Turkish Journal of Hematology Volume: 35 - Issue: 1
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
Volume 35 Issue 1 March 2018 80 TL
ISSN 1300-7777
Review
Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and
New Antifungal Therapies
Maria N. Gamaletsou, et al.; Leeds, United Kingdom; New York, USA; Athens, Greece
Research Articles
A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements,
and Challenges in Prevention
Yeşim Aydınok, et al.; Hemoglobinopathy Study Group, Turkey
Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia
Stella Genitsari, et al.; Crete, Athens, Greece
Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients
Özlem Tüfekçi, et al.; İzmir, Ankara, Samsun, Kayseri, İstanbul, Kocaeli, Antalya, Konya, Bursa, Trabzon, Turkey
Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis
Seçil Vural, et al.; Ankara, Turkey
The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells
Hossein Nikkhah, et al.; Tabriz, Sari, Iran; Minnesota, USA
NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques – Sanger Sequencing,
Pyrosequencing, and Real-Time Polymerase Chain Reaction
Dushyant Kumar, et al.; Guwahati, New Delhi, India
Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study
Mehmet Özen, et al.; Ankara, Turkey
Cover Picture:
Jakub Debski et al.
Ascites in the Course of
Plasma Cell Myeloma
Complicated by AL Amyloidosis
1
Editor-in-Chief
Reyhan Küçükkaya
İstanbul, Turkey
rkucukkaya@hotmail.com
Associate Editors
Ayşegül Ünüvar
İstanbul, Turkey
aysegulu@hotmail.com
Cengiz Beyan
TOBB University of Economics and Technology,
Ankara, Turkey
cengizbeyan@hotmail.com
Hale Ören
Dokuz Eylül University, İzmir, Turkey
hale.oren@deu.edu.tr
İbrahim C. Haznedaroğlu
Hacettepe University, Ankara, Turkey
haznedar@yahoo.com
M. Cem Ar
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
mcemar68@yahoo.com
Selami Koçak Toprak
Ankara University, Ankara, Turkey
sktoprak@yahoo.com
Semra Paydaş
Çukurova University, Adana, Turkey
sepay@cu.edu.tr
Assistant Editors
A. Emre Eşkazan
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
Ali İrfan Emre Tekgündüz
Dr. A. Yurtaslan Ankara Oncology Training and
Research Hospital, Ankara, Turkey
Claudio Cerchione
University of Naples Federico II Napoli,
Campania, Italy
Elif Ünal İnce
Ankara University, Ankara, Turkey
İnci Alacacıoğlu
Dokuz Eylül University, İzmir, Turkey
Müge Sayitoğlu
İstanbul University, İstanbul, Turkey
Nil Güler
Ondokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay
Koç University, İstanbul, Turkey
Şule Ünal
Hacettepe University, Ankara, Turkey
Veysel Sabri Hançer
İstinye University, İstanbul, Turkey
Zühre Kaya
Gazi University, Ankara, Turkey
International Review Board
Nejat Akar
Görgün Akpek
Serhan Alkan
Çiğdem Altay
Koen van Besien
Ayhan Çavdar
M. Sıraç Dilber
Ahmet Doğan
Peter Dreger
Thierry Facon
Jawed Fareed
Gösta Gahrton
Dieter Hoelzer
Marilyn Manco-Johnson
Andreas Josting
Emin Kansu
Winfried Kern
Nigel Key
Korgün Koral
Abdullah Kutlar
Luca Malcovati
Robert Marcus
Jean Pierre Marie
Ghulam Mufti
Gerassimos A. Pangalis
Antonio Piga
Ananda Prasad
Jacob M. Rowe
Jens-Ulrich Rüffer
Norbert Schmitz
Orhan Sezer
Anna Sureda
Ayalew Tefferi
Nükhet Tüzüner
Catherine Verfaillie
Srdan Verstovsek
Claudio Viscoli
Past Editors
Erich Frank
Orhan Ulutin
Hamdi Akan
Aytemiz Gürgey
Senior Advisory Board
Yücel Tangün
Osman İlhan
Muhit Özcan
Teoman Soysal
Ahmet Muzaffer Demir
TOBB Economy Technical University Hospital, Ankara, Turkey
Maryland School of Medicine, Baltimore, USA
Cedars-Sinai Medical Center, USA
Ankara, Turkey
Chicago Medical Center University, Chicago, USA
Ankara, Turkey
Karolinska University, Stockholm, Sweden
Mayo Clinic Saint Marys Hospital, USA
Heidelberg University, Heidelberg, Germany
Lille University, Lille, France
Loyola University, Maywood, USA
Karolinska University Hospital, Stockholm, Sweden
Frankfurt University, Frankfurt, Germany
Colorado Health Sciences University, USA
University Hospital Cologne, Cologne, Germany
Hacettepe University, Ankara, Turkey
Albert Ludwigs University, Germany
University of North Carolina School of Medicine, NC, USA
Southwestern Medical Center, Texas, USA
Georgia Health Sciences University, Augusta, USA
Pavia Medical School University, Pavia, Italy
Kings College Hospital, London, UK
Pierre et Marie Curie University, Paris, France
King’s Hospital, London, UK
Athens University, Athens, Greece
Torino University, Torino, Italy
Wayne State University School of Medicine, Detroit, USA
Rambam Medical Center, Haifa, Israel
University of Köln, Germany
AK St Georg, Hamburg, Germany
Memorial Şişli Hospital, İstanbul, Turkey
Santa Creu i Sant Pau Hospital, Barcelona, Spain
Mayo Clinic, Rochester, Minnesota, USA
İstanbul Cerrahpaşa University, İstanbul, Turkey
University of Minnesota, Minnesota, USA
The University of Texas MD Anderson Cancer Center, Houston, USA
San Martino University, Genoa, Italy
Language Editor
Leslie Demir
Statistic Editor
Hülya Ellidokuz
Editorial Office
İpek Durusu
Bengü Timoçin
A-I
Publishing
Services
GALENOS PUBLISHER
Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey
Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr
Contact Information
Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya
E-mail : rkucukkaya@hotmail.com
All Inquiries Should be Addressed to
TURKISH JOURNAL OF HEMATOLOGY
Address : Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey
Phone : +90 312 490 98 97
Fax : +90 312 490 98 68
E-mail : info@tjh.com.tr
ISSN: 1300-7777
Publishing Manager
Sorumlu Yazı İşleri Müdürü
Muhlis Cem Ar
Management Address
Yayın İdare Adresi
Türk Hematoloji Derneği
Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.)
No: 8 06550 Çankaya, Ankara / Turkey
Online Manuscript Submission
http://mc.manuscriptcentral.com/tjh
Web page
www.tjh.com.tr
Owner on behalf of the Turkish Society of Hematology
Türk Hematoloji Derneği adına yayın sahibi
Güner Hayri Özsan
International scientific journal published quarterly.
Üç ayda bir yayımlanan İngilizce süreli yayındır.
Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish
Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi
tarafından yayınlanmasına karar vermiştir.
Publishing House / Yayınevi
Molla Gürani Mah. Kaçamak Sk. No: 21, 34093
Fındıkzade, İstanbul, Turkey
Tel: +90 212 621 99 25 Fax: +90 212 621 99 27
E-mail: info@galenos.com.tr
Print: Creative Basım Ltd. Şti.
Litros Yolu 2. Matbaacılar Sit. ZD1 Topkapı, İstanbul-Turkey
Phone: +90 212 709 75 25
www.Creativebasim.com
Printing Date / Basım Tarihi
25.02.2018
Cover Picture
Jakub Debski et al.,
Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis
Microscopic evaluation of plasmacytes and plasmablasts in an ascitic fluid
smear (modified Wright-Giemsa stain, 400 x ).
A-II
AIMS AND SCOPE
The Turkish Journal of Hematology is published quarterly (March, June,
September, and December) by the Turkish Society of Hematology. It is an
independent, non-profit peer-reviewed international English-language
periodical encompassing subjects relevant to hematology.
The Editorial Board of The Turkish Journal of Hematology adheres to
the principles of the World Association of Medical Editors (WAME),
International Council of Medical Journal Editors (ICMJE), Committee on
Publication Ethics (COPE), Consolidated Standards of Reporting Trials
(CONSORT) and Strengthening the Reporting of Observational Studies in
Epidemiology (STROBE).
The aim of The Turkish Journal of Hematology is to publish original
hematological research of the highest scientific quality and clinical
relevance. Additionally, educational material, reviews on basic
developments, editorial short notes, images in hematology, and letters
from hematology specialists and clinicians covering their experience and
comments on hematology and related medical fields as well as social
subjects are published. As of December 2015, The Turkish Journal of
Hematology does not accept case reports. Important new findings or data
about interesting hematological cases may be submitted as a brief report.
General practitioners interested in hematology and internal medicine
specialists are among our target audience, and The Turkish Journal of
Hematology aims to publish according to their needs. The Turkish Journal
of Hematology is indexed, as follows:
- PubMed Medline
- PubMed Central
- Science Citation Index Expanded
- EMBASE
- Scopus
- CINAHL
- Gale/Cengage Learning
- EBSCO
- DOAJ
- ProQuest
- Index Copernicus
- Tübitak/Ulakbim Turkish Medical Database
- Turk Medline
Impact Factor: 0.686
Open Access Policy
Turkish Journal of Hematology is an Open Access journal. This journal
provides immediate open access to its content on the principle that
making research freely available to the public supports a greater global
exchange of knowledge.
Open Access Policy is based on the rules of the Budapest Open Access
Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.
Subscription Information
The Turkish Journal of Hematology is sent free-of-charge to members
of Turkish Society of Hematology and libraries in Turkey and abroad.
Hematologists, other medical specialists that are interested in hematology,
and academicians could subscribe for only 40 $ per printed issue. All
published volumes are available in full text free-of-charge online at www.
tjh.com.tr.
Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya,
Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Permissions
Requests for permission to reproduce published material should be sent to
the editorial office.
Editor: Professor Dr. Reyhan Küçükkaya
Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya,
Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Publisher
Galenos Yayınevi
Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey
Telephone : +90 212 621 99 25
Fax : +90 212 621 99 27
info@galenos.com.tr
Instructions for Authors
Instructions for authors are published in the journal and at www.tjh.com.tr
Material Disclaimer
Authors are responsible for the manuscripts they publish in The Turkish
Journal of Hematology. The editor, editorial board, and publisher do not
accept any responsibility for published manuscripts.
If you use a table or figure (or some data in a table or figure) from another
source, cite the source directly in the figure or table legend.
The journal is printed on acid-free paper.
Editorial Policy
Following receipt of each manuscript, a checklist is completed by the
Editorial Assistant. The Editorial Assistant checks that each manuscript
contains all required components and adheres to the author guidelines,
after which time it will be forwarded to the Editor in Chief. Following the
Editor in Chief’s evaluation, each manuscript is forwarded to the Associate
Editor, who in turn assigns reviewers. Generally, all manuscripts will be
reviewed by at least three reviewers selected by the Associate Editor, based
on their relevant expertise. Associate editor could be assigned as a reviewer
along with the reviewers. After the reviewing process, all manuscripts are
evaluated in the Editorial Board Meeting.
Turkish Journal of Hematology’s editor and Editorial Board members are
active researchers. It is possible that they would desire to submit their
manuscript to the Turkish Journal of Hematology. This may be creating
a conflict of interest. These manuscripts will not be evaluated by the
submitting editor(s). The review process will be managed and decisions
made by editor-in-chief who will act independently. In some situation, this
process will be overseen by an outside independent expert in reviewing
submissions from editors.
A-III
TURKISH JOURNAL OF HEMATOLOGY
INSTRUCTIONS FOR AUTHORS
The Turkish Journal of Hematology accepts invited review articles, research
articles, brief reports, letters to the editor, and hematological images that
are relevant to the scope of hematology, on the condition that they have
not been previously published elsewhere. Basic science manuscripts,
such as randomized, cohort, cross-sectional, and case-control studies,
are given preference. All manuscripts are subject to editorial revision
to ensure they conform to the style adopted by the journal. There is a
double-blind reviewing system. Review articles are solicited by the Editorin-Chief.
Authors wishing to submit an unsolicited review article should
contact the Editor-in-Chief prior to submission in order to screen the
proposed topic for relevance and priority.
The Turkish Journal of Hematology does not charge any article submission
or processing charges.
Manuscripts should be prepared according to ICMJE guidelines (http://
www.icmje.org/). Original manuscripts require a structured abstract. Label
each section of the structured abstract with the appropriate subheading
(Objective, Materials and Methods, Results, and Conclusion). Letters to
the editor do not require an abstract. Research or project support should
be acknowledged as a footnote on the title page. Technical and other
assistance should be provided on the title page.
Original Manuscripts
Title Page
Title: The title should provide important information regarding the
manuscript’s content. The title must specify that the study is a cohort
study, cross-sectional study, case-control study, or randomized study (i.e.
Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability
of ferrous succinate tablet formulations without correction for baseline
circadian changes in iron concentration in healthy Chinese male
subjects: A single-dose, randomized, 2-period crossover study. Clin Ther
2011;33:2054-2059).
The title page should include the authors’ names, degrees, and institutional/
professional affiliations and a short title, abbreviations, keywords, financial
disclosure statement, and conflict of interest statement. If a manuscript
includes authors from more than one institution, each author’s name
should be followed by a superscript number that corresponds to their
institution, which is listed separately. Please provide contact information
for the corresponding author, including name, e-mail address, and
telephone and fax numbers.
Running Head: The running head should not be more than 40 characters,
including spaces, and should be located at the bottom of the title page.
Word Count: A word count for the manuscript, excluding abstract,
acknowledgments, figure and table legends, and references, should be
provided and should not exceed 2500 words. The word count for the
abstract should not exceed 300 words.
Conflict of Interest Statement: To prevent potential conflicts of
interest from being overlooked, this statement must be included in each
manuscript. In case there are conflicts of interest, every author should
complete the ICMJE general declaration form, which can be obtained at
http://www.icmje.org/downloads/coi_disclosure.zip
Abstract and Keywords: The second page should include an abstract
that does not exceed 300 words. For manuscripts sent by authors in
Turkey, a title and abstract in Turkish are also required. As most readers
read the abstract first, it is critically important. Moreover, as various
electronic databases integrate only abstracts into their index, important
findings should be presented in the abstract.
Objective: The abstract should state the objective (the purpose of the
study and hypothesis) and summarize the rationale for the study.
Materials and Methods: Important methods should be written
respectively.
Results: Important findings and results should be provided here.
Conclusion: The study’s new and important findings should be
highlighted and interpreted.
Other types of manuscripts, such as reviews, brief reports, and
editorials, will be published according to uniform requirements.
Provide 3-10 keywords below the abstract to assist indexers. Use
terms from the Index Medicus Medical Subject Headings List
(for randomized studies a CONSORT abstract should be provided: http://
www.consort-statement.org).
Introduction: The introduction should include an overview of the
relevant literature presented in summary form (one page), and whatever
remains interesting, unique, problematic, relevant, or unknown about
the topic must be specified. The introduction should conclude with the
rationale for the study, its design, and its objective(s).
Materials and Methods: Clearly describe the selection of observational
or experimental participants, such as patients, laboratory animals, and
controls, including inclusion and exclusion criteria and a description of the
source population. Identify the methods and procedures in sufficient detail
to allow other researchers to reproduce your results. Provide references
to established methods (including statistical methods), provide references
to brief modified methods, and provide the rationale for using them and
an evaluation of their limitations. Identify all drugs and chemicals used,
including generic names, doses, and routes of administration. The section
should include only information that was available at the time the plan
or protocol for the study was devised (https://www.strobe-statement.org/
fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined.
pdf).
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
A-IV
the reported results. Statistically important data should be given in the
text, tables, and figures. Provide details about randomization, describe
treatment complications, provide the number of observations, and specify
all computer programs used.
Results: Present your results in logical sequence in the text, tables, and
figures. Do not present all the data provided in the tables and/or figures
in the text; emphasize and/or summarize only important findings, results,
and observations in the text. For clinical studies provide the number of
samples, cases, and controls included in the study. Discrepancies between
the planned number and obtained number of participants should be
explained. Comparisons and statistically important values (i.e. p-value
and confidence interval) should be provided.
Discussion: This section should include a discussion of the data. New and
important findings/results and the conclusions they lead to should be
emphasized. Link the conclusions with the goals of the study, but avoid
unqualified statements and conclusions not completely supported by
the data. Do not repeat the findings/results in detail; important findings/
results should be compared with those of similar studies in the literature,
along with a summarization. In other words, similarities or differences in
the obtained findings/results with those previously reported should be
discussed.
Study Limitations: Limitations of the study should be detailed. In
addition, an evaluation of the implications of the obtained findings/
results for future research should be outlined.
Conclusion: The conclusion of the study should be highlighted.
References
Cite references in the text, tables, and figures with numbers in square
brackets. Number references consecutively according to the order in
which they first appear in the text. Journal titles should be abbreviated
according to the style used in Index Medicus (consult List of Journals
Indexed in Index Medicus). Include among the references any paper
accepted, but not yet published, designating the journal followed by “in
press”.
Examples of References:
1. List all authors
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow
transplantation from unrelated donors for patients with aplastic anemia
after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.
2. Organization as author
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of
syngeneic bone marrow graft without preconditioning in post-hepatitis
marrow aplasia. Lancet 1977;2:742-744.
3. Book
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger,
1961.
4. Book Chapter
Perutz MF. Molecular anatomy and physiology of hemoglobin. In:
Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:
Genetics, Pathophysiology, Clinical Management. New York, Cambridge
University Press, 2000.
5. Abstract
Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)
stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).
6. Letter to the Editor
Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further
definition of 20q deletion in myeloid leukemia using fluorescence in situ
hybridization. Blood 1994;84:2821-2823.
7. Supplement
Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant
2005;9(Suppl 7):81-86.
Brief Reports
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1200 words.
Introduction: State the purpose and summarize the rationale for the study.
Materials and Methods: Clearly describe the selection of the observational
or experimental participants. Identify the methods and procedures in
sufficient detail. Provide references to established methods (including
statistical methods), provide references to brief modified methods, and
provide the rationale for their use and an evaluation of their limitations.
Identify all drugs and chemicals used, including generic names, doses, and
routes of administration.
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported findings/results. Provide details about randomization,
describe treatment complications, provide the number of observations,
and specify all computer programs used.
Results: Present the findings/results in a logical sequence in the text,
tables, and figures. Do not repeat all the findings/results in the tables and
figures in the text; emphasize and/or summarize only those that are most
important.
Discussion: Highlight the new and important findings/results of the
study and the conclusions they lead to. Link the conclusions with the
goals of the study, but avoid unqualified statements and conclusions not
completely supported by your data.
Invited Review Articles
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 4000 words.
Review articles should not include more than 100 references. Reviews
should include a conclusion, in which a new hypothesis or study about the
A-V
subject may be posited. Do not publish methods for literature search or
level of evidence. Authors who will prepare review articles should already
have published research articles on the relevant subject. The study’s new
and important findings should be highlighted and interpreted in the
Conclusion section. There should be a maximum of two authors for review
articles.
Images in Hematology
Article length: Not to exceed 200 words.
Authors can submit for consideration illustrations or photos that are
interesting, instructive, and visually attractive, along with a few lines of
explanatory text and references. Images in Hematology can include no
more than 200 words of text, 5 references, and 3 figures or tables. No
abstract, discussion, or conclusion is required, but please include a brief
title.
Letters to the Editor
Article length: Not to exceed 500 words.
Letters can include no more than 500 words of text, 5-10 references, and
1 figure or table. No abstract is required, but please include a brief title.
Tables
Supply each table in a separate file. Number tables according to the order
in which they appear in the text, and supply a brief caption for each.
Give each column a short or abbreviated heading. Write explanatory
statistical measures of variation, such as standard deviation or standard
error of mean. Be sure that each table is cited in the text.
Figures
Figures should be professionally drawn and/or photographed. Authors
should number figures according to the order in which they appear in the
text. Figures include graphs, charts, photographs, and illustrations. Each
figure should be accompanied by a legend that does not exceed 50 words.
Use abbreviations only if they have been introduced in the text. Authors
are also required to provide the level of magnification for histological
slides. Explain the internal scale and identify the staining method used.
Figures should be submitted as separate files, not in the text file. Highresolution
image files are not preferred for initial submission as the file
sizes may be too large. The total file size of the PDF for peer review should
not exceed 5 MB.
Authorship
Each author should have participated sufficiently in the work to assume
public responsibility for the content. Any portion of a manuscript that
is critical to its main conclusions must be the responsibility of at least
one author.
Contributor’s Statement
All submissions should contain a contributor’s statement page. Each
statement should contain substantial contributions to idea and design,
acquisition of data, and analysis and interpretation of findings. All
persons designated as an author should qualify for authorship, and all
those that qualify should be listed. Each author should have participated
sufficiently in the work to take responsibility for appropriate portions of
the text.
Acknowledgments
Acknowledge support received from individuals, organizations, grants,
corporations, and any other source. For work involving a biomedical
product or potential product partially or wholly supported by corporate
funding, a note stating, “This study was financially supported (in part)
with funds provided by (company name) to (authors’ initials)”, must
be included. Grant support, if received, needs to be stated and the
specific granting institutions’ names and grant numbers provided when
applicable.
Authors are expected to disclose on the title page any commercial or
other associations that might pose a conflict of interest in connection
with the submitted manuscript. All funding sources that supported the
work and the institutional and/or corporate affiliations of the authors
should be acknowledged on the title page.
Ethics
When reporting experiments conducted with humans indicate that
the procedures were in accordance with ethical standards set forth
by the committee that oversees human subject research. Approval of
research protocols by the relevant ethics committee, in accordance
with international agreements (Helsinki Declaration of 1975, revised
2013 available at https://www.wma.net/policies-post/wma-declarationof-helsinki-ethical-principles-for-medical-research-involving-humansubjects/),
is required for all experimental, clinical, and drug studies.
Patient names, initials, and hospital identification numbers should not
be used. Manuscripts reporting the results of experimental investigations
conducted with humans must state that the study protocol received
institutional review board approval and that the participants provided
informed consent.
Non-compliance with scientific accuracy is not in accord with scientific
ethics. Plagiarism: To re-publish, in whole or in part, the contents of
another author’s publication as one’s own without providing a reference.
Fabrication: To publish data and findings/results that do not exist.
Duplication: Use of data from another publication, which includes republishing
a manuscript in different languages. Salami slicing: To create
more than one publication by dividing the results of a study unnecessarily.
We disapprove of such unethical practices as plagiarism, fabrication,
duplication, and salami slicing, as well as efforts to influence the
review process with such practices as gifting authorship, inappropriate
acknowledgments, and references. Additionally, authors must respect
participants‘ right to privacy.
On the other hand, short abstracts published in congress books that do
not exceed 400 words and present data of preliminary research, and
A-VI
those that are presented in an electronic environment, are not considered
as previously published work. Authors in such a situation must declare
this status on the first page of the manuscript and in the cover letter.
(The COPE flowchart is available at http://publicationethics.org.)
We use iThenticate to screen all submissions for plagiarism before
publication.
Conditions of Publication
All authors are required to affirm the following statements before their
manuscript is considered: 1. The manuscript is being submitted only
to The Turkish Journal of Hematology; 2. The manuscript will not be
submitted elsewhere while under consideration by The Turkish Journal
of Hematology; 3. The manuscript has not been published elsewhere,
and should it be published in The Turkish Journal of Hematology it will
not be published elsewhere without the permission of the editors (these
restrictions do not apply to abstracts or to press reports for presentations
at scientific meetings); 4. All authors are responsible for the manuscript’s
content; 5. All authors participated in the study concept and design,
analysis and interpretation of the data, and drafting or revising of the
manuscript and have approved the manuscript as submitted. In addition,
all authors are required to disclose any professional affiliation, financial
agreement, or other involvement with any company whose product
figures prominently in the submitted manuscript.
Authors of accepted manuscripts will receive electronic page proofs and
are responsible for proofreading and checking the entire article within
two days. Failure to return the proof in two days will delay publication. If
the authors cannot be reached by email or telephone within two weeks,
the manuscript will be rejected and will not be published in the journal.
Copyright
At the time of submission all authors will receive instructions for
submitting an online copyright form. No manuscript will be considered
for review until all authors have completed their copyright form. Please
note, it is our practice not to accept copyright forms via fax, e-mail, or
postal service unless there is a problem with the online author accounts
that cannot be resolved. Every effort should be made to use the online
copyright system. Corresponding authors can log in to the submission
system at any time to check the status of any co-author’s copyright form.
All accepted manuscripts become the permanent property of The Turkish
Journal of Hematology and may not be published elsewhere, in whole or
in part, without written permission.
Note: We cannot accept any copyright form that has been altered,
revised, amended, or otherwise changed. Our original copyright form
must be used as is.
Units of Measurement
Measurements should be reported using the metric system, according
to the International System of Units (SI). Consult the SI Unit Conversion
Guide, New England Journal of Medicine Books, 1992.
An extensive list of conversion factors can be found at https://www.
nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For
more details, see http://www.amamanualofstyle.com/oso/public/jama/
si_conversion_table.html.
Abbreviations and Symbols
Use only standard abbreviations. Avoid abbreviations in the title and
abstract. The full term for an abbreviation should precede its first use
in the text, unless it is a standard abbreviation. All acronyms used in the
text should be expanded at first mention, followed by the abbreviation
in parentheses; thereafter the acronym only should appear in the text.
Acronyms may be used in the abstract if they occur 3 or more times
therein, but must be reintroduced in the body of the text. Generally,
abbreviations should be limited to those defined in the AMA Manual of
Style, current edition. A list of each abbreviation (and the corresponding
full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process
The Turkish Journal of Hematology uses submission software powered
by ScholarOne Manuscripts. The website for submissions to The Turkish
Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This
system is quick and convenient, both for authors and reviewers.
Setting Up an Account
New users to the submission site will need to register and enter their
account details before they can submit a manuscript. Log in, or click
the “Create Account” button if you are a first-time user. To create a
new account: After clicking the “Create Account” button, enter your
name and e-mail address, and then click the “Next” button. Your e-mail
address is very important. Enter your institution and address information,
as appropriate, and then click the “Next” Button. Enter a user ID and
password of your choice, select your area of expertise, and then click the
“Finish” button.
If you have an account, but have forgotten your log-in details, go to
“Password Help” on the journal’s online submission system and enter your
e-mail address. The system will send you an automatic user ID and a new
temporary password.
Full instructions and support are available on the site, and a user ID
and password can be obtained during your first visit. Full support for
authors is provided. Each page has a “Get Help Now” icon that connects
directly to the online support system. Contact the journal administrator
with any questions about submitting your manuscript to the journal
(info@tjh.com.tr). For ScholarOne Manuscripts customer support, click
on the “Get Help Now” link on the top right-hand corner of every page
on the site.
The Electronic Submission Process
Log in to your author center. Once you have logged in, click the “Submit a
Manuscript” link in the menu bar. Enter the appropriate data and answer
A-VII
the questions. You may copy and paste directly from your manuscript.
Click the “Next” button on each screen to save your work and advance
to the next screen.
Upload Files
Click on the “Browse” button and locate the file on your computer. Select
the appropriate designation for each file in the drop-down menu next to
the “Browse” button. When you have selected all the files you want to
upload, click the “Upload Files” button. Review your submission before
sending to the journal. Click the “Submit” button when you are finished
reviewing. You can use ScholarOne Manuscripts at any time to check
the status of your submission. The journal’s editorial office will inform
you by e-mail once a decision has been made. After your manuscript
has been submitted, a checklist will then be completed by the Editorial
Assistant. The Editorial Assistant will check that the manuscript contains
all required components and adheres to the author guidelines. Once the
Editorial Assistant is satisfied with the manuscript it will be forwarded to
the Senior Editor, who will assign an editor and reviewers.
The Review Processs
Each manuscript submitted to The Turkish Journal of Hematology is
subject to an initial review by the editorial office in order to determine
if it is aligned with the journal’s aims and scope and complies with
essential requirements. Manuscripts sent for peer review will be assigned
to one of the journal’s associate editors that has expertise relevant to the
manuscript’s content. All accepted manuscripts are sent to a statistical
and English language editor before publishing. Once papers have been
reviewed, the reviewers’ comments are sent to the Editor, who will then
make a preliminary decision on the paper. At this stage, based on the
feedback from reviewers, manuscripts can be accepted or rejected, or
revisions can be recommended. Following initial peer-review, articles
judged worthy of further consideration often require revision. Revised
manuscripts generally must be received within 3 months of the date of
the initial decision. Extensions must be requested from the Associate
Editor at least 2 weeks before the 3-month revision deadline expires;
The Turkish Journal of Hematology will reject manuscripts that are not
received within the 3-month revision deadline. Manuscripts with extensive
revision recommendations will be sent for further review (usually by the
same reviewers) upon their re-submission. When a manuscript is finally
accepted for publication, the Technical Editor undertakes a final edit
and a marked-up copy will be e-mailed to the corresponding author for
review and any final adjustments.
Submission of Revised Papers
When revising a manuscript based on the reviewers’ and Editor’s feedback,
please insert all changed text in red. Please do not use track changes, as
this feature can make reading difficult. To submit revised manuscripts,
please log in to your author center at ScholarOne Manuscripts. Your
manuscript will be stored under “Manuscripts with Decisions”. Please click
on the “Create a Revision” link located to the right of the manuscript title.
A revised manuscript number will be created for you; you will then need
to click on the “Continue Submission” button. You will then be guided
through a submission process very similar to that for new manuscripts.
You will be able to amend any details you wish. At stage 6 (“File Upload”),
please delete the file for your original manuscript and upload the revised
version. Additionally, please upload an anonymous cover letter, preferably
in table format, including a point-by-point response to the reviews’
revision recommendations. You will then need to review your paper as
a PDF and click the “Submit” button. Your revised manuscript will have
the same ID number as the original version, but with the addition of an R
and a number at the end, for example, TJH-2011-0001 for an original and
TJH-2011-0001.R1, indicating a first revision; subsequent revisions will
end with R2, R3, and so on. Please do not submit a revised manuscript
as a new paper, as revised manuscripts are processed differently. If you
click on the “Create a Revision” button and receive a message stating that
the revision option has expired, please contact the Editorial Assistant at
info@tjh.com.tr to reactivate the option.
English Language and Statistical Editing
All manuscripts are professionally edited by an English language editor
prior to publication. After papers have been accepted for publication,
manuscript files are forwarded to the statistical and English language
editors before publishing. Editors will make changes to the manuscript to
ensure it adheres to TJH requirements. Significant changes or concerns
are referred to corresponding authors for editing.
Online Early
The Turkish Journal of Hematology publishes abstracts of accepted
manuscripts online in advance of their publication in print. Once an
accepted manuscript has been edited, the authors have submitted any
final corrections, and all changes have been incorporated, the manuscript
will be published online. At that time the manuscript will receive a Digital
Object Identifier (DOI) number. Both forms can be found at www.tjh.
com.tr. Authors of accepted manuscripts will receive electronic page
proofs directly from the printer and are responsible for proofreading
and checking the entire manuscript, including tables, figures, and
references. Page proofs must be returned within 48 hours to avoid delays
in publication.
A-VIII
CONTENTS
Review
1 Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies
Maria N. Gamaletsou, Thomas J. Walsh, Nikolaos V. Sipsas; Leeds, United Kingdom; New York, USA; Athens, Greece
Research Articles
12 A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention
Yeşim Aydınok, Yeşim Oymak, Berna Atabay, Gönül Aydoğan, Akif Yeşilipek, Selma Ünal, Yurdanur Kılınç, Banu Oflaz, Mehmet Akın,
Canan Vergin, Melike Sezgin Evim, Ümran Çalışkan, Şule Ünal, Ali Bay, Elif Kazancı, Talia İleri, Didem Atay, Türkan Patıroğlu, Selda Kahraman,
Murat Söker, Mediha Akcan, Aydan Akdeniz, Mustafa Büyükavcı, Güçhan Alanoğlu, Özcan Bör, Nur Soyer, Nihal Özdemir Karadaş,
Ezgi Uysalol, Meral Türker, Arzu Akçay, Süheyla Ocak, Adalet Meral Güneş, Hüseyin Tokgöz, Elif Ünal, Naci Tiftik, Zeynep Karakaş;
Hemoglobinopathy Study Group, Turkey
19 Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia
Stella Genitsari, Eftichia Stiakaki, Chryssoula Perdikogianni, Georgia Martimianaki, Iordanis Pelagiadis, Margarita Pesmatzoglou,
Maria Kalmanti, Helen Dimitriou; Crete, Athens, Greece
27 Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients
Özlem Tüfekçi, Ülker Koçak, Zühre Kaya, İdil Yenicesu, Canan Albayrak, Davut Albayrak, Şebnem Yılmaz Bengoa, Türkan Patıroğlu,
Musa Karakükçü, Ekrem Ünal, Elif Ünal İnce, Talia İleri, Mehmet Ertem, Tiraje Celkan, Gül Nihal Özdemir, Nazan Sarper, Dilek Kaçar,
Neşe Yaralı, Namık Yaşar Özbek, Alphan Küpesiz, Tuba Karapınar, Canan Vergin, Ümran Çalışkan, Hüseyin Tokgöz, Melike Sezgin Evim,
Birol Baytan, Adalet Meral Güneş, Deniz Yılmaz Karapınar, Serap Karaman, Vedat Uygun, Gülsun Karasu, Mehmet Akif Yeşilipek, Ahmet Koç,
Erol Erduran, Berna Atabay, Haldun Öniz, Hale Ören; İzmir, Ankara, Samsun, Kayseri, İstanbul, Kocaeli, Antalya, Konya, Bursa, Trabzon, Turkey
35 Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis
Seçil Vural, Bengü Nisa Akay, Ayşenur Botsalı, Erden Atilla, Nehir Parlak, Aylin Okçu Heper, Hatice Şanlı; Ankara, Turkey
42 The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells
Hossein Nikkhah, Elham Safarzadeh, Karim Shamsasenjan, Mehdi Yousefi, Parisa Lotfinejad, Mehdi Talebi, Mozhde Mohammadian,
Farhoud Golafshan, Aliakbar Movassaghpour; Tabriz, Sari, Iran; Minnesota, USA
49 NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques - Sanger Sequencing, Pyrosequencing, and
Real-Time Polymerase Chain Reaction
Dushyant Kumar, Anurag Mehta, Manoj Kumar Panigrahi, Sukanta Nath, Kandarpa Kumar Saikia; Guwahati, New Delhi, India
54 Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study
Mehmet Özen, Soner Yılmaz, Tülin Özkan, Yeşim Özer, Aliye Aysel Pekel, Asuman Sunguroğlu, Günhan Gürman, Önder Arslan; Ankara, Turkey
Brief Reports
61 Impact of Fluorescent In Situ Hybridization Aberrations and CLLU1 Expression on the Prognosis of Chronic Lymphocytic Leukemia:
Presentation of 156 Patients from Turkey
Ümmet Abur, Gönül Oğur, Ömer Salih Akar, Engin Altundağ, Huri Sema Aymelek, Düzgün Özatlı, Mehmet Turgut; Samsun, Turkey
66 Glomerular and Tubular Functions in Children and Adults with Transfusion-Dependent Thalassemia
Agageldi Annayev, Zeynep Karakaş, Serap Karaman, Altan Yalçıner, Alev Yılmaz, Sevinç Emre; İstanbul, Turkey
A-IX
Images in Hematology
71 Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis
Jakub Debski, Lidia Usnarska-Zubkiewicz, Katarzyna Kapelko-Słowik, Aleksander Pawlus, Urszula Zaleska-Dorobisz,
Kazimierz Kuliczkowski; Wroclaw, Poland
73 Pachymeningeal Involvement with Blindness as the Presenting Manifestation of Non-Hodgkin Lymphoma
Charanpreet Singh, Arjun Lakshman, Aditya Jandial, Sudha Sharma, Ram Nampoothiri, Gaurav Prakash, Pankaj Malhotra; Chandigarh, India
Letters to the Editor
75 Leukoagglutination, Mycoplasma pneumoniae Pneumonia, and EDTA Acid Blood
Beuy Joob, Viroj Wiwanitkit; Bangkok, Thailand, Pune, India
77 Cyclic Guanosine Monophosphate-Dependent Protein Kinase I Stimulators and Activators Are Therapeutic Alternatives for Sickle Cell Disease
Mohankrishna Ghanta, Elango Panchanathan, Bhaskar VKS Lakkakula; Tamil Nadu, Chhattisgarh, India
79 Three Factor 11 Mutations Associated with Factor XI Deficiency in a Turkish Family
Veysel Sabri Hançer, Zafer Gökgöz, Murat Büyükdoğan; İstanbul, Ankara, Turkey
81 Participation in Physical and Sportive Activities among Adult Turkish People with Hemophilia: A Single-Center Experience
Arni Lehmeier, Muhlis Cem Ar, Sevil Sadri, Mehmet Yürüyen, Zafer Başlar; İstanbul, Turkey
83 A Lesser Known Side Effect of Tigecycline: Hypofibrinogenemia
Fulya Yılmaz Duran, Halil Yıldırım, Emre Mehmet Şen; İzmir, Turkey
85 Effectiveness of Ankaferd BloodStopper in Prophylaxis and Treatment of Oral Mucositis in Childhood Cancers Evaluated with Plasma Citrulline Levels
Türkan Patıroğlu, Nagihan Erdoğ Şahin, Ekrem Ünal, Mustafa Kendirci, Musa Karakükcü, Mehmet Akif Özdemir; Kayseri, Turkey
87 Late Side Effects of Chemotherapy and Radiotherapy in Early Childhood on the Teeth: Two Case Reports
Sevcihan Günen Yılmaz, İbrahim Şevki Bayrakdar, Seval Bayrak, Yasin Yaşa; Antalya, Eskişehir, Bolu, Ordu, Turkey
89 t(9;19)(q22;p13) in Acute Myelomonocytic Leukemia
Moeinadin Safavi, Akbar Safaei, Marzieh Hosseini; Tehran, Shiraz, Iran
91 Invasive Aspergillosis in Refractory Angioimmunoblastic T-Cell Lymphoma
Prakash NP, Anoop TM, Rakul Nambiar, Jaisankar Puthusseri, Swapna B; Thiruvananthapuram, India
92 Expansion of a Myeloma-associated Lesion from Orbita to the Cerebrum
Sinan Demircioğlu, Demet Aydoğdu, Özcan Çeneli; Konya, Turkey
A-X
REVIEW
DOI: 10.4274/tjh.2018.0007
Turk J Hematol 2018;35:1-11
Invasive Fungal Infections in Patients with Hematological
Malignancies: Emergence of Resistant Pathogens and New
Antifungal Therapies
Hematolojik Kanserleri Olan İnvaziv Mantar Enfeksiyonlu Hastalar: Dirençli Patojenlerin
Ortaya Çıkışı ve Yeni Antifungal Tedaviler
Maria N. Gamaletsou 1 , Thomas J. Walsh 2 , Nikolaos V. Sipsas 3
1
The Leeds Teaching Hospitals NHS Trust, St James University Hospital, Department of Infection and Travel Medicine, Leeds, United Kingdom
2
Weill Cornell Medicine of Cornell University, Department of Medicine, Pediatrics, and Microbiology and Immunology, New York, United States of
America
3
National and Kapodistrian University of Athens Faculty of Medicine, Department of Pathophysiology, Athens, Greece
Abstract
Invasive fungal infections caused by drug-resistant organisms are
an emerging threat to heavily immunosuppressed patients with
hematological malignancies. Modern early antifungal treatment
strategies, such as prophylaxis and empirical and preemptive therapy,
result in long-term exposure to antifungal agents, which is a major
driving force for the development of resistance. The extended
use of central venous catheters, the nonlinear pharmacokinetics
of certain antifungal agents, neutropenia, other forms of intense
immunosuppression, and drug toxicities are other contributing factors.
The widespread use of agricultural and industrial fungicides with
similar chemical structures and mechanisms of action has resulted in
the development of environmental reservoirs for some drug-resistant
fungi, especially azole-resistant Aspergillus species, which have been
reported from four continents. The majority of resistant strains have
the mutation TR34/L98H, a finding suggesting that the source of
resistance is the environment. The global emergence of new fungal
pathogens with inherent resistance, such as Candida auris, is a new
public health threat. The most common mechanism of antifungal drug
resistance is the induction of efflux pumps, which decrease intracellular
drug concentrations. Overexpression, depletion, and alteration of
the drug target are other mechanisms of resistance. Mutations
in the ERG11 gene alter the protein structure of C-demethylase,
reducing the efficacy of antifungal triazoles. Candida species become
echinocandin-resistant by mutations in FKS genes. A shift in the
epidemiology of Candida towards resistant non-albicans Candida spp.
has emerged among patients with hematological malignancies. There
is no definite association between antifungal resistance, as defined by
elevated minimum inhibitory concentrations, and clinical outcomes in
Öz
İlaca dirençli organizmaların neden olduğu invaziv mantar
enfeksiyonları, ağır immün baskılanma altındaki hematolojik kanserli
hastalar için bir tehdittir. Profilaktik, Öz ampirik ve önleyici tedaviler
gibi güncel anti-fungal tedavi yaklaşımları, direnç gelişiminde büyük
bir itici güç olan anti-fungal ajanlara uzun süreli maruz kalma ile
sonuçlanmaktadır. Santral venöz kateterlerin uzun süreli kullanımı,
bazı anti-fungal ajanların doğrusal olmayan farmakokinetiği,
nötropeni, yoğun immün baskılamanın farklı formları ve ilaç
toksisitesi direnç gelişimine katkıda bulunan diğer faktörlerdir. Benzer
kimyasal yapılara ve etki mekanizmalarına sahip, tarımsal ve
endüstriyel fungisitlerin yaygın kullanımı, dört kıtadan bildirilen bazı
ilaca dirençli mantarlar, özellikle azole dayanıklı Aspergillus türleri
için çevresel kaynakların gelişmesine neden olmaktadır. Dirençli
suşların çoğunda bulunan TR34 / L98H mutasyonu, direncin çevresel
kaynaklı olduğunu düşündürmektedir. Candida auris gibi doğal
dirençli yeni fungal patojenlerin ortaya çıkması, yeni bir halk sağlığı
tehdididir. Anti-fungal ilaç direncinin en yaygın mekanizması, hücre
içi ilaç konsantrasyonlarını azaltan hücre dışına atım pompalarının
uyarılmasıdır. Diğer direnç mekanizmaları arasında ilaç hedefinin
aşırı ekspresyonu, tükenmesi ya da değişmesi bulunmaktadır. ERG11
genindeki mutasyonlar, antif-fungal triazollerin etkinliğini azaltarak
C-demetilazın protein yapısını değiştirir. Candida türleri, FKS
genlerindeki mutasyonlarla ekinokandine dirençli hale gelir. Candida
epidemiyolojisinde dirençli albicans-dışı Candida spp. hematolojik
kanseri olan hastalarda ön plana çıkmaktadır. Bu popülasyondaki hasta
grubunda artmış minimum inhibitör konsantrasyonlarla tanımlanan
anti-fungal direnç ile klinik sonuçlar arasında kesin bir ilişki yoktur.
Moleküler yöntemlerin kullanımı ile dirence neden olan genlerin veya
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Maria N. GAMALETSOU, M.D.,
Received/Geliş tarihi: January 04, 2018
The Leeds Teaching Hospitals NHS Trust, St James University Hospital, Department of Infection and Travel Medicine, Leeds, United Kingdom Accepted/Kabul tarihi: January 22, 2018
Phone : +44 1132 066 083
E-mail : magama@med.uoa.gr ORCID-ID: orcid.org/0000-0002-0530-3209
1
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
Turk J Hematol 2018;35:1-11
this population. Detection of genes or mutations conferring resistance
with the use of molecular methods may offer better predictive values
in certain cases. Treatment options for resistant fungal infections are
limited and new drugs with novel mechanisms of actions are needed.
Prevention of resistance through antifungal stewardship programs is
of paramount importance.
