Figures - E-LIB - UniversitÃ¤t Bremen

More documents

Recommendations

Info

Publication III 104 Hardewig, I., Pörtner, H. O. and Peck, L. S. (1999). Thermal sensitivity of mitochondrial function in the Antarctic Notothenioid Lepidonotothen nudifrons. J Comp Physiol [B] 169, 597-604. Hochachka, P. W. and Somero, G. N. (2002). Temperature. In Biochemical Adaptation- Mechanisms and process in physiological evolution., pp. 290-438. Oxford: Oxford University Press. Hofmann, G., Buckley, B., Airaksinen, S., Keen, J. and Somero, G. (2000). Heat-shock protein expression is absent in the antarctic fish Trematomus bernacchii (family Nototheniidae). J Exp Biol 203, 2331-2339. Hudson, H., Brauer, P., Scofield, M. and Petzel, D. (2008). Effects of warm acclimation on serum osmolality, cortisol and hematocrit levels in the Antarctic fish, Trematomus bernacchii. Polar Biol 31, 991. Ip, Y. T. and Davis, R. J. (1998). Signal transduction by the c-Jun N-terminal kinase (JNK) - from inflammation to development. Curr Opin Cell Biol 10, 205-219. IPCC. (2007). Intergovernmental Panel on Climate Change: Climate Change 2007- Synthesis Report. Contribution of Working Groups I, II and III to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Geneva, Switzerland. Johnston, I. I., Calvo, J. and Guderley, Y. H. (1998). Latitudinal variation in the abundance and oxidative capacities of muscle mitochondria in perciform fishes. J Exp Biol 201 (Pt 1), 1-12. Ju, Z. J., Dunham, R. D. and Liu, Z. L. (2002). Differential gene expression in the brain of channel catfish (Ictalurus punctatus) in response to cold acclimation. Mol Genet Genomics 268, 87-95. Kadrmas, J. L. and Beckerle, M. C. (2004). The LIM domain: from the cytoskeleton to the nucleus. Nat Rev Mol Cell Biol 5, 920-931. Kassahn, K., Crozier, R., Ward, A., Stone, G. and Caley, M. J. (2007). From transcriptome to biological function: environmental stress in an ectothermic vertebrate, the coral reef fish Pomacentrus moluccensis. BMC Genomics 8, 358. Kassahn, K. S., Crozier, R. H., Pörtner, H. O. and Caley, M. J. (2009). Animal performance and stress: responses and tolerance limits at different levels of biological organisation. Biol Rev Camb Philos Soc 84, 277-92. Kikuchi, G., Motokawa, Y., Yoshida, T. and Hiraga, K. (2008). Glycine cleavage system: reaction mechanism, physiological significance, and hyperglycinemia. Proc Jpn Acad, B 84, 246-263. Kimura, S. H., Ikawa, M., Ito, A., Okabe, M. and Nojima, H. (2001). Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damage recovery. Oncogene 20, 3290-3300. Kültz, D. (2005). Molecular and Evolutionary Basis of the Cellular Stress Response. Annu Rev Physiol 67, 225-257. Lannig, G., Storch, D. and Pörtner, H.-O. (2005). Aerobic mitochondrial capacities in Antarctic and temperate eelpout (Zoarcidae) subjected to warm versus cold acclimation. Polar Biol 28, 575-584. Logan, C. A. and Somero, G. N. (2010). Transcriptional responses to thermal acclimation in the eurythermal fish Gillichthys mirabilis (Cooper 1864). Am J Physiol Regul Integr Comp Physiol 299, R843-R852. Logan, C. A. and Somero, G. N. (2011). Effects of thermal acclimation on transcriptional responses to acute heat stress in the eurythermal fish Gillichthys mirabilis (Cooper). Am J Physiol Regul Integr Comp Physiol 300, R1373-R1383. Lowe, C. J. and Davison, W. (2005). Plasma osmolarity, glucose concentration and erythrocyte responses of two Antarctic nototheniid fishes to acute and chronic thermal change. J Fish Biol 67, 752-766.
