Figures - E-LIB - UniversitÃ¤t Bremen

More documents

Recommendations

Info

Materials & Methods 28
Publications 3 Publications List of publications and authors’ contributions. Publication I Heidrun S. Windisch, Raphaela Kathöver, Hans-Otto Pörtner, Stephan Frickenhaus and Magnus Lucassen (2011). Thermal acclimation in Antarctic fish: Transcriptomic profiling of metabolic pathways. American Journal of Physiology: Regulatory, Integrative and Comparative Physiology, 301 (5), R1453–R1466. The concept of the study was elaborated by ML and myself. I performed the experiments with help of RK. The data analyses and interpretation was done by SF, ML, RK and myself. I drafted the manuscript, which was revised by HOP, ML and SF. Publication II Heidrun S. Windisch, Magnus Lucassen and Stephan Frickenhaus (2012). Evolutionary force in confamiliar marine vertebrates of different temperature realms: adaptive trends in zoarcid fish transcriptomes. BioMed Central Genomics 13, 549. The ideas for this study were developed by SF, ML and myself. I conducted the experiments and analyzed the data. The approach for a pair-wise comparative analyses was developed by SF. I wrote the manuscript, which was revised by ML and SF. Publication III Heidrun S. Windisch, Stephan Frickenhaus, Uwe John, Rainer Knust, Hans-Otto Pörtner and Magnus Lucassen (in preparation). Transcriptomic features in Pachycara brachycephalum after chronic acclimation to various temperatures; a microarray study in Antarctic fish. I developed the concept and design of the experiment in cooperation with ML, RK and SF, supported by UJ. I performed the experiments and analyzed the data with the help of SF and UJ. I wrote the manuscript, which was revised by HOP, ML, SF and UJ. 29
Page 1: Molecular adaptation and thermal pl
Page 5 and 6: Table of Contents Abbreviations ...
Page 7 and 8: Abbreviations Abbreviations 3HBDH 6
Page 9 and 10: Figures & Tables Figures Figure 1:
Page 11 and 12: Summary prepares for hypoxemic cond
Page 13 and 14: Zusammenfassung Um die Anpassungsf
Page 15 and 16: Introduction 1 Introduction The imp
Page 17 and 18: Introduction processes become incre
Page 19 and 20: Introduction viscosity of body flui
Page 21 and 22: Introduction turnover rates (K kat
Page 23 and 24: Introduction haemoglobin in icefish
Page 25 and 26: Introduction In several studies P.
Page 27 and 28: Introduction (Gille, 2002). The spe
Page 29 and 30: Materials & Methods 2 Materials & M
Page 31 and 32: Materials & Methods 2.2 Animal incu
Page 33 and 34: Materials & Methods For enzymes mea
Page 35 and 36: Materials & Methods 8.4), 50 mM KCl
Page 37 and 38: Materials & Methods Between both ap
Page 39 and 40: Materials & Methods Figure 6: Exper
Page 41: Materials & Methods Figure 7: Norma
Page 45 and 46: Publication I Publication I Thermal
Page 47 and 48: Am J Physiol Regul Integr Comp Phys
Page 49 and 50: == TGACGACACGGACATCCTCAAC A
Page 51 and 52: == TCTGTGACGAGCGAGTGGTT TGA
Page 61 and 62: Publication II Publication II Evolu
Page 63 and 64: Publication II Evolutionary force i
Page 65 and 66: Publication II Background Marine ec
Page 67 and 68: Publication II Results A classifica
Page 69 and 70: Publication II Figure 3 Overview of
Page 71 and 72: Publication II Amino acid usage Tra
Page 73 and 74: Publication II Codon usage The set
Page 75 and 76: Publication II Discussion In the pr
Page 77 and 78: Publication II (meNOG13752) and ext
Page 79 and 80: Publication II pooling unpolar to p
Page 81 and 82: Publication II transcript sequences
Page 83 and 84: Publication II Material and methods
Page 85 and 86: Publication II Quality assessment a
Page 87 and 88: Publication II Acknowledgments The
Page 89 and 90: Publication II 30. Wang G-Z, Lerche
Page 91 and 92: Publication III Publication III Str
Page 93 and 94:
Publication III Stress response or
Page 95 and 96:
Publication III Introduction Temper
Page 97 and 98:
Publication III designed a microarr
Page 99 and 100:
Publication III Animal performance
Page 101 and 102:
Publication III Data processing and
Page 103 and 104:
Publication III Results and Discuss
Page 105 and 106:
Publication III Functional outline
Page 107 and 108:
Publication III temperatures, but a
Page 109 and 110:
Publication III cytosol is affected
Page 111 and 112:
Publication III After chronic expos
Page 113 and 114:
Publication III contribute to cellu
Page 115 and 116:
Publication III induction was descr
Page 117 and 118:
Publication III References Abele, D
Page 119 and 120:
Publication III Lum, J. J., DeBerar
Page 121 and 122:
Publication III Figures: Figure 1:
Page 123 and 124:
Publication III Tables: Table 1: Ta
Page 125 and 126:
Publication III Supplementary figur
Page 127 and 128:
Publication III Cluster 3: Metaboli
Page 129 and 130:
Discussion 4 Discussion This thesis
Page 131 and 132:
Discussion cellular metabolism disp
Page 133 and 134:
Discussion genes between a cold-ada
Page 135 and 136:
Discussion Moreover, when analyzing
Page 137 and 138:
Discussion Elevated COX/CS ratios i
Page 139 and 140:
Discussion acclimation (pub. I, Fig
Page 141 and 142:
Discussion fluid osmotic gradient i
Page 143 and 144:
Discussion 9°C) were analyzed with
Page 145 and 146:
Discussion 4.3.2 Characteristic tra
Page 147 and 148:
Discussion constraint in the cold a
Page 149 and 150:
Discussion zoarcid transcriptomic s
Page 151 and 152:
Discussion The question remains as
Page 153 and 154:
References 31, 75-87. Brett, J. R.
Page 155 and 156:
References sequences reveals that l
Page 157 and 158:
References Hemmingsen, E. A., Dougl
Page 159 and 160:
References Antarctic and temperate
Page 161 and 162:
References stable housekeeping gene
Page 163 and 164:
References preferentially cataboliz
Page 165 and 166:
References 263. Wang, H.-C., Xia, X
Page 167 and 168:
Appendix Figure AP-1: Tissue-specif
Page 169 and 170:
Appendix Table Ap-1: Summary of mos
Page 171 and 172:
Appendix 6.5 Sex-dependent gene exp
Page 173 and 174:
Danksagung Allen übrigen Mitgliede
Page 175:
Erklärung Heidrun Windisch Goethes
show all

Figures - E-LIB - UniversitÃ¤t Bremen

Create successful ePaper yourself

Delete template?

Save as template?