absence of site I sequences
when the DNAse footprint assay is used (mutants dl 18, 41,
43, dl 22; Figures 5, 6). We also observe the formation of T
antigen-site II complexes with deletion mutant dl 22 using an
immunoaffinity assay (Jones and Tjian, 1984) and the site II-
T antigen complex can also be detected using the filter binding
assay if antibody directed against T antigen is present in
the binding reaction (data not shown). These findings suggest
that binding to sites I and II are independent events in vitro,
and that T antigen contacts specific sequences within each
binding site. We note that DNase footprint analysis of the
more extensively deleted mutants dl 23 and dl 12 does not rule
out the possibility of a relatively small effect on binding due
to deletion of sequences between the two binding sites and,
moreover, we have not eliminated the possibility of interactions
between T antigen multimers bound at sites I and II that
do not contribute to the binding affinity. Similar observations
concerning the binding to site II in the absence of site I sequences
have been reported by others (DiMaio and Nathans,
1982; Tenen et al., 1983).
The deletion analysis presented here indicates that site I
binding is diminished or less specific in the absence of sequences
between base pairs 5192 and 5220. The late boundary
is established from the isolated site I fragment of mutant pIN
41, which appears to have an unaltered affinity for site I when
assayed by filter-binding. These sequences contain the close T
antigen contacts as defined by methylation-protection (Tjian,
_m
_
lof
- -
_g_b_WOqf
--
11

11
wt
dl 1
X8
piN 4
plN4 X8 wt
T antigen binding and DNA replication mutants
Fig. 7. DNase footprint analysis of mutant site II templates. Wild-type and mutant dl-l DNA templates, 5' end-labeled at the early strand, were incubated
with D2 protein at concentrations of 0 nM, 15 nM, 3 nM, 45 nM and 60 nM (left panel, lanes 1-5, respectively). The right panel shows the DNase footprint
pattern of mutants pX8, pIN4, and the wild-type template in the presence of 0 nM, 20 nM, 40 nM and 60 nM of D2 protein (lanes 1-4, respectively).
Table I. Mutant plasmid replication in COS7 cells
wt dl 1
1 2 3 4511 2 34 5
I_ _ - ,__om--
DNA % wild-type replication
pSVo1 100
dl2 n.d.
dl 3 n.d.
dl 4 100
dl 22 100
dl 18 20-25
pIN 43

K.A.Jones, R.M.Myers and R.Tjian
ped to the SV40 minimal origin (base pairs 5208-30; Learned
et al., 1981; Myers and Tjian, 1980; DiMaio and Nathans,
1980). The binding of T antigen to site I in mutant dl 22 is
characterized by a weak affinity and produces a severely truncated
reigon of DNase protection (determined both by DNase
footprinting and alkylation-interference techniques) indicating
that complete site I binding is not required for
replication but, rather, that sequences in the region of base
pairs 5205 -5221 are critical for viral DNA replication. It is
interesting in this regard that the origin of bidirectional
replication in vivo has also been mapped to this region (base
pairs 5210-5211; Hay and DePamphilis, 1982). In addition,
the major initiation sites for Okazaki fragment synthesis map
to nucleotides 5239 and 12 on the early mRNA strand within
T antigen binding site II (Hay and DePamphilis, 1982). It is
possible that the replicative failure of site II mutants dl 1 and
pX 8 is due to the absence of appropriate primer initiation sequences
in both mutants.
Finally, we note that mutants in which binding sites I and
II are separated by 65 bp are replication-deficient in COS7
cells (pIN 41, pIN 43; Table I). Because these mutants bind T
antigen at both sites with wild-type affinities, we conclude
that the altered spacing between base pairs 5205 and 5212 in
site I and essential sequences in site II somehow disrupts the
normal replication process. Recently, these insertion mutants
were also found to be defective in vitro in the repression of
transcription by T antigen (Rio and Tjian, unpublished
results). Therefore, interactions between T antigen multimers
bound at each site may contribute to the mechanism of autoregulation,
although the data presented here indicate that
direct protein-protein interactions do not contribute significantly
to the affinity of T antigen for each binding site.
Materials and methods
Restriction enzymes and nuclease Bal31 were purchased from Bethesda
Research Laboratories. T4 polynucleotide kinase was from P-L Biochemicals
and DNase I was from Worthington.