Keywords: Invasive fungal infections, Antifungal resistance,
Hematological malignancies, New antifungal agents
mutasyonların saptanması, bazı olgularda daha iyi klinik ön görü
sağlayabilir. Dirençli fungal enfeksiyonlara yönelik tedavi seçenekleri
sınırlıdır ve yeni mekanizmalara sahip ilaçlara ihtiyaç duyulmaktadır.
Anti-fungal idame programlarıyla direncin önlenmesi büyük önem
taşır.
Anahtar Sözcükler: İnvazif mantar enfeksiyonları, Anti-fungal direnç,
Hematolojik kanserler, Yeni anti-fungal ajanlar
Introduction
Invasive fungal infections (IFIs) are associated with increased
morbidity and unacceptably high mortality among patients
with hematological malignancies (HMs) [1,2]. However,
treatment options are limited, including only four chemical
classes: polyenes, triazoles, echinocandins, and flucytosine. The
expansion of the use of antifungal agents over the last two
decades not unexpectedly contributed to the development
of antifungal resistance [3,4,5]. Another factor driving the
emergence of resistance is the widespread use of agricultural and
industrial fungicides with chemical structures and mechanisms
of action similar to those of human antifungal agents, resulting
in the development of environmental reservoirs for some drugresistant
fungi, especially triazole-resistant Aspergillus species
[6,7]. Recently, researchers showed that even the household
environment may serve as a potential source of triazoleresistant
invasive aspergillosis [8].
Antifungal resistance can be either intrinsic or acquired (Table
1) [9,10,11]. Intrinsic drug resistance can occur naturally
among certain fungi without previous exposure to antifungal
agents, such as fluconazole-resistant Candida krusei [9,12].
The emergence of new fungal species with intrinsic resistance
to some or all antifungal agents is a new threat. The recent
outbreaks of multidrug-resistant Candida auris [13] in many
hematology centers around the world and the increasing
reports of infections caused by panresistant Lomentospora
prolificans [14,15] are characteristic examples.
Acquired or iatrogenic antifungal resistance is favored by
specific risk factors in patients with HMs. Modern early
treatment strategies, such as prophylaxis and empirical and
preemptive therapy, result in long-term exposure to antifungal
agents, which is a major driving force for the development
of resistance [5]. Repeated cycles of chemotherapy and/or
hematopoietic stem cell transplantation (HSCT) prolong even
more the exposure to antifungal agents. Chemotherapyinduced
neutropenia limits the pharmacodynamic response to
antifungal agents and dictates prolonged therapeutic courses.
Indwelling catheters, especially central venous catheters (CVCs),
are a major factor for the development of resistance, as their
surfaces are often infected by pathogenic fungi and the ensuing
biofilm formation does not allow drug penetration, thus
rendering the infection refractory to treatment [16,17,18,19].
Nonlinear pharmacokinetics of certain antifungal agents,
especially certain triazoles, may result in suboptimal antifungal
drug levels, favoring the development of resistance [20,21].
Intraabdominal fungal infections in patients with HMs, such as
intraabdominal abscesses, can promote drug resistance because
antifungal drug delivery in the abdomen is poor and fungi are
exposed to possibly subtherapeutic drug concentrations [22].
The emergence of antifungal drug resistance has tremendous
clinical implications, as it further restricts the already limited
antifungal armamentarium, raising concerns among clinicians
that we are close to the “post-antifungal” era, in parallel to the
“post-antibiotic” era [4,10]. The outlook is similarly grim, as there
is a paucity of new antifungal agents with novel mechanisms of
action in development [23].
The focus of this review will be the emergence of fungal
infections with innate or acquired resistance to antifungal
agents among patients with HMs. We will visit the many
different facets of this complex area, including mechanisms
of resistance, epidemiology, clinical implications, and current
treatment options. Finally, we will review new antifungal agents
in development and the priorities for future research in the field.
Antifungal-Resistant Invasive Aspergillosis
Mechanisms of Resistance
Triazole-Resistant Aspergillus spp.: Triazoles with activity
against Aspergillus spp. (i.e. itraconazole, voriconazole,
posaconazole, and isavuconazole) are recommended for
the treatment of invasive aspergillosis among patients with
HMs. Antifungal triazoles act by inhibiting the cytochrome
P450 enzyme sterol 14α-demethylase, which converts
lanosterol to ergosterol, and is encoded by the gene CYP51 in
filamentous fungi. Inhibition of 14α-demethylase by an azole
results in the interruption of biosynthesis of ergosterol, which
is fungicidal for molds, as it leads to intracellular accumulation
of toxic 14α-methyl sterols and to alterations in cell membrane
structure, impairing its permeability and stability and thus the
2
Turk J Hematol 2018;35:1-11
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
Table 1. Inherited and acquired resistance reported among pathogenic fungi infecting patients with hematological malignancies.
Fungus Inherent resistance Acquired resistance
Candida spp.
C. albicans
C. parapsilosis
C. tropicalis
C. glabrata
C. krusei
C. lusitaniae
C. guilliermondii
C. auris
Non-Candida yeasts
Trichosporon spp.
Saccharomyces Malassezia spp.
Geotrichum
Rhodotorula
Pichia
Aspergillus spp.
A. fumigatus
A. terreus
A. flavus
A. nidulans
Mucorales
Hyalohyphomycetes
Fusarium solani
Scedosporium spp.
Lomentospora prolificans
Yeasts
None
Echinocandins (?)
None
Triazoles
Triazoles
Amphotericin B
Fluconazole, echinocandins
Azoles, amphotericin B
Echinocandins amphotericin B
None
Echinocandins
Echinocandins
Triazoles
Fluconazole
Molds
Fluconazole
Fluconazole, amphotericin B
Fluconazole, amphotericin B
Fluconazole, amphotericin B
Fluconazole, voriconazole
Echinocandins and variably resistant to
amphotericin B and triazoles
Panresistant*
Fluconazole, echinocandins
Fluconazole
Fluconazole, echinocandins
Echinocandins
Echinocandins
Fluconazole, echinocandins
Echinocandins
Fluconazole
Fluconazole
*Panresistant: Consistently resistant to all 4 major classes of systemic antifungal agents: triazoles, polyenes, echinocandins, and fluoropyrimidines.
Voriconazole, isavuconazole
Voriconazole, isavuconazole
Voriconazole, isavuconazole
Voriconazole, isavuconazole
viability of the fungus. Mutations in the CYP51A fungal gene
alter the structure of the 14α-demethylase, leading to reduced
azole binding and thus generating triazole-resistant phenotypes
[24,25]. The two most common alterations in CYP51A offering
resistance to triazoles are tandem repeats in the promoter region
of the gene along with gene mutations and point mutations [5].
There are also other non-CYP51 mechanisms associated with
azole resistance [24].
The most frequently identified mechanism of triazole resistance
in Aspergillus fumigatus involves a 34-bp tandem repeat (TR 34
)
in the promoter region of the CYP51A gene combined with
a substitution of leucine 98 to histidine (TR 34
/L98H). These
alterations cause overexpression of the gene [25,26]. Another
mechanism of resistance involves a 46-bp tandem repeat in
the CYP51A promoter region combined with two substitutions:
tyrosine 121 for phenylalanine and threonine 289 for alanine
(TR 46
/Y121F/T289A) [27]. This modification of the CYP51A gene
makes Aspergillus fumigatus resistant to voriconazole [28].
Finally, a 53-bp tandem repeat in the promoter region of
the CYP51A gene without any other substitution conferring
azole resistance has been detected in environmental [29] and
clinical triazole-resistant Aspergillus fumigatus strains [30].
Another mechanism of triazole resistance for Aspergillus spp. is
nonsynonymous hot-spot mutations in the CYP51A gene.
Numerous amino acid substitutions associated with
reduced susceptibility for triazoles have been reported [2
4,31,32,33,34,35,36,37,38,39,40]. Recently, many azoleresistant
Aspergillus isolates were found not to have point
mutations in CYP51A or promoter duplications, suggesting
that alternative mechanisms for azole resistance exist
[40,41]. Researchers reported that 43% of 64 azoleresistant
Aspergillus isolates did not carry a CYP51A mutation,
indicating that other mechanisms must be responsible [42].
Potential mechanisms conferring resistance include activation
of efflux pumps [43]; overexpression of transporter genes [44];
loss of the algA gene [45]; the point mutation P88L in HapE, an
3
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
Turk J Hematol 2018;35:1-11
important transcription factor [46]; biofilm formation
[43,47]; and cholesterol import by Aspergillus fumigatus to
overcome ergosterol deprivation [48].
Cryptic Aspergillus spp. may be resistant to voriconazole. For
example, Aspergillus calidoustus typically has elevated minimum
inhibitory concentrations (MICs) for voriconazole that exceed
CLSI and EUCAST interpretive breakpoints. Aspergillus lentulus,
which may phenotypically resemble a slowly growing Aspergillus
fumigatus, may also have elevated MICs for voriconazole [24].
Polyene-Resistant Aspergillus spp.: Polyene antifungal agents
bind to ergosterol on the cell membrane of the fungus and
cause formation of intramembrane channels that kill the cell.
Amphotericin B is a first-line treatment for invasive aspergillosis
in patients with HMs. Although it has been used since 1957,
emergence of resistance is usually not an issue and typically
involves selection of inherently resistant strains. Development
of acquired resistance during therapy is rare [5]. The most
common amphotericin B-resistant species include Aspergillus
terreus, Aspergillus flavus, Aspergillus nidulans, Aspergillus
calidoustus, and Aspergillus lentulus [49,50,51]. The main
mechanism of resistance is believed to be the modification of
the cell membrane, by diminishing its ergosterol content [51].
Researchers have found that previous treatment with
triazoles also may reduce the amount of membrane ergosterol
in Candida spp. resistant to amphotericin B [52]. Reduction of
membrane ergosterol renders Cryptococcus neoformans less
susceptible to amphotericin B [53]. Whether this mechanism
also confers polyene resistance to Aspergillus spp. is uncertain.
Epidemiology
Triazole-resistant Aspergillus fumigatus has been
described in the Netherlands since 1999, with an estimated
prevalence of 6.0%-12.8% of patients with invasive
aspergillosis [6]. In 2007, infections caused by triazoleresistant
Aspergillus fumigatus were reported in hematology
patients from six different hospitals in the Netherlands [25]. One
year later, another Dutch hospital noted that 28.1% of 32
patients with invasive aspergillosis had an azole-resistant isolate
of Aspergillus fumigatus [54]. The predominant mechanism
of resistance of clinical isolates from patients in different
hospitals was TR34/L98H, a finding suggesting that the source
of resistance was the environment [54,55]. Subsequent studies
from the Netherlands [55] and the United Kingdom [56] showed
that, from 1994 to 2009, the incidence of triazole-resistant
aspergillosis rapidly increased to 20%. Recently, a prospective
study on the prevalence and the mechanisms of azole-resistance
was conducted among 22 centers in 19 European countries
[25]. Triazole-resistant Aspergillus fumigatus isolates have
been reported in 11 countries, although the prevalence ranged
widely, from 0% to 26%, among the participating centers and
even among centers from the same country. The overall triazole
resistance prevalence was 3.2% [25]. To date, triazole-resistant
clinical isolates of Aspergillus fumigatus have been reported in
the majority of European counties [24], as well as Turkey [56].
Most reports of triazole-resistant Aspergillus spp. have
originated from Europe, but recently researchers from four
continents reported increasing numbers of infections caused by
resistant Aspergillus strains [34,57,58,59,60,61], suggesting that
azole resistance is a global threat.
Clinical Significance
Data on the clinical significance of triazole resistance are
limited and contradictory. In vitro studies have shown that the
presence of triazole resistance mechanisms is associated with
reduced susceptibility of Aspergillus fumigatus to all azoles
[62], including the recently licensed isavuconazole [63,64,65].
Several studies have shown that triazole resistance is associated
with treatment failure, especially among patients with HMs
[24,28,29,36,39]. In a study from India, invasive aspergillosis
caused by a resistant isolate was associated with a significantly
higher mortality rate (88%) compared with that of aspergillosis
caused by wild-type isolates (30%-50%) [66]. On the contrary,
in a retrospective study from the United States, higher azole
MICs were not correlated with outcome of aspergillosis in
patients with HMs or HSCT recipients [67]. Clearly, more data
are needed to delineate the clinical significance of triazole
resistance in Aspergillus spp.
Treatment
Due to the low worldwide prevalence of azole-resistant
aspergillosis, there are no clinical studies on its treatment. In
2015, an expert panel published an opinion paper on how to
treat azole-resistant aspergillosis [68]. They suggested that in
areas with high (>10%) environmental resistance, first-line
therapy should be liposomal amphotericin B or a combination
of voriconazole and an echinocandin. These suggestions
require meticulous surveillance studies to define areas of high
resistance; such studies are not always feasible.
Antifungal-Resistant Invasive Candidiasis
Mechanisms of Resistance
Triazole-Resistant Candida spp.: Antifungal azoles act by
inhibiting the enzyme sterol 14α-demethylase, resulting in
the interruption of biosynthesis of ergosterol, which is an
essential Candida cell membrane component. The inhibition
of ergosterol synthesis may be fungicidal for molds, but
4
Turk J Hematol 2018;35:1-11
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
only fungistatic for yeasts. Several mechanisms confer azole
resistance to Candida spp. [18]. The most common mechanism is
the induction of efflux pumps, which decrease the intracellular
drug concentration. Efflux pumps are encoded by various
genes belonging to the ATP-binding cassette superfamily or
to the major facilitator superfamily [69]. The transcription
of these genes is regulated by transcription factors, such as
Tac1 and Mrr1 for Candida albicans and CgPdr1 for Candida
glabrata [69]. Overexpression or alteration of the drug
target, 14α-demethylase, is another mechanism of resistance.
Numerous point mutations in the ERG11 gene, usually after
exposure to fluconazole, can generate structural changes in the
active site of the demethylase, causing reduced target affinity
and thus triazole resistance [70]. Overexpression of ERG11 [71]
and loss of function of the sterol Δ5,6-desaturase gene (ERG3)
[72] also confer azole resistance. Loss of function of the sterol
Δ5,6-desaturase gene in Candida glabrata may also result in
resistance to amphotericin B. These mechanisms can occur
either alone or concurrently in a single isolate and may lead to
cross-resistance to many azoles.
Echinocandin-Resistant Candida spp.: The mechanism of
action of the echinocandins is inhibition of (1,3)-β-D-glucan
synthesis [73]. Beta-D-glucans are cross-linked to chitin and
mannoproteins, providing structural integrity to cell walls
of various fungi. Echinocandins are fungicidal for Candida
spp., as β-D-glucan accounts for approximately 30%-60% of
the cell wall mass in Candida species [73]. Conversely, among
filamentous fungi, echinocandins have only fungistatic effects,
as the cell wall contains less glucan, concentrated at the apical
tips and branching points of hyphae.
Echinocandins exert their antifungal activity by binding to the
enzyme FKS, which catalyzes the synthesis of (1,3)-β-D-glucans.
Glucan synthase has two catalytic subunits, FKS1 and FKS2,
encoded by their respective FKS genes. Candida species become
echinocandin-resistant by genetic acquisition of mutations
in FKS genes, which encode amino acid substitutions in two
narrow hot-spot regions of FKS1 for all Candida species and FKS2
for C. glabrata [74]. The most common (>90%) FKS1 substitutions
among echinocandin-resistant Candida albicans isolates occur
at Ser-641 or Ser-645 [74]. In Candida glabrata, the most
common amino acid substitutions occur in FKS2 [75].
Resistance to two or more classes of antifungal agents further
augments the threat of Candida glabrata in patients with
HMs. Candida glabrata bloodstream isolates from patients
with HMs developed cross-resistance to both triazoles and
echinocandins [76]. While the molecular events leading to
triazole and echinocandin resistance may occur independently,
one potential unifying mechanism is the development of DNA
mismatch-repair gene mutations, which lead to “hypermutable”
clinical strains [12].
Polyene-Resistant Candida spp.: Candida species with acquired
resistance to polyenes are uncommon, although researchers
have reported cases of Candida albicans, Candida krusei,
Candida glabrata, Candida tropicalis, Candida rugosa, Candida
lusitaniae, and Candida guilliermondii with high MICs to
amphotericin B [5,18]. The main mechanism of resistance
involves a reduction in cell membrane ergosterol, which is the
biological target of amphotericin B. Reduction of ergosterol can
be caused by previous treatment with triazoles, which lowers
membrane sterol concentrations, or mutations affecting sterol
biosynthesis, such as defects in ERG1, ERG2, ERG3, ERG4, ERG6,
and ERG11 [18,77].
Biofilm Formation and Candida Resistance: Biofilm formation
on artificial devices, especially CVCs, is an essential factor driving
the development of drug-resistant Candida spp. in patients with
HMs. Antifungal drugs do not achieve therapeutic levels within
the biofilm because they are trapped in a glucan-rich matrix
polymer. The hypoxic environment within biofilms results in
a metabolic stress response that leads to increased MICs to
triazoles. Moreover, once the Candida strain is embedded in the
biofilm, it may not need to be resistant in order to grow despite
adequate antifungal treatment and may cause breakthrough
candidemia [19].
Epidemiology
Antifungal drug resistance has emerged through the
development of acquired resistance and an epidemiological shift
in the distribution of Candida species towards inherently less
susceptible non-albicans species [16]. In large-scale surveillance
studies of bloodstream isolates, the overall prevalence of Candida
albicans resistance is less than 1% [78]. Resistance rates are
higher among non-albicans Candida species, notably Candida
glabrata, reaching 2%-4% in most epidemiological prevalence
studies [79]. A trend towards increasing rates of Candida
glabrata resistance has been noted, as the proportion of
nonsusceptible isolates increased from 4.2% in 2008 to 7.8%
in 2014 [80], while some institutions reported resistance rates
close to 10% [75]. In hematology patients, a rise in Candida
glabrata with echinocandin and azole resistance and crossresistance
to two or more antifungal classes (multidrug
resistance) has been reported, mainly in the United States,
but not in Europe [81]. In a European study of candidemia
among hematology patients, in vitro resistance to at least one
antifungal agent was observed for 27% of Candida isolates [17].
The problem of antifungal-resistant yeast infections has been
aggravated by recent epidemiological changes. A shift in
5
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
Turk J Hematol 2018;35:1-11
the distribution of candidemia-associated Candida species
towards more resistant non-albicans species, such as Candida
parapsilosis, Candida tropicalis, Candida glabrata, and Candida
krusei, has been reported among patients with HMs in both
the United States and Europe [16,17]. In addition, the recent
emergence of Candida auris, an uncommon species that exhibits
both multidrug resistance and strong potential for nosocomial
transmission, raises concerns worldwide [82]. Cases and hospital
outbreaks of Candida auris invasive infections have been
reported from four continents, mainly among patients with
HMs, with high mortality [82,83].
Clinical Significance
There are no clinical studies showing a definite association
between in vitro susceptibility testing and outcomes of invasive
candidiasis in neutropenic patients [4,18,19], with the exception
of Candida glabrata, where clinical studies demonstrated that
infection with an echinocandin-resistant strain was associated
with worse outcomes [9,75]. Clinical failure was associated
with the presence of the FKS mutation and not MIC values
[9]. Finally, the recent epidemiological shift of Candida species
distribution towards non-albicans species in patients with HMs
[16] has an impact on outcomes as many non-albicans species,
especially Candida glabrata and Candida krusei, exhibit higher
resistance rates and higher mortality [16,17].
Treatment
There are no clinical studies on the optimal initial treatment
of patients with or at risk for antifungal-resistant
invasive Candida infections. Current guidelines for treatment
of candidiasis recommend lipid formulation of amphotericin
B (3-5 mg/kg daily) for patients with suspected azoleand
echinocandin-resistant Candida infections [84]. This
recommendation is characterized as “strong” but is based on
“low-quality evidence”. Regarding the emerging problem of
multidrug-resistant Candida glabrata infection, there are
no good clinical data on the optimal treatment. The best
strategy for the initial treatment of suspected or documented
resistant Candida infection is to be tailored according to
individual risk factors and the local epidemiology [18].
Antifungal Resistance in Fungal Infections Caused by Rare
Molds and Non-Candida, Non-Cryptococcus Yeasts
The frequency of invasive fungal disease caused by resistant
filamentous fungi other than Aspergillus is increasing. The
majority of these rare molds are Mucorales, hyalohyphomycetes
(Fusarium spp., Scedosporium spp.), and dematiaceous fungi
and they occur mainly in heavily immunosuppressed patients
with HMs [85]. The TRANSNET study reported that among 983
IFIs identified in 875 HSCT recipients, 8% were mucormycosis
and 14% of infections were caused by other filamentous fungi
[86]. The intrinsic resistance of many of these rare fungi to
antifungal agents is of concern. Mucorales species are resistant
to some triazoles, while multidrug resistance has been reported
for Fusarium spp., Scedosporium spp., and dematiaceous fungi.
Although Candida infections comprise the vast majority
of yeasts growing in blood cultures, clinicians should be
aware that a substantial proportion of fungemia cases are
caused by non-Candida, non-Cryptococcus yeasts [87], such
as Trichosporon asahii, Magnusiomyces (Blastoschizomyces)
capitatus, Saccharomyces cerevisiae, Malassezia spp.,
Saprochaete (Geotrichum) spp., and Rhodotorula spp. The
majority of these rare yeasts are intrinsically resistant to one
or more classes of antifungal agents, and infections occur
frequently as breakthrough infections in hematology patients
receiving antifungals and with a CVC in place [87,88]. For
instance, Trichosporon spp. are resistant to echinocandins and
to the fungicidal activity of polyenes, while Rhodotorula spp.
are resistant to the triazoles [18]. In vitro susceptibility testing
is not always useful in patients with infections caused by
less frequent opportunistic yeast or mold infections. In these
patients, breakpoints are not based on data derived from clinical
responses or outcomes but only from epidemiological cut-off
values and pharmacokinetic and pharmacodynamic data from
animal models [89].
Diagnostic Tests for the Detection of Fungal Resistance
Isolation of the infecting fungus through conventional culture
of biological fluids and tissues, identification to the species
level, and in vitro testing to determine the susceptibility to
antifungal agents is the current standard for the diagnosis of IFIs
caused by resistant fungi and for decision making [90]. Species
identification is time-consuming, prompting physicians to
initiate empirical treatment until the results become available.
Newer methods, including MALDI-TOF mass spectroscopy and
T2 magnetic resonance assay, allow rapid species identification
with excellent sensitivity and specificity [90,91]. Antifungal
susceptibility testing is recommended for the triazoles against
all bloodstream Candida isolates and for the echinocandins
against resistant species, such as Candida glabrata and Candida
parapsilosis isolates [84]. As mentioned previously, clinical
breakpoints are only available for certain species of fungi and
are not useful for the diagnosis of resistance, as they do not
always correlate with clinical outcomes, especially in patients
with HMs [18,19,90]. Thus, a low MIC value does not necessarily
predict successful treatment and an elevated MIC does not
automatically predict treatment failure.
Currently, only polymerase chain reaction (PCR) has the potential
for early detection of resistance [92]. Even PCR, though, has its
drawbacks, such as low sensitivity for detection of resistance
markers and difficulty in differentiating colonization from
6
Turk J Hematol 2018;35:1-11
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
invasive infection or a living from a dead organism [93].
Therefore, clinicians should be cautious as to how to interpret
these non-culture-based diagnostic tests in everyday clinical
practice and for decision making. New molecular detection
methods, including HRMA/PCR, microarrays, and metagenomic
shotgun sequencing, are under development and hold promise
for the future [92].
New Antifungal Agents for Resistant Fungi
IFIs caused by drug-resistant organisms are an emerging threat
to heavily immunosuppressed patients with HMs. Therefore,
there is an urgent need for new antifungals with activity
against resistant fungi. It should be underlined, though, that
fungi are eukaryotes, just like human cells; thus, discovering
new antifungal agents not interfering with human cells is
challenging.
Recent developments in fungal functional genomics, proteomics,
and gene mapping allowed the discovery of potential new drug
targets that could offer additional options to treat resistant
fungal infections [94]. Cellular and biochemical targets of
investigational agents against drug-resistant fungal pathogens
include metabolic pathways (such as the glyoxylate cycle,
iron metabolism, and heme biosynthesis), cell wall and cell
membrane components, signal transduction pathways (such
as MAP kinase), and gene expression. However, there is a
paucity of novel antifungal compounds in preclinical or clinical
development, as the majority of these new antifungal agents
are in the very early stages of development.
SCY-078 is the first orally bioavailable inhibitor of (1,3)-β-Dglucan
synthesis of the fungal cell wall. A triterpene derivative,
SCY-078 has demonstrated in vitro and in vivo activity against
all tested Candida spp., including Candida auris, as well as
triazole-resistant and echinocandin-resistant Candida spp.
[94]. Its spectrum includes Aspergillus spp., where it may
be particularly effective in combination with anti-mold
triazoles. E1210 is a novel isoxazolyl-bis-pyridine wall-active
antifungal compound that inhibits inositol acylation of
mannosylated cell wall proteins, resulting in arrest of fungal
growth [94]. The antifungal spectrum includes most yeast
with the exception of Candida krusei and molds, including
isolates resistant to triazoles and polyenes. Biafungin (CD101)
is a novel, long-acting, semisynthetic echinocandin derivative
of anidulafungin that is currently in phase III clinical
studies. In vitro susceptibility testing showed that biafungin
has activity against caspofungin-resistant Candida strains
containing FKS mutations [95]. Other antifungal agents under
development include F901318 (dihydroorotate dehydrogenase
inhibitor), VT-1598 (metalloenzyme inhibitors of CYP51), and
ASP2397 (hydroxamate siderophores-like agent) [94].
Future Research Directions in Fungal Resistance
Invasive infections caused by resistant fungi are emerging global
problems of public health, associated with increased morbidity
and mortality, particularly among patients with HMs. There are
unanswered questions and unmet needs in all areas of knowledge
of fungal resistance, including epidemiology, diagnostics,
therapeutics, prevention, and education, that require expertise
from many different disciplines to be addressed [96].
The emerging epidemiological data raise intriguing questions:
why is the prevalence of azole resistance in Aspergillus so
variable? The frequency of resistance may vary considerably,
not only between continents and countries but also between
hospitals within the same country, between departments, or
between risk groups within the same hospital [97,98,99]. Is this
under- or overreporting, suboptimal sampling, and/or technical
issues in Aspergillus fumigatus isolation and resistance
detection? Alternatively, are there any geoclimatic factors that
create ecological niches favoring the spread of resistance?
Obviously, general surveillance studies are not sufficient to
capture the problem. In the future, meticulous well-funded
epidemiological studies targeted to specific high-risk groups,
especially patients with HMs, are necessary.
Development and implementation of laboratory diagnostic
tools should be a priority for future research in the field of
resistant fungal infections, as current technology does not
allow rapid species identification and assessment of resistance.
Development of interpretive breakpoints for fungal infections
in neutropenic patients with HMs is an unmet need. New
molecular technologies for the prompt and accurate detection
of genes and mutations associated with fungal resistance are
urgently needed.
The existing antifungal agents are not sufficient to confront
the growing trend of resistance. The limited antifungal
armamentarium should be enriched with agents with novel
mechanisms of action to overcome resistance. A fascinating
direction for future research is the development of new
antifungal agents that do not kill or inhibit the growth of
fungi but impair key virulence properties, such as invasion or
adherence.
Prevention of fungal resistance should be at the core of future
research. Antifungal stewardship programs should ensure
that there is an indication for antifungal therapy, that the
appropriate antifungal agent is selected, and that the dosage,
route of administration, and duration are optimal and that deescalation
is implemented when feasible. A robust antifungal
stewardship program might have beneficial effects on the
prevention of resistance. Understanding the pathophysiology
7
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
Turk J Hematol 2018;35:1-11
of biofilm formation and reducing the use of CVCs might also
prevent the development of catheter-related resistant fungal
infections.
Authorship Contributions
Concept: M.N.G.; Design: M.N.G., T.J.W., N.V.S.; Data Collection
or Processing: M.N.G.; Analysis or Interpretation: M.N.G., T.J.W.,
N.V.S.; Literature Search: M.N.G.; Writing: M.N.G., T.J.W., N.V.S.
Conflict of Interest: MNG reports no conflict of interest for
this specific work; TJW reports receiving research grants for
experimental and clinical antifungal pharmacotherapeutics
from Astellas, Novartis, Merck, and Pfizer; he has served as a
consultant to Astellas, Drais, iCo, Novartis, Pfizer, Methylgene,
and Sigma-Tau. NVS reports receiving consulting fees, grant
support, lecture fees, and honoraria from Astellas Greece, Gilead
Greece, MSD Greece, and Pfizer Greece.
Financial Disclosure: This work was supported by the Special
Account for Research Grants (ELKE) of the National and
Kapodistrian University of Athens (grant number 70/3/11724)
and by a grant from the Save Our Sick Kids Foundation (http://
soskidsfoundation.org).
References
1. Sipsas NV, Bodey GP, Kontoyiannis DP. Perspectives for the management
of febrile neutropenic patients with cancer in the 21st century. Cancer
2005;103:1103-1113.
2. Neofytos D, Horn D, Anaissie E, Steinbach W, Olyaei A, Fishman J, Pfaller M,
Chang C, Webster K, Marr K. Epidemiology and outcome of invasive fungal
infection in adult hematopoietic stem cell transplant recipients: analysis of
Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin
Infect Dis 2009;48:265-273.
3. Kontoyiannis DP, Lewis RE. Antifungal drug resistance of pathogenic fungi.
Lancet 2002;359:1135-1144.
4. Kontoyiannis DP. Antifungal resistance: an emerging reality and a global
challenge. J Infect Dis 2017;216(Suppl 3):431-435.
5. Perlin DS, Rautemaa-Richardson R, Alastruey-Izquierdo A. The global
problem of antifungal resistance: prevalence, mechanisms, and
management. Lancet Infect Dis 2017;17:383-392.
6. Verweij PE, Snelders E, Kema GH, Mellado E, Melchers WJ. Azole resistance
in Aspergillus fumigatus: a side-effect of environmental fungicide use?
Lancet Infect Dis 2009;9:789-795.
7. Snelders E, Melchers WJ, Verweij PE. Azole resistance in Aspergillus
fumigatus: a new challenge in the management of invasive aspergillosis?
Future Microbiol 2011;6:335-347.
8. Lavergne RA, Chouaki T, Hagen F, Toublanc B, Dupont H, Jounieaux V, Meis
JF, Morio F, Le Pape P. Home environment as a source of life-threatening
azole-resistant Aspergillus fumigatus in immunocompromised patients.
Clin Infect Dis 2017;64:76-78.
9. Shields RK, Nguyen MH, Press EG, Kwa AL, Cheng S, Du C, Clancy CJ. The
presence of an FKS mutation rather than MIC is an independent risk factor
for failure of echinocandin therapy among patients with invasive candidiasis
due to Candida glabrata. Antimicrob Agents Chemother 2012;56:4862-
4869.
10. Verweij PE, Chowdhary A, Melchers WJ, Meis JF. Azole resistance in
Aspergillus fumigatus: can we retain the clinical use of mold-active
antifungal azoles? Clin Infect Dis 2016;62:362-368.
11. Chowdhary A, Sharma C, Meis JF. Azole-resistant aspergillosis: epidemiology,
molecular mechanisms and treatment. J Infect Dis 2017;216(Suppl 3):436-
444.
12. Healey KR, Zhao Y, Perez WB, Lockhart SR, Sobel JD, Farmakiotis D,
Kontoyiannis DP, Sanglard D, Taj-Aldeen SJ, Alexander BD, Jimenez-
Ortigosa C, Shor E, Perlin DS. Prevalent mutator genotype identified in
fungal pathogen Candida glabrata promotes multi-drug resistance. Nat
Commun 2016;7:11128.
13. Lockhart SR, Etienne KA, Vallabhaneni S, Farooqi J, Chowdhary A, Govender
NP, Colombo AL, Calvo B, Cuomo CA, Desjardins CA, Berkow EL, Castanheira
M, Magobo RE, Jabeen K, Asghar RJ, Meis JF, Jackson B, Chiller T, Litvintseva
AP. Simultaneous emergence of multidrug-resistant Candida auris on 3
continents confirmed by whole-genome sequencing and epidemiological
analyses. Clin Infect Dis 2017;64:134-140.
14. Lamaris GA, Chamilos G, Lewis RE, Safdar A, Raad II, Kontoyiannis DP.
Scedosporium infection in a tertiary care cancer center: a review of 25
cases from 1989-2006. Clin Infect Dis 2006;43:1580-1584.
15. Park BJ, Pappas PG, Wannemuehler KA, Alexander BD, Anaissie EJ, Andes DR,
Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S, Herwaldt L, Ito JI,
Kauffman CA, Lyon GM, Marr KA, Morrison VA, Papanicolaou G, Patterson
TF, Perl TM, Schuster MG, Walker R, Wingard JR, Walsh TJ, Kontoyiannis DP.
Invasive non-Aspergillus mold infections in transplant recipients, United
States, 2001-2006. Emerg Infect Dis 2011;17:1855-1864.
16. Sipsas NV, Lewis RE, Tarrand J, Hachem R, Rolston KV, Raad II, Kontoyiannis
DP. Candidemia in patients with hematologic malignancies in the era
of new antifungal agents (2001-2007): stable incidence but changing
epidemiology of a still frequently lethal infection. Cancer 2009;115:4745-
4752.
17. Gamaletsou MN, Walsh T, Zaoutis T, Pagoni M, Kotsopoulou M, Voulgarelis
M, Panayiotidis P, Vassilakopoulos T, Angelopoulou MK, Marangos
M, Spyridonidis A, Kofteridis D, Pouli A, Sotiropoulos D, Matsouka P,
Argyropoulou A, Perloretzou S, Leckerman K, Manaka A, Oikonomopoulos P,
Daikos G, Petrikkos G, Sipsas NV. A prospective, cohort, multicenter study of
candidemia in hospitalized adult patients with hematological malignancies.
Clin Microbiol Infect 2014;20:50-57.
18. Farmakiotis D, Kontoyiannis DP. Epidemiology of antifungal resistance in
human pathogenic yeasts: current viewpoint and practical recommendations
for management. Int J Antimicrob Agents 2017;50:318-324.
19. Gamaletsou MN, Daikos GL, Walsh TJ, Perlin DS, Ortigosa CJ, Psaroulaki
A, Pagoni M, Argyropoulou A, Nepka M, Perivolioti E, Kotsopoulou M,
Perloretzou S, Marangos M, Kofteridis D, Grammatikou M, Goukos D,
Petrikkos G, Sipsas NV. Breakthrough candidemia caused by phenotypically
susceptible Candida spp. in patients with hematological malignancies does
not correlate with established interpretive breakpoints. Int J Antimicrob
Agents 2014;44:248-255.
20. Siopi M, Neroutsos E, Zisaki K, Gamaletsou M, Piroynaki M, Tsirigotis P,
Sipsas N, Dokoumetzidis A, Goussetis E, Zerva L, Valsami G, Meletiadis J.
Bioassay for determining voriconazole serum levels in patients receiving
combination therapy with echinocandins. Antimicrob Agents Chemother
2015;60:632-636.
21. Walsh TJ, Driscoll T, Milligan PA, Wood ND, Schlamm H, Groll AH, Jafri H,
Arrieta AC, Klein NJ, Lutsar I. Pharmacokinetics, safety, and tolerability of
voriconazole in hospitalized immunocompromised children. Antimicrob
Agents Chemother 2010;54:4116-4123.
22. Shields RK, Nguyen MH, Press EG, Clancy CJ. Abdominal candidiasis is a
hidden reservoir of echinocandin resistance. Antimicrob Agents Chemother
2014;58:7601-7615.
23. Osherov N, Kontoyiannis DP. The anti-Aspergillus drug pipeline: is the glass
half full or empty? Med Mycol 2017;55:118-124.
24. Chowdhary A, Sharma C, Meis JF. Azole-resistant aspergillosis: epidemiology,
molecular mechanisms, and treatment. J Infect Dis 2017;216(Suppl 3):436-
444.
25. van der Linden JW, Arendrup MC, Warris A, Lagrou K, Pelloux H, Hauser PM,
Chryssanthou E, Mellado E, Kidd SE, Tortorano AM, Dannaoui E, Gaustad
8
Turk J Hematol 2018;35:1-11
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
P, Baddley JW, Uekötter A, Lass-Flörl C, Klimko N, Moore CB, Denning DW,
Pasqualotto AC, Kibbler C, Arikan-Akdagli S, Andes D, Meletiadis J, Naumiuk
L, Nucci M, Melchers WJ, Verweij PE. Prospective multicenter international
surveillance of azole resistance in Aspergillus fumigatus. Emerg Infect Dis
2015;21:1041-1044.
26. Verweij PE, Mellado E, Melchers WJ. Multiple-triazole-resistant aspergillosis.
N Engl J Med 2007;356:1481-1483.
27. Mellado E, Garcia-Effron G, Alcázar-Fuoli L, Melchers WJ, Verweij PE,
Cuenca-Estrella M, Rodríguez-Tudela JL. A new Aspergillus fumigatus
resistance mechanism conferring in vitro cross-resistance to azole
antifungals involves a combination of cyp51A alterations. Antimicrob
Agents Chemother 2007;51:1897-1904.
28. van der Linden JW, Camps SM, Kampinga GA, Arends JP, Debets-Ossenkopp
YJ, Haas PJ, Rijnders BJ, Kuijper EJ, van Tiel FH, Varga J, Karawajczyk A, Zoll
J, Melchers WJ, Verweij PE. Aspergillosis due to voriconazole highly resistant
Aspergillus fumigatus and recovery of genetically related resistant isolates
from domiciles. Clin Infect Dis 2013;57:513-520.
29. Le Pape P, Lavergne RA, Morio F, Alvarez-Moreno C. Multiple fungicidedriven
alterations in azole-resistant Aspergillus fumigatus, Colombia, 2015.
Emerg Infect Dis 2016;22:156-157.
30. Hodiamont CJ, Dolman KM, Ten Berge IJ, Melchers WJ, Verweij PE, Pajkrt D.
Multiple-azole-resistant Aspergillus fumigatus osteomyelitis in a patient
with chronic granulomatous disease successfully treated with long-term
oral posaconazole and surgery. Med Mycol 2009;47:217-220.
31. Howard SJ, Arendrup MC. Acquired antifungal drug resistance in Aspergillus
fumigatus: epidemiology and detection. Med Mycol 2011;49 (Suppl 1):90-
95.
32. Mann PA, Parmegiani RM, Wei SQ, Mendrick CA, Li X, Loebenberg D,
DiDomenico B, Hare RS, Walker SS, McNicholas PM. Mutations in Aspergillus
fumigatus resulting in reduced susceptibility to posaconazole appear to be
restricted to a single amino acid in the cytochrome P450 14α-demethylase.
Antimicrob Agents Chemother 2003;47:577-581.
33. Mellado E, Garcia-Effron G, Alcazar-Fuoli L, Cuenca-Estrella M, Rodriguez-
Tudela JL. Substitutions at methionine 220 in the 14α-sterol demethylase
(Cyp51A) of Aspergillus fumigatus are responsible for resistance in vitro to
azole antifungal drugs. Antimicrob Agents Chemother 2004;48:2747-2750.
34. Chen J, Li H, Li R, Bu D, Wan Z. Mutations in the cyp51A gene and
susceptibility to itraconazole in Aspergillus fumigatus serially isolated from
a patient with lung aspergilloma. J Antimicrob Chemother 2005;55:31-37.
35. Bellete B, Raberin H, Morel J, Flori P, Hafid J, Manhsung RT. Acquired
resistance to voriconazole and itraconazole in a patient with pulmonary
aspergilloma. Med Mycol 2010;48:197-200.
36. Krishnan Natesan S, Wu W, Cutright JL, Chandrasekar PH. In vitro-in vivo
correlation of voriconazole resistance due to G448S mutation (cyp51A
gene) in Aspergillus fumigatus. Diagn Microbiol Infect Dis 2012;74:272-
277.
37. Paul RA, Rudramurthy SM, Meis JF, Mouton JW, Chakrabarti A. A novel
Y319H substitution in CYP51C associated with azole resistance in Aspergillus
flavus. Antimicrob Agents Chemother 2015;59:6615-6619.
38. Arendrup MC, Jensen RH, Grif K, Skov M, Pressler T, Johansen HK, Lass-Flörl
C. In vivo emergence of Aspergillus terreus with reduced azole susceptibility
and a Cyp51a M217I alteration. J Infect Dis 2012;206:981-985.
39. Howard SJ, Cerar D, Anderson MJ, Albarrag A, Fisher MC, Pasqualotto
AC, Laverdiere M, Arendrup MC, Perlin DS, Denning DW. Frequency and
evolution of azole resistance in Aspergillus fumigatus associated with
treatment failure. Emerg Infect Dis 2009;15:1068-1076.
40. Albarrag AM, Anderson MJ, Howard SJ, Robson GD, Warn PA, Sanglard
D, Denning DW. Interrogation of related clinical pan-azole-resistant
Aspergillus fumigatus strains: G138C, Y431C, and G434C single nucleotide
polymorphisms in cyp51A, upregulation of cyp51A, and integration and
activation of transposon Atf1 in the cyp51A promoter. Antimicrob Agents
Chemother 2011;55:5113-5121.
41. Moye-Rowley WS. Multiple mechanisms contribute to the development
of clinically significant azole resistance in Aspergillus fumigatus. Front
Microbiol 2015;6:70.
42. Bueid A, Howard SJ, Moore CB, Richardson MD, Harrison E, Bowyer P,
Denning DW. Azole antifungal resistance in Aspergillus fumigatus: 2008
and 2009. J Antimicrob Chemother 2010;65:2116-2118.
43. Rajendran R, Mowat E, McCulloch E, Lappin DF, Jones B, Lang S, Majithiya
JB, Warn P, Williams C, Ramage G. Azole resistance of Aspergillus fumigatus
biofilms is partly associated with efflux pump activity. Antimicrob Agents
Chemother 2011;55:2092-2097.
44. Paul S, Diekema D, Moye-Rowley WS. Contributions of both ATP-binding
cassette transporter and Cyp51A proteins are essential for azole resistance
in Aspergillus fumigatus. Antimicrob Agents Chemother 2017;61:e02748-
16.
45. Wei X, Chen P, Gao R, Li Y, Zhang A, Liu F, Lu L. Screening and characterization
of the non-cyp51A mutation Afcox10 conferring azole resistance in
Aspergillus fumigatus. Antimicrob Agents Chemother 2017;61:e02101-16.
46. Camps SM, Dutilh BE, Arendrup MC, Rijs AJ, Snelders E, Huynen MA, Verweij
PE, Melchers WJ. Discovery of a hapE mutation that causes azole resistance
in Aspergillus fumigatus through whole genome sequencing and sexual
crossing. PLoS One 2012;7:e50034.
47. Ramage G, Mowat E, Jones B, Williams C, Lopez-Ribot J. Our current
understanding of fungal biofilms. Crit Rev Microbiol 2009;35:340-355.
48. Xiong Q, Hassan SA, Wilson WK, Han XY, May GS, Tarrand JJ, Matsuda SP.
Cholesterol import by Aspergillus fumigatus and its influence on antifungal
potency of sterol biosynthesis inhibitors. Antimicrob Agents Chemother
2005;49:518-524.
49. Balajee SA, Gribskov JL, Hanley E, Nickle D, Marr KA. Aspergillus lentulus sp.
nov., a new sibling species of A. fumigatus. Eukaryot Cell 2005;4:625-632.
50. Alastruey-Izquierdo A, Cuesta I, Houbraken J, Cuenca-Estrella M, Monzon
A, Rodriguez-Tudela JL. In vitro activity of nine antifungal agents against
clinical isolates of Aspergillus calidoustus. Med Mycol 2010;48:97-102.
51. Walsh TJ, Petraitis V, Petraitiene R, Field-Ridley A, Sutton D, Ghannoum
M, Sein T, Schaufele R, Peter J, Bacher J, Casler H, Armstrong D, Espinel-
Ingroff A, Rinaldi MG, Lyman CA. Experimental pulmonary aspergillosis due
to Aspergillus terreus: pathogenesis and treatment of an emerging fungal
pathogen resistant to amphotericin B. J Infect Dis 2003;188:305-319.
