Rapid and specific identification of four Agrobacterium ... - Cost 873

ARTICLE IN PRESSSystematic and Applied Microbiology 29 (2006) 470–479www.elsevier.de/syapmRapid and specific identification of four Agrobacterium speciesand biovars using multiplex PCRJoanna Pu"awska a, , Anne Willems b , Piotr Sobiczewski aa Research Institute of Pomology and Floriculture, ul. Pomologiczna 18, 96-100 Skierniewice, Polandb Laboratory of Microbiology, Department of Biochemistry, Physiology and Microbiology, Ghent University, Gent, BelgiumAbstractOn the basis of 23S rRNA gene sequences, 1 universal forward and 4 taxon (species/biovar)-specific reverse primerswere designed for multiplex PCR to aid in identification and differentiation of Agrobacterium rubi, Agrobacterium vitisand Agrobacterium biovars 1 and 2. In reactions with DNA of 119 bacterial strains belonging to: Agrobacterium,Allorhizobium, Mesorhizobium, Rhizobium, Sinorhizobium and Phyllobacterium, as well as phytopathogenic bacteriarepresenting various genera, the primers developed for identification of A. vitis, A. rubi or Agrobacterium biovar 1amplified only DNA of strains belonging to these taxa, producing fragments of the expected sizes: 478, 1006 and184 bp, respectively. However, in the case of the primer developed for identification of Agrobacterium biovar 2, thecharacteristic 1066 bp PCR product was obtained not only with DNA of this biovar, but also with DNA of 3 atypicalbiovar 1 strains and some rhizobial strains. Differentiation between Agrobacterium biovar 2 and the other strains waspossible using the restriction analysis of this product with endonuclease Alw26I. The method developed is an excellenttool for rapid classification of these 4 taxa of Agrobacterium.r 2005 Elsevier GmbH. All rights reserved.Keywords: Agrobacterium; Biovar/species identification; Crown gall; Hairy root; Multiplex-PCRIntroductionThe genus Agrobacterium includes both phytopathogenic(tumour- or hairy-roots inducing) and nonpathogenicsoil-borne bacteria. The taxonomy of bacteriabelonging to Agrobacterium has been unclear for a longtime. For many years, classification of species within thisgenus was based mostly on their phytopathogenicproperties. Five species were distinguished: A. radiobacter,harbouring the non-pathogenic bacteria, A.tumefaciens, with bacteria inducing crown gall, A. rubi– bacteria causing crown gall on Rubus, A. vitis, bacteria Corresponding author. Tel.: +48 46 834 53 66;fax: +48 46 833 32 28.E-mail address: jpulaw@insad.pl (J. Pu"awska).producing crown gall on Vitis vinifera, andA. rhizogenes,harbouring bacteria inducing hairy-roots. However,phytopathogenic abilities of those bacteria are encodedmostly by genes located on conjugal plasmids, transferablebetween strains [12]. Consequently, in the phytopathology-basedtaxonomy, the species status of aparticular Agrobacterium strain might change becauseof the loss or acquisition of the tumour- or root-inducingplasmid. An alternative classification divides bacteriabelonging to A. tumefaciens, A. rhizogenes and A. radiobacterinto 3 biovars: 1, 2 and 3 [10]. This system, basedon biochemical features encoded by chromosomal genesdisagreed with the traditional species classification.However, the results of various taxonomic studies basedon conventional [8,25], chemotaxonomic [11,27,31],numerical [13] and DNA-based methods such as0723-2020/$ - see front matter r 2005 Elsevier GmbH. All rights reserved.doi:10.1016/j.syapm.2005.11.002

ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479 471DNA:DNA hybridization [5], sequenceanalysisof16SrDNA [26,33] and 23S rDNA [23] indicate that biovaridentity of Agrobacterium is a reliable taxonomic trait.These studies also showed that the genus Agrobacteriumis closely related and even entwined with bacteriabelonging to Rhizobium, Sinorhizobium and Mesorhizobium.Based on these results several proposals ofnomenclature changes within Agrobacterium were presented[9,26] including the latest one suggesting rejectionof this genus and incorporation of agrobacteria toRhizobium [34]. However, this proposal is not generallyaccepted [7] and therefore, we prefer to use theAgrobacterium nomenclature instead of the Rhizobium.Until now, no rapid, PCR-based system for identificationof taxa within the genus Agrobacterium has beenavailable to phytopathologists. However, such a methodwould be very useful in classification of isolated crowngall and hairy roots causal agents to biovar or species,because some species, e.g. A. rubi and A. vitis show hostspecialization. This kind of tool would be also helpful inecological studies on soil-borne bacteria. At present,classification of agrobacteria is performed most often onthe basis of several biochemical tests, which aregenerally time-consuming and labour intensive [18],even when modified into a microtiter system [2].The aim of our study was to develop a multiplex PCRsystem, based on the differences in sequences of 23SrRNA gene, for fast identification of Agrobacteriumbiovar 1, biovar 2, A. rubi, andA. vitis.1 mM EDTA pH 8.0). To lyse the cells, 200 ml of buffer(0.25% SDS, 0.2 M NaOH) was added and then themixture was incubated at 70 1C for 15 min. Next 200 mlof 5 M NaCl solution was added, the mixture wascarefully mixed and incubated on ice for 15 min.After centrifugation (10 min at 15 000g) DNA wasprecipitated with 2 volumes of cold EtOH at roomtemperature. The pellet was washed with 70% EtOH,dried and dissolved in 500 ml of 10 mM Tris-HCl buffer,pH 8.2.Primer designFive primers were designed on the basis of thenucleotide sequence of the 23S rDNA determined for12 Agrobacterium, 2 Sinorhizobium and 4 Rhizobiumstrains [23] and 23S rDNA sequences of related bacteriaobtained from GenBank (U45329, U28505, L39095,X88894, Z35330, X71840, X87283, X71839). One ofthem, UF, is a universal forward primer complementaryto 23S rDNA sequences of all agrobacteria. Four othersare reverse primers, each complementary to DNA of adifferent species/biovar of Agrobacterium: B1R – toDNA of biovar 1 strains, B2R – to biovar 2 strains, AvR–toA. vitis (ex biovar 3 strains) and ArR – to A. rubi(Table 3). All primers were checked for homology toother sequences in the GenBank and EMBL databasesusing the BLAST N program.Specificity of developed primersMaterials and methodsBacterial strainsAll bacterial strains used in this study are presented inTable 1. The Agrobacterium, Erwinia, Pseudomonas andXanthomonas strains were grown on King’s B medium[14], strains of Allorhizobium, Mesorhizobium, Rhizobiumand Sinorhizobium – on mannitol–yeast extractmedium (79 CA) [32] and Phyllobacterium – on nutrientagar with beef extract (Oxoid CM3). For the Agrobacteriumstrains with unknown identity, the biovar orspecies status was assessed on the basis of a set ofbiochemical tests: 3-ketolactose production, citrate andL-tyrosine utilization, growth and pigmentation in ferricammonium citrate broth, acid from erythritol andoxidase reaction [18] (Table 2).Total bacterial DNA preparationsTotal bacterial DNA was extracted using a methoddescribed by Sambrook et al. [24] in own modification.For DNA isolation bacteria taken from 1 colony wereresuspended in 100 ml of TE buffer (10 mM Tris-HCl,DNA of each bacterial strain (Table 1) was tested inseparate PCRs with the following sets of primers: (i)UF+B1R, (ii) UF+B2R, (iii) UF+AvR, (iv)UF+ArR and in a multiplex PCR with primersUF+B1R+B2R+AvR+ArR. DNA amplificationwas performed in total volume of 15 ml in ThermalCycler Trio – Thermoblock (Biometra, Germany). Allreactions were performed in PCR buffer (10 mM Tris-HCl, pH 9.0; 50 mM KCl; 0.1% Triton X-100) with1.5 mM MgCl 2 , 200 mM of each dNTP, 1 mM ofeachprimer and 1 U of thermostable DNA polymerase(Promega, Madison, USA). The optimal amplificationconditions were determined experimentally: initial denaturationat 94 1C for 1 min, followed by 35 cycles ofdenaturation at 94 1C for 1 min, annealing at 67 1C for1 min, extension at 72 1C for 1.5 min and a finalextension step for 10 min. PCR products were analyzedby electrophoresis through 2% agarose gel. EachAgrobacterium strain was tested at least twice.Restriction analysisFor differentiation between strains of Agrobacteriumbiovar 2 and other representatives of family

