Accurate Detection and Quantitation of Heteroplasmic Mitochondrial ...

More documents

Recommendations

Info

QUANTITATION OF HETEROPLASMIC MITOCHONDRIAL MUTATIONS 193Three microliters of Streptavidin Sepharose HP (Amersham,Piscataway, NJ) was added to 37 l binding buffer (10 mMTris-HCl pH 7.6, 2 M NaCl, 1 mM ethylenediaminetetraaceticacid [EDTA], 0.1% Tween 20) and mixed with 20 L PCRproduct and 20 l high purity water for 10 min at room temperatureusing a Variomag Monoshaker (Camlab, Cambridge,UK). The beads containing the immobilized templates werecaptured onto the filter probes after applying the vacuum andthen washed with 70% ethanol for 5 sec, denaturation solution(0.2 M NaOH) for 5 seconds and washing buffer (10 mM Tris-Acetate pH 7.6) for 5 seconds. The vacuum was then releasedand the beads released into a PSQ 96 Plate Low containing 45l annealing buffer (20 mM Tris-Acetate, 2 mM MgAc 2 pH7.6), 0.3 M sequencing primer. For the T8993C/G assay, wefound it necessary to add 1 l single stranded binding protein(Promega, 2.2 g/l) to eliminate secondary structure in thetemplate DNA. The samples were heated to 80°C for 2 min andthen allowed to cool to room temperature.Pyrosequencing reactions and data analysis. Pyrosequencingreactions were performed according to the manufacturer’sinstructions using the PSQ 96 SNP Reagent Kit, which containedthe enzyme and substrate mixture and nucleotides. Assayswere performed using the nucleotide dispensation ordersshown in Table 1. The sample genotype and percent heteroplasmywere determined using the allele frequency quantification(AQ) function in the SNP Software (Biotage AB). Sampleswere considered to have the mutation if the value of percentheteroplasmy was greater than three standard deviations fromthe mean value obtained from the normal replicates.Threshold detection of A3243G mutationDNA samples with known levels of heteroplasmy were preparedto determine the lowest level of the A3243G mutationthat could be detected reliably. In 2004, Urata and colleaguesanalyzed 40 healthy donors and MELAS patients using peptidenucleic acid probe-directed PCR clamping and demonstratedthat a mutational load as low as 0.1% can be clinically significant.Therefore, the detection of low frequency heteroplasmyfor this mutation is particularly important. DNA from a MELASpatient was amplified using the primers 5 tgcagccgctattaaaggtt3 and 5 ggttcggttggtctctgcta 3 (amplified region 3014–3894). The resulting 880-bp amplicon was cloned into the vectorpCR2.1 (Invitrogen, Carlsbad, CA) and several colonieswere sequenced to identify 2 clones; one with a wild-type genotypeand the other with the MELAS mutation. DNA from eachclone was quantified and diluted to a final concentration equivalentto 2 10 4 mitochondrial genomes per microliter (dilutedin 10 ng salmon sperm DNA). The wild-type and mutated DNAwere mixed to generate samples with the A3243G mutationpresent at levels ranging from 1%–100%. Each sample was analyzedin triplicate using the Pyrosequencing assay, fluorescentand nonfluorescent PCR-RFLP (using identical primersets), and the detection threshold for each technique was determined.RESULTSSensitivity, specificity, and reproducibilityTo determine the background levels for each Pyrosequencingassay, 15 normal DNA samples were analyzed in six independentexperiments. The mean and standard deviation valuesfor intra and inter assay analysis are shown in Table 2. Nodifferences were observed between the interassay and intra-assayanalysis, which suggests that the background variation seenin these assays is consistent and that the assays are robust. Figure1 shows the genotype and percent heteroplasmy obtainedfrom the 50 patient DNA samples using the Pyrosequencing assayscompared to the results obtained using the routine PCR-RFLP method for all mutated samples. Error bars for the Pyrosequencingdata indicate the standard deviation for triplicateanalysis. Samples were considered to harbor the mutation if theAQ value obtained was greater than three standard deviationsTABLE 2. INTERASSAY AND INTRA-ASSAY ANALYSIS OF FIFTEEN NORMAL SAMPLES TESTED IN SIX INDEPENDENT EXPERIMENTSTO DETERMINE LEVEL OF BACKGROUND DETECTION OF MUTANT ALLELE FOR EACH ASSAYInterassay analysis (n 15) Intra-assay analysis (n 6)StandardStandardMutation Mean deviation Mean deviation Mean 3SDA3460G 2.86 1.62 2.88 1.62 7.72LHONG11778A 0.05 0.14 0.06 0.22 0.72LHONT14484C 2.13 0.63 2.13 0.98 5.07LHONA3243G 0.06 0.07 0.06 0.11 0.39MELASA8344G 0.13 0.32 0.13 0.50 1.63MERRFT8993G/C 0.01 0.02 0.01 0.03 0.04NARP/LeighsSD, standard deviation.