52. Vazquez JA, Arganoza MT, Boikov D, Yoon S, Sobel JD, Akins RA. Stable
phenotypic resistance of Candida species to amphotericin B conferred by
preexposure to subinhibitory levels of azoles. J Clin Microbiol 1998;36:2690-
2695.
53. Perfect JR, Cox GM. Drug resistance in Cryptococcus neoformans. Drug
Resist Updat 1999;2:259-269.
54. Snelders E, van der Lee HA, Kuijpers J, Rijs AJ, Varga J, Samson RA, Mellado
E, Donders AR, Melchers WJ, Verweij PE. Emergence of azole resistance in
Aspergillus fumigatus and spread of a single resistance mechanism. PLoS
Med 2008;5:e219.
55. Snelders E, Huis In ‘t Veld RA, Rijs AJ, Kema GH, Melchers WJ, Verweij PE.
Possible environmental origin of resistance of Aspergillus fumigatus to
medical triazoles. Appl Environ Microbiol 2009;75:4053-4057.
56. Özmerdiven GE, Ak S, Ener B, Ağca H, Cilo BD, Tunca B, Akalın H. First
determination of azole resistance in Aspergillus fumigatus strains carrying
the TR34/L98H mutations in Turkey. J Infect Chemother 2015;21:581-586.
57. Hsueh PR, Lau YJ, Chuang YC, Wan JH, Huang WK, Shyr JM, Yan JJ, Yu
KW, Wu JJ, Ko WC, Yang YC, Liu YC, Teng LJ, Liu CY, Luh KT. Antifungal
susceptibilities of clinical isolates of Candida species, Cryptococcus
neoformans, and Aspergillus species from Taiwan: surveillance of
multicenter antimicrobial resistance in Taiwan program data from 2003.
Antimicrob Agents Chemother 2005;49:512-517.
58. Lockhart SR, Frade JP, Etienne KA, Pfaller MA, Diekema DJ, Balajee SA.
Azole resistance in Aspergillus fumigatus isolates from the ARTEMIS global
surveillance study is primarily due to the TR/L98H mutation in the cyp51A
gene. Antimicrob Agents Chemother 2011;55:4465-4468.
9
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
Turk J Hematol 2018;35:1-11
59. Wiederhold NP, Gil VG, Gutierrez F, Lindner JR, Albataineh MT, McCarthy DI,
Sanders C, Fan H, Fothergill AW, Sutton DA. First detection of TR34 L98H
and TR46 Y121F T289A Cyp51 mutations in Aspergillus fumigatus isolates
in the United States. J Clin Microbiol 2016;54:168-171.
60. Gonçalves SS. Global aspects of triazole resistance in Aspergillus fumigatus
with focus on Latin American countries. J Fungi 2017;3:5.
61. Kidd SE, Goeman E, Meis JF, Slavin MA, Verweij PE. Multi-triazole-resistant
Aspergillus fumigatus infections in Australia. Mycoses 2015;58:350-355.
62. van Ingen J, van der Lee HA, Rijs TA, Zoll J, Leenstra T, Melchers WJ, Verweij
PE. Azole, polyene and echinocandin MIC distributions for wild-type,
TR34/L98H and TR46/Y121F/T289A Aspergillus fumigatus isolates in the
Netherlands. J Antimicrob Chemother 2015;70:178-181.
63. Howard SJ, Lass-Flörl C, Cuenca-Estrella M, Gomez-Lopez A, Arendrup
MC. Determination of isavuconazole susceptibility of Aspergillus and
Candida species by the EUCAST method. Antimicrob Agents Chemother
2013;57:5426-5431.
64. Gregson L, Goodwin J, Johnson A, McEntee L, Moore CB, Richardson M,
Hope WW, Howard SJ. In vitro susceptibility of Aspergillus fumigatus
to isavuconazole: correlation with itraconazole, voriconazole, and
posaconazole. Antimicrob Agents Chemother 2013;57:5778-5780.
65. Steinmann J, Hamprecht A, Vehreschild MJ, Cornely OA, Buchheidt D,
Spiess B, Koldehoff M, Buer J, Meis JF, Rath PM. Emergence of azoleresistant
invasive aspergillosis in HSCT recipients in Germany. J Antimicrob
Chemother 2015;70:1522-1526.
66. Chowdhary A, Kathuria S, Xu J, Sharma C, Sundar G, Singh PK, Gaur
SN, Hagen F, Klaassen CH, Meis JF. Clonal expansion and emergence of
environmental multiple-triazole-resistant Aspergillus fumigatus strains
carrying the TR 34
/L98H mutations in the cyp51A gene in India. PLoS One
2012;7:e52871.
67. Heo ST, Tatara AM, Jiménez-Ortigosa C, Jiang Y, Lewis RE, Tarrand J, Tverdek
F, Albert ND, Verweij PE, Meis JF, Mikos AG, Perlin DS, Kontoyiannis DP.
Changes in in vitro susceptibility patterns of Aspergillus to triazoles and
correlation with aspergillosis outcome in a tertiary care cancer center,
1999-2015. Clin Infect Dis 2017;65:216-225.
68. Verweij PE, Ananda-Rajah M, Andes D, Arendrup MC, Brüggemann RJ,
Chowdhary A, Cornely OA, Denning DW, Groll AH, Izumikawa K, Kullberg BJ,
Lagrou K, Maertens J, Meis JF, Newton P, Page I, Seyedmousavi S, Sheppard
DC, Viscoli C, Warris A, Donnelly JP. International expert opinion on the
management of infection caused by azole-resistant Aspergillus fumigatus.
Drug Resist Updat 2015;21-22:30-40.
69. Cowen LE, Sanglard D, Howard SJ, Rogers PD, Perlin DS. Mechanisms of
antifungal drug resistance. Cold Spring Harb Perspect Med 2015;5:a019752.
70. Sagatova AA, Keniya MV, Wilson RK, Monk BC, Tyndall JD. Structural
insights into binding of the antifungal drug fluconazole to Saccharomyces
cerevisiae lanosterol 14α-demethylase. Antimicrob Agents Chemother
2015;59:4982-4989.
71. Flowers SA, Barker KS, Berkow EL, Toner G, Chadwick SG, Gygax SE,
Morschhäuser J, Rogers PD. Gain-of-function mutations in UPC2 are a
frequent cause of ERG11 upregulation in azole-resistant clinical Isolates of
Candida albicans. Eukaryotic Cell 2012;11:1289-1299.
72. Vale-Silva LA, Coste AT, Ischer F, Parker JE, Kelly SL, Pinto E, Sanglard D.
Azole resistance by loss of function of the sterol Δ 5,6 -desaturase gene (ERG3)
in Candida albicans does not necessarily decrease virulence. Antimicrob
Agents Chemother 2012;56:1960-1968.
73. Douglas CM. Fungal beta(1,3)-D-glucan synthesis. Med Mycol 2001;39(Suppl
1):55-66.
74. Arendrup MC, Perlin DS. Echinocandin resistance: an emerging clinical
problem? Curr Opin Infect Dis 2014;27:484-492.
75. Alexander BD, Johnson MD, Pfeiffer CD, Jiménez-Ortigosa C, Catania
J, Booker R, Castanheira M, Messer SA, Perlin DS, Pfaller MA. Increasing
echinocandin resistance in Candida glabrata: clinical failure correlates with
presence of FKS mutations and elevated minimum inhibitory concentrations.
Clin Infect Dis 2013;56:1724-1732.
76. Bailly S, Maubon D, Fournier P, Pelloux H, Schwebel C, Chapuis C, Foroni
L, Cornet M, Timsit JF. Impact of antifungal prescription on relative
distribution and susceptibility of Candida spp.- trends over 10 years. J
Infect 2016;72:103-111.
77. Hull CM, Bader O, Parker JE, Weig M, Gross U, Warrilow AG, Kelly DE, Kelly
SL. Two clinical isolates of Candida glabrata exhibiting reduced sensitivity
to amphotericin B both harbor mutations in ERG2. Antimicrob Agents
Chemother 2012;56:6417-6421.
78. Pfaller MA, Messer SA, Woosley LN, Jones RN, Castanheira M. Echinocandin
and triazole antifungal susceptibility profiles for clinical opportunistic yeast
and mold isolates collected from 2010 to 2011: application of new CLSI
clinical breakpoints and epidemiological cutoff values for characterization
of geographic and temporal trends of antifungal resistance. J Clin Microbiol
2013;51:2571-2581.
79. Pham CD, Iqbal N, Bolden CB, Kuykendall RJ, Harrison LH, Farley MM,
Schaffner W, Beldavs ZG, Chiller TM, Park BJ, Cleveland AA, Lockhart SR.
Role of FKS mutations in Candida glabrata: MIC values, echinocandin
resistance, and multidrug resistance. Antimicrob Agents Chemother
2014;58:4690-4696.
80. Vallabhaneni S, Cleveland AA, Farley MM, Harrison LH, Schaffner W, Beldavs
ZG, Derado G, Pham CD, Lockhart SR, Smith RM. Epidemiology and risk
factors for echinocandin non-susceptible Candida glabrata bloodstream
infections: data from a large multisite population-based candidemia
surveillance program, 2008-2014. Open Forum Infect Dis 2015;2:ofv163.
81. Klotz U, Schmidt D, Willinger B, Steinmann E, Buer J, Rath PM, Steinmann
J. Echinocandin resistance and population structure of invasive Candida
glabrata isolates from two university hospitals in Germany and Austria.
Mycoses 2016;59:312-318.
82. McCarthy MW, Walsh TJ. Containment strategies to address the expanding
threat of multidrug-resistant Candida auris. Expert Rev Anti Infect Ther
2017;15:1095-1099.
83. Calvo B, Melo AS, Perozo-Mena A, Hernandez M, Francisco EC, Hagen F,
Meis JF, Colombo AL. First report of Candida auris in America: clinical and
microbiological aspects of 18 episodes of candidemia. J Infect 2016;73:369-
374.
84. Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner
L, Reboli AC, Schuster MG, Vazquez JA, Walsh TJ, Zaoutis TE, Sobel JD.
Executive summary: Clinical practice guideline for the management of
candidiasis: 2016 update by the Infectious Diseases Society of America. Clin
Infect Dis 2016;62:409-417.
85. Slavin M, van Hal S, Sorrell TC, Lee A, Marriott DJ, Daveson K, Kennedy K,
Hajkowicz K, Halliday C, Athan E, Bak N, Cheong E, Heath CH, Orla Morrissey
C, Kidd S, Beresford R, Blyth C, Korman TM, Owen Robinson J, Meyer W,
Chen SC; Australia and New Zealand Mycoses Interest Group. Invasive
infections due to filamentous fungi other than Aspergillus: epidemiology
and determinants of mortality. Clin Microbiol Infect 2015;21:490.
86. Kontoyiannis DP, Marr KA, Park BJ, Alexander BD, Anaissie EJ, Walsh TJ, Ito
J, Andes DR, Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S,
Herwaldt LA, Kauffman CA, Knapp K, Lyon GM, Morrison VA, Papanicolaou
G, Patterson TF, Perl TM, Schuster MG, Walker R, Wannemuehler KA,
Wingard JR, Chiller TM, Pappas PG. Prospective surveillance for invasive
fungal infections in hematopoietic stem cell transplant recipients, 2001-
2006: overview of the Transplant-Associated Infection Surveillance
Network (TRANSNET) Database. Clin Infect Dis 2010;50:1091-1100.
87. Fernández-Ruiz M, Guinea J, Puig-Asensio M, Zaragoza Ó, Almirante B,
Cuenca-Estrella M, Aguado JM; CANDIPOP Project; GEIH-GEMICOMED
(SEIMC) and REIPI. Fungemia due to rare opportunistic yeasts: data from a
population-based surveillance in Spain. Med Mycol 2017;55:125-136.
88. Bretagne S, Renaudat C, Desnos-Ollivier M, Sitbon K, Lortholary O, Dromer
F; French Mycosis Study Group. Predisposing factors and outcome of
uncommon yeast species-related fungaemia based on an exhaustive
surveillance programme (2002-14). J Antimicrob Chemother 2017;72:1784-
1793.
10
Turk J Hematol 2018;35:1-11
Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections
89. Espinel-Ingroff A, Turnidge J. The role of epidemiological cutoff values
(ECVs/ECOFFs) in antifungal susceptibility testing and interpretation for
uncommon yeasts and moulds. Rev Iberoam Micol 2016;33:63-75.
90. Ostrosky-Zeichner L, Andes D. The role of in vitro susceptibility
testing in management of fungal infections. J Infect Dis 2017;216(Suppl
3):452-457.
91. Mylonakis E, Clancy CJ, Ostrosky-Zeichner L, Garey KW, Alangaden GJ,
Vazquez JA, Groeger JS, Judson MA, Vinagre YM, Heard SO, Zervou FN,
Zacharioudakis IM, Kontoyiannis DP, Pappas PG. T2 magnetic resonance
assay for the rapid diagnosis of candidemia in whole blood: a clinical trial.
Clin Infect Dis 2015;60:892-899.
92. Perlin DS, Wiederhold NP. Culture-independent molecular methods for
detection of antifungal resistance mechanisms and fungal identification. J
Infect Dis 2017;216(Suppl 3):458-465.
93. Alanio A, Bretagne S. Performance evaluation of multiplex PCR including
Aspergillus-not so simple! Med Mycol 2017;55:56-62.
94. McCarthy MW, Kontoyiannis DP, Perfect J, Cornely OS, Walsh TJ. Novel
agents and drug targets to meet the challenges of resistant fungi. J Infect
Dis 2017;216(Suppl 3):474-483.
95. Pfaller MA, Messer SA, Rhomberg PR, Jones RN, Castanheira M. Activity
of a long-acting echinocandin, CD101, determined using CLSI and EUCAST
reference methods, against Candida and Aspergillus spp., including
echinocandin- and azole-resistant isolates. J Antimicrob Chemother
2016;71:2868-2873.
96. McCarthy MW, Denning DW, Walsh TJ. Future research priorities in fungal
resistance. J Infect Dis 2017;216(Suppl 3):484-492.
97. Verweij PE, Lestrade PP, Melchers WJ, Meis JF. Azole resistance surveillance
in Aspergillus fumigatus: beneficial or biased? J Antimicrob Chemother
2016;71:2079-2082.
98. Alanio A, Denis B, Hamane S, Raffoux E, Peffault de la Tour R, Touratier S,
Bergeron A, Bretagne S. New therapeutic strategies for invasive aspergillosis
in the era of azole resistance: how should the prevalence of azole resistance
be defined? J Antimicrob Chemother 2016;71:2075-2078.
99. Lestrade PP, Meis JF, Arends JP, van der Beek MT, de Brauwer E, van Dijk K,
de Greeff SC, Haas PJ, Hodiamont CJ, Kuijper EJ, Leenstra T, Muller AE, Oude
Lashof AM, Rijnders BJ, Roelofsen E, Rozemeijer W, Tersmette M, Terveer
EM, Verduin CM, Wolfhagen MJ, Melchers WJ, Verweij PE. Diagnosis and
management of aspergillosis in the Netherlands: a national survey. Mycoses
2016;59:101-107.
11
RESEARCH ARTICLE
DOI: 10.4274/tjh.2017.0039
Turk J Hematol 2018;35:12-18
A National Registry of Thalassemia in Turkey: Demographic
and Disease Characteristics of Patients, Achievements, and
Challenges in Prevention
Türkiye Ulusal Talasemi Kaydı: Hastaların Demografik ve Hastalık Özellikleri, Kontrol
Programının Başarısı ve Sorunları
Yeşim Aydınok, Yeşim Oymak, Berna Atabay, Gönül Aydoğan, Akif Yeşilipek, Selma Ünal, Yurdanur Kılınç, Banu Oflaz,
Mehmet Akın, Canan Vergin, Melike Sezgin Evim, Ümran Çalışkan, Şule Ünal, Ali Bay, Elif Kazancı, Talia İleri, Didem
Atay, Türkan Patıroğlu, Selda Kahraman, Murat Söker, Mediha Akcan, Aydan Akdeniz, Mustafa Büyükavcı, Güçhan Alanoğlu,
Özcan Bör, Nur Soyer, Nihal Özdemir Karadaş, Ezgi Uysalol, Meral Türker, Arzu Akçay, Süheyla Ocak, Adalet Meral
Güneş, Hüseyin Tokgöz, Elif Ünal, Naci Tiftik, Zeynep Karakaş
Hemoglobinopathy Study Group, Turkey
Abstract
Objective: The Turkish Society of Pediatric Hematology set up a
National Hemoglobinopathy Registry to demonstrate the demographic
and disease characteristics of patients and assess the efficacy of a
hemoglobinopathy control program (HCP) over 10 years in Turkey.
Materials and Methods: A total of 2046 patients from 27 thalassemia
centers were registered, of which 1988 were eligible for analysis. This
cohort mainly comprised patients with β-thalassemia major (n=1658,
83.4%) and intermedia (n=215, 10.8%).
Results: The majority of patients were from the coastal areas of
Turkey. The high number of patients in Southeastern Anatolia was
due to that area having the highest rates of consanguineous marriage
and fertility. The most common 11 mutations represented 90% of
all β-thalassemia alleles and 47% of those were IVS1-110(G->A)
mutations. The probability of undergoing splenectomy within the
first 10 years of life was 20%, a rate unchanged since the 1980s.
Iron chelators were administered as monotherapy regimens in 95%
of patients and deferasirox was prescribed in 81.3% of those cases.
Deferasirox administration was the highest (93.6%) in patients aged
<10 years. Of the thalassemia major patients, 5.8% had match-related
hemopoietic stem cell transplantation with a success rate of 77%.
Cardiac disease was detected as a major cause of death and did not
show a decreasing trend in 5-year cohorts since 1999.
Conclusion: While the HCP has been implemented since 2003, the
affected births have shown a consistent decrease only after 2009,
being at lowest 34 cases per year. This program failure resulted from
a lack of premarital screening in the majority of cases. Additional
problems were unawareness of the risk and misinformation of the
Öz
Amaç: Türk Pediatrik Hematoloji Derneği, Türkiye’de 10 yıldır devam
eden Hemoglobinopati Kontrol Programı’nın (HCP) etkinliğini
değerlendirmek ve hemoglobinopati hastalarının demografik ve
hastalık özelliklerini ortaya koymak üzere bir Ulusal Hemoglobinopati
Kayıt Programı oluşturdu.
Gereç ve Yöntemler: Toplam 27 talasemi merkezinden 2046 hasta
kaydedildi ve bunların 1988’i analize uygun bulundu. Kayıtların
çoğunluğunu β-talasemi majör (n=1658, %83,4) ve intermedia
(n=215, %10,8) olguları oluşturdu.
Bulgular: Hastaların büyük çoğunluğu kıyı bölgelerde bulunuyordu.
Güneydoğu Anadolu’da yüksek hasta sayısına, bu bölgede en yüksek
görülen akraba evliliği ve yüksek doğum oranının etkisi olabilirdi.
En sık 11 talasemi mutasyonu, tüm β-talasemi allellerinin %90’ını
oluşturuyordu ve bunların %47’si IVS1-110(G->A) mutasyonu
idi. Yaşamın ilk 10 yılında splenektomi olasılığı %20 idi ve bu oran
1980’lerden beri değişmemişti. Demir şelasyonu hastaların %95’inde
monoterapi olarak uygulanmaktaydı ve %81,3’ünü deferasiroks
oluşturuyordu. Deferasiroks uygulaması en yüksek (%93,6) 10
yaştan küçük hastalarda bulundu. Talasemi majör olgularının %5,8’i
hemopoetik kök hücre nakli olmuştu ve başarı oranı %77 idi. Kardiyak
hastalık ölümlerin majör nedeni idi ve beşer yıllık kohortlarda,
1999’dan beri azalma eğilimi göstermiyordu.
Sonuç: HCP 2003 yılından beri uygulanmakla beraber, yeni hastaların
doğumu ancak 2009’dan itibaren azalma eğilimi gösteriyordu ve en
düşük yılda 34 yeni hasta saptandı. Program başarısızlığı, çiftlerin
çoğunda, evlilik öncesi tarama yapılmamasından kaynaklanmaktaydı.
Bir kısmında ise riskin farkında olunmaması ve çiftlerin hatalı
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Yeşim AYDINOK, M.D.,
Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey
Phone : +90 532 396 27 46
E-mail : yesim.aydinok@ege.edu.tr ORCID-ID: orcid.org/0000-0001-8463-2723
Received/Geliş tarihi: January 28, 2017
Accepted/Kabul tarihi: April 11, 2017
12
Turk J Hematol 2018;35:12-18
Aydınok Y, et al: A National Registry of Thalassemia in Turkey
at-risk couples. In addition, prenatal diagnosis was either not offered
to or was not accepted by the at-risk families. This study indicated
that a continuous effort is needed for optimizing the management of
thalassemia and the development of strategies is essential for further
achievements in the HCP in Turkey.
Keywords: Thalassemia, Hemoglobinopathies, Splenectomy, Registries,
Iron chelators, β-thalassemia mutations, Turkey
bilgilendirilmesi nedenliydi. Sonuç olarak, risk ailelerine prenatal
tanı önerilmemesi veya prenatal tanının reddi diğer nedenleri
oluşturuyordu. Bu çalışma, Türkiye’de talasemi tedavisinin
optimizasyonu için çabanın sürdürülmesine ve HCP’nin daha yüksek
başarısı için gelişen stratejilere gereksinim olduğunu gösterdi.
Anahtar Sözcükler: Talasemi, Hemoglobinopatiler, Splenektomi,
Kayıt, Demir şelatörleri, β-talasemi mutasyonları, Türkiye
Introduction
Better management of thalassemia by regular and adequate
red cell transfusions, close monitoring of iron loading, and
appropriate iron chelation therapy (ICT) with deferoxamine
(DFO) has changed the prognosis of the disease worldwide [1].
Furthermore, there was a revolutionary development in the
management of the disease at the beginning of the twentyfirst
century with the introduction of magnetic resonance
imaging (MRI) as a measure of tissue-specific iron loading and
the availability of oral iron chelators deferiprone (DFP) and
deferasirox (DFX) [2,3].
In parallel, DFP and DFX were registered in Turkey in 2004
and 2006, respectively, and gradually replaced DFO. However,
the dissemination of cardiac T2* MRI as a useful tool for the
monitoring and management of iron overload has remained
limited.
The cornerstone of relevant public health policies in Turkey was
the recognition of thalassemia as a common health problem in
1993. Eventually, a comprehensive national hemoglobinopathy
control program (HCP) was implemented by law and came into
force on 24 October 2002 in 33 provinces of Turkey.
In 2012, the Turkish Society of Pediatric Hematology set up
the National Registry for Hemoglobinopathies to collate the
demographic and disease characteristics of patients, and also
quantified and assessed the efficacy of the HCP over 10 years
in Turkey.
Materials and Methods
A website was prepared to conduct this observational
prospective cohort study. The website was launched after
receiving the approval of the ethics committee in October
2012 (B.30.2.EGE.0.20.05.00/OY/1747-723 decision number: 12-
5.2/11) and remained active until June 2015. The investigators
received a secure entrance to the website. The electronic case
report form for each patient with a thalassemia disease and
variant hemoglobins and the signed informed consent form
were completed by the investigators. The system was able to
detect repeated registries for any patient receiving health care
in more than one center. The demographic features and disease
characteristics of the patients were reported. Affected births
from marriages after 2003 were also investigated and relevant
information was collected.
Results
The overall population with a major hemoglobinopathy comprised
2046 patients from 27 thalassemia centers (TCs) participating in
the study. A total of 56 double and one triple registration were
excluded. A total of 1988 patients were analysed.
Distribution of Patients Throughout Turkey
The majority of patients came from TCs in the Aegean (n=622),
Marmara (n=518), Mediterranean (n=348), and Southeastern
Anatolia (n=338) regions. A total of 139 patients were
registered from TCs in Central Anatolia and 23 patients were
from a single TC serving the whole of Eastern Anatolia. There
was no TC in the Black Sea region where a few patients may be
living and receiving health care from the nearest TCs outside
the region (Table 1). The highest number of registered patients
lived in İstanbul (n=265), İzmir (n=207), and Şanlıurfa (n=201)
provinces.
Table 1. Regional distribution of the registered patients.
Regions Provinces Centers (n) Patients (n)
Marmara
Central Anatolia
Southeastern Anatolia
Aegean
Mediterranean
İstanbul 3 416
Bursa 2 102
Ankara 1 36
Kayseri 1 31
Eskişehir 1 19
Konya 1 54
Şanlıurfa 2 187
Diyarbakır 2 105
Gaziantep 1 46
İzmir 4 495
Denizli 1 73
Aydın 2 54
Antalya 1 96
Mersin 1 92
Adana 1 90
Hatay 1 49
Isparta 1 21
Eastern Anatolia Erzurum 1 23
13
Aydınok Y, et al: A National Registry of Thalassemia in Turkey
Turk J Hematol 2018;35:12-18
Demographic Characteristics of Patients
This was a relatively young cohort (51% male), of which 72%
of individuals were below 20 years old (Figure 1). A total of
378 subjects (19%) in the cohort were of preschool age (<6
years). The majority of subjects aged ≥6 years were students
(n=981, 67%). A total of 480 subjects (33%) were not attending
school. Just over half of these (n=256, 53%) were >18 years
old and employed, whereas 224 (47%) were unemployed and
214 of those were >18 years old. Of the unemployed patients
57% had only completed the 8-year primary education, whereas
33% had graduated from high school and 10% from university.
The schooling or employment status was not obtained from 149
subjects. All patients, except for 1%, were covered by social
security regardless of their social status.
Consanguineous marriage was reported for 48% of parents
and 51% of those were first-cousin marriages. Consanguineous
marriages accounted for 75% of parents from Şanlıurfa, which
was the city with the third highest number of thalassemic
patients on the registry. In comparison, consanguineous
marriages were reported in 38.5% and 29% of parents from
İstanbul and İzmir, respectively. Furthermore, the average
number of children born to parents with an affected child was
4 in Şanlıurfa but 2 in İstanbul and İzmir. A total of 214 families
in the registry had more than one thalassemic child.
Disease Characteristics
The majority of subjects (95%) had homozygous β-thalassemia
(Table 2). A total of 1385 β-thalassemia alleles reported from
724 patients contained 22 different β-thalassemia mutations.
The most common 11 mutations represented 90% of all
β-thalassemia alleles. IVS1-110(G->A) was the most prevalent
mutation (Table 3).
Although β-thalassemia intermedia (TI) was reported in 215
(11.5%) of 1873 patients with β-thalassemia, only one-third
of subjects (33.3%) were entirely transfusion-free. Regular
(>8 times/year), frequent (5-8 times/year), and occasional
(0-4 times/year) transfusions were reported in 79 (37.6%), 30
(14.3%), and 31 (14.8%) patients, respectively.
Splenectomy had been performed in 79 (38%) of 207 patients
with TI and 590 (37%) of 1594 patients with β-thalassemia
major (TM). The patients were divided into four age cohorts by
decades and splenectomy indication during the first decade was
compared between age cohorts II, III, and IV. The splenectomy
frequency in age cohort III displayed a slight decrease compared
to cohort IV and simply shifted to the second decade. However,
the frequency of splenectomy did not change in age cohort II
compared to III (Table 4).
A total of 115 patients with TM were aged <2 years at the time
of registration and had not met the criteria for starting ICT.
A total of 150 patients with TI, hemoglobin H (HbH) disease,
Table 2. The diagnosis of registered patients.
Diagnosis n %
β-thalassemia major 1658 83.4
β-thalassemia intermedia 215 10.8
β/S-thalassemia 16 0.8
S/S disease 77 3.9
HbH disease 22 1.1
HbH: hemoglobin H
Table 3. The most common β-thalassemia mutations in the
cohort.
β T mutation
Homozygous
Compound
heterozygous
Total
β T allele
IVSI-110(G->A) 234 184 652 47.1
IVSI-1(G->A) 26 53 105 7.6
IVSI-6(T->C) 24 56 104 7.5
Codon 39(C->T) 22 35 79 5.7
IVSII-745(C->G) 19 40 78 5.6
IVSII-1(G->A) 20 36 76 5.5
Codon 8(-AA) 23 26 72 5.2
Codon 44(-C) 17 11 45 3.3
Codon 5(-CT) 12 17 41 3.0
-30 (T->A) 10 13 33 2.4
IVSI-5(G->C) 10 9 29 2.1
%
Table 4. Changes in frequency and age of splenectomy in age cohorts by decades.
Age cohorts of patients
Age of
I (0-10 years), II (10-20 years), III (20-30 years), IV (30-40 years),
splenectomy (years)
n=685 (%)
n=716 (%)
n=366 (%)
n=129 (%)
0-10 37 (5.5) 135 (19) 73 (20) 33 (26)
10-20 - 105 (15) 137 (37) 36 (29)
20-30 - - 22 (6) 18 (15)
30-40 - - - 2 (1.5)
14
Turk J Hematol 2018;35:12-18
Aydınok Y, et al: A National Registry of Thalassemia in Turkey
sickle-cell disease (SCD), and β/S thalassemia were not receiving
ICT. The history of ICT was not obtained for 78 patients. Overall,
1561 of 1645 patients (95%) with TM (n=1473), TI (n=128),
SCD (n=31), β/S thalassemia (n=9), and HbH disease (n=4) were
receiving a monotherapy regimen. DFX was the most prevalent
chelator, prescribed to 1337 (81.3%) patients, followed by DFO
to 131 (8%) and DFP to 93 (5.7%) patients. Combined therapy of
DFO+DFP was reported in 58 (3.5%), DFX+DFO in 20 (1.2%), and
DFX+DFP in 6 (0.3%) patients. The highest DFX administration of
93.6% was reported in patients aged <10 years and it remained
the most prevalent chelator in all age cohorts. The use of DFO
and DFP was lowest in patients aged <10 years and increased
gradually in older age cohorts (Table 5).
Hemopoietic stem cell transplantation (HSCT) was reported in 96
patients, of which all but one with SCD had TM. The average age
at HSCT was 8.1 years (median: 7 years) and the oldest patient
was 18 years old. The source of HSCT was matched sibling
donor (MSD) in 87 of 92 patients, whereas three family and
two unrelated-donor transplantations were reported. Overall,
70 of 91 patients (77%) had thalassemia-free survival after
HSCT, whereas 20 patients had graft rejection with autologous
recovery (22%) and 1 died (1.1%). There were 115 patients with
an MSD who had not yet had HSCT, of whom 84 were <17 years
old. Furthermore, there were 417 patients with a healthy sibling
whose human leukocyte antigen (HLA) compatibility had not
Figure 1. The age distribution of the registered patients.
Figure 2. The number of affected births prior to and after the
implementation of the hemoglobinopathy control program.
been evaluated.
There were 34 deaths (5%) out of 680 patients from 3 TCs. The
causes of death were heart disease (n=17), infections (n=8),
hepatic failure (n=2), anemia (n=1), HSCT (n=1), and unknown
causes (n=5). The earliest cardiac death was at 11 years old. The
rates of cardiac deaths in the population at risk (age of >10
years) improved gradually in 5-year cohorts since 1999 (Table 6).
The Impact of the Hemoglobinopathy Control Program on
Thalassemic Births
There were 619 thalassemic births after 2004. The number of
new cases has shown a consistent decrease only since 2009
(Figure 2). The year of marriage was recorded for 482 of 619
parents, of whom 242 had been married since 2003 or later.
According to the statements of couples, overall 142 of those
242 (58.7%) had married in provinces covered by the HCP but
did not receive premarital screening. The remaining 100 couples
had premarital screening but 40% of those either received
no feedback information (n=25) or were misinformed (n=15)
regarding screening results and 60% had been informed of
being couples at risk of having thalassemic offspring but those
parents either had not had a prenatal diagnosis (n=49) or had
knowingly given birth to a thalassemic child (n=11).
Sixty-two of these 242 (25.6%) couples were married in Şanlıurfa.
Premarital screening was performed for only 17 (27%) of these
62 couples. Although 12 out of those 17 were informed that
they were at-risk couples, only one had a prenatal diagnosis but
knowingly gave birth to an affected child. Nineteen (7.8%) of
the 242 couples were married in İzmir, of whom 15 (79%) had
premarital screening and 10 of those 15 were informed that they
were at-risk couples, but only 5 of those had a prenatal diagnosis.
Table 5. Changes over time in percentage of chelator use in
patients with hemoglobinopathies.
Age (years) n DFO (%)
DFP
(%)
DFX
(%)
0-10 486 3.3 2 93.6 1.1
11-20 637 7 4 85 4
21-30 317 12 11.3 69.4 7.3
31-40 112 21.4 14.2 60 4.5
DFX: Deferasirox, DFO: deferoxamine, DFP: deferiprone.
Table 6. Changes over time in the number and age of
cardiac deaths.
Cardiac deaths
n
Average age
(years)
1994-1998 6 17.2±5.9 3.26
1999-2003 3 13.7±2.3 1.98
2004-2008 4 19.8±4.0 1.53
2009-2013 3 23.3±3.5 0.85
% of deaths,
DFP + DFO
(%)
at-risk population
15
Aydınok Y, et al: A National Registry of Thalassemia in Turkey
Turk J Hematol 2018;35:12-18
Discussion
Previous epidemiological studies from Turkey reported that
the Çukurova region was the most prevalent for hemoglobin S
(HbS) carriers (up to 10%) and the majority of patients with SCD
were from that region [4,5,6]. Because the TCs that participated
from Çukurova had not registered patients with SCD, the
current registry mainly included patients with homozygous
β-thalassemia. TI accounted for 11.5% of the cohort and the
majority of those individuals were receiving transfusions. It
remains to be determined whether the milder forms have been
missed.
Although the prevalence of β-thalassemia carriers was
stated as 2.1% overall in Turkey [7], the epidemiological data
demonstrated regional differences, with a higher prevalence
in coastal areas [5,8,9,10]. In concordance with this, the
majority of patients came from the Marmara, Aegean, and
Mediterranean regions. Although epidemiological data from
Southeastern Anatolia did not indicate a high prevalence of
thalassemia carriers [11,12], homozygous forms in the region
were found to be as high as those in the coastal areas, most
probably because of the higher number of consanguineous
marriages and the higher fertility rate. The considerable number
of families with more than one affected child indicated that
preventive measures have not been implemented even for the
families with a proven risk. After implementation of the HCP,
the highest number of affected children were born in Şanlıurfa.
It was revealed that the majority of these couples had not had
premarital screening and, furthermore, prenatal diagnosis was
either not offered or not accepted by the at-risk families. The
number of newborns with thalassemia and hemoglobinopathies
was reported as being reduced from 272 in 2002 to 25 in 2010,
which accounted for a 90% reduction over these years [13]. We
consider that report with caution since in the current registry
79 affected births were reported from 27 TCs in Turkey in 2010.
This inconsistency can be explained by insufficient reporting of
new cases to the official registry system used by the Ministry of
Health in Turkey. Nevertheless, the number of affected newborns
per year demonstrated a trend towards a consistent decrease
since 2009. This achievement can be improved by auditing all
components of the program carefully and applying appropriate
corrective measures.
This was a relatively young cohort as 72% of the registry
was <20 years old and they were mostly either of preschool
age (19%) or students (67%). Approximately one-half of the
remaining thalassemic subjects were employed while just under
half were neither employed nor in education or training (NEET).
The Organisation for Economic Co-operation and Development
(OECD) reported that nearly 30% of young people in Turkey
aged 15-29 were NEET, which is well above the OECD average
of 15%, and low skills were a key barrier to achieve better
labor market outcomes for youth in Turkey [14]. In fact, 57%
of NEET individuals in the registry were early school-leavers.
Although the patients were covered by social security regardless
of their social status, effective policies are needed to improve
the education, job, and career prospects of the patients up to at
least the average of their peers. Taking into account that most
children and adolescents in this cohort will be moving from
childhood to adulthood in the near future, the transition from
pediatric to adult care should also be adjusted appropriately.
The wide molecular heterogeneity of Turkish thalassemic
subjects has been confirmed by this registry. The most
common seven mutations accounted for less than 80% of
all thalassemia alleles, consistent with previous reports from
Turkey [15,16,17,18,19,20]. The IVS-I-110(G->A) substitution
was the most common defect with a frequency of 47% within
all β-thalassemia alleles in the cohort. Five of the seven most
common β-thalassemia alleles were either β 0 (codon 39[C->T],
IVSI-1[G->A], FSC8[-AA]) or severe β + thalassemia (IVSI-110[G-
>A], IVSII-745[C->G]), whereas only two prevalent alleles (IVSI-
6[T->C], IVSII-1[G->T]) were related to mild β ++ -thalassemia
mutations.
It is suggested that improved tissue oxygenation by adequate
transfusion regimens has considerably reduced the incidence
of splenectomy within the first 10 years of life in thalassemic
patients [21,22]. The unchanged needs for splenectomy in our
patients from the mid-1970s to mid-2000s may be related to
the low transfusion rates in Turkey.
All guidelines provide age-specific recommendations for
the initiation of ICT. In children <6 years old, all guidelines
recommend DFO as the first-line choice and DFX as the
second-line option for patients where DFO is ineffective or not
tolerated. DFP is recommended for children >6 years old and/or
as a second-line option if patients are resistant or intolerant to
DFX [21,23]. Under the regulations of Turkey, all chelators have
been approved as first-line treatment at the age of ≥2 years
and DFX has been the first-line choice for more than 90% of
patients.
HSCT has remained the only curative treatment for TM.
The Turkish Pediatric Bone Marrow Transplantation Group
specifically collected the data of 245 thalassemic children who
underwent HSCT and of whom 68% achieved thalassemia-free
survival [24]. In this registry, only 96 patients were reported as
having HSCT. The missing registration data may result from the
loss of follow-up of these patients because their health care
is usually moved from the TC to the transplantation center
after HSCT. Nevertheless, there were 115 TM patients with an
16
Turk J Hematol 2018;35:12-18
Aydınok Y, et al: A National Registry of Thalassemia in Turkey
MSD but not yet transplanted and a further 417 patients with
healthy sibling(s) with unknown HLA compatibility. These data
indicate that the awareness of physicians and parents about this
curative option should be increased.
The widespread implementation of cardiac T2* MRI and
appropriate intensification of chelation in those with cardiac
iron overload reduced cardiac mortality significantly [2,3].
Survival data from three major TCs indicated that despite a
gradual improvement in cardiac deaths in the at-risk population
in 5-year cohorts since 1994, cardiac disease is still a major
cause of early deaths and a sustained effort in dissemination of
cardiac T2* MRI and optimum use of ICT should be maintained.
The compliance with ICT remained the most important factor
in ensuring the desired outcome for thalassemic patients and
that may be strengthened by individualized treatment, careful
monitoring, and continuous psychosocial support [2,25].
Conclusion
In conclusion, many efforts have been directed toward optimizing
patients’ management and implementing a prevention program
in Turkey in the new millennium. The current data indicate
that these efforts should be maintained to achieve further
improvement in the survival and quality of life associated with
better integration into social life for thalassemic patients. The
developing strategies are also essential for further achievements
in the prevention program.
Acknowledgments
The authors thank Çağlar Serdar, Aylin Gökduman, and Tolga
Turgay of Plexus Information Technologies for their website
support. The current study and the work presented here are from
an Investigator Initiated Trial, which was sponsored by the Ege
Children’s Foundation and funded by Novartis Pharmaceuticals
Corporation.
Ethics
Ethics Committee Approval: The website was launched after
receiving the approval of the Ege University Faculty of Medicine
Ethics Committee in October 2012 (B.30.2.EGE.0.20.05.00/
OY/1747-723 decision number: 12-5.2/11) and remained active
until June 2015.
Informed Consent: The electronic case report form for each
patient with a thalassemia disease and variant hemoglobins
and the signed informed consent form were completed by the
investigators.
Authorship Contributions
Study Design: Y.A.; Data Collection or Processing: Y.A., Y.O., B.A.,
G.A., A.Y., S.Ü., Y.K., B.O., M.A., C.V., M.E., Ü.Ç., Ş.Ü., A.B., E.K.,
T.İ., D.A., T.P., S.K., M.S., M.A., A.A., M.B., G.A., Ö.B., N.S., N.K.,
E.U., M.T., A.A., S.O., A.M., H.T., Z.U., M.A.Ö., N.T., Z.K.; Analysis or
Interpretation: Y.A.; Literature Search: Y.A.; Writing: Y.A.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Ehlers KH, Giardina PJ, Lesser ML, Engle MA, Hilgartner MW. Prolonged
survival in patients with beta-thalassemia major treated with deferoxamine.
J Pediatr 1991;118:540-545.
2. Modell B, Khan M, Darlison M, Westwood MA, Ingram D, Pennell DJ.
Improved survival of thalassaemia major in the UK and relation to T2*
cardiovascular magnetic resonance. J Cardiovasc Magn Reson 2008;10:42.
3. Borgna-Pignatti C, Cappellini MD, De Stefano P, Del Vecchio GC, Forni GL,
Gamberini MR, Ghilardi R, Piga A, Romeo MA, Zhao H, Cnaan A. Cardiac
morbidity and mortality in deferoxamine or deferiprone-treated patients
with thalassemia major. Blood 2006;107:3733-3737.
4. Altay C, Yetgin S, Ozsoylu S, Kutsal A. Hemoglobin S and some other
hemoglobinopathies in Eti-Turks. Hum Hered 1978;28:56-61.
5. Koçak R, Alparslan ZN, Ağridağ G, Başlamisli F, Aksungur PD, Koltaş S. The
frequency of anaemia, iron deficiency, hemoglobin S and beta thalassemia
in the south of Turkey. Eur J Epidemiol 1995;11:181-184.
6. Canatan D, Kose MR, Ustundag M, Haznedaroglu D, Ozbas S.
Hemoglobinopathy control program in Turkey. Community Genet
2006;9:124-126.
7. Cavdar AO, Arcasoy A. The incidence of-thalassemia and abnormal
hemoglobins in Turkey. Acta Haematol 1971;45:312-318.
8. Dinçol G, Aksoy M, Erdem S. Beta-thalassaemia with increased haemoglobin
A2 in Turkey. A study of 164 thalassaemic heterozygotes. Hum Hered
1979;29:272-278.
9. Bircan I, Sişli S, Güven A, Cali S, Yeğin O, Ertuğ H, Güven AG, Akar N.
Hemoglobinopathies in the district of Antalya, Turkey. Pediatr Hematol
Oncol 1993;10:289-291.
10. Aydinok Y, Oztop S, Nişli G, Kavakli K. Prevalence of beta-thalassaemia trait in
1124 students from Aegean region of Turkey. J Trop Pediatr 1997;43:184-185.
11. Koç A, Kösecik M, Vural H, Erel O, Ataş A, Tatli MM. The frequency and
etiology of anemia among children 6-16 years of age in the southeast
region of Turkey. Turk J Pediatr 2000;42:91-95.
12. Kilinç M, Yüregir GT, Ekerbiçer H. Anaemia and iron-deficiency anaemia in
south-east Anatolia. Eur J Haematol 2002;69:280-283.
13. Canatan D. Thalassemias and hemoglobinopathies in Turkey. Hemoglobin
2014;38:305-307.
14. OECD. Employment Outlook 2016. Paris, OECD Publishing, 2016.
15. Nişli G, Kavakli K, Aydinok Y, Oztop S, Cetingül N. Beta-thalassemia alleles
in Aegean region of Turkey: effect on clinical severity of disease. Pediatr
Hematol Oncol 1997;14:59-65.
16. Tadmouri GO, Tüzmen S, Ozçelik H, Ozer A, Baig SM, Senga EB, Başak AN.
Molecular and population genetic analyses of beta-thalassemia in Turkey.
Am J Hematol 1998;57:215-220.
17. Cürük MA, Arpaci A, Attila G, Tuli A, Kilinç Y, Aksoy K, Yüreğir GT. Genetic
heterogeneity of beta-thalassemia at Cukurova in southern Turkey.
Hemoglobin 2001;25:241-245.
18. Ayçiçek A, Koç A, Özdemir ZC, Bilinç H, Koçyiğit A, Dilmeç F. Beta-globin
gene mutations in children with beta-thalassemia major from Şanlıurfa
province, Turkey. Turk J Haematol 2011;28:264-268.
