products - Integrated DNA Technologies

INTEGRATEDDNATECHNOLOGIESContact InformationCOMPANYABOUT IDTEuropean OperationsPlace an OrderUS HeadquartersPlace an Order•Order online at www.idtdna.com•Order online at www.idtdna.com•Email orders to euorders@idtdna.com•Email orders to orders@idtdna.com•Fax orders to +32 (0) 16 28 22 80•Fax orders to +1-319-626-8444Contact IDTDirect: +32 (0) 16 28 22 60Fax: +32 (0) 16 28 22 80General & Technical Questions: eutechsupport@idtdna.comInvoice Questions: invoices@idtdna.comSales Representative Information: eutechsupport@idtdna.comLegal & Regulatory Affairs: legal@idtdna.comPackaging & Formulation Quotes: pfquote@idtdna.comContact IDTDirect: +1-319-626-8400Fax: +1-319-626-8444General & Technical Questions: custcare@idtdna.comInvoice Questions: invoices@idtdna.comSales Representative Information: custcare@idtdna.comLegal & Regulatory Affairs: legal@idtdna.comPackaging & Formulation Quotes: pfquote@idtdna.comWeb Chat: www.idtdna.com•All orders accepted by IDT are made subject to the restrictions and conditions outlined in the Standard Terms &Conditions of Sale section of this catalog. Further restrictions may apply. IDT reserves the right to refuse any order.OfficesUS HeadquartersIntegrated DNA Technologies, Inc.1710 Commercial ParkCoralville, IA 52241USAEuropean OperationsIntegrated DNA Technologies, BVBAInterleuvenlaan 12A3001 LeuvenBELGIUMCanada Sales OfficeDirect: +604-756-0979Fax: +604-756-0591CANADAExecutive OfficeIntegrated DNA Technologies, Inc.8180 N. McCormick Blvd.Skokie, IL 60076USAScotland Sales OfficeWoodside House20-23 Woodside PlaceGlasgow, Scotland G3 7QFSCOTLAND*See page 2 for distributor information©2008 Integrated DNA Technologies www.idtdna.com1

INTEGRATEDDNATECHNOLOGIESPRODUCTSTABLE OF CONTENTSTable of ContentsGeneral InformationContact IDT 1Shipping 1Payment/Pricing Terms 1International Distributors 2DNA and RNA SynthesisCustom DNA Synthesis 6Custom DNA Synthesis in Plates 6Custom RNA Synthesis 7Ultramers 8Oligonucleotide Purification 9SameDay Oligo Service 10Rapid HPLC Purification 10HOTplates 10Preparative and Analytical Services 11Packaging and Formulation 11Functional GenomicsScreening DsiRNA 15Evader DsiRNA 16Large-Scale DsiRNA 17TriFECTa RNAi Kit 18Validated DsiRNA Controls 19TriFECTin Transfection Reagent 23DNA-Directed RNAi 24MicroCache Small RNA Cloning 25miRFire 29Antisense Oligonucleotides 30Fluorescence-Based ApplicationsExpress DLP 50Dual-Labeled DNA Probes 51Dual-Labeled LNA Probes 54Plexor 56Molecular Beacons 57RNase Substrates 58ModificationsFreedom Dyes 61Fluorophores 63Phosphorylation 69Attachment Chemistry/Linkers 69Dark Quenchers 73Spacers 74Modified Bases 76Phosphorothioate Bonds 80Standard Terms & Conditions of Sale 82Appendix 86Synthetic BiologyCustom Gene Synthesis 32MicroArray ProductsDetector Oligonucleotides 34Buffers 35Nuclease ControlRNaseAlert and DNaseAlert Substrates 38Reagents, Buffers & MarkersNuclease-free Buffers and Reagents 40Oligo Length Standards 41ReadyMade ProductsReadyMade Primers 44Aminoacyl-Adenylate Analogues 44ReadyMade Randomers 45©2008 Integrated DNA Technologies www.idtdna.com3

INTEGRATEDDNATECHNOLOGIESPRODUCTSDNA/RNA SYNTHESISCustom DNA Synthesis in TubesDesalted custom synthesized DNA oligos delivered in tubes are shipped lyophilized or hydrated with LabReady Oligo Service.Synthesis scales up to 1 μmole are shipped the next business day. 5 μmole and 10 μmole scales are shipped within 5 businessdays.At no extra charge, every oligo is deprotected and desalted to remove small molecule impurities. Oligos are quantitatedtwice by UV spectrophotometry to provide an accurate measure of yield. Mass yield (OD) varies with length and decreases forshorter oligos. All oligos are quality control (QC) checked by mass spectrometry. This data is provided free of charge at www.idtdna.com.Yield Guarantees for Standard Desalted DNA OligosYields (listed for unmodified DNA oligos and will vary with length)Synthesis Scale Length Yield Available in Plates25 nmole 15-60 bases 3 ODs a100 nmole 10-90 bases 6 ODs a250 nmole 5-100 bases 15 ODs a1 µmole 5-100 bases 45 ODs a5 µmole 5-60 bases 225 ODs Inquire10 µmole 5-60 bases 450 ODs InquireCustom DNA in PlatesOrders with 24 oligos or more can be packaged into 96-well plates. 384-well plates are also available for orders with 96 oligosor more. Plates can be delivered lyophilized or at a pre-set volume in water or buffer. IDTE (1X TE solution) is available in pH 7.5or pH 8.0.IDT offers several plate loading options• Oligos can be normalized to the same concentration or volume across the plate• Full synthesis yield can be loaded into the plate• Mixed, normalized oligos can be loaded in the same well• Normalized oligos in plates can have the remainder of the synthesis yield loaded into a separate plate• Primer mix remainders can be shipped in two separate plates• Duplicate 96-well plates are available.Please inquire for modified or purified oligos in plates. Contact a local sales office for pricing and turnaround time.Related ProductsUltramers (60-200 bases) Pg. 08 Preparative and Analytical Services Pg. 11Standard Mixed Base Sites Pg. 11 DNaseAlert Pg. 38©2008 Integrated DNA Technologies 6 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSDNA/RNA SYNTHESISCustom RNA SynthesisIDT has the expertise to deliver custom-synthesized RNA with the yield and purity that today’s researcher demands. RNAsynthesized on the 100 nmole, 250 nmole or 1 µmole scale is shipped deprotected and desalted in 2-3 business days ordeprotected and purified in 4-6 business days. Please inquire for turnaround on 5 µmole and 10 µmole RNA synthesis.Available Lengths: RNA oligos are available from 10-50 bases on the 100 nmole scale and 5-50 bases on all other scales.2’-O-Methyl RNA2’-O-Methyl RNA is a useful RNA analog that is resistant to degradation by single-stranded ribonucleases.Large-Scale RNA SynthesisRNA, RNA analogs and chimeras are available in quantities up to ten grams. IDT continues its tradition of providing researcherswith the highest quality RNA oligonucleotide synthesis, in quantities ranging from multi-mg to several grams.Custom Services:• Scale-up programs for siRNA, DsiRNA, aptamers, ribozymes, antisense and others• Extensive QC packages tailored to researchers’ needs• Sterile-filtered oligo preparations available, endotoxin free• Harmonized protocols allow simple transfer to our kilo-scale cGMP manufacturing partner, Agilent• Contact a local sales office for more information.Related ProductsRNase Free HPLC Pg. 9 2’ O-Methyl RNA bases Pg. 30, 79Nuclease Decontamination Solution Pg. 40 Annealing Pg. 11RNaseAlert Pg. 38 LNA bases Pg. 54, 78Preparative and Analytical Services Pg. 11Technical NoteGenerally for RNA oligos, 1 OD ~ 100/x nanomoles, where x isthe length of the oligo in bases. For the average 20-mer RNAoligo, 1 OD = 5 nanomoles. Actual nanomoles per OD varieswith sequence composition.FREE QC TRACES ONLINE©2008 Integrated DNA Technologies www.idtdna.com7

INTEGRATEDDNATECHNOLOGIESPRODUCTSDNA/RNA SYNTHESISULTRAmers TMUltramers represent the next generation in DNA synthesis technology. IDT’s proprietary synthesis systems and chemistriesallow high-fidelity synthesis of very long oligos (up to 200 bases). Suitable for demanding applications like cloning, ddRNAiand gene construction, Ultramers can save researchers a great deal of time and trouble in these applications through directsynthesis of the entire target fragment.Ultramers are delivered deprotected and desalted to remove small molecule impurities, or PAGE purified for extremely highpurity needs. For even greater convenience, standard desalted Ultramers are delivered normalized to IDT’s guaranteed yield.Ultramers are shipped lyophilized in 2 to 4 business days for standard desalt and 4 to 7 business days when PAGE purified.As always at IDT, all oligos receive complimentary mass spectrometry quality control (MS QC). A custom, proprietary LC-MSElectrospray method has been developed to provide accurate mass assessment up to 200 bases. The mass spectrometry QC traceis provided at www.idtdna.com.Product Specifications:• 60 to 200 bases• Delivered normalized and lyophilized in tubes• Ideal for gene construction, cloning and ddRNAi• Standard desalted Ultramers ship within 2-4 business days• PAGE-purified Ultramers ship within 4-7 business daysProduct Purification Guaranteed Yield4-nmole Ultramer DNA Oligo Standard Desalt 4 nmoles25-nmole Ultramer DNA Oligo Standard Desalt 25 nmolesPAGE-Purified Ultramer DNA OligoPAGEPurificationInquire4-nmole Ultramer Plate* Oligo Standard Desalt 4 nmoles/well*Minimum of 24 Ultramer oligos per plate.Modifications:• 5' Phosphorylation• 5' Biotin• 5' Amino Modifier C6• 5' Amino C12• 5' & Int deoxyInosine• 5' & Int deoxyUridinePlease note that not all modifications are compatible with PAGE purification.Technical NotePurity cannot be assessed accurately on Ultramer oligos (60 - 200 bases in length) as CE and HPLC methods lose their single-baseresolution properties with molecules this large.Ultramer plates are loaded at 4 nmoles per well, either lyophilized or shipped wet (frozen on dry ice) at 100 µM in 40 µL. Remaindersin tubes or plates are not available on Ultramer oligo plates.©2008 Integrated DNA Technologies 8 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESOligonucleotide Purification & Guaranteed Yields*PRODUCTSDNA/RNA SYNTHESISScale PAGE HPLC IE HPLCRNase-FreeHPLCDual HPLCDual PAGE &HPLC100 nmole 1 OD 1 OD 1 OD 1 OD 1 OD N/A250 nmole 2 ODs 4 ODs 4 ODs 4 ODs 2 ODs 1 OD1 µmole 10 ODs 20 ODs 20 ODs 20 ODs 10 ODs 5 ODs5 µmole 50 ODs 100 ODs 100 ODs 100 ODs 50 ODs 25 ODs10 µmole 100 ODs 200 ODs 200 ODs 200 ODs 100 ODs 50 ODs*Minimum guaranteed yields are for purified, unmodified DNA oligos 20-50 bases in lengthPurification is recommended for all oligos greater than 40 bases in length and for many modified oligos. For demandingapplications such as multiplex PCR, cloning, mutagenesis or antisense/RNAi methods, additional purification will significantlyimprove oligonucleotide performance. Every purified oligo up to 60 bases in length receives QC by capillary electrophoresis(CE) or HPLC to validate final purity.PAGE PurificationPAGE obtains extremely high purity, especially for unmodified oligos and Ultramers. PAGE purification is stronglyrecommended for oligos over 60 bases in length. For unmodified oligos, purity of >90% is routinely achieved.HPLC PurificationHPLC is well-suited to purify any modified oligo or unmodified sequences up to 60 bases in length. Purity of >85% is routinelyachieved.Ion-Exchange HPLCIE-HPLC is available to purify long DNA oligos. For unmodified oligos, purity of >85% is routinely achieved.Dual PurificationFor the most demanding applications, IDT offers Dual HPLC Purification and Dual PAGE and HPLC Purification. These methodsresult in oligos of the highest possible purity.RNase-Free HPLC PurificationOriginally developed for isolating RNA oligos, RNase-Free HPLC Purification has been extended to DNA oligos for use inapplications where there is a high sensitivity to ribonucleases. RNase-Free HPLC purification is carefully performed in anRNase-free environment; reagents, equipment and lab surfaces are monitored for RNase contamination using IDT's RNaseAlertsystem.Technical NoteSecondary structure and some modifications can affect purity guarantees. Please contact a local sales office for further information.©2008 Integrated DNA Technologies www.idtdna.com9

INTEGRATEDDNATECHNOLOGIESPRODUCTSDNA/RNA SYNTHESISSameDay® Oligo ServiceSameDay oligo service allows unmodified oligos to be shipped the same day they’re ordered.Specifications• 2-OD minimum yield guarantee (sufficient for > 250 PCR reactions)• 15-45 bases• Shipped lyophilized in tubes• Deprotected & desalted• Unmodified• Restrictions apply. Visit www.idtdna.com for details.Rapid HPLC PurificationIDT is the only oligo synthesis company offering Rapid HPLC purification. The fastest turnaround time available, coupled withexcellent quality, gives researchers the opportunity to receive purified oligos quickly. IDT reserves capacity for Rapid HPLColigos and dedicated purification scientists eliminate all waiting time between process steps during synthesis. Rapid HPLColigos are purified using the same equipment and protocols as standard HPLC purification. Resulting purity is >85% full-lengthproduct, all oligos are quality control checked by mass spectrometry and the trace is available free at www.idtdna.com. WhenRapid HPLC is ordered, the HPLC purified oligo is shipped the next business day.Specifications• 10-60 bases• Shipped lyophilized in tubes• Unmodified• Available in 100 nmole (1 OD) or 250 nmole (4 ODs)• Restrictions apply. Visit www.idtdna.com for details.HOTplatesAs with SameDay oligo service, IDT has brought the same focus on speed, quality and service without compromise to the 96-well plate. For the needs of high-throughput labs performing the most cutting-edge research, IDT offers the HOTplate.Specifications• Normalized to 2 to 10 nmoles/well or full synthesis yield• 15-60 bases• Shipped in 300 µl V-bottom plates• Unmodified• Minimum of 48 oligos per plate• Restrictions apply. Visit www.idtdna.com for details.©2008 Integrated DNA Technologies 10 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSDNA/RNA SYNTHESISCustom Preparative & Analytical ServicesFor ultimate convenience, IDT offers LabReady oligo services. We will ship your 25 nmole, 100 nmole or 250 nmole oligoshydrated at 100 µM concentration in IDTE (1x TE buffer) at pH 8.0.IDT offers all standard mixed base sites at no additional charge. Custom mixes are also available. IDT will hand-mix to anycustomer-defined percentage composition. For each mixture, IDT can incorporate up to 100 residues on the 100-nmole and250-nmole scales and up to 40 residues on the 1-µmole scale.Custom Preparative Services• Standard mixed bases (degenerate sites)• Customized hand-mixed bases• LabReady oligo service• Na+ salt exchange• Annealing of complementary oligos (duplex fee)Standard Mixed Base Sites:R = A,gY = C,TM = A,CK = g,TS = g,CW = A,TH = A,C,TB = g,T,CV = g,C,AD = g,A,TN = A,C,g,TCustom Analytical Services• Analytical IE-HPLC pH 12.0• Analytical RP-HPLC• Capillary Electrophoresis (on standard oligos up to 60 bases – also available for plates)• Conductivity measurement• Fluorometric Scan (absorbance/emission spectra)©2008 Integrated DNA Technologies www.idtdna.com11

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com13

INTEGRATEDDNATECHNOLOGIESGene KnockdownThe sequence-specific interaction of short nucleic acids with target RNAs or DNAs can be exploited as a tool to specificallysuppress gene expression. These methods have found utility in a wide variety of applications ranging from understandingthe function of newly discovered genes to medical therapeutics. It is important to have a variety of techniques available; bothantisense and RNAi are subject to artifacts such as off-target effects due to cross-hybridization or stimulation of the innateimmune system. It may be necessary to validate findings made using one method through use of a second approach. IDTtherefore offers a wide variety of products that span the spectrum of available technologies.RNA Interference (RNAi)RNA interference is a method where double-stranded RNA is used to reduce gene expression in a sequence-specific fashion.While this method has only been known to work in mammalian systems since 2001, it is already being used successfully inthousands of labs and ambitious whole-genome screening projects. The duplex RNA effector molecules can be syntheticoligonucleotides or can be made as transcripts from DNA templates (ddRNAi). The most straightforward approach to RNAi isthe use of duplex RNAs made by chemical synthesis. IDT has been making synthetic RNAs since 1987 and offers a full line ofRNA products ranging from microgram to gram scale.Dicer-Substrate RNA InterferenceDeveloped as a collaborative effort between John Rossi (Beckman Research Institute of the City of Hope) and IDT, DicersubstrateRNAs (DsiRNAs) are chemically synthesized 27-mer duplex RNAs that have increased potency in RNA interference. 1Traditional 21-mer siRNAs are designed to mimic Dicer products and bypass interaction with Dicer. The enzyme Dicer isnaturally involved with processing siRNA and assembly of the RNA Induced Silencing Complex (RISC). In fact, Dicer is acomponent of RISC. Dicer-substrate siRNAs are designed to be optimally processed by Dicer and show increased potency byengaging this natural processing pathway. Using this approach, sustained knockdown has been regularly achieved using subnanomolarconcentrations. New design rules specific to DsiRNAs have been developed and are available only from IDT. 2ddRNAiDNA-Directed RNAi (ddRNAi) uses DNA oligos as a template for RNA synthesis. RNA synthesis can be achieved using in vitrotranscription (IVT) or in vivo if the oligos are cloned into an appropriate expression vector. Typically these vector methodsemploy short-hairpin RNA (shRNAs) which mimic the design of naturally occurring miRNAs. IDT offers high quality DNA oligosin tubes or plates for this application.AntisenseAntisense is a method where single-stranded DNA or RNA, in antisense configuration to a target sense mRNA, is used toreduce gene expression in a sequence-specific fashion. Synthetic antisense DNA oligonucleotides were first used almost30 years ago. Antisense methods have been used to modulate expression of single genes, thousands of genes in highthroughputscreening programs, and are under active development as drugs. IDT has been involved in antisense researchsince the company was founded in 1987 and currently offers antisense oligos synthesized using DNA, 2’-O-methyl RNA, orLNA bases with either phosphorothioate or unmodified internucleoside bonds. Antisense mechanism of action varies withthe design of the antisense oligonucleotide (ASO) and can invoke steric blockade of the ribosome complex, RNase H directedmRNA degradation, RNase L directed mRNA degradation, or other pathways. The current preferred design is an RNase Hactive LNA phosphorothioate chimera. HPLC purification is recommended, especially if phosphorothioate bonds are used.miRNAsMicroRNAs (miRNAs) are a novel class of regulatory molecules which are naturally occurring cellular products that are madeusing the same intracellular machinery that makes siRNAs. IDT offers a variety of products that are useful in miRNA research.References:PRODUCTSFUNCTIONAL GENOMICS1. Synthetic dsRNA Dicer-substrates enhance RNAi potency and efficacy. Kim, D.H., et al., Nat Biotechnol, 23(2): p. 222-6 (2005).2. Functional polarity is introduced by Dicer processing of short substrate RNAs. Rose, S.D., et al., Nucleic Acids Res, 33(13): p. 4140-56 (2005).©2008 Integrated DNA Technologies 14 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSDicer-Substrate siRNAs (DsiRNAs)Predesigned DsiRNAsDsiRNA RefSeq LibraryOver 3,000,000 DsiRNAs have been designed against the approximately 25,000 genes from each of the human, mouse, rat,cow, dog, chicken, and chimp transcriptomes in The RefSeq Genbank collection: http://www.ncbi.nlm.nih.gov/RefSeq.Site selection is first performed using a proprietary algorithm that uses novel Dicer-substrate specific design rules. Sequencesthat pass this stage are next screened to minimize the potential for cross-hybridization and off-target effects (Smith-Watermananalysis); sites are also eliminated that include known SNPs; the analysis is further extended to include the presence ofalternatively spliced exons (if any are present for that gene in RefSeq). Finally, local mRNA secondary structure is modeled andareas of high predicted structure are avoided.DsiRNA Libraries• Splice common: targets all known variants of a gene in RefSeq; duplexes lie only within common exons. Thisconstitutes the bulk of the DsiRNA collection and is the best choice for most users. 8-10 duplexes are available or eachgene target.• Splice specific: targets only exons present in specific splice forms. In some cases, the unique exon may be verysmall or comprised of a sequence unfavorable for selection of RNAi duplexes (please note that knock-downguarantees do not apply for these sites). This collection is intended for those researchers who have a specialized needto selectively target specific splice variants or isoforms.When working with a gene target that is included in the above collection, IDT recommends using the predesigned duplexesas these include significantly more bioinformatics analysis than is possible for sequences designed in real-time using IDT'sweb-based interface design tool.Screening DsiRNAIdeal for small-scale in vitro applications, screening DsiRNA duplex products include affinity purification. In addition, both thesense and antisense oligos are identified by ESI mass spectrometry QC. Mass spectrometry data is provided free on IDT’s website.Screening DsiRNA sequences must be between 24 and 30 bases and 100% complementary with up to a 3-base overhang.Order screening dsiRNA duplexes normalized to2 nmoles or 10 nmoles per duplex.Note: RNA duplexes can be ordered through IDT's online RNA ordering module as ssRNAs or as dsRNA with a variety of modifications.Related ProductsNuclease-Free Duplex Buffer Pg. 40Trifectin Transfection Reagent Pg. 23©2008 Integrated DNA Technologies www.idtdna.com15