Construction of plasmids containing wild-type and mtuant SV40 origin sequences
The 31 l-bp EcoRII G fragment of SV40 was inserted at the EcoRI site of
pBR322 (Myers and Tjian, 1980), creating plasmid pSVOI, the wild-type
origin plasmid used in the replication studies. A plasmid containing these
tandem copies of the EcoRII G fragment, pSVO7, was used in the binding
studies. Construction of deletion mutants dl 1, dl 4, dl 22, dl 23, and dl 12 has
been previously described (Myers and Tjian, 1980), and the creation of
substitution mutant pIN 4 was detailed by Rio and Tjian (1983). Mutant dl A
was created by Bal31 digestion of plasmid pSV1096 cut at a HinclII site within
site III; this mutant is lacking sequences from base pair 5241 to 52. Mutant
pX 8 was a gift from Michael Fromm and Paul Berg (Fromm and Berg,
1982). Insertion mutants pIN 41 and pIN 43 were constructed as follows: a
fragment containing all of site I and 65 bp of bacterial DNA at the site II proximal
side of site I was isolated from insertion mutant pIN 1 (Myers et al.,
1981b) by cutting the polylinker sequence with BamHI, trimming the ends
with nuclease Bal3J, followed by complete digestion with EcoRI. A vector for
this insert was generated by cutting plasmid pSV01097 (a plasmid containing
the origin fragment from CS1097; Shortle and Nathans, 1979) with HindIII
and treating with nuclease Bal31 to remove site I sequences, followed by
EcoRI digestion. The ligated plasmid forms the sequence site I -bacterial
DNA -site II-site III, as diagrammed in Figure 2. Viral and plasmid DNAs
were purified by a modified Hirt extraction (Hirt, 1967), followed by CsCl
ethidium bromide gradient centrifugation. Ethidium was removed with
Dowex AG 50W-X8 resin in 10 mM Tris, pH 7.9, 1 mM EDTA and 1 M
NaCl and the samples were dialyzed extensively against 10 mM Tris 7.9, and
I mM EDTA at 4° C.
Purification of T antigen
We have used two sources of T antigen in the binding studies reported here,
both derived from HeLa cells infected with defective adenovirus-SV40 hybrid
viruses. The Ad2+D2 virus encodes a 107-K protein that is the functional
equivalent of SV40large T antigen (DeLucia et al., 1983) consisting of - 10 K
3254
of an adenovirus polypeptide at the amino terminus (Hassell et al., 1978). The
Ad-SVR284 hybrid virus produces full-length T antigen (Thummel et al.,
1983). Both proteins were purified to homogeneity by the method of Tjian
(1978), and were stored at 4-6 mg/ml concentrations in 10 mM Tris, pH 8,
0.5 M, NaCl, 0.2 mM dithiothreitol, 10% glycerol at - 80° C. The source of
T antigen used for each experiment is indicated in the individual figure
legends.
DNA-binding protocols
The nitrocellulose filter-binding assay has been described (Myers and Tjian,
1980). Origin-containing fragments were 5' end-labeled with [7y-32P]ATP and
polynucleotide kinase and purified by agarose or polyacrylamide gel electrophoresis
for use in footprinting experiments. The restriction site in the procedure
is indicated in the individual figure legends. Approximately 10- 13 mol
(150 ng) of each fragment was incubated with various concentrations of D2
protein in 100 i1 25 mM 1,4-piperazinediethanesulfonic acid (Pipes), pH 6.8,
0.1 M NaCl, 10% glycerol, 10 jug/ml BSA (5 min, 22° C) and cut 60 s with
3 ng DNase I in 15 mM MgCl2, 100mM CaCI. The digestion was terminated by
the addition of 200 /l 2 M ammonium acetate, 100 mM EDTA and
150 jzg/ml sonicated calf thymus DNA, and the DNA was precipitated with
2.5 volumes of ethanol. DNA pellets were resuspended in 200 Al 2.5 M ammonium
acetate and reprecipitated from ethanol. After drying, the pellets
were resuspended in 25 mM NaOH and 75% formamide, heated for 2 min at
100° C and subjected to polyacrylamide gel electrophoresis (8-16%
acrylamide, 19:1 acrylamide:bisacrylamide). The gels were analyzed by
autoradiography for 8-24 h at -80° C using an X-ray intensifer screen.
DNA replication assay
The protocol followed in the analysis of plasmid replication in COS cells is
outlined by Myers and Tjian (1980). COS7 cells, a monkey cell line constitutively
producing SV40 T antigen, were kindly provided by Yakov Gluzman.
Acknowledgements
We thank Dan DiMaio and Dan Nathans for providing cs1097 viral DNA and
freely discussing unpublished data, Michael Fromm and Paul Berg for
plasmid pX 8, and Don Rio for mutant pIN 4 DNA. We also thank Carl
Thummel and Terri Grodzicker for Ad-SVR284 viral stocks, and Robin Clark
for assistance in the purification of R284 T antigen. We are grateful to Karen
Erdley for typing this manuscript. This work was funded by a National Institute
of Environmental Health Sciences Center grant. K.A.J. was the recipient
of a postdoctoral fellowship from the National Institutes of Health.
References
Bradley,M.K., Griffin,J.D. and Livingston,D.M. (1982) Cell, 28, 125-134.
Buckman,A.R., Burnett,L. and Berg,P. (1980) in Tooze,J. (ed.), DNA
Tumor Viruses, Part II, Cold Spring Harbor Laboratory Press, NY, pp.
799-829.
DeLucia,A.L., Lewton,B.A., Tjian,R. and Tegtmeyer,P. (1983) J. Virol.,
46, 143-150.
DiMaio,D. and Nathans,D. (1980) J. Mol. Biol., 140, 129-142.