194WHITE ET AL.FIG. 1. Percentage heteroplasmy detected by the Pyrosequencing assays compared to the diagnostic result obtained using nonfluorescentpolymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). A: G3460A. B: G11778A. C:T14484C and fluorescent PCR-RFLP. D: A3243G. E: T8993G/C. F: A8344G. The x axis shows the sample number and the yaxis shows the percentage heteroplasmy detected. In graphs (a) to (c) the 100% heteroplasmy obtained for PCR-RFLP indicatesthat no wild-type product was viewed on a 3% agarose gel after restriction enzyme digestion.from the mean value obtained from the normal replicated samples(Table 2). The genotypes obtained using the Pyrosequencingassays were 100% concordant with those obtained usingPCR-RFLP and the levels of heteroplasmy detected usingboth techniques were essentially identical. Of the 50 patientDNA samples 13 were found to have 1 of the 3 LHON mutations,10 had the A3243G MELAS mutation, 4 were positivefor the MERRF A8344G mutation, 4 carried the NARP/LeighsT8993G/C mutation, and no mutation was detected in 19 samples.None of the samples had the G8994A polymorphism. ThePyrosequencing assays were 100% sensitive and 100% specifictaking into account the respective background values. The determinationof the level of heteroplasmy using the Pyrosequencingassays was highly reproducible. For the mutated samplesanalyzed in triplicate, no deviation from the mean wasobserved for the 3 LHON assays and the coefficient of variancefor the 3243, 8344, and 8993 assays was 1.2–52.7,1.65–5.47, and 0.6–3.5 respectively. Representative pyrogramsobtained for a mutated sample from each assay are shown inFigure 2.Threshold detection of A3243G mutationThe lowest level of detection of the A3243 mutation for thePyrosequencing, nonfluorescent PCR-RFLP and fluorescentPCR-RFLP assay was determined by generating a standardcurve from cloned wild-type and mutated DNA samples thathad been mixed to generate samples with the A3243G mutationpresent at levels of 0%, 1%, 2.5%, 5%, 10%, 20%, 30%,40%, 50%, 60%, 70%, 80%, 90%, and 100%. Figure 3 showsthe standard curves for the Pyrosequencing and fluorescentPCR-RFLP assays for identical samples analyzed in triplicate.A level of 1% heteroplasmy was reliably detected with a meanAQ value of 1.73 (standard deviation 0.84). Results from thefluorescent PCR-RFLP show that 5% heteroplasmy is the limitof detection for this technique. In contrast to the expected linearrelationship between observed and expected heteroplasmylevels for the Pyrosequencing assay an apparent quadratic relationshipwas seen for PCR-RFLP. This may reflect the underrepresentationof heteroplasmy detected because of the formationof heteroduplexes that cannot be cut by the restrictionenzyme. Analysis of the same PCR products by agarose gelelectrophoresis detected the mutation with a sensitivity of only20% (data not shown) which is consistent with other studies(Hancock et al., 2002).Cost-effectiveness and speed of analysisCostings for the Pyrosequencing assays and fluorescentPCR-RFLP using 2004 list prices were comparable to the costper sample being £1.20 (GBP) and £1.17, respectively, excludingsystem costs and machine maintenance contracts. Af-
Page 1 and 2: GENETIC TESTINGVolume 9, Number 3,
Page 3: TABLE 1. SEQUENCES OF OLIGONUCLEOTI
Page 7 and 8: 196detection methods are therefore
Page 9 and 10: 198reference peaks are also incorpo

Accurate Detection and Quantitation of Heteroplasmic Mitochondrial ...

Create successful ePaper yourself

Delete template?

Save as template?