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSEvader TM DsiRNADevelopment of Dicer-Substrate technology has led to Evader DsiRNA, which is specifically designed to provide improvednuclease resistance and evade immune detection for in vivo applications. Evader duplexes include RNase-Free HPLCpurification. In addition, both the sense and antisense strands are identified by ESI mass spectrometry QC and duplex purity isassessed by analytical HPLC. Quality control data is provided free on IDT’s website.Predesigned sequences are available for ordering via SciTools.Order Evader DsiRNA duplexes normalized to2 nmoles, 10 nmoles or 40 nmoles per duplex.siLentMer Validated Target-Specific DsiRNAIDT and Bio-Rad have partnered to develop a collection of validated, premade Dicer-substrate duplexes. Hundreds of humangenes are currently in the process of validation. Please check the Bio-Rad website for the precise targets available today; notethat new products will be introduced rapidly as validation proceeds.Validation criteria require that each duplex reduces target gene expression by >85% at a dose of 5 nM as assessed by qRT-PCR24 hours post transfection. No other validated reagents must pass such strict criteria. Validated primers for SYBR® Green qRT-PCR assays are also available for all targets.See www.bio-rad.com for details and pricing.Premade DsiRNA LibrariesPremade collections of DsiRNAs are available for use in large-scale screening programs. Duplexes are arrayed in plates withtwo scale options: 2 nmoles or 0.25 nmole of each duplex. All duplexes are HPLC purified and receive ESI-MS and analyticalHPLC QC.Four libraries are currently available. Please inquire for pricing or custom synthesis of new collections of any size.Human Protein Kinome Set549 Human Protein Kinases, 4 duplexes per target, 2196 duplexesHuman GPCR Set409 Human GPCRs, 4 duplexes per target, 1636 duplexesHuman ATPase Set78 Human ATPases, 4 duplexes per target, 312 duplexesMouse GPCR Set386 Mouse GPCRs, 4 duplexes per target, 1544 duplexes©2008 Integrated DNA Technologies 16 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSLarge-Scale DsiRNAsRNA duplexes are available up to 10 grams. All duplexes are purified using RNase-free HPLC methods and come with purityand ESI-MS QC documents.Researchers planning in vivo work should be aware that potentially toxic substances can be introduced during oligonucleotidesynthesis and purification (HPLC) processes that must be removed to prevent errors or artifacts.Proper manufacturing protocols for large-scale DsiRNA synthesis include:• Adding trace EDTA in HPLC buffers to remove heavy metal cations• Using only biocompatible buffers and salts such as sodium phosphate and sodium chloride for HPLC• Maintaining an endotoxin-free environment• Options for sterile filtration and endotoxin testingThe Endotoxin ProblemThe classic endotoxin is lipopolysaccharide (LPS), a natural product present in the outer membrane of the cell wall of Gramnegative bacteria. Toxic LPS is liberated whenever these bacteria die. Its presence can cause severe inflammatory responsesand/or death of the animals. In mammals, LPS binds to serum proteins and interacts with various receptors on monocytes,macrophages, and endothelial cells. This eventually triggers cytokine production, complement activation, and coagulationcascades.IDT large-scale siRNAs are manufactured with in vivo use in mind. Protocols are employed that minimize the risk of endotoxincontamination.As an option, duplexes can be ordered as sterile filtered, endotoxin-free. Endotoxin testing will be performed to verify thatlevels do not exceed 0.1 EU/mg.Please inquire with a local sales office for a custom quote.Dicer-substrate RNAi methods were developed in a collaborative project between IDT and Drs. John Rossi and Dongho Kim at the BeckmanResearch Institute of the City of Hope National Medical Center. 1,2 IDT is licensed under patent applications jointly filed by IDT and The City ofHope Medical Center to sell research products incorporating Dicer-substrate RNAi technology.Related ProductsRNaseAlert and DNaseAlert Pg. 38Duplex Buffer Pg. 40References:1. Synthetic dsRNA Dicer-substrates enhance RNAi potency and efficacy. Kim, D.H., et al., Nat Biotechnol, 23(2): p. 222-6 (2005).2. Functional polarity is introduced by Dicer processing of short substrate RNAs. Rose, S.D., et al., Nucleic Acids Res, 33(13): p. 4140-56 (2005).©2008 Integrated DNA Technologies www.idtdna.com17

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSTriFECTaDicer-substrate RNAi kits for gene knockdownThe Trifecta kit contains three Dicer-substrate (DsiRNA) duplexes targeting a specific gene that are selected from apredesigned collection of duplexes in the DsiRNA RefSeq Library. The DsiRNA target sites were chosen by a rational designalgorithm that integrates both traditional 21-mer siRNA design rules as well as new Dicer-substrate design criteria.In addition to three target-specific screening duplexes, the Trifecta kit contains three control sequences that are needed toperform RNAi experiments, including: (1) a TYE 563-labeled transfection control DsiRNA duplex, (2) a scrambled universalnegative control DsiRNA duplex which is absent in human, mouse, and rat genomes, and (3) a positive control DsiRNA duplexwhich targets a site in the HPRT (hypoxanthine guanine phosphoribosyltransferase) gene that is common between human,mouse, and rat and is pre-validated to give >90% knockdown of HPRT when transfected at 10 nM concentration.IDT guarantees that at least two of the three screening DsiRNA duplexes in the Trifecta kit will give at least 70% knockdownof the target mRNA when used at 10 nM concentration and assayed by quantitative RT-PCR when the fluorescent transfectioncontrol duplex indicates that >90% of the cells have been transfected and the HPRT positive control works with the expectedefficiency.Trifecta Kit Contents• Three target-specific Screening DsiRNA duplexes (2 nmoles each)• Fluorescent-labeled transfection control duplex: TYE 563 (1 nmole)• HPRT-S1 DS Positive Control duplex (1 nmole)• DS Scrambled-Neg, universal negative control duplex (1 nmole)• RNase-Free Duplex Buffer (100mM KAc/30 mM HEPES pH 7.5)THESE PRODUCTS ARE NOT FOR USE IN HUMANS OR NON-HUMAN ANIMALS AND MAY NOT BE USED FOR HUMAN ORVETERINARY DIAGNOSTIC, PROPHYLACTIC OR THERAPEUTIC PURPOSES.References1. Synthetic dsRNA Dicer-substrates enhance RNAi potency and efficacy. Kim, D.H., et al., Nat Biotechnol, 23(2): p. 222-6 (2005).2. Functional polarity is introduced by Dicer processing of short substrate RNAs. Rose, S.D., et al., Nucleic Acids Res, 33(13): p. 4140-56 (2005).Technical NoteBioinformatics support personnel can assist with special design needs. Please contact a local sales office.©2008 Integrated DNA Technologies 18 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSEndogenous Gene Positive Control Duplexes and Primers (continued)IDT recommends studying functional transfection efficiency by examining mRNA levels at 24 hours post-transfection.Alternatively, Western blots can be performed at 48-72 hours. Validated primers for HPRT SYBR® Green qRT-PCR assays areavailable for the following organisms:SYBR®-Green Q-PCR Primer SetsHPRT SYBR®-Green primers (Human) - 1 nmole or 5 nmolesHPRT SYBR®-Green primers (Mouse) - 1 nmole or 5 nmolesHPRT SYBR®-Green primers (Rat) - 1 nmole or 5 nmolesHPRT SYBR®-Green primers (Chinese hamster) - 1 nmole or 5 nmolesHPRT SYBR®-Green primers (Cow) - 1 nmole or 5 nmolesHPRT SYBR®-Green primers (Pig) - 1 nmole or 5 nmolesIt is often useful to have cloned gene fragments available to establish quantitative standard curves when performing qRT-PCR.Relative RNA levels can be measured without use of copy number standards (ΔΔCt method); however, cloned copy numberstandards permit true quantitative measurements to be made. The assay amplicon for each of the above HPRT positive controlqRT-PCR reactions has been cloned into pBlueScript TM -II and sequence verified. Clones are provided as 0.5 µg of purified,linearized plasmid DNA that is directly ready for use in PCR.Cloned Purified PlasmidsHPRT Cloned qControl (Human) - 0.5 µgHPRT Cloned qControl (Mouse) - 0.5 µgHPRT Cloned qControl (Rat) - 0.5 µgHPRT Cloned qControl (Chinese hamster) - 0.5 µgHPRT Cloned qControl (Cow) - 0.5 µgHPRT Cloned qControl (Pig) - 0.5 µgAccession#NM_000194NM_013556NM_012583J00060NM_001034035NM_001032376SYBR®-Green is a registered trademark of Invitrogen.©2008 Integrated DNA Technologies 20 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSInternal Control Primers for qRT-PCR AnalysisWhen qRT-PCR is performed it is necessary to have an internal standard to control for RNA loading. While many differenthousekeeping genes have been used for this purpose (such as β-Actin, GAPDH, or Cyclophilin), most of these genes showfluctuation in expression levels with different treatments and are not as invariant as is needed for a true internal qRT-PCRcontrol. IDT has developed the following SYBR® Green assays suitable for use as an internal normalization standard in qRT-PCRanalysis (ΔΔCt method). When combined with use of the cloned copy number control plasmids, these reagents permit relativeRNA mass-loading normalization plus absolute quantitative PCR to be performed.ProductRPLP0 SYBR®-Green Primers (Human) - 1 nmole or 5 nmolesRPL23 SYBR®-Green Primers (Mouse) - 1 nmole or 5 nmolesRPL23 SYBR®-Green Primers (Rat) - 1 nmole or 5 nmolesRPL23 SYBR®-Green Primers (Chinese hamster) - 1 nmole or 5 nmolesRPLP0 SYBR®-Green Primers (Cow) - 1 nmole or 5 nmolesRPL4 SYBR®-Green Primers (Pig) - 1 nmole or 5 nmolesIt is often useful to have cloned gene fragments available to establish quantitative standard curves when performing qRT-PCR.Relative RNA levels can be measured without use of copy number standards (ΔΔCt method); however, cloned copy numberstandards permit true quantitative measurements to be made. The assay amplicon for each of the above positive control qRT-PCR reactions has been cloned into pBlueScript TM -II and sequence verified. Clones are provided as 0.5 µg of purified, linearizedplasmid DNA that is directly ready for use in PCR.Cloned Purified PlasmidsRPLP0 Cloned qControl (Human) - 0.5 µgRPL23 Cloned qControl (Mouse) - 0.5 µgRPL23 Cloned qControl (Rat) - 0.5 µgRPL23 Cloned qControl (Chinese hamster) - 0.5 µgRPLP0 Cloned qControl (Cow) - 0.5 µgRPL4 Cloned qControl (Pig) - 0.5 µgAccession#NM_001002NM_022891NM_001007599Not assignedNM_001012682DQ845176Visit www.idtdna.com for a map of the plasmid clones in PDF format.©2008 Integrated DNA Technologies www.idtdna.com21

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSExogenous Reporter Gene Positive ControlsReporter genes can be used both as positive controls and as negative controls and so are very useful reagents. If your cell lineexpresses the reporter either stably or via co-transfection of an expression plasmid, the anti-EGFP or anti-FLuc DsiRNAs canfunction as a positive control. If your cell line does not express these reporter genes, then the anti-EGFP or anti-Luciferase(Firely or Renilla) DsiRNAs can function as negative controls. Importantly, these DsiRNAs are validated, functional duplexeswith known efficient RISC loading and therefore offer an added level of control that non-targeting sequences cannot provide.ProductEGFP-S1 DS Positive Control - 1 nmole or 5 nmolesFLuc-S1 DS Positive Control (pGL2, pGL3) - 1 nmole or 5 nmolesFLuc-S2 DS Positive Control (pGL4) - 1 nmole or 5 nmoleshRLuc-4 DS Positive Control - 1 nmole or 5 nmolesUniversal Negative ControlA negative control duplex has been developed that does not target any sequence in the human, mouse, or rat transcriptomes.It can be employed as a universal negative control for DsiRNA transfections. This is a non-targeting sequence. The EGFP andFLuc DsiRNAs may also be used as negative controls if functional, targeting duplexes are desired.ProductDS Scrambled Neg - 1 nmole or 5 nmoles©2008 Integrated DNA Technologies 22 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSTriFECTin TM Transfection ReagentTrifectin is a proprietary cationic lipid formulation that has been optimized for delivery of IDT’s Dicer-substrate siRNAsinto a wide variety of cell types with minimal toxicity. It is equally potent for delivery of traditional 21-mer siRNAs and isalso effective in delivering other kinds of nucleic acids. In particular, Trifectin has been shown to be effective in deliveringantisense oligos (ASOs) of all kinds, including anti-miRNA ASOs. Trifectin is also effective in delivering plasmid DNAs into cells.Benefits of Trifectin include:•••Easy optimization due to low toxicity and good function across a wide range of RNA/lipid transfection ratiosEfficient transfection permitting use of lower RNA concentrationsFunctional in a wide range of cell types – see the Trifectin Technical Bulletin on IDT's website for up-to-date protocolsfor different cellsProduct0.5 mL Trifectin1 mL Trifectin5 x 1 mL TrifectinTechnical NoteContents and StorageHandle under sterile conditions. Store at +4°C. Trifectin is guaranteed to be stable for a minimum of six months whenproperly stored. Do not freeze or leave at room temperature for extended periods of time.To qualitatively assess transfection efficiency, we recommend using the dye-labeled transfection control duplexes. Toquantitatively assess transfection efficiency, we recommend using the positive control duplexes. A variety of positivecontrols are available.Basic ProtocolMix Trifectin with the siRNA or other nucleic acid, add to the cells, and incubate. Trifectin has low toxicity and it is notnecessary to remove the transfection cocktail before an extended incubation period. Use is compatible with bothforward and reverse transfection and in manual or robotic systems.Related ProductDsiRNA Screening Duplexes Pg. 15©2008 Integrated DNA Technologies www.idtdna.com23