19. Aldemir O, Izmirli M, Kaya H. The spectrum of β-thalassemia
mutations in Hatay, Turkey: reporting three new mutations. Hemoglobin
17
Aydınok Y, et al: A National Registry of Thalassemia in Turkey
Turk J Hematol 2018;35:12-18
2014;38:325-328.
20. Ozkinay F, Onay H, Karaca E, Arslan E, Erturk B, Ece Solmaz A, Tekin IM,
Cogulu O, Aydinok Y, Vergin C. Molecular basis of β-thalassemia in the
population of the Aegean region of Turkey: identification of a novel
deletion mutation. Hemoglobin 2015;39:230-234.
21. Cappellini MD, Cohen A, Porter J, Viprakasit V. Guidelines for the
Management of Transfusion Dependent Thalassaemia (TDT), 3rd ed. Nicosia,
Thalassaemia International Federation, 2014.
22. Piga A, Serra M, Longo F, Forni G, Quarta G, Cappellini MD, Galanello R.
Changing patterns of splenectomy in transfusion-dependent thalassemia
patients. Am J Hematol 2011;86:808-810.
23. Musallam KM, Angastiniotis M, Eleftheriou A, Porter JB. Cross-talk between
available guidelines for the management of patients with beta-thalassemia
major. Acta Haematol 2013;130:64-73.
24. Yesilipek MA, Ertem M, Cetin M, Öniz H, Kansoy S, Tanyeli A, Anak S, Kurekci
E, Hazar V. HLA-matched family hematopoetic stem cell transplantation
in children with beta thalassemia major: the experience of the Turkish
Pediatric Bone Marrow Transplantation Group. Pediatr Transplant
2012;16:846-851.
25. Musallam K, Cappellini MD, Taher A. Challenges associated with prolonged
survival of patients with thalassemia: transitioning from childhood to
adulthood. Pediatrics 2008;121:1426-1429.
18
RESEARCH ARTICLE
DOI: 10.4274/tjh.2017.0209
Turk J Hematol 2018;35:19-26
Biological Features of Bone Marrow Mesenchymal Stromal Cells
in Childhood Acute Lymphoblastic Leukemia
Çocukluk Çağı Akut Lenfoblastik Lösemisinde Kemik İliği Mezenkimal Stroma Hücrelerinin
Biyolojik Özellikleri
Stella Genitsari 1 , Eftichia Stiakaki 1 , Chryssoula Perdikogianni 2 , Georgia Martimianaki 3 , Iordanis Pelagiadis 4 , Margarita
Pesmatzoglou 1 , Maria Kalmanti 5 , Helen Dimitriou 1
1
Crete University Faculty of Medicine, University Hospital of Heraklion, Department of Pediatric Hematology and Oncology, Crete, Greece
2
Crete University Faculty of Medicine, Department of Pediatrics, Crete, Greece
3
Crete University Faculty of Medicine, Division of Mother and Child Health, Crete, Greece
4
Metropolitan Hospital, N. Faliro, Athens, Greece
5
Private Sector
Abstract
Objective: Mesenchymal stromal cells (MSCs) have a supportive
role in hematopoiesis and as components of the bone marrow (BM)
microenvironment may present alterations during acute lymphoblastic
leukemia (ALL) and be affected by chemotherapeutic agents. We
examined the biological and functional characteristics of MSCs in
ALL diagnosis and treatment and their effect on MSC qualitative
properties.
Materials and Methods: Immunophenotypic characterization,
evaluation of clonogenicity, and proliferative capacity were measured.
Apoptotic features, cell-cycle analysis, and stromal cell-derived factor
1α and angiopoietin-1 levels in MSC supernatant at diagnosis and
in different phases of treatment were assessed. Chemotherapy was
administered according to the Berlin-Frankfurt-Munster-2000
protocol. BM samples from children with solid tumors without BM
involvement were used as the control group.
Results: The morphology, the immunophenotypic profile, and the
apoptotic characteristics of the MSCs were not affected by leukemia.
The secretion of factors involved in the trafficking of hematopoietic
cells in the BM seems to be upregulated at diagnosis in comparison
to the treatment phases. MSCs are influenced by the disease in
terms of their functional characteristics such as clonogenicity and
proliferation rate. These effects cease as soon as treatment is initiated.
Chemotherapy does not seem to exert any effect on any of the MSC
features examined.
Conclusion: MSCs from children with ALL are affected by their
interaction with the leukemic environment, but this phenomenon
ceases upon treatment initiation, while no effect is observed by
chemotherapy itself.
Keywords: Bone marrow microenvironment, Childhood leukemia,
Mesenchymal stromal cells, Stromal cell-derived factor 1α
Öz
Amaç: Mezenkimal stroma hücreleri (MSH) hematopoezde destek
rolü oynar, kemik iliği (Kİ) mikroçevresinin parçası olduklarından akut
lenfoblastik lösemide (ALL) değişikliğe uğrayabilir ve kemoterapötik
ajanlardan etkilenebilirler. Bu çalışmada, ALL’de tanı anında ve
tedavide MSH’lerin biyolojik ve fonksiyonel özellikleri ile bunların
MSH’lerin niteliksel özellikleri üzerine olan etkilerini araştırdık.
Gereç ve Yöntemler: İmmünofenotipik özellikler, klonalite
değerlendirilmesi ve çoğalma kapasitesi ölçümleri yapıldı. Tanıda
ve tedavinin değişik evrelerinde MSH süpernatanında apoptotik
özellikler, hücre döngüsü analizi ve stromal hücre türevi factor-1α ile
anjiyopoietin-1 düzeyleri değerlendirildi. Kemoterapi olarak Berlin-
Frankfurt-Munster-2000 protokolü uygulandı. Solid tümörü olan ve
Kİ tutulumu bulunmayan hastaların Kİ örnekleri kontrol grubu olarak
kullanıldı.
Bulgular: MSH’lerin morfoloji, immünofenotipik profil ve apoptotik
özellikleri açısından lösemiden etkilenmediği görüldü. Hematopoetik
hücrelerinin Kİ’de yer değiştirmesi üzerine etkisi olabilen faktörlerinin
salınımının tanıda, tedavi evrelerine göre upregüle olduğu tespit
edildi. MSH’ler hastalıktan klonalite ve çoğalma hızı gibi fonksiyonel
özellikler kapsamında etkilenmekteydi. Bu etkiler tedavi başlanması
ile duraklamaktaydı. Kemoterapinin incelenen MSH özelliklerinden
hiçbiri üzerine bir etkisi olmadığı görüldü.
Sonuç: ALL’si olan çocuklardaki MSH’ler lösemik çevre ile ilişkilerden
etkilenir, ancak bu fenomen tedavi başlanması ile duraklar ve bu
çalışmada kemoterapinin bunun üzerine bir etkisi gözlenmemiştir.
Anahtar Sözcükler: Kemik iliği mikroçevresi, Çocukluk çağı lösemisi,
Mezenkimal stroma hücreleri, Stromal hücre türevi factor-1α
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Helen DIMITRIOU, PhD, Crete University Faculty of Medicine,
University Hospital of Heraklion, Department of Pediatric Hematology and Oncology, Crete, Greece
Phone : +30 2810 394 674
E-mail : lena.dimitriou@uoc.gr ORCID-ID: orcid.org/0000-0001-9142-907X
Received/Geliş tarihi: May 24, 2017
Accepted/Kabul tarihi: September 08, 2017
19
Genitsari S, et al: MSCs in Childhood ALL
Turk J Hematol 2018;35:19-26
Introduction
Mesenchymal stromal cells (MSCs) constitute part of the
bone marrow (BM) microenvironment where the survival,
proliferation, and differentiation of hematopoietic stem cells
(HSCs) take place [1]. Despite the large amount of information
on the nature of MSCs, they have not been fully characterized
so far. The in vivo counterparts or possibly precursors of culturedeveloped
MSCs are currently considered to be perivascular
cells, namely pericytes. These two-cell populations share similar
properties in terms of marker expression, ability to self-renew,
and potential to differentiate into multiple cell types such as
adipocytes, chondrocytes, osteocytes, and myocytes under
specified culture conditions [2,3]. The BM microenvironment
is believed to play a pivotal role in the development and
progression of leukemia [4]; thus, it is reasonable to speculate
that MSCs may also be involved in the perturbation of
normal hematopoiesis. Their putative role in oncogenesis and
leukemogenesis has not been fully clarified and the results from
the studies already published are contradictory. In vitro studies
have shown that MSCs from newly diagnosed adult patients
with leukemia (acute myeloid leukemia and acute lymphoblastic
leukemia) are less efficient for supporting normal hematopoietic
progenitor cell survival and this functional capacity is partially
restored after chemotherapy [5]. Their implication in childhood
ALL has only recently being addressed, revealing that ALL-
MSCs display reduced proliferative capacity and ability to
support long-term hematopoiesis in vitro while those isolated
at diagnosis did not differ from those obtained during
treatment [6]. The detection of leukemia-associated genetic
aberrations in MSCs implied a clonal relationship between
MSCs and leukemia cells in childhood ALL and suggested the
involvement of MSCs in the pathogenesis of the disease [7].
Involvement of MSCs in various malignancies via deregulation
of the secretion of chemokines [8,9,10] implies that
they mediate cell migration and homing [11]. Stromal cellderived
factor 1α (SDF-1α or CXCL12) was found to retain
and support the HSCs in the BM via the SDF-1α/CXCR4 axis
[12,13]. CXCL12 is constitutively secreted by marrow stromal
cells, being the major source for CXCL12 in adults [14]. Less is
known about its role in hematological malignancies and how
it could be affected during chemotherapy. The existing studies
have come to conflicting results [8,15]. Angiopoietin-1 (Ang-
1), initially known for its role in both embryonic and postnatal
angiogenesis, has recently been reported to interact with HSCexpressed
Tie-2 [3,16], enhancing the maintenance of HSCs in a
quiescent state within the BM, and Ang-1 is thereby part of the
network regulating the “stemness” of HSCs [17].
MSCs have been considered promising candidates for cell
therapies and, in view of their potential, there are many ongoing
studies to understand their properties, mechanisms of action,
and putative role in hematological malignancies [7,18,19,20]. So
far MSCs from different sources have been shown to exhibit
different properties [21]. Moreover, BM MSCs from children
seem to be different from their adult counterparts [22].
The aim of this study is to characterize MSCs derived from the
BM of children with ALL at the onset of the disease in order
to evaluate the leukemic effect, if any, on their biological/
functional properties. In addition, an attempt was made to
compare this population with the MSCs derived from the BM
during different treatment phases for the assessment of the
effect of chemotherapy on these features.
Materials and Methods
Patients
BM samples from children with B-lineage ALL and >90% BM
infiltration at diagnosis, hospitalized from 2006 to 2010 at the
Department of Pediatric Hematology and Oncology, University
Hospital of Heraklion, were studied. They included samples
at diagnosis (d, n=28), day 15 (d15, n=12), day 33 of
induction therapy (d33, n=20) when remission was achieved,
at intensification-consolidation (consol, n=33), during
maintenance (maint, n=19) therapy, and at the end of treatment
(end, n=20), all in remission. MSCs examined at different phases
of ALL treatment are not necessarily in all cases from the same
patients. Patients were treated according to the ALL Berlin-
Frankfurt-Munster-2000 protocol and their risk stratification
[medium risk (MR) and high risk (HR)] according to the same
protocol was considered in some of the employed assays. The
control group (n=15) consisted of BM samples from children
with solid tumors without BM involvement. Patients’ ages
ranged from 1.2 to 18 years (median: 6 years). The study was
approved by the Ethical Committee of the University Hospital
of Heraklion.
Methods are described in more detail in the Appendix
(Supplementary Materials and Methods).
BM Mononuclear Cells (MNCs) Isolation and MSC Culture and
Expansion
BM MNCs, following Ficoll-Hypaque separation (1077 g/mL;
Lymphoprep, Nycomed, Oslo, Norway), were cultured in a-MEM
as described previously for MSC development [22]. MSCs were
maintained for up to five passages. Assays were performed at
any of P1 to P4 depending on the cell availability.
Immunophenotyping Evaluation
Phenotypic characterization of MSCs was performed by flow
cytometry at various passages using hematopoietic cell and
MSC-specific monoclonal antibodies (BD Biosciences, San Jose,
CA, USA). One hundred thousand cells were stained with the
markers as described previously [23]. At least 10,000 events
were acquired for each analysis.
20
Turk J Hematol 2018;35:19-26
Genitsari S, et al: MSCs in Childhood ALL
Cell Doubling Time (DT)
DT was calculated according to the formula DT=t/n=t×log(2)/log
(cells harvested/cells inoculated), where t is the time between
initial plating and harvest for the respective passage.
Colony Forming Units-Fibroblast (CFU-F) Formation
At day 0, 1x10 5 MNCs were seeded in each well of a 24-well plate
(in triplicate) in the absence of fibroblast growth factor-2 (FGF-
2). At subsequent passages, MSCs were plated in 20-cm 2 petri
plates at a concentration of 10 cells/cm 2 (in duplicate). The
colonies that developed were categorized according to their
size as small (S), medium (M), and large (L, highly proliferating)
CFU-F. The sum of all sizes is denoted as CFU-F.
Cell-Cycle Analysis - Apoptosis
MSCs at either P2 or P3 were stained with propidium iodide in
order to estimate the percentage of cells in each phase of the
cell cycle. Cell-cycle analysis was performed using WinMDI
software version 2.8 [24].
Apoptotic MSCs at passages P2 and P4 were detected by flow
cytometry and 7-amino-actinomycin D (7-AAD; Sigma, St.
Louis, MO, USA) staining [25].
than 0.05 were considered as statistically significant. Analysis
was performed using SPSS 18.0 (SPSS Inc., Chicago, IL, USA).
Results
Morphology and Immunophenotypic Profile
BM MSCs from all groups were expanded until the fifth passage
and all displayed the characteristic spindle-shape morphology.
Immunophenotypic assays at P2 and P4 did not identify any
differences among groups. MSCs at diagnosis expressed CD90
(99.67±0.09%), CD105 (97.39±0.72%), CD146 (59.55±2.84%),
CD29 (99.1±0.12%), CD44 (98.07±1.39%), CD95 (90.25±2.85%),
and CD73 (99.4±0.4%), while there was no expression of
hematopoietic markers such as CD34, CD45, and CD14. The same
immunophenotypic profile was also observed at all treatment
phases and in the control group.
Growth Rate of MSCs (DT)
MSCs within the MNC fraction (d0) at diagnosis reached
confluency in approximately 20.71±1.24 days, whereas at the
end of chemotherapy they required 15.10±0.63 days. The DT at
Detection of SDF-1α and Ang-1 (ELISA)
A quantitative sandwich enzyme-linked immunosorbent assay
technique (ELISA) was employed for the determination of both
SDF-1α and Ang-1 (R&D Systems, Minneapolis, MN, USA) in the
supernatant of MSCs at any of P1 to P3 cultures (and of MNCs
at d0) within the leukemia group only, at diagnosis, and during
treatment phases following the instructions of the manufacturer.
Statistical Analysis
Results are expressed as mean ± standard error of the mean
mean (SEM). Differences between groups were assessed using
the nonparametric Mann-Whitney U-test and p-values lower
Figure 1. Days required for mesenchymal stromal cells in the
mononuclear cells fraction (d0) to reach confluency. The doubling
time at diagnosis differs from that of the phases of chemotherapy
(p: d15=0.042, d33=0.007, consol=0.001, maint=0.022, end=0.002)
and of the control (p=0.011). This defect subsides with the
progression of culture (*: ss in comparison to the d group).
Table 1. Doubling time of mesenchymal stromal cells of all groups in the different passages (P1-P5).
P1 P2 P3 P4 P5
d 3.30±0.41 3.07±0.58 4.20±0.80 5.37±1.06 4.75±0.95
d15 2.39±0.31 5.49±1.18 4.80±1.22 3.83±0.97 3.82±0.69
d33 2.57±0.24 2.86±0.35 3.47±0.42 3.85±0.61 3.82±0.41
Consol 2.59±0.19 2.72±0.23 3.24±0.30 4.12±0.61 4.50±0.93
Maint 3.44±0.53 5.98±1.17 3.57±0.49 3.18±0.52 4.21±0.50
End 2.49±0.20 2.59±0.25 2.57±0.32 3.41±0.38 3.73±0.40
CTL 2.34±0.11 3.03±0.31 2.42±0.25 4.41±1.07 4.47±2.13
Data are expressed as mean ± standard error of mean. CTL: Cytotoxic lymphocyte
21
Genitsari S, et al: MSCs in Childhood ALL Turk J Hematol 2018;35:19-26
diagnosis was statistically different compared to all the phases
of treatment (Figure 1). At subsequent passages, DT was similar
among all groups (Table 1). This finding indicates that MSCs
present in the MNC fraction at diagnosis, which was mainly
constituted of lymphoblasts, expanded more slowly compared
to treatment phases and the control group, but this defect
subsided with the progression of culture (more advanced P). No
difference was observed among all passages in all other studied
groups. As the culture progressed, DT increased in all groups and
the control.
CFU-F Development
At day 0, the CFU-F formation at diagnosis appeared to be impaired
compared to the other groups (Figure 2), a result attributed to the
lower number of the medium and the large-sized colonies. The
impaired clonogenicity of MSCs at the time of diagnosis was a
constant finding, observed at subsequent passages as well (Table
2). Culture progression resulted in lower colony development,
the control included, and this became statistically significant at
the later passages (P1 vs. P4 or P5, p<0.001). MSCs at diagnosis
formed fewer small, medium, and large colonies compared to all
other groups. Larger colonies prevailed at early passages, while
at the later ones, the CFU-F population consisted of mainly small
colonies (Supplementary Figure 1).
Cell-Cycle Analysis - Apoptosis
Most of the MSCs were in quiescence, presenting a higher
percentage of cells in the G0G1 phase compared to the control
group (Figure 3). The study of apoptosis in all phases of disease
and treatment at P2 and P4 confirmed the stability of BM-MSCs
under long-term culture expansion through serial passages.
Spontaneous apoptosis was detected at P2 and it did not change
at P4 in all groups (Table 3).
Figure 2. Colony forming units-fibroblast development of
mesenchymal stromal cells in the mononuclear cells fraction (d0)
from all studied groups. The number of colonies at diagnosis is
lower than that of the other groups (d vs. end, control: p<0.0001).
Culture progression resulted in lower colony development,
becoming significant at the later passages.
Data are expressed as mean ± SEM (*: p<0.05 compared to
diagnosis).
CFU-F: Colony forming units.
Figure 3. Analysis of the cell-cycle phases. Most of the
mesenchymal stromal cells are in quiescence as the highest
percentage of cells are in the G0G1 phase.
Data are expressed as mean ± SEM.
SDF-1α and Ang-1
SDF-1α in the MSC supernatants at diagnosis was variably
expressed (median: 5334.63 pg/mL, range: 1066.70-22,480.86 pg/mL)
Table 2. Colony forming units-fibroblast development of mesenchymal stromal cells from all studied groups (P1-P5).
P1 P2 P3 P4 P5
d 26.80±2.79 21.39±3.63 19.61±4.69 23.59±3.45 19.46±3.55
d15 45.08±5.72* 34.96±5.44* 37.73±6.01* 17.59±3.48 7.82±2.21
d33 38.52±3.52* 41.40±2.87* 32.06±3.51* 21.11±2.90 17.11±2.41
Consol 47.10±3.10* 34.47±2.68* 26.78±2.30* 24.83±3.33 27.94±3.25
Maint 46.15±3.28* 33.63±3.99* 31.93±2.63* 26.50±3.32 15.12±2.02
End 48.34±4.43* 41.23±4.48* 34.20±4.28* 24.50±3.52 29.00±3.30
CTL 57.27±4.47* 43.53±3.71* 37.38±5.40* 35.67±3.2* 38.83±6.05*
Data are expressed as mean ± standard error of mean.
*Statistical significance in comparison to the d group, CTL: Cytotoxic lymphocyte
22
Turk J Hematol 2018;35:19-26
Genitsari S, et al: MSCs in Childhood ALL
Supplementary Figure 1. Colony forming units-fibroblast (CFU-F) colonies of large (L), medium (M), and small (S) size at the initial (P1)
and last (P5) passages of the study. Larger colonies prevail at early passages while at the later ones the CFU-F population consists of
mainly small colonies.
Table 3. Spontaneous apoptosis, evaluated by flow cytometry after 7-amino-actinomycin D staining of mesenchymal stromal
cells at diagnosis and during treatment at passages 2 and 4 (P2, P4).
Study group P2 (%) P4 (%)
A D A D
d 4.92±2.38 2.5±0.94 3.47±0.97 2.37±1.15
d15 2.48±0.86 1.97±1.21 2.82±0.65 1.97±1.21
d33 2.65±0.59 1.07±0.56 1.42±0.27 0.52±0.25
Consol 2.01±0.45 1.4±0.38 2.2±0.32 1.05±0.21
Maint 1.97±0.38 0.97±0.57 1.2±0.65 1.67±1.2
End 2.94±0.93 3.78±1.33 1.62±0.77 1.45±1.02
CTL 1.75±0.29 0.58±0.16 0.92±0.37 0.27±0.14
Values are expressed as mean ± standard error of mean.
A: Apoptotic cells, D: dead cells, CTL: Cytotoxic lymphocyte
and did not differ in comparison with the treatment phases. Its
levels were higher in the HR group compared to the MR group
(HR=9205.77±2721.82, MR=6686.11±4006.34, p=0.021).
As far as Ang-1 expression is concerned, in the two cell
subpopulations of MNCs and MSCs, our results showed that,
similar to SDF-1α, stromal cells secreted statistically significant
higher amounts of this growth factor (Figure 4). No difference
was found in the comparison of diagnosis with treatment
groups.
Discussion
MSCs are described as fibroblast-like cells, displaying a
characteristic spindle shape, and all of our cells exhibited this
feature. As in vitro culture progresses, cells enter senescence
and MSCs become larger with irregular and flat shapes [26], not
observed in our samples. Our source though was the BM of
children, albeit leukemic BM, and our culture was followed up
to P5 [27].
23
Genitsari S, et al: MSCs in Childhood ALL Turk J Hematol 2018;35:19-26
that leukemic cells do not confer to MSCs any preferential ability
to proliferate, but they rather promote a deficient capacity,
opposing the hypothesis that MSC populations might be crucial
for the efficient promotion of the survival and proliferation of
blasts [30]. Treatment does not affect the clonogenicity as the
number of colonies produced at any time-point is similar to that
of the controls. Another factor involved in colony development
is the duration of the culture. Interestingly, the decrease of
colony number throughout passages is more profound in largeand
medium-sized colonies. Considering that large colonies
derive from more primitive cells, it becomes obvious that older
cultures contain more mature MSCs. Altogether, the above
indicate that the presence of leukemia cells at diagnosis, but
not chemotherapeutic agents, modifies BM-MSC properties.
Figure 4. The stromal cell-derived factor-1α (SDF-1α) and
angiopoietin-1 (Ang-1) expressions by both mesenchymal
stromal cells (MSCs) and mononuclear cells (MNCs) at diagnosis
and treatment. Stromal cells secrete higher amounts of both
these factors. A) Variability in their expression was noticed at
diagnosis, which became more uniform in treatment phases. B)
No difference in angiopoietin-1 levels between diagnosis and
treatment groups.
MSC: Mesenchymal stromal cell, MNC: mononuclear cell, Ang-1:
angiopoietin-1, SDF-1α: stromal cell-derived factor-1α.
MSCs from all groups at different passages were highly
expressing MSC-related markers and lacking the hematopoietic
markers, as proposed by the International Society for Cell
Therapy [28,29]. This indicates that the MSC cultures were
homogeneous, in agreement with Conforti et al. [6], and neither
disease nor treatment had any influence on them. Clonogenicity
and proliferation potential were lower at diagnosis and decreased
as the culture progressed, in partial agreement with the only study,
so far, examining the characteristics of pediatric ALL-MSCs [6].
The lowest number of colonies was developed at
diagnosis. Although this result does not stand alone to support
that it is an intrinsic defect (because of the effect of the disease on
MSCs) rather than a quantitative one, due to the lower frequency
of MSCs in BM infiltrated by leukemic cells combined, with the
fact that it continues to be seen in subsequent passages, where
the same number of MSCs are used to initiate the culture, it is
more suggestive of the hypothesis that the microenvironment
(as expressed by BM MSCs) is also affected by the leukemic
process. This result favors the observation of Conforti et al. [6]
Cell-cycle analysis revealed that most of the MSCs are in quiescence
while about 20% of the cells of the control group are at the
S phase, compared to less than 10% of the rest of the groups.
Further analysis is required in order to fully clarify this difference
found under identical culture conditions. Apoptosis remained
unaltered throughout passages, a finding reported for BM-MSCs
from children with benign hematological disorders [26]. Conforti
et al. [6] reported different results, but they evaluated apoptosis
for many passages and reported data for the latest one (P18).
Finally, we evaluated the levels of SDF-1α and Ang-1,
recently revealed as major regulators in the crosstalk between
hematopoietic progenitors and their microenvironment [31,32].
Data reporting the expression of SDF-1α by BM MSCs in patients
with hematological malignancies are limited. SDF-1α in the
supernatant of MSCs at diagnosis of ALL was slightly increased
compared to that from treatment phases, although this difference
was not statistically verified. Interestingly, HR patients exhibited
higher levels compared to the MR ones, a difference no longer
occurring upon treatment initiation. Reduced extracellular
levels of SDF-1α were assessed in hematological malignancies of
adults [33,34]. Others found increased SDF-1α secretion from
MSCs at diagnosis in adolescents and young adults with ALL,
reversed by chemotherapy [6]. In pediatric patients with acute
leukemia, SDF-1α serum levels differed depending on whether
they were evaluated in PB or BM serum (decreased expression) or
MSC supernatants at diagnosis (decrease not evident) compared
to the remission and control groups [15]. The above, combined
with our findings, further support the notion that leukemic cells
do not affect CXCL12 production and the decrease reported in
serum cannot be attributed to the productive capacity of MSCs.
We found that the lowest amount of Ang-1 was expressed
in MSC culture supernatant from diagnosis, albeit not
statistically differently from treatment phases. There is one
more study to date, on the effect of Ang-1 in childhood ALL
[35], in which the authors claimed similar findings in the MSC
supernatant and low levels of Ang-1 and Ang-2 in BM serum
at diagnosis. Nevertheless, other factors such as age-related
24
Turk J Hematol 2018;35:19-26
Genitsari S, et al: MSCs in Childhood ALL
post-transcriptional effect on the expression of proteins or the
exposure of BM MSCs to fetal bovine serum and FGF-b [36]
have to be taken into consideration in order to fully exploit the
role of these molecules in leukemia.
Study Limitation
A limitation of our study is that the samples examined at
different phases of ALL are not necessarily from the same patients
longitudinally. This approach ensures a reasonable number of
samples within a reasonable timeframe for each group for a
rather rare pediatric entity and hence a stronger statistical result.
Conclusion
In conclusion, biological characteristics and functional properties
of MSCs are affected at the onset of leukemia. Most defects persist
throughout passages. MSCs recover after treatment initiation and
remission achievement and are not affected by chemotherapy.
Their secretory profile remains unaltered by the disease. The
summing of these data clearly indicates that any effect on MSCs
from the leukemic clones in childhood ALL is transient and ceases
upon treatment initiation. A standard hurdle in the comparison of
our data to other studies continues to be the diversity of working
protocols used for MSC cultures and further evaluation.
Acknowledgments
The authors would like to thank Kaparou Maria and Fillipides
Anthi for their contributions in the performance of a number
of experiments, Choumerianou Despina for her contribution
in experiments and helpful suggestions, and Koutala Helen for
technical advice and support in flow cytometry.
Ethics
Ethics Committee Approval: The study was approved by the
Ethical Committee of the University Hospital of Heraklion.
Authorship Contributions
Medical Practices: E.S., M.K., C.P.; Concept: H.D., I.P., C.P., E.S.;
Design: H.D., I.P., C.P., E.S.; Data Collection or Processing: S.G.,
H.D., G.M., I.P., M.P.; Analysis or Interpretation: S.G., M.P., H.D.,
I.P., C.P., E.S., M.K.; Literature Search: S.G., I.P., H.D., G.M., Writing:
H.D.; S.G., C.P.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
Financial Disclosure: This work was partially supported by
the European 6 th Framework Program GENOSTEM (contract
no: 503161) and the University of Crete Secretariat Research
Committee (KA 3769).
References
1. El Marsafy S, Larghero J, Bennaceur-Griscelli A, Turhan A. Mesenchymal stem cells:
pivotal players in hematopoietic stem cell microenvironment. J Stem Cell Res Ther
2014;4:225.
2. Wong SP, Rowley JE, Redpath AN, Tilman JD, Fellous TG, Johnson JR. Pericytes,
mesenchymal stem cells and their contributions to tissue repair. Pharmacol Ther
2015;151:107-120.
3. Sacchetti B, Funari A, Michienzi S, Di Cesare S, Piersanti S, Saggio I, Tagliafico E,
Ferrari S, Robey PG, Riminucci M, Bianco P. Self-renewing osteoprogenitors in
bone marrow sinusoids can organize a hematopoietic microenvironment. Cell
2007;131:324-336.
4. Sanchez-Aguilera A, Mendez-Ferrer S. The hematopoietic stem-cell niche in health
and leukemia. Cell Mol Life Sci 2017;74:579-590.
5. Sorokina T, Shipounova I, Bigildeev A, Petinati N, Drize N, Turkina A, Chelysheva E,
Shukhov O, Kuzmina L, Parovichnikova E, Savchenko V. The ability of multipotent
mesenchymal stromal cells from the bone marrow of patients with leukemia to
maintain normal hematopoietic progenitor cells. Eur J Haematol 2016;97:245-252.
6. Conforti A, Biagini S, Del Bufalo F, Sirleto P, Angioni A, Starc N, Li Pira G, Moretta F,
Proia A, Contoli B, Genovese S, Ciardi C, Avanzini MA, Rosti V, Lo-Coco F, Locatelli F,
Bernardo ME. Biological, functional and genetic characterization of bone marrowderived
mesenchymal stromal cells from pediatric patients affected by acute
lymphoblastic leukemia. PLoS One 2013;8:e76989.
7. Shalapour S, Eckert C, Seeger K, Pfau M, Prada J, Henze G, Blankenstein T,
Kammertoens T. Leukemia-associated genetic aberration in mesenchymal stem cells
of children with acute lymphoblastic leukemia. J Mol Med (Berl) 2010;88:249-265.
8. Ge J, Hu Y, Gui Y, Hou R, Yang M, Zeng Q, Xia R. Chemotherapy-induced alteration
of SDF-1/CXCR4 expression in bone marrow-derived mesenchymal stem cells from
adolescents and young adults with acute lymphoblastic leukemia. J Pediatr Hematol
Oncol 2014;36:617-623.
9. Azab AK, Runnels JM, Pitsillides C, Moreau AS, Azab F, Leleu X, Jia X, Wright R,
Ospina B, Carlson AL, Alt C, Burwick N, Roccaro AM, Ngo HT, Farag M, Melhem MR,
Sacco A, Munshi NC, Hideshima T, Rollins BJ, Anderson KC, Kung AL, Lin CP, Ghobrial
IM. CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells
with the bone marrow microenvironment and enhances their sensitivity to therapy.
Blood 2009;113:4341-4351.
10. Noh YH, Yim YS, Kim DH, Lee MW, Kim DS, Kim HR, Lee SH, Chueh HW, Choi SJ, Oh
WI, Yang YS, Jung HL, Yoo KH, Sung KW, Koo HH. Correlation between chemokines
released from umbilical cord blood-derived mesenchymal stem cells and
engraftment of hematopoietic stem cells in nonobese diabetic/severe combined
immunodeficient (NOD/SCID) mice. Pediatr Hematol Oncol 2011;28:682-690.
11. Fouillard L, Francois S, Bouchet S, Bensidhoum M, Elm’selmi A, Chapel A. Innovative
cell therapy in the treatment of serious adverse events related to both chemoradiotherapy
protocol and acute myeloid leukemia syndrome: the infusion of
mesenchymal stem cells post-treatment reduces hematopoietic toxicity and
promotes hematopoietic reconstitution. Curr Pharm Biotechnol 2013;14:842-848.
12. Van Overstraeten-Schloge N, Beguin Y, Gothot A. Role of stromal derived factor-1
in the hematopoietic-supporting activity of human mesenchymal stem cells. Eur J
Haematol 2006:76:488-493.
13. Sharma MB, Limaye LS, Kale VP. Mimicking the functional hematopoietic stem
cell niche in vitro: recapitulation of marrow physiology by hydrogel-based threedimensional
cultures of mesenchymal stromal cells. Haematologica 2012;97:651-
660.
14. Burger JA, Kipps TJ. CXCR4: a key receptor in the crosstalk between tumor cells and
their microenvironment. Blood 2006;107:1761-1767.
15. Van den Berk LC, van der Veer A, Willemse ME, Theeuwes MJ, Luijendijk MW,
Tong WH, van der Sluis IM, Pieters R, den Boer ML. Disturbed CXCR4/CXCL12
axis in paediatric precursor B-cell acute lymphoblastic leukaemia. Br J Haematol
2014;166:240-249.
16. Fukuhara S, Sako K, Noda K, Nagao K, Miura K, Mochizuki N. Tie2 is tied at the
cell-cell contacts and to extracellular matrix by angiopoietin-1. Exp Mol Med
2009;41:133-139.
17. Arai F, Hirao A, Ohmura M, Sato H, Matsuoka S, Takubo K, Ito K, Koh GY, Suda T. Tie2/
angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone
marrow niche. Cell 2004;118:149-161.
25
Genitsari S, et al: MSCs in Childhood ALL Turk J Hematol 2018;35:19-26
18. Blau O, Hofmann WK, Baldus CD, Thiel G, Serbent V, Schümann E, Thiel E, Blau IW.
Chromosomal aberrations in bone marrow mesenchymal stroma cells from patients
with myelodysplastic syndrome and acute myeloblastic leukemia. Exp Hematol
2007;35:221-229.
19. Menendez P, Catalina P, Rodriguez R, Melen GJ, Bueno C, Arriero M, García-Sánchez
F, Lassaletta A, García-Sanz R, García-Castro J. Bone marrow mesenchymal stem
cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4
fusion gene. J Exp Med 2009;206:3131-3141.
20. Zhao Z, Tang X, You Y, Li W, Liu F, Zou P. Assessment of bone marrow mesenchymal
stem cell biological characteristics and support hematopoiesis function in patients
with chronic myeloid leukemia. Leuk Res 2006;30:993-1003.
21. Karaöz E, Çetinalp Demircan P, Erman G, Güngörürler E, Eker Sarıboyacı A.
Comparative analyses of immune-suppressive characteristics of bone-marrow,
Wharton’s jelly, and adipose tissue-derived human MSCs. Turk J Hematol
2017;34:213-225.
22. Choumerianou DM, Martimianaki G, Stiakaki E, Kalmanti L, Kalmanti M, Dimitriou
H. Comparative study of stemness characteristics of mesenchymal cells from bone
marrow of children and adults. Cytotherapy 2010;12:881-887.
23. Dimitriou H, Linardakis E, Martimianaki G, Stiakaki E, Perdikogianni CH, Charbord P,
Kalmanti M. Properties and potential of bone marrow mesenchymal stromal cells
from children with hematologic diseases. Cytotherapy 2008;10:125-133.
24. Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and simple
method for measuring thymocyte apoptosis by propidium iodide staining and flow
cytometry. J Immunol Methods 1991;139:271-279.
25. Lecoeur H, Ledru E, Prevost MC, Gougeon ML. Strategies for phenotyping
apoptotic peripheral human lymphocytes comparing ISNT, annexin V and 7-AAD
cytofluorometric staining methods. J Immunol Methods 1997;209:111-123.
26. Wagner W, Horn P, Castoldi M, Diehlmann A, Bork S, Saffrich R, Benes V, Blake J,
Pfister S, Eckstein V, Ho AD. Replicative senescence of mesenchymal stem cells: a
continuous and organized process. PLoS One 2008;3:e2213.
27. Stolzing A, Jones E, McGonagle D, Scutt A. Age-related changes in human bone
marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech
Ageing Dev 2008;129:163-173.
28. Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, Deans
RJ, Krause DS, Keating A; International Society for Cellular Therapy. Clarification of
the nomenclature for MSC: the International Society for Cellular Therapy position
statement. Cytotherapy 2005;7:393-395.
29. Lv FJ, Tuan RS, Cheung KM, Leung VY. Concise review: the surface markers and
identity of human mesenchymal stem cells. Stem Cells 2014;32:1408-1419.
30. Nagasawa T. Microenvironmental niches in the bone marrow required for B-cell
development. Nat Rev Immunol 2006;6:107-116.
31. Gomes AC, Gomes MS. Hematopoietic niches, erythropoiesis and anemia of chronic
infection. Exp Hematol 2016;44:85-91.
32. Nie Y, Han YC, Zou YR. CXCR4 is required for the quiescence of primitive
hematopoietic cells. J Exp Med 2008;205:777-783.
33. Ge J, Hou R, Liu Q, Zhu R, Liu K. Stromal-derived factor-1 deficiency in the bone
marrow of acute myeloid leukemia. Int J Hematol 2011;93:750-759.
34. Khandany BK, Hassanshahi G, Khorramdelazad H, Balali Z, Shamsizadeh A, Arababadi
MK, Ostadebrahimi H, Fatehi A, Rezazadeh M, Ahmadi Z, Karimabad MN. Evaluation
of circulating concentrations of CXCL1 (Gro-α), CXCL10 (IP-10) and CXCL12 (SDF-
1) in ALL patients prior and post bone marrow transplantation. Pathol Res Pract
2012;208:615-619.
35. Karakurt N, Aksu T, Koksal Y, Yarali N, Tunc B, Uckan-Cetinkaya D, Ozguner M.
Angiopoietins in the bone marrow microenvironment of acute lymphoblastic
leukemia. Hematology 2016;21:325-331.
36. Pelagiadis I, Stiakaki E, Choulaki C, Kalmanti M, Dimitriou H. The role of children’s
bone marrow mesenchymal stromal cells in the ex vivo expansion of autologous
and allogeneic hematopoietic stem cells. Cell Biol Int 2015;39:1099-1110.
Appendix: Supplementary Materials and Methods
BM MNC Isolation and MSC Culture and Expansion
BM MNCs, following separation with Ficoll-Hypaque (1077 g/mL; Lymphoprep,
Nycomed, Oslo, Norway), were cultured in a-MEM without nucleotides in the presence
of 10% lot-selected fetal calf serum (Invitrogen Ltd., Paisley, UK) as described previously
[21]. They were seeded at a concentration of 5x10 4 cells/cm 2 in the presence of 1 ng/
mL FGF-2 (FGF-2; Abcys SA, Paris, France). A complete medium change was performed
twice a week. When layers became confluent at ~90%, cells were detached using 0.25%
trypsin/1 mM EDTA (Invitrogen Ltd.) and then replated at a concentration of 1x10 3 cells/
cm 2 (passage 1, P1). MSCs were maintained in culture for up to five passages. Assays
were performed at any of P1 to P4 depending on the cell availability.
Immunophenotyping Evaluation
Phenotypic characterization of MSCs was performed by flow cytometry at various
passages using the following monoclonal antibodies: CD105-phycoerythrin (PE)
CD146-PE, CD73-PE CD29-fluorescein isothiocyanate (FITC), CD44-FITC, CD90-FITC,
CD14-FITC, CD45-FITC, CD34-PE, and CD95-FITC (BD Biosciences, San Jose, CA, USA).
One hundred thousand cells were stained with the markers as described previously [21].
At least 10,000 events were acquired for each analysis.
Cell-Cycle Analysis - Apoptosis
MSCs, at either P2 or P3, after detachment by trypsinization (trypsin/EDTA 0.25%) were
centrifuged at 150 x g for 10 min at 4 °C and washed with PBS. In order to estimate the
percentage of cells in each phase of the cell cycle, 1x10 6 MSCs were stained with 1 mL
of propidium iodide staining solution (50 µg/mL propidium iodide, 1 mg/mL RNAse in
PBS without Ca ++ /Mg ++ , pH 7.4) for 30 min at room temperature. After the acquisition
of at least 10,000 events for each sample, cells were gated according to forward vs.
side scatter (FSC/SSC) characteristics. Cell-cycle analysis was performed using WinMDI
software, version 2.8 [22].
Apoptotic MSCs at passages P2 and P4 were detected by flow cytometry and 7-aminoactinomycin
D (7-AAD; Sigma, St. Louis, MO, USA) staining [23]. They were initially
gated according to their morphology (FSC/SSC). Then a scattergram was generated by
combining FSC with 7-AAD fluorescence to quantitate 7-AAD negative (alive), 7-AAD low
(early apoptotic), and 7-AAD high (late apoptotic/dead) cells.
Cell DT
DT was calculated according to the formula DT=t/n=t×log(2)/log (cells harvested/cells
inoculated), where t is the time between initial plating and harvest for the respective
passage.
CFU-F Formation
At day 0.1x10 5 MNCs were seeded in each well of a 24-well plate (in triplicate) in the
absence of FGF-2. At subsequent passages, MSCs were plated in 20-cm 2 petri plates
at a concentration of 10 cells/cm 2 (in duplicate). Following 14 days of culture at 37 °C
and 5% CO 2
, CFU-F was quantified after staining with Giemsa stain and categorized
according to size as small CFU-F (S: <50 cells), medium CFU-F (M: 50-500 cells), and
large CFU-F (highly proliferating; L: >500 cells). The sum of CFU-F of all sizes is denoted
as CFU-F.
Detection of SDF-1α and Ang-1 (ELISA)
A quantitative sandwich ELISA was employed for the determination of both SDF-1α
and Ang-1 in the supernatant of MSCs at any of P1 to P3 cultures (and of MNCs at
d0) within the leukemia group only. All subgroups were examined for the evaluation
of these factors through the whole course of the disease, diagnosis, and treatment. The
ELISA kits were purchased from R&D Systems, and the instructions of the manufacturer
were followed. More specifically, 100 µL for SDF-1α (50 µL for Ang-1) of standard or
sample per well was added and incubated for 2 h at room temperature on a shaker.
After well aspiration and washing, 200 µL of the corresponding conjugate was added.
Incubation was continued for 2 h further under the same conditions. After washing,
200 µL of substrate solution was added to each well for 30 min at room temperature
and then 50 µL of stop solution terminated the reaction. The optical density of each
well was determined at 450 nm with wavelength correction at 570 nm.
26
RESEARCH ARTICLE
DOI: 10.4274/tjh.2017.0021
Turk J Hematol 2018;35:27-34
Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective
Analysis of Sixty-five Patients
Türkiye’de Juvenil Miyelomonositik Lösemi: Altmış Beş Hastanın Retrospektif Analizi
Özlem Tüfekçi 1 , Ülker Koçak 2 , Zühre Kaya 2 , İdil Yenicesu 2 , Canan Albayrak 3 , Davut Albayrak 3 , Şebnem Yılmaz Bengoa 1 ,
Türkan Patıroğlu 4 , Musa Karakükçü 4 , Ekrem Ünal 4 , Elif Ünal İnce 5 , Talia İleri 5 , Mehmet Ertem 5 , Tiraje Celkan 6 , Gül Nihal Özdemir 6 ,
Nazan Sarper 7 , Dilek Kaçar 8 , Neşe Yaralı 8 , Namık Yaşar Özbek 8 , Alphan Küpesiz 9 , Tuba Karapınar 10 , Canan Vergin 10 , Ümran Çalışkan 11 ,
Hüseyin Tokgöz 11 , Melike Sezgin Evim 12 , Birol Baytan 12 , Adalet Meral Güneş 12 , Deniz Yılmaz Karapınar 13 , Serap Karaman 14 , Vedat
Uygun 15 , Gülsun Karasu 15 , Mehmet Akif Yeşilipek 15 , Ahmet Koç 16 , Erol Erduran 17 , Berna Atabay 18 , Haldun Öniz 18 , Hale Ören 1
1
Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey
2
Gazi University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey
3
Ondokuz Mayıs University Faculty of Medicine, Department of Pediatric Hematology, Samsun, Turkey
4
Erciyes University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Kayseri, Turkey
5
Ankara University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Ankara, Turkey
6
İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey
7
Kocaeli University Faculty of Medicine, Department of Pediatric Hematology, Kocaeli, Turkey
8
Ankara Children’s Hematology and Oncology Training and Research Hospital, Ankara, Turkey
9
Akdeniz University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Antalya, Turkey
10
Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey
11
Necmettin Erbakan University Meram Faculty of Medicine, Department of Pediatric Hematology, Konya, Turkey
12
Uludağ University Faculty of Medicine, Department of Pediatric Hematology, Bursa, Turkey
13
Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey
14
Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İstanbul, Turkey
15
Bahçeşehir University Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey
16
Marmara University Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey
17
Karadeniz Technical University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Trabzon, Turkey
18
Tepecik Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey
Abstract
Objective: This study aimed to define the status of juvenile
myelomonocytic leukemia (JMML) patients in Turkey in terms of
time of diagnosis, clinical characteristics, mutational studies, clinical
course, and treatment strategies.
