[Catalyst 2016] Final

More documents

Recommendations

Info

CTTGCGACAGACTTCCTACTCACACTCGCTCACATTGAGCTACTCGATGGGCCATCAGCTTGACCCGCTCTGTAGGGTCGCGATTACGTGAGTTAGGGCTCCGG GCGCTGTATAGTCGAATCTGATCTCGCCCCCACAACTGCAAACCCCAACTTATTTAGATAACATGATTAGCCGAAGTTGCACGGGGTGCCCACCGTGGACTCCT CGGGTGTCGCTCCTTCATCTGACAATATGCAGCCGCTACCACCATCGATTAATACAACGAACGGTGATGTTGTCATAGATTCGGCACATTTCCCTTGTAGGTGTGA CACTTAGCTTCGCGCCGAAGTCTTATGGCAAAACCGATGGACTATGTTTCGGGTAGCACCAGAAGTCTATAGCACGTGCATCCCAACGTGGCGTGCGTACACCT dangers TCACCGCTTCATGCTAAGGTCCTGGCTGCATGCTATGTTGATACGCCTGCACTGCTCGAAGAAAATATACGAAGCGGGCGGCCTGGCCGGAGCACTACCGCAT CGCGTATTCGAATACTGTTAATTGCTCACACATGAGCAAAATAGTAGACCGTCAATTTCAGCCCTCTTATCCTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATT of TCTATGACGGTATCTGCTGATGGGTAGGGAGACCCAGAATCTATCGGCCTATGTCACTAAAACTTTCCAAACACCCCATGTCGATACTGAACGAATCGACGCAC CCCTTCCTTGAAAACGCACAATCATACAACTGGGCACATAATGCGTACGCCCATCTAATACATCCAACTCTCTAGGTCCTGTTCAAGAGCTGGAAGAGCACCCTC TTGGTCAAGTGATATCCTCGTAAGGCAAGCTCGTACCGTCATTCATGCGGAAGGGGTAAGACCATTAGAAGTAGGGATAGTCCCGAACCTCACTTACCACTCCC AAGGGATCCCTGTCTGAAGGATGAGTG dna AATAAGGGATCCCTGTCTGAAGGATGAGTGTCAATAAGGGATCCCTGTCTGAAGGATGAGTGTCAATAAGGGATCC profiling CTTGCGACAGACTTCCTACTCACACTCGCTCACATTGAGCTACTCGATGGGCCATCAGCTTGACCCGCTCTGTAGGGTCGCGATTACGTGAGTTAGGGCTCCGG GCGCTGTATAGTCGAATCTGATCTCGCCCCCACAACTGCAAACCCCAACTTATTTAGATAACATGATTAGCCGAAGTTGCACGGGGTGCCCACCGTGGACTCCT CGGGTGTCGCTCCTTCATCTGACAATATGCAGCCGCTACCACCATCGATTAATACAACGAACGGTGATGTTGTCATAGATTCGGCACATTTCCCTTGTAGGTGTGA CACTTAGCTTCGCGCCGAAGTCTTATGGCAAAACCGATGGACTATGTTTCGGGTAGCACCAGAAGTCTATAGCACGTGCATCCCAACGTGGCGTGCGTACACCT TCACCGCTTCATGCTAAGGTCCTGGCTGCATGCTATGTTGATACGCCTGCACTGCTCGAAGAAAATATACGAAGCGGGCGGCCTGGCCGGAGCACTACCGCAT rishi suresh CGCGTATTCGAATACTGTTAATTGCTCACACATGAGCAAAATAGTAGACCGTCAATTTCAGCCCTCTTATCCTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATT TGCCTTG DNA profiling has radically changed forensics from generation to generation. Erlich was CGACAG by providing an objectively verifiable method able to use the Y chromosome’s STR marker ACTTCCT for linking suspects to crimes. Currently, to identify the last names of the individuals ACTCACA many states collect the DNA of felons in order to whom the DNA belonged by using easily to ensure that repeat offenders are caught accessible genealogy sites. 3 With just a CTCGCTC and convicted efficiently. 1 Over the past few computer and access to genome data, Erlich ACATTGA years, situations in which law enforcement could identify personal information in DNA officials can collect DNA from suspects have registries. Clearly, the creation of a national GCTACTC increased drastically. In 2013, President DNA database could give rise to widespread GATGGG Obama strongly supported the creation of a privacy concerns. Though there are large national DNA database that included samples fines associated with unauthorized disclosure CCATCAG from not only people who are convicted, or acquisition of DNA data, current federal CTTGACC but also those arrested. 1 In Maryland v. King regulations do not technically limit health (2013), the Supreme Court declared that law insurance companies from using genome CGCTCTG enforcement officials are justified in collecting mining in order to determine life insurance or TAGGGTC DNA prior to conviction if it aids in solving a disability care. 4 criminal case. GCGATTA 2 In the years since this decision, the creation of a national DNA database Hacking of federal databases is not an TACGTGA has become a particularly polarizing and unreasonable scenario — just this past July, contentious issue. Proponents argue that a sensitive information including the addresses, GTTAGGG database would dramatically improve the health history, and financial history of CTCCGG ability of law enforcement to solve crimes. over 20 million individuals was stolen in a However, detractors argue that the potential massive cyber-attack. ACTGCGC 4 That attack uncovered for misuse of genetic information is too great information about every single individual TGTATAG to warrant the creation of such a system. who has attempted to work or has worked TCGAATC TGATCTC GCCCCC “IT IS REASONABLE TO CONCLUDE THAT MERELY HAVING AN EXTRA Y ACAACTG CHROMOSOME DOES NOT PREDISPOSE SOMEONE TO BE VIOLENT; CAAACCC RATHER, A WIDE VARIETY OF SOCIAL FACTORS PLAY A ROLE” CAACTTA TTTAGAT DNA is popularly referred to as the in the United States government. A