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSDNA-Directed RNA Interference (ddRNAi)RNA interference can be achieved using RNA made enzymatically by transcription from DNA templates. This method has beencalled DNA-Directed RNAi, or ddRNAi. In its simplest form, ddRNAi can be done in vitro where a T7 or any other convenientpromoter/polymerase combination is used to make RNA from template DNA oligos 1 . These products are heterogeneous andcan sometimes result in interferon induction or other related problems 2 . However, this approach does offer an inexpensiveway to make RNA.DNA oligos can be cloned into a variety of vectors, ranging from expression plasmids to lentiviral vectors. These constructscan be introduced into cells or animals. The cloned vectors will express the dsRNA molecules and initiate an RNAi response inthe transfected or infected cells. This method can deliver long-term instead of transient RNAi. DNA oligos can be cloned withthe sense and antisense stands in tandem 3 or in hairpin configuration, which mimics naturally occurring miRNAs. Expressedhairpins, or short-hairpin RNAs (shRNAs), are the currently favored design for the ddRNAi approach, and the construction andsystematic use of large-scale libraries of this kind for functional genomics screens are showing great promise 4, 5, 6 .ddRNAi oligos are available normalized to 4 nmoles in tubes or plates.Normally IDT recommends the use of purified oligos when cloning DNA sequences over 40 bases long. However, the hairpinpresent in the shRNA cloning oligos makes purification difficult. Further, purification is not feasible for large-volume shRNAcloning projects, where many thousands of oligos are needed quickly at low cost. IDT has developed a synthesis scale thatresults in an ultra-high quality product. This process has been optimized for manufacturing oligos in the 60-200 base range.Product identity is confirmed by LC MS spectrometry. These oligos are intended for use without additional purification.IDT is licensed under patents owned by Benitec Ltd. to sell oligos for use in ddRNAi applications.Technical NotePlease visit www.idtdna.com for information on making an shRNA expression plasmid.References:1. RNA interference in mammalian cells using siRNAs synthesized with T7 RNA polymerase. Donze, O., and Picard, D. Nucleic Acids Res., 30:e46 (2002).2. Interferon induction by siRNAs and ssRNAs synthesized by phage polymerase. Kim, D.-H., Longo, M., Han, Y., Lundberg, P., Cantin, E., and Rossi, J.J. NatureBiotechnology, 22:321-325 (2003).3. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. Nature Biotechnology, 19:500-505 (2002)4. An approach to genomewide screens of expressed small interfering RNAs in mammalian cells. Zheng, L., Liu, J., Batalov, S., Zhou, D., Orth, A., Ding, S., andSchultz, P.G. Proc. Natl. Acad. Sci., USA, 101:135-140(2004).5. A resource for large-scale RNA-interference-based screen in mammals. Paddison, P.J., Silva, J.M., Conklin, D.S., Schlabach, M., Li, M., Aruleba, S., Balija, V.,O’Shaughnessy, A., Gnoj, L., Scobie, K., Chang, K., Westbrook, T., Cleary, M., Sachidanandam, R., McCombie, W.R., Elledge, S.J., and Hannon, G.J. Nature, 428:427-431(2004).6. A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Berns, K., Hijmans, E.M., Mullenders, J., Brummelkamp, T.R., Velds,A., Heimerikx, M., Kerkhoven, R.M., Madiredjo, M., Nijkamp, W., Weigelt, B., Agami, R., Ge, W., Cavet, G., Linsley, P.S., Beigersbergen, R.L., and Bernards, R. Nature,428:431-7(2004).©2008 Integrated DNA Technologies 24 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSmicroCache TM Small RNA Cloning ProductsSmall RNAs have been found to be crucial elements in a host of cellular processes including development, aptosis, genomeorganization and several diseases, notably cancer 1 . To address the need to be able to identify small RNAs in vitro in any speciesand in any tissue, IDT has developed a line of small RNA cloning products.3’ Cloning LinkersLinker-1 is the original modban sequence employed by Lau and Bartel in 2001 2 and contains a Ban I restriction site. Linker-2contains Ava I and Sty I restriction sites. Linker-3 contains Eco RI and Msp I restriction sites and was adapted from Pfeffer andTuschl 3 . All three linkers are modified with a 3’-terminal dideoxy-C (ddC) base to prevent self ligation. Experiments have shownmiRNA linker performance can vary depending on the RNA source. For this reason, the miRNA Cloning Linker Pack providessmall samples (1 nmole) of each of the three linkers and is useful for optimizing methods before using RNA samples in largescalelibrary construction.Linker oligonucleotides are provided lyophilized and are ready for use in cloning; just resuspend at the desired concentrationand add to your ligation mix (using T4 RNA Ligase without ATP). Use of this reagent can improve cloning efficiency of miRNAs,which have a 5’-phosphate and will circularize if attachment of linkers is attempted using RNA Ligase in the presence of ATP.SpecificationsProduct 1 nmole 5 nmole nmole/OD MW SequenceLinker-1Linker-20.18 OD5.8 µg0.18 OD5.8 µg0.92 OD29 µg0.92 OD29 µg5.42 5838 5’ rAppCTGTAGGCACCATCAAT/3ddC/ 3’5.41 5872 5’ rAppCACTCGGGCACCAAGGA/3ddC/ 3’Linker-30.19 OD5.8 µg0.96 OD31 µg5.21 6142 5’ rAppTTTAACCGCGAATTCCAG/3ddC/ 3’Modifications:Purification:Quality Control:5’-Adenylated; fully activated and ready for use3’-end blocked with a dideoxy-C baseHPLC purifiedIdentity confirmed by ESI Mass SpectrometryTested for reactivity with T4 RNA ligaseCertificate of Analysis available online3' miRNA Cloning Linkers 3-pack -3 Linker Types - 1 nmole each is also available.References:1. Massimo N, Ferracin M, Sabbioni S and Croce CM 2007 MicroRNAs in human cancer: from research to therapy. Journal of Cell Science 120: 1833-1840.2. Lau NC, Lim LP, Weinstein EG, and Bartel DP 2001 An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science294:858-862.3. Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyke LF, Ho CK, Shuman S, Chien M, et. al. 2005 Identification of microRNAs ofthe herpesvirus family. Nature Methods 2: 269-276.©2008 Integrated DNA Technologies www.idtdna.com25

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICS5’ M.R.S. (Multiple Restriction Site) miRNA Cloning LinkerThe 5’ M.R.S. Linker sequence is designed for use with any of the 3’ miRNA cloning linkers. The sequence has been optimizedfor linking to the 5’ end of RNAs containing a 5’ phosphate group. The reaction is carried out with T4 RNA Ligase in thepresence of 1 mM ATP. The sequence contains restriction endonuclease recognition sites compatible with Ban I (Linker-1),Sty I and Ava I (Linker-2) and Eco RI (Linker-3). Upon reverse transcription of doubly linked RNAs, the restriction endonucleaseappropriate for the 3’ cloning linker will also generate compatible ends in the 5’ M.R.S. Linker sequence permittingconcatamerization and/or cloning. Further, the additional restriction sites in the M.R.S. Linker, when matched with specific 3’linkers, can generate ends for directional cloning. For example, M.R.S. Linker/Linker 3 digestion with Eco RI and Ban I will leavea Ban I 5’ end and an Eco RI 3’ end.Product 1 nmole 5 nmole nMole/OD MW SequenceM.R.S. Linker0.21 OD7.0 µg1.06 OD3.5 µg4.68 6989 5’ TGGAATrUrCrUrCrGrGrGrCrArCrCrArArGrGrU 3’Purification:HPLC purifiedQuality Control: Identity confirmed by ESI Mass SpectrometryTested for reactivity with RNA ligaseCertificate of Analysis available onlineTechnical NoteInstructions for UsemiRNA cloning linkers are provided lyophilized and ready for use. IDT recommends that linkers be resuspended innuclease-free water or IDTE Buffer to a stock concentration of 100 µM (100pmole/µl). This is 10 µl for the 1-nmoleproduct and 50 µl for the 5-nmole product. A typical RNA ligation reaction will require 1-5 µl of linker. In addition, toavoid unwanted side reactions in the ligation, it is recommended that no more than 1-3 U of T4 RNA Ligase be used perreaction and that the ligation reaction not contain ATP.©2008 Integrated DNA Technologies 26 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSmiRCat TM Small RNA Cloning KitmiRCat small RNA cloning is based on the pre-activated, adenylated RNA linkering method that has been used successfullyin many labs since its development in 2001 1 . The kit includes the 5’ M.R.S. Linker and Linker-1 along with PCR and reversetranscription primers and necessary buffers and reagents to permit cloning of small RNAs from any cell or tissue source in anyspecies. Material sufficient for ten cloning experiments is provided in the miRCat kit.Kit Contents:• 3’ Linker-1 Pre-Activated, Adenylated Cloning Linker• 5’ M.R.S. Cloning Linker• miSPIKE 21-mer Internal RNA Control• Forward and Reverse/RT primers• T4 RNA Ligase• Ligation Buffer w/o ATP• Ligation Enhancer• 10 mM ATP• T4 DNA Ligase• 3M NaOAc (pH 5.2)• 10 mg/mL Glycogen• IDTE (pH 7.5)• Nuclease-free Water• Technical ManualmiRCat-33 TM Conversion Oligo PackmiRCat-33 is a conversion of the miRCat kit for the purpose of performing 5’ ligation-independent small RNA cloning using themethod of Pak and Fire 2 .Includes:• miRCat-33 3’ pre-activated, adenylated cloning linkerSequence- 5’- rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3’• miRCat-33 PCR PrimerSequence- 5’- CCTTGGCACCCGAGAATT -3’ProductmiRCat-33 Conversion Oligo Pack - 1 nmole or 5 nmolesReferences:1. Lau NC, Lim LP, Weinstein EG, and Bartel DP 2001 An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science294:858-862.2. Pak J and Fire A 2007 Distinct populations of primary and secondary effectors during RNAi in C. elegans. Science 315: 241-244.©2008 Integrated DNA Technologies www.idtdna.com27

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSInternal RNA ControlsmiSPIKE and piSPIKE are synthetic RNA sequences specifically selected not to target any known small RNA sequence inGenBank, miRBase, or RNAdb, and synthesized without a 5’ phosphate. This was done so that the marker can serve both asa size marker for small RNA enrichment on a denaturing acrylamide gel and as a 3’ ligation control, but will be unable toparticipate in 5’ ligations.miSPIKE sequence: 5’- rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrU -3’piSPIKE sequence: 5’- rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrUrCrArCrUrGrArArCrGrU -3’ProductmiSPIKE 21-mer Internal RNA Control – 100 pmolespiSPIKE 31-mer Internal RNA Control – 100 pmoles454 Adapter Primer Sets454 Adapter Primers are designed to convert small RNA libraries created by the miRCat Kit (Set I) or by the miRCat-33conversion oligos (Set II) into 454-compatible PCR libraries for deep sequencing 1 .Set I:FOR: 5’- GCCTCCCTCGCGCCATCAGTGGAATTCTCGGGCACC -3’REV: 5’- GCCTTGCCAGCCCGCTCAGGATTGATGGTGCCTACAG -3’Set II:FOR: 5’- GCCTCCCTCGCGCCATCAGGATTGATGGTGCCTACAG -3’REV: 5’- GCCTTGCCAGCCCGCTCAGCCTTGGCACCCGAGAATT -3’Product454 Adapter Primer Sets – 10 µgReferences:1. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen Y-J, Dewell SB et al. 2005 Genome sequencing inmicrofabricated high-density picolitre reactors. Nature 437: 376-380.©2008 Integrated DNA Technologies 28 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSmiRFire TM ProductsmiRNA StarFire is a proprietary labeling system for generating radiolabeled oligo probes with 10-fold greater specific activitythan traditional 5’ end labeling with polynucleotide kinase. It is based on 3’ end labeling with DNA polymerase. This labelingmethod is particularly useful for probes to identify small regulatory RNA and analyze the expression of microRNA genes. 1-3 Formore information, visit www.idtdna.com.miRNA StarFire® Complete KitSufficient for 25 labeling reactionsIncludes:Exo- Klenow DNA PolymerasemiRNA StarFire 10X Buffer MixmiRNA StarFire Stop Buffer1 PAGE-purified miRNA StarFire Custom Probe (up to 50 bases)miRNA StarFire Universal TemplatemiRNA StarFire® Universal TemplateSufficient for 300 labeling reactions0.5 OD (in single tube)HPLC PurifiedQuality control checked by Mass Spectrometry and CEmiRNA StarFire® Custom Probes (up to 50 bases)miRNA StarFire® PAGE PurificationmiRNA StarFire® Refill KitSufficient for 25 labeling reactionsExo- Klenow DNA PolymerasemiRNA StarFire 10X Buffer MixmiRNA StarFire Stop BuffermiRNA StarFire Universal TemplateReferences:1. Use of high specific activity StarFire® oligonucleotide probes to visualize low-abundance pre-mRNA splicing intermediates in S. pombe. Behlke, M.A.,Dames, S.A., McDonald, W.H., Gould, K.L., Devor, E.J., and Walder, J.A., BioTechniques, 29:892-897 (2000).2. Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and Broad-Complex gene activity. Sempere, L.F.,Sokol, N.S., Dubrovsky, E.B., Berger, E.M., Ambros, V., Development Biology 259: 9 (2003).3. The Expression of the let-7 Small Regulatory RNA Is Controlled by Ecdysone during metamorphosis in Drosophila melanogaster. Sempere, L.F., Dubrovskaya,V.A., Dubrovsky, E.B., Berger, E.M., Ambros, V., Development Biology, vol. 244: 170 (2002).©2008 Integrated DNA Technologies www.idtdna.com29

INTEGRATEDDNATECHNOLOGIESPRODUCTSFUNCTIONAL GENOMICSAntisense OligonucleotidesAntisense oligonucleotides have been used for over twenty-five years to inhibit gene expression levels both in vitro and invivo. Recent improvements in design and chemistry of antisense compounds have enabled this technology to become aroutinely used tool in basic research, genomics, target validation and drug discovery. It is becoming increasingly popular toconfirm phenotypes seen using RNAi by gene-silencing antisense DNA oligos. A nucleic acid sequence, usually 16-20 baseslong, is designed in antisense orientation to the mRNA of interest; the sequence is made as a synthetic oligonucleotide and isintroduced into the cell or organism. Hybridization of the antisense oligo to the target mRNA results in RNase H cleavage ofthe message, which prevents protein translation and thereby blocks gene expression. Antisense oligonucleotides containinga native DNA or phosphorothioate-modified DNA segment at least six bases long will bind the target mRNA and form an RNA/DNA heteroduplex, which is a substrate for endogenous cellular RNases H. 1-2 The decrease in mRNA levels can be measuredusing qPCR blots or microarrays.Phosphorothioates and Chimeric OligosWhile unmodified oligodeoxynucleotides can display some antisense activity, they are subject to rapid degradation bynucleases and are of limited utility. The simplest and most widely used nuclease-resistant chemistry available for antisenseapplications is the phosphorothioate (PS) modification. In phosphorothioates, a sulfur atom replaces a non-bridging oxygenin the oligo phosphate backbone. PS oligos can show greater non-specific protein binding than unmodified phosphodiester(PO) oligos, which can cause toxicity or other artifacts when present at high concentrations. These problems can be reducedor eliminated using chimeric designs, which limit the number of phosphorothioate internucleoside linkages within the oligo.LNA, 2’-O-Methyl RNA, and 5-Methyl dCState-of-the-art antisense design employs chimeras having both DNA and modified-RNA bases. Locked nucleic acids (LNAs)offer the most potent option available today 3,4,5 , which IDT offers through licensure from Exiqon. The use of modified RNA,such as LNAs or 2’-O-Methyl RNA in chimeric antisense designs, increases both nuclease stability and affinity (Tm) of theantisense oligo to the target mRNA. These modifications, however, do not activate RNase H cleavage. The preferred antisensedesign incorporates LNA or other 2’-O-modified RNA in chimeric antisense oligos that retain an RNase H activating domainof DNA (or phosphorothioate DNA). As LNA bases confer significant nuclease resistance, we recommend phosphorothioatemodification of only the DNA gap, leaving the LNA flanks phosphodiester in chimeric LNA antisense oligos. 6It can also be beneficial to substitute 5-Methyl-dC for dC in the context of CpG motifs. Substitution of 5-Methyl dC for dCwill slightly increase the T m of the antisense oligo. Use of 5-Methyl dC in CpG motifs can also reduce the chance of adverseimmune responses in vivo.Technical NoteIDT recommends all antisense oligos receive HPLC purification and oligos undergo a Na+ salt exchange before use in cells or liveanimals to ensure that salts used in purification are removed.*IDT is exclusively licensed under University of Iowa Research Foundation patents 5,491,133; 5,962,425 and 6,197,944 tomanufacture and sell Chimeric Antisense oligos. For further information, see Standard Terms & Conditions of Sale.References:1. Role of RNase H in hybrid-arrested translation by antisense oligonucleotides. Walder, R.Y. and Walder, J.A. Proc. Natl. Acad. Sci. USA, 85:5011 (1988).2. Targeted degradation of mRNA in Xenopus oocytes and embryos directed by modified oligonucleotides: studies of An2 and cyclin in embryogenesis.Dagle, J.M., Walder, J.A.and Weeks, D.L. Nucleic Acids Res., 18:4751 (1990).3. Antisense inhibition of gene expression in cells by oligonucleotides incorporating locked nucleic acids: effect for mRNA target sequence and chimeradesign. Braasch, D.A., Liu, Y., and Corey, D.R. Nucleic Acids Research, 30:5160-5167 (2002).4. Design of antisense oligos stabilized by locked nucleic acids. Kurreck, J., Wyszko, E., Clemens, G., and Erdmann, V.A. Nucleic Acids Research, 30:1911-1918(2002).5. Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2’-O-methyl RNA, phosphorothioates and small interfering RNA.Grunweller, A., Wyszko, E., Bieber, B., Jahnel, R., Erdmann, V.A., and Kurreck, J. Nucleic Acids Research, 31:3185-3193(2003).6. Characterization of Modified Antisense Oligonucleotides in Xenopus laevis Embryos. Lennox KA, Sabel JL, Johnson MJ, Moreira BG, Fletcher CA, Rose SD,Behlke MA, Laikhter AL, Walder JA, Dagle JM. Oligonucleotides 16: 26-42 (2006).©2008 Integrated DNA Technologies 30 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com31

INTEGRATEDDNATECHNOLOGIESPRODUCTSSYNTHETIC BIOLOGYCustom Gene SynthesisConfidential and guaranteed gene synthesis service, ready for use in a variety of applications. For assistance with design,please contact a local sales office.Gene synthesis service includes•••••••Design consultationCodon optimizationCloned into a plasmid (please inquire for custom vectors)Guaranteed sequence verification through use of double-stranded DNA sequencing2 µg purified plasmid DNASequence information is always confidential at IDTNon-disclosure agreements are available through IDT’s legal services upon requestGene Synthesis Applications••••••••shRNA expression cassettesStandards for quantitative PCR and other assaysmicroRNA genesCodon optimized short proteins• cDNA constructs• Recombinant antibodiesRegulatory sequence cassettesMicroarray-ready cDNAGene variants and SNPsDNA vaccines and vectorsminiGENESGenesLength Up to 500 bp 501 + bpTurnaround Time 6-12 business days Available by quoteRelated ProductUltramers (60-200 bases) Pg. 8Technical NoteExtra charges may apply for gene segments with added complexity(ex: homopolymeric runs, critical hairpin structures or high G/Ccontent), which can interfere with assembly and/or sequencingperformance.©2008 Integrated DNA Technologies 32 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com33

INTEGRATEDDNATECHNOLOGIESMICROARRAY PRODUCTSMicroarray ProductsMicroarrays have become a routine tool used in many labs for applications ranging from quantitative analysis of geneexpression profiles to SNP genotyping.Microarray BioinformaticsCorrect design of oligonucleotides used in microarray experiments requires that a variety of parameters be considered. Oligosmust be screened for Tm, self-dimer potential, hairpin potential, location within the transcript, and cross-reactivity with othertranscripts.IDT Bioinformatics offers a free microarray oligo design tool on the web in the Workbench section of SciTools (www.idtdna.com/scitools/scitools.aspx). This design tool allows for batch processing of thousands of probes or single oligos.SpotQCIDT has developed a Cy3 TM dye-labeled oligonucleotide with improved thermodynamics that will hybridize with greateruniformity to the wide variety of sequences employed in large-scale microarrays. Our Cy3 TM detector oligo used with ouroptimized hybridization solution permits rapid, precise QC of printed microarray slides. Hybridization, wash, and imageacquisition can be done in under an hour. While the benefit of our new formulation is most evident with oligonucleotidearrays, SpotQC can also be used with superior results for cDNA/PCR product arrays. SpotQC has improved sensitivity, detectsa greater range of oligo-probe lengths and GC compositions, and more accurately assesses the spotted probe’s availability forhybridization vs. traditional random fluorescent primers. Biotin SpotQC employs a biotin-labeled detector oligo that permitsthe use of enzymatic-based chemiluminescent or colorimetric detection options for the QC assay.Cy3 SpotQC Detector OligoProduct1000 pmoles Cy3 SpotQC Detector OligoBiotin SpotQC Detector oligoBio-SpotQC is a biotinylated version of SpotQC, and has been developed for precise QC of printed microarray slidesutilizing secondary fluorescent, chemiluminescent, or colorimetric hybridization detection assays. (Secondary fluorescent,chemiluminescent, and/or colorimetric detection assay reagents not included.)Product1000 pmoles Bio-SpotQC Detector OligoDetector oligos are shipped with a complimentary tube of 1X Hybridization Buffer (500 µl). The quantity is sufficient to analyze10 arrays using large 24x60mm cover slips or up to 30 arrays using small 22x22mm cover slips.©2008 Integrated DNA Technologies 34 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESMICROARRAY PRODUCTSSpotQC Hybridization BufferSpotQC Hybridization Buffer is an optimized hybridization solution specifically formulated for use with IDT’s SpotQC detectoroligos. It also allows for the dilution of the SpotQC detector oligo up to 20-fold while maintaining the superior detection of abroad range of oligo-probe lengths and GC compositions .Product10x2 mL SpotQC Hybridization Buffer125 mL SpotQC Hybridization BufferOligo Spotting Buffer (OSB)OSB microarray printing solution improves spot morphology and uniformity, both of which are essential for producing highqualityarrays and reliable data. OSB microarray printing solution is optimized for manufacturing oligonucleotide arrays onamine slides.Product125 mL 1X Oligo Spotting BufferEpoxide Spotting Buffer (ESB)Epoxide Spotting Buffer is an optimized microarray printing solution that dramatically improves spot morphology anduniformity, both of which are essential for producing high-quality arrays and reliable data. ESB is optimized for spotting eitheramine-modified or I-Linker-modified oligo probes on epoxy surface slides. The combination of the I-Linker modification andESB results in a two-fold increase in microarray spot hybridization signal over traditional amine-modified oligo probes printedon an epoxide surface. ESB is designed for reduced evaporation and is suitable for either short or overnight microarray printruns.Product125 mL 1X Epoxide Spotting BufferRelated ProductsDNA Oligos Pg. 06RNaseAlert Pg. 38Nuclease Decontamination Solution Pg. 40©2008 Integrated DNA Technologies www.idtdna.com35

