September 2007 - Wadsworth Center

More documents

Recommendations

Info

MOLD DESCRIPTIONSM-1 Malbranchea sp.Source: LungScoring:No. LaboratoriesReferee Laboratories with correct ID: 7Laboratories with correct ID: 54Laboratories with incorrect ID: 23(Arthrographis sp.) (21)(Emmonsia parva) (1)(Trichophyton terrestre) (1)Clinical Significance: Malbranchea sp. is not a known human pathogenic fungus. It has been isolated froma variety of clinical specimens – skin lesions, toe nails, CSF, sinus, etc.Ecology: Malbranchea sp. is found worldwide in soil, decaying vegetation and animal dung.Laboratory Diagnosis:1. Culture – Colonies on Sabouraud dextrose agar and potato dextrose agar were wooly to powdery intexture, grew rapidly, and color ranged from white, pink, buff to brown (Figure 1A). The reverse waswhite, yellow, to buff towards the center (Figure 1B). Like other saprobes, Malbranchea sp. wascycloheximide- sensitive.2. Microscopic morphology – Lactophenol Cotton Blue or Calcofluor mount revealed hyaline, septatehyphae with no conidiophores. Fragmentation of hyphae caused formation of arthroconidia, which hadthe same diameter as that of the hyaline hyphae and alternate with disjunctor cells (Figure 2).3. Differentiation from other molds – Malbranchea sp. produces alternate arthroconidia, which have thesame width as that of the vegetative hyphae. Once this arthroconidia are liberated along with the ‘annularfrills’ (the remnants of disjunctor cells), the fungus closely resembles Coccidioides immitis.Arthrographis sp. can also be confused with Malbranchea species. However Arthrographis sp. producesarthroconidia from conidiophores. There may be some resemblance to Odiodendron sp., which is adematiaceous, arthroconidia-forming fungi. These features are summarized in Table 1.4. In vitro susceptibility testing – The limited susceptibility testing data available showed that this organismwas susceptible to amphotericin B, and azoles like itraconazole, ketoconazole but resistant tofluconazole.5. Molecular tests – Very limited information available. Internal transcribed spacer (ITS) regions can beused for Malbranchea sp. identification.The identity of the test isolate was confirmed in Mycology PTP program by sequencing of its ITS1 andITS2 regions of rDNA. 100% identity was found between this PT specimen and Malbranchea filamentosaUAMH9987 (Genebank accession number: AY177301) for both ITS1 and ITS2 regions.Comments: This specimen was not validated in this test event although it was sent by our programpreviously (Oct. 2000 Test Event). The isolate sent in the present testing event resembled C. immitis.However, the isolate did not grow in the presence of cycloheximide, and also had a negative reaction for C.immitis DNA probe. Many labs reported this isolate as Arthrographis species, which could be easily10
differentiated by presence of conidiophore. It is important to distinguish between Malbranchea species andC. immitis as the later is a highly virulent and increasingly being reported outside of its endemic zone in theSouthwest. Trichophyton terrestre produces 2-6 cells long, cylindrical macroconidia, which are verydifferent from arthroconidia of Malbranchea sp. Emmonsia parva can grow in the presence of cycloheximidebut Malbranchea sp. does not.Sequences alignment:Query 1 CATTAAAGTGTTAAGCCGGCGCCTCCGTGTGCCGGTGAAACTCCACCCTTGACTACTATA 60||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 1 CATTAAAGTGTTAAGCCGGCGCCTCCGTGTGCCGGTGAAACTCCACCCTTGACTACTATA 60Query 61 CCACATGTTGCTTTGGCGGGCCCGCCTCCGGGCCGCCGGGGGCCCTGCCCCTGGCCCGCG 