472Table 1.Strains used in this studyARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479Strain Source and location Fragments produced in multiplex PCR with primersUF+B1R+B2R+AvR+ArRBiovar 1(184 bp)Biovar 2(1066 bp)A.vitis(478 bp)A. rubi(1006 bp)PCR-RFLP ofUF+B2Rproduct aBiovar 1g-114-3-2 Unknown; Israel + nt32/1 Apple; Hungary + nt7/1 Raspberry; Hungary + + 365 Raspberry; Hungary + nt39/7 Plum; Hungary + + 3CFBP 2516, CFBP Poplar; France + nt2519,CFBP 2177B6 Tomato; France + ntC58 Sweet cherry; USA + ntT37 Unknown; France + ntACH5 Unknown; Belgium + ntAT4, 137 Cherry; Poland + nt6 Cherry; Hungary + ntCh3, Ch6Chrysanthemum; + ntPoland13B Unknown; Israel + nt0 Grapevine; Hungary + + 3131a/b Apple; Poland + ntBiovar 2K84 Peach; Australia + 2LMG 150 Apple; Unknown + 2K27 Poplar; Australia + 215b/94, 21/94, 307a, Apple; Poland + 258031a/b, 32a, 32b, 39, Cherry; Poland + 240, 88, 101, 107, 125,126, 129, 133, 301,387, 389, 392, 40046, 182, 192, 262 Pear; Poland + 2122, 568 Plum; Poland + 2103, 104 Peach; Poland + 260, 67, 69, 71, 77, 81, Sweet cherry; Poland + 283, 84, 89, 221b, 36530/2, 9 Peach; Hungary + 28/1, 51, 9/2 Raspberry; Hungary + 2P-Ag- 1, 2, 3, 4, 6 Pear; Japan + 2Pch-Ag- 2, 3, 4, 5, 6 Peach; Japan + 2A. vitisLMG 8750 Grapevine; Australia + ntAg162 Grapevine; Grecja + nt2/3 S5R, AB3, AB4, Grapevine; Hungary + ntTm4g-114-5-IV-1 Grapevine; Israel + ntCG49 Grapevine; USA + ntA. rubiLMG 156 Boysenberry; USA + ntLMG 159 Black raspberry; USA + ntLMG 294Eunonymus sp.;+ ntFranceA. larrymooreiLMG 21410Ficus benjaminant

ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479 473Table 1. (continued )Strain Source and location Fragments produced in multiplex PCR with primersUF+B1R+B2R+AvR+ArRBiovar 1(184 bp)Biovar 2(1066 bp)A.vitis(478 bp)A. rubi(1006 bp)PCR-RFLP ofUF+B2Rproduct aAgrobacteriumunclassifiedCh11, Ch12Chrysanthemum;ntPoland47/7 Peach; Hungary + ntAllorhizobium undicolaLMG 11875Bradyrhizobiumjaponicum 94pMesorhizobium lotiLMG 6125PhyllobacteriummyrsinacearumLMG 2P. rubiacearumLMG 1Rhizobium etliUSDA 9032Neptunia natans;SenegalSoybean; ?Lotus; New ZealandArdisia crispa;Germany+ 3Pavettantzimmermannia;GermanyBean; Mexico + 3R. galegaeLMG 6214 Goat’s rue; Finland ntLMG 6215Goat’s rue; formerUSSR.ntR. huautlense SO2 Sesbania herbacea;MexicoR. leguminosarumbv. viciae PRE Pea; Holand ntbv. trifoliiLMG 8820Trifolium; ? + 3R. tropici ntLMG 9503 Bean; Columbia + 3LMG 9517 Bean; Brazil ntUT 30011O Bean; Mexico + 3Sinorhizobium frediiLMG 6217Soybean; China + 3S. melilotia18 Alfalfa; Poland + 3LMG 6133 Alfalfa; ? + 3S. saheli LMG 7837 Sesbania cannabina;+ 3SenegalS. teranga LMG 7834 Acacia laeta; Senegal + 3Arthrobacter ramosus Unknown; Poland ntArthrobacterUnknown; PolandntglobiformisArthrobacter pascens Unknown; Poland ntErwinia amylovora 659 Apple; Poland ntErwinia herbicola 801 Chrysanthemum;Polandntntntntnt

474ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479Table 1. (continued )Strain Source and location Fragments produced in multiplex PCR with primersUF+B1R+B2R+AvR+ArRBiovar 1(184 bp)Biovar 2(1066 bp)A.vitis(478 bp)A. rubi(1006 bp)PCR-RFLP ofUF+B2Rproduct aPseudomonas syringaepv. tomatoXanthomonas arboricolapv. pruniUnknown; PolandUnknown; Unknownntnta 2, two DNA fragments of 1006 bp and 60 bp were obtained as a result of RFLP with Alw26I; 3, three DNA fragments of 830 bp, 167 bp and 60 bpwere obtained; nt, not tested.Table 2.Characteristic of phenotypic features of some Agrobacterium strains testedStrain 