DiMaio,D. and Nathans,D. (1982) J. Mol. Biol., 156, 531-548.
Fromm,M. and Berg,P. (1982) J. Mol. Appl. Genet., 1., 457-481.
Galas,D.J. and Schmitz,A. (1978) Nucleic Acids Res., 5, 3157-3170.
Giacherio,D. and Hager,L.P. (1979) J. Biol. Chem., 254, 8113-8116.
Gluzman,Y. (1981) Cell, 23, 175-182.
Gluzman,Y., Sambrook,J.F. and Frisque,R.J. (1980) Proc. Natl. Acad. Sci.
USA, 77, 3898-3902.
Hansen,U., Tenen,D.G., Livingston,D.M. and Sharp,P.A. (1981) Cell, 27,
603-612.
Hassell,J.A., Lukanidin,E., Fey,G. and Sambrook,J. (1978) J. Mol. Biol.,
120, 209-247.
Hay,R.T. and DePamphilis,M.L. (1982) Cell, 28, 767-779.
Hirt,B. (1967) J. Mol. Biol., 26, 365-369.
Jones,K.A. and Tjian,R. (1984) Cell, 36, 155-162.
Lane,D.P. and Crawford,L.V. (1979) Nature, 278, 261-263.
Learned,R.M., Myers,R.M. and Tjian,R. (1981) in Ray,D.S. and Fox,C.F.
(eds.), ICN-UCLA Symposium on Molecular and Cellular Biology, Vol.
21, Academic Press, NY, pp. 555-566.
Lewton,B.A., DeLucia,A.L. and Tegtmeyer,P. (1984) J. Virol., 49, 9-13.
Linzer,D.I.H. and Levine,A.J. (1979) Cell, 17, 43-52.
Margolskee,R.F. and Nathans,D. (1984) J. Virol., 49, 386-393.
McCormick,F. and Harlow,E. (1980) J. Virol., 34, 213-224.
McCutchan,J.H. and Pagano,J.S. (1968) J. NatI. Cancer Inst., 41, 351-356.
McKay,R.D.G. (1981) J. Mol. Biol., 145, 471-488.
McKay,R. and DiMaio,D. (1981) Nature, 289, 810-813.
Myers,R.M. and Tjian,R. (1980) Proc. Natl. Acad. Sci. USA, 77, 6491-
6495.

Myers,R.M., Kligman,M. and Tjian,R. (1981a) J. Biol. Chem., 256, 10156-
10160.
Myers,R.M., Rio,D.C., Robbins,A.K. and Tjian,R. (1981b) Cell, 25, 373-
384.
Myers,R.M., Williams,R.C. and Tjian,R. (1981c) J. Mol. Biol., 148, 347-353.
Osborn,M. and Weber, K. (1975) J. Virol., 15, 636-644.
Rio,D.C. and Tjian,R. (1983) Cell, 32, 1227-1240.
Rio,D., Robbins,A., Myers,R. and Tjian,R. (1980) Proc. Nat!. Acad. Sci.
USA, 77, 5706-5710.
Shortle,D. and Nathans,D. (1979) J. Mo!. Biol., 131, 801-817.
Shortle,D.R., Margolskee,R.F. and Nathans,D. (1979) Proc. Nat!. Acad.
Sci. USA, 77, 5706-5710.
Southern,E.M. (1975) J. Mol. Biol., 26, 365-369.
Tegtmeyer,P. (1975) J. Virol., 15, 613-618.
Tegtmeyer,P., Anderson,B., Shaw,S.B. and Wilson,V.G. (1981) Virology,
115, 75-87.
Tegtmeyer,P., Lewton,B.A., DeLucia,A.L., Wilson,V.G. and Ryder,K.
(1983) J. Virol., 46, 151-161.
Tenen,D.G., Haines,L.L. and Livingston,D.M. (1982) J. Mol. Biol., 157,
473-492.
Tenen,D.G., Taylor,T.S., Haines,L.L., Bradley,M.K., Martin,R.G. and
Livingston,D.M. (1983) J. Mol. Biol., 168, 791-808.
Thummel,C., Tjian,R., Hu,S.-L. and Grodzicker,T. (1983) Cell, 33,455-464.
Tjian,R. (1978) Cell, 13, 165-179.
Tjian,R. (1979) Cold Spring Harbor Symp. Quant. Biol., 43, 655-662.
Tjian,R. (1981) Cell, 26, 1-2.
Tjian,R. and Robbins,A. (1979) Proc. Nat!. Acad. Sci. USA, 76, 610-614.
Tjian,R., Robbins,A. and Clark,R. (1980) Cold Spring Harbor Symp. Quant.
Biol., 44, 103-111.
Tooze,J. (1981) Molecular Biology of Tumor Viruses, 2nd ed., DNA Tumor
Viruses, published by Cold Spring Harbor Laboratory Press, NY.
Wilson,V.G., Tevethia,M.J., Lewton,B.A. and Tegtmeyer,P. (1982) J.
Virol., 44, 458-466.
Received on 8 August 1984; revised on 28 September 1984
T antigen binding and DNA replication mutants
3255