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com37

INTEGRATEDDNATECHNOLOGIESPRODUCTSNUCLEASE CONTROLRNaseAlert and DNaseAlert SubstrateNuclease Detection SystemsNucleases are widely present in the laboratory environment and can interfere with many experiments. Single-strandedRNases are ubiquitous, hard to eliminate and can rapidly degrade important samples used in microarray studies, real-timePCR, Northern blots or cDNA cloning. IDT has developed reagents that allow for rapid, sensitive detection of RNases andDNases. These reagents are fluorescence-quenched oligonucleotide probes that emit a fluorescent signal only after nucleasedegradation. Assays can be used qualitatively to test lab reagents, equipment and supplies for nuclease contamination.Assays can also be used quantitatively to study enzyme kinetics.The RNaseAlert substrate employs a FAM (fluorescein) reporter (Em 520 nm) and a dark quencher. The RNA sequence hasbeen carefully optimized to react with a wide variety of ribonucleases. Intact, the substrate has little or no fluorescence. Whencleaved by an RNase, the substrate fluoresces green (490 nm or UV excitation, 520 nm emission).The DNaseAlert Substrate is a synthetic DNA oligonucleotide that has a HEX reporter dye (hexachlorofluorescein) on oneend and a dark quencher on the other end. The DNA sequence has been carefully optimized to react with a wide variety ofnucleases; it contains domains that will react with single-stranded endonucleases, certain single-stranded exonucleases,and double-stranded nucleases. Intact, the substrate has little or no fluorescence. When cleaved by a DNase, the substratefluoresces pink (536 nm or UV excitation, 556 nm emission) and can be detected visually or using a fluorometer.RNaseAlert and DNaseAlert are available in single-use tubes that are ideal for rapid hand-held visual assays at the researchbench, or as bulk substrate that can be used in either visual assays or read in a fluorometer. Buffers are optimized for detectionof a wide variety of DNases or RNases.RNaseAlert Kit Components:• (25) 50 pmole Fluorescent Substrate tubes• 250 µl RNaseAlert Buffer• 2 mL Nuclease-Free Water• 50 µl RNase A (positive control)• 50 mL Nuclease Decontamination SolutionDNaseAlert Kit Components:• (25) 50 pmole Fluorescent Substrate tubes• 250 µl DNaseAlert Buffer• 2 mL Nuclease-Free Water• 25 µl DNase 1 Enzyme (positive control)• 50 mL Nuclease Decontamination SolutionKit quality is guaranteed for six months from the date received when stored at -20°C.Nuclease Detection Products(25) single-use 50 pmole tubes(2) 2-nmole bulk tubes (enough for 200 reactions)Complete Kit10X Buffer 2 mL tubeRelated ProductsRNase Substrates Pg. 58Nuclease Decontamination Solution Pg. 40©2008 Integrated DNA Technologies 38 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com39

INTEGRATEDDNATECHNOLOGIESPRODUCTSREAGENTS, BUFFERS & MARKERSNuclease-free Buffers and ReagentsWhile many researchers continue to store oligonucleotides in water, resuspension in a buffered solution such as TE isrecommended. DNA oligonucleotides can be damaged by prolonged incubation or storage in even mildly acidic solutions;DNA dissolved in distilled water will often have a final pH < 5.0 and is at risk for depurination. RNA will degrade in alkalineconditions. Single-stranded nucleic acids can easily be degraded by trace contamination with a variety of nucleases that arecommon contaminants in a normal laboratory environment. Any solution used to resuspend and store DNA or RNA shouldbe nuclease-free. It is recommended that stock oligo solutions be made at high concentration and stored frozen. More diluteworking solutions can be made from the stock solutions at intervals as needed.The following solutions are for use in the resuspension and dilution of oligos. Each lot is tested using our RNaseAlert andDNaseAlert reagents to document the absence of any detectable nuclease activity. Water is DEPC-Free. Individual lots arescreened for endotoxins using a Limulus Amebocyte Lysate (LAL) assay.IDTE (10 mM Tris, pH 7.5 or 8.0, 0.1 mM EDTA)A 1X TE buffer for initial resuspension and storage of DNA oligos.Duplex Buffer (30 mM Hepes, pH 7.5, 100 mM Potassium Acetate)For initial resuspension, annealing and storage of duplex DsiRNA products.Nuclease-Free Water (DEPC-Free)For initial resuspension and storage of single-stranded RNA or DNA oligos to be used in buffered solutions or protocolsincompatible with TE. Also suitable for making dilute working solutions from stock oligos.Available Quantities10x2 mL250 mL1 Liter4x1 LiterNuclease Decontamination SolutionMany RNases and DNases are naturally found in the environment. A variety of nucleases are employed in routine molecularbiology methods and can accidentally contaminate lab surfaces at very high levels. In particular, RNases can be very difficultto eliminate and can cause damage to projects that require manipulations of intact RNA samples, such as functional genomicsexperiments, real-time quantitative PCR, microarrays, etc.Nuclease Decontamination Solution irreversibly inactivates RNases and DNases and can be applied to most lab surfaces toremove nuclease contamination. Just spray, rinse and let dry. Nuclease Decontamination Solution eliminates the need to bakeglassware and can be applied to plastic surfaces that are difficult to sterilize.Products250 mL Spray Bottle6x250 mL Spray Bottle Refill Kit©2008 Integrated DNA Technologies 40 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSREAGENTS, BUFFERS & MARKERSOligo Length StandardsTwo oligonucleotide formulations for use as size/mass standards are available. Marker oligos have balanced base content,are purified and provided in equal mass amounts (10 µg of each oligo per tube) to normalize band intensity. (Note that the10-mer binds dye poorly and may appear more faint than the other bands.) Each tube contains enough marker for 25-100loadings, depending on the gel configuration and the stain employed. The recommended loading mass varies with theparticular stain used and the dimensions of gel comb. For 1mm x 4-6mm comb dimensions, 0.1-0.2 µg/lane is recommendedif using SybrGold stain (Molecular Probes). 0.2-0.4 µg/lane is recommended if using GelStar (Cambrex). For non-fluorescentstains such as Stains-All TM (Sigma-Aldrich), use 0.3-0.4 µg/lane. Ethidium Bromide staining works poorly with single-strandednucleic acid and is not recommended.10/60 Ladder10, 15, 20, 25, 30, 40, 50, 60 base marker oligos20/100 Ladder20, 30, 40, 50, 60, 70, 80, 90, 100 base marker oligosResuspension and Use GuidelinesResuspend the lyophilized oligo mixture in 100 µl of IDTE buffer (10 mM Tris pH 7.5, 0.1 mM EDTA) to obtain aconcentration of 0.1 µg/µl (of each oligo). Mix the desired amount of marker solution (1-4 µl) with an equal volume of aformamide or urea-based loading buffer. Heat samples at 95°C for 3 minutes, cool on ice, load.©2008 Integrated DNA Technologies www.idtdna.com41

INTEGRATEDDNATECHNOLOGIESREADYMADE PRODUCTSReadyMade PrimersThe Highest Quality• Each primer is > 95% pure to ensure optimum performance• Identity is confirmed by Mass Spectrometry• Purity is established by Capillary Electrophoresis• 10 µg of purified product• Enough for 100 sequencing reactions• Fast turnaround, subject to in-stock availabilityReadyMade Primers16S rRNA Forward M13 Forward (-20) pGEX 3’16S rRNA Reverse M13 Forward (-41) pGEX 5’3’ RACE PCR M13 Reverse (-27) Random HexamerAnchored Oligo dT (20) M13 Reverse (-48) Random Hexamer w/BiotinAnchored Oligo dT (22) Neomycin Forward ROSA26 Promoter ForwardBGH Reverse Neomycin Reverse ROSA26 Promoter ReverseBluescript KS Oligo dT, (20) w/5’ Phos SP6Bluescript SK Oligo dT, 15-mer SP6 upstreamcDNA Cloning Primer Oligo dT, 16-mer T3 PromoterEGFP-C Oligo dT, 18 mer T7 PromoterEGFP-N Oligo dT, 20-mer T7 TerminatorG3PDH Forward PCMV Forward T-cell Receptor ForwardG3PDH Reverse pET 3’ T-cell Receptor ReverseIL-2 Exon 3 Forward (7329)IL-2 Exon 3 Reverse (7652)Aminoacyl Adenylate AnaloguespET 5’ (T7)pET UpstreamAminoacyl adenylate analogues (5’-O-[N-(L-aminoacyl)sulfamoyl]adenosines) function as potent inhibitors of the aminoacyl-tRNAsynthetase enzymes. tRNA synthetases play vital roles in translation as they are responsible for transferring the correct amino acid to theircorresponding tRNA. Analogues of the aminoacyl intermediates have been used in structural and mechanistic studies of the enzymes,uncovering their evolutionary history, and determining the extent of amino acid discrimination exhibited by each synthetase.More recently, tRNA synthetases have emerged as a potential platform for the development of new antibiotics that specifically target theseenzymes as a way to inhibit bacterial growth. Modified aminoacyl adenosine analogues are also being used to evolve tRNA synthetasesthat can be used to incorporate modified amino acids into proteins, which are valuable for investigating structure-activity relationships ordeveloping modified peptide-based therapeutics. t-RNA synthetases from humans have also been found to possess cytokine activity andplay a role in the regulation of angiogenesis.10 or 50 µgAlanyl Analogue Isoleucyl Analogue Phenylalanyl AnalogueArginyl Analogue Leucyl Analogue Prolyl AnalogueAsparaginyl Analogue Lysyl Analogue Seryl AnalogueAspartyl Analogue Glycyl Analogue Threonyl AnalogueCysteinyl Analogue Histidyl Analogue Tryptophanyl AnalogueGlutaminyl Analogue Isoleucyl Analogue Tyrosyl AnalogueGlutamyl Analogue Leucyl Analogue Valyl AnalogueGlycyl AnalogueHistidyl AnalogueLysyl AnalogueMethionyl Analogue©2008 Integrated DNA Technologies 44 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESREADYMADE PRODUCTSReadyMade RandomersRandomers are oligonucleotides composed of all possible sequences for a given length. The use of randomers began in theearly 1980s when random hexamers were employed in radio labeling DNA probes 1,2 . A later application was the use of randomsequence primers to detect Random Amplified Polymorphisms (RAPDs) 3,4 .Today, random sequence oligonucleotides are being used to detect Single Nucleotide Polymorphisms (SNPs) as well as smallscale chromosome events, primarily insertions or deletions 5,6 . Comparative Genomic Hybridization (CGH) has been developedto elucidate genome-wide sequence copy-number variation (CNV) between different genomes, such as the differentialamplification or deletion of genetic regions between tumor DNA and normal DNA from neighboring unaffected tissue 7-10 .These applications demand that the oligonucleotides have consistent base composition and minimal lot-to-lot variation.IDT Randomers are made using an N-base phosphoramidite mixture that is carefully prepared in bulk to ensure thatequal base representation is achieved. The batch is then tested by making test randomer oligos and checking actual basecomposition by enzymatic degradation and HPLC.ReadyMade Random Nonamers10, 50 or 500 nmoles5’ Cy3 Random Nonamer5’ Cy5 Random Nonamer5’ TYE 563 Random Nonamer5’ TYE 665 Random NonamerReadyMade Random Nonamer Matched Sets for CGH10, 50 or 500 nmoles5’ Cy3 & 5’ Cy5 Random Nonamer Set5’ TYE 563 & 5’ TYE 665 Random Nonamer SetReadyMade Random Hexamers10, 50 or 500 nmolesRandom Hexamer5’ Biotinylated Random HexamerReferences:1. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Feinberg, A.P., and Vogelstein, B. Analytical Biochemistry,132: 6-13 (1983).2. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Addendum. Feinberg, A.P., and Vogelstein, B. AnalyticalBiochemistry, 137: 266-7 (1984).3. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, A.J., and Tingey, S.V. NucleicAcids Research 18: 6531-6535 (1990).4. Fingerprinting genomes using PCR with arbitrary primers. Welsh, J., and McClelland, M. Nucleic Acids Research 18: 7213-7219 (1990).5. Comparative Genomic Hybridization: an Overview. Houldsworth, J., and Chaganti, R. American Journal of Pathology 145: 1253-1260 (1994).6. Detection of chromosomal aberrations by means of molecular cytogenetics: painting of chromosomes and chromosomal subregions and comparativegenomic hybridization. Lichter, P., Bentz, M., and Joos, S. Methods in Enzymology 254: 334-359 (1995).7. Comparative Genomic Hybridization for Molecular Cytogenetic Analysis of Solid Tumors. Kallioniemi, A., Kallioniemi, O-P., Sudar, D., Rutovitz, D., Gray, J.W.,Waldman, F., and Pinkel, D. Science 258:818-821 (1992).8. High resolution analysis of DNA copy number variation using comparative genomic hybridization to microarrays. Pinkel, D., Segraves, R., Sudar, D., Clark, S.,Poole, I., Kowbel, D., Collins, C., Kuo, W-L., Chen, C., Zhai, Y. et al. Nature Genetics 20:207-211 (1998).9. From microscopes to microarrays: dissecting recurrent chromosomal rearrangements. Emanuel, B.S., and Saitta, S.C. Nature Reviews Genetics 8(11):869-83(2007).10. Comparing whole genomes using DNA microarrays. Gresham, D., Dunham, M.J., and Botstein, D. Nature Reviews Genetics 9(4):291-302 (2008).©2008 Integrated DNA Technologies www.idtdna.com45

PRODUCTS

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com47

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSPeak Emissions of Reporter DyesMAXNHS Ester(557)TYE 563(563)Cy3(564)Alexa Fluor 546NHS Ester(571)TAMRANHS Ester(583)Rhodamine Red-XNHS Ester(594)ROXNHS Ester(608)JOE NHS Ester(555)Alexa Fluor 594NHS Ester(616)HEX(555)Alexa Fluor 532NHS Ester(553)TET(539)Rhodamine Green-XNHS Ester(531)6-FAM(520)I O W AF QB L A C KF QI O W AL A C KBI O W AR QTEX 615(613)Texas Red-XNHS Ester(617)Bodipy 630/650-XNHS Ester(653)TYE 665(665)WellRED D4(666)Cy5(668)Alexa Fluor 488-X(517)B L A C KB L A C KB H Q - 2B H Q - 2- 1F QI O W A- 1B H QB H QBB H Q - 2I O W AL A C KB H Q- 1D A B C Y LB L A C KR QB H Q- 2F QI O W AI O W ABB H Q - 2L A C KB L A C KR QBI O W AF QI O W ABL A C KR QI O W AR QL A C KB H Q - 2Alexa Fluor 647NHS Ester(670)Alexa Fluor 660NHS Ester(691)IRDye 800(809)IRDye 800CW(789)WellRED D2(778)Dy 750NHS Ester(776)Alexa Fluor 750NHS Ester(775)Cy5.5(706)TYE 705(704)IRDye 700(702)WellRED D3(701)See Standard Terms & Conditions of Sale on p. 82 for important trademark information.Technical NoteAbsorbance and Emission maxima may vary slightly with oligo composition. Listed Ab/Em Max were measured on a standardizedoligo sequence in 10 mM Tris, 50 mM KCl, 5 mM MgCl2, pH 8.3.©2008 Integrated DNA Technologies 48 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSFluorescent DNA and LNA ProbesFluorescence-based methods for detecting nucleic acids are an attractive alternative to traditional radioactive andcolorimetric methods. Single-labeled fluorescent oligonucleotides are routinely used in such applications as DNA sequencing,genotyping, sequence detection and enzyme assays. Dual-labeled oligonucleotide designs, where a fluorescent reporter anda fluorescence quencher are placed on the same oligonucleotide, enable closed-tube systems that permit rapid and sensitivehigh-throughput assays. Most dual-labeled fluorescent systems employ FRET principles to control the dark versus bright state.Fluorescence Resonance Energy Transfer (FRET) is a process where energy from an excited fluorophore is transferred to aneighboring acceptor molecule without the release of light by the fluorophore (quenching). In FRET, the efficiency of thisenergy transfer process is dependent upon the physical distance between the reporter fluorophore and the quencher, andthe degree of overlap between reporter emission and quencher absorption spectra. When reporter and quencher are close,quenching is efficient and the oligo is dark. When reporter and quencher are distant, quenching is reduced or eliminatedand the oligo is bright. The range over which quenching occurs is unique for each reporter/quencher pair but is commonlybetween 30 and 70 Å (the distance where quenching is 50% efficient is defined as the Förster radius for that R/Q pair). Thequencher (energy acceptor) molecule can be another fluorescent dye such as TAMRA or a non-fluorescent dark quencher.Dark Quenchers Provide Superior Performance• Probes incorporating dark quenchers have lower background fluorescence, providing greater sensitivity.• Since dark quenchers absorb broadly and do not emit light, multiple reporter dyes can be used with a givenquencher, expanding the options available for multiplex assays.• Dark quenchers simplify detection, making them compatible with a broad range of image analysis instruments.The following dark quenchers can be incorporated into oligonucleotides: Dabcyl, Black Hole Quenchers® (BHQ®-1 and BHQ®-2)and Iowa Black® (IB FQ and IB RQ). At close range, dark quenchers can sometimes quench the fluorophore by non-FRETmechanisms, eliminating the requirement for spectral overlap. IB FQ and IB RQ, developed at IDT, quench fluorescein and dyesin the red region of the spectrum, respectively.Please note IDT’s Freedom Reporter and Quencher options for high-quality probes with no royalty feesfor resale, kitting, or in vitro diagnostic use.Reporter Dye Equivalence ChartFreedom EquivalentReporterFreedom Reporter EquivalentCy3 TM TYE TM 563Cy5 TM TYE TM 665Texas Red® TEX TM 615Cy5.5 TM TYE TM 705©2008 Integrated DNA Technologies www.idtdna.com49