3-ketolactoseproductionCitrateutilizationL-tyrosineutilizationFerricammoniumcitrateAcid fromerythritolNaCltolerance(%)Oxidase cAgrobacterium B6 T (bv.1) + + 4 +Agrobacterium Ch 3, 131a/b + + 3 +Agrobacterium Ch-6, 137, 6, + + 4 +CFBP 2519Agrobacterium 0, 39/7, 7/1 + 4 +Agrobacterium LMG 150 T+ + + 1(bv.2)Agrobacterium 400 + + + 1 +/Agrobacterium 77 + + + 1A. vitis LMG 8750 T + 3 +A. rubi LMG 156 T nt 4 +Agrobacterium Ch-11 5 +Agrobacterium Ch-12 3 +/Agrobacterium 47/7 + + 3 +T , type strain; nt, not tested.Table 3.Agrobacterium species/biovar-specific primers based on 23S rDNA sequencesName of primer Target position a Sequence (5 0 –3 0 )UF f 171–193 GTAAGAAGCGAACGCAGGGAACTB1R r 338–360 GACAATGACTGTTCTACGCGTAAB2R r 1207–1230 TCCGATACCTCCAGGGCCCCTCACAAvR r 640–662 AACTAACTCAATCGCGCTATTAACArR r 1150–1173 AAAACAGCCACTACGACTGTCTTf, forward; r, reverse.a E. coli position numbering [1].Rhizobiaceae which produced a 1066 bp amplificationproduct with primers UF+B2R (Table 1),the restriction analysis of this product was applied.On the basis of computer analysis, endonucleaseAlw26I was chosen as the most appropriate for thispurpose. For each reaction 50 ng of PCR product wasused. Restriction fragments were separated in 2%agarose gels.

ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479 475SDS-PAGE of whole-cell proteinsWhole-cell protein extracts were prepared and separatedby electrophoresis using slight modifications of theprocedure of Laemmli [16] as described by de Lajudieet al. [4].Results and discussionPresented study allowed to develop a rapid methodfor identification and differentiation of 4 taxa belongingto genus Agrobacterium using multiplex PCR withprimers complementary to the 23S rRNA gene. Up tonow, analysis of phenotypic features based on biochemicaltests has been the phytopathologist’s standardmethod to classify agrobacteria into biovar 1, biovar2, A. vitis and A. rubi [18]. However, unambiguousclassification of agrobacteria into a particular taxon islaborious and time-consuming, and the results are veryoften difficult to interpret. Modern systems of bacterialidentification exploit techniques based on analysis ofsequences of functional genes. One of the most oftenused for this purpose is the gene coding for 16S rRNA.Systems based on this gene were developed for rapididentification of bacteria belonging to genera Bifidobacterium[6], Mycobacterium, Nocardia and others (reviewedin [15]). However, among agrobacteria thedivergence in sequences of 16S rDNA is not highenough for this system to be effective. For example,dissimilarity between 16S rDNA sequences of A. rubiand Agrobacterium biovar 1 is only 1.5%, which limitsthe possibilities for developing primers or probesdifferentiating these 2 taxa [26,33]. Mougel et al. [19]designed probes complementary to 16S rDNA, whichallow the discrimination of biovar 2, but not biovar 1agrobacteria and A. rubi. The gene coding for 23SrRNA contains more information than that for 16SrRNA and has already been used for identification ofbacteria of other genera [17,30]. In the case ofAgrobacterium, higher dissimilarity between sequencesof all species/biovars was found for this gene. Forinstance, differences between 23S rDNA sequences ofbiovar 1 agrobacteria and A. rubi ranged from 2.37% to3.09% [23], offering more scope for the development ofspecific primers. Similar results were obtained also byPeplies et al. [20], who in study on oligonucleotide probedesign for some marine Alphaproteobacteria found that23S rRNA gene has up to 8 times more discriminatorysites than 16S rRNA.Based on BLAST N analysis, 4 of the developedprimers, UF, B2R, AvR and ArR showed 100%homology only to the 23S rDNA sequences of the taxathey were designed to identify. The sequence of primerB1R, in addition to homology to 23S rDNA sequence ofAgrobacterium biovar 1, also showed 100% homologyto gene sequences of A. rubi IAM 13569 (AY244376)and