Rapid and specific identification of four Agrobacterium ... - Cost 873

More documents

Recommendations

Info

ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479 473Table 1. (continued )Strain Source and location Fragments produced in multiplex PCR with primersUF+B1R+B2R+AvR+ArRBiovar 1(184 bp)Biovar 2(1066 bp)A.vitis(478 bp)A. rubi(1006 bp)PCR-RFLP ofUF+B2Rproduct aAgrobacteriumunclassifiedCh11, Ch12Chrysanthemum;ntPoland47/7 Peach; Hungary + ntAllorhizobium undicolaLMG 11875Bradyrhizobiumjaponicum 94pMesorhizobium lotiLMG 6125PhyllobacteriummyrsinacearumLMG 2P. rubiacearumLMG 1Rhizobium etliUSDA 9032Neptunia natans;SenegalSoybean; ?Lotus; New ZealandArdisia crispa;Germany+ 3Pavettantzimmermannia;GermanyBean; Mexico + 3R. galegaeLMG 6214 Goat’s rue; Finland ntLMG 6215Goat’s rue; formerUSSR.ntR. huautlense SO2 Sesbania herbacea;MexicoR. leguminosarumbv. viciae PRE Pea; Holand ntbv. trifoliiLMG 8820Trifolium; ? + 3R. tropici ntLMG 9503 Bean; Columbia + 3LMG 9517 Bean; Brazil ntUT 30011O Bean; Mexico + 3Sinorhizobium frediiLMG 6217Soybean; China + 3S. melilotia18 Alfalfa; Poland + 3LMG 6133 Alfalfa; ? + 3S. saheli LMG 7837 Sesbania cannabina;+ 3SenegalS. teranga LMG 7834 Acacia laeta; Senegal + 3Arthrobacter ramosus Unknown; Poland ntArthrobacterUnknown; PolandntglobiformisArthrobacter pascens Unknown; Poland ntErwinia amylovora 659 Apple; Poland ntErwinia herbicola 801 Chrysanthemum;Polandntntntntnt
474ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479Table 1. (continued )Strain Source and location Fragments produced in multiplex PCR with primersUF+B1R+B2R+AvR+ArRBiovar 1(184 bp)Biovar 2(1066 bp)A.vitis(478 bp)A. rubi(1006 bp)PCR-RFLP ofUF+B2Rproduct aPseudomonas syringaepv. tomatoXanthomonas arboricolapv. pruniUnknown; PolandUnknown; Unknownntnta 2, two DNA fragments of 1006 bp and 60 bp were obtained as a result of RFLP with Alw26I; 3, three DNA fragments of 830 bp, 167 bp and 60 bpwere obtained; nt, not tested.Table 2.Characteristic of phenotypic features of some Agrobacterium strains testedStrain 3-ketolactoseproductionCitrateutilizationL-tyrosineutilizationFerricammoniumcitrateAcid fromerythritolNaCltolerance(%)Oxidase cAgrobacterium B6 T (bv.1) + + 4 +Agrobacterium Ch 3, 131a/b + + 3 +Agrobacterium Ch-6, 137, 6, + + 4 +CFBP 2519Agrobacterium 0, 39/7, 7/1 + 4 +Agrobacterium LMG 150 T+ + + 1(bv.2)Agrobacterium 400 + + + 1 +/Agrobacterium 77 + + + 1A. vitis LMG 8750 T + 3 +A. rubi LMG 156 T nt 4 +Agrobacterium Ch-11 5 +Agrobacterium Ch-12 3 +/Agrobacterium 47/7 + + 3 +T , type strain; nt, not tested.Table 3.Agrobacterium species/biovar-specific primers based on 23S rDNA sequencesName of primer Target position a Sequence (5 0 –3 0 )UF f 171–193 GTAAGAAGCGAACGCAGGGAACTB1R r 338–360 GACAATGACTGTTCTACGCGTAAB2R r 1207–1230 TCCGATACCTCCAGGGCCCCTCACAAvR r 640–662 AACTAACTCAATCGCGCTATTAACArR r 1150–1173 AAAACAGCCACTACGACTGTCTTf, forward; r, reverse.a E. coli position numbering [1].Rhizobiaceae which produced a 1066 bp amplificationproduct with primers UF+B2R (Table 1),the restriction analysis of this product was applied.On the basis of computer analysis, endonucleaseAlw26I was chosen as the most appropriate for thispurpose. For each reaction 50 ng of PCR product wasused. Restriction fragments were separated in 2%agarose gels.
Page 1 and 2: ARTICLE IN PRESSSystematic and Appl
Page 3: 472Table 1.Strains used in this stu
Page 7 and 8: 476ARTICLE IN PRESSJ. Pu"awska et a
Page 9 and 10: 478ARTICLE IN PRESSJ. Pu"awska et a

Rapid and specific identification of four Agrobacterium ... - Cost 873

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?