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSExpress DLPThe fastest turnaround time, coupled with the lowest price available gives IDT the opportunity to ship dual-labeled, purifiedprobes the next working day after receiving the order. All oligos are HPLC purified and quality control checked by massspectrometry and the trace is available free at www.idtdna.com.Freedom Reporter5’ 6-FAM TMQuencherMinimum YieldIowa Black® FQ5 nmoles3’ Black Hole Quencher®-1 5 nmolesExpress DLP Specifications:• 18 - 35 bases• HPLC purified• Shipped lyophilized• QC verified by mass spectrometry• Restrictions apply. See www.idtdna.com for details.©2008 Integrated DNA Technologies 50 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSDual-Labeled DNA ProbesProducts below include synthesis of the custom oligo (18 to 35 bases in length), reporter, quencher and HPLC purification.Inquire for Dual-Labeled DNA Probes >35 bases. Nanomole yields are listed for Dual-Labeled DNA Probes 18 to 35 bases inlength. Turnaround time for Dual-Labeled DNA Probes is 3-5 business days. Turnaround time for Dual-Labeled DNA Probeswith NHS Ester modification is 4-6 business days.Freedom Reporter5’ 6-FAM TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-1 3’ Iowa Black® FQ 10 nm, 25 nm, 50 nm3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 10 nm, 25 nm, 50 nm3’ TAMRA TM 5 nm, 10 nm, 20 nm3’ TAMRA TM NHS Ester 10 nm, 20 nmReporter 5’ HEX TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-1 3’ Iowa Black® FQ 10 nm, 25 nm, 50 nm3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 10 nm, 25 nm, 50 nmReporter 5’ TET TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-1 3’ Iowa Black® FQ 10 nm, 25 nm, 50 nm3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 10 nm, 25 nm, 50 nmFreedom Reporter 5’ TYE TM 563Freedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 2 nm, 8 nm, 20 nmReporter 5’ Cy3 TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 2 nm, 8 nm, 20 nmFor other fluorophore/quencher combinations, please inquire.©2008 Integrated DNA Technologies www.idtdna.com51

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSDual-Labeled DNA ProbesFreedom Reporter 5’ TYE TM 665Freedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 2 nm, 8 nm, 20 nmReporter 5’ Cy5 TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 2 nm, 8 nm, 20 nmFreedom Reporter 5’ TEX TM 615Freedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 5 nm, 10 nm, 20 nmReporter 5’ Texas Red®-X NHS EsterFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 8 nm, 20 nmReporter 5’ JOE NHS EsterFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-1 3’ Iowa Black® FQ 8 nm, 20nm3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 8 nm, 20nmReporter 5’ ROX TM NHS EsterFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 8 nm, 20 nmFREE QC TRACES ONLINE©2008 Integrated DNA Technologies 52 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSDual-Labeled DNA ProbesReporter 5’ TAMRA TM NHS EsterFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 8 nm, 20 nmFreedom Quencher 5’ Iowa Black® FQFreedom ReporterGuaranteed Yields3’ 6-FAM TM 10 nm, 20 nm, 40 nm©2008 Integrated DNA Technologies www.idtdna.com53

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSDual-Labeled LNA ProbesLocked Nucleic Acids (LNAs) can be incorporated into dual-labeled probes. 1-3 Since LNA bases significantly increase Tm, LNADual-Labeled Probes (DLPs) are shorter than standard DNA DLPs. Shorter probes have better quenching, a higher signal-tonoiseratio and are more sensitive. More importantly, these probes offer an improved ability to distinguish mutations or singlenucleotide polymorphisms (SNPs). A DNA DLP typically has a ΔTm of ~5°C between perfect match and mismatch hybridization.An LNA DLP can have a ΔTm of >15°C, greatly increasing accuracy of allele determination in real-time PCR or other methodsthat use differential hybridization to distinguish polymorphisms.Depending on sequence context, insertion of an LNA base into a DNA oligo can increase the Tm by 3-6°C. IDT recommends3-6 LNA bases be placed in an LNA DLP. LNA bases should be placed at the SNP site and adjacent bases. The SNP should bepositioned in the center of the probe if possible. Additional LNA bases can be added towards the 3’-end of the probe to adjustTm as needed. Note that relative binding affinity (Tm) of LNA bases is LNA:LNA > LNA:DNA > DNA:DNA. It is important toexamine the probe sequence for self-dimer and hairpin formation and minimize designs that allow for LNA:LNA pairing.Prices below include synthesis of the custom oligo (up to 25 bases in length), up to 6 LNA base insertions, reporter, quencherand HPLC purification. Nanomole yields are listed for Dual-Labeled LNA Probes 10 to 25 bases in length. Turnaround time forDual-labeled LNA Probes is 4-6 business days. Please contact Customer Care at 800-328-2661 for assistance with the design ofLNA DLPs.Freedom Reporter5’ 6-FAM TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-1 3’ Iowa Black® FQ 4 nm, 10 nmReporter 5’ Cy3 TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 4 nm, 10 nmReporter 5’ Cy5 TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 4 nm, 10 nmLocked Nucleic Acids are licensed from Exiqon, www.exiqon.com.References:1. Evaluation of the performance of LNA and MGB probes in 5’-nuclease assays. Letertre, C., Perelle, S., Dilasser, F., Arar, K., and Fach, P. Molecular and CellularProbes, 17:307-311 (2003).2. Real-time genotyping with oligonucleotide probes containing locked nucleic acids. Ugozzoli, L.A., Latorra. D., Pucket, R., Arar, K., and Hamby, K. AnalyticalBiochemistry, 324:143-152 (2004).3. Locked nucleic acid (LNA) single nucleotide polymorphism (SNP) genotype analysis and validation using real-time PCR. Johnson, M.P., Haupt, L.M., andGriffiths, L.R. Nucleic Acids Res., 32:e55 (2004).©2008 Integrated DNA Technologies 54 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSDual-Labeled LNA Probes (continued)Freedom Reporter 5’ TYE TM 563Freedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 4 nm, 10 nmFreedom Reporter 5’ TYE TM 665Freedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 4 nm, 10 nmFreedom Reporter 5’ TEX TM 615Freedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-2 3’ Iowa Black® RQ 8 nm, 20 nm©2008 Integrated DNA Technologies www.idtdna.com55

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSPlexor Technology: A New Chemistry for Real-Time PCRThe power of the polymerase chain reaction (PCR) is greatly enhanced by techniques that accurately, sensitively andreproducibly quantify DNA samples. These real-time or quantitative PCR (qPCR) techniques rely on the ability to detect thePCR product at each cycle during the exponential phase. The Plexor technique requires only two primers for sensitive andspecific quantification.Plexor technology takes advantage of the highly specific interaction between two modified nucleotides for qPCR analysis.These two novel bases, iso-dG and iso-dC, form a unique bonding interaction when incorporated in double-stranded DNAand pair only with each other. In Plexor reactions, one PCR primer is synthesized with an iso-dC residue and a fluorescentlabel at the 5’ end. The second PCR primer is unlabeled. Included in the reaction mix are modified Iso-dGTP nucleotides, whichare conjugated to the quencher Dabcyl. During the amplification reaction only dabcyl-iso-dGTP can be incorporated at theposition complementary to the iso-dC residue. Incorporation of the dabcyl-iso-dGTP in close proximity to the fluorescent labeleffectively quenches the fluorescent signal.A web-based primer design program for use with Plexor is available for single and multiplex qPCR reactions. For moreinformation, please visit www.promega.com/techserv/apps/qpcr.Plexor Labeled PrimersProducts include synthesis of the custom oligo (up to 30 bases in length), the fluorophore, an iso-dC residue and HPLCpurification. Turnaround time for Plexor Primers is 7-10 business days.2 nmoles or 5 nmoles5’ 6-FAM Primer5’ HEX Primer5’ TEX 615 Primer5’ Cy5Plexor Control Primer SetsPre-mixed Plexor Control Gene Primer Set contains 0.5 nmoles of the Plexor Control Primer and an unlabeled companionreverse primer.Available Products - 0.5 nmoleHEX Human b-actin Primer SetHEX Human GAPDH Primer SetTEX 615 Human b-actin Primer SetTEX 615 Human GAPDH Primer SetTechnical NotePlexor Control Gene Primer Sets mustbe resuspended in a pH 8.0 buffer. Rehydrationof the primer set in 200µl of 1mMMOPS, 0.1mM EDTA pH 8.0 will create a2.5µM stock solution. The buffer may bepurchased from Promega (Part #Y5101).Failure to maintain the primer set in a basicenvironment may result in significantdamage to the Plexor Primer.©2008 Integrated DNA Technologies 56 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSMolecular BeaconsMolecular Beacons are a special class of dual-labeled probes having self-complementary ends that form a stem-loop structure(hairpin) in their native state. The hairpin forces the reporter and quencher into contact (dark). Upon hybridization to target,reporter and quencher are separated and the Molecular Beacon becomes bright. Because the hairpins in these probesresult in enhanced specificity for their targets, Molecular Beacons are often better able to discriminate single nucleotidepolymorphisms (SNPs) than simple linear probes. 1Products below include synthesis of a custom oligo (up to 35 bases in length), reporter, quencher and HPLC purification.Please inquire for Molecular Beacons greater than 35 bases in length.Turnaround time is 5–7 business days for standard Molecular Beacons.Freedom Reporter5’ 6-FAM TMFreedom EquivalentQuencher Freedom Quencher Guaranteed Yields3’ Black Hole Quencher®-1 3’ Iowa Black® FQ 10 nm, 40 nm3’ Dabcyl 10 nm, 40 nmReporter 5’ TET TMFreedom QuencherGuaranteed Yields3’ Iowa Black® FQ 10 nm, 40 nmReporter 5’ HEX TMFreedom QuencherGuaranteed Yields3’ Iowa Black® FQ 10 nm, 40 nmFreedom Reporter 5’ TYE TM 563Freedom QuencherGuaranteed Yields3’ Iowa Black® RQ 5 nm, 20 nmFreedom Reporter 5’ TYE TM 665Freedom QuencherGuaranteed Yields3’ Iowa Black® RQ 5 nm, 20 nmReference:1. Thermodynamic basis of the enhanced specificity of structured DNA probes. Bonnet et al. Proc Natl Acad Sci USA 96: 6171-6176 (1999).FREE QC TRACES ONLINE©2008 Integrated DNA Technologies 57 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSFLUORESCENCE-BASED APPLICATIONSRNase SubstratesRNase Substrates are a collection of four fluorescent dual-labeled oligonucleotide probes that can be used to quantitatively orqualitatively detect RNase activity with any base specificity. Intact probes are dark (quenched) while cleaved probes are bright(unquenched). Assays are rapid, quantitative over time, inexpensive, and do not involve the use of radioactive or otherwisehazardous reagents. Each substrate contains only a single ribonucleotide residue: rU, rC, rA or rG 1-2 .Product Sequence QuantityrU RNase Substrate 5’ 6-FAM-ArUAA-3’ TAMRA 10 nmolesrC RNase Substrate 5’ 6-FAM-ArCAA-3’ TAMRA 10 nmolesrA RNase Substrate 5’ 6-FAM-ArAAA-3’ TAMRA 10 nmolesrG RNase Substrate 5’ 6-FAM-ArGAA-3’ TAMRA 10 nmolesRNase Substrates were developed in collaboration with Professor Ron Raines from the University of Wisconsin, Madison.References:1. Hypersensitive substrate for ribonucleases. Kelemen, B.R., Klink, T.A., Behlke, M.A., Eubanks, S.R., Leland, P.A., and Raines, R.T. Nucleic Acids Res. 27:3696-3701 (1999).2. Fast, facile, hypersensitive assays for ribonucleolytic activity. Park, C., Kelemen, B.R., Klink, T.A., Sweeney, R.Y., Behlke, M.A., Eubanks, S.R., and Raines, R.T.Methods Enzymol. 341:81-94 (2001).©2008 Integrated DNA Technologies 58 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com59

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSKeyAll modifications listed are available on oligos with DNAbases. The following symbols indicate additional options.Freedom Dye equivalent availableAvailable on oligos with RNA basesTechnical NoteA wide variety of modifications can be incorporated into an oligonucleotide at the time of synthesis. When possible,this is done using a modified solid support (CPG) for 3’-modifications or a specialized phosphoramidite reagent forinternal and 5’-modifications.Certain modifications (notably Digoxigenin and some fluorescent dyes) are not available as a modified-CPG orphosphoramidite and must be attached to the oligo after synthesis using NHS Ester chemistry. NHS Esters react withfree primary amines and result in stable, covalent attachment. A primary amine is therefore added to the oligo duringsynthesis to permit reaction with the desired NHS Ester.5’ 5’ Amino Modifier C6 (phosphoramidite)Int Internal amino-C6-dT (phosphoramidite)3’ 3’ Amino Modifier (CPG)Post-synthetic chemical modifications made to an oligonucleotide result in lower yields than modifications introducedduring synthesis. Further, all NHS Ester modifications require HPLC purification. PAGE purification is not offered forNHS Ester modifications as yields are further decreased and certain modifications can be damaged during PAGEpurification.Listed molecular weights correspond to the increase in MW of the oligo upon addition of the modification andincludes attachment groups used to incorporate the modification into the sequence. In some cases, the linker, andhence the MW, differs for attachment to the 5’ end, internal sites or 3’ end.Absorbance and Emission maxima of fluorescent dyes may vary slightly with oligo composition. Listed Ab/Em Maxwere measured on a standardized oligo sequence in 10 mM Tris, 50 mM KCl, 5 mM MgCl2, pH 8.3.All modifications are not available on every synthesis scale. Please visit www.idtdna.com or contact a local sales officefor more information.Please inquire for modifications not listed.©2008 Integrated DNA Technologies 60 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFreedom DyesFreedom Dyes are IDT-proprietary solutions for commonly used dye wavelengths. The numerical value in the dye namerepresents the emission of the dye when attached to an oligo. These dyes are free from additional licensing requirementsfrom IDT or third party companies. Freedom Dyes are available for commercial or diagnostic applications.MAX 557 NHS Ester Ab max524 nm Em max557 nmMW: 619.7MAX is most often used as a dye to multiplex with FAM. Its spectral profile is nearly identical to VIC® and can be used as aVIC® substitute. Importantly, MAX is efficiently excited by either a 488 nm laser or a broad emission light source, and thereforecan be used with most commercial detection platforms. MAX is conjugated post-synthesis to an amino-modified oligo as anNHS-ester dye.5’ INT. 3’a — aHPLC purification requiredTEX 615 Ab max596 nm Em max613 nm5’ MW: 966.13’ MW: 897.0TEX 615 is a red wavelength dye and is commonly used in multiplex reactions with fluorescein or in FACS or microscopyapplications using the rhodamine filter. TEX 615 can be used as a direct substitute for Texas Red®.5’ INT. 3’a — aHPLC purification requiredTYE DyesTYE fluorescent dyes are bright and can be used in microarray applications. TYE 563 can be used as a direct substitute forCy3, TYE 665 for Cy5, and TYE 705 for Cy5.5TYE 563 Ab max549 nm Em max563 nm5’ INT. 3’a — aHPLC purification required5’ MW: 490.63’ MW: 634.8TYE 665 Ab max645 nm Em max665 nm5’ INT. 3’a — a5’ MW: 516.63’ MW: 774.0HPLC purification required©2008 Integrated DNA Technologies www.idtdna.com61

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFreedom DyesTYE TM 705 Ab max686 nm Em max704 nm5’ MW: 616.75’ INT. 3’a — —HPLC purification requiredi Dye SeriesThe i series is a collection of fluorescent dyes that absorb in the near infrared region and are designed to be direct substitutesfor the WellRED dyes.i2 Ab max747 nm Em max776 nmi2 can be used as a direct substitute for WellRED D25’ INT. 3’a — —HPLC purification requiredi3 Ab max686 nm Em max705 nmi3 can be used as a direct substitute for WellRED D35’ INT. 3’a — —HPLC purification requiredi4 Ab max652 nm Em max665 nmi4 can be used as a direct substitute for WellRED D45’ INT. 3’a — —HPLC purification required©2008 Integrated DNA Technologies 62 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFluorophoresLI-COR IRDyes®IRDyes® can be attached at the 5’-end of an oligonucleotide. These near-infrared dyes are made by LI-COR® Biosciences andintended for use in biochemical applications and DNA sequencing.IRDye® 700 Ab max684 nm Em max702 nm MW: 753.95’ INT. 3’N + -O 3SNa — —OO P O -O3'IRDye® 800 Ab max791 nm Em max809 nm MW: 862.15’ INT. 3’a — —ON + -O 3SNOO P O -O3'IRDye® 800CW Ab max774 nm Em max789 nm MW: 1278.3IRDye® 800CW is an NHS-ester and can be attached at the 5’ end of an oligonucleotide via conjugation to a primary amine.This infrared dye is made by LI-COR® Biosciences and is more hydrophilic than any of the other infrared dyes available.Combined with the excellent tissue penetration seen in the 800 nm wavelength spectra, it is ideal for in vivo fluorescenceimaging applications.5’ INT. 3’a — —Alexa Fluor® DyesAlexa® Dyes have high quantum yields and are relatively photostable. They are conjugated post-synthesis to an aminomodifiedoligo as NHS Esters. They are available in a wide spectral range from blue to deep red.Alexa Fluor® 488 NHS Ester Ab max492 nm Em max517 nm MW: 695.6SO3 - SO - 35’ INT. 3’a — aHPLC purification requiredH2N ONH2 +OO –HNO©2008 Integrated DNA Technologies www.idtdna.com63

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFluorophoresAlexa Fluor® 532 NHS Ester Ab max527 nm Em max553 nm MW: 787.8SO3H SO - 35’ INT. 3’HNO H +Na — aHPLC purification requiredHNOAlexa Fluor® 546 NHS Ester Ab max555 nm Em max571 nm MW: 1121.5SO 3- SO 3-5’ INT. 3’HNOH +Na — aOClOHHPLC purification requiredNHHNSClOOClAlexa Fluor® 594 NHS Ester Ab max584 nm Em max616 nm MW: 883.9N ON +5’ INT. 3’a — aCH2SO3HOO –CH2SO3 -HPLC purification requiredHNOAlexa Fluor® 647 NHS Ester Ab max650 nm Em max670 nm MW: 1020.25’ INT. 3’a — aHPLC purification requiredAlexa Fluor® 660 NHS Ester Ab max661 nm Em max691 nm MW: 941.75’ INT. 3’a — aHPLC purification requiredAlexa Fluor® 750 NHS Ester Ab max753 nm Em max775 nm MW: 1047.25’ INT. 3’a — aHPLC purification required©2008 Integrated DNA Technologies 64 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFluorophoresBodipy® DyeBodipy® 630/650-X NHS Ester has a narrow spectral profile and is highly fluorescent. This dye is only available as an NHS esterand is conjugated post-synthesis to an amino-modified oligo.Bodipy® 630/650-X NHS Ester Ab max638 nm Em max653 nm MW: 724.65’ INT. 3’a — aHPLC purification requiredSNFB - N +FHC CHO HNOHNOCy DyesCy fluorescent dyes are bright and are the standard for use in microarray applications today.Cy3 Ab max550 nm Em max564 nm Freedom Dye Equivalent-TYE 5635’ INT. 3’a a aHPLC purification requiredHON +NOO P O -O3'5’ MW: 506.6Int. MW: 506.63’ MW: 644.6Cy5 Ab max648 nm Em max668 nm Freedom Dye Equivalent-TYE 6655’ INT. 3’a a aHPLC purification requiredHON +NOO P O -5’ MW: 532.6Int. MW: 532.63’ MW: 670.7O3'Cy5.5 Ab max685 nm Em max706 nm Freedom Dye Equivalent-TYE 7055’ INT. 3’a — aN +N5’ MW: 632.73’ MW: 770.8HPLC purification requiredHOOO P O -O3'Dy750 NHS Ester Ab max747 nm Em max776 nm MW: 875.1Dy750 can be used with any detection system that functions in the infrared region and in certain bioimaging applications dueto its degree of tissue penetration. Dy750 is conjugated post-synthesis to an amino-modified oligo as an NHS-ester dye.5’ INT. 3’HNNSO3 -a — —OHPLC purification requiredNO+©2008 Integrated DNA Technologies www.idtdna.com65