similar AACATG “blueprint of life” and contains extremely abuse of genetic information by third parties sensitive information such as an individual’s is undoubtedly a danger associated with a ATTAGCC susceptibility to genetic disorders. One of national DNA database. Despite advances GAAGTT the major arguments against the creation in federal protections such as the Genetic of a national DNA database is that such Information Nondiscrimination Act, there GCACGG information could be hacked. Yaniv Erlich, a are still numerous instances where genetic GGTGCC geneticist at MIT, illustrated this when he used information regarding disease is used in “genome mining” to find the true identities employment decisions. CACCGTG 5 of individuals in a national genome registry. GACTCCT In his study, Erlich obtained genomes from Another potential issue associated with the CCCGGG the 1000 Genomes Project, a large database creation of a DNA database is the notion of used for scientific research. He then used genetic essentialism. Genetic essentialism GTCGCTC a computer algorithm to search for specific argues that the genes of an individual can CTTCATC DNA sequences known as short tandem predict behavioral outcomes. 6 Critics of a repeats (STRs) on the Y chromosome of national DNA database argue that certain TGACAAT males. These STRs are remarkably invariable factors—such as the extra Y chromosome— 3 CATALYST ATGCAGC GACAATCAT !
may lead law enforcement officials to suspect certain individuals more than others, which sets up a dangerous precedent. The notion that chromosomal abnormalities can alter behavioral outcomes has generated numerous studies examining the link between criminality and changes in sex chromosomes— the genes that determine whether an individual is male or female. Normally, females will have two X chromosomes, whereas males have one X chromosome and one Y chromosome. However, in rare cases, males can either have an extra X chromosome (XXY) or an extra Y chromosome (XYY). General literature review suggests that XXY men have feminine characteristics and are substantially less aggressive than XYY or XY men. 7 Conversely, studies like Jacobs et al. have suggested that the XYY condition can lead to increased aggression in individuals. 8 However, Alice Theilgaard, one of the most prominent researchers on this topic, found that most behavioral characteristics associated with the XYY chromosomal abnormality are controversial. 7 Even tests based on objective measures, like testosterone levels, have been inconclusive. Thus, Theilgaard argues that the XYY chromosomal abnormality does not cause increased aggression or propensity to commit crimes. Rather, she states that the criminality of XYY individuals might be a socially constructed phenomenon. XYY individuals often have severe acne, lowered intellect, and unusual height. This makes it difficult for people with this condition to “fit in.” As a result of their physical characteristics, XYY individuals might feel ostracized and become antisocial. 8 Thus, it is reasonable to conclude that merely having an extra Y chromosome does not predispose someone to be violent; rather a wide variety of social factors play a role. It is entirely plausible that law enforcement individuals could misinterpret genetic information. For example, they could mistakenly believe that an individual with the XYY condition is more likely to be a suspect for a violent crime. Such an assumption would hinder law enforcement officials from objectively evaluating the evidence involved in a crime and shift the focus to individual characteristics of particular suspects. People in favor of a national DNA database often argue that it would be a great method of solving crimes. Specifically, some officials argue that a database would prevent recidivism (a relapse in criminal behavior) and deter people from committing crimes. However, research done by Dr. Avinash Bhati suggests that the inclusion of DNA in a national registry only seems to reduce recidivism for burglaries and robberies; in other crime categories, recidivism is generally unaffected. 