Publication III Lum, J. J., DeBerardinis, R. J. and Thompson, C. B. (2005). Autophagy in metazoans: cell survival in the land of plenty. Nat Rev Mol Cell Biol 6, 439-448. Mark, F. C., Bock, C. and Pörtner, H. O. (2002). Oxygen-limited thermal tolerance in Antarctic fish investigated by MRI and 31P-MRS. Am J Physiol Regul Integr Comp Physiol 283, R1254-1262. Mark, F. C., Lucassen, M. and Pörtner, H. O. (2006). Thermal sensitivity of uncoupling protein expression in polar and temperate fish. Comp Biochem Physiol D Genom Proteom 1, 365-374. Neves, S. R., Ram, P. T. and Iyengar, R. (2002). G Protein Pathways. Science 296, 1636- 1639. Podrabsky, J. E. and Somero, G. N. (2004). Changes in gene expression associated with acclimation to constant temperatures and fluctuating daily temperatures in an annual killifish Austrofundulus limnaeus. J Exp Biol 207, 2237-2254. Pörtner, H. (2012). Integrating climate-related stressor effects on marine organisms: unifying principles linking molecule to ecosystem-level changes. Mar Ecol Prog Ser 470, 273-290. Pörtner, H. O. (2002a). Climate variations and the physiological basis of temperature dependent biogeography: systemic to molecular hierarchy of thermal tolerance in animals. Comp Biochem Physiol A Mol Integr Physiol 132, 739-761. Pörtner, H. O. (2002b). Physiological basis of temperature-dependent biogeography: trade-offs in muscle design and performance in polar ectotherms. J Exp Biol 205, 2217- 2230. Pörtner, H. O. (2010). Oxygen- and capacity-limitation of thermal tolerance: a matrix for integrating climate-related stressor effects in marine ecosystems. J Exp Biol 213, 881-893. Pörtner, H. O. and Farrell, A. P. (2008). Ecology. Physiology and climate change. Science 322, 690-2. Pörtner, H. O. and Knust, R. (2007). Climate Change Affects Marine Fishes Through the Oxygen Limitation of Thermal Tolerance. Science 315, 95-97. Pörtner, H. O., Lucassen, M. and Storch, D. (2005). Metabolic Biochemistry: Its Role in Thermal Tolerance and in the Capacities of Physiological and Ecological Function. In The Physiology of Polar Fishes, vol. Volume 22 eds. A. P. Farrell and J. F. Steffensen, pp. 79- 154. San Diego: Elsevier Academic Press. Pörtner, H. O., Peck, L. and Somero, G. (2007). Thermal limits and adaptation in marine Antarctic ectotherms: an integrative view. Philos Trans R Soc B-Biol Sci 362, 2233-2258. Powell, S., Szklarczyk, D., Trachana, K., Roth, A., Kuhn, M., Muller, J., Arnold, R., Rattei, T., Letunic, I., Doerks, T. et al. (2011). eggNOG v3.0: orthologous groups covering 1133 organisms at 41 different taxonomic ranges. Nucl Acids Res 40, D284- D289. R-Development-Core-Team. (2011). R: A language and environment for statistical computing. R Foundation for Statistical Computing, ISBN 3-900051-07-0, http://www.Rproject.org/. Vienna, Austria. Saeed, A. I., Bhagabati, N. K., Braisted, J. C., Liang, W., Sharov, V., Howe, E. A., Li, J., Thiagarajan, M., White, J. A., Quackenbush, J. et al. (2006). TM4 Microarray Software Suite. Meth Enzymology 411, 134-193. Shivaswamy, S. and Iyer, V. R. (2008). Stress-Dependent Dynamics of Global Chromatin Remodeling in Yeast: Dual Role for SWI/SNF in the Heat Shock Stress Response. Mol Cell Biol 28, 2221-2234. Sidell, B. and Hazel, J. (2002). Triacylglycerol lipase activities in tissues of Antarctic fishes. Polar Biol 25, 517-522. Smith, T. F. (2008). Diversity of WD-repeat proteins. Subcell Biochem 48, 20-30. 105
Page 1:
Molecular adaptation and thermal pl
Page 5 and 6:
Table of Contents Abbreviations ...
Page 7 and 8:
Abbreviations Abbreviations 3HBDH 6
Page 9 and 10:
Figures & Tables Figures Figure 1:
Page 11 and 12:
Summary prepares for hypoxemic cond
Page 13 and 14:
Zusammenfassung Um die Anpassungsf
Page 15 and 16:
Introduction 1 Introduction The imp
Page 17 and 18:
Introduction processes become incre
Page 19 and 20:
Introduction viscosity of body flui
Page 21 and 22:
Introduction turnover rates (K kat
Page 23 and 24:
Introduction haemoglobin in icefish
Page 25 and 26:
Introduction In several studies P.
Page 27 and 28:
Introduction (Gille, 2002). The spe
Page 29 and 30:
Materials & Methods 2 Materials & M
Page 31 and 32:
Materials & Methods 2.2 Animal incu
Page 33 and 34:
Materials & Methods For enzymes mea
Page 35 and 36:
Materials & Methods 8.4), 50 mM KCl
Page 37 and 38:
Materials & Methods Between both ap
Page 39 and 40:
Materials & Methods Figure 6: Exper
Page 41 and 42:
Materials & Methods Figure 7: Norma
Page 43 and 44:
Publications 3 Publications List of
Page 45 and 46:
Publication I Publication I Thermal
Page 47 and 48:
Am J Physiol Regul Integr Comp Phys
Page 49 and 50:
== TGACGACACGGACATCCTCAAC A
Page 51 and 52:
== TCTGTGACGAGCGAGTGGTT TGA
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Publication II Publication II Evolu
Page 63 and 64:
Publication II Evolutionary force i
Page 65 and 66:
Publication II Background Marine ec
Page 67 and 68: Publication II Results A classifica
Page 69 and 70: Publication II Figure 3 Overview of
Page 71 and 72: Publication II Amino acid usage Tra
Page 73 and 74: Publication II Codon usage The set
Page 75 and 76: Publication II Discussion In the pr
Page 77 and 78: Publication II (meNOG13752) and ext
Page 79 and 80: Publication II pooling unpolar to p
Page 81 and 82: Publication II transcript sequences
Page 83 and 84: Publication II Material and methods
Page 85 and 86: Publication II Quality assessment a
Page 87 and 88: Publication II Acknowledgments The
Page 89 and 90: Publication II 30. Wang G-Z, Lerche
Page 91 and 92: Publication III Publication III Str
Page 93 and 94: Publication III Stress response or
Page 95 and 96: Publication III Introduction Temper
Page 97 and 98: Publication III designed a microarr
Page 99 and 100: Publication III Animal performance
Page 101 and 102: Publication III Data processing and
Page 103 and 104: Publication III Results and Discuss
Page 105 and 106: Publication III Functional outline
Page 107 and 108: Publication III temperatures, but a
Page 109 and 110: Publication III cytosol is affected
Page 111 and 112: Publication III After chronic expos
Page 113 and 114: Publication III contribute to cellu
Page 115 and 116: Publication III induction was descr
Page 117: Publication III References Abele, D
Page 121 and 122: Publication III Figures: Figure 1:
Page 123 and 124: Publication III Tables: Table 1: Ta
Page 125 and 126: Publication III Supplementary figur
Page 127 and 128: Publication III Cluster 3: Metaboli
Page 129 and 130: Discussion 4 Discussion This thesis
Page 131 and 132: Discussion cellular metabolism disp
Page 133 and 134: Discussion genes between a cold-ada
Page 135 and 136: Discussion Moreover, when analyzing
Page 137 and 138: Discussion Elevated COX/CS ratios i
Page 139 and 140: Discussion acclimation (pub. I, Fig
Page 141 and 142: Discussion fluid osmotic gradient i
Page 143 and 144: Discussion 9°C) were analyzed with
Page 145 and 146: Discussion 4.3.2 Characteristic tra
Page 147 and 148: Discussion constraint in the cold a
Page 149 and 150: Discussion zoarcid transcriptomic s
Page 151 and 152: Discussion The question remains as
Page 153 and 154: References 31, 75-87. Brett, J. R.
Page 155 and 156: References sequences reveals that l
Page 157 and 158: References Hemmingsen, E. A., Dougl
Page 159 and 160: References Antarctic and temperate
Page 161 and 162: References stable housekeeping gene
Page 163 and 164: References preferentially cataboliz
Page 165 and 166: References 263. Wang, H.-C., Xia, X
Page 167 and 168: Appendix Figure AP-1: Tissue-specif
Page 169 and 170:
Appendix Table Ap-1: Summary of mos
Page 171 and 172:
Appendix 6.5 Sex-dependent gene exp
Page 173 and 174:
Danksagung Allen übrigen Mitgliede
Page 175:
Erklärung Heidrun Windisch Goethes
show all

Figures - E-LIB - UniversitÃ¤t Bremen

Create successful ePaper yourself

Delete template?

Save as template?