Materials and Methods: Data including clinical and laboratory
characteristics and treatment strategies of JMML patients were
collected retrospectively from pediatric hematology-oncology centers
in Turkey.
Results: Sixty-five children with JMML diagnosed between 2002
and 2016 in 18 institutions throughout Turkey were enrolled in the
study. The median age at diagnosis was 17 months (min-max: 2-117
months). Splenomegaly was present in 92% of patients at the time of
diagnosis. The median white blood cell, monocyte, and platelet counts
were 32.9x10 9 /L, 5.4x10 9 /L, and 58.3x10 9 /L, respectively. Monosomy
Öz
Amaç: Türkiye’deki juvenil miyelomonositik lösemi (JMML) hastalarının
durumunu, tanı zamanı, klinik özellikler, mutasyon çalışmaları, klinik
gidiş ve tedavi stratejileri açısından ortaya koymaktır.
Gereç ve Yöntemler: Ülkemizdeki pediatrik hematoloji ve onkoloji
kliniklerinden veri istenerek, JMML tanısı ile takip ve tedavisi yapılan
hastaların klinik ve laboratuvar bulguları geriye dönük olarak
değerlendirildi.
Bulgular: On sekiz merkezden, 2002-2016 tarihleri arasında JMML
tanısı alan toplam 65 hasta çalışmaya dahil edildi. Ortanca tanı
yaşı 17 ay idi (2-117 ay). Splenomegali tanıda %92 hastada vardı.
Ortanca lökosit, monosit ve trombosit sayıları sırasıyla 32,9x10 9 /L,
5,4x10 9 /L ve 58,3x10 9 /L idi. Monozomi 7, %18 hastada saptanmıştı.
JMML mutasyonları 32 hastada (%49) çalışılmış olup, en sık rastlanan
mutasyon PTPN11 idi. Hematopoetik kök hücre nakli (HKHN)
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Özlem TÜFEKÇİ, M.D.,
Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey
Phone : +90 232 412 61 50
E-mail : ozlemtufekci@hotmail.com ORCID-ID: orcid.org/0000-0002-0721-1025
Received/Geliş tarihi: January 19, 2017
Accepted/Kabul tarihi: February 07, 2017
27
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
Turk J Hematol 2018;35:27-34
7 was present in 18% of patients. JMML mutational analysis was
performed in 32 of 65 patients (49%) and PTPN11 was the most
common mutation. Hematopoietic stem cell transplantation (HSCT)
could only be performed in 28 patients (44%), the majority being
after the year 2012. The most frequent reason for not performing
HSCT was the inability to find a suitable donor. The median time from
diagnosis to HSCT was 9 months (min-max: 2-63 months). The 5-year
cumulative survival rate was 33% and median estimated survival
time was 30±17.4 months (95% CI: 0-64.1) for all patients. Survival
time was significantly better in the HSCT group (log-rank p=0.019).
Older age at diagnosis (>2 years), platelet count of less than 40x10 9 /L,
and PTPN11 mutation were the factors significantly associated with
shorter survival time.
Conclusion: Although there has recently been improvement in terms
of definitive diagnosis and HSCT in JMML patients, the overall results
are not satisfactory and it is necessary to put more effort into this
issue in Turkey.
Keywords: Hematopoietic stem cell transplantation, Juvenile
myelomonocytic leukemia, Turkey
hastaların ancak %44’üne uygulanabilmiş olup, nakillerin büyük bir
oranı 2012 yılından sonra yapılmıştı. Nakil yapılamamasının en sık
nedeni uygun donör bulunamamasıydı. Tanı aldıktan nakile kadar
geçen ortalama süre 9 ay (2-63 ay) olarak saptandı. Tüm hastalarda 5
yıllık kümülatif sağkalım oranı %33, ortanca tahmini yaşam süresi ise
30±17,4 ay (%95 CI: 0-64,1) olarak bulundu. Sağkalım süresi HKHN
yapılan hastalarda anlamlı olarak daha uzundu (log-rank p=0,019).
Tanıda 2 yaşın üstünde olmak, trombosit sayısının 40x10 9 /L’nin altında
saptanması ve PTPN11 mutasyon varlığı yaşam süresini anlamlı olarak
kısaltan faktörler olarak bulundu.
Sonuç: Ülkemizde her ne kadar son dönemlerde JMML hastalarında
kesin tanı ve HKHN açısından iyileşme kaydedilmiş olsa da genel sonuç
tatminkar değildir ve bu konu ile ilgili daha fazla çaba göstermeye
gerek vardır.
Anahtar Sözcükler: Hematopoetik kök hücre nakli, Juvenil
miyelomonositik lösemi, Türkiye
Introduction
Juvenile myelomonocytic leukemia (JMML) is a chronic
malignant myeloproliferative disease of early childhood [1].
The World Health Organization classifies JMML in the group
of myelodysplastic/myeloproliferative disorders owing to both
myelodysplastic and proliferative features of the disease [2]. It is
a rare disease comprising 2%-3% of all pediatric leukemias with
a yearly incidence of 1.2 per million children [3,4]. Symptoms
and signs of the disease result from infiltration of different
organs including the spleen, liver, lungs, and gastrointestinal
tract by leukemic cells [5,6]. Affected children generally present
at a median age of 1.8 years with pallor, fever, infection, skin
bleeding, cough, skin rash, marked splenomegaly, and sometimes
diarrhea [5,7]. Leukocytosis with marked monocytosis,
circulating myeloid/erythroid precursors, varying degrees of
myelodysplasia and thrombocytopenia in peripheral blood, and
an elevated hemoglobin F (HbF) corrected for age are common
findings that are important for diagnosis. Bone marrow aspirate
findings are not diagnostic per se but rather supportive with the
presence of hypercellularity, predominance of granulocytic cells,
and fewer than 20% blasts [5,6,7,8,9,10,11]. Monosomy 7 is the
major cytogenetic anomaly found in 20%-25% of patients [5,7].
The majority of genetic mutations identified in JMML cause
pathologic activation of the RAS-RAF-MAPK signaling pathway.
These genes include NF1, KRAS, NRAS, and PTPN1. NF1 and CBL
are found in approximately 90% of patients [1,6,8]. The advances
that have been achieved in the molecular characterization
of JMML are important not only in diagnosis, but also in
the management and prognosis of the disease, addressing
a crucial phenotype-genotype relationship [1,2,8,12,13].
Some mutation types have been associated with mild clinical
phenotypes and spontaneous remission rates, but the disease
follows an aggressive course in the majority of cases if not
treated [8,13,14,15,16,17]. Chemotherapy approaches have not
been successful; the only curative treatment known so far is
hematopoietic stem cell transplantation (HSCT) [7,8,9,11].
The characteristics of the disease together with problems in
finding a suitable donor for HSCT make the disease management
difficult, especially in a developing country. In this context,
we aimed to define the status of JMML patients in Turkey in
terms of time of diagnosis, clinical characteristics, mutational
analysis, clinical course, and treatment strategies. We think that
identifying the problems in the management of this specific
group of patients will help us achieve better care for them by
taking the necessary precautions.
Materials and Methods
Sixty-five children with JMML diagnosed between 2002 and
2016 in 18 institutions throughout Turkey were enrolled in the
study. The diagnosis of JMML was based on previously published
criteria [2,18,19,20]. Data including patient and disease
characteristics and transplantation outcome were collected by
standardized questionnaires for each patient.
Due to the retrospective nature of the study, several patients
had some missing data for some of the parameters.
Clinical Assessment
Data including age, sex, presenting symptoms at first diagnosis,
presence of recurrent fever, respiratory and gastrointestinal
problems, rash, hepatosplenomegaly, and additional findings in
physical examination were all noted.
The details of the management of the disease for each patient
including chemotherapy and HSCT were all noted.
28
Turk J Hematol 2018;35:27-34
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
Laboratory Measurements, Bone Marrow, and Genetic Studies
Hematologic data including initial complete blood count,
hemoglobin electrophoresis, analysis of peripheral blood smears,
and bone marrow aspiration slides as well as cytogenetic and
molecular genetic studies from the bone marrow aspirates were
all noted.
JMML mutations including PTPN11, NRAS, KRAS, and CBL
were all studied at the University of Freiburg in the European
Working Group on Myelodysplastic Syndromes in Childhood
(EWOG-MDS) center. Analyses for CBL mutations were started
after the year 2011.
Statistical Analysis
All statistical analyses were performed using SPSS 22 (IBM Corp.,
Armonk, NY, USA). Overall survival for all patients was defined
as the time from diagnosis to death or last follow-up. Survival
probabilities were estimated by Kaplan-Meier method and
comparisons between different patient groups were performed
using two-sided log-rank tests. Prognostic factors for the length
of survival were analyzed by using the log-rank chi-square test.
The choice of variables tested was based on our own results
and other studies, and p<0.05 was considered statistically
significant.
Results
A total of 65 children were enrolled in the study. Only six had
received the diagnosis of JMML between 2002 and 2006. The
majority of the study patients (92%) had received the diagnosis
of JMML in the last 10 years (2007-2016); 52 of them (80%)
received the diagnosis after the year 2010 (Figure 1).
Clinical Features
The clinical characteristics of the patients are detailed in
Table 1.
The median age at diagnosis was 17 months (min-max: 2-117
months). Only three patients (4%) were older than 5 years old,
the eldest being 9.7 years old. There was a male predominance
with a male/female ratio of 2.25:1. The most common symptom
at presentation was fever, followed by frequent infection,
recurrent pulmonary symptoms, abdominal distension, and
skin rash. Pallor was a presenting symptom in only 12% of
patients.
Splenomegaly was present in 92% at the time of diagnosis,
whereas lymphadenopathy was noted in 18%. Four children
(6%) had the clinical diagnosis of neurofibromatosis type 1.
Laboratory Features
The hematologic data are given in Table 2. The median white
blood cell (WBC), monocyte, and platelet counts were 32.9x10 9 /L,
5.4x10 9 /L, and 58.3x10 9 /L, respectively. The hemoglobin level
was below 10 g/dL in 55 (84%) patients.
Table 1. Clinical characteristics of the patients.
Median age at diagnosis, months (minimummaximum)
n=65
17 (2-117)
Male/female 45/20
Symptoms at diagnosis n (%)
Fever 36 (55)
Recurrent fever 30 (46)
Frequent infection 28 (43)
Recurrent pulmonary symptoms 23 (35)
Abdominal distension 21(32)
Skin rash 15 (23)
Gastrointestinal system symptoms 14 (21)
Pallor 8 (12)
Signs at diagnosis n (%)
Figure 1. The distribution of newly diagnosed juvenile
myelomonocytic leukemia patients and the number of juvenile
myelomonocytic leukemia patients for whom hematopoietic
stem cell transplantation was performed according to years.
JMML: Juvenile myelomonocytic leukemia, HSCT: hematopoietic stem
cell transplantation.
Splenomegaly 60 (92)
Hepatosplenomegaly 49 (75)
Lymphadenopathy 12 (18)
Clinical diagnosis of neurofibromatosis type 1 4 (6)
29
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
Turk J Hematol 2018;35:27-34
The percentage of blasts in the bone marrow was less than 5%
in the majority (69%) of patients.
Cytogenetics and JMML Mutation Analysis
Cytogenetic study of the bone marrow was available in 49
patients; of those, 9 patients (18%) were found to have
monosomy 7 positivity (Table 2). Complex karyotypes were seen
in three patients. The remaining 37 patients (75%) had normal
karyotypes.
JMML mutation analysis was performed in 32 of 65 patients
(49%). The most common mutation was PTPN11, followed by
NRAS, KRAS, and CBL, respectively (Table 3). Seven patients were
found to have none of the screened mutations. The mutations
were all somatic, except for one germline CBL mutation.
Treatment Strategies
Treatment, either in the form of mild cytoreductive or acute
myeloid leukemia (AML)-like intensive chemotherapy, was given
to 46 of 61 patients (75%) with or without subsequent HSCT.
The combination of low-dose cytarabine (40 mg/m 2 /day) and
6-mercaptopurine was the most frequent treatment given to 11
patients (23%), followed by high dose cytarabine+etoposide in
7 patients (16%) and 6-mercaptopurine in 6 patients (15%). The
Table 2. Hematologic data of the patients at diagnosis.
Peripheral blood
n=65 Median
(minimummaximum)
other less commonly used agents in treatment were azacitidine,
cis-retinoic acid, hydroxyurea, and cytarabine, alone or in
various combinations.
HSCT was planned for 63 of 65 patients but could only be
performed in 28 (44%) patients. Five other patients (8%) were
also found to have suitable donors, but they were still waiting for
HSCT at the time of data collection. The most frequent reason for
not performing HSCT was the inability to find a suitable donor
(21 patients: 33%). Patient/family incompatibility in 5 patients
(8%) and death due to disease in 4 patients while planning HSCT
(6%) were other reasons for not performing HSCT.
“Watch and wait” was the main treatment strategy for those
two patients for whom HSCT was not planned. One of them was
a female patient with CBL mutation and the other was a male
patient with NRAS mutation.
The median time from diagnosis to HSCT was 9 months (minmax:
2-63 months).
HSCT was performed in 28 patients (44%). Three patients were
transplanted twice and two patients were transplanted three
times due to relapse. The distribution of the transplanted
patients according to years is shown in Figure 1. HSCT was
performed for 50% of the newly diagnosed JMML patients after
the year 2012. Donor type was matched sibling donor in 18
patients (64%), matched unrelated donor in 8 patients (28%),
haploidentical donor in one patient, and unrelated cord blood
in one patient.
Median hemoglobin at diagnosis, g/dL 8.8 (3.3-12.3)
Median leukocytes at diagnosis, x10 9 /L 32.9 (0.3-325)
Median monocytes at diagnosis, x10 9 /L 5.4 (1-49.1)
Median thrombocytes at diagnosis, x10 9 /L 58.3 (5-925)
Median percentage of myeloid precursors 10 (0-59)
Median percentage of HbF 8 (0-63)
Bone marrow n=58 (%)
Bone marrow blasts: <5% 40 (69)
Bone marrow blasts: 5%-20% 18 (31)
Bone marrow cytogenetics n=49 (%)
Normal karyotype 37 (75)
Monosomy 7 9 (18)
Karyotype abnormality other than monosomy 7 3 (6)
HbF: Fetal hemoglobin.
Figure 2. Survival of patients with or without hematopoietic
stem cell transplantation (patients with hematopoietic stem cell
transplantation: n=25, patients without hematopoietic stem cell
transplantation: n=40).
HSCT: Hematopoietic stem cell transplantation.
30
Turk J Hematol 2018;35:27-34
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
Survival
The 5-year cumulative survival rate of the whole group was
33%. The mean estimated survival time was 72.4±12.9 months
(95% CI: 46.9-97.9) and median estimated survival time was
30±17.4 months (95% CI: 0-64.1) for all patients. Survival time
was significantly better in the HSCT group (log-rank p=0.019)
(Figure 2). Relapse after HSCT occurred in 10 of 28 (35%)
patients. Death occurred in 31 of 62 patients (50%); of those,
12 were in the HSCT (44%) group and 19 (54%) were in the
non-HSCT group. The causes of death were HSCT toxicity (50%)
and sepsis/organ failure due to relapse (50%) in the HSCT group.
In all patients in the non-HSCT group, the cause of death was
sepsis/organ failure due to progressive disease.
Factors Influencing Survival
Older age at diagnosis (>2 years old), platelet count at diagnosis
of less than 40x10 9 /L, and PTPN11 mutation were the factors
associated with shorter survival time (Figures 3, 4, and 5; Table
4). Sex, fetal hemoglobin (HbF) percentage (<10% or ≥10%),
presence of monosomy 7, and bone marrow blast percentage at
diagnosis did not influence survival significantly (Table 4).
Figure 4. Survival of patients according to platelet count at
diagnosis (platelets <40x10 9 /L: n=21, platelets ≥40x10 9 /L: n=44).
Figure 3. Survival of patients according to age at diagnosis (age
<2 years: n=38 , age ≥2 years: n=27).
Table 3. The distribution of juvenile myelomonocytic
leukemia mutations in 32 patients.
n=32 (%)
PTPN11 9 (28)
NRAS 8 (25)
KRAS 7 (22)
CBL 1 (3)
Mutation not detected 7 (22)
Figure 5. Survival of patients according to PTPN11 mutation
status in patients for whom JMML mutation analysis was
conducted (n=32) (PTPN11 mutation: n=9, NRAS/KRAS/CBL/no
mutation: n=23).
Discussion
This retrospective clinical study reflects the diagnosis, treatment
strategies, and prognosis of 65 JMML patients from Turkey. The
clinical features of the patients were highly similar to those
reported in the literature [3,5,10,12]. In our study, the median
time of diagnosis was found as 17 months and almost all of
the patients (95%) were younger than 5 years old. The median
age of diagnosis in the previous studies was reported within a
range of 17-24 months old and more than 90% of patients were
reported to be younger than 5 years old. The male predominance
that was reported in other studies has also been observed in our
study with a male:female ratio of 2.2 [4,5,7,12,21].
31
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
Turk J Hematol 2018;35:27-34
Table 4. Factors influencing survival in patients with juvenile myelomonocytic leukemia.
Variable Number of patients Mean estimated survival time
(months), ± SE
95% CI Log-rank p
Age
Younger than 2 years
2 years and older
38
27
94±19
29±6
56-132
16-41
0.014
Sex
Male
Female
40
18
36±4
96±21
27-45
55-137
0.449
Platelet count at diagnosis
Below 40x10 9 /L
40x10 9 /L or above
21
44
22±4
87±15
12-31
56-118
0.024
Mutational status
PTPN11 mutation
NRAS/KRAS/CBL/no mutation
9
23
14±3
83±11
7-22
61-105
0.004
HbF level
Less than 10%
10% or more
26
15
97±21
38±9
55-140
20-56
0.162
Monosomy 7
Positive
Negative
9
40
32±6
59±9
19-45
39-78
0.903
Bone marrow blasts
Less than 5%
5%-20%
38
16
94±16
29±6
62-125
17-41
0.165
Patients with JMML have been commonly reported to present
with symptoms of pallor, fever, infection, skin bleeding, cough,
skin rash, and sometimes diarrhea [5,7]. The major presenting
symptoms were fever and recurrent infection in the present study.
Recurrent pulmonary infections and gastrointestinal symptoms
were also seen in a substantial number of patients in this study.
However, pallor was not a common symptom, which was reported
as the major frequent symptom in the EWOG-MDS study [5]. In
fact, the median hemoglobin level was 8.1 g/dL in our study and
84% of patients had an initial hemoglobin value of less than 10
g/dL. This was a retrospective study collecting data from patients’
records and so pallor might have been overlooked.
The presence of splenomegaly is a hallmark in the diagnosis of
JMML; nevertheless, it has been reported that 7% of patients do
not have splenomegaly at the time of diagnosis [6]. Similarly,
splenomegaly was present in 92% of our patients at the time
of diagnosis. Lymphadenopathy, on the other hand, was not as
frequent in our patients as reported by the EWOG-MDS study
[5]. Neurofibromatosis type 1 has been well recognized to have
a 200- to 500-fold increased risk for development of JMML and
has been reported in 8%-14% of JMML patients [5,10,22,23,24].
It was present in 4 patients (6%) in our study.
Patients with JMML generally present with leukocytosis,
monocytosis, and thrombocytopenia [5,6,7,8]. The hematologic
data in our study were highly similar to those reported in the
literature [5,7,12]. In our study, the median WBC, monocyte,
and platelet counts were 32.9x10 9 /L, 5.4x10 9 /L, and 58.3x10 9 /L,
respectively. The median HbF value was 8%. Locatelli et al. [7]
reported the median WBC, monocyte, and platelet counts as
34x10 9 /L, 5.5x10 9 /L, and 65x10 9 /L, respectively, and the HbF
value as 9%. These data show that although there might be
some differences in the clinical presentation, hematologic data
do not differ significantly among JMML patients.
Major advances have been achieved in defining the genomic
landscape of JMML in recent years [1,6,11,12,13,14,15,16,17].
Progress in the discovery of the underlying mutations helped in
the definitive diagnosis of the patients and also led physicians
to establish a phenotype-genotype relationship, predict the
clinical outcome, and determine a treatment strategy. In JMML,
for patients with NF1 and somatic mutations of PTPN11 and
K-RAS, and for the majority of patients with somatic NRAS
mutations, HSCT is recommended as the first treatment option
[8]. As patients with germline CBL and a few patients with
somatic NRAS mutations were reported to have had spontaneous
remission, careful follow-up rather than HSCT is recommended
in the first place for those patients [8,14,15,16,17]. In our study,
mutational analysis was done for only 32 patients (49%) at the
EWOG-MDS center. PTPN11 mutation was the most frequently
seen mutation (28%) and was also associated with significantly
32
Turk J Hematol 2018;35:27-34
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
lower survival rates compared to other mutations. Somatic
PTPN11 mutations constitute ~35% of all JMML mutations and
in some series have been reported to be associated with lower
survival rates compared to other mutations [12,25,26]. Given
the fact that the majority of the patients in this study had the
diagnosis of JMML after 2010, mutational analysis was possible
for most of them. In this respect, we hope that this study
increases the awareness of JMML among physicians in terms
of diagnosis as well as mutational analysis in order to outline
a treatment strategy and to start a donor screening program
immediately for HSCT if indicated.
The only curative treatment approach in JMML to date has been
HSCT [7,8,27,28,29]. HSCT was planned for all but two patients
but could only be performed in 44% of the patients and it
was associated with better survival time compared to those
who were not transplanted. Mild cytoreductive or AML-like
intensive chemotherapy was given to the majority of patients.
Approximately one-third of the patients lacked a suitable donor
for transplantation. The median time from the time of diagnosis
to HSCT has been reported as between 6 and 10 months in various
studies [7,27,28]. It was 9 months in our study, comparable to
other studies, but 6% of the patients died while waiting for
HSCT. It seems that besides finding a suitable donor we also had
problems in performing HSCT. However, Turkey has made great
progress in stem cell transplantation in the recent years. Besides
the tremendous increase in the number of well-equipped stem
cell transplantation centers in the last 5 years, difficulties in
finding suitable donors have been mainly overcome. A national
bone marrow bank, called Turkey Stem Cell Coordination Center,
was established by the Turkish Ministry of Health in 2014 and
has reached a substantial number of volunteer donors over
time [30]. Along with these developments, most of our patients
had stem cell transplantation in the recent years. Indeed, much
effort has been needed, as HSCT remains the only curative
treatment for this disease.
Factors associated with poor prognosis other than mutational
status have been reported as older age at diagnosis (>2 years),
platelet count of <33-40x10 9 /L, and increased HbF level at
diagnosis [4,5]. Consistent with the literature, besides PTPN11
mutation, age older than 2 years and platelet count of less
than 40x10 9 /L were associated with lower survival rates in our
study. Patients with HbF level greater than 10%, as well as male
sex and higher bone marrow blast percentage (5%-20%) at
diagnosis, seemed to have worse outcomes, but the statistical
differences were not significant.
The natural course of JMML is aggressive and the great majority
of patients die if the disease is left untreated [4,5,10]. The
5-year overall survival rate in JMML patients has been reported
as 30%-40% in older studies [4,10]. However, with HSCT, the
EWOG-MDS study reported the 5-year probability of overall
survival as 64%, with the median observation time of patients
alive being 40 months (min-max: 6-44) [7]. In our study, the
5-year cumulative survival rate of all patients was 33%, the
median estimated time of survival was 30±17.4 months, and
the most common cause of death was sepsis/organ failure due
to progressive disease. This low survival rate in our patients
obviously results from the low transplantation rate. Relapse
after allogeneic stem cell transplantation has been a great
problem in patients with JMML, occurring in one-third of
transplanted patients [7,27,29]. The relapse rate was 35% in our
study, and half of the relapsed patients had received more than
one transplant.
Conclusion
In summary, the genotype-phenotype relationship becomes
increasingly important in JMML. As a result, mutational analysis
is important not only for definitive diagnosis of the disease but
also to determine the indication and urgency for HSCT, and to
promptly initiate donor screening if necessary. Although there
is a possibility of spontaneous remission with certain types of
mutations, HSCT still remains the only curative treatment for
this disease. As the main reason for not performing HSCT was
the inability to find a suitable donor in this study, we think that
it is necessary to put more effort into this issue in Turkey.
Ethics
Ethics Committee Approval: Retrospective study.
Informed Consent: Not applicable.
Authorship Contributions
Surgical and Medical Practices: Ö.T., Ü.K., Z.K., İ.Y., C.A., D.A.,
Ş.Y.B., T.P., M.K., E.Ü., E.Ü.İ., T.İ., M.E., T.C., G.N.Ö., N.S., D.K., N.Y.,
N.Y.Ö., A.K., T.K., C.V., Ü.Ç., H.T., M.S.E., B.B., A.M.G., D.Y.K., S.K.,
V.U., G.K., M.A.Y., A.K., E.E., B.A., H.Ö., H.Ö.; Concept: Ö.T., H.Ö.;
Design: Ö.T., H.Ö.; Data Collection or Processing: Ö.T., Ü.K., Z.K.,
İ.Y., C.A., D.A., Ş.Y.B., T.P., M.K., E.Ü., E.Ü.İ., T.İ., M.E., T.C., G.N.Ö.,
N.S., D.K., N.Y., N.Y.Ö., A.K., T.K., C.V., Ü.Ç., H.T., M.S.E., B.B.,
A.M.G., D.Y.K., S.K., V.U., G.K., M.A.Y., A.K., E.E., B.A., H.Ö., H.Ö.;
Analysis or Interpretation: Ö.T., Ş.Y., H.Ö.; Literature Search: Ö.T.;
Writing: Ö.T., Ş.Y., H.Ö.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
References
1. Chang TY, Dvorak CC, Loh ML. Bedside to bench in juvenile myelomonocytic
leukemia: insights into leukemogenesis from a rare pediatric leukemia.
Blood 2014;124:2487-2497.
2. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM,
Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World
Health Organization classification of myeloid neoplasms and acute
leukemia. Blood 2016;127:2391-2405.
33
Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey
Turk J Hematol 2018;35:27-34
3. Hasle H, Wadsworth LD, Massing BG, McBride M, Schultz KR. A populationbased
study of childhood myelodysplastic syndrome in British Columbia,
Canada. Br J Haematol 1999;106:1027-1032.
4. Passmore SJ, Chessells JM, Kempski H, Hann IM, Brownbill PA, Stiller CA.
Paediatric myelodysplastic syndromes and juvenile myelomonocytic
leukemia in the UK: a population based study of incidence and survival. Br
J Haematol 2003;121:758-767.
5. Niemeyer CM, Arico M, Basso G, Biondi A, Cantu Rajnoldi A, Creutzig U,
Haas O, Harbott J, Hasle H, Kerndrup G, Locatelli F, Mann G, Stollmann-
Gibbels B, van’t Veer-Korthof ET, van Wering E, Zimmermann M. Chronic
myelomonocytic leukemia in childhood: a retrospective analysis of 110
cases. European Working Group on Myelodysplastic Syndromes in Childhood
(EWOG-MDS). Blood 1997;89:3534-3543.
6. Loh ML. Recent advances in the pathogenesis and treatment of juvenile
myelomonocytic leukaemia. Br J Haematol 2011;152:677-687.
7. Locatelli F, Nöllke P, Zecca M, Korthof E, Lanino E, Peters C, Pession A,
Kabisch H, Uderzo C, Bonfim CS, Bader P, Dilloo D, Stary J, Fischer A, Révész
T, Führer M, Hasle H, Trebo M, van den Heuvel-Eibrink MM, Fenu S, Strahm
B, Giorgiani G, Bonora MR, Duffner U, Niemeyer CM; European Working
Group on Childhood MDS; European Blood and Marrow Transplantation
Group. Hematopoietic stem cell transplantation (HSCT) in children with
juvenile myelomonocytic leukemia (JMML): results of the EWOG-MDS/
EBMT trial. Blood 2005;105:410-419.
8. Locatelli F, Niemeyer CM. How I treat juvenile myelomonocytic leukemia.
Blood 2015;125:1083-1090.
9. Niemeyer CM, Kratz CP. Paediatric myelodysplastic syndromes and juvenile
myelomonocytic leukaemia: molecular classification and treatment options.
Br J Haematol 2008;140:610-624.
10. Passmore SJ, Hann IM, Stiller CA, Ramani P, Swansbury GJ, Gibbons B,
Reeves BR, Chessells JM. Pediatric myelodysplasia: a study of 68 children
and a new prognostic scoring system. Blood 1995;85:1742-1750.
11. Sakashita K, Matsuda K, Koike K. Diagnosis and treatment of juvenile
myelomonocytic leukemia. Pediatr Int 2016;58:681-690.
12. Yoshida N, Yagasaki H, Xu Y, Matsuda K, Yoshimi A, Takahashi Y, Hama A,
Nishio N, Muramatsu H, Watanabe N, Matsumoto K, Kato K, Ueyama J,
Inada H, Goto H, Yabe M, Kudo K, Mimaya J, Kikuchi A, Manabe A, Koike K,
Kojima S. Correlation of clinical features with the mutational status of GM-
CSF signaling pathway-related genes in juvenile myelomonocytic leukemia.
Pediatr Res 2009;65:334-340.
13. Matsuda K, Shimada A, Yoshida N, Ogawa A, Watanabe A, Yajima S, Iizuka S,
Koike K, Yanai F, Kawasaki K, Yanagimachi M, Kikuchi A, Ohtsuka Y, Hidaka E,
Yamauchi K, Tanaka M, Yanagisawa R, Nakazawa Y, Shiohara M, Manabe A,
Kojima S, Koike K. Spontaneous improvement of hematologic abnormalities
in patients having juvenile myelomonocytic leukemia with specific RAS
mutations. Blood 2007;109:5477-5480.
14. Flotho C, Kratz CP, Bergsträsser E, Hasle H, Starý J, Trebo M, van den Heuvel-
Eibrink MM, Wójcik D, Zecca M, Locatelli F, Niemeyer CM; European Working
Group of Myelodysplastic Syndromes in Childhood. Genotype-phenotype
correlation in cases of juvenile myelomonocytic leukemia with clonal RAS
mutations. Blood 2008;111:966-967.
15. Loh ML, Sakai DS, Flotho C, Kang M, Fliegauf M, Archambeault S, Mullighan
CG, Chen L, Bergstraesser E, Bueso-Ramos CE, Emanuel PD, Hasle H, Issa
JP, van den Heuvel-Eibrink MM, Locatelli F, Stary J, Trebo M, Wlodarski M,
Zecca M, Shannon KM, Niemeyer CM. Mutations in CBL occur frequently in
juvenile myelomonocytic leukemia. Blood 2009;114:1859-1863.
16. Niemeyer CM, Kang MW, Shin DH, Furlan I, Erlacher M, Bunin NJ, Bunda
S, Finklestein JZ, Gorr TA, Mehta P, Schmid I, Kropshofer G, Corbacioglu S,
Lang PJ, Klein C, Schlegel PG, Heinzmann A, Schneider M, Starý J, van den
Heuvel-Eibrink MM, Hasle H, Locatelli F, Sakai D, Archambeault S, Chen L,
Russell RC, Sybingco SS, Ohh M, Braun BS, Flotho C, Loh ML. Germline CBL
mutations cause developmental abnormalities and predispose to juvenile
myelomonocytic leukemia. Nat Genet 2010;42:794-800.
17. Matsuda K, Taira C, Sakashita K, Saito S, Tanaka-Yanagisawa M, Yanagisawa
R, Nakazawa Y, Shiohara M, Fukushima K, Oda M, Honda T, Nakahata T, Koike
K. Long-term survival after nonintensive chemotherapy in some juvenile
myelomonocytic leukemia patients with CBL mutations, and the possible
presence of healthy persons with the mutations. Blood 2010;115:5429-
5431.
18. Pinkel D. Differentiating juvenile myelomonocytic leukemia from infectious
disease. Blood 1998;91:365-367.
19. Hasle H, Niemeyer CM, Chessells JM, Baumann I, Bennett JM, Kerndrup G,
Head DR. A pediatric approach to the WHO classification of myelodysplastic
and myeloproliferative diseases. Leukemia 2003;17:277-282.
20. Chan RJ, Cooper T, Kratz CP, Weiss B, Loh ML. Juvenile myelomonocytic
leukemia: a report from the 2nd International JMML Symposium. Leuk Res
2009;33:355-362.
21. Yoshida N, Hirabayashi S, Watanabe S, Zaike Y, Tsuchida M, Yoshimi A,
Masunaga A, Otsuka Y, Ito M, Kojima S, Nakahata T, Manabe A. Prognosis
of 75 patients with juvenile myelomonocytic leukemia: prospective study
by MDS committee in the Japanese Society of Pediatric Hematology. Rinsho
Ketsueki 2011;52:1853-1858.
22. Bader JL, Miller RW. Neurofibromatosis and childhood leukemia. J Pediatr
1978;92:925-929.
23. Stiller CA, Chessells JM, Fitchett M. Neurofibromatosis and childhood
leukaemia/lymphoma: a population-based UKCCSG study. Br J Cancer
1994;70:969-972.
24. Side L, Taylor B, Cayouette M, Conner E, Thompson P, Luce M, Shannon
K. Homozygous inactivation of the NF1 gene in bone marrow cells from
children with neurofibromatosis type 1 and malignant myeloid disorders. N
Engl J Med 1997;336:1713-1720.
25. Tartaglia M, Niemeyer CM, Fragale A, Song X, Buechner J, Jung A, Hählen
K, Hasle H, Licht JD, Gelb BD. Somatic mutations in PTPN11 in juvenile
myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid
leukemia. Nat Genet 2003;34:148-150.
26. Park HD, Lee SH, Sung KW, Koo HH, Jung NG, Cho B, Kim HK, Park IA, Lee KO,
Ki CS, Kim SH, Yoo KH, Kim HJ. Gene mutations in the Ras pathway and the
prognostic implication in Korean patients with juvenile myelomonocytic
leukemia. Ann Hematol 2012;91:511-517.
27. Manabe A, Okamura J, Yumura-Yagi K, Akiyama Y, Sako M, Uchiyama H,
Kojima S, Koike K, Saito T, Nakahata T; MDS Committee of the Japanese
Society of Pediatric Hematology. Allogeneic hematopoietic stem cell
transplantation for 27 children with juvenile myelomonocytic leukemia
diagnosed based on the criteria of the International JMML Working Group.
Leukemia 2002;16:645-649.
28. Smith FO, King R, Nelson G, Wagner JE, Robertson KA, Sanders JE, Bunin N,
Emaunel PD, Davies SM; National Marrow Donor Program. Unrelated donor
bone marrow transplantation for children with juvenile myelomonocytic
leukaemia. Br J Haematol 2002;116:716-724.
29. Locatelli F, Niemeyer C, Angelucci E, Bender-Götze C, Burdach S, Ebell W,
Friedrich W, Hasle H, Hermann J, Jacobsen N, Klingebiel T, Kremens B, Mann
G, Pession A, Peters C, Schmid HJ, Stary J, Suttorp M, Uderzo C, van’t Veer-
Korthof ET, Vossen J, Zecca M, Zimmermann M. Allogeneic bone marrow
transplantation for chronic myelomonocytic leukemia in childhood: a
report from the European Working Group on Myelodysplastic Syndrome in
Childhood. J Clin Oncol 1997;15:566-573.
30. Türk Kızılay. Kök Hücre Bağış. Available online at http://www.kanver.org/
sayfa/kan-hizmetleri/kok-hucre-bagisi/53.
34
RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0502
Turk J Hematol 2018;35:35-41
Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical
Characteristics and Prognosis
Mikozis Fungoides/Sezary Sendromunda Transformasyon: Klinik Özellikler ve Prognoz
Seçil Vural 1 , Bengü Nisa Akay 1 , Ayşenur Botsalı 1 , Erden Atilla 2 , Nehir Parlak 1,3 , Aylin Okçu Heper 4 , Hatice Şanlı 1
1Ankara University Faculty of Medicine, Department of Dermatology, Ankara, Turkey
2Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey
3Etimesgut Şehit Sait Ertürk State Hospital, Clinic of Dermatology, Ankara, Turkey
4Ankara University Faculty of Medicine, Department of Pathology, Ankara, Turkey
Abstract
Objective: Transformed mycosis fungoides (T-MF) is a rare variant
of MF with an aggressive course. In this study, we aimed to
describe characteristics of MF/Sezary syndrome (SS) patients with
transformation.
Materials and Methods: Patients diagnosed with T-MF among MF/
SS patients between 2000 and 2014 in a tertiary single center were
evaluated retrospectively. Demographic data, clinical data, laboratory
data, immunophenotype features, response to treatment, survival, and
histopathologic features were analyzed.
Results: Among 254 MF patients, 25 patients with T-MF were
identified (10.2%) and included in the study. The male-to-female ratio
was 2.6/1. The median time between MF diagnosis and transformation
was 32 months (range: 0-192). Nine (36%) patients were diagnosed
initially with T-MF. Advanced disease stage and high serum lactate
dehydrogenase (LDH) levels were indicators of poor prognosis and
treatment response. Five of the 18 patients with progressive disease
had undergone allogeneic hematopoietic stem cell transplantation
(allo-HSCT). Allo-HSCT resulted in complete remission in three (60%)
patients. Ten (40%) patients died as a result of disease progression.
Mean survival time was 25.2±14.9 (2-56) months after transformation.
Conclusion: Advanced stage, high serum LDH levels, and loss of
CD26 and CD7 expression in the peripheral blood are poor rognostic
factors in T-MF. Treatment-resistant tumors and nodules should be
cautionary for T-MF. Patients with T-MF have a shortened survival.
Some patients may respond to first-line treatments. However, the
majority of patients who do not respond to first-line therapies also
are unresponsive to second or third-line therapies. Allo-HSCT may be
an alternative option in patients with T-MF.
Keywords: Anaplastic, Transformation, Mycosis fungoides,
Transformed, Allogeneic hematopoietic stem cell transplantation,
Sezary syndrome
Öz
Amaç: Transforme mikozis fungoides (T-MF) MF nadir görülen
agresif seyirli bir alt tipidir. Bu çalışmada transformasyon gelişen MF/
Sezary sendromu (SS) hastalarının klinik ve laboratuvar özelliklerinin
değerlendirilmesi amaçlanmıştır.
Gereç ve Yöntemler: Bu çalışmada tek bir referans merkezde 2000-
2014 yılları arasında takip edilen MF/SS hastaları arasından T-MF
geliştirenler retrospektif olarak değerlendirilmiştir. Demografik,
klinik ve laboratuvar veriler, immünfenotiplendirme, tedavi yanıtları,
histopatolojik özellikler ve sağkalım analiz edilmiştir.
Bulgular: Takip edilen 254 MF hastası içerisinde 25 T-MF saptanarak
(%10,2) çalışmaya dahil edilmiştir. Erkek kadın oranı 2,6/1’dir.
MF tanısı ile T-MF tanısı arasında geçen sürenin medianı 32 ay
olarak tespit edilmiştir (0-192). Dokuz hastada (%36) tanı anında
transformasyon bulunmaktadır. İleri hastalık evresi ve yüksek serum
laktat dehidrogenaz (LDH) düzeyleri kötü prognoz ve tedavi yanıtı
göstergesi olarak saptanmıştır. Tedaviye dirençli 18 ileri evre hastadan
beşine allojenik hematopoetik kök hücre transplantasyonu (allo-HKHT)
yapılmıştır. Bunlardan üçünde tam remisyon sağlanmıştır. İzlemde
toplam 10 hasta hastalık progresyonu nedeniyle kaybedilmiştir. T-MF
sonrası ortalama sağkalım 25,2±14,9 (2-56) aydır.
Sonuç: İleri hastalık evresi, yüksek LDH düzeyi, perifer kan T hücrelerde
CD26 ve CD7 kaybı kötü prognoz belirteçlerindendir. Tedaviye dirençli
nodül ve tümörler T-MF açısından şüphe uyandırmalıdır. T-MF’de
sağkalım kısalmıştır. Bazı hastalarda birinci basamak tedavilere iyi
yanıt alınabilmektedir. Ancak birinci basamak tedavilere yanıtsız
hastalar genellikle ikinci ve üçüncü basamak tedavilere de direnç
gösterebilmektedir. Allo-HKHT, T-MF hastalarında alternatif bir tedavi
yöntemi olarak kullanılabilir.
Anahtar Sözcükler: Anaplastik, Transformasyon, Mikozis fungoides,
Transforme, Allojenik hematopoetik kök hücre transplantasyonu,
Sezary sendromu
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Seçil VURAL, M.D.,
Ankara University Faculty of Medicine, Department of Dermatology, Ankara, Turkey
Phone : +90 505 432 46 82
E-mail : secilsaral@gmail.com ORCID-ID: orcid.org/0000-0001-6561-196X
Received/Geliş tarihi: December 30, 2016
Accepted/Kabul tarihi: May 22, 2017
35
Vural S, et al: Transformation of Mycosis Fungoides
Turk J Hematol 2018;35:35-41
Introduction
Mycosis fungoides (MF) is the most common subtype of
cutaneous T-cell lymphoma (CTCL). Generally, MF has an
indolent course with slow progression from patch/plaque-stage
disease to cutaneous tumors [1]. However, in the case of largecell
transformation (LCT), it is associated with an aggressive
clinical course and poor survival [2].
Diagnosis of transformed MF (T-MF) is based on the presence
of large cells (CD30 +/-) exceeding 25% of the infiltrate
throughout the lesion or forming microscopic nodules of large
cells [3]. Molecular studies have demonstrated that the largecell
infiltrate in T-MF/Sezary syndrome (SS) represents evolution
from the original clone [4].
Advanced stage of MF at the time of transformation and
folliculotropism are suggested as the most important factors
affecting survival [2]. Additionally, early transformation in MF
lesions was described as a poor prognostic factor in previous
studies [5]. Even though the CD30 expression is more common
in advanced MF, in T-MF, it is reported as a favorable prognostic
factor [6,7,8].
Risk factors associated with an aggressive course of T-MF are
not well described in the literature due to the low incidence of
MF/SS and thus T-MF. In different series, the incidence of T-MF
has been reported to range between 8% and 55% among MF
patients [3,5,9,10,11]. This study was designed to investigate the
clinical, laboratory, and histopathological parameters associated
with T-MF.
Materials and Methods
We retrospectively evaluated all MF/SS patient records in a
single reference center in Ankara, Turkey, from 2000 to 2014.
Among all MF/SS patients, T-MF patients with at least one
histopathologically confirmed biopsy were included in the study.
For each case, clinical features were evaluated by three
dermatologists and histopathological findings were reviewed by
one pathologist who was an expert in this area.
All patients were classified according to the International
Society for Cutaneous Lymphomas and European Organisation
of Research and Treatment of Cancer revised criteria of 2007
[12]. Staging included physical examination, blood cell count
and chemistry, peripheral blood smear and flow cytometry,
lymph node ultrasonography, and, in most cases, computed
tomography scans of the abdomen, chest, and pelvis.
