download (pdf, 719 kb) - Institute of Pharmacology and Toxicology

1050 The 2.5 Å Structure of M. tuberculosis Rv2740Table 1. Kinetic characteristics of Rv2740 with different substratesSubstrate/enzyme V max (nmol mg K1 min K1 ) K m (mM) k cat /K m (M K1 s K1 )Styrene 7,8-oxide (LEH) n.d. (1700G250) O5000 (1400G280) 3G0.6 (340G30)Cholesterol 5,6-oxide 1.1G0.4 60G30 5.5G0.59,10-Epoxystearic acid 30G10 45G15 210G65V max for styrene 7,8-oxide is recorded as not determined (n.d.); saturation was not obtained at substrate concentrations as high as 5 mM,and so only k cat /K m could be estimated with confidence. Values measured for LEH with the same substrate 5 are shown in parenthesesfor comparison. No turnover could be detected for LEH with cholesterol-5,6-oxide and 9,10-epoxystearic acid as substrates.Table 2. Data collection and refinement statisticsNative dataSe-Met dataA. Data collectionBeamline (wavelength, Å) MaxLab 711 (1.134) ESRF ID14-EH2 (0.934)Resolution range (Å) 30.0–3.0 (3.05–3.0) 70.9–2.50 (2.64–2.50)Unit cell dimensions (Å) 80.6, 80.6, 118.7 81.9, 81.9, 117.0Number of observed/unique reflections 70,441/9338 348,194/16,247Completeness (%) 99.8 (99.8) 100.0 (100.0)Multiplicity/anomalous multiplicity 7.5 (7.5)/– 21.2 (21.5)/10.8 (11.4)R merge 0.042 (0.136) 0.095 (0.33)hIi/hs(I)i 26.4 (7.7) 29.0 (8.8)B. RefinementR cryst (%) – 22.2aR free – 25.4Number of atoms (Average B (Å 2 )) – 3285 (42.1)Number of waters (Average B (Å 2 )) – 90 (35.9)Bond RMSD from ideal values b (Å) – 0.023Angle RMSD from ideal values b (deg.) – 1.96Ramachandran plot outliers c (%) – 0.83Values in parentheses are for the highest resolution shell.a R free , calculated from a randomly chosen 5% of unique reflections.b Ideal values from Engh & Huber. 36c Defined according to Kleywegt & Jones. 37Overall structureStatistics for the X-ray data and the final refinedmodel of the selenomethionine (Se-Met) substitutedform of Rv2740 are summarized in Table 2. Thestructure is characterized by a curved six-strandedb-sheet that packs against three antiparallela-helices, creating a wide pocket lined primarilywith hydrophobic side-chains. A fourth long helixcompletes the fold (Figure 2). The asymmetric unitcontains three chemically equivalent moleculeswith very similar conformations; residues 16–140of each chain can be superimposed with a rootmean-square(RMS) distance of less than 0.1 Å.Twoof the molecules form a dimer with subunits relatedby a nearly perfect non-crystallographic (NCS)2-fold axis. The third forms a dimer with aneighboring molecule, its 2-fold rotational axiscoinciding with a crystallographic dyad.The subunit interface of each dimer has a totalburied surface area of 2000 Å 2 , within the rangeexpected for homodimers (1700 (G1100) Å 2 ). 8 Threemajor segments are involved in quaternary interactionsbetween the two subunits. W105, Y123,W105 0 and Y123 0 form a hydrophobic surface; theprime indicates that a residue belongs to theadjacent polypeptide chain. Two sets of doublebidentate salt-bridges, R79–E111 0 –E90–R121 0 , alsostabilize the interaction. Although C107 and C107 0are close enough to form a disulfide bridge acrossthe dimer interface, they are clearly reduced in thecrystal structure, contributing instead to the hydrophobicinteractions between the subunits.Figure 2. The Rv2740 dimer. The two subunits are colorcodedgoing from red to blue, beginning with the Nterminus of the A molecule and ending with the Cterminus of the B molecule.