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFluorophores6-FAM (Fluorescein) Ab max495 nm Em max520 nm 5’ MW: 537.53’ MW: 569.56-carboxyfluorescein is a single isomer derivative of fluorescein. 6-FAM is the most commonly used fluorescent dye forattachment to oligonucleotides and is compatible with most fluorescence detection equipment. Below pH 7, 6-FAMbecomes protonated, which results in decreased fluorescence. It is typically used in the pH range 7.5-8.5.5’ INT. 3’-OOOa — aOO –OHN5' 6-FAMOOFluorescein-dT Ab max495 nm Em max520 nm 3'MW: 816.7Fluorescein-dT is a modified base wherein fluorescein is attached to position 5 of the thymine ring by a 6-carbon spacer arm.O P O --OOO5’ INT. 3’O –a a —HNOONHHNOOHPLC purification required'5OOONOO P O -O3'HEX Ab max538 nm Em max555 nm MW: 744.1Hexachlorofluorescein is a chemical relative of fluorescein that is commonly used for multiplexed assays with FAM and TET.5’ INT. 3’-OClOClOa — —ClClO –ClOOClHNO P OJOE NHS Ester Ab max529 nm Em max555 nmOMW: 666.4- 3'JOE is 6-carboxy-4’, 5’-dichloro-2’, 7’- dimethoxyfluorescein. It is available only as an NHS ester and must be attached to anamino-modified oligonucleotide. This dye is frequently used in multiplex reactions with fluorescein.O5’ INT. 3’ClCla — a-OOOHPLC purification requiredH 3COO –OCH 3HNOO©2008 Integrated DNA Technologies 66 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFluorophoresRhodamine DyesFluorophores from the rhodamine family, ranging from green (Rhodamine Green, Em 531 nm) to red (ROX, Em 608 nm)emission, are offered. Compared to the fluorescein family of dyes, rhodamine dyes are relatively resistant to photobleachingand can be used over a wider pH range.Rhodamine Green-X NHS Ester Ab max504 nm Em max531 nm MW: 648.7H2NO NH2 +5’ INT. 3’O –a — aHNOHPLC purification requiredOONHRhodamine Red-X NHS Ester Ab max574 nm Em max594 nm MW: 833.05’ INT. 3’a — aHPLC purification requiredNO N +SO 3-HNNHSO 2OROX NHS Ester Ab max588 nm Em max608 nm MW: 695.8ROX is carboxy-X-rhodamine. It is available only as an NHS ester and must be attached to an amino-modifiedoligonucleotide. Its spectral properties are similar to Texas Red®.5’ INT. 3’a — aN ON +O –HPLC purification requiredHNOOTAMRA DyesTAMRA is carboxytetramethylrhodamine. It is available as an NHS ester and can be attached to an amino-modified oligonucleotide.It can also be directly incorporated onto the 3’-end of an oligo at the time of synthesis. It can be used both as areporter dye and as a quencher with fluorescein in dual-labeled probes.TAMRA Ab max559 nm Em max583 nm MW: 1008.9NO –O N +5’ INT. 3’OO— — aHNNHHNOOHPLC purification required'5OOONOO P O -O3'©2008 Integrated DNA Technologies www.idtdna.com67

INTEGRATEDDNATECHNOLOGIESFluorophoresPRODUCTSMODIFICATIONSTAMRA NHS Ester Ab max559 nm Em max583 nm 5’ MW: 591.6Int. MW: 870.9NO N +5’ INT. 3’3’ MW: 1008.9a a aHPLC purification requiredHNOO –OTET Ab max522 nm Em max539 nm MW: 675.2Tetrachlorofluorescein is a chemical relative of fluorescein that is commonly used for multiplexed assays with FAM and HEX.5’ INT. 3’-OOOa — —ClClO –ClOOClHNOOPOO -3'TEXAS RED®-X NHS Ester Ab max598 nm Em max617 nm Freedom Dye Equivalent-TEX TM 615MW: 881.0Texas Red®-X is a commonly used red wavelength fluorescent dye. It is available only as an NHS ester and must be attached toan amino-modified oligonucleotide.5’ INT. 3’a — aHPLC purification requiredN ON +4SO3 -2HNSOO2NHWellRED DyesThe WellRED dye-labeled phosphoramidites use cyanine-based fluorescent dyes with high extinction coefficients thatabsorb in the near infrared region. These dyes were designed specifically for use with the CEQ Series Genetic Analysis systems,and are excited to fluoresce when using diode lasers. This method is much more stable and cost-effective than traditionalargon ion lasers.WellRED D2 Ab max763 nm Em max778 nm Freedom Dye Equivalent-i25’ INT. 3’a — —HPLC purification requiredMW: 640.8©2008 Integrated DNA Technologies 68 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSFluorophoresWellRED D3 Ab max683 nm Em max701 nm Freedom Dye Equivalent-i35’ INT. 3’a — —MW: 644.8HPLC purification requiredWellRED D4 Ab max648 nm Em max666 nm Freedom Dye Equivalent-i45’ INT. 3’a — —MW: 544.7HPLC purification requiredPhosphorylationPhosphorylation MW: 80.05’ Phosphorylation is needed if an oligo is to be used as a substrate for DNA ligase. 3’ Phosphorylation will inhibit degradationby some 3’-exonucleases and can be used to block extension by DNA polymerases.5’ INT. 3’a — aOHO P O -O3'5' PhosphorylationAttachment Chemistry / LinkersAcrydite MW: 247.2Acrydite is an attachment chemistry based on an acrylic phosphoramidite that can be added to oligonucleotides as a 5’-modification. Acrydite-modified oligonucleotides covalently react with thiol-modified surfaces or can be incorporated intopolyacrylamide gels during polymerization.HN5’ INT. 3’a — —OOO P O -O3'Amino ModifiersA primary amino group can be used to attach a variety of modifiers (such as fluorescent dyes) to an oligonucleotide or usedto attach an oligonucleotide to a solid surface. Amino modifiers can be positioned at the 5’-end with either a standard (C6)or longer (C12) spacer arm. Amino modifications can also be positioned at the 3’-end. Internal amino modifications can beintroduced using an amino-dT base.Amino Modifier C6 MW: 179.25’ INT. 3’a — —H 2NOO P O -O3'©2008 Integrated DNA Technologies www.idtdna.com69

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSAttachment Chemistry / LinkersAmino Modifier C12 MW: 263.35’ INT. 3’a — —H 2NOO P O -O3'OONH2Amino Modifier C6 dTHNNMW: 458.4H5’ INT. 3’a a —'5OOOOO P O -NO3'Amino Modifier MW: 179.25’ INT. 3’— — a'5ONH 2Uni-Link Amino Modifier MW: 209.2Uni-Link is an amino-modifier phosphoramidite from Clontech that provides a free primary amine attached to the 5’-end ofan oligo via a six carbon aliphatic spacer arm. It is functionally interchangeable with Amino Modifier C6.5’ INT. 3’O5'a a —H 2NOO P O -O3'BiotinylationBiotin-modified oligos bind tightly to streptavidin. The streptavidin can be labeled with fluorescent dyes and enzymes ormediate attachment to a solid surface. A variety of molecular biology assays and purification methods employ biotin. Biotincan be added to the 5’- or 3’-ends of an oligo using either a C6 (standard) or TEG (tetra-ethyleneglycol, 15 atom) spacer arm.5’ Biotin-TEG requires purification. Internal biotin modification can be introduced using a biotin dT base, which also requiresadditional purification.Biotin5’ INT. 3’a — aHNOSNHOHN3’ BiotinOOHO5'5’ MW: 394.43’ MW: 437.4©2008 Integrated DNA Technologies 70 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSAttachment Chemistry / LinkersBiotin dT MW: 684.7HNONH5’ INT. 3’HNOONHHNSa a —'5OOONOHPLC purification requiredOO P O -Biotin-TEGBiotin-TEG has an extended 15-atom spacer arm.O3'MW: 569.6O5’ INT. 3’HNNHa — aSHNOOOOO5'OAdditional purification is required on 5’ Biotin-TEG.OO P O -O3'Dual Biotin MW: 871.0Two biotin groups are sequentially placed on the 5’-end, which increases the efficiency of streptavidin binding. Dual Biotin iscommonly employed in SAGE protocols 1 O.HNNH5’ INT. 3’HNOHa — —Additional purification requiredHNSONHOHNOOPOO -SReference:1. Enhanced concatemer cloning-a modification to the SAGE (Serial Analysis of Gene Expression) technique. Powell, J., Nucleic Acids Research, 26:3445-46(1998).OOO P O -O3'PC Biotin MW: 597.6PC Biotin produces a photocleavable spacer between the biotin group and the DNA bases. Optimal cleavage is obtained withexposure to long-wave UV light in the 300-350 nm spectral range. Cleavage releases the oligo with a 5’-phosphate group.5’ INT. 3’OHNNHa — — HNHPLC purification requiredSONHNO 2OOO P O -O3'©2008 Integrated DNA Technologies www.idtdna.com71

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSAttachment Chemistry / Linkers3’ Cholesteryl TEG MW: 756.0Cholesterol can be conjugated to oligonucleotides and can facilitate uptake into cells. It has been used as a transfection aidfor antisense oligos and siRNAs, both in vitro and in vivo. Cholesterol is a very hydrophobic modification which is best purifiedusing RP-HPLC.5’ INT. 3’— — aOOO5'OHPLC purification requiredONHOOOHDigoxigenin NHS Ester MW: 722.9Digoxigenin is a small hapten that can be conjugated to amino-modified oligos. Anti-digoxigenin antibodies allow capture ordetection of a digoxigenin-labeled oligo and can be used in a variety of assay formats much like biotin/streptavidin.5’ INT. 3’a — aOHCH3OOHPLC purification requiredOCH3HNOHNHODithiol MW: 214.2Each Dithiol insertion results in 2 SH groups and is available for coupling with ligands or surfaces (linkage to gold surfacesin one popular application). Dithiol can be inserted in series so that two or even three groups can be positioned adjacentto each other to increase efficiency of ligand/surface interactions. Note that serial insertions will decrease oligo yield due tolower efficiency of incorporation of the Dithiol phosphoramidite.O5'5’ INT. 3’a a —SSOOO P O -Additional purification requiredO3'I-Linker MW: 208.2I-Linker, developed at IDT, is a proprietary covalent attachment chemistry for oligonucleotides. The modifier is attached to the5’-end of the oligo. I-Linker can be substituted for amino modifications in many applications. In addition, I-Linker expands therange of reactive groups that can be used for conjugation, including aldehyde and ketone-modified ligands or surfaces.5’ INT. 3’a — —©2008 Integrated DNA Technologies 72 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSAttachment Chemistry / LinkersThiol ModificationsA thiol group can be used to attach an oligo to a variety of fluorescent and nonfluorescent moieties or surfaces. Oligoscontaining thiol modifiers are shipped in their oxidized (disulfide) form and require chemical reduction by dithiothreitol (DTT)or Tris (2-carboxyethyl) phosphine (TCEP) prior to use.Thiol Modifier C3 S-S MW: 244.35’ INT. 3’— — a'5OSSOHHOSThiol Modifier C6 S-S MW: 328.4S5’ INT. 3’a — —OO P O -O3'Dark QuenchersIowa Black® QuenchersThe Iowa Black quenchers are a family of proprietary dark quenchers developed by IDT that are offered as either 5’- or 3’-endmodifications. They have excellent properties for use in fluorescence-quenched probes. These compounds are stable over awide range of conditions, including pH and heat.Iowa Black® FQ Ab max531 nm 5’ MW: 426.43’ MW: 583.6Iowa Black FQ has a broad absorbance spectra ranging from 420 to 620 nm with peak absorbance at 531 nm. This quencher isideal for use with fluorescein and other fluorescent dyes that emit in the green to pink spectral range.5’ INT. 3’a — aHPLC purification requiredIowa Black® RQ 5’ Ab max656 nm 5’ MW: 420.43’ Ab max667 nm 3’ MW: 678.6Iowa Black RQ has a broad absorbance spectra ranging from 500 to 700 nm. This quencher is ideal for use with TEX 615, TYE563, TYE 665, and other fluorescent dyes that emit in the red spectral range.5’ INT. 3’a — aHPLC purification required©2008 Integrated DNA Technologies www.idtdna.com73

INTEGRATEDDNATECHNOLOGIESDark QuenchersPRODUCTSMODIFICATIONSBlack Hole Quencher®-1 Ab max534 nm MW: 554.5BHQ-1® is best suited for fluorophores that emit in the wavelength range from FAM to TAMRA.5’ INT. 3’— — aHPLC purification requiredBlack Hole Quencher®-2 Ab max578 nm MW: 556.5BHQ-2® is best suited for fluorophores in the Cy3 to Cy5 wavelength range.5’ INT. 3’— — aHPLC purification requiredDabcyl Ab max478 nm MW: 757.8Dabcyl is a relatively weak dark quencher and is best suited for use in Molecular Beacons when the hairpin places thequencher and fluorescent dye in close proximity.5’ INT. 3’— — aHPLC purification requiredSpacersOOC3 Spacer MW: 138.1Multiple C3 spacers can be added at either end of an oligo to introduce a long hydrophilic spacer arm for the attachment offluorophores or other pendent groups.5’ INT. 3’a a a'5OOOP O -O -NHNN'5OOOO NHOOO P O -O3'N N N5' C3 SpacerPC Spacer MW: 344.3PC (Photo-Cleavable) Spacer can be placed between DNA bases or between the oligo and a 5’-modifier group. It offers a 10-atom spacer arm that can be cleaved with exposure to UV light in the 300-350 nm spectral range. Cleavage releases the oligowith a 5’-phosphate group.O5’ INT. 3’'5ONHa a —HPLC purification requiredONO 2O P O -O3'©2008 Integrated DNA Technologies 74 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESSpacersPRODUCTSMODIFICATIONSSpacer 9 MW: 212.1Spacer 9 is a triethylene glycol spacer that can be incorporated at the 5’-end of an oligo or internally. Multiple insertions canbe used to create long spacer arms.5’ INT. 3’a a —'5OOOOO P O -O3'Spacer 18 MW: 344.3Spacer 18 is an 18-atom hexa-ethyleneglycol spacer. It is the longest spacer arm that can be added as a single modification.5’ INT. 3’a a —'5OOOOOOOO P O -O3'1’,2’-Dideoxyribose (dSpacer) MW: 180.1The 1’,2’-Dideoxyribose modification is used to introduce a stable abasic site within an oligonucleotide.5’ INT. 3’a a —'5OOOO P O -Hexanediol MW: 180.1Hexanediol is a six carbon glycol spacer that is capable of blocking extension by DNA polymerases. This 3’ modification iscapable of supporting synthesis of oligos up to 100 bases.O3'5’ INT. 3’'5OOH— — a©2008 Integrated DNA Technologies www.idtdna.com75

INTEGRATEDDNATECHNOLOGIESModified BasesPRODUCTSMODIFICATIONS2-Aminopurine MW: 313.22-Aminopurine can substitute for dA in an oligonucleotide. It is a naturally fluorescent base that is sensitive to the localenvironment making it a useful probe for monitoring the structure and dynamics of DNA hairpins and for detecting the basestacking state of a duplex. 2-Aminopurine can be destabilizing and can slightly lower the T m .5’ INT. 3’NNa a —'5H 2NONONOO2,6-Diaminopurine(2-Amino-dA) MW: 328.23'This modified base can form three hydrogen bonds when base-paired with dT and can increase the T m of short oligos by asmuch as 1-2°C per insertion. This effect, however, is complex and is dependent on sequence context 1 .O P O -NH25’ INT. 3’NNa a —HPLC purification required'5H 2NONONOOReference:3'1. The use of diaminopurine to investigate structural properties of nucleic acids and molecular recognition between ligands and DNA. Bailly, C., and Waring,M.J., Nucleic Acids Research, 26:4309-14 (1998).O P O -5-Bromo dU MW: 369.15-Bromo-deoxyuridine (5-BrdU) is a photoreactive halogenated base that can be incorporated into oligonucleotides tocrosslink them to DNA, RNA or proteins with exposure to UV light. Crosslinking is maximally efficient with light at 308 nm.5’ INT. 3’OBra a —OHNNHPLC purification required'5OOOO P O -deoxyUridine MW: 290.2DeoxyUridine (dU) can be substituted for dT in DNA oligonucleotides. The base can be removed by the enzyme uracil-Ndeglycosylase(UNG), which renders the oligo susceptible to strand scission. One common use of this strategy is to eliminateamplified DNA and prevent cross-contamination.O3'O5’ INT. 3’HNa a a'5ONOO5' deoxyUridineOO P O -O3'©2008 Integrated DNA Technologies 76 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESModified BasesPRODUCTSMODIFICATIONSFluorine Bases2’ Fluoro Uridine and 2’ Fluoro Cytidine have a fluorine modified ribose which increases binding affinity (T m ) and also confersnuclease resistance when compared to native RNA. These modified bases are commonly employed in ribozymes and siRNAsOto improve stability in serum or other biological fluids.2’ Fluoro U MW: 308.25’ INT. 3’a a —'5OOOOHNO P O -FNO3'2’ Fluoro C MW: 307.2NNH25’ INT. 3’a a —'5OOONOFO P O -Inverted dT MW: 304.2Inverted dT can be incorporated at the 3’-end of an oligo, leading to a 3’-3’ internucleotide linkage that inhibits bothdegradation by 3’ exonucleases and extension by DNA polymerases.5’ INT. 3’— — aHO'5OOOO3'NHNdideoxy-C MW: 273.2Dideoxycytidine (ddC) is a 3’ chain terminator that prevents 3’ extension by DNA polymerases.O5’ INT. 3’— — aNNH2'5ONOO5-Methyl dC MW: 303.25-Methyl deoxyCytidine (5-MedC), when substituted for dC, will increase the T m by as much as 0.5°C per insertion. In addition,the presence of 5-Methyl dC in CpG motifs can prevent or limit unwanted immune responses that otherwise occur if oligos areadministered in vivo, which is of particular importance in antisense applications.NH25’ INT. 3’Na a aO'5ONO5' 5-Methyl dCOO P O -©2008 Integrated DNA Technologies 77 www.idtdna.comO3'