A. vitis IAM 14140 (AY244374). However, thesesequences may be misnamed, because on the basis ofcluster analysis of all known 23S rDNA sequences ofbacteria belonging to family Rhizobiaceae they are mostsimilar to sequences of biovar 1 strains of Agrobacterium,but not to other sequences of A. rubi (AF205373)and A. vitis (AF209071, AF209076, AY244370) strains(including the type strains) present in the publicdatabases.The specificity of the newly developed primers wastested in PCRs using DNA of 119 bacterial strainsincluding: 93 of Agrobacterium, 19 of rhizobia and 7strains of phytopathogenic bacteria representing variousgenera. Primers developed for identification of bacteriaclassified as A. vitis, A. rubi and Agrobacterium biovar 1,amplified DNA of strains belonging only to these taxaand gave products of the expected sizes: 478, 1006 and184 bp, respectively. However, primer B2R, combinedwith primer UF, in addition to strains of Agrobacteriumbiovar 2, also amplified DNA of some (though not all)strains of other, closely related genera such as:Allorhizobium undicola, Rhizobium etli, R. leguminosarumbv. trifolii, R. tropici and all tested strains of thegenus Sinorhizobium. None of tested primers amplifiedDNA of strains belonging to A. larrymoorei, Phyllobacterium,Arthrobacter, Erwinia, Pseudomonas or Xanthomonas(Table 1). The results obtained in separate PCRswith following sets of primers: UF+B1R, UF+B2R,UF+AvR and UF+ArR were identical with thoseobtained in the PCRs, using all 5 primers simultaneously.Four PCR products of expected sizes wereobtained as a result of multiplex PCR with DNAmixture of representative strains of all Agrobacteriumtaxa (Fig. 1).As a result of DNA amplification with primers UFand B2R, a characteristic product of 1066 bp wasobtained in PCRs with DNA of 3 strains of Agrobacteriumbiovar 1, 58 strains of biovar 2 and 10 rhizobiastrains (Table 1). Restriction analysis of these productsusing endonuclease Alw26I allowed differentiation ofbiovar 2 strains from the other strains. The followingDNA fragments were obtained after digestion of the1066 bp PCR product of agrobacteria belonging tobiovar 2: 1006 and 60 bp, whereas in case of the otherbacteria 3 products (830, 167 and 60 bp, as expected onthe basis of computer analysis) were obtained (Table 1,Fig. 2).In case of strain 47/7, a 184 bp product typical forbiovar 1 was obtained as a result of amplification withprimers UF+B1R. However, this strain could not beclearly classified in biovar 1 on the basis of phenotypicfeatures. It showed typical features for biovar 2, such asthe ability to produce an acid from erythritol and it was3-ketolactose negative but at the same time showed

476ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479M 1 2 3 4 5 6 7 8 9 10 11 12 13M 1 2 3 4 5 6 7 8 9500 bp→Fig. 1. Electrophoresis gel showing PCR products obtained inmultiplex PCR with DNA of following Agrobacterium strains:1 – B6 (bv 1); 2 – LMG 150 (bv 2); 3 – LMG 8750 (A. vitis);4–LMG 156 (A. rubi); 5 – LMG 21410 (A. larrymoorei); 6 –mixture of DNA of strains B6, LMG 150, LMG 8750, LMG156 and LMG 21410; 7 – 47/7; 8 – 0; 9 – 7/1; 10 – 39/7; 11 –Ch11; 12 – Ch12; 13 – negative control; M – molecular weightmarker 100 bp ladder (Fermentas, Lithuania).500 bp→features typical for biovar 1 such as presence of oxidaseC as well as growth and pigmentation in ferricammonium citrate broth (Table 2). We verified its 16SrDNA sequence and found that 47/7 was 100% similarto that of Agrobacterium biovar 1 strain IAM 13129(accession no. D12784) and thus we can conclude it isindeed a biovar 1 strain (data unpublished).DNA of 3 other Hungarian strains (0, 7/1, 39/7) wasamplified both with primers complementary to 23SrDNA sequence of Agrobacterium biovar 1 and biovar2. As a result of amplification with the 5-primer mixture2 PCR products (184 and 1066 bp) were obtained(Fig. 1). Analysis of phenotypic features showed, thatthese 