9 This suggests that a convict’s knowledge that he/she is in a DNA database is not a true deterrent. The concerns raised by this study should show that databases might not be as effective a crime-fighting tools as proponents suggest. “HAVING SENSITIVE GENETIC INFORMATION IN ONE CENTRALIZED DATABASE COULD POTENTIALLY LEAD TO ABUSE AND DISCRIMINATORY BEHAVIORS BY PARTIES THAT HAVE ACCESS TO THAT INFORMATION” Both genome mining and genetic essentialism present very real harms associated with the creation of a national DNA database. Having sensitive genetic information in one centralized registry could potentially lead to abuse and discriminatory behaviors by parties that have access to that information. Even if genome databases are strictly regulated, the possibility of that information being hacked still exists. Furthermore, assuming that genetics are the only determinants of behavior could lead to people with genetic abnormalities being suspected of crimes at a higher rate than “normal” individuals. Social factors often shape the way an individual acts; the possibility of law enforcement officials embracing the genetic essentialism approach is another associated harm. In the end, it seems that the negative consequences associated with the creation of a national DNA database outweigh the benefits. WORKS CITED: [1] Barnes, R. Supreme Court upholds Maryland law, says police may take DNA samples from arrestees. Washington Post, https://www. washingtonpost.com/politics/supreme-courtupholds-maryland-law-says-police-may-take-dnasamples-from-arrestees/2013/06/03/0b619adecc5a-11e2-8845-d970ccb04497_story.html (accessed 2015). [2] Wolf, R. Supreme Court OKs DNA swab of people under arrest. USA Today, http://www. usatoday.com/story/news/politics/2013/06/03/ supreme-court-dna-cheek-swab-rape-unsolvedcrimes/2116453/ (accessed 2015). [3] Ferguson, W. A Hacked Database Prompts Debate about Genetic Privacy. Scientific American, http://www.scientificamerican.com/ article/a-hacked-database-prompts/ (accessed 2015). [4] Davis, J. Hacking of Government Computers Exposed 21.5 Million People. The New York Times, http://www.nytimes.com/2015/07/10/us/ office-of-personnel-management-hackers-gotdata-of-millions.html?_r=0 (accessed 2015). [5] Berson, S. Debating DNA Collection. National Institute of Justice, http://www.nij.gov/ journals/264/pages/debating-dna.aspx (accessed 2015). [6] Coming to Terms with Genetic Information. Australian Law Reform Commission , http://www. alrc.gov.au/publications/3-coming-terms-geneticinformation/dangers-‘genetic-essentialism’ (accessed 2015). [7] Are XYY males more prone to aggressive behavior than XY males? Science Clarified, http:// www.scienceclarified.com/dispute/vol-1/are-xyymales-more-prone-to-aggressive-behavior-thanxy-males.html (accessed 2015). [8] Dar-Nimrod, I.; Heine, S. Genetic Essentialism: On the Deceptive Determinism of DNA. Psychological Bulletin, http://www.ncbi.nlm.nih. gov/pmc/articles/pmc3394457/ (accessed 2015) [9] Bhati, A. Quantifying The Specific Deterrent Effects of DNA Databases. PsycEXTRA Dataset. 2011. https://www.ncjrs.gov/app/publications/ abstract.aspx?id=258313 (accessed May 2015). DESIGN BY Kris Sheng, Gloria Kim Normal Male Sex Chromosome: XY Abonormal Male Sex Chromosome: XYY and XXY People with XXY chromosome: female-like characteristics and substantially less aggressive People with XYY chromosome: more aggressive 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 (sex chromosome) THIS ARTICLE IS FROM ICSJ <strong>2016</strong> SEE PG 27 FOR MORE INFORMATION CATALYST 4
Page 1 and 2: VOLUME 9, 2016 RICE UNDERGRADUATE S
Page 3 and 4: TALYST SECTION DIVIDER IDEAS T SECT
Page 5: PRINTING: LITTLE LONGER is very imp
Page 9 and 10: 1877 Giovanni Schiaparelli observes
Page 11 and 12: was shown to cause no damage. Sumpt
Page 13 and 14: "The brain size of the discovered h
Page 15 and 16: PHOTOS FROM WIKIMEDIA COMMONS BUREA
Page 17 and 18: BY ELAINE SHEN and can have as many
Page 19 and 20: PHOTO FROM: USER: ROBIAND ON WIKIME
Page 21 and 22: “WITH AN ESTIMATED 40 MILLION IND
Page 23 and 24: Microglia often experience increase
Page 25 and 26: O O n n PCL Polymer Illustration of
Page 27 and 28: PRESCRIPTION PILLS Adderall and Rit
Page 29 and 30: An important factor of GNP therapy
Page 31 and 32: DEVELOPMENTS IN BONE REGENERATIVE M
Page 33 and 34: second most rigid. In general, G-PB
Page 35 and 36: DNA METHYLATION & ITS IMPLICATIONS
Page 37 and 38: BUT FIRST, LET ME TAKE A SELFIE The
Page 39 and 40: THE CHEMISTRY C oF COFFEE ollege st

[Catalyst 2016] Final

Create successful ePaper yourself

Delete template?

Save as template?