INTEGRATEDDNATECHNOLOGIESModified BasesPRODUCTSMODIFICATIONSdeoxyInosine MW: 314.2Historically, the first universal base employed was 2’-deoxyInosine (dI). DeoxyInosine is a naturally occurring base that, whilenot truly universal, is less destabilizing than mismatches involving the four standard bases. Hydrogen bond interactionsbetween dI and dA, dG, dC and dT are weak and unequal, with the result that some base-pairing bias does exist with dI:dC >dI:dA > dI:dG > dI:dT. When present in a DNA template, deoxyInosine preferentially directs incorporation of dC in the growingnascent strand by DNA polymerase.5’ INT. 3’a a a'5OHNONONN5' deoxyInosineLocked Nucleic Acids (LNAs)OO P O -O3'LNA A MW: 341.2 LNA G MW: 357.2LNA C MW: 331.2 LNA T MW: 332.2LNA bases have a modification to the ribose backbone that locks the base in the 3’-endo position, which favors RNA A-typehelix duplex geometry. This modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertionscan be placed in an oligo at any position. Applications have been described ranging from antisense oligos to hybridizationprobes to SNP detection and allele -specific PCR. Due to the large increase in Tm conferred by LNAs, they also can causean increase in primer dimer formation as well as self-hairpin formation. We recommend limiting the number of LNAsincorporated into a single oligo to 10 bases or less 1,2 . LNA bases are indicated using the + symbol (+A for example) in the IDTordering system.5’ INT. 3’a a a'5OOOO P O -OBaseReferences:O3'1. Design considerations and effects of LNA in PCR primers. Latorra, D., Arar, K., and Hurley, J.M., Mol. Cell. Probes., 17:253-9 (2003).2. Antisense inhibition of gene expression in cells by oligonucleotides incorporating locked nucleic acids: effect of mRNA target sequence and chimeradesign. Braasch, D.A., Liu, Y., and Corey, D.R., Nucleic Acids Res., 30:5160-7 (2002).5-Nitroindole MW: 340.25-Nitroindole is the best universal base currently available. It does not favor any particular base-pairing (i.e., it does notsupport base-specific hydrogen bond formation), but does contribute to duplex stability through base-stacking interactions.Therefore, it is not as destabilizing to the duplex as mismatches between the standard bases. 5-Nitroindole directs randomincorporation of any base when used as a template for DNA polymerase and partially blocks enzyme processivity 1 .5’ INT. 3’a a —O 2NReference:1. The applications of universal DNA base analogues. Loakes, D., Nucleic Acids Res., 29:2437-2447 (2001).'5OONOO P O -O3'©2008 Integrated DNA Technologies 78 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSModified Bases2’-O-Methyl RNA BasesmA MW: 343.2 mG MW: 359.2mC MW: 319.2 mU MW: 320.22’-O-Methyl RNA is a naturally occurring modification of RNA found in tRNA and other small RNAs that arises as a posttranscriptionalmodification. Oligonucleotides can be directly synthesized that contain 2’-O-Methyl RNA. This modificationincreases Tm of RNA:RNA duplexes but results in only small changes in RNA:DNA stability. It is stabile with respect to attackby single-stranded ribonucleases and is typically 5- to 10-fold less susceptible to DNases than DNA. It is commonly usedin antisense oligos as a means to increase stability and binding affinity to the target message. 2’-O-Methyl RNA bases areindicated using lower case m (mU for example) in the IDT ordering system.'5BaseOOOOCH 3O P O -3’-Ribo PrimersO3'Ribo A MW: 329.2 Ribo C MW: 305.2Ribo G MW: 345.2 Ribo U MW: 306.2PCR primers containing a 3’-terminal ribose can be used to prevent cross-contamination of amplified sequences. 15’ INT. 3’— — a'5NNH2NNNRibo AOOReference:OHOH1. Use of PCR primers containing a 3’-terminal ribose residue to prevent cross-contamination of amplified sequences. Walder, R.Y. and Walder, J.A. NucleicAcids Research, 21:4339-43 (1993).Iso-dC and Iso-dGIso-dG and Iso-dC are novel DNA bases licensed from EraGen Biosciences, Inc (www.eragen.com). Iso-dC and Iso-dG arechemical variants of cytosine and guanine, respectively. Iso-dC will hydrogen bond with Iso-dG but not with dG. Similarly,Iso-dG will base pair with Iso-dC but not with dC. 1 Incorporation of these novel bases into DNA effectively expands the geneticalphabet and permits synthesis of oligonucleotides that have increased specificity and decreased mismatch hybridizationpotential. For example, an oligo containing Iso-dC can be designed so that it will hybridize to a complementary oligocontaining Iso-dG, but will not hybridize to any naturally occurring nucleic acid sequence. Iso-dG and Iso-dC triphosphates,which can be incorporated opposite Iso-dG and Iso-dC using traditional polymerases, are available from EraGen.Oligonucleotides that contain either or both iso-bases require IE-HPLC purification.HNNIso-dC MW: 303.25’ INT. 3’a a —IE-HPLC requiredReference:ONHN5-Me-Iso-dCNHNHNHON1. Enzymatic recognition of the base pair between isocytidine and isoguanosine. Switzer, C.Y., Moroney, S.E., and Benner, S.A. Biochemistry, 32:10489-96(1993).NIso-dG©2008 Integrated DNA Technologies www.idtdna.com79HNNHN5-Me-dCOHONHNNHNdG

INTEGRATEDDNATECHNOLOGIESPRODUCTSMODIFICATIONSModified BasesIso-dG MW: 329.25’ INT. 3’a a —IE-HPLC purification requiredONHNHNHNNHONNNIso-dGHNNHNOHONHNNNdGNHH5-Me-Iso-dC5-Me-dCTrimer-20Mix of 20 Trimers:(AAA+AAC+ACT+ATC+ATG+CAG+CAT+CCG+CGT+CTG+GAA+GAC+GCT+GGT+GTT+TAC+TCT+TGC+TGG+TTC)It is common practice to insert random N-base domains into oligonucleotides to perform mutagenesis or to evolve novelproteins (random sequence libraries). Unfortunately, inserting serial N bases gives rise to all 64 possible codons and thus doesnot produce an equal representation of the 20 amino acids (AAs). It will also insert unwanted stop codons. A set of trimerphosphoramidites has been developed which comprises a single codon for each of the 20 AAs. The set is available as a 20Trimer Mix for creating better N-domains into oligonucleotides intended to encode proteins. Each trimer addition inserts 3bases into a DNA sequence. It is also possible to obtain custom mixes with more limited AA content. Note that the use oftrimer mixes will not be useful to create N-base domains for aptamer evolution libraries.5’ INT. 3’a a —Phosphorothioate BondThe phosphorothioate (PS) bond substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of an oligo.This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioates can be introducedat either the 5’- or 3’-end of the oligo to inhibit exonuclease degradation. In antisense oligonucleotides, phosphorothioatesare also introduced internally to limit attack by endonucleases. Phosphorothioate bonds are indicated using the * symbol(A* for example) in the IDT ordering system.NH2NN'5NNOONH 2NOOPS -NOOOOOPS -O3'©2008 Integrated DNA Technologies 80 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com81

INTEGRATEDDNATECHNOLOGIESPRODUCTSSTANDARD TERMS & CONDITIONS OF SALEStandard Terms and Conditions of SaleAll orders received by IDT, and all sales of IDT products, are made subject to the following conditions of sale, disclaimer of warranties, andcustomer indemnification of IDT.Use Restrictions. Oligonucleotides and nucleic acid products are manufactured and sold by IDT for the customer’s research purposesonly. Resale of IDT products requires the express written consent of IDT. Unless pursuant to a separate signed agreement by authorized IDTofficials, IDT products are not sold for (and have not been approved) for use in any clinical, diagnostic or therapeutic applications. Obtaininglicense and/or regulatory approval to use IDT products in proprietary applications, or in any non-research (clinical) applications, are thecustomer’s exclusive responsibilities.Limited Liability/Customer Indemnity. IDT is not responsible or liable for any losses, costs, expenses or other forms of liability arising outof the unauthorized or unlicensed use of IDT products. Purchasers of IDT products shall indemnify and hold IDT harmless for any and alldamages and/or liability, however characterized, related to the unauthorized or unlicensed use of IDT products. Under no circumstancesshall IDT be liable for any consequential damages, resulting from any use (approved or otherwise) of IDT products.Warranties/Disclaimers. IDT’s products are guaranteed to meet or exceed our published specifications for identity, purity and yield asmeasured under normal laboratory conditions. If our product fails to meet such specifications, IDT will promptly replace the product. Allother warranties are hereby expressly disclaimed, including but not limited to, the implied warranties of merchantability and fitness for aparticular purpose, and any warranty that the products, or the use of products, manufactured by IDT will not infringe the patents of one ormore third-parties. All orders received by IDT and all sales of IDT products are made subject to the aforementioned disclaimers of warranties.Licenses/TrademarksFluorescent-Labeled OligonucleotidesAlexa Fluor® / Texas Red® / Bodipy® / Rhodamine Red and Rhodamine Green These products are provided under an agreementbetween Molecular Probes, Inc (a wholly owned subsidiary of Invitrogen Corporation), and Integrated DNA Technologies, and themanufacture, use, sale or import of this product may be subject to one or more U.S. patents, pending applications, and corresponding non-U.S. equivalents, owned by Molecular Probes, Inc. The purchase of this product conveys to the buyer the non-transferable right to use thepurchased amount of the product and components of the product in research conducted by the buyer (whether the buyer is an academicor for-profit entity). The buyer cannot sell or otherwise transfer (a) this product, (b) its components or (c) materials made using this productor its components to a third party or otherwise use this product, its components or materials made using this product or its components forCommercial Purposes. Commercial Purposes means any activity by a party for consideration and may include, but is not limited to: (1) useof the product or its components in manufacturing; (2) use of the product or its components to provide a service, information, or data; (3)use of the product or its components for therapeutic, diagnostic or prophylactic purposes; or (4) resale of the product or its components,whether or not such product or its components are resold for use in research. For information on purchasing a license to this product for anyother use, contact Molecular Probes, Inc., Business Development, 29851 Willow Creek Road, Eugene, OR 97402, USA, Tel: (541)465-8300. Fax:(541) 335-0504.Black Hole Quenchers®, BHQ-1® and BHQ-2® dyes and products incorporating them are to be used for research & development purposesonly and may not be used for any commercial, clinical, in vitro diagnostic or other use. Products incorporating these dyes are subject to theproprietary worldwide rights of Biosearch Technologies, Inc. and are made and sold under license from Biosearch Technologies, Inc. There isno implied license for commercial use with respect to the Products and a license must be obtained directly from Biosearch Technologies, Inc.with respect to any proposed commercial use of the Products. “Commercial Use” includes but is not limited to the sale, lease, license or othertransfer of the products or any material derived there from, the sale, lease, license or other grant of rights to use the Products or any materialderived or produced from them, or the use of the Products to perform services for a fee for third parties (including fee for service or contractresearch.Cy Dyes and Cy -labeled oligonucleotides are covered by U.S. Patent Numbers 5,556,959 and 5,808,044 and are licensed and sold fornon-commercial research purposes only. Any other use including diagnostic, therapeutic or in vivo applications requires a license fromAmersham Biosciences, Inc. Cy is a trademark of Amersham Biosciences.FAM, HEX, ROX, TAMRA and TET are trademarks of Applied Biosystems, Inc.Iowa Black®, TYE, MAX, TEX are trademarks of Integrated DNA Technologies, Inc.IRDye® 700 and IRDye® 800 are products manufactured under license from LI-COR® Biosciences, which expressly excludes the right to usethis product in qPCR or AFLP applications.LC Red 640/LC Red 610. Sold under license from Roche Diagnostics GmbH for non-sequencing, research use only. LightCycler® is aregistered trademark of a member of the Roche group.Molecular Beacons are licensed under patents owned by The Public Health Research Institute of the City of New York, Inc. and come withlicensed rights for use only in the purchaser’s research and development activities.Well-Red® Dyes: IDT manufactured oligonucleotides incorporating Well-Red® Dyes are made and sold under license from BeckmanCoulter Inc., (BCI) for use exclusively with BCI instruments or BCI-approved instruments. All other uses are prohibited unless specifically andseparately authorized by BCI.©2008 Integrated DNA Technologies 82 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSSTANDARD TERMS & CONDITIONS OF SALENotice: The 5’ Nuclease Assay and other homogenous amplification methods used in connection with the Polymerase Chain Reaction(“PCR”) process are covered by patents owned by Roche Molecular Systems, Inc. and F. Hoffman La-Roche Ltd (“Roche”). No license to use the5’ Nuclease Assay or any Roche patented homogenous amplification process is conveyed expressly or by implication to the purchaser by thepurchase of the above listed products or any other IDT products. Additionally, no license to use methods covered by Genetic TechnologiesLimited (GTG) patents relating to allelic discrimination or SNP genotyping are conveyed by the purchase of IDT oligonucleotides.Gene KnockdownRNAi. IDT’s products are licensed under U.S. and international patent rights owned by the Carnegie Institution of Washington thatcover RNA interference. These products are accompanied by a limited non-exclusive worldwide license under the Carnegie Institutionof Washington’s patent rights for researchers at academic or other not-for-profit institutions to use the products for non-profit research.However, use of dsRNA for RNA interference by for-profit organizations requires a license from the Carnegie Institution of Washington.siRNA. This product is licensed under European Patents 1144623, 121945 and foreign equivalents from Alnylam Pharmaceuticals,Inc., Cambridge, USA and is provided only for use in academic and commercial research whose purpose is to elucidate gene function,including research to validate potential gene products and pathways for drug discovery and development and to screen non-siRNA basedcompounds (but excluding the evaluation or characterization of this product as the potential basis for an siRNA-based drug) and not for anyother commercial purposes. Information about licenses for commercial use (including discovery and development of siRNA-based drugs) isavailable from Alnylam Pharmaceuticals, Inc., 300 Third Street, Cambridge MA 02142, USA.DsiRNA and TriFECTa are trademarks of IDT. IDT is exclusively licensed under patents owned by the City of Hope and IDT to make andsell DsiRNA products for use in research and development. Use of DsiRNA products or technology in humans or for human or veterinarydiagnostic, prophylactic or therapeutic purposes requires a separate license from City of Hope Medical Center.Chimeric Antisense Oligos. In addition to an exclusive license under University of Iowa Research Foundation patents, IDT is the soleoligonucleotide supplier licensed under several patents owned or presently controlled by ISIS Pharmaceuticals, Inc. to manufacture and sellChimeric Antisense Oligonucleotides to universities and other non-profit institutions for research purposes. Certain design, sequence, scaleand use restrictions may apply. IDT reserves the unlimited right to refuse any order for Chimeric Antisense Oligos.DNA-Directed RNAi. Use of IDT oligos for DNA-Directed RNAi research is protected by patents co-owned by Benitec Australia Ltd., andlicensed exclusively to Promega Corporation in the human field (excluding human therapeutics). For information regarding licensing ofddRNAi technology, please visit www.promega.com/licensing. For licensing any human therapeutic purpose, contact Benitec Australia Ltdat info@benitec.com.Locked Nucleic Acids (LNAs). IDT is licensed under patents and patent applications assigned to Exiqon A/S to sell oligonucleotidesincorporating LNAs for research purposes only. Resale of LNA-oligos and their use in humans or in therapeutic applications are allprohibited.TriFECTin is a trademark of IDT.Other LicensesAcrydite. IDT is licensed under U.S. Patent Number 6,180,770, and 5,932,711 to sell oligos incorporating Acrydite modifications foruse solely in the purchaser’s own life sciences research and development activities. Resale, or use of this product in clinical or diagnosticapplications, or other commercial applications, requires separate license from Matrix Technologies, Inc. Acrydite is a trademark of MatrixTechnologies, Inc.Digoxigenin is licensed by Roche Diagnostics GmbH. The use of digoxigenin technology to label nucleic acids is licensed under patents (EP0 324 474, US 5,344,757, US 5,702,888, US 5,354,657, JP 1999884 and HK 1169) owned by Roche Diagnostics GmbH. For further informationon products to label and detect digoxigenin-modified nucleic acids refer to www.rocheapplied-science.com/dig/Iso dC and Iso dG and Plexor. IDT is licensed by EraGen Biosciences, Inc., under U.S. Patent Numbers 5,432,272; 6,001,983; 6,037,120; and6,140,496, and other pending applications to sell oligonucleotides for non-commercial, research use in the life sciences research market.Plexor is a trademark of Promega Corporation.RNaseAlert compositions and methods are protected under U.S. Patent No. 6,773,885 and other pending IDT patent(s). RNaseAlert is atrademark of Ambion, Inc.Rapid HPLC, Express DLP, SameDay®, HotPlates, Ultramer, miniGenes, miRFire , ReadyMade Primers, OligoCard,I-Linker and DNaseAlert are trademarks of Integrated DNA Technologies, Inc.StarFire® is a registered trademark of IDT, and its compositions and methods are protected under pending IDT patent(s).SAGE is a trademark of Genzyme Molecular Oncology. Purchase of IDT oligos does not confer to customer a license to perform SAGEmethods. For more information, contact Genzyme or Johns Hopkins University.Uni-Link is a trademark of Clontech Laboratories, Inc.©2008 Integrated DNA Technologies www.idtdna.com83

INTEGRATEDDNATECHNOLOGIESPRODUCTS©2008 Integrated DNA Technologies www.idtdna.com85