The 2.5 Å Structure of M. tuberculosis Rv2740 1051Comparison with known structuresA DALI search 9 of the Protein Data Bank (PDB 10 ),using the Rv2740 A subunit as a probe, identifiedseveral structural homologues (Table 3). Rathersurprisingly, the most similar structure is that ofBal32a, 11 a thermostable protein of unknownfunction from an unidentified bacterium. Strongsimilarity to Rv2740 is observed in both the subunitand dimer. However, Bal32a has a long loop thatcovers the entrance of the active-site pocket, turningit into a closed cavity. Robinson et al. 11 speculatethat the interior of the protein may be accessible tosubstrates via movements of a flexible cap. As forRv2740, a pair of cysteine residues is observed in thereduced state at the subunit–subunit interface in thecrystal structure. Oxidation results in an increase inthe melting temperature of Bal32a from 65 8C to80 8C, strongly suggesting a role for the disulfide instabilization of its dimer.As expected, Rv2740 was found to be similar instructure to LEH. 5 Similarities were also noted to D5-3-ketosteroid isomerase, 12 scytalone dehydratase 13,14and a carotenoid-binding protein of unknownfunction. 15 The D5-3-ketosteroid isomerase forms adimer with a similar construction to that of Rv2740,LEH and Bal32a. The scytalone dehydratase forms atrimer along similar principles, while the correspondingregion of the carotenoid-binding protein representsa single domain of a larger protein.Active siteThe three residues mainly responsible forcatalysis in LEH have been identified through sitedirectedmutagenesis. 5 In the mycobacterial epoxidehydrolase, these side-chains correspond to R91,D93 and D122, which are situated at the bottom ofthe active-site pocket (Figure 3(a)). Two otherresidues, Y46 and N48 (in Rv2740 numbering),have been suggested to be associated with the activewater molecule of the hydrolase reaction. The activesites of LEH and the mycobacterial enzyme havealmost identical hydrogen-bonding networks, theonly exception being N55 in LEH, which isstabilized by a single hydrogen bond. The correspondingside-chain of Rv2740, N48, is coordinatedboth by Y46 and S52. In Bal32a, the equivalents ofR91, D93 and D122 are changed to H105, N107 andE136, respectively, suggesting that its function isdifferent from that of Rv2740, Furthermore, thecounterparts of Y46 and N48 are completely absent.Although the catalytic residues of LEH andRv2740 are very similar, the shape of the pocketthat contains them is quite different (Figure 3(b)).The deeper substrate-binding site of the mycobacterialstructure is in part explained by the differingorientations of L35 and L28, as well as I80 and F73,in the LEH and Rv2740 structures, respectively.Substitutions such as M78 to V71 and L74 to M67,combined with the different packing of the thirdand fourth helices, make room in the mycobacterialenzyme for substrates bulkier than limonene-1,2-epoxide. The side-chains of L95, M129, I97, L140,V138, L137, L134 and F130 form a large solventexposedhydrophobic patch at the upper part of thepocket; this feature seems to be well conservedthroughout Mycobacteriaceae.As in LEH, an endogenous ligand of unknownorigin was found in the active-site cavity of each of thethree molecules in the asymmetric unit, bound close tothe catalytic residues (Figure 3(c) and (d)). The electrondensity is essentially identical in averaged andunaveraged maps at 2.5 Å resolution, suggesting asingle compound with a single well-defined bindingmode. The character of this ligand is markedlydifferent from the heptanamide modeled in the LEHcase, being more consistent with a cyclohexane ringwith a single attached aliphatic chain. The shape of thedensity does not resemble that of any chemical usedin either purification or crystallization.Related sequencesIn addition to the group of sequences previouslyidentified as potential LEHs, 5 at least four moresequences from actinobacteria and proteobacteriahave a highly conserved catalytic center (Figure 4).A few differences from the originally defined LEHfamily are evident. For example, Y46 in themycobacterial enzyme is replaced by a tryptophanin both Ralstonia solanacearum (GenBank accessionnumber 17547309; partial sequence) and Erwiniacaratova (50120522). The latter protein also lacks ahydrogen bond between N48 and S52 (Rv2740numbering), leaving the residue corresponding toN48 solely responsible for positioning the putativecatalytic water molecule.Four additional sequences are more distantlyrelated, but likely to have similar structure. TheTable 3. Comparisons with DALIPDB entryZRMS differenceResiduesalignedLength ofsequence Identical (%) Protein1TUH 15.8 2.7 122 131 19 Bal32a1OPY 14.9 2.1 115 123 16 D5-3-Ketosteroid isomerase1NU3 13.9 2.2 117 141 28 LEH3STD 13.3 2.4 121 162 5 Scytalone dehydratase1M98 12.0 2.2 106 316 11 Unknown function, orangecarotenoid proteinOnly hits with Z-scores greater than 12 are listed.