3 strains were most similar to biovar 1, except intheir ability to grow and produce pigment in ferricammonium citrate broth (Table 2). On the other hand,restriction analysis with Alw26I of products obtainedwith primers UF+B2R gave the same 3 fragments (830,167 and 60 bp) as those found for rhizobial strains butnot the 2 fragments (1006 and 60 bp) characteristic forbiovar 2. SDS-PAGE of total cellular proteins was usedas a rapid tool to screen for overall similarities of theHungarian strains and other taxa in our protein profiledatabase. It was found that these 3 strains producedsimilar protein patterns distinct from type strains ofother biovars and species, but most similar to biovar 1strains (Fig. 3). They may represent a separate, hithertounrecognized taxon. The fact that none of the rhizobialstrains produced a product with the primer combinationUF+B1R as the Hungarian strains did, seems toconfirm that they may be a distinct group.Fig. 2. Restriction analysis with endonuclease Alw26I of PCRproducts obtained with primers UF+B2R. For comparisonnot digested product on lane 5 (1066 bp). Digestion fragmentsof UF+B2R PCR product of rhizobia (expected sizes: 830,167 and 60 bp): lane 1 – S. saheli LMG 7837; lane 2 – S.teranga LMG 7834; lane 3 – R. tropici LMG 9503; lane 4 – A.undicola LMG 11875. Digestion fragments of UF+B2R PCRproduct of some strains of agrobacteria biovar 2 (expectedsizes: 1006 and 60 bp): lane 6 – 39; lane 7 – LMG 150; lane 8 –K84; lane 9 – 129; lane 10 – 89. M – molecular weight marker100 bp ladder (Promega, USA).DNA of 2 Agrobacterium strains (Ch11 and Ch12)isolated from galls on chrysanthemum plants was notamplified with any set of primers, which suggests thatthey do not belong to any of the present biovars orspecies of Agrobacterium. Phenotypic characteristicsindicated that these strains are most similar to the A.rubi-type strain (Table 2), but FAME and RAPDanalysis did not confirm unambiguously their affinityto A. rubi [21]. Further studies should determine theirtaxonomic status.The method presented here is the first PCR-basedprotocol developed for identification and differentiationof bacteria belonging to biovars 1 and 2 of Agrobacterium,A. vitis and A. rubi. However, for discriminationbetween strains of biovar 2 and some rhizobia species

ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479 4775060708090100M. huakuii LMG 14107M. plurifarium LMG11892 TA. rhizogenes LMG 150M. ciceri LMG 14989 TR. huautlense LMG 18254Agrobacterium sp. 39/7Agrobacterium sp. 7/1Agrobacterium sp. 0A. radiobacter (bv. 1) LMG140 TA. tumefaciens (bv. 1) LMG 232A. tumefaciens (bv. 1) LMG 243A. tumefaciens (bv. 1) LMG 52A. larrymoorei LMG 21410 TA. tumefaciens (bv. 1) LMG 187 TS. terangae LMG 7834 TB. japonicum LMG 6138 TAz. caulinodans LMG6465 TS. arboris LMG15624S. saheli LMG 7837 TR. galegae LMG 6214 TR. leguminosarum LMG 8817 TR. tropici LMG 9503 TR. tropici LMG 9517M. loti LMG 6125 TS. kostiense LMG 15610S. meliloti LMG 6130S. meliloti LMG 6133 TR. etli CFN42 TS. medicae LMG 16580S. fredii LMG 6217 TR. mongolense LMG 19141M. mediterraneum LMG17148 TM. tianshanense LMG15767 TA. tumefaciens (bv. 1) LMG 37R. hainanense LMG 18075A. vitis LMG8750 TAl. undicola LMG 11874Fig. 3. Dendrogram showing the similarities between the SDS-PAGE protein profiles of Hungarian strains 39/7, 7/1, 0 and aselection of reference strains. Using the program GelCompar v. 4.2, the Pearson product moment correlation coefficient wascalculated and converted to percentage values. The similarities are represented as a UPGMA (unweighted pair grouping methodusing averages) dendrogram.