INTEGRATEDDNATECHNOLOGIESAppendixPRODUCTSAPPENDIXStandard IDT Ordering Base Codes• Standard Bases: A, C, G, T• RNA expressed as ‘r_’ (for example rA, rU)• 2’ O-Methyl RNA bases are entered as ‘m_’.• Locked nucleic acid bases (LNA) are entered as ‘+_’.• Phosphorothioated DNA bases are entered as ‘_*’• Phosphorothioated RNA bases are entered as ‘r_*’.• Phosphorothioated 2’-O-Methyl RNA bases are entered as ‘m_*’.• Phosphorothioated LNA bases are entered as ‘+_*’.Please note that rT and mT are not valid, and must be expressed as rU and mU instead.Mixed Base DefinitionsMixed bases, which are also known as degenerate or wobble bases, can be introduced at any position in an oligomer sequence. Forexample, mixed-base composition at a single position can include all 4 bases (“N”), C or T bases (“Y”), A or G bases (“R”), etc. Since there are11 different possible combinations of 2, 3 or 4 bases, a universal nomenclature has been established that must be used when specifyingnucleic acid content at a mixed-base site.IUB Codes:SymbolRYMKSWHBVDNMixed BasesA, GC, TA, CG, TC, GA, TA, C, TC, G, TA, C, GA, G, TA, C, G, TModification ListCategory Modification Sequence Code Molecular Weight Ab maxEm maxAttachment Chemistry/Linkers 3’ Amino Modifier /3AmM/ 179.23’ Biotin /3Bio/ 437.53’ Biotin-TEG /3BioTEG/ 569.63’ Cholesteryl-TEG /3CholTEG/ 756.03’ Digoxigenin NHS Ester /3DigoxN/ 722.93’ Thiol Modifier C3 S-S (Disulfide) /3ThioMC3-D/ 244.35’ Acrydite /5Acryd/ 247.25’ Amino Modifier C12 /5AmMC12/ 263.35’ Amino Modifier C6 /5AmMC6/ 179.25’ Amino Modifier C6 dT /5AmMC6T/ 458.45’ Biotin /5Bio/ 405.45’ Biotin dT /5BiodT/ 684.75’ Biotin-TEG /5BioTEG/ 569.65’ Digoxigenin NHS Ester /5DigN/ 722.9©2008 Integrated DNA Technologies 86 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSAPPENDIXCategory Modification Sequence Code Molecular Weight Ab maxEm maxAttachment Chemistry/Linkers 5’ Dithiol /5DTPA/ 214.25’ Dual Biotin /52-Bio/ 871.05’ I-Linker /5ILink12/ 208.25’ PC Biotin /5PCBio/ 597.65’ Thiol Modifier C6 S-S (Disulfide) /5ThioMC6-D/ 328.45’ Uni-Link Amino Modifier /5UniAmM/ 209.2Int Amino Modifier C6 dT /iAmMC6T/ 458.4Int Biotin dT /iBiodT/ 684.7Int Dithiol /iDTPA/ 214.2Int Uni-Link Amino Modifier /iUniAmM/ 209.2Quenchers 3’ Black Hole Quencher® 1 /3BHQ_1/ 554.5 5343’ Black Hole Quencher® 2 /3BHQ_2/ 556.5 5783’ Dabcyl /3Dab/ 757.8 4783’ Iowa Black® FQ /3IABlkFQ/ 822.7 5313’ Iowa Black® RQ-Sp /3IAbRQSp/ 678.4 6565’ Iowa Black® FQ /5IAbFQ/ 426.4 5315’ Iowa Black® RQ /5IAbRQ/ 420.4 656Fluorophores 3’ 6-FAM /36-FAM/ 569.5 495 5203’ Alexa Fluor® 488 NHS Ester /3Alexa488N/ 695.6 492 5173’ Alexa Fluor® 532 NHS Ester /3Alexa532N/ 787.8 527 5533’ Alexa Fluor® 546 NHS Ester /3Alexa546N/ 1121.5 555 5713’ Alexa Fluor® 594 NHS Ester /3Alexa594N/ 883.9 584 6163’ Alexa Fluor® 647 NHS Ester /3Alexa647N/ 1020.2 650 6703’ Alexa Fluor® 660 NHS Ester /3Alexa660N/ 941.7 661 6913’ Alexa Fluor® 750 NHS Ester /3Alexa750N/ 1047.2 753 7753’ Bodipy® 630/650-X NHS Ester /3Bod650-XN/ 724.6 638 6533’ Cy3 /3Cy3Sp/ 644.6 550 5643’ Cy5.5 /3Cy55Sp/ 770.8 685 7063’ Cy5 /3Cy5Sp/ 670.7 648 6683’ JOE NHS Ester /3JoeN/ 666.4 529 5553’ MAX 557 NHS Ester /3MAXN/ 619.7 524 5573’ Rhodamine Green-X NHS Ester /3RhoGn-XN/ 648.7 504 5313’ Rhodamine Red-X NHS Ester /3RhoRd-XN/ 833.0 574 5943’ ROX NHS Ester /3RoxN/ 695.8 588 6083’ TAMRA NHS Ester /36-TAMTSp/ 591.9 559 5833’ TAMRA /36-TAMSp/ 1008.0 559 5833’ Texas Red®-X NHS Ester /3TexRed-XN/ 881.5 598 6175’ 6-FAM /56-FAM/ 537.6 495 5205’ Alexa Fluor® 488 NHS Ester /5Alex488N/ 695.8 492 5175’ Alexa Fluor® 532 NHS Ester /5Alex532N/ 787.5 527 553©2008 Integrated DNA Technologies www.idtdna.com87

INTEGRATEDDNATECHNOLOGIESPRODUCTSAPPENDIXCategory Modification Sequence Code Molecular Weight Ab maxEm maxFluorophores 5’ Alexa Fluor® 546 NHS Ester /5Alex546N/ 1121.9 555 5715’ Alexa Fluor® 594 NHS Ester /5Alex594N/ 883.2 584 6165’ Alexa Fluor® 647 NHS Ester /5Alex647N/ 1020.7 650 6705’ Alexa Fluor® 660 NHS Ester /5Alex660N/ 941.2 661 6915’ Alexa Fluor ®750 NHS Ester /5Alex750N/ 1047.6 753 7755’ Bodipy® 630/650-X NHS Ester /5Bo650-XN/ 724.6 638 6535’ Cy3 /5Cy3/ 506.6 550 5645’ Cy5 /5Cy5/ 532.6 648 6685’ Cy5.5 /5Cy55/ 632.7 685 7065’ Dy 750 NHS Ester /5Dy750N/ 875.1 747 7765’ Fluorescein dT /5FluorT/ 816.7 495 5205’ HEX /5HEX/ 744.1 538 5555’ IRDYE 700 /5IRD700/ 753.9 684 7025’ IRDYE 800 /5IRD800/ 862.1 791 8095’ IRDYE 800CW /5IRD800CWN/ 1099.1 774 7895’ JOE NHS Ester /56-JOEN/ 666.4 529 5555’ MAX NHS Ester /5MAXN/ 619.7 524 5575’ Rhodamine Green-X NHS Ester /5RhoG-XN/ 648.7 504 5315’ Rhodamine Red-X NHS Ester /5RhoR-XN/ 833.0 574 5945’ ROX NHS Ester /56-ROXN/ 695.8 588 6085’ TAMRA NHS Ester /56-TAMN/ 591.6 559 5835’ TET /5TET/ 675.2 522 5395’ TEX 615 /5TEX615/ 966.1 598 6175’ Texas Red®-X NHS Ester /5TexRd-XN/ 881.0 598 6175’ TYE 563 /5TYE563/ 490.6 549 5635’ TYE 665 /5TYE665/ 516.6 645 6655’ TYE 705 /5TYE705/ 616.7 686 7055’ WellRED D2 /5D2/ 640.5 763 7785’ WellRED D3 /5D3/ 644.2 683 7015’ WellRED D4 /5D4/ 544.2 648 666Int Cy3 /iCy3/ 506.6 550 564Int Cy5 /iCy5/ 532.6 648 668Int Fluorescein dT /iFluorT/ 816.7 495 520Int TAMRA NHS Ester /i6-TAMN/ 870.9 559 583Modified Bases 3’ deoxyInosine /3deoxyI/ 314.23’ deoxyUridine /3deoxyU/ 290.23’ Dideoxy-C /3ddC/ 273.23’ Inverted dT /3InvdT/ 304.23’ 5-Methyl dC /3Me-dc/ 303.23’ Ribo A /3RiboA/ 329.2©2008 Integrated DNA Technologies 88 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSAPPENDIXCategory Modification Sequence Code Molecular Weight Ab maxEm maxModified Bases 3’ Ribo C /3RiboC/ 305.23’ Ribo G /3RiboG/ 345.23’ Ribo U /3RiboU/ 306.25’ 2, 6-Diaminopurine /5AmdA/ 328.25’ 2-Aminopurine /52AmPr/ 313.25’ 5-Bromo dU /55Br-dU/ 369.15’ 5-Methyl dC /5Me-dC/ 303.25’ 5-Nitroindole /55NitInd/ 340.25’ deoxyInosine /5deoxyI/ 314.25’ deoxyUridine /5deoxyU/ 290.25’ isodC /5Me-isodC/ 303.25’ isodG /5isodG/ 329.25’ Trimer-20 /5TriMix20/ 926.9Int 2, 6-Diaminopurine /i6diPr/ 328.2Int 2-Aminopurine /i2AmPr/ 313.2Int 5-Bromo dU /i5Br-dU/ 369.1Int 5-Methyl dC /iMe-dC/ 303.2Int 5-Nitroindole /i5NitInd/ 340.2Int deoxyInosine /ideoxyI/ 314.2Int deoxyUridine /ideoxyU/ 290.2Int isodC /iMe-isodC/ 303.2Int isodG /iisodG/ 329.2Int Trimer-20 /iTriMix20/ 926.9Phosphorylation 3’ Phosphorylation /3Phos/ 79.95’ Phosphorylation /5Phos/ 79.9Spacers 3’ C3 Spacer /3SpC3/ 138.13’ Hexanediol /3C6/ 180.15’ C3 Spacer /5SpC3/ 138.15’ dSpacer /5dSp/ 180.15’ PC Spacer /5SpPC/ 344.35’ Spacer 18 /5Sp18/ 344.35’ Spacer 9 /5Sp9/ 212.1Int C3 Spacer /iSpC3/ 138.1Int dSpacer /idSp/ 180.1Int PC Spacer /iSpPC/ 344.3Int Spacer 18 /iSp18/ 344.3Int Spacer 9 /iSp9/ 212.1©2008 Integrated DNA Technologies www.idtdna.com89

INTEGRATEDDNATECHNOLOGIESPRODUCTSAPPENDIXMelting TemperatureMelting temperature (T m ) is the temperature at which an oligonucleotide duplex is 50% in single-stranded form and 50% in doublestrandedform. IDT’s online Oligo Analyzer estimates T m from the nearest-neighbor two-state model, which is applicable to short DNAduplexes,ΔH°T m (°C) = - 273.15ΔS° + R 1n[oligo]where ΔH° (enthalpy) and ΔS° (entropy) are the melting parameters calculated from the sequence and the published nearest neighborthermodynamic parameters, R is the ideal gas constant (1.987 cal. K-1mole-1), [oligo] is the molar concentration of an oligonucleotide,and the constant of -273.15 converts temperature from Kelvin to degrees of Celsius. The most accurate, nearest-neighbor parameters wereobtained from the following publications for DNA/DNA base pairs (Allawi, H., SantaLucia, J.,Jr., Biochemistry, 36, 10581), RNA/DNA base pairs(Sugimoto, N. et al., Biochemistry, 34, 11211), RNA/RNA base pairs (Xia, T. et al., Biochemistry, 37, 14719), and LNA/DNA base pairs (McTigue,P.M. et al., Biochemistry, 43, 5388).T m calculations for oligonucleotides containing non-consecutive, isolated LNA nucleotides hybridized to a DNA template utilize LNAenergetic parameters from McTigue, P.M. et al. All other LNA nucleotides (i.e., consecutive LNA bases on a DNA template or any LNAnucleotides on an RNA template) are approximated because nearest-neighbor parameters for these types of base pairs have yet to bepublished. Applications requiring extremely accurate predictions of the T m for LNA-containing oligonucleotides should be reviewed with atechnical support representative from Exiqon, Inc. (www.exiqon.com)T m depends on monovalent salt concentration ([Na + ]) of the solvent. The linear T m correction has been typically used in the past. Scientistsat IDT performed a large set of UV melting experiments (~3000 measurements) on about 100 short DNA duplexes in a variety of sodiumbuffers and determined that this linear function is inaccurate. OligoAnalyzer employs the improved quadratic T m salt correction function(Owczarzy,R. et al., Biochemistry, 43, 3537),1 1= + (4.29f(GC) - 3.95) x 10 -5 In[Na + ] + 9.40 x 10 -6 In 2 [Na + ]T m (Na + ) T m (1MNa + )where f(GC) is the fraction of GC base pairs.ModificationsModified oligonucleotides also need special consideration to ensure accuracy when calculating molecular weight, extinction coefficient(ε 260), and melting temperature (T m ). Modifications can change oligo mass, and sometimes alter UV absorbance or T m .Examples:Molecular Weight of an oligo containing an NHS Ester modification (such as 5’ Texas Red® NHS Ester) is a sum of molecular weights of nativeoligo, the fluorophore group, and an amino modifier.Extinction Coefficients (ε 260) of modifications, such as fluorophores and base analogs, are usually added to the ε 260of the nativeoligonucleotide. Calculations for base analogs (e.g., 5-bromo dC) and conjugated bases (e.g., fluorescein dT) are more complex. First, ε 260ofan oligo containing the unmodified base is calculated. An adjustment is made later for the contribution of the modification (fluorophore).Unfortunately, ε 260values are not known for all modifications.Melting Temperature (T m ) can be changed when nucleotides are modified or additional chemical groups are added. For example,introduction of phosphorothioated residues decreases T m significantly. In contrast, LNA nucleotides increase T m . Unfortunately, nearestneighbor thermodynamic parameters have not been determined for a majority of these modifications. Therefore, no accurate parametersand physical models exist that would allow us to calculate melting temperatures for many modified oligonucleotides. Internal basemodifications (e.g., biotin-dT), could collide and interfere with the duplex structure. Because the quantitative effects of interferenceare unknown, they are neglected. If thermodynamic parameters are not available, OligoAnalyzer reports T m values for the unmodifiedsequence. Melting temperature changes caused by modifications may be approximated from the published literature. If needed, a preciseT m can be measured experimentally.©2008 Integrated DNA Technologies 90 www.idtdna.com

INTEGRATEDDNATECHNOLOGIESPRODUCTSAPPENDIXMolar Extinction CoefficientOptical absorbance at 260 nm is routinely used to measure the concentration of nucleic acids present in a solution. Approximate conversionfactors estimate that duplex DNA is about 50 µg/OD 260, single-stranded RNA is approximately 40 µg/OD 260, and single-stranded DNA isapproximately 33 µg/OD 260. While this is true for randomized sequences, these conversion factors are less accurate for short oligonucleotidesand repeating sequences. Since the absorbance of each base is different, base composition and sequence context influence the absorbance.For example, 1.0 OD 260of d(CCCCCCCCCCCC) (homopolymeric deoxycytidine) has a mass of 39 µg while 1.0 OD 260of d(AAAAAAAAAAAA)(homopolymeric deoxyadenosine) has a mass of 25 µg. The extinction coefficient (ε 260) describes the relationship between concentrationand UV absorbance and can be calculated for any sequence. Greatest accuracy is therefore achieved when the exact value of ε 260iscalculated for each oligo. Further, it is possible to take into account the presence of modified groups, such as fluorescent dyes, which havesignificant absorbance at 260 nm.The molar extinction coefficient is a physical constant that is unique for each sequence and describes the amount of absorbance at 260 nm(A 260) of 1 mole/L DNA solution measured in 1 cm path-length cuvette. This definition is derived from the Beer-Lambert law,A = log(I O/ I) = ε * c * pwhere A is the absorbance, I Oand I are, respectively, the intensities of incident and transmitted light, c is the molar concentration of anoligonucleotide (mole/L), p is the length of the light path through the sample (cm), and ε is the molecule molar extinction coefficient (L/(mole .cm)). The ε 260value of an oligonucleotide is calculated from the following equation (Cantor,C.R. et al., Biopolymers, 9, 1059-1077.,Cavaluzzi,M.J. and Borer,P.N. Nucleic Acids Res., 32, e13),ε 260= 2x (Σε Nearest-Neighbor ) - Σε Individual + Σε ModificationN-1 N-1 N1 2 1where ε Nearest-Neighboris the nearest neighbor coefficient for a pair of bases, ε Individualis the coefficient for an individual base, and N is the lengthof the oligonucleotide.Molecular Weight (Anhydrous)Molecular weight (MW) is the sum of the atomic masses of the constituent atoms for 1 nmole of oligonucleotide. The anhydrous molecularweight represents the pure oligo free of any of the counter ions or water molecules that are normally weakly bound to an oligo aftersynthesis. This calculation gives the molecular weight as measured by mass spectrometry.Molecular weight of an oligomer is a sum of the weights of individual bases and chemical modifications. Oligos are typically synthesizedwithout a 5’-phosphate group, which must be subtracted.where PO 2H = 63.980 and H 2= 2.016Anhydrous MW = Σ Individual Base MW+ Σ Individual Mod MW- PO 2H + H 2Molecular weights of DNA bases:dA 313.2dC 289.2dG 329.2dT 304.2dU 290.2dI 314.2RNA bases: The molecular weight of an RNA nucleotide is the weight of a DNA nucleotide + 15.999, accounting for the additional oxygenatom present (Example: rA is dA (313.209) + 15.999 = 329.208). When determining the weight of uracil (rU), start with dU and not thymine(dT).2’-O-Methyl bases: The molecular weight of a 2’-O-Methyl RNA nucleotide is the weight of a DNA nucleotide + 30.026, accounting for theadditional methoxy group (-OCH 3) present (For example: mA is dA (313.209) + 30.026 = 343.235). When determining the weight of uracil(mU), start with dU and not thymine (dT).©2008 Integrated DNA Technologies www.idtdna.com91

INTEGRATEDDNATECHNOLOGIESPRODUCTSAPPENDIXMolecular Weight (Anhydrous) continuedLNA bases: The molecular weight of an LNA nucleotide is the weight of a DNA nucleotide + 28.011, accounting for the bridging oxygen andcarbon from the 2’ carbon to the 4’ carbon (-OCH 2-) present (For example: +A is dA (313.209) + 28.011 = 341.220). The exception is LNA C,which contains an additional methyl group off of the 5-carbon (14.026).Phosphorothioated bases: The molecular weight of a phosphorothioate nucleotide is the weight of a nucleotide (DNA, RNA, 2’-O-Methyl,LNA) + 16.061, accounting for the substitution of one sulfur atom for a non-bridging oxygen atom in the phosphodiester backbone (Forexample: A* is A (313.209) + 16.061 = 329.270). Phosphorothioate modification refers to substitutions affecting the internucleoside linkagesand does not involve the free 3’- or 5’- ends. Thus a 20-mer phosphorothioate oligonucleotide has 19 phosphorothioate linkages.nmole/OD 260The amount of oligonucleotide in nanomoles that, when dissolved in 1 mL volume, results in 1 unit of absorbance at 260 nm with a standard1 cm path-length cuvette. nmole/OD 260is calculated from an oligonucleotide’s molar extinction coefficient. OD 260is calculated from thefollowing equation,OD 260= (A 260* V) / pwhere A 260is the absorbance at 260 nm, V is the solution volume in mL, and p is the length of the light path through the sample (cm). Thus,OD 260has the units mL/cm. Starting from the oligo molar extinction coefficient, ε 260,ε 260= L/(mol . cm) = 10 3 mL/(mol . cm)Since OD 260has the units of mL/cm, the equation can be written as,10 3 OD 260/mol = 10 3 OD 260/ 10 9 nmol = OD 260/ 10 -6 nmolCombination of both equations yields,ε 260= OD 260/ 10 -6 nmoland this can be rearranged as,nmole/OD 260= 10 6 / ε 260µg/OD 260The amount of oligonucleotide in micrograms that, when dissolved in 1 mL volume, results in 1 unit of absorbance at 260 nm with astandard 1 cm path-length cuvette. µg/OD 260is derived using molecular weight and nmole/OD 260values:µg/OD 260= nmole/OD 260* molecular weight (g/mol) * 10 -3The definition of OD 260can be found within the nmole/OD 260definition above.©2008 Integrated DNA Technologies 92 www.idtdna.com