1052 The 2.5 Å Structure of M. tuberculosis Rv2740Figure 3. The active site. (a) Residues lining the cavity of Rv2740. (b) Comparison of the size of the substrate-bindingpockets of Rv2740 (blue) and LEH (red). Solvent-accessible surfaces were generated in O, using a probe radius of 1.3 Å.Residues of Rv2740 are labeled. (c) and (d) The Rv2740 active site with electron density for endogenous ligand (12F obs KF calc j contoured at 0.4 eÅ 3 ), using views that are similar to those in (a) and (b), respectively.protein from Burkholderia cepacia (46319940), as well astwo from the Mycobacterium avium subspecies paratuberculosis(41407700 and 41409656), is missing one ofthe catalytic aspartate residues (D93). In the M. tuberculosisRv0141c (15607283), as well as both of theM. avium sequences, R91 is substituted by histidine orasparagine. All four have replaced N48 with variousother hydrophilic residues, suggesting that theirfunction may be different from that of Rv2740.DiscussionStudies of LEH suggest that it uses a single-step,push–pull mechanism that is distinct from thetwo-step mechanism used by the a/b-hydrolaseclass of EHs. 5 The single-step mechanism featuresan Asp-Arg-Asp triad, i.e. residues R91, D93 andD122 in Rv2740 (Figure 1(c)). We suggest that D122activates a water molecule for its attack on theepoxide ring, while the ring is simultaneouslyencouraged to open by a proton donated by D93.The arginine side-chain interacts with and orientsthe carboxylate groups of the catalytic aspartateresidues, while Y46 and N48 help position thecatalytic water.We show here that Rv2740 can hydrolyze threestructurally diverse epoxides, albeit with moderatecatalytic efficiency (Table 1). If Rv2740, like LEH,metabolizes carbon compounds obtained from thesurroundings, it would be expected to have a higheractivity on one or more preferred substrates. This isin contrast to the broad specificity and slowerreaction rates associated with a function in detoxification(a major function of mammalian a/b EHs).Obviously, the physiological substrates for Rv2740have yet to be identified, and the observedefficiency on these non-optimal substrates is understandablylower. The hydrophobic character of thesubstrate binding cavity and the low K m value withepoxystearic acid and cholesterol 5,6-epoxidesuggest that the most relevant substrates may befatty acid or steroid derivatives. However, themetabolism of such compounds in M. tuberculosisremains largely unexplored. In this context, theobserved electron density for an endogenous ligand

Figure 4. Structure-based sequence alignment of Rv2740 and LEH, together with alignment of other related sequences. The last five residues of the first M. avium sequence areomitted for simplicity. Asterisks denote residues lining the active-site cavity.