(Allorhizobium undicola, Rhizobium etli, R. leguminosarumbv. trifolii, R. tropici and tested Sinorhizobium sp.) itis necessary to carry out RFLP analysis of the obtained1066 bp PCR product. Although as inferred fromtheoretical analysis, the primer B2R was expected tobe 100% complementary only to 23S rDNA of biovar 2strains, it also allowed amplification in some strains ofrhizobia. This may be due to the fact that all rhizobialstrains producing the typical 1066 bp amplicon withprimers UF+B2R, are phylogeneticaly closely relatedto agrobacteria, as is apparent from 16S rDNAphylogeny [3,34]. Similarity of 23S rDNA of Agrobacteriumbiovar 2 and some rhizobia is very high. In somecases, 23S rDNA sequences of biovar 2 strains are evenmore similar to the same gene sequence of rhizobia (e.g.R. tropici) than to those of other Agrobacterium biovar/species [23].The presented method we use for fast identificationand classification of isolated agrobacteria from plantsand soil. Simultaneous application of primers complementaryto tms2 gene which amplify DNA of onlytumour inducing strains [22,29] or pathogenicity tests onplants [28] allows for complete characterization ofstudied agrobacteria. The developed method should behelpful in phytopathological and ecological studies.AcknowledgmentsThe authors wish to thank J.H. Haas, S. Su¨le,X.Nesme,M. Maes, H. Sawada, S. Martyniuk, H. Bagin´ska for

478ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479providing bacterial strains. J. Pu"awska is deeply indebtedto the Foundation for Polish Science for NationalScholarship for Young Scientist (Edition 2001/2002).A. Willems is grateful to the Fund for ScientificResearch – Flanders for a postdoctoral research fellowship.This work was supported by Polish Scientific Committee(KBN) Grant 5P06A02119.References[1] J. Brosius, T.J. Dull, D.D. Sleeter, H.F. Noller, Geneorganization and primary structure of a ribosomal RNAoperon from Escherichia coli, J. Mol. Biol. 148 (1981)107–127.[2] J. Cubero, M.M. Lopez, An efficient microtiter system todetermine Agrobacterium biovar, Eur. J. Plant Pathol. 107(2001) 757–760.[3] P. de Lajudie, E. Laurent-Fulele, A. Willems, U. Torck,R. Coopman, M.D. Collins, K. Kersters, B. Dreyfus, M.Gillis, Allorhizobium undicola gen. nov., sp. nov., nitrogen-fixingbacteria that efficiently nodulate Neptunianatans in Senegal, Int. J. Syst. Bacteriol. 48 (1998)1277–1290.[4] P. de Lajudie, A. Willems, B. Pot, D. Dewettinck,G. Maestrojuan, M. Neyra, M.D. Collins, B. Dreyfus,K. Kersters, M. Gillis, Polyphasic taxonomy of rhizobia:emendation of the genus Sinorhizobium and description ofSinorhizobium meliloti comb. nov., Sinorhizobium sahelisp. nov., and Sinorhizobium teranga sp. nov., Int. J. Syst.Bacteriol. 44 (1994) 715–733.[5] J. De Ley, R. Tijtgat, J. De Smedt, M. Michiels,Thermal stability of DNA:DNA hybrids within thegenus Agrobacterium, J. Gen. Microbiol. 78 (1973)241–252.[6] X. Dong, G. Cheng, W. Jian, Simultaneous identificationof five Bifidobacterium species isolated from human beingsusing multiple PCR primers, Syst. Appl. Microbiol. 23(2000) 386–390.[7] S.K. Farrand, P.B. van Berkum, P. Oger, Agrobacteriumis a definable genus of the family Rhizobiaceae, Int.J. Syst. Evol. Microbiol. 53 (2003) 1681–1687.[8] B. Holmes, Taxonomy of Agrobacterium, Acta Hortic.225 (1988) 47–52.[9] B. Holmes, P. Roberts, The classification, identificationand nomenclature of agrobacteria, J. Appl. Bacteriol. 50(1981) 443–467.[10] J.G. Holt, N.R. Krieg, P.H.A. Sneath, J.T. Staley, S.T.Williams, Bergey’s Manual of Determinative Bacteriology,ninth ed., Williams & Wilkins Comp., Baltimore,MD, USA, 1994.[11] B.D.W. Jarvis, S. Sivakumaran, S.W. Tighe, M. Gillis,Identification of Agrobacterium and Rhizobium speciesbased on cellular fatty acid composition, Plant Soil 184(1996) 143–158.[12] A. Kerr, P. Manigault, J. Tempé, Transfer of virulence invivo and in vitro in Agrobacterium, Nature 265 (1977)560–561.[13] K. Kersters, J. De Ley, P.H.A. Sneath, M. Sackin,Numerical taxonomic analysis of Agrobacterium, J. Gen.Microbiol. 78 (1973) 227–239.[14] E.O. King, M.K. Ward, D.E. Raney, Two simple mediafor the demonstration of pyocyanin and fluorescein,J. Lab. Med. 44 (1954) 693–695.