Histopathology included one or multiple skin biopsies for all
patients. In the case of clinically and sonographically significant
adenopathy, a lymph node biopsy was performed.
The accompanying prognostic factors were also analyzed: age,
sex, age at diagnosis of T-MF, presence of folliculotropism in
skin lesions, CD30 expression in more than 75% of cutaneous
neoplastic T cells, serum lactate dehydrogenase (LDH) levels,
serum β2-microglobulin levels, and eosinophilia. The time
interval between MF and T-MF, clinical stage at the time of
T-MF, and survival were analyzed.
Therapies were classified as first-, second-, and third-line
treatments according to the 2014 National Comprehensive
Cancer Network Clinical Practice Guidelines in Oncology [13,14].
Allogeneic hematopoietic stem cell transplantation (allo-HSCT)
and autologous stem cell transplantation were evaluated
separately.
Response to treatment was evaluated as follows: complete
response (CR), complete resolution of the disease; partial
response (PR), at least 50% improvement compared with
baseline; stable disease (SD), some improvement (25% to 50%
improvement in lesions) plus reduction in the size of axillary
and inguinal lymph nodes in the absence of significant evidence
of disease; or progressive disease (PD), more than 25% increase
in the number or size of clinically abnormal lymph nodes, or
development of novel tumors or pathologically positive nodes
or visceral disease [12].
Statistical Analysis
The data obtained from patients were analyzed with SPSS 16.0.
The Mann-Whitney U test, chi-square test, Spearman’s test,
and Mantel-Cox analysis were used to compare variables. The
Kaplan-Meier method was used to determine overall survival.
Results
Clinical Data
The disease stage and exact TNMB stages of patients, initial
treatments, and follow-up data of each patient are summarized
in Table 1. Durations between the diagnosis of MF and
transformation and the follow-up duration are given in Table
2. The rate of T-MF was 10.2% (n=25) among all MF/SS patients
(n=254). The median age at the time of MF diagnosis was 49
years (range: 26-76), whereas the median age at the time
of transformation was 54 years (range: 30-78). The male-tofemale
ratio was 2.6 (M/F: 18/7). Sex was not significantly related
to survival (p=0.218). Patients’ age at the time of transformation
was also not related to survival (p=0.697). Transformation was
detected in 36% (n=9) of the patients at the onset of MF. The
median time between the diagnosis of MF and transformation
was 32 months (range: 0-192). Patients were followed for a
mean of 39.4±17.1 months after transformation.
Two of 25 patients with T-MF (8%) had early patch and plaque
MF (stage IA: 1, stage 1B: 1). Twenty-three patients had
advanced-stage disease [stage IIB (n=9, 36%), stage III (n=3,
12%), stage IVA 1
(n=8, 32%), stage IVA 2
(n=2, 8%), and stage
36
Turk J Hematol 2018;35:35-41
Vural S, et al: Transformation of Mycosis Fungoides
Table 1. Characteristics of patients with transformed mycosis fungoides.
Diagnosis and
stage
Sex and age Initial treatment Response to treatment
Follow-up
(months)
MF IA M 36 1 st line (PUVA, IFN) Complete remission 51 CR
MF IB F 52 1 st line (PUVA, INF, ECP, bexarotene) Stable disease 37 PD
MF IIB M 58 1 st line (PUVA, IFN, ECP, bexarotene) Progression 13 PD
MF IIB M 78 1 st line (PUVA, IFN, bexarotene, ECP) Progression 47 PD
MF IIB M 48 1 st line (PUVA, IFN) Progression 20 PD
MF IIB M 61 1 st line (PUVA, ECP, Roferon) SD 49 SD
MF IIB M 56
1 st line (PUVA, ECP, Roferon,
bexarotene, local RT)
Progression 30 PD
MF IIB M 43 1 st line (PUVA, Roferon, bexarotene) SD 51 SD
MF IIB M 40 1 st line (PUVA, IFN, local RT) SD 34 SD
MF IIB M 48 1 st line (PUVA, IFN) Complete remission 70 CR
MF IIB F 30 1 st line (PUVA, IFN, ECP, bexarotene) Progression 59 PD
MF III F 50 1 st line (PUVA, IFN) PR 16 PR
MF III M 59
1 st line (PUVA, IFN, ECP), 3 rd line
(CHOPx6)
Progression 29 E
MF III M 75 1 st line (PUVA, IFN) SD 59 SD
MF IVA2 M 33 3 rd line* (CHOPx6), 1 st line (local RT)
Progression**
25 CR
MF IVA2 F 69 1 st line (PUVA, ECP, IFN) Progression 19 E
MF IVA2 M 49
1 st line (PUVA, IFN, ECP, HDAC
inhibitor)
Progression** 56 E
MF IVA2 M 60 1 st line (PUVA, IFN, bexarotene, ECP) Progression** 19 E
MF IVA2 M 48
1 st line (PUVA, IFN, ECP, HDAC
inhibitor), 2 nd line (gemcitabine)
Progression 29 E
SS IVA2 F 54 1 st line (PUVA, IFN) Progression** 40 E
SS IVA2 M 55 1 st line (methotrexate, PUVA, IFN, ECP) Progression 13 E
SS IVA1 F 51
1 st line (PUVA, ECP, IFN, HDAC
inhibitor, local electron beam
radiotherapy)
Progression 19 E
SS IVA2 M 48 1 st line (PUVA, IFN, ECP) Progression** 54
SS IVA2 M 53 1 st line (ECP, IFN) Progression 18 Exitus
SS IVA1 F 48 3 rd line (CHOPx6)* Progression 2 Exitus
Last follow-up
Complete
remission
*Before admission, **Patients referred for allogeneic hematopoietic stem cell transplantation due to progressive disease.
ECP: Extracorporeal photopheresis, PUVA: psoralen ultraviolet A, IFN: interferon-alpha 2a, CHOP: cyclophosphamide, doxorubicin, vincristine, and prednisolone regimen chemotherapy,
HDAC: histone deacetylase, CR: complete remission, PR: partial remission, SD: stable disease, PD: progressive disease; E: exitus.
IVB (n=1, 4%)]. Most patients had transformation only at a skin
site (96%); in one patient skin and lymph, node transformations
were detected simultaneously (4%). Furthermore, 32% of T-MF
patients presented with a new or enlarging tumor accompanied
by long-standing plaque lesions. Dermatological examination
at the time of T-MF diagnosis for the rest of the patients
revealed the following: two (8%) patients had long-standing
enlarging tumors, four (16%) patients had a new tumor
accompanied with erythroderma (one bullous), one (4%)
patient demonstrated ichthyosiform erythroderma, three (12%)
patients had an enlarging plaque with erythroderma, three
(12%) patients had long-standing plaques, two (8%) patients
had newly scattered papules distinct from MF plaques, one
(4%) patient showed an abrupt onset of multiple pink scattered
nodules, and another patient (4%) had follicular papules
associated with hair loss within the involved area (Figure 1).
Histopathological examinations of the transformation site
showed tumoral lesions in 18 (72%) cases and plaque lesions
in seven (28%) cases. Lesion subtype (plaque or tumor) was not
significantly correlated with survival (p=0.678). Less prominent
37
Vural S, et al: Transformation of Mycosis Fungoides Turk J Hematol 2018;35:35-41
or focal epidermotropism was present in 15 (60%) of the 25
patients in our study, and only 2 (8%) patients had Pautrier
microabscesses. Folliculotropism was observed in ten cases
(40%) with LCT. In eight (80%) of them, there was progression
under treatment, while in one (10%) patient PR to treatment
and in 1 (10%) patient CR was observed. Folliculotropism was
not correlated statistically with survival (p=0.568).
correlated with poor survival (p=0.017). Loss of CD7 expression
(more than 40%) was significantly related to poor survival
(p=0.001).
Laboratory findings are summarized in Table 3. High serum
LDH levels were correlated significantly with poor survival
(p=0.000). There was a statistically significant relationship
Immunophenotype analysis of the skin biopsies showed that
24 (96%) patients had a CD3 + CD4 + CD8 − T-cell phenotype
and one (4%) patient had a double CD4 + CD8 + T-cell aberrant
phenotype. In most cases (88%), there was partial loss of one
or more pan-T-cell antigens. Loss of CD7 expression was seen in
22 (88%) patients.
CD30 positivity in more than 75% of all the large T cells was
present in skin biopsies of five patients (20%). In the remaining
20 (80%) cases, CD30 staining was either completely negative
or expressed by only a very few (<5%) large T cells. There was
no statistically significant difference either in disease stage or
treatment response among CD30-positive and CD30-negative
patients (p=0.290, p=0.630). Twelve patients with early (<2
years, n=3, 12%) and concurrent (n=9, 36%) transformation
were also evaluated separately for survival (p=0.582).
Advanced disease stage at the time of transformation correlated
with poor survival (p=0.003). In our study, among the deceased
patients, 80% had stage IV disease, whereas only 20% of
patients had stage IV disease among the surviving patients
(p=0.002). During follow-up, 10 patients died of disease-related
events (32%). Three (30%) of 10 patients who died in our
study had SS, and the other patients’ stages were as follows:
stage IIB (n=1, 10%), stage III (n=1, 10%), and stage IVA (n=5,
50%). The survival curve of the patients is presented in Figure
2. Mean survival time was 25.2±14.9 (2-56) months after
transformation.
Laboratory Findings
Flow cytometry of peripheral blood showed an increased ratio
of CD4/CD8 (>2) in 13 (52%) patients. The ratio was between
2 and 10 in ten (40%) patients and higher than 10 in three
(12%) patients. The patients’ disease stages and CD4/CD8
levels showed a statistically significant positive correlation
(p=0.038). Increased CD4+/CD26 cell ratio was significantly
Figure 1. Histopathologically confirmed transformed mycosis
fungoides (T-MF) lesions in different patients: extensive tumoral
lesions with anaplastic transformation on the trunk (a); resistant
tumoral lesion with loss of hair on eyebrow (b); refractory plaque
on forearm (c); erythrodermic patient with ichthyotic lesions on
legs, consistent with T-MF (d); postinflammatory hypopigmentary
areas from previous treated tumors and tumoral lesions with
anaplastic transformation (e); plaques and tumoral lesions on
gluteal region and legs of a patient receiving extracorporeal
photopheresis, interferon psoralen ultraviolet A, and bexarotene
(f).
Table 2. Clinical features of transformed mycosis fungoides patients.
Mean ± SD Median Minimum Maximum
Age at MF diagnosis, years 49±11.95 48 26 76
Age at T-MF diagnosis, years 53.68±12.06 50 30 78
MF to T-MF duration, months 67.9±62.6 32 0 192
Survival, months 25.2±14.9 23 2 56
MF: Mycosis fungoides, T-MF: transformed mycosis fungoides, SD: standard deviation.
38
Turk J Hematol 2018;35:35-41
Vural S, et al: Transformation of Mycosis Fungoides
between elevated serum LDH levels and advanced disease stage
(p=0.028). The disease stage and β2-microglobulin levels were
found to be positively correlated with Spearman’s test (p=0.026,
r=0.463). There was no statistically significant relationship
between β2-microglobulin levels and survival (p=0.125).
Figure 2. Kaplan-Meier survival curve: survival in months after
anaplastic transformation.
Table 3. Laboratory findings of transformed mycosis
fungoides patients.
Laboratory findings
n (%)
Normal
n (%)
High
Eosinophil count 21 (84) 4 (16)
LDH 14 (56) 11 (44)
β2-microglobulin 7 (28) 18 (72)
Peripheral blood
flow cytometry
CD4/CD8
<2 >10
11 (44) 3 (12)
CD26 loss 10 (40)* 13 (52)
CD7 loss 16 (64)** 9 (36)
*CD4+/CD7-, 40% or more, **CD4+/CD26-, 30% or more.
LDH: Lactate dehydrogenase.
Treatment
All patients received first-line therapy as a combination
treatment of two or more of the following: psoralen plus
ultraviolet, interferon-alpha, extracorporeal photopheresis,
vorinostat, bexarotene, retinoid, low-dose methotrexate, local
radiotherapy, or total skin electron beam radiotherapy. Of
the 18 (72%) patients showing PD with first-line treatment
modalities, 12 (48%) patients received either second- or thirdline
treatments. Of these 12 patients, six (48%) received secondline
treatments either for the induction of remission or in an
attempt to decrease tumor burden before allo-HSCT. Secondline
therapy included single-agent chemotherapy of either
gemcitabine or pralatrexate in 5 (20%) patients to decrease the
tumor burden before allo-HSCT. One patient had a lymph node
biopsy consistent with concomitant natural killer cell lymphoma
and received an Aurora A kinase inhibitor as second-line therapy
following five cycles of multiagent chemotherapy. All of the
patients’ treatment responses with second-line treatment were
evaluated as PD.
Seven (28%) patients received third-line therapy due to PD.
Additionally, three (12%) patients had received multiagent
chemotherapy before first- and second-line treatments before
admission to our center. In all patients, the treatment responses
of the third-line treatments were evaluated as PD.
Five (20%) patients with PD underwent allo-HSCT and CR was
achieved in 3 (60%) of them after the procedure. Two patients’
disease recurred 2 and three months after allo-HSCT, and these
two patients died 9 and 11 months following transplantation,
respectively. One patient in follow-up with complete remission
died 24 months after allo-HSCT due to sepsis. Autologous
stem cell transplantation was performed in one patient in 2000,
and the patient died four months after the procedure due to
disease progression. The outcome of patients with HSCT is given
in Table 4.
Table 4. Clinical features and treatment results of the patients who had undergone allogeneic hematopoietic stem cell
transplantation.
Type Age Sex Stage
HSCT/HLA
mismatch
Conditioning
regimen
Follow-up after allo-
HSCT
Treatment response at last
follow-up
1 Allo-HSCT 33 M IVA 10/10 RIC (Flu+Cy+TBI) 21 months CR
2 Allo-HSCT 49 M IVA 10/10 RIC (Flu+Cy+TBI) 41 months CR
3 Allo-HSCT 48 M IIB** 10/10 RIC (Flu+Cy+TBI) 24 months CR*
4 Allo-HSCT 59 F IVA 9/10 MA (Cy+TBI) 7 months Exitus (refractory)
5 Allo-HSCT 60 M IVA 9/10 RIC (Flu+Cy+TBI) 11 months Exitus (refractory)
6 Autologous 63 M III NA - 4 months Exitus (refractory)
*Patient died due to sepsis without recurrence, **The patient’s stage was IIB at the time of transformation and progressed to stage IVA during follow-up.
Allo-HSCT: Allogeneic hematopoietic stem cell transplantation, HSCT: hematopoietic stem cell transplantation, HLA: human leukocyte antigen, CR: complete response.
39
Vural S, et al: Transformation of Mycosis Fungoides Turk J Hematol 2018;35:35-41
Discussion
LCT of MF can occur at any stage of MF, and it has been
associated with disease progression and poor outcome.
Unfavorable prognostic factors for T-MF have been reported
previously as advanced stage, presentation of MF with
transformation, generalized skin tumors, increased LDH level,
and use of combination chemotherapy [5,15]. CD30 expression
in less than 10% of skin lesions is one of the poor prognostic
factors [5,6,8,15]. On the other hand, in this study, high serum
LDH levels, loss of CD26 expression of more than 30% in
peripheral blood, and loss of CD7 expression were associated
with poor survival among T-MF patients.
LCT at initial diagnosis of MF or within two years
has been associated with worse prognosis in several
studies [3,5,16,17,18]. However, in some studies, including ours,
the prognostic significance of early transformation was not
validated [19]. Mean time between MF and T-MF diagnosis varies
from 44 months to 6.5 years in reported studies [2,7,17,19]. In
our study, this period was determined as 32 months.
In previous studies, LCT of MF has been reported mainly in
advanced disease. In a series with 22 T-MF patients, Arulogun
et al. [17] reported that only 1.4% of early-stage MF patients
developed T-MF, whereas this rate was more than 25% in stage
2B patients and more than 50% in stage 4 patients. Consistent
with this study, LCT of MF was detected in 8% of cases in the
early stage in our series. MF is a slowly progressive CTCL with
an excellent prognosis, especially in early-stage disease. In
the case of transformation, the prognosis of early-stage MF
deteriorates significantly [20]. Still, previous studies have shown
that patients with early (stage I-IIA) LCT have longer survival
compared with patients with LCT in advanced disease (stage
IIB-IV) [5]. Likewise, in our study, advanced disease stage at the
time of transformation was significantly correlated with shorter
survival. In different studies, extracutaneous disease (stage IV)
was shown to be associated with poor prognosis [2,19]. In our
study, a significant majority of the patients who died had stage
IV MF. The mean survival time after LCT has been reported to
be in the range of 2 to 36 months [2,3,4,5,7,9,10,17,19]. In our
study, the mean survival time of the ten patients who died was
determined as 25.2±14.9 (2-56) months.
Transformed folliculotropic MF patients were previously found
to have shorter survival time [2,21,22]. In one previous study,
epidermotropism was detected in patients with LCT, although it
was less prominent or focal [3]. In our series epidermotropism
was present only in 60% of patients and it was less noticeable
in histopathological examinations.
According to a recent study, several clinical characteristics such
as a new solitary nodule on MF plaques or rapidly presenting
scattered papules may be indicators of the development of
LCT for dermatologists [15]. We would like to emphasize that
transformation was also observed in treatment-refractory
long-standing tumoral and plaque lesions, and in a patient
with ichthyosiform erythroderma. For this reason, in addition
to the cautionary skin findings mentioned before, reevaluation
of treatment-resistant and unexpected lesions, especially in
advanced-stage patients, is recommended.
The treatment strategy is challenging in T-MF. It is important to
note that, among our patients with advanced stages of T-MF,
none had a CR to treatment under first-line therapies. Among
patients receiving first-line therapy, 20% had either SD or PR
with these therapies. Notably, all the patients who received
second- and third-line therapies had PD. This finding highlights
the refractory nature of T-MF. In fact, aggressive treatment
strategies and multiple chemotherapies for MF result in a short
period of CR, followed by an aggressive relapse [13]. Allo-HSCT
is an emerging effective therapy in MF/SS, demonstrating a
decrease in the relapse rate and an overall increase in diseasefree
survival. It was reported that one year after allo-HSCT,
42% of patients remained in remission [23]. In our series, 60%
of patients were in remission one year after transplantation.
Transplant-related mortality and infections are significant
factors decreasing the success rate of allo-HSCT. However, in
selected patients with T-MF, allo-HSCT increases disease-free
survival and thus the quality of life.
Study Limitations
A limitation of the present study was the small number of
patients with T-MF, highlighting the rarity of MF/SS. A second
limitation was the retrospective design of the study, which may
have restricted retrieval of the data from patient archives.
Conclusion
Unfavorable prognostic factors in T-MF include advanced stage,
high serum LDH levels, and loss of CD7 and CD26 expression in
T helper cells. In patients with treatment-refractory tumors and
unusual lesions, a biopsy is warranted to exclude T-MF. Patients
with T-MF have a short life expectancy. Patients may have CR,
PR, or SD with first-line treatments, which underlines the value
of less aggressive therapies. However, nonresponders usually do
not respond to second- or third-line therapies. Allo-HSCT may
be an alternative option for patients with T-MF.
Ethics
Ethics Committee Approval: Ankara University Faculty of
Medicine Ethical Comittee (09/01/2017 number: 01-05-17).
Informed Consent: Retrospective study
40
Turk J Hematol 2018;35:35-41
Vural S, et al: Transformation of Mycosis Fungoides
Authorship Contributions
Medical Practices: E.A., S.V., B.N.A., H.Ş., N.P., A.O.H.;
Concept: B.N.A., H.Ş.; Design: S.V., A.B.; Data Collection or
Processing: A.B., N.P., E.A., S.V.; Analysis or Interpretation: A.B.,
S.V., B.N.A., H.Ş.; Literature Search: A.B., S.V.; Writing: S.V., A.B.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Willemze R, Jaffe ES, Burg G, Cerroni L, Berti E, Swerdlow SH, Ralfkiaer
E, Chimenti S, Diaz-Perez JL, Duncan LM, Grange F, Harris NL, Kempf W,
Kerl H, Kurrer M, Knobler R, Pimpinelli N, Sander C, Santucci M, Sterry W,
Vermeer MH, Wechsler J, Whittaker S, Meijer CJ. WHO-EORTC classification
for cutaneous lymphomas. Blood 2005;105:3768-3785.
2. Benner MF, Jansen PM, Vermeer MH, Willemze R. Prognostic factors in
transformed mycosis fungoides: a retrospective analysis of 100 cases. Blood
2012;119:1643-1649.
3. Salhany KE, Cousar JB, Greer JP, Casey TT, Fields JP, Collins RD. Transformation
of cutaneous T cell lymphoma to large cell lymphoma. A clinicopathologic
and immunologic study. Am J Pathol 1988;132:265-277.
4. Wolfe JT, Chooback L, Finn DT, Jaworsky C, Rook AH, Lessin SR. Large-cell
transformation following detection of minimal residual disease in cutaneous
T-cell lymphoma: molecular and in situ analysis of a single neoplastic T-cell
clone expressing the identical T-cell receptor. J Clin Oncol 1995;13:1751-
1757.
5. Diamandidou E, Colome-Grimmer M, Fayad L, Duvic M, Kurzrock
R. Transformation of mycosis fungoides/Sezary syndrome: clinical
characteristics and prognosis. Blood 1998;92:1150-1159.
6. Talpur R, Jones DM, Alencar AJ, Apisarnthanarax N, Herne KL, Yang Y, Duvic
M. CD25 expression is correlated with histological grade and response
to denileukin diftitox in cutaneous T-cell lymphoma. J Invest Dermatol
2006;126:575-583.
7. Barberio E, Thomas L, Skowron F, Balme B, Dalle S. Transformed mycosis
fungoides: clinicopathological features and outcome. Br J Dermatol
2007;157:284-289.
8. Greisser J, Doebbeling U, Roos M, Mueller B, Schmid M, Burg G, Kadin ME,
Kempf W. Apoptosis in CD30-positive lymphoproliferative disorders of the
skin. Exp Dermatol 2005;14:380-385.
9. Dmitrovsky E, Matthews MJ, Bunn PA, Schechter GP, Makuch RW, Winkler
CF, Eddy J, Sausville EA, Ihde DC. Cytologic transformation in cutaneous T
cell lymphoma: a clinicopathologic entity associated with poor prognosis. J
Clin Oncol 1987;5:208-215.
10. Greer JP, Salhany KE, Cousar JB, Fields JP, King LE, Graber SE, Flexner JM,
Stein RS, Collins RD. Clinical features associated with transformation
of cerebriform T-cell lymphoma to a large cell process. Hematol Oncol
1990;8:215-227.
11. Cerroni L, Rieger E, Hodl S, Kerl H. Clinicopathologic and immunologic
features associated with transformation of mycosis fungoides to large-cell
lymphoma. Am J Surg Pathol 1992;16:543-552.
12. Olsen E, Vonderheid E, Pimpinelli N, Willemze R, Kim Y, Knobler R, Zackheim
H, Duvic M, Estrach T, Lamberg S, Wood G, Dummer R, Ranki A, Burg G,
Heald P, Pittelkow M, Bernengo MG, Sterry W, Laroche L, Trautinger F,
Whittaker S, ISCL/EORTC. Revisions to the staging and classification of
mycosis fungoides and Sezary syndrome: a proposal of the International
Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphoma
task force of the European Organization of Research and Treatment of
Cancer (EORTC). Blood 2007;110:1713-1722.
13. Alberti-Violetti S, Talpur R, Schlichte M, Sui D, Duvic M. Advancedstage
mycosis fungoides and Sezary syndrome: survival and response to
treatment. Clin Lymphoma Myeloma Leuk 2015;15:105-112.
14. National Comprehensive Cancer Network. NCCN Clinical Practice Guidelines
in Oncology. Fort Washington, NCCN, 2017. Available online at https://
www.nccn.org/professionals/physician_gls/f_guidelines.asp.
15. Talpur R, Sui D, Gangar P, Dabaja BS, Duvic M. Retrospective analysis of
prognostic factors in 187 cases of transformed mycosis fungoides. Clin
Lymphoma Myeloma Leuk 2016;16:49-56.
16. Diamandidou E, Colome M, Fayad L, Duvic M, Kurzrock R. Prognostic factor
analysis in mycosis fungoides/Sezary syndrome. J Am Acad Dermatol
1999;40:914-924.
17. Arulogun SO, Prince HM, Ng J, Lade S, Ryan GF, Blewitt O, McCormack C.
Long-term outcomes of patients with advanced-stage cutaneous T-cell
lymphoma and large cell transformation. Blood 2008;112:3082-3087.
18. Scarisbrick JJ, Prince HM, Vermeer MH, Quaglino P, Horwitz S, Porcu P,
Stadler R, Wood GS, Beylot-Barry M, Pham-Ledard A, Foss F, Girardi M,
Bagot M, Michel L, Battistella M, Guitart J, Kuzel TM, Martinez-Escala ME,
Estrach T, Papadavid E, Antoniou C, Rigopoulos D, Nikolaou V, Sugaya M,
Miyagaki T, Gniadecki R, Sanches JA, Cury-Martins J, Miyashiro D, Servitje
O, Muniesa C, Berti E, Onida F, Corti L, Hodak E, Amitay-Laish I, Ortiz-
Romero PL, Rodríguez-Peralto JL, Knobler R, Porkert S, Bauer W, Pimpinelli
N, Grandi V, Cowan R, Rook A, Kim E, Pileri A, Patrizi A, Pujol RM, Wong H,
Tyler K, Stranzenbach R, Querfeld C, Fava P, Maule M, Willemze R, Evison F,
Morris S, Twigger R, Talpur R, Kim J, Ognibene G, Li S, Tavallaee M, Hoppe
RT, Duvic M, Whittaker SJ, Kim YH. Cutaneous Lymphoma International
Consortium study of outcome in advanced stages of mycosis fungoides
and Sezary syndrome: effect of specific prognostic markers on survival and
development of a prognostic model. J Clin Oncol 2015;33:3766-3773.
19. Vergier B, de Muret A, Beylot-Barry M, Vaillant L, Ekouevi D, Chene G,
Carlotti A, Franck N, Dechelotte P, Souteyrand P, Courville P, Joly P,
Delaunay M, Bagot M, Grange F, Fraitag S, Bosq J, Petrella T, Durlach A, De
Mascarel A, Merlio JP, Wechsler J. Transformation of mycosis fungoides:
clinicopathological and prognostic features of 45 cases. French Study
Group of Cutaneous Lymphomas. Blood 2000;95:2212-2218.
20. Herrmann JL, Hughey LC. Recognizing large-cell transformation of mycosis
fungoides. J Am Acad Dermatol 2012;67:665-672.
21. Agar NS, Wedgeworth E, Crichton S, Mitchell TJ, Cox M, Ferreira S, Robson
A, Calonje E, Stefanato CM, Wain EM, Wilkins B, Fields PA, Dean A, Webb
K, Scarisbrick J, Morris S, Whittaker SJ. Survival outcomes and prognostic
factors in mycosis fungoides/Sezary syndrome: validation of the revised
International Society for Cutaneous Lymphomas/European Organisation
for Research and Treatment of Cancer staging proposal. J Clin Oncol
2010;28:4730-4739.
22. van Doorn R, Van Haselen CW, van Voorst Vader PC, Geerts ML, Heule F,
de Rie M, Steijlen PM, Dekker SK, van Vloten WA, Willemze R. Mycosis
fungoides: disease evolution and prognosis of 309 Dutch patients. Arch
Dermatol 2000;136:504-510.
23. Duarte RF, Canals C, Onida F, Gabriel IH, Arranz R, Arcese W, Ferrant A,
Kobbe G, Narni F, Deliliers GL, Olavarria E, Schmitz N, Sureda A. Allogeneic
hematopoietic cell transplantation for patients with mycosis fungoides and
Sezary syndrome: a retrospective analysis of the Lymphoma Working Party
of the European Group for Blood and Marrow Transplantation. J Clin Oncol
2010;28:4492-4499.
41
RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0498
Turk J Hematol 2018;35:42-48
The Effect of Bone Marrow Mesenchymal Stem Cells on the
Granulocytic Differentiation of HL-60 Cells
Kemik İliği Mezankimal Hücrelerinin HL-60 Hücrelerindeki Granülositik Farklılaşması
Üzerine Etkisi
Hossein Nikkhah 1 , Elham Safarzadeh 2,3 , Karim Shamsasenjan 1 , Mehdi Yousefi 2,3 , Parisa Lotfinejad 1,3 , Mehdi Talebi 1 ,
Mozhde Mohammadian 4 , Farhoud Golafshan 5 , Aliakbar Movassaghpour 1
1
Tabriz University Faculty of Medicine, Hematology and Oncology Research Center, Tabriz, Iran
2
Tabriz University Faculty of Medicine, Drug Applied Research Center, Tabriz, Iran
3
Tabriz University Faculty of Medicine, Department of Immunology, Tabriz, Iran
4
Mazandaran University Faculty of Medicine, Amol Faculty of Paramedical Sciences, Sari, Iran
5
Hamline University Faculty of Medicine, Department of Biology, Minnesota, USA
Abstract
Objective: Mesenchymal stem cells (MSCs) are multipotent stromal
cells that can differentiate into a variety of cell types. They control the
process of hematopoiesis by secreting regulatory cytokines and growth
factors and by the expression of important cell adhesion molecules for
cell-to-cell interactions. This investigation was intended to examine
the effect of bone marrow (BM)-derived MSCs on the differentiation
of HL-60 cells according to morphological evaluation, flow cytometry
analysis, and gene expression profile.
Materials and Methods: The BM-MSCs were cultured in Dulbecco’s
modified Eagle’s medium supplemented with 10% fetal bovine serum
(FBS). After the third passage, the BM-MSCs were irradiated at 30
Gy. To compare how the HL-60 cells differentiated in groups treated
differently, HL-60 cells were cultured in RPMI-1640 and supplemented
with 10% FBS. The HL-60 cells were seeded into six-well culture
plates and treated with all-trans-retinoic acid (ATRA), BM-MSCs, or
BM-MSCs in combination with ATRA, while one well remained as
untreated HL-60 cells. The expression levels of the granulocyte subsetspecific
genes in the HL-60 cells were assayed by real-time polymerase
chain reaction.
Results: Our results revealed that BM-MSCs support the granulocytic
differentiation of the human promyelocytic leukemia cell line HL-60.
Conclusion: Based on the results of this study, we concluded that
BM-MSCs may be an effective resource in reducing or even preventing
ATRA’s side effects and may promote differentiation for short
medication periods. Though BM-MSCs are effective resources, more
complementary studies are necessary to improve this differentiation
mechanism in clinical cases.
Keywords: Mesenchymal stem cells, HL-60 cells, Differentiation, Alltrans-retinoic
acid
Öz
Amaç: Mezankimal kök hücreler (MKH) birçok hücre tipine göre
farklılaşabilen multipotent stromal hücrelerdir. Hematopoez sürecini
düzenleyici sitokinler ve büyüme faktörleri salınımı ile ve hücreler arası
etkileşim için önemli hücresel adezyon moleküllerinin ifadesi yoluyla
kontrol ederler. Bu çalışma da kemik iliği (Kİ) kaynaklı MKH HL-60
hücrelerinin farklılaşması üzerine etkisini morfolojik değerlendirme,
akım sitometri ve gen ifade analizi yöntemleriyle araştırılması
amaçlanmıştır.
Gereç ve Yöntemler: Kİ-MKH %10 fetal sığır serumu (FSS) içeren
Dulbecco’nun modifiye Eagle ortamında kültür edildi. Üçüncü
pasaj sonrası, Kİ-MKH 30 Gy ile ışınlandı. HL-60 hücrelerinin farklı
şartlarda nasıl farklılaştığını karşılaştırmak için HL-60 hücreler %10
FSS eklenmiş RPMI-1640 ortamında kültür edildi. HL-60 hücreleri altı
kuyucuklu plaklarda all-trans retinoik asit (ATRA), Kİ-MKH ve ATRA
ile birlikte Kİ-MKH ile muamele edilirken, bir kuyucuğa sadece HL-
60 hücreleri kondu. HL-60 hücrelerinde granülosit alt gruplarına özgü
genlerin ifade düzeyleri gerçek zamanlı polimeraz zincir reaksiyonu ile
değerlendirildi.
Bulgular: Sonuçlarımız Kİ-MKH’nin insan promiyelositik lösemi hücre
dizisi HL-60’ın granülositik farklılaşmasını desteklediğini gösterdi.
Sonuç: Bu çalışmanın bulgularına göre, Kİ-MKH’nin ATRA yan etkilerini
azaltıcı ve hatta önleyici etkili bir kaynak olduğu ve kısa ilaç kullanımı
süreçlerinde farklılaşmayı uyarabileceği sonucunu çıkarttık. Kİ-MKH
etkili bir kaynak olsa da, klinik olgularda bu farklılaşma mekanizmasını
iyileştirmek için destekleyici ek çalışmalara ihtiyaç vardır.
Anahtar Sözcükler: Mezankimal kök hücreler, HL-60 hücreleri,
Farklılaşma, All-trans retinoik asit
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Ali Akbar MOVASSAGHPOUR, M.D.,
Tabriz University Faculty of Medicine, Hematology and Oncology Research Center, Tabriz, Iran
Phone : +984 133 343 888
E-mail : movassaghpour@tbzmed.ac.ir ORCID-ID: orcid.org/0000-0002-6990-9260
Received/Geliş tarihi: December 27, 2016
Accepted/Kabul tarihi: June 12, 2017
42
Turk J Hematol 2018;35:42-48
Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation
Introduction
There are different cell types of the osteoblast lineage in bone
and the bone marrow, the most primitive of them being the
mesenchymal stem cells (MSCs) [1,2]. MSCs can differentiate into
several types of cells and produce important growth factors and
cytokines [3,4]. MSCs are defined by the International Society
of Cellular Therapy based on three properties: the adherence to
plastic in standard culture; the expression of CD105, CD73, and
CD90 and lack of expression of CD45, CD34, CD14 or CD11b,
CD79α or CD19, and HLA class II; and differentiation potential
into osteocytes, adipocytes, and chondrocytes [5,6]. These cells
are involved in the regulation of hematopoietic precursor cell
proliferation and differentiation [7,8].
All-trans-retinoic acid (ATRA) has a potential role in treating
acute myeloid leukemia (AML) and some hematological
disorders [9]. It has been recognized that ATRA induces the
differentiation of myeloid leukemic cells through growth
inhibition [10]. Many studies have reported severe adverse
effects of ATRA. Therefore, novel therapeutic strategies need
to be developed to decrease ATRA’s potential side effects and
enhance the efficacy of this drug. One possible approach is the
use of ATRA-based combinations that are more efficient than
the single components [11,12,13]. The roles of the various cells
in the bone marrow niche are unclear in the differentiation of
hematopoietic stem cells, and MSCs, as the precursors of the
cellular components, are important cells of the bone marrow
niche [14]. To understand the precise interaction between MSCs
and leukemic cells, in the current study we investigated whether
MSCs affect the differentiation of HL-60 cells.
Materials and Methods
Cell Culture
Human promyelocytic leukemia cell line HL-60 (a kind gift
from Dr. Abroun, Tarbiat Modares University, Tehran, Iran)
was cultured in RPMI-1640 medium (Sigma-Aldrich, St.
Louis, MO, USA) supplemented with 10% fetal bovine serum
(HyClone, Logan, UT, USA), 100 U/mL penicillin, and 100 µg/mL
streptomycin (Sigma, St. Louis, MO, USA). The BM-MSCs (Stem
Cell Technology, Tehran, Iran) were cultured in low-glucose
Dulbecco’s modified Eagle medium (GIBCO BRL, Gaithersburg
MD, USA) containing 10% fetal bovine serum.
Co-culture Experiments
HL-60 cells (10 5 cells/mL) were seeded onto plates and treated
with ATRA at a concentration of 5x10 -7 M (Sigma-Aldrich) for
48 h. The co-culture experiments were performed in six-well
plates including the HL-60 cells treated with BM-MSCs or those
treated with BM-MSCs and 5x10 -7 M ATRA together. Before coculturing
with cancer cells, the BM-MSCs were irradiated at 30
Gy when they reached 60% confluence. The HL-60 cells came
into direct contact with the BM-MSCs.
Morphological Study of Differentiated Granulocyte Cells
To study the morphological changes, the HL-60 cells were
treated with ATRA, BM-MSCs, or a combination of ATRA and
BM-MSCs. After 48 h of incubation, the cells were stained with
Wright-Giemsa stain and studied by light microscope.
Flow Cytometric Assessment of Granulocytic Markers for
Differentiation
The HL-60 cells (1x10 6 ) of the different groups, the co-culture
of the HL-60 cells with BM-MSCs, the HL-60 cells with BM-
MSCs and ATRA in combination, the HL-60 cells with ATRA as
a positive control, and the HL-60 cells without additions as a
negative control were harvested and incubated with FITClabeled
anti-CD11b (Becton Dickinson, San Jose, CA, USA) for 30
min at 4 °C. The cells were then analyzed for the evaluation of
CD11b expression (a myeloid differentiation marker) with a flow
cytometer (Becton Dickinson).
Real-Time Polymerase Chain Reaction
The expression of the granulocyte subset-specific genes in the
treated HL-60 cells was investigated by real-time polymerase
chain reaction (RT-PCR) after an incubation period of 48 h.
Total RNA was extracted using the QIAzol lysis reagent (QIAGEN,
Germantown, MD, USA) according to the manufacturer’s
instructions. The cDNA was prepared according to the
instructions of the Revert Aid Single Strand Kit (Fermentas,
Burlington, ON, Canada). The mRNA levels of PU.1, CD11b,
lysozyme, C/EBP-ALPHA, C/EBP-BETA, C/EBP E, MPO, CD64,
CD16, GCSFR, and cathepsin G were analyzed using qRT-PCR.
The GAPDH gene was used as an internal control (Table 1).
Statistical Analysis
Data were reported as mean ± standard deviation and were
analyzed using Graph Pad Prism v 5.00 (Graph Pad Software, Inc.,
La Jolla, CA, USA). Student’s t-test for single comparisons and twoway
ANOVA for multigroup comparisons were used for analysis
and p<0.01 was regarded as denoting statistical significance.
Results
Flow Cytometry Confirmation of the Nature of the BM-MSCs
To verify the mesenchymal nature of the BM-MSCs, the surface
antigens were assessed by flow cytometry, including CD14,
CD19, CD34, CD45 CD90, CD105, and CD73. The characterization
experiments performed in our study demonstrated that the
BM-MSCs were negative in the expression of the hematopoietic
markers for CD14, CD19, CD34, and CD45, and they had positive
expression for CD90, CD105, and CD73 markers (Figure 1).
43
Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation
Turk J Hematol 2018;35:42-48
Table 1. Primers for real-time polymerase chain reaction.
Gene name Forward primer Reverse primer
PU.1 GACACGGATCTATACCAACGCC CCGTGAAGTTGTTCTCGGCGAA
CD11b GGAACGCCATTGTCTGCTTTCG ATGCTGAGGTCATCCTGGCAGA
Lysozyme ACTACAATGCTGGAGACAGAAGC GCACAAGCTACAGCATCAGCGA
C/EBP-α AGGAGGATGAAGCCAAGCAGCT AGTGCGCGATCTGGAACTGCAG
C/EBP-β AGAAGACCGTGGACAAGCACAG CTCCAGGACCTTGTGCTGCGT
C/EBP E CCAGCCTCTGCGCGTTCTCAA CAAGGCTATCTTTGTTCACTGCC
MPO GAGCAGGACAAATACCGCACCA AGAGAAGCCGTCCTCATACTCC
CD16 GGTGACTTGTCCACTCCAGTGT ACCATTGAGGCTCCAGGAACAC
GCSFR CCACTACACCATCTTCTGGACC GGTGGATGTGATACAGACTGGC
Cathepsin G CGACAGTACCATTGAGTTGTGCG TTCGTCCATAGGAGACAATGCCC
MPO: Myeloperoxidase.
Figure 1. Flow cytometry analysis confirmed the mesenchymal nature of the bone marrow mesenchymal stem cells. The markers assessed
by flow cytometry included CD14, CD19, CD34, CD45 CD90, CD105, and CD73. The experiments were done in triplicate.
Morphological Changes of the Treated Cells
To assess the morphological changes in the treated HL-60 cells,
Wright-Giemsa staining was performed (Figures 2A-2D). The
comparative study of the morphological changes in the HL-60
cells stained by Wright-Giemsa indicated that, in comparison to
the control, the cells treated with ATRA and BM-MSCs individually
had induced granulocytic differentiation of the HL-60 cells
(Figures 2B and 2C) and showed an additive effect when used
with BM-MSCs in combination with ATRA (Figure 2D). While the
control cells (Figure 2A) demonstrated typical morphology in the
promyelocytic cells (a circular nucleus), the treated HL-60 cells
exhibited a kidney-shaped nucleus and segmented nucleus and
also had a reduced nuclear/cytoplasmic ratio.
44
Turk J Hematol 2018;35:42-48
Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation
CD11b Expression Increased in Treated HL-60 Cells
In the treated HL-60 cells, an increase was observed in the
percentage of CD11b marker expression, one of the main
granulocytic differentiation markers measured by flow
cytometry, after 48 h. Flow cytometry results displayed that
the expression of the CD11b marker was 17.12%, 76.69%,
23.96%, and 96.4% in the untreated HL-60 cells, in the HL-60
cells treated with ATRA, in the HL-60 cells treated with BM-
MSCs, and in the HL-60 cells treated with a combination of
BM-MSCs and ATRA, respectively (Figure 3). The expression of
CD11b significantly increased in the HL-60 cells treated with
the combination of BM-MSCs and ATRA compared to the HL-60
cells treated with ATRA alone or with BM-MSCs alone.
Effects of BM-MSCs and ATRA on Gene Expression in HLA-60
Cells
In the ATRA-treated HL-60 cells, there was a marked increase
(p<0.05) in the gene expressions of CD11b, lysozyme, GCSFR,
CD64, PU.1, and C/EBP-ALPHA from 1.00 to 8.33 (±0.07), 5.53
(±0.16), 3.36 (±0.12), 1.94 (±0.02), 1.26 (±0.04), and 1.11 (±0.02),
respectively. There was no gene expression for C/EBP-BETA,
C/EBP E, or CD16 (Figure 4). On the other hand, as revealed in
Figure 4, in the HL-60 cells co-cultured with the BM-MSCs,
there was significant increase (p<0.05) in CD11b, lysozyme, PU.1,
CD64, and GCSFR expression levels from 1.00 to 2.2 (±0.07), 3.3
(±0.16), 1.23 (±0.02), 1.11 (±0.02), and 1.51 (±0.12), respectively,
and there was no expression of C/EBP-BETA, C/EBP E, or CD16
levels. In the HL-60 cells co-cultured with the combination of
BM-MSCs and ATRA, the gene expression of CD11b, lysozyme,
CD64, GCSFR, C/EBP-ALPHA, and PU.1 was markedly increased
(p<0.05) from 1.00 to 12.26 (±0.07), 7.19 (±0.16), 1.92 (±0.02),
4.77 (±0.12), 1.31(±0.02), and 1.18 (±0.04), respectively. There was
no expression for C/EBP-BETA, C/EBP E, or CD16 (Figure 4). The
myeloid differentiation was characterized by downregulation of
myeloperoxidase (MPO), a major protein expressed in myeloid
cells. We assessed the mRNA level of MPO by RT-PCR after 48 h
of treatment. The BM-MSCs, like ATRA, tended to decrease the
MPO transcription (Figure 4).
Discussion
MSCs can support hematopoiesis by producing soluble factor(s)
and also by the expression of cell adhesion molecules that are
important for cell-to-cell interaction [15]. MSCs have been the
subject of particular interest in recent years due their great
potential for treating various diseases, especially those related
to immune system disorders. However, there are controversial
opinions on the role of MSCs in malignancies [16,17,18,19].