1054 The 2.5 Å Structure of M. tuberculosis Rv2740in the active site of Rv2740 is extremely interesting.Although the compound probably originated fromthe E. coli expression host, it provides leads for thetask of identifying the true substrates for Rv2740.This ligand could only be partially displaced byvalpromide (K I w100 mM), even at the highestsoluble concentration, 10 mM; its apparent persistencethroughout purification also indicates tightbinding. The shape of the electron density issuggestive of a cyclohexane ring with an attachedaliphatic chain (Figure 3(c) and (d)). Limoneneitself, one of the physiological substrates of LEH,has some similarities in shape (Figure 1), but thewider site of Rv2740 (Figure 3(b)) would allow alarger substrate. The relevant portion of thecarotenoid in the related structure describedabove (Table 3) is placed in a very similar locationand orientation within that binding-site pocket.However, residues lining the corresponding site inRv2740 are not conserved; indeed, sequence identitybetween the two proteins is very low, and thesimilarities could only be uncovered based oncomparisons of the three-dimensional structures.The ability of Rv2740 to hydrolyze cholesterol 5,6-epoxide is intriguing for reasons of broader interest.On the basis of an analysis of LEH, we havepreviously speculated that it could be a homologueof the human cholesterol epoxide hydrolase, a keyenzyme in the metabolism of cholesterol oxidationproducts which has, so far, evaded attempts atpurification and cloning. 5 Although LEH itself didnot show any turnover with cholesterol epoxide, thepresent study shows that the wider active site ofRv2740 does allow such a reaction to occur.Another interesting finding is the high enantioselectivityof Rv2740 with a fatty acid epoxidesubstrate. Although the enantioselectivity of thisclass of enzymes has been shown for the rigidsubstrate limonene 1,2-epoxide, 16 the phenomenonis rather unexpected with 9,10-epoxystearic acid,since the groups that could direct such selectivityare quite distant from the catalytic center (Figure 1).In recent years, there has been a strong interest inepoxide hydrolases for the production of enantiopureepoxides and diols, mainly as building blocksin the fine chemical and drug industries. 17 Indeed,mining for such novel enzymes was a goal in thestudies with Bal32a referred to here 11 as well assimilar ones with a/b-type epoxide hydrolases. 18Given its unusual properties, Rv2740 will provide auseful addition to the toolbox of enzymes availablefor biocatalytic production of fine chemicals.Experimental ProceduresRadiolabeled compounds[26- 14 C]Cholesterol 5,6-oxide (53 mCi/mmol), racemic[1- 14 C]9,10-epoxystearic acid (56 mCi/mmol) and racemic[ 14 C]styrene 7,8-oxide (15 mCi/mmol) were synthesized asdescribed. 19Cloning, over-expression and purificationThe sequence corresponding to the open reading frameof the Rv2740 gene was amplified by PCR from total DNAof M. tuberculosis strain H37Rv, using the high-fidelitypolymerase Pfu Turbo (Stratagene) with the primersATGGCTCATCATCATCATCATTGTGCCGAGCTGACCGAAACATC (forward) and CTACAGCGTTGCCTTCAGCGATG (reverse). The forward primer includedthe sequence for a histidine-tag immediately upstream ofthe gene. After addition of a 3 0 A overhang by incubationwith Taq polymerase (Roche), the DNA fragment wasligated into the pCR T7 TOPO vector (Invitrogen), andused to transform E. coli TOP10 cells (Invitrogen); theconstruct was verified by DNA sequence analysis.Expression was performed in E. coli Rosetta (DE3) cellswith a pLacI plasmid (Novagen) or in E. coli BL21-AI cells(Invitrogen). The cells were cultured in LB medium at37 8C. At A 600 Z0.5–1.0, the temperature was lowered to24 8C and expression of the target gene induced withIPTG (100 mg/l) for three hours. After harvesting bycentrifugation, the cell pellet was resuspended in lysisbuffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 10 mM imidazole,10%(v/v) glycerol, 0.5%(v/v) Triton X-100 (pH 8.0))with 1 mg/ml of lysozyme, 1 mM PMSF, 0.01 mg/ml ofRNase A and 0.02 mg/ml of DNase I, and lysed using aOne Shot cell disruptor (Constant Systems Ltd.). Thesoluble fraction was incubated with 1 ml of pre-equilibratedNi-NTA agarose (Qiagen) slurry at 4 8C for onehour, then poured into a column. After washing with 20column volumes of buffer (20 mM imidazole, 50 mMNaH 2 PO 4 , 300 mM NaCl, 10% glycerol (pH 8.0)), theprotein was eluted with four column volumes of 250 mMimidazole in the same buffer. Fractions containing theprotein were pooled and further purified on a HiLoad 16/60 Superdex 75 prep grade column (Amersham Biosciences)equilibrated in 20 mM Tris–HCl (pH 7.5),150 mM NaCl, 10% glycerol. The protein eluted in twopeaks, apparently a monomer and a dimer. The twosamples were concentrated separately to 4–5 mg/mlusing Vivaspin 6 concentrators (10,000 MWCO).For expression of the Se-Met labeled protein, it wasnecessary to efficiently suppress the background level ofexpression. Therefore, the gene was transferred to thepET101D vector (Invitrogen) and the expression performedin BL21-AI cells. Se-Met was introduced into theprotein by metabolic inhibition. 20 Fermentation wasperformed in minimal medium supplemented withSe-Met, lysine, threonine, phenylalanine, leucine, isoleucineand valine according to published procedures.Expression was performed at room temperature overnight.The purification was carried out as described forthe native protein, except that 10 mM b-mercaptoethanolwas included in all buffers to prevent Se-Met oxidation.Enzyme assaysThe enzymatic activity of native Rv2740 with racemic[ 14 C]styrene 7,8-oxide as the substrate was determinedessentially as described. 5 For the assay with [1- 14 C]-cis-9,10-epoxystearic acid, 10–15 mg of pure enzyme wasincubated with the substrate in 100 mM sodium phosphate,(pH 7.4), 50 mM NaCl in a total volume of 50 mland incubated for 15 minutes at 37 8C. The substrate wasadded from a stock solution in acetonitrile, resulting in afinal solvent concentration in the assay mixture of 2%; theorganic solvent has no effect on the enzyme activity. Thereaction was terminated and 200 ml of ethylacetate was

1056 The 2.5 Å Structure of M. tuberculosis Rv27405. Arand, M., Hallberg, B. M., Zou, J., Bergfors, T.,Oesch, F., van der Werf, M. J. et al. (2003). Structure ofRhodococcus erythropolis limonene-1,2-epoxide hydrolasereveals a novel active site. EMBO J. 22, 2583–2592.6. van der Werf, M. J., Swarts, H. J. & de Bont, J. A.(1999). Rhodococcus erythropolis DCL14 contains anovel degradation pathway for limonene. Appl.Environ. Microbiol. 65, 2092–2102.7. Pacifici, G. M., Franchi, M., Bencini, C. & Rane, A.(1986). Valpromide inhibits human epoxide hydrolase.Br. J. Clin. Pharmacol. 22, 269–274.8. Jones, S. & Thornton, J. M. (1996). Principles of protein–protein interactions. Proc. Natl Acad. Sci. USA, 93, 13–20.9. Holm, L. & Sander, C. (1993). Protein structurecomparison by alignment of distance matrices. J.Mol. Biol. 233, 123–138.10. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G.,Bhat, T. N., Weissig, H. et al. (2000). The Protein DataBank. Nucl. Acids Res. 28, 235–242.11. Robinson, A., Wu, P. S., Harrop, S. J., Schaeffer, P. M.,Dosztanyi, Z., Gillings, M. R. et al. (2005). Integronassociatedmobile gene cassettes code for folded proteins:the structure of Bal32a, a new member of the adaptablealphaCbeta barrel family. J. Mol. Biol. 346, 1229–1241.12. Wu, Z. R., Ebrahimian, S., Zawrotny, M. E.,Thornburg, L. D., Perez-Alvarado, G. C., Brothers, P.et al. (1997). Solution structure of 3-oxo-delta5-steroidisomerase. Science, 276, 415–418.13. Lundqvist, T., Rice, J., Hodge, C. N., Basarab, G. S.,Pierce, J. & Lindqvist, Y. (1994). Crystal structure ofscytalone dehydratase–a disease determinant of the ricepathogen, Magnaporthe grisea. Structure, 2, 937–944.14. Chen, J. M., Xu, S. L., Wawrzak, Z., Basarab, G. S. &Jordan, D. B. (1998). Structure-based design of potentinhibitors of scytalone dehydratase: displacement of awater molecule from the active site. Biochemistry, 37,17735–17744.15. Kerfeld, C. A., Sawaya, M. R., Brahmandam, V., Cascio,D., Ho, K. K., Trevithick-Sutton, C. C. et al. (2003). Thecrystal structure of a cyanobacterial water-solublecarotenoid binding protein. Structure, 11, 55–65.16. van der Werf, M. J., Orru, R. V. A., Overkamp, K. M.,Swarts, H. J., Osprian, I., Steinreiber, A. et al. (1999).Substrate specificity and stereospecificity of limonene-1,2-epoxidehydrolase from Rhodococcus erythropolisDCL14; an enzyme showing sequential andenantioconvergent substrate conversion. Appl. Microbiol.Biotechnol. 