[15] C.P. Kolbert, D.H. Persing, Ribosomal DNA sequencingas a tool for identification of bacterial pathogens, Curr.Opin. Microbiol. 2 (1999) 299–305.[16] U.K. Laemmli, Cleavage of structural proteins duringassembly of the head of bacteriophage T4, Nature 227(1970) 680–685.[17] W. Ludwig, S. Dorn, N. Springer, G. Kirchhof, K.H.Schleifer, PCR-based preparation of 23S rRNA-targetedgroup-specific polynucleotide probes, Appl. Environ.Microbiol. 60 (1994) 3234–3244.[18] L.W. Moore, C.I. Kado, H. Bouzar, II Gram-negativebacteria A, Agrobacterium, In: N.W. Schaad (Ed.),Laboratory Guide for Identification of Plant PathogenicBacteria, American Phytopathological Society, St. Paul,MN, 1988, pp. 16–36.[19] C. Mougel, B. Cournoyer, X. Nesme, Novel telluriteamendedmedia and specific chromosomal and Ti plasmidprobes for direct analysis of soil populations of Agrobacteriumbiovars 1 and 2, Appl. Environ. Microbiol. 67(2001) 65–74.[20] J. Peplies, F.O. Glo¨ckner, R. Amann, W. Ludwig,Comparative sequence analysis and oligonucleotide probedesign based on 23S rRNA genes of Alphaproteobacteriafrom North Sea bacterioplankton, Syst. Appl. Microbiol.27 (2004) 573–580.[21] J. Pu"awska, Z. Piotrowska-Seget, Characterization ofAgrobacterium isolates from chrysanthemum on the basisof biochemical tests, FAME analysis and RAPD,Phytopathol. Pol. 30 (2003) 9–17.[22] J. Pu"awska, P. Sobiczewski, Development of a seminestedPCR based method for sensitive detection oftumorigenic Agrobacterium in soil, J. Appl. Microbiol. 98(2005) 710–721.[23] J. Pu"awska, M. Maes, A. Willems, P. Sobiczewski,Phylogenetic analysis of 23S rRNA gene sequences ofAgrobacterium, Rhizobium and Sinorhizobium strains,Syst. Appl. Microbiol. 23 (2000) 238–244.[24] J. Sambrook, E.F. Fritsch, T. Maniatis, MolecularCloning, A Laboratory Manual, second ed., Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY,1989.[25] H. Sawada, H. Ieki, Phenotypic characteristics of thegenus Agrobacterium, Ann. Phytopathol. Soc. Jpn. 58(1992) 37–45.[26] H. Sawada, H. Ieki, H. Oyaizu, S. Matsumoto, Proposalfor rejection of Agrobacterium tumefaciens and reviseddescription for the genus Agrobacterium and for Agrobacteriumradiobacter and Agrobacterium rhizogenes, Int.J. Syst. Bacteriol. 43 (1993) 694–702.[27] H. Sawada, Y. Takikawa, H. Ieki, Fatty acid methyl esterprofiles of the genus Agrobacterium, Ann. Phytopathol.Soc. Jpn. 58 (1992) 46–51.[28] P. Sobiczewski, Etiology of crown gall on fruit trees inPoland, J. Fruit Ornam. Plant Res. 4 (1996) 147–161.

ARTICLE IN PRESSJ. Pu"awska et al. / Systematic and Applied Microbiology 29 (2006) 470–479 479[29] P. Sobiczewski, J. Pu"awska, S. Berczyn´ski, Practical useof PCR-based method for detection of tumorigenicAgrobacterium in soil, Phytopathol. Pol. 35 (2005)79–84.[30] N. Springer, W. Ludwig, G. Hardarson, A 23S rRNAtargeted specific hybridisation probe for B. japonicum,Syst. Appl. Microbiol. 16 (1993) 468–470.[31] S.W. Tighe, P. de Lajudie, K. Dipietro, K. Lindstro¨m,G. Nick, B.D.W. Jarvis, Analysis of cellular fatty acidsand phenotypic relationships of Agrobacterium, Bradyrhizobium,Mesorhizobium, Rhizobium and Sinorhizobiumspecies using the Sherlock Microbial IdentificationSystem, Int. J. Syst. Evol. Microbiol. 50 (2000) 787–801.[32] J.M. Vincent, Manual for the Practical Study of RootNodule Bacteria. IBP Handbook no. 5, BlackwellScientific Publications, Oxford, 1970.[33] A. Willems, M.D. Collins, Phylogenetic analysis ofrhizobia and agrobacteria based on 16S rRNA genesequences, Int. J. Syst. Bacteriol. 43 (1993) 305–313.[34] J.M. Young, L.D. Kuykendall, E. Martinez-Romero,A. Kerr, H. Sawada, A revision of Rhizobium Frank 1889,with an emended description of the genus, and theinclusion of all species of Allorhizobium undicola deLajudie et al., 1998 as new combinations: Rhizobiumradiobacter, R. rhizogenes, R. rubi, R. undicola and R.vitis, Int. J. Syst. Evol. Microbiol. 51 (2001) 89–103.