In recent years, several groups investigated the possible role of MSCs
in influencing the behavior of tumor cells [20,21]. These studies
Figure 2. BM-MSCs induced the granulocytic differentiation
of HL-60 cells after 48 h of incubation and showed an additive
effect with all-trans-retinoic acid (ATRA). The differentiation
of the HL-60 cells was assessed by Wright-Giemsa staining:
a) untreated HL-60 cells, b) HL-60 cells treated with ATRA, c) HL-
60 cells treated with bone marrow mesenchymal stem cells, d)
HL-60 cells treated with ATRA and BM-MSCs. Magnitude: 100 x .
Figure 3. The flow cytometric analysis of CD11b, a granulocytic
differentiation marker, after 48 h: a) untreated HL-60 cells, b) HL-
60 cells treated with BM-MSCs, c) HL-60 cells co-cultured with
all-trans-retinoic acid (ATRA), d) HL-60 cells treated with BM-
MSCs and ATRA. BM-MSCs and ATRA synergistically upregulated
CD11b expression in cells treated with the combination of the
two. The experiments were done in triplicate.
45
Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation
Turk J Hematol 2018;35:42-48
Figure 4. Gene expression during differentiation of the HL-60 cells after 48 h: a) PU.1 gene expression, b) CD11b gene expression, c)
lysozyme gene expression, d) C/EBP-alpha gene expression, e) myeloperoxidase gene expression, f) CD64 gene expression, g) GCSFR gene
expression, h) cathepsin G gene expression. The experiments were performed in triplicate. *p<0.05.
MPO: Myeloperoxidase, ATRA: all-trans-retinoic acid.
mostly focused on the proliferation and apoptosis of cancer cells,
but little is known about the effect of MSCs in the differentiation
of leukemic cells [22]. It has been shown that substances such
as ursolic acid, 12-O-tetradecanoylphorbol 13-acetate, and
1,25-dihydroxyvitamin D3 [1,25(OH)2D3] inhibit the proliferation
of and promote the monocyte/macrophage differentiation of
AML HL-60 cells. A secosteroid, 1,25(OH)2D3 has a potential role
in the differentiation of the cells of the myeloid lineage in vitro
and ex vivo. This ability results in the use of 1,25(OH)2D3 to treat
myelodysplastic syndromes or AML. However, 1,25(OH)2D3 leads
to the partial differentiation of the hematopoietic blast cells and
hypercalcemia, which is a limiting factor in its clinical application
[23,24]. Differentiation therapy in APL patients with ATRA alone or
in combination with chemotherapy has made great breakthroughs
and results in high rates of complete clinical remission. However,
it has potentially fatal side effects, such as retinoic acid syndrome
and the development of resistance to this drug [13,25]. Repeated
treatment with ATRA results in progressive resistance that it is
attributed to the decrease of the ATRA serum level, which may
46
be caused by accelerated clearance [26]. The use of ATRA in
combination is one possible method to increase the therapeutic
efficacy of this drug. Therefore, increasing efforts have been
focused on developing alternative differentiation-promoting
therapeutic methods with fewer side effects [22]. MSCs possess
great advantages in research and clinical applications because of
their better expandability, sufficient supply, and painless collection
process [27].
Previous studies have shown that ATRA induces morphological
differentiation of HL-60 cells. The results from this study
indicated that ATRA, BM-MSCs, and ATRA in combination with
BM-MSCs promote the differentiation of HL-60 cells compared
to untreated cells. It should be added that the HL-60 cells
treated with both ATRA and BM-MSCs appeared more mature,
presenting band-form nuclei and segmented nuclei, compared
to cells treated with either ATRA or the BM-MSCs alone (Figure
2). Matching of the morphological and immunophenotypic data
is critical, so immunophenotypic evaluations were performed.
The proliferating HL-60 cells, in contrast to monocytes and
Turk J Hematol 2018;35:42-48
Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation
neutrophils, do not express the CD11b marker, the b-subunit
of integrin-aMb2 (also known as CD11b/CD18, MAC-1, or
CR3). It was demonstrated that most HL-60 cells, following
treatment with D3 (90% at 3-4 days) or ATRA (80% at 4-5
days), become CD11b-positive [28]. As shown in Figure 3, the
morphological data were further confirmed by the results of
the immunophenotyping of CD11b. After 48 h of treatment, the
expression of the CD11b marker in the HL-60 cells co-cultured
with BM-MSCs in combination with ATRA was higher than
that in the HL-60 cells co-cultured with BM-MSCs or ATRA
individually. Therefore, we concluded that BM-MSCs induce the
granulocytic differentiation of HL-60 cells.
Our data described the changes in the gene expression pattern
during the transformation of the proliferating HL-60 cells into
mature cells. One of the important factors that regulate the
differentiation of HSCs along the myeloid lineage towards
granulocytes rather than monocytes is CCAAT-enhancer
binding protein-alpha (C/EBP-ALPHA). Indeed, C/EBP alpha
knock-out mice demonstrate an early block in granulocytic
differentiation [29]. The results of this study indicate that the
BM-MSCs enhance ATRA’s effect on the amplification of C/EBP-
ALPHA transcription, but the BM-MSCs alone were upregulated
without statistical significance. Our data also showed that the
BM-MSCs and ATRA synergistically increased the expression of
the CD11b and lysozyme genes.
In this study, we found an increased level of gene expression
of PU.1 in the three groups of experiments compared to the
untreated cells. Interestingly, we observed no significant
synergistic effect in the HL-60 cells treated with ATRA in
combination with the BM-MSCs. PU.1 has a critical role in the
growth and development of hematopoietic cells. Several studies
reported that PU.1-deficient mice lack mature myeloid lineages
[30,31]. Uchino et al. [32] reported that the expression of the
G-CSF receptor, contrary to their hypotheses, was downregulated
after treatment with ATRA. The G-CSF receptor is present in the
progenitor cells in the bone marrow, which is involved in the
differentiation of the granulocytes through induction of G-CSF
[33]. In our study, ATRA upregulated the expression of the G-CSF
receptor gene and the use of the BM-MSCs in combination with
ATRA synergistically enhanced ATRA’s effect on the expression of
this gene, which may demonstrate the critical role of the G-CSF
receptor in the promotion of differentiation in promyelocytic
leukemia cells. Furthermore, in line with our hypothesis, the
treatment with ATRA downregulated the expression of the MPO
gene, but the BM-MSCs in combination with ATRA did not have
a synergistic effect on the expression of this gene.
Conclusion
Our results demonstrated that BM-MSCs could promote the
granulocytic differentiation of HL-60 cells and could elicit
an additive effect when used in combination with ATRA.
Consequently, our data highlight the critical role of BM-MSCs
in the granulocytic differentiation of HL-60 cells and the use of
BM-MSCs and ATRA in combination could be a novel therapeutic
strategy for AML patients.
Acknowledgments
We would like to acknowledge the support of the Shahid Ghazi
Hematology and Oncology Research Center and Hematology
and Oncology Laboratory, Tabriz University Faculty of Medicine.
We would also like to thank the Blood Transfusion Research
Center of Tabriz.
Ethics
Ethics Committee Approval: Tabriz University Faculty of
Medicine, approval number (IR.TBZMED.REC.8204).
Informed Consent: N/A.
Authorship Contributions
Concept: A.M.; Design: A.M., M.Y.; Cellular Analysis: H.N.;
Molecular Analysis: E.S.; Data Collection or Processing: M.M.,
Analysis or Interpretation: K.S.; Literature Search: M.T.;
Writing: P.L., F.G.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Kim YH, Yoon DS, Kim HO, Lee JW. Characterization of different
subpopulations from bone marrow-derived mesenchymal stromal cells by
alkaline phosphatase expression. Stem Cells Dev 2012;21:2958-2968.
2. Short B, Brouard N, Occhiodoro-Scott T, Ramakrishnan A, Simmons PJ.
Mesenchymal stem cells. Arch Med Res 2003;34:565-571.
3. Delorme B, Chateauvieux S, Charbord P. The concept of mesenchymal stem
cells. Regen Med 2006;1:497-509.
4. Beyer Nardi N, da Silva Meirelles L. Mesenchymal stem cells: isolation, in
vitro expansion and characterization. Handb Exp Pharmacol 2006:249-282.
5. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D,
Deans R, Keating A, Prockop DJ, Horwitz E. Minimal criteria for defining
multipotent mesenchymal stromal cells. The International Society for
Cellular Therapy position statement. Cytotherapy 2006;8:315-317.
6. Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini
FC, Deans RJ, Krause DS, Keating A; International Society for Cellular
Therapy. Clarification of the nomenclature for MSC: The International
Society for Cellular Therapy position statement. Cytotherapy 2005;7:393-
395.
7. Majumdar MK, Thiede MA, Haynesworth SE, Bruder SP, Gerson SL. Human
marrow-derived mesenchymal stem cells (MSCs) express hematopoietic
cytokines and support long-term hematopoiesis when differentiated toward
stromal and osteogenic lineages. J Hematother Stem Cell Res 2000;9:841-
848.
8. Dazzi F, Ramasamy R, Glennie S, Jones SP, Roberts I. The role of mesenchymal
stem cells in haemopoiesis. Blood Rev 2006;20:161-171.
47
Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation
Turk J Hematol 2018;35:42-48
9. Andreeff M, Jiang S, Zhang X, Konopleva M, Estrov Z, Snell VE, Xie Z, Okcu
MF, Sanchez-Williams G, Dong J, Estey EH, Champlin RC, Kornblau SM,
Reed JC, Zhao S. Expression of Bcl-2-related genes in normal and AML
progenitors: changes induced by chemotherapy and retinoic acid. Leukemia
1999;13:1881-1892.
10. Tarantilis PA, Morjani H, Polissiou M, Manfait M. Inhibition of growth
and induction of differentiation of promyelocytic leukemia (HL-60) by
carotenoids from Crocus sativus L. Anticancer Res 1994;14:1913-1918.
11. Fenaux P, Le Deley MC, Castaigne S, Archimbaud E, Chomienne C, Link H,
Guerci A, Duarte M, Daniel MT, Bowen D. Effect of all transretinoic acid in
newly diagnosed acute promyelocytic leukemia. Results of a multicenter
randomized trial. European APL 91 Group. Blood 1993;82:3241-3249.
12. Esser AC, Nossa R, Shoji T, Sapadin AN. All-trans-retinoic acid-induced
scrotal ulcerations in a patient with acute promyelocytic leukemia. J Am
Acad Dermatol 2000;43:316-317.
13. Frankel SR, Eardley A, Lauwers G, Weiss M, Warrell RP Jr. The retinoic acid
syndrome in acute promyelocytic leukemia. Ann Intern Med 1992;117:292-
296.
14. Molaeipour Z, Shamsasanjan K, Movassaghpour AA, Akbarzadehlaleh P,
Sabaghi F, Saleh M. The effect of bone marrow mesenchymal stem cells on
vitamin D 3
induced monocytic differentiation of U937 cells. Adv Pharm Bull
2016;6:23-29.
15. Smirnov SV, Harbacheuski R, Lewis-Antes A, Zhu H, Rameshwar P,
Kotenko SV. Bone-marrow-derived mesenchymal stem cells as a target for
cytomegalovirus infection: implications for hematopoiesis, self-renewal
and differentiation potential. Virology 2007;360:6-16.
16. Rhee KJ, Lee JI, Eom YW. Mesenchymal stem cell-mediated effects of tumor
support or suppression. Int J Mol Sci 2015;16:30015-30033.
17. Tocci A, Forte L. Mesenchymal stem cell: use and perspectives. Hematol J
2003;4:92-96.
18. Porada CD, Almeida-Porada G. Mesenchymal stem cells as therapeutics and
vehicles for gene and drug delivery. Adv Drug Deliv Rev 2010;62:1156-1166.
19. Uccelli A, Moretta L, Pistoia V. Mesenchymal stem cells in health and
disease. Nat Rev Immunol 2008;8:726-736.
20. Ramasamy R, Lam EW, Soeiro I, Tisato V, Bonnet D, Dazzi F. Mesenchymal
stem cells inhibit proliferation and apoptosis of tumor cells: impact on in
vivo tumor growth. Leukemia 2007;21:304-310.
21. Dasari VR, Velpula KK, Kaur K, Fassett D, Klopfenstein JD, Dinh DH, Gujrati
M, Rao JS. Cord blood stem cell-mediated induction of apoptosis in glioma
downregulates X-linked inhibitor of apoptosis protein (XIAP). PLoS One
2010;5:e11813.
22. Chen F, Zhou K, Zhang L, Ma F, Chen D, Cui J, Feng X, Yang S, Chi Y, Han Z, Xue
F, Rong L, Ge M, Wan L, Xu S, Du W, Lu S, Ren H, Han Z. Mesenchymal stem
cells induce granulocytic differentiation of acute promyelocytic leukemic
cells via IL-6 and MEK/ERK pathways. Stem Cells Dev 2013;22:1955-1967.
23. White SL, Belov L, Barber N, Hodgkin PD, Christopherson RI.
Immunophenotypic changes induced on human HL60 leukaemia cells by
1α,25-dihydroxyvitamin D 3
and 12-O-tetradecanoyl phorbol-13-acetate.
Leuk Res 2005;29:1141-1151.
24. Zhang T, He YM, Wang JS, Shen J, Xing YY, Xi T. Ursolic acid induces HL60
monocytic differentiation and upregulates C/EBPβ expression by ERK
pathway activation. Anticancer Drugs 2011;22:158-165.
25. Gallagher RE. Retinoic acid resistance in acute promyelocytic leukemia.
Leukemia 2002;16:1940-1958.
26. Adamson PC, Boylan JF, Balis FM, Murphy RF, Godwin KA, Gudas LJ, Poplack
DG. Time course of induction of metabolism of all-trans-retinoic acid and
the up-regulation of cellular retinoic acid-binding protein. Cancer Res
1993;53:472-476.
27. Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineage
differentiation potential of human mesenchymal stem cells derived from
umbilical cord and bone marrow. Stem Cells 2007;25:1384-1392.
28. Drayson MT, Michell RH, Durham J, Brown G. Cell proliferation and CD11b
expression are controlled independently during HL60 cell differentiation
initiated by 1,25α-dihydroxyvitamin D 3
or all-trans-retinoic acid. Exp Cell
Res 2001;266:126-134.
29. Dahl R, Walsh JC, Lancki D, Laslo P, Iyer SR, Singh H, Simon MC. Regulation
of macrophage and neutrophil cell fates by the PU.1:C/EBP α
ratio and
granulocyte colony-stimulating factor. Nat Immunol 2003;4:1029-1036.
30. Scott EW, Simon MC, Anastasi J, Singh H. Requirement of transcription
factor PU.1 in the development of multiple hematopoietic lineages. Science
1994;265:1573-1577.
31. Moreau-Gachelin F, Wendling F, Molina T, Denis N, Titeux M, Grimber G,
Briand P, Vainchenker W, Tavitian A. Spi-1/PU.1 transgenic mice develop
multistep erythroleukemias. Mol Cell Bio 1996;16:2453-2463.
32. Uchino Y, Iriyama N, Hatta Y, Takei M. Granulocyte colony-stimulating factor
potentiates all-trans retinoic acid-induced granulocytic differentiation in
acute promyelocytic leukemia cell line HT93A. Cancer Cell Int 2015;15:30.
33. Zeidler C, Welte K. Kostmann syndrome and severe congenital neutropenia.
Semin Hematol 2002;39:82-88.
48
RESEARCH ARTICLE
DOI: 10.4274/tjh.2017.0095
Turk J Hematol 2018;35:49-53
NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison
of Three Techniques - Sanger Sequencing, Pyrosequencing, and
Real-Time Polymerase Chain Reaction
Akut Miyeloid Lösemide NPM1 Mutasyon Analizi: Üç Tekniğin Karşılaştırılması/Sanger
Dizileme, Pirodizileme ve Gerçek Zamanlı Polimeraz Zincir Reaksiyonu
Dushyant Kumar 1 , Anurag Mehta 2 , Manoj Kumar Panigrahi 1 , Sukanta Nath 1 , Kandarpa Kumar Saikia 1
1
Gauhati University Faculty of Medicine, Department of Bioengineering and Technology, Guwahati, India
2
Rajiv Gandhi Cancer Institute and Research Centre, New Delhi, India
Abstract
Objective: Nucleophosmin-1 (NPM1) mutations have prognostic
importance in acute myeloid leukemia (AML) patients with
intermediate-risk karyotype at diagnosis. Approximately 30% of newly
diagnosed cytogenetically normal AML (CN-AML) patients harbor the
NPM1 mutation in India. In this study we compared the efficiency of
three molecular techniques in detecting NPM1 mutation in peripheral
blood and bone marrow samples.
Materials and Methods: In a single-center cohort we analyzed
165 CN-AML bone marrow/peripheral blood samples for NPM1
mutation analysis. About 30% of the CN-AML samples revealed NPM1
mutations. For the detection, three methods were compared: Sanger
sequencing, pyrosequencing, and real-time polymerase chain reaction
(PCR).
Results: NPM1 exon 12 mutations were observed in 52 (31.51%) of all
CN-AML cases. The sensitivity of Sanger sequencing, pyrosequencing,
and real-time PCR was 80%, 90%, and 95%, whereas specificity
was 95%, 100%, and 100%, respectively. The minimum limit of
mutation detection was 20%-30% for Sanger sequencing, 1%-5% for
pyrosequencing, and 0.1%-1% for real-time PCR.
Conclusion: The sequencing method, which is the reference method,
has the lowest sensitivity and is sometimes difficult to interpret. Realtime
PCR is a highly sensitive method for mutation detection but
is limited for specific mutation types. In our study, pyrosequencing
emerged as the most suitable technique for the detection of NPM1
mutations on the basis of its easy interpretation and less timeconsuming
processes than Sanger sequencing.
Keywords: NPM1, Pyrosequencing, Acute myeloid leukemia, Mutation
analysis
Öz
Amaç: Nükleofosmin-1 (NPM1) mutasyonları tanı anında orta risk
akut miyeloid lösemi (AML) hastalarında prognostik öneme sahiptir.
Hindistan’da, yeni teşhis normal sitogenetiğe sahip AML (CN-AML)
hastalarının yaklaşık %30’u NPM1 pozitiftir. Bu çalışmada periferik kan
ve kemik iliği örneklerinde NPM1 mutasyonu saptamada kullanılan üç
moleküler tekniğin etkinliğini karşılaştırdık.
Gereç ve Yöntemler: Tek merkezli bu kohortta, 165 CN-AML kemik
iliği/periferik kan örneklerinde NPM1 mutasyon analizi yapıldı. CN-
AML örneklerinin yaklaşık %30’unda NPM1 mutasyonu saptandı.
Mutasyonun taranmasında üç yöntem karşılaştırıldı: Sanger dizileme,
pirodizileme, gerçek-zamanlı polimeraz zincir reaksiyonu (PCR).
Bulgular: Tüm CN-AML olgularının 52’sinde (%31,51) NPM1 exon12
mutasyonları gözlendi. Sanger dizileme, pirodizileme ve gerçek zamanlı
PCR’nin duyarlılıkları sırasıyla %80, %90 ve %95 iken, özgünlükleri
%95, %100 ve %100’dü. Mutasyonun saptanmasında minimum limit
Sanger dizileme yöntemi için %20-%30, pirodizilemede %1-5, ve
gerçek-zamanlı PCR için %0,1-%1 idi.
Sonuç: Referans yöntemi olan dizileme yöntemi, en düşük duyarlılığa
sahiptir ve bazen yorumlaması güçtür. Gerçek-zamanlı PCR mutasyon
saptamada yüksek duyarlılığa sahip bir yöntemdir fakat özel
mutasyon tipleri için sınırlıdır. Çalışmamızda, pirodizileme yönteminin
kolay yorumlanması ve Sanger dizileme yönteminden daha az
zaman harcanan işlem olması esasına dayanarak NPM1 mutasyonun
saptanmasında en uygun teknik olduğu sonucuna varılmıştır.
Anahtar Sözcükler: NPM1, Pirodizileme, Akut miyeloid lösemi,
Mutasyon analizi
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Dushyant KUMAR, M.D.,
Gauhati University Faculty of Medicine, Department of Bioengineering and Technology, Guwahati, India
Phone : +91 858 886 60 49
E-mail : anumehta11@gmail.com ORCID-ID: orcid.org/0000-0003-4255-8283
Received/Geliş tarihi: March 07, 2017
Accepted/Kabul tarihi: November 09, 2017
49
Kumar D, et al: NPM1 Mutation Analysis
Turk J Hematol 2018;35:49-53
Introduction
An increasing number of genetic abnormalities are revealed
in acute myeloid leukemia (AML). Among these genetic
alterations, potential prognostic genetic markers are the
nucleophosmin 1 (NPM1) gene, FLT3 gene, and CEBPA gene
[1]. Mutations in the NPM1 and FLT3 genes represent the
most important diagnostic and prognostic indicators in
patients with cytogenetically normal AML (CN-AML). NPM1
is a phosphoprotein that continuously shuttles between the
cytoplasm and nucleus. Several functions for this protein have
been described, including the binding of p53, the initiation
of centrosome duplication, and ribosomal protein assembly
and transport [2]. NPM1 mutations found in exon 12 code
for the COOH terminal region. Frameshift mutations in the
NPM1 gene result in an elongated protein that contains an
additional nuclear export signal and leads to an abnormal
cytoplasmic localization of the protein [3,4]. These mutations are
involved in leukemogenesis and are detected in about 35%-60%
of AML cases [5]. Six types of NPM1 mutation variants have been
identified: NPM1 mutation A (c.860_863dupTCTG), mutation B
(c.862_863insCATG), mutation D (c.863_864insCCTG), mutation
I (c.863_864insTAAG), mutation J (c.863_864insCTTG), and
mutation K (c.863_864insTATG). Mutation A (TCTG insertion)
is the most commonly occurring variant, found in about 80%
of all NPM1-mutated AML cases (Table 1) [3,5]. The effect
of mutant NPM1 has been studied using gene expression
profiling and studies revealed a distinctive signature of
these mutations [6]. Many studies reported the prognostic
significance of NPM1 mutation status in AML [7,8,9,10,11].
There are highly specific and sensitive molecular assays available
for detecting NPM1 mutations, like Sanger sequencing, highresolution
melting curve analysis, real-time polymerase chain
reaction (PCR), and pyrosequencing (Pyr). In this study, we
evaluated the utility of Pyr in the detection of NPM1 mutation
detection and also compared it with Sanger sequencing and realtime
PCR in terms of assay sensitivity, specificity, limit of
mutation detection, turnaround time, and assay cost [12,13].
Materials and Methods
A total of 165 CN-AML bone marrow aspiration or peripheral
blood samples taken at the time of first diagnosis were included
in this study from February 2014 to September 2016. Out of
these 165 patients, 79 (47.87%) were male and 86 (52.12%)
were female. Twenty cases (12.12%) were pediatric cases.
DNA Extraction
Genomic DNA was extracted from the received samples using
the QIAGEN DNeasy Kit (QIAGEN, Hilden, Germany) as per the
manufacturer’s instructions.
NPM1 Mutation Detection by Pyr Analysis
In the Pyr method for DNA sequence analysis, inorganic
phosphate released in the course of nucleotide incorporation
serves as the initial substrate in a sequence of four successive
enzymatic reactions. This results in the emission of light, which
functions as a signal that is proportional to the number of
nucleotides incorporated.
For NPM1 mutation analysis TTAACTCTCTGGTGGTAGAATG was
used as a forward primer, biotin-ACATTTATCAAACACGGTAGG
as a reverse primer, and TTTTCCAGGCTATTCAAGAT as the
sequencing primer (Sigma-Aldrich, New Delhi, India). DNA
(50 ng) was amplified using 400 nmol of forward and reverse
primers in 25 µL of reaction mix with PyroMark master mix
(QIAGEN). PCR conditions were as follows: initial denaturing
at 95 °C for 15 min; 42 cycles of 95 °C for 20 s, 53 °C for 30
s, and 60 °C for 20 s; and final extension at 72 °C for 5 min.
PCR products were electrophoresed on agarose gel to confirm
successful amplification. The PCR products (10 µL) were then
sequenced with the Pyr PyroMark Q24 system (QIAGEN).
NPM1 Mutation Detection by Pyr Analysis
Using Ipsogen NPM1 MutaScreen Kit
The Ipsogen NPM1 MutaScreen Kit (QIAGEN) combines two
techniques to screen for the presence of mutations in the
target gene. The real-time quantitative PCR (qPCR) double-dye
oligonucleotide hydrolysis principle uses specific primers and
an internal double-dye probe with a reporter and a quencher
(FAM-TAMRA) for the amplification reactions. In addition,
a 3’-end modified phosphate oligonucleotide is used that
perfectly matches the wild-type NPM1 gene and does not allow
polymerization. The Ipsogen NPM1 MutaScreen Kit detects
total NPM1 (wild-type + mutated) and mutated NPM1 and
separately identifies NPM1 Mut A, Mut B, and Mut D in genomic
DNA. A sample of DNA of 25 ng was used in a final reaction
volume of 25 µL. The PCR profile for Rotor-Gene Q (QIAGEN)
was 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95
°C for 15 s and 60 °C for 90 s with acquisition performed at 60
°C. Analysis was performed as per the kit’s instructions.
NPM1 Mutation Analysis by Sanger Sequencing
Analysis of NPM1 exon 12 mutations was done as described by
Falini et al. [4]. A sample of DNA of 50 ng was amplified using
an Applied Biosystems Veriti thermal cycler (Foster City, CA,
USA) and purified PCR product was used for BigDye termination
bidirectional sequencing. Results were analyzed using BioEdit
sequence analysis software.
Results
NPM1 exon 12 mutation was observed in 52 (31.51%) of all CN-
AML cases. As expected, the percentage of the DNA samples in
50
Turk J Hematol 2018;35:49-53
Kumar D, et al: NPM1 Mutation Analysis
which mutations were detected varied and depended upon the
method of detection used. NPM1 mutation analysis by Pyr had the
highest likelihood of identifying a mutation in the NPM1 gene,
followed by the NPM1 MutaScreen kit and direct sequencing
(Table 2). However, on the basis of our evaluation criteria (Table
1), the most sensitive tool was the Ipsogen MutaScreen kit
(95%), followed by Pyr (90%) and Sanger sequencing (80%). In
terms of specificity, all three methods matched equally.
Discussion
It has been found that 99% of all NPM1 mutations detected
by Pyr have 4-base insertions at position 860 while the rest of
the NPM1 mutations detected by Pyr were found as insertion at
862 and deletion at 863 and 861 [14]. We have examined
the ability of three different methods to detect mutations in
NPM1 gene exon 12 in 165 CN-AML samples. Bone marrow
or peripheral blood samples with a minimum of 15% blasts
were examined in this study. NPM1 mutations were found in
52 samples (31.51%), while 113 (68.48%) samples were found
to be wild-type. Twenty-eight (53.84%) of the NPM1-positive
patients were male while 24 (46.15%) were female. Seven
(13.46%) of the NPM1-positive samples were from pediatric
patients while 45 (86.53%) were from adults. Mutation type A
was the most frequent mutation (~80%), followed by types B
(12%) and D (6%). We also found one case of mutation type K
(c.863_864insTATG) by Pyr (Figure 1). The sequencing method is
considered the gold-standard technique for detection of somatic
as well as generic mutations. Jancik et al. [15] compared the
specificity, sensitivity, cost, and working time of five techniques
Table 1. NPM1 mutation frequencies in de novo acute
myeloid leukemia.
NPM1
mutation
type
Nucleotide
Insertion
Mutation A c.860_863dupTCTG ~72%
Mutation B c.862_863insCATG ~12%
Mutation D c.863_864insCCTG ~4%
Mutation G c.863_864insTTTG <1%
Mutation I c.863_864insTAAG <1%
Mutation J c.863_864insCTTG <1%
Mutation K c.863_864insTATG <1%
Others - <1%
AML: Acute myeloid leukemia.
Frequency in
de novo AML
References
[3,5]
Table 2. Number and percentage of mutations detected by
three different methods.
Method Mutations/Samples Percentage
Pyrosequencing 52/165 31.51%
Ipsogen MutaScreen Kit 51/165 30.90%
Sanger sequencing 46/165 27.87%
including Pyr, Sanger sequencing, and real-time PCR for KRAS
mutations. Ogino et al. [16] stated that the Pyr assay to detect
somatic mutations from formalin-fixed paraffin embedded
tissue is more sensitive than Sanger sequencing. Tsiatis et al.
[17] compared Pyr, Sanger sequencing, and melting curve
methods for the detection of somatic mutations like KRAS,
NRAS, and BRAF and demonstrated that Sanger sequencing
specificity is generally high compared with other methods, but
sensitivity has been reported to differ. Real-time PCR is the most
sensitive method for detecting minimal residual disease [18],
but it is limited to specific detection of mutations A, B, and D.
In the case of limited mutation, we can synthesize primers and
probes for other mutations as well, but it will add extra cost per
reaction (Table 3).
Figure 1. NPM1 mutation detection by pyrosequencing detection
by pyrosequencing.
Figure 2. A) NPM1 mutation detection by real-time polymerase
chain reaction using Ipsogen MutaScreen Kit. B) Sanger
sequencing.
51
Kumar D, et al: NPM1 Mutation Analysis Turk J Hematol 2018;35:49-53
Table 3. Sensitivity, specificity, time, and monetary cost of pyrosequencing, real-time polymerase chain reaction, and Sanger
sequencing.
Technique Sensitivity* Specificity* Limit of detection* Detection of rare mutations Time
Pyrosequencing 90% 100% 1%-5%
Real-Time PCR Ipsogen
MutaScreen Kit
Yes (can detect any mutation
located between the primers)
Monetary cost
(per reaction)
2 days 2500 INR ($38)
95% 100% 0.1%-1% No 1 day 4000 INR ($61)
Sanger sequencing 80% 95% 20%-30%
*From Jancik et al. [15].
INR: Indian rupee, PCR: polymerase chain reaction.
Yes (can detect any mutation
located between the primers)
4 days 1500 INR ($23)
Pyr is easily capable of detecting PCR fragments that are 25-
50 bp in length while longer fragments may pose a problem
[15,16]. In the case of NPM1, in which 99% of mutations occur at
position 956 in exon 12 [14], with Pyr we were able to detect all
types of mutations (Figure 1) with lower cost than real-time PCR
and less time than Sanger sequencing (Figure 2). Recently nextgeneration
sequencing (NGS) has become popular for detection
of mutations in 50 genes to 100 genes simultaneously. NGS is the
method to detect mutations down to the mutational burden of
1.25%. However, even though NGS is an accurate method, it is
still costly and time-consuming compared with Pyr.
Conclusion
In our study Pyr emerged as the most suitable technique for
the detection of NPM1 mutations on the basis of its easy
interpretation and less time-consuming processes than Sanger
sequencing. However, the limit of mutation detection by realtime
PCR is 0.1%-1%, the lowest of all three techniques, so realtime
PCR is the best technique to determine minimal residual
disease compared to Pyr, which has a limit of detection of
1%-5%. The Pyr assay can be considered as a better technique
for NPM1 mutation detection.
Ethics
Ethics Committee Approval: This study was approved by the
Gauhati University Ethical Committee with code number GUEC-
12/2015.
Informed Consent: N/A.
Authorship Contributions
Concept: K.K.S., D.K.; Design: K.K.S., D.K.; Data Collection or
Processing: D.K., M.K.P., S.N.; Analysis or Interpretation: D.K.,
K.K.S., A.M.; Literature Search: D.K., M.K.P., S.N.; Writing: D.K.,
M.K.P.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
References
1. Naoe T, Suzuki T, Kiyoi H, Urano T. Nucleophosmin: a versatile molecule
associated with hematological malignancies. Cancer Sci 2006;97:963-969.
2. Zhao T, Zhu HH, Wang J, Jia JS, Yang SM, Jiang H, Lu J, Chen H, Xu LP, Zhang
XH, Jiang B, Ruan GR, Wang DB, Huang XJ, Jiang Q. Prognostic significance
of early assessment of minimal residual disease in acute myeloid leukemia
with mutated NPM1 patients. Zhonghua Xue Ye Xue Za Zhi 2013;38:10-16.
3. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens
W, Uitterlinden AG, Erpelinck CA, Delwel R, Löwenberg B, Valk PJ.
Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML):
association with other gene abnormalities and previously established gene
expression signatures and their favorable prognostic significance. Blood
2005;106:3747-3754.
4. Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L, La Starza
R, Diverio D, Colombo E, Santucci A, Bigerna B, Pacini R, Pucciarini A,
Liso A, Vignetti M, Fazi P, Meani N, Pettirossi V, Saglio G, Mandelli F, Lo-
Coco F, Pelicci PG, Martelli MF; GIMEMA Acute Leukemia Working Party.
Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal
karyotype. N Engl J Med 2005;352:254-266.
5. Thiede C, Creutzig E, Reinhardt D, Ehninger G, Creutzig U. Different types of
NPM1 mutations in children and adults: evidence for an effect of patient
age on the prevalence of the TCTG-tandem duplication in NPM1-exon 12.
Leukemia 2007;21:366-367.
6. Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi SP, Meani
N, Diverio D, Bernard L, Tizzoni L, Volorio S, Luzi L, Colombo E, Lo Coco F,
Mecucci C, Falini B, Pelicci PG. Acute myeloid leukemia bearing cytoplasmic
nucleophosmin (NPMc +
AML) shows a distinct gene expression profile
characterized by up-regulation of genes involved in stem cell maintenance.
Blood 2005;106:899-902.
7. Liu Y, He P, Liu F, Shi L, Zhu H, Zhao J, Wang Y, Cheng X, Zhang M. Prognostic
significance of NPM1 mutations in acute myeloid leukemia: a metaanalysis.
Mol Clin Oncol 2014;2:275-281.
8. Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R, Kodera Y, Miyawaki
S, Asou N, Kuriyama K, Yagasaki F, Shimazaki C, Akiyama H, Nishimura M,
Motoji T, Shinagawa K, Takeshita A, Ueda R, Kinoshita T, Emi N, Naoe T.
Clinical characteristics and prognostic implications of NPM1 mutations in
acute myeloid leukemia. Blood 2005;106:2854-2861.
9. Gale RE, Green C, Allen C, Mead AJ, Burnett AK, Hills RK, Linch DC; Medical
Research Council Adult Leukaemia Working Party. The impact of FLT3
internal tandem duplication mutant level, number, size, and interaction
with NPM1 mutations in a large cohort of young adult patients with acute
myeloid leukemia. Blood 2008;111:2776-2784.
10. Becker H, Marcucci G, Maharry K, Radmacher MD, Margeson KM,
Whitman SP, Wu YZ, Schwind S, Paschka P, Powell BL, Carter TH, Kolitz ZE,
Wetzler M, Carrol AJ, Baer MR, Caligiuri MA, Larson RA, Bloomfield CD.
Favorable prognostic impact of NPM1 mutations in older patients with
cytogenetically normal de novo acute myeloid leukemia and associated
gene and microRNA-expression signatures: a Cancer and Leukemia Group B
study. J Clin Oncol 2010;28:596-604.
52
Turk J Hematol 2018;35:49-53
Kumar D, et al: NPM1 Mutation Analysis
11. Boonthimat C, Thongnoppakhun W, Auewarakul CU. Nucleophosmin
mutation in Southeast Asian acute myeloid leukemia: eight novel variants,
FLT3 coexistence and prognostic impact of NPM1/FLT3 mutations.
Haematologica 2008;93:1565-1569.
12. Falini B, Martelli MP, Pileri SA, Mecucci C. Molecular and alternative
methods for diagnosis of acute myeloid leukemia with mutated NPM1:
flexibility may help. Haematologica 2010;95:529-534.
13. Gorello P, Cazzaniga G, Alberti F, Dell’Oro MG, Gottardi E, Specchia G, Roti
G, Rosati R, Martelli MF, Diverio D, Lo Coco F, Biondi A, Saglio G, Mecucci
C, Falini B. Quantitative assessment of minimal residual disease in acute
myeloid leukemia carrying nucleophosmin (NPM1) gene mutations.
Leukemia 2006;20:1103-1108.
14. Schnittger S, Kern W, Tschulik C, Weiss T, Dicker F, Falini B, Haferlach C,
Haferlach T. Minimal residual disease levels assessed by NPM1 mutationspecific
RQ-PCR provide important prognostic information in AML. Blood
2009;114:2220-2231.
15. Jancik S, Drabek J, Berkovcova J, Xu YZ, Stankova M, Klein J, Kolek V, Skarda
J, Tichy T, Grygarkova I, Radzioch D, Hajduch M. A comparison of direct
sequencing, pyrosequencing, high resolution melting analysis, TheraScreen
DxS, and the K-ras StripAssay for detecting KRAS mutations in non small
cell lung carcinomas. J Exp Clin Cancer Res 2012;31:79.
16. Ogino S, Kawasaki T, Brahmandam M, Yan L, Cantor M, Namgyal C, Mino-
Kenudson M, Lauwers GY, Loda M, Fuchs CS. Sensitive sequencing method
for KRAS mutation detection by pyrosequencing. J Mol Diagn 2005;7:413-
421.
17. Tsiatis AC, Norris-Kirby A, Rich RG, Hafez MJ, Gocke CD, Eshleman JR,
Murphy KM. Comparison of Sanger sequencing, pyrosequencing, and
melting curve analysis for the detection of KRAS mutations: diagnostic and
clinical implications. J Mol Diagn 2010;12:425-432.
18. Falini B, Martelli MP, Bolli N, Sportoletti P, Liso A, Tiacci E, Haferlach T. Acute
myeloid leukemia with mutated nucleophosmin (NPM1): is it a distinct
entity? Blood 2011;117:1109-1120.
53
RESEARCH ARTICLE
DOI: 10.4274/tjh.2016.0504
Turk J Hematol 2018;35:54-60
Incomplete Antibodies May Reduce ABO Cross-Match
Incompatibility: A Pilot Study
İnkomplet Antikorlar ABO Çapraz Karşılaştırma Uyumsuzluğunu Azaltabilirler:
Bir Başlangıç Çalışması
Mehmet Özen 1 , Soner Yılmaz 2 , Tülin Özkan 3 , Yeşim Özer 4 , Aliye Aysel Pekel 5 , Asuman Sunguroğlu 3 , Günhan Gürman 6 ,
Önder Arslan 6
1
Ufuk University Faculty of Medicine, Department of Hematology, Ankara, Turkey
2
University of Health Sciences, Gülhane Training and Research Hospital, Blood Bank Unit, Ankara, Turkey
3
Ankara University Faculty of Medicine, Department of Medical Biology, Ankara, Turkey
4
Ankara University Faculty of Medicine, Unit of Blood Bank, Ankara, Turkey
5
University of Health Sciences, Gülhane Training and Research Hospital, Clinic of Immunology and Allergy Diseases, Ankara, Turkey
6
Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Abstract
Objective: Any erythrocyte transfusion among humans having type A or
B blood groups is impossible due to antibodies causing fatal transfusion
complications. A cross-match test is performed to prevent immune
transfusion complications before transfusion. Our hypothesis is that the
fragment antibody (Fab) part of the antibody (incomplete antibody) may
be used to prevent an immune stimulus related to the complete antibody.
Therefore, we designed a pilot study to evaluate the effectiveness of these
incomplete antibodies using cross-match tests.
Materials and Methods: Pepsin enzyme and staphylococcal protein A
columns were used to cut anti-A and anti-B monoclonal antibodies and
purify their Fab (2) fragments, respectively. An Rh-positive erythrocyte
suspension with purified anti-A Fab (2) solution and B Rh-positive
erythrocyte suspension with purified anti-B Fab (2) solution were
combined correspondingly. Cross-match tests were performed by tube and
gel centrifugation methods. The agglutination levels due to the anti-A and
anti-B Fab (2) antibodies and their effects on the agglutination normally
observed with complete antibodies were then measured.
Results: No agglutination for the purified incomplete anti-A Fab (2) with
A Rh+ erythrocyte and anti-B Fab (2) with B Rh+ erythrocyte combinations
was observed in the tube cross-match tests. These agglutination levels were
1+ in two wells in the gel centrifugation cross-match tests. Fab (2)-treated
erythrocytes were also resistant to the agglutination that normally occurs
with complete antibodies.
Conclusion: We determined that the Fab (2) fragments of antibodies may
not only be used to obtain a mild or negative reaction when compared
to complete antibodies, but they might also be used for decreasing ABO
incompatibility. Incomplete antibodies might be a therapeutic option in
autoimmune hemolytic anemia and they may also be used in solid organ
or hematopoietic stem cell transplantation. Therefore, we have planned an
in vivo study to prove these in vitro findings.
Keywords: Transfusion medicine, Red blood cells, Complications, Humoral
immune response
Öz
Amaç: Tip A ve B kan grubuna sahip insanlar arasında herhangi bir eritrosit
nakli öldürücü transfüzyon komplikasyonlarına neden olan antikorlar
nedeniyle imkansızdır. İmmün transfüzyon komplikasyonlarını önlemek için
transfüzyondan önce çapraz karşılaştırma testi yapılır. Hipotezimiz komplet
antikorla ilişkili bağışıklık yanıtını önlemekte antikorun fragman antikor
(Fab) parçasının (inkomplet antikor) kullanılabileceğidir. Bu inkomplet
antikorların etkinliğini değerlendirmek için de çapraz karşılaştırma
testlerini kullanarak bir başlangıç çalışması tasarladık.
Gereç ve Yöntemler: Anti-A ve anti-B monoklonal antikorlarını kesmek ve
saflaştırmak için sırasıyla pepsin enzimi ve stafilokokal protein A kolonları
kullanıldı. A Rh pozitif eritrosit süspansiyonu ile saflaştırılmış anti-A Fab
(2) solüsyonu ve B Rh pozitif eritrosit süspansiyonu ile saflaştırılmış anti-B
Fab (2) solüsyonu sırasıyla birleştirildi. Çapraz karşılaştırma testleri tüp ve
jel santrifügasyon yöntemleri kullanılarak çalışıldı. Sonrasında anti-A ve
anti-B Fab (2) antikorlara bağlı aglütinasyon düzeyi ve bunların komplet
antikorlarla normalde gözlenen aglütinasyon üzerine etkileri ölçüldü.
Bulgular: Tüp yöntemi ile yapılan çapraz karşılaştırma testinde saflaştırılmış
inkomplet anti-A Fab (2) ile A Rh pozitif eritrosit ve anti-B Fab (2) ile B Rh pozitif
eritrosit kombinasyonlarında aglütinasyon gözlenmedi. Jel santrifügasyon
yöntemi ile yapılan çarpraz karşılaştırma testinde bu aglütinasyon düzeyleri
her iki kuyucukta da 1 pozitifti. Fab (2) ile muamele edilen eritrositler komplet
antikorla normalde oluşan aglütinasyona da dirençliydiler.
Sonuç: Antikorların Fab (2) fragmanlarının sadece komplet antikorlara
kıyasla daha hafif veya negatif reaksiyonu elde etmekte değil, aynı zamanda
ABO uyumsuzluğunu azaltmakta da kullanılabileceğini değerlendirdik.
İnkomplet antikorlar otoimmün hemolitik anemide bir tedavi seçeneği
olabileceği gibi aynı zamanda solid organ veya hematopoeitik kök hücre
naklinde kullanılabilir. Bu nedenle in vitro bulguları doğrulamak için in vivo
bir çalışma planladık.
Anahtar Sözcükler: Transfüzyon tıbbı, Alyuvarlar, Komplikasyonlar,
Hümöral bağışıklık yanıtı
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Mehmet ÖZEN, M.D.,
Ufuk University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Phone : +90 536 275 00 74
E-mail : kanbilimci@gmail.com ORCID-ID: orcid.org/0000-0002-0910-9307
Received/Geliş tarihi: December 30, 2016
Accepted/Kabul tarihi: May 22, 2017
54
Turk J Hematol 2018;35:54-60
Özen M, et al: ABO Blood Group and Fab Antibodies
Introduction
There are many blood groups used for the human population,
including ABO, Rh, Kidd, Kell, Duffy, MNS, and Lewis. The ABO
system is the most important of all blood groups in transfusion
practice due to the reciprocal antibodies [1]. These antibodies
consistently and predictably present in the sera of normal people
whose erythrocytes lack the corresponding antigen(s) [2]. These
antibodies may cause immediate lysis of donor red blood cells
(RBCs) during ABO-incompatible transfusion and initiate fatal
hemolytic transfusion reactions [1].
