Agronomic Investigation of New Microbial Isolates as Bio fertilizers ...
Agronomic Investigation of New Microbial Isolates as Bio fertilizers ...
Agronomic Investigation of New Microbial Isolates as Bio fertilizers ...
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
c. Molecular characterization <strong>of</strong> the bi<strong>of</strong>ertilizer microbes<br />
Isolation <strong>of</strong> the genomic DNA (Sambrook et al. 1989)<br />
<br />
<br />
<br />
<br />
<br />
Amplification <strong>of</strong> 16s rDNA - Forward 8F primer<br />
5'AGAGTTTGATCCTGGCTCAG3' and reverse 1492R primer<br />
5'CGGCTACCTTGTTACGACTT3’ (Babu et al. 2004)<br />
Agarose Gel Electrophoresis (AGE) with 100 bp marker (NE<br />
<strong>Bio</strong>labs)<br />
The band cut, eluted and purified using the QIA quick gel<br />
extraction kit, QIAGEN<br />
Sequencing <strong>of</strong> the eluted product - Genei, Bangalore<br />
Sequence analysis - National Centre <strong>of</strong> <strong>Bio</strong>technology<br />
Information (NCBI) datab<strong>as</strong>e -B<strong>as</strong>ic Local Alignment Search Tool<br />
(BLAST)
Change language