120||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 61 CCACATGTTGCTTTGGCGGGCCCGCCTCCGGGCCGCCGGGGGCCCTGCCCCTGGCCCGCG 120Query 121 CCCGCCAGAGATACACTGAACCCTTTGTGAAATTGGACGTCTGAGTTGATGATCAATCAT 180||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 121 CCCGCCAGAGATACACTGAACCCTTTGTGAAATTGGACGTCTGAGTTGATGATCAATCAT 180Query 181 TAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC 232||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 181 TAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC 232Alignment of primary sequence of the ITS1 regions of Auxarthron filamentosum (anamorph: Malbranchea filamentosa) UAMH9987 and PT specimen Malbranchea sp. NYSDOH 0907.Query 1 CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATC 60||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 214 CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATC 273Query 61 ATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGC 120||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 274 ATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGC 333Query 121 GTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTCGTCCCCCGTGGACGTGCCCG 180||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 334 GTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTCGTCCCCCGTGGACGTGCCCG 393Query 181 AAAGGCAGTGGCGGCGTCCGTTTCGGTGCCCGAGCGTATGGGAACTCTTATACCGCTCGA 240||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 394 AAAGGCAGTGGCGGCGTCCGTTTCGGTGCCCGAGCGTATGGGAACTCTTATACCGCTCGA 453Query 241 AGGGCCCGGCGGCGCTGGTCAGAACCAAATCTTTTACCGGTTGACCTCGGATCAGG 296||||||||||||||||||||||||||||||||||||||||||||||||||||||||AY177301 454 AGGGCCCGGCGGCGCTGGTCAGAACCAAATCTTTTACCGGTTGACCTCGGATCAGG 509Alignment of primary sequence of the ITS2 regions of Auxarthron filamentosum (anamorph: Malbranchea filamentosa) UAMH9987 and PT specimen Malbranchea sp. NYSDOH 0907.Further Reading:1. Brenda, T.J. Jr. and Corey, J.P. 1994. Malbranchea pulchella fungal sinusitis. Otolaryngology – Headand Neck Surgery. 110: 501 – 504.2. Currah, R.S. 1985. Taxonomy of the Onygenales: Arthrodermataceae, Gymnoascaceae, Myxotrichaceae,and Onygenaceae. Mycotaxon. 24: 1 –216.11
Page 3 and 4: CONTENTSContents 3Schedules 4Test S
Page 6 and 7: A failure to attain an overall scor
Page 8 and 9: LABORATORY PERFORMANCE SUMMARYMycol
Page 12 and 13: 3. Kaufman, L., Standard, P.G., Hup
Page 14 and 15: A. B.Figure 1. (A) One-week-old col
Page 16 and 17: Query 121 GTCCGCCGGGGAAAACCAAACCCTG
Page 18 and 19: A. B.Figure 3. (A) Seven-day-old, p
Page 20 and 21: ectangular, of the same diameter as
Page 22 and 23: TABLE 2: Differentiation of Chrysos
Page 24 and 25: M-4 Fusarium sp.Source: NailsScorin
Page 26 and 27: A. B.Figure 7. (L) Seven-day-old, w
Page 28 and 29: A. B.Figure 9. (A) Seven-day-old, w
Page 30 and 31: Query 180 TTGGTTCTGGCATCGATGAAGAACG
Page 32 and 33: YEAST DESCRIPTIONSY-1 Candida dubli
Page 34 and 35: Alignment of primary sequence of th
Page 36 and 37: Y-2 Rhodotorula minutaSource: Cathe
Page 38 and 39: Figure 15. Seven-day-old, soft, smo
Page 40 and 41: Sequences alignment:Query 1 TCCGTAG
Page 42 and 43: Y-4 Candida parapsilosisSource: Sto
Page 44 and 45: 8. Yalaz, M., Akisu, M., Hilmioglu,
Page 46 and 47: Y-5 Trichosporon asahiiSource: Bloo
Page 48 and 49: 5. Panagopoulou, P., Evdoridou, J.,
Page 50 and 51: ANTIFUNGAL SUSCEPTIBILITY TESTINGIn
Page 52 and 53: DIRECT DETECTION (CRYPTOCOCCUS NEOF
Page 54 and 55: Table 4. Summary of quantitative as
Page 56 and 57: 25. Rebell, G. and Taplin, D. 1972.

September 2007 - Wadsworth Center

Create successful ePaper yourself

Delete template?

Save as template?