Typing and screening are the first steps of pretransfusion
compatibility tests. These tests are used to define the patient’s
ABO group and Rh type and to detect expected and unexpected
antibodies in the patient’s serum. The cross-match is the final
step of pretransfusion testing [3]. In this test, donor cells
are combined with the patient’s serum and checked for
agglutination, which would signify incompatible blood [4]. This
process, also known as major cross-matching, serves as the last
safeguard to ensure a safe transfusion [4,5,6].
Antibodies are also essential for humoral immunity [7].
Many antibodies have been shown to be primarily related
to autoimmune diseases and such diseases are referred to as
antibody-related autoimmune diseases [7,8,9]. Many of these
diseases may disappear in the absence of certain antibodies [9].
All antibodies have two fragments. The antigen-binding fragment
(Fab) binds to an antigen, and the crystallizable fragment (Fc)
stimulates the immune system by activating the complement
[10]. Additionally, macrophages or lymphocytes detect the Fc
fragment of antibodies [11,12]. Therefore, the Fab fragment
detects antigens and the Fc fragment stimulates the immune
system. An antibody with the Fc part removed, in which only
the Fab fragment exists, may be called an incomplete antibody.
Papain or pepsin enzymes can be used in the fragmentation of
antibodies and can produce Fab or Fab (2) fragments of the
antibodies, respectively [13]. The effectiveness levels of Fab
and Fab (2) fragments of an antibody are similar and they
are interchangeable [14]. Our hypothesis is that incomplete
antibodies may be used to prevent an immune stimulus. We
designed a pilot study to examine the effectiveness of these
incomplete antibodies in incompatible cross-matches due
to ABO antibodies and we are presenting it here. Local ethics
committee approval was obtained for this study.
Materials and Methods
Anti-A and anti-B monoclonal antibodies (Eryclone, Verna
Industrial Estate, Verna, India) were used for this study. First the
pepsin enzyme was used to cut these monoclonal antibodies
and staphylococcal protein A columns were used to purify their
Fab (2) fragments. The Pierce F(ab’)2 Preparation Kit (Thermo
Fisher Scientific, Rockford, IL, USA) was used to produce the
Fab (2) fragments from complete antibodies. This process was
conducted according to the manufacturer’s instructions.
After obtaining purified Fab (2)s, we began the second part of
the study. During purification of Fab (2)s, the volume of the
products changed. The ratios of the complete monoclonal
antibodies to the standard erythrocyte solution for an
optimal cross-match test were calculated according to the
manufacturer’s instructions. We used these ratios for the anti-A
or -B Fab (2) to the A or B Rh-positive erythrocyte solutions for
the cross-match tests, respectively.
After calculation, an anti-IgG cross-match card (Ortho-Clinical
Diagnostics, High Wycombe, UK) was used for the compatibility
tests. We combined 10 µL of A Rh-positive 5% erythrocyte
suspension with 150 µL of purified anti-A Fab (2) solution in the
same well to conduct a cross-match test in order to prove that
the erythrocytes were covered with anti-A Fab (2). We also used
150 µL of complete anti-A antibodies for the positive control
and 150 µL of phosphate-buffered saline (PBS) for the negative
control. We incubated all cards at 37 °C for 10 min and then
centrifuged them for 5 min. The negative controls lacked the
complete and incomplete antibodies. We repeated the same
process with complete and incomplete anti-B antibodies and the
B Rh-positive erythrocyte suspension. In addition, we repeated
these tests using Across Gel ® Anti-Human Globulin IgG+C3d
cross-match cards (Dia Pro, İstanbul, Turkey). We also evaluated
agglutination levels when complete and incomplete antibodies
were put in the same well at the same time, noting the amounts
for A and B erythrocyte suspensions. We conducted an antibody
titration test and repeated this last test with several ratios
(32/1, 8/1, 4/1, 1/1, 1/4, and 1/16) for complete to incomplete
antibodies when used simultaneously. Finally, we evaluated the
reactions in all wells.
We also performed a tube test to confirm the results of the
card tests and to show whether incomplete antibodies inhibited
normal agglutination with complete antibodies or not. First,
we treated A Rh+ erythrocytes with anti-A Fab (2) and B Rh+
erythrocytes with anti-B Fab (2) in two separate tubes. We then
added complete anti-A and anti-B antibodies to the respective
tubes and mixed them. As a positive control, A Rh+ erythrocytes
were treated only with complete anti-A antibodies and B Rh+
erythrocytes were treated only with complete anti-B antibodies
in a tube without adding incomplete fragments. Consequently,
there were no incomplete antibodies in positive control tubes.
We then evaluated the agglutination levels in the tubes.
In addition, we performed a flow cytometric analysis to prove
the results of all these tests. The B Rh+ erythrocyte sample
was transferred to a tube containing K 3
EDTA and that tube’s
contents were divided into four tubes. We mixed each tube with
55
Özen M, et al: ABO Blood Group and Fab Antibodies
Turk J Hematol 2018;35:54-60
one of the following: PBS, anti-B complete antibodies alone,
anti-B incomplete antibodies alone, or a mix of anti-B antibodies
(1:1 ratio for incomplete to complete). To label the erythrocytes,
CD235a FITC (glycophorin A, BD Pharmingen, San Diego, CA, USA)
and cytoplasm-staining nucleic acid dye 7-amino-actinomycin
(7-ADD) (BD Pharmingen) were added to the tubes. The samples
were analyzed using the FACSDiva software of the FACSCanto
II model flow cytometer (BD Biosciences, San Jose, CA, USA).
Viable erythrocytes were identified as cells stained positive with
CD235a FITC and negative with 7-ADD. We evaluated 100,000
events per sample to show the erythrocyte agglutination levels
in the tubes. Agglutination levels were calculated with the
single-cell analysis and forward-scatter gating strategy [15].
The antibody titration test results are given in Table 1. Higher
concentrations of complete antibodies (from 8 to 32 times
more than incomplete antibodies) were associated with 4+
agglutination levels in simultaneous use on the cross-match card
Results
For the card test, we observed a 1+ reaction for the purified
incomplete anti-A Fab (2) and A Rh+ erythrocyte combination.
However, we observed 4+ reactions for the complete anti-A
antibody with the A Rh+ erythrocyte combination. No positive
reactions were observed in the negative control wells. The test
results were similar for the B Rh+ erythrocyte and complete
anti-B or incomplete anti-B Fab (2) antibody combinations and
negative controls (Figures 1 and 2).
Figure 2. Group B erythrocytes: T, with complete (total) antibody
(4+ reaction); PBS, with phosphate-buffered saline (- reaction);
Fab, with anti-B Fab (2) (- reaction); Fab+T: with anti-B complete
(total) and anti-B Fab (2) simultaneously, 1:1 dilution (double
reaction with 4+ and -).
PBS: Phosphate-buffered saline, Fab: fragment antibody.
Figure 1. A) Group A erythrocytes: Ai, with incomplete anti-A
antibody (1+ reaction); A+, with complete anti-A antibody (4+
reaction); A-, with negative control (no reaction). B) Group B
erythrocytes: Bi, with incomplete anti-B antibody (1+ reaction);
B+, with complete anti-B antibody (4+ reaction); B-, with
negative control (no reaction).
Table 1. Antibody titration tests on the immunoglobulin G
cross-match cards according to the ratios for complete to
incomplete antibodies added simultaneously.
Complete/
Incomplete ratio
Group
A erythrocytes
From 8/1 to 32/1 4+ 4+
4/1 -/4+* -/4+*
1/1 -/4+* -/4+*
1/4 -/4+* -/4+*
1/16 -/4+* -/4+*
*Double population.
Group
B erythrocytes
56
Turk J Hematol 2018;35:54-60
Özen M, et al: ABO Blood Group and Fab Antibodies
tests (Table 1). Lower ratios than 8/1 showed double population
results when both complete and incomplete antibodies were
simultaneously added to the wells before erythrocytes (Table 1,
Figure 2). Increasing the amounts of incomplete antibodies did
not cause any 4+ results if complete antibodies were not added
to the wells.
For the tube tests, we observed no agglutination for the A
Rh+ erythrocytes and incomplete anti-A Fab (2) antibodies
combination and the B Rh+ erythrocytes and incomplete
anti-B Fab (2) antibodies combination in two separate tubes.
There was also no agglutination when complete anti-A and
anti-B antibodies were added to the respective tubes. No
agglutination continued when the two tubes were mixed (Figure
3). Agglutination was present in the positive control tube that
contained complete antibodies (Figure 4).
minimal or no agglutination in the card and tube cross-match
tests. Minimal agglutination with Fab (2) parts was similar to
the negative controls. These results come from the characteristic
features of an antibody. The Fab part of an antibody binds to the
antigen, and the Fc part of the antibody both starts agglutination
and stimulates the immune system via activating the complement
system and/or binding to Fc receptors of macrophages or
lymphocytes [10,11,12]. Fc and its interactions with the Fc
receptors of macrophages have a critical role and are required
for antibody response [16,17]. Hemolytic disease of newborns is a
good example of this pathologic mechanism of antibody response.
Flow cytometric analysis also showed similar results (Figure 5).
Agglutinated erythrocytes expressed brighter CD235a positivity
than non-agglutinated erythrocytes. Almost all erythrocytes
were viable in the tubes. Erythrocyte agglutination levels were
calculated as 0.9% for the PBS tube, 0.1% for the Fab (2) tube,
7.1% for the complete anti-B antibody tube, and 2.9% for the
mixed tube (1:1, complete to incomplete antibody).
Discussion
Although complete anti-A and -B antibodies cause strong
agglutination, the Fab (2) parts of these antibodies caused
Figure 3. Group A and group B erythrocytes in the same tube
incubated with incomplete anti-A and -B fragment antibody
fragments and after addition of complete anti-A and -B to the
medium. No agglutination.
Figure 4. Group A and group B erythrocytes in the same tube
incubated with complete anti-A and -B antibodies. Positive
agglutination.
57
Özen M, et al: ABO Blood Group and Fab Antibodies
Turk J Hematol 2018;35:54-60
purified Fab fragments of the anti-D antibody were studied for
hemolytic disease of newborns because of their binding to Rh+
erythrocytes [19,20]. However, anti-D Fab treatment was not
sufficient for being used for hemolytic disease of newborns due
to its ineffectiveness [16]. This situation comes from the Fc part
of the antibody. Removal of the Fc part of an antibody may result
in ineffectiveness of the antibody when stimulating the immune
system even if it binds to an antigen. Similarly, the digoxinspecific
incomplete Fab antibody effectively binds to its antigen
(Digifab). However, no significant immune reaction was reported
in patients treated with this agent, probably due to the absence
of the Fc part of the antibody [21].
Figure 5. Flow cytometric analysis with group B erythrocytes:
a) with phosphate-buffered saline, 0.9% agglutination; b) with
anti-B fragment antibody (Fab) (2), 0.1% agglutination; c) with
complete anti-B, 7.1% agglutination; d) with anti-B complete
and Fab (2) simultaneously, 2.9% agglutination.
In this antibody-related disease, anti-D antibody treatment
is used to prevent hemolytic disease of newborns [18]. Anti-D
antibody drugs should be composed of complete antibodies to
prevent competitive binding of Fab fragments [16]. In the past,
ABO incompatibility is an unavoidable clinical issue, and
complications associated with ABO incompatibility should
be managed and treated appropriately [22]. Hemovigilance
procedures are recommended and used because of the potential
for fatal complications following blood transfusion [23].
Although some procedures for treating ABO-incompatible
blood transfusions are used, to the best of our knowledge,
none of them are specific [24]. In our study, we showed that
if erythrocytes are exposed to Fab (2) and complete antibodies
simultaneously, complete antibody-associated agglutination
ratios may decrease due to the coating of some erythrocytes
with Fab (2) and others with complete antibodies. Therefore, we
hypothesized that anti-A and anti-B Fab (2) antibodies might
be a useful treatment for these patients and may reduce fatal
complications. Competitive binding between complete and
incomplete antibodies may reduce or eliminate the effects of
complete antibodies [25]. No strong agglutination with high
amounts of Fab (2) and insufficiency of low amounts of Fab
(2) in preventing agglutination related to complete antibodies
also supports our hypothesis. Similarly, anti-Rh antibodies
are considered for use in preventing transfusion reactions in
hemolytic disease of newborns and their effect is superior when
they are used early after birth [26]. Our results could also be
explained with the epitope-masking hypothesis [27]. When
an epitope on an antigen is coated with an antibody, other
antibodies cannot bind the same epitope. Therefore, if the
first antibody did not start an immune response and occupy
the epitope, the following antibodies will also not be able to
cause an immune response. Our hypothesis may be stated as
follows: the Fab (2) parts of the same antibodies may be used
for masking the epitopes instead of other antibodies. Moreover,
our findings may also help in universal group O RBC studies [28].
Instead of polyethylene glycol, Fab (2)s may be used in order to
cover erythrocytes via coating surface antigens. However, our
in vitro study needs to be supported with future in vivo animal
studies for this use. Therefore, we are planning to conduct an in
vivo study to prove the results of our pilot study.
ABO incompatibility between the donor and the recipient can
cause hemolysis in the recipient, especially when performing
58
Turk J Hematol 2018;35:54-60
Özen M, et al: ABO Blood Group and Fab Antibodies
hematopoietic and solid organ transplantations [22,29].
It also presents several challenges for hematopoietic stem
cell transplantation [29]. During hematopoietic stem cell
transplantation, transfused erythrocytes and other blood
products change based on the donor’s and recipient’s blood
groups, and such changes are not stable [30]. Irradiated, filtered,
and leukocyte-depleted blood products are commonly used
for blood transfusions [31]. Some hemolytic anemia patients
also have auto-anti-A or auto-anti-B antibodies [32,33,34].
We hypothesize that the anti-A and anti-B Fab (2) antibody
fragments presented here may be used to prepare suitable
or alternative blood products for such patients in the future.
Using Fab (2) fragments of antibodies, including those of other
blood groups, may simplify current antibody screening and
identification tests. In spite of the importance of these tests,
due to problems originating from technical procedures and
evaluation methods, these tests take time, postpone the use of
blood products for patients, and sometimes result in inconclusive
outcomes [35]. As we showed, seeing a double population in a
well may help in the identification process of antibodies.
ABO-incompatible solid organ transplantation presents
other challenges, and some such transplants are currently
impossible due to ABO incompatibility [22,36]. Solid organs
contain ABO antigens that can cause incompatibility [22,36].
Immunoadsorption techniques are used to prevent the
antibody-related immune response and to extend the survival
of grafts and transplant recipients having ABO incompatibility
[37]. Hyperacute rejection in solid organ transplants may also be
reversed by using Fab fragments [38]. We hypothesized that the
intravenous administration of anti-A and anti-B Fab (2) antibody
fragments may also be applied in solid organ transplantation.
Study Limitations
Our study has some limitations. Our sole aim was to test our
hypothesis that Fab (2) antibody fragments can be used to
prevent an immune stimulus. All of the funds for this project were
provided by the authors and our funds were not sufficient to fully
complete the project. Although the results of cross-match tests
and flow cytometric analysis were consistent, we were not able
to evaluate all possible immune stimulus mechanisms associated
with incomplete antibodies. In addition, we would have preferred
to measure the levels of the Fab (2) antibody fragments and
pepsin after completing the reaction, and also to measure the
reaction in various environmental conditions, but we did not have
sufficient funds to perform all these tests. It should also be noted
that the weak positive reactions in group A or B erythrocytes
with incomplete anti-A or anti-B antibodies in IgG cross-match
card tests, respectively, may have originated from inadequate Fab
(2) antibody fragment yields with pepsin and protein A columns
in our study [39]. However, we cannot state a definite reason
explaining these mild agglutinations in card tests as we could not
measure the levels of complete and incomplete antibodies in the
products used for card tests. Higher agglutination results related
to Fab (2) fragments by the gel centrifugation technique than
tube tests may also have originated from its higher sensitivity in
detecting agglutination [40].
Conclusion
In this in vitro study, we showed that ABO incompatibility can
be minimized by using Fab (2) antibody fragments of anti-A
and anti-B antibodies. In vivo studies are needed to explore the
potential therapeutic effects of these agents. Therefore, we have
planned to start an in vivo study to prove these in vitro findings.
Acknowledgments
The authors declare no financial, consulting, or personal
relationships with other people or organizations that could
influence the work. There was also no scientific writing
assistance or grant support or employment in this study.
Ethics
Ethics Committee Approval: Dumlupınar University Faculty of
Medicine, Ethics Committee 04.05.2015 and approval number:
2015-KAEK-86/2015.04.
Informed Consent: N/A.
Authorship Contributions
Surgical and Medical Practices: Y.Ö., A.A.P.; Concept: M.Ö., G.G.;
Design: M.Ö., T.Ö., G.G., A.S.; Data Collection or Processing: T.Ö.,
M.Ö., S.Y.; Analysis or Interpretation: M.Ö., S.Y., Ö.A.; Literature
Search: M.Ö., S.Y.; Writing: M.Ö., S.Y., Ö.A.
Conflict of Interest: We report that Dr. Mehmet Özen has a
patent pending (PCT/TR2016/050352). The other authors declare
that they have no conflict of interest.
References
1. Harmening DM, Forneris G, Tubby BJ. The ABO blood group system. In:
Harmening DM, (ed). Modern Blood Banking & Transfusion Practices.
Philadelphia, F. A. Davis Company, 2012.
2. Blancher A, Klein J, Socha WW. Molecular Biology and Evolution of Blood
Group and MHC Antigens in Primates, 1st ed. New York, Springer, 1997.
3. Makarovska-Bojadzieva T, Blagoevska M, Kolevski P, Kostovska S. Optimal
blood grouping and antibody screening for safe transfusion. Prilozi
2009;30:119-128.
4. Petrides M. Pretransfusion compatibility testing. In: Petrides M, Stack G,
(eds). Practical Guide to Transfusion Medicine, 2nd ed. Bethesda, American
Association of Blood Banks, 2007.
5. Shulman IA, Nelson JM, Saxena S, Thompson JC, Okamoto M, Kent
DR, Nakayama RK. Experience with the routine use of an abbreviated
crossmatch. Am J Clin Pathol 1984;82:178-181.
6. Judd WJ, Fullen DR, Steiner EA, Davenport RD, Knafl PC. Revisiting the issue:
can the reading for serologic reactivity following 37 degrees C incubation
be omitted? Transfusion 1999;39:295-259.
59
Özen M, et al: ABO Blood Group and Fab Antibodies
Turk J Hematol 2018;35:54-60
7. Janeway CA Jr. How the immune system works to protect the host from
infection: a personal view. Proc Natl Acad Sci U S A 2001;98:7461-7468.
8. Kamisawa T, Funata N, Hayashi Y, Eishi Y, Koike M, Tsuruta K, Okamoto A,
Egawa N, Nakajima H. A new clinicopathological entity of IgG4-related
autoimmune disease. J Gastroenterol 2003;38:982-984.
9. Ferraccioli GF, De Vita S, Casatta L, Damato R, Pegoraro I, Bartoli E.
Autoimmune connective tissue disease, chronic polyarthritides and B cell
expansion: risks and perspectives with immunosuppressive drugs. Clin Exp
Rheumatol 1996;14(Suppl 14):71-80.
10. Stigbrand T, Ahlström KR, Sundström B, Makiya R, Stendahl U. Alternative
technologies to generate monoclonal antibodies. Acta Oncol 1993;32:841-
844.
11. Bussel JB. Modulation of Fc receptor clearance and antiplatelet antibodies
as a consequence of intravenous immune globulin infusion in patients with
immune thrombocytopenic purpura. J Allergy Clin Immunol 1989;84:566-
578.
12. Nardin A, Lindorfer MA, Taylor RP. How are immune complexes bound
to the primate erythrocyte complement receptor transferred to acceptor
phagocytic cells? Mol Immunol 1999;36:827-835.
13. Andrew SM, Titus JA. Fragmentation of immunoglobulin G. Curr Protoc
Immunol 2001;2:2-8.
14. Kulberg AJ, Bartova LM, Evnin DN. Further studies of the adjuvant properties
of homologous IgG split products: mode of action of F(ab’)2 and related
fragments. Immunology 1978;34:199-206.
15. Won DI, Jung OJ, Lee YS, Kim SG, Suh JS. Flow cytometry antibody screening
using pooled red cells. Cytometry B Clin Cytom 2010;78:96-104.
16. Rewald E. Are there options for donor-derived i.m. anti-D IgG preparations
other than to prevent Rh(D) sensitization? The intravenous route. Transfus
Sci 1995;16:383-389.
17. Yu X, Menard M, Seabright G, Crispin M, Lazarus AH. A monoclonal antibody
with anti-D-like activity in murine immune thrombocytopenia requires
Fc domain function for immune thrombocytopenia ameliorative effects.
Transfusion 2015;55:1501-1511.
18. Altuntas N, Yenicesu I, Himmetoglu O, Kulali F, Kazanci E, Unal S, Aktas
S, Hirfanoglu I, Onal E, Turkyilmaz C, Ergenekon E, Koc E, Atalay Y. The
risk assessment study for hemolytic disease of the fetus and newborn in a
University Hospital in Turkey. Transfus Apher Sci 2013;48:377-380.
19. Margni RA, Leoni J, Bazzurro M. The incomplete anti-Rh antibody
agglutination mechanism of trypsinized ORh+ red cells. Immunology
1977;33:153-160.
20. Williamson RA, Persson MA, Burton DR. Expression of a human monoclonal
anti-(rhesus D) Fab fragment in Escherichia coli with the use of
bacteriophage λ vectors. Biochem J 1991;277:561-563.
21. Chan BS, Buckley NA. Digoxin-specific antibody fragments in the treatment
of digoxin toxicity. Clin Toxicol (Phila) 2014;52:824-836.
22. Simmons DP, Savage WJ. Hemolysis from ABO incompatibility. Hematol
Oncol Clin North Am 2015;29:429-443.
23. Vasudev R, Sawhney V, Dogra M, Raina TR. Transfusion-related
adverse reactions: from institutional hemovigilance effort to National
Hemovigilance program. Asian J Transfus Sci 2016;10:31-36.
24. Aliç Y, Akpek EA, Dönmez A, Ozkan S, Perfusionist GY, Aslamaci S. ABOincompatible
blood transfusion and invasive therapeutic approaches during
pediatric cardiopulmonary bypass. Anesth Analg 2008;107:1185-1187.
25. Mijares A, Lebesgue D, Wallukat G, Hoebeke J. From agonist to antagonist:
Fab fragments of an agonist-like monoclonal anti-β2-adrenoceptor
antibody behave as antagonists. Mol Pharmacol 2000;58:373-379.
26. Chang TY, Siegel DL. Genetic and immunological properties of phagedisplayed
human anti-Rh(D) antibodies: implications for Rh(D) epitope
topology. Blood 1998;91:3066-3078.
27. Karlsson MC, Getahun A, Heyman B. FcgammaRIIB in IgG-mediated
suppression of antibody responses: different impact in vivo and in vitro. J
Immunol 2001;167:5558-5564.
28. Kruskall MS, AuBuchon JP. Making Landsteiner’s discovery superfluous:
safety and economic implications of a universal group O red blood cell
supply. Transfus Sci 1997;18:613-620.
29. Staley EM, Schwartz J, Pham HP. An update on ABO incompatible
hematopoietic progenitor cell transplantation. Transfus Apher Sci
2016;54:337-344.
30. Worel N. ABO-mismatched allogeneic hematopoietic stem cell
transplantation. Transfus Med Hemother 2016;43:3-12.
31. Özen M, Üstün C, Öztürk B, Topçuoğlu P, Arat M, Gündüz M, Atilla E, Bolat
G, Arslan Ö, Demirer T, Akan H, İlhan O, Beksaç M, Gürman G, Özcan M.
Allogeneic transplantation in chronic myeloid leukemia and the effect of
tyrosine kinase inhibitors on survival: a quasi-experimental study. Turk J
Hematol 2017;34:16-26.
32. Govoni M, Turbiani C, Menini C, Tomasi P. Anti-A autoantibody associated
with immune hemolytic anemia. Vox Sang 1991;61:75.
33. Atichartakarn V, Chiewsilp P, Ratanasirivanich P, Stabunswadgan S.
Autoimmune hemolytic anemia due to anti B autoantibody. Vox Sang
1985;49:301-303.
34. Aygun B, Padmanabhan S, Paley C, Chandrasekaran V. Clinical significance
of RBC alloantibodies and autoantibodies in sickle cell patients who
received transfusions. Transfusion 2002;42:37-43.
35. Özen M, Erkul S, Alptekin Erkul GS, Genç Ö, Akgül E, Vural AH. Therapeutic
plasma exchange ameliorates incompatible crossmatches. Turk J Hematol
2016;33:356-358.
36. Rydberg L. ABO-incompatibility in solid organ transplantation. Transfus
Med 2001;11:325-342.
37. Genberg H, Kumlien G, Wennberg L, Berg U, Tydén G. ABO-incompatible
kidney transplantation using antigen-specific immunoadsorption and
rituximab: a 3-year follow-up. Transplantation 2008;85:1745-1754.
38. Urbani L, Cardoso J, Soubrane O, Houssin D, Gautreau C. Fab fragments from
intravenous immunoglobulin prevent hyperacute rejection in the guinea
pig-to-rat combination without reducing hemolytic complement activity
in rat serum. Transplant Proc 2000;32:2707-2709.
39. Jones RG, Landon J. A protocol for ‘enhanced pepsin digestion’: a step by
step method for obtaining pure antibody fragments in high yield from
serum. J Immunol Methods 2003;275:239-250.
40. Judd WJ, Steiner EA, Knafl PC. The gel test: sensitivity and specificity for
unexpected antibodies to blood group antigens. Immunohematology
1997;13:132-135.
60
BRIEF REPORT
DOI: 10.4274/tjh.2017.0112
Turk J Hematol 2018;35:61-65
Impact of Fluorescent In Situ Hybridization Aberrations and CLLU1
Expression on the Prognosis of Chronic Lymphocytic Leukemia:
Presentation of 156 Patients from Turkey
Kronik Lenfositik Lösemi Hastalarının Prognozunda Floresan İn Situ Hibridizasyon
Aberasyonları ve CLLU1 Ekspresyonunun Etkisi: Türkiye’den 156 Hastanın Sunumu
Ümmet Abur 1 , Gönül Oğur 1 , Ömer Salih Akar 1 , Engin Altundağ 1 , Huri Sema Aymelek 1 , Düzgün Özatlı 2 , Mehmet Turgut 2
1
Ondokuz Mayıs University Faculty of Medicine, Department of Medical Genetics, Samsun, Turkey
2
Ondokuz Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey
Abstract
Objective: This study evaluates the impact of CLLU1 expression and
fluorescent in situ hybridization (FISH) analysis of a group of Turkish
chronic lymphocytic leukemia (CLL) patients.
Materials and Methods: A total of 156 CLL patients were analyzed
by FISH method; 47 of them were also evaluated for CLLU1 expression.
Results were correlated with clinical parameters.
Results: FISH aberrations were found in 62% of patients. These
aberrations were del13q14 (67%), trisomy 12 (27%), del11q22 (19%),
del17p (8%), and 14q32 rearrangements (20%). Overall del11q22 and
del17p were associated with the highest mortality rates, shortest
overall survival (OS), and highest need for medication. Homozygous
del13q14, 14q32 rearrangements, and higher CLLU1 expression
correlated with shorter OS.
Conclusion: Cytogenetics/FISH analysis is still indicated for routine
evaluation of CLL. Special consideration is needed for the poor
prognostic implications of del11q22, del17p, 14q32 rearrangements,
and homozygous del13q14. The impact of CLLU1 expression is not yet
clear and it requires more data before becoming routine in genetic
testing in CLL patients.
Keywords: Chronic leukemia, Chronic lymphocytic leukemia,
Cytogenetics/FISH, CLLU1
Öz
Amaç: Bu çalışma, bir grup Türk kronik lenfositik lösemi (KLL)
hastasında CLLU1 ekspresyonu ve floresan in situ hibridizasyon (FISH)
analizinin prognostik etkisini değerlendirmektedir.
Gereç ve Yöntemler: Yüz elli altı KLL hastası FISH yöntemiyle
analiz edildi. Bu 156 hastanın 47’sinde ek olarak CLLU1 ekspresyonu
incelendi. Sonuçlar klinik parametrelerle ilişkilendirildi.
Bulgular: FISH aberasyonu, hastaların %62’sinde bulundu.
Aberasyonların dağılımı del13q14 (%67), trizomi 12 (%27), del11q22
(%19), del17p (%8) ve 14q32’nin yeniden düzenlenmesi (%20) olarak
bulundu. En yüksek mortalite, en kısa sağkalım süresi ve en fazla
ilaç kullanımı del11q22 ve del17p grubunda idi. Homozigot 13q14
delesyonu, 14q32 yeniden düzenlenmesi ve yüksek CLLU1 ekspresyonu
olan hastalar kısa sağkalıma sahipti.
Sonuç: Sitogenetik/FISH analizi, KLL’nin prognostik değerlendirmesinde
ve yeni genetik moleküler belirteçlerin belirlenmesinde halen etkili
yöntemlerdir. del11q22, del17p, 14q32 yeniden düzenlenmesi ve
homozigot del13q14’ün kötü prognostik etkisi gözden kaçırılmamalıdır.
CLLU1’in KLL’de prognostik yeri tartışmalıdır. Çalışmamızda orta-kötü
prognostik bir kriter olarak belirmesine rağmen, KLL’de rutin genetik
testler arasına girebilmesi için daha fazla veri gereklidir.
Anahtar Sözcükler: Kronik lösemi, Kronik lenfositik lösemi,
Sitogenetik/FISH, CLLU1
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Ümmet ABUR, M.D.,
Ondokuz Mayıs University Faculty of Medicine, Department of Medical Genetics, Samsun, Turkey
Phone : +90 362 312 19 19
E-mail : ummetabur@hotmail.com ORCID-ID: orcid.org/0000-0002-4811-9321
Received/Geliş tarihi: March 16, 2017
Accepted/Kabul tarihi: November 09, 2017
61
Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL
Turk J Hematol 2018;35:61-65
Introduction
The clinical manifestation of chronic lymphocytic leukemia
(CLL) is variable. While some patients are asymptomatic for
years, others show a rapid progression of the disease [1].
Recent identifiers of high-risk patients include chromosomal
abnormalities, immunoglobulin heavy chain variable gene,
ZAP70, CD38, β2 microglobulin and lactate dehydrogenase
(LDH), and CLL upregulated gene 1 (CLLU1) expression [2].
The chromosomal abnormality rate in CLL is 30%-50%; this
rate reaches up to 70%-80% with the fluorescent in situ
hybridization (FISH) method [3,4]. FISH results have shown that
del13q14 is correlated with good prognosis whereas del11q22
and del17p indicate poor prognosis [5,6].
Unfortunately, CLL is genetically heterogeneous. Recently
relevant new genomic abnormalities such as NOTCH1 and
SF3B1 mutations as well as BIRC3 disruptions have been
described [7,8], but none of these genetic markers are unique
to CLL. CLLU1 is defined as the first gene specific to CLL. The
high expression level of CLLU1 seems to be unique in CLL [9].
However, its relevance to prognosis is still unclear.
In this study, the distribution and prognostic impact of
chromosomal aberrations via FISH as well as CLLU1 expression
levels were analyzed in a group of North Anatolian CLL patients.
Materials and Methods
Patients
Interphase FISH analysis was applied to blood or bone marrow
samples of 156 CLL patients. Of these, 47 were also evaluated
for CLLU1 expression and compared with 35 healthy controls.
Staging was done according to the modified Rai staging (MRS)
system. The results of the β2 microglobulin, LDH, white blood
cell (WBC) count, and absolute lymphocyte count were grouped
as high or low risk (Table 1).
FISH data were categorized as group 1: del13q14, group 2:
trisomy 12, group 3: del11q and del17p, and group 4: normal
FISH results. Additionally, two groups were formed with
14q32(IGH) rearrangements being positive or normal.
Interphase FISH
FISH analysis was performed by directly labeled probes (Vysis/
Abbott Co., Abbott Park, IL, USA). A FISH panel of 5 probes
(D13S319, LSI 13q34, LSI ATM, CEP12, LSI p53) was applied [10].
Seventy-one out of 156 patients were also tested by 14q32
break-apart probe.
FISH analyses were conducted using an Olympus BX51
microscope equipped with a Progressive Scan Video Camera
(Tokyo, Japan). Image analysis was carried out with CytoVision
software (version 3.93; Applied Imaging, Grand Rapids, MI, USA).
For each probe for optimization, a cut-off level was obtained
by counting 300 cells. Results were considered clonal when the
percentage of cells with any given chromosome abnormality
exceeded the normal cut-off value.
CLLU1 Expression
For the analysis of CLLU1 expression, RNA was isolated (QIAGEN,
Hilden, Germany); cDNA was synthesized using a cDNA Reverse
Transcription Kit (Ipsogen, QIAGEN). CLLU1 expression was tested
by real time-polymerase chain reaction (Rotor-Gene Q, QIAGEN)
using primers/probes previously defined (Ipsogen, CLLU1 Profile
Quant Kit). Analysis was performed using the comparative Ct
method of relative quantification with β2 microglobulin as an
endogenous control. The CLLU1 expression levels were measured
as fold upregulation in relation to normal patients’ cells and a
Table 1. Distribution of patients according to risk groups and chromosomal abnormalities (fluorescent in situ hybridization).
White blood cell
count
Absolute lymphocyte count b2 Microglobulin Lactate dehydrogenase
FISH
anomalies
Low
risk
(<50x10 3 /µL)
High
risk
(≥50x10 3 /µL)
Low
risk
(<30x10 3 /uL)
High
risk
(≥30x10 3 /µL)
Low
risk
(<2300 g/
mL)
High
risk
(≥2300
ng/mL)
Low
risk
(<500
U/L)
High
risk
(≥500 U/L)
del 11q22/del17p
(TP53)
12 (50%) 12 (50%) 7 17 (71%) 6 17 (71%) 7 (78%) 2 (22%)
del13q14 24 (65%) 13 (35%) 20 17 (45%) 19 15 (44%) 36 (95%) 2 (5%)
Trisomy 12 14 (65%) 5 (35%) 15 4 (21%) 8 10 (55%) 14 (74%) 5 (26%)
Normal 47 (79%) 13 (21%) 42 18 (30%) 22 32 (60%) 51 (88%) 7 (12%)
p-value <0.05 <0.05 >0.05 >0.05
FISH: Fluorescent in situ hybridization.
62
Turk J Hematol 2018;35:61-65
Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL
cut-off value was defined to separate high from low expression
levels [11].
Statistical Analysis
The chi-square test was applied to determine the relationship
among clinical and laboratory parameters (LDH and β2
microglobulin, WBC, MRS, CLLU1 expression, and subsets of FISH
abnormalities). Overall survival (OS) was tested by the Kaplan-
Meier method. The survival curves were statistically compared
using a log-rank test (p≤0.05).
Results
Patient Population
Of 156 patients, 103 patients were male. Ages ranged from 36
to 90 years (median: 68 years). In total, 37 patients died during
the study. The median OS time was 101±12 months.
Results of FISH
FISH analysis detected aberrations in 96 patients (62%). The
most frequent abnormality was del13q14 (67%), followed by
trisomy 12 (27%), del11q22 (19%), and del17p13 (8%). The
occurrence of del13q14 and del11q22 was the most frequent
complex abnormality (Table 2). 14q32 rearrangements were
detected in 14 of 71 patients (20%).
The shortest survival was observed with del11q and del17p
and trisomy 12; the longest survival was with del13q14
and in normal patients (p>0.05). The need for medication
was significantly higher for del11q22 and del17p (p<0.05).
Homozygous del13q14 showed twofold shorter OS (p>0.05) and
was categorized in the high-risk group (p<0.05) (Table 3). Positive
14q32 rearrangements showed a twofold increase in mortality
and need for medication (p>0.05). They were categorized in the
intermediate- to high-risk group (p<0.05).
FISH results were correlated with MRS. The 11q22 and 17p13
deletions had an advanced stage (p<0.05), as well as higher
WBC and absolute lymphocyte counts (p<0.05). No difference
was observed within groups with respect to β2 microglobulin
and LDH and initiation of therapy (p>0.05) (Table 1).
Results of CLLU1 Expression
CLLU1 expression represented a continuum ranging from 0.1 to
3900 and a median of 17.6-fold upregulation (Figure 1). In the
group with high CLLU1 expression, survival time was twofold
lower and the need for medication was twofold higher (p>0.05).
High CLLU1 expression was associated with higher WBC count.
Table 2. Frequencies of fluorescent in situ hybridization
anomalies in chronic lymphocytic leukemia patients.
Main FISH anomalies Patient (n) Percent (%)
Heterozygote del13q14 64 67
Trisomy 12 26 27
del11q22 18 19
del17p13 8 8
Complex FISH anomalies
del13q14 + del11q22 (most common) 9 33
Homozygote del13q14 6 22
del11q22 + trisomy 12 2 7
del13q14 + del17p13 3 11
del13q14 + trisomy 12 4 15
del13q14 + del13q34 1 4
del13q14 + del13q34 + del17p13 1 4
Homozygote del13q14 + del17p13 1 4
Total 27 100
FISH: Fluorescent in situ hybridization.
Table 3. Correlation of the genetic markers with overall survival and medication.
Genetic markers Overall survival (months) No medication Medication Total
Normal 123±22 months 35 (59%) 24 (41%) 59
del11q22/del17p13 77±12 months 1 (11%) 8 (89%)* 9
Trisomy 12 74±7 months 12 (60%) 8 (40%) 20
Heterozygote del13q14 98±22 months 22 (58%) 16 (42%) 38
Homozygote del13q14 47±4 months 3 (50%) 3 (50%) 6
High expression CLLU1 levels 48±3 months 13 (46%) 15 (54%) 28
Low expression CLLU1 levels 82±8 months 4 (21%) 15 (79%) 19
*p<0.05.
63
Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL Turk J Hematol 2018;35:61-65
Table 4. Comparison of prognostic markers in the group with high CLLU1 expression with the findings of previous studies.
Overall survival Need for
medication
Advanced stage High β2
microglobulin level
FISH
anomalies
Age
Our study
Shorter
(p>0.05)
High
(p>0.05)
-
(p>0.05)
-
(p>0.05)
-
(p>0.05)
-
(p>0.05)
Buhl et al. [18]
Shorter
(p<0.05)
High
(p<0.05)
+
(p<0.05)
NA +*
(p<0.05)
NA
Chen et al. [20] NA NA +
(p<0.05)
Josefsson et al.
[11]
Gonzalez et al.
[19]
Shorter
(p<0.05)
Shorter
(p<0.05)
High
(p<0.05)
-
(p>0.05)
(p>0.05) NA +
(p<0.05)
NA -
(p>0.05)
NA +*
(p<0.05)
-
(p>0.05)
NA
-
(p>0.05)
+
(p<0.05)
*del11q22 and del17p group correlation.
NA: Not available, FISH: fluorescent in situ hybridization.
There was no correlation between CLLU1 expression and FISH
anomalies, β2 microglobulin and LDH levels, or MRS (p>0.05).
Discussion
Genetic markers have been major factors in the prognostic
evaluation of CLL. The chromosomal anomaly detection rate with
FISH is 70%-80% [3]. In our study, the FISH abnormality rate
was 62%. Detected abnormalities include del13q14 (40%-60%),
trisomy 12 (15%-20%), del11q22 (10%-20%), and del17p13
(5%-10%). Our study yielded a similar pattern. Survival was
significantly shorter among patients with del11q12 and del17p13.
Similar to the literature data, significant correlation was observed
between these two deletions and poor prognosis [5,6,12]. In this
study, patients with positive 14q32 rearrangements also had poor
outcomes, as shown in some previous reports [13,14].
Few studies refer to homozygote del13q14, and its contribution
to prognosis is unclear. Some have reported that homozygote
del13q14 is associated with an advanced stage [15,16], while
Puiggros et al. [17] noted the opposite. In our study, homozygote
del13q14 was correlated with advanced stage and shorter
survival.
Previous studies reported that TP53, NOTCH, SF3B1, and BIRC3
mutations are accountable for poor prognosis [7,8]. The impact
of CLLU1 expression as a new prognostic factor in CLL is unclear.
In the present report, high CLLU1 expression indicated shorter
survival and higher need for treatment. Similar results were
observed in the literature [11,18,19].
In our study, there was no correlation between CLLU1 expression
and FISH aberrations. Some have reported that patients with
del17p13 and del11q22 have significantly higher levels of CLLU1
[11,18]. Chen et al. [20] noted the opposite. Buhl et al. [21] reported
no increase in the level of CLLU1 in patients with trisomy 12;
Gonzalez et al. [19] noted the opposite. There was no correlation
between trisomy 12 and CLLU1 expression in our study (Table 4).
Figure 1. Levels of CLLU1 expression: a, b, d, g- patients; c-
standard; e, f- healthy controls.
Conclusion
A chromosomal evaluation is still needed for the genetic
evaluation of CLL because it can identify unique translocations
or aberrations in which breakpoints could lead to identification
of new molecular markers. Application of a FISH panel including
probes aiming to detect homozygous del13q14, del11q22,
del17p, 14q32 rearrangements, and trisomy 12 should still be
the routine. The impact of testing CLLU1 expression is not yet
clear and there is a need for more relevant data.
Ethics
Ethics Committee Approval: This study had the permission
of the Ondokuz Mayıs University Ethical Committee (approval
number: 201/855).
Informed Consent: It was received.
Authorship Contributions
Surgical and Medical Practices: G.O., M.T., D.Ö.; Concept: G.O.,
D.Ö., M.T.; Design: Ü.A., Ö.S.A., H.S.A.; Data Collection or
Processing: Ü.A., E.A., Ö.S.A.; Analysis or Interpretation: Ü.A., E.A.;
Literature Search: Ü.A., H.S.A., E.A., Ö.S.A.; Writing: G.O., Ü.A.
64
Turk J Hematol 2018;35:61-65
Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
References
1. Gentile M, Mauro FR, Guarini A, Foà R. New developments in the diagnosis,
prognosis and treatment of chronic lymphocytic leukemia. Curr Opin Oncol
2005;17:597-604.
2. Byrd JC, Stilgenbauer S, Flinn IW. Chronic lymphocytic leukemia.
Hematology Am Soc Hematol Educ Program 2004;163-183.
3. Dicker F, Schnittger S, Haferlach T, Kern W, Schoch C. Immunostimulatory
oligonucleotide-induced metaphase cytogenetics detect
chromosomal aberrations in 80% of CLL patients: a study of 132 CLL
cases with correlation to FISH, IgVH status, and CD38 expression. Blood
2006;108:3152-3160.
4. Shanafelt TD, Geyer SM, Kay NE. Prognosis at diagnosis: integrating
molecular biologic insights into clinical practice for patients with CLL.
Blood 2004;103:1202-1210.
5. Lai YY, Huang XJ. Cytogenetic characteristics of B cell chronic lymphocytic
leukemia in 275 Chinese patients by fluorescence in situ hybridization: a
multicenter study. Chin Med J (Engl) 2011;124:2417-2422.
6. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L,
Döhner K, Bentz M, Lichter P. Genomic aberrations and survival in chronic
lymphocytic leukemia. N Engl J Med 2000;343:1910-1916.
7. Puiggros A, Blanco G, Espinet B. Genetic abnormalities in chronic
lymphocytic leukemia: where we are and where we go. Biomed Res Int
2014;2014:435983.
8. Stilgenbauer S, Schnaiter A, Paschka P, Zenz T, Rossi M, Döhner K, Bühler A,
Böttcher S, Ritgen M, Kneba M, Winkler D, Tausch E, Hoth P, Edelmann J,
Mertens D, Bullinger L, Bergmann M, Kless S, Mack S, Jäger U, Patten N, Wu
L, Wenger MK, Fingerle-Rowson G, Lichter P, Cazzola M, Wendtner CM, Fink
AM, Fischer K, Busch R, Hallek M, Döhner H