Beginner's Guide to BLAST
Beginner's Guide to BLAST
Beginner's Guide to BLAST
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
Scan Database…Initiate Extensions<br />
Protein <strong>BLAST</strong> requires two hits<br />
GTQITVEDLFYNI<br />
<br />
two neighborhood words<br />
Nucleotide <strong>BLAST</strong> requires exact matches<br />
ATCGCCATGCTTAATTGGGCTT<br />
<br />
exact word match<br />
11<br />
Global vs Local Alignment<br />
Seq 1<br />
Seq 2<br />
Global alignment<br />
Seq 1<br />
Seq 2<br />
Local alignment<br />
12