52, 380–385.17. Archelas, A. & Furstoss, R. (2001). Synthetic applicationsof epoxide hydrolases. Curr. Opin. Chem. Biol. 5, 112–119.18. Zhao, L., Han, B., Huang, Z., Miller, M., Huang, H.,Malashock, D. S. et al. (2004). Epoxide hydrolasecatalyzedenantioselective synthesis of chiral 1,2-diolsvia desymmetrization of meso-epoxides. J. Am. Chem.Soc. 126, 11156–11157.19. Müller, F., Arand, M., Frank, H., Seidel, A., Hinz, W.,Winkler, L. et al. (1997). Visualization of a covalentintermediate between microsomal epoxide hydrolase,but not cholesterol epoxide hydrolase, and theirsubstrates. Eur. J. Biochem. 245, 490–496.20. Van Duyne, G. D., Standaert, R. F., Karplus, P. A.,Schreiber, S. L. & Clardy, J. (1993). Atomic structuresof the human immunophilin FKBP-12 complexes withFK506 and rapamycin. J. Mol. Biol. 229, 105–124.21. Page, R., Grzechnik, S. K., Canaves, J. M., Spraggon, G.,Kreusch, A., Kuhn, P. et al. (2003). Shotgun crystallizationstrategy for structural genomics: an optimized twotieredcrystallization screen against the Thermotogamaritima proteome. Acta Crystallog. sect. D, 59, 1028–1037.22. Otwinowski, Z. & Minor, W. (1997). Processing ofX-ray diffraction data collected in oscillation mode.Methods Enzymol. 276, 307–326.23. Matthews, B. W. (1968). Solvent content of proteincrystals. J. Mol. Biol. 33, 491–497.24. Knight, S. D. (2000). RSPS version 4.0: a semiinteractivevector-search program for solving heavyatomderivatives. Acta Crystallog. sect. D, 56, 42–47.25. de La Fortelle, E. & Bricogne, G. (1997). Maximumlikelihoodheavy-atom refinement in the MIR andMAD methods. Methods Enzymol. 276, 472–494.26. Jones, T. A., Zou, J.-Y., Cowan, S. W. & Kjeldgaard, M.(1991). Improved methods for building protein modelsin electron density maps and the location of errors inthese models. Acta Crystallog. sect. A, 47, 110–119.27. Kleywegt, G. J. & Jones, T. A. (1994). Halloween.masks and bones. In From First Map to Final Model(Bailey, S., Hubbard, R. & Waller, D., eds), pp. 59–66,SERC Daresbury Laboratory, Warrington, UK.28. Cowtan, K. & Main, P. (1998). Miscellaneous algorithmsfor density modification. Acta Crystallog. sect. D, 54, 487–493.29. Jones, T. A. (2004). Interactive electron-density mapinterpretation: from INTER to O. Acta Crystallog. sect.D, 60, 2115–2125.30. Brünger, A. T., Adams, P. D., Clore, G. M., DeLano, W.L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998).Crystallography and NMR system (CNS): a newsoftware suite for macromolecular structure determination.Acta Crystallog. sect. D, 54, 905–921.31. Murshudov, G. N., Vagin, A. A. & Dodson, E. J. (1997).Refinement of macromolecular structures by themaximum-likelihood method. Acta Crystallog. sect.D, 53, 240–255.32. Read, R. J. (1986). Improved Fourier coefficients formaps using phases from partial structures witherrors. Acta Crystallog. sect. A, 42, 140–149.33. Perrakis, A., Sixma, T. K., Wilson, K. S. & Lamzin, V. S.(1997). wARP: improvement and extension ofcrystallogaphic phases by weighted averaging ofmultiple-refined dummy atomic models. Acta Crystallog.sect. D, 53, 448–455.34. Lopez, R., Silventoinen, V., Robinson, S., Kibria, A. &Gish, W. (2003). WU-Blast2 server at the EuropeanBioinformatics Institute. Nucl. Acids Res. 31, 3795–3798.35. Harris, M. & Jones, T. A. (2001). Molray - a webinterface between O and the POV-Ray ray tracer. ActaCrystallog. sect. D, 57, 1201–1203.36. Engh, R. A. & Huber, R. (1991). Accurate bond andangle parameters for X-ray protein structure refinement.Acta Crystallog. sect. A, 47, 392–400.37. Kleywegt, G. J. & Jones, T. A. (1996). Phi/Psi-cology:Ramachandran revisited. Structure, 4, 1395–1400.Edited by M. Guss(Received 29 April 2005; received in revised form 17 June 2005; accepted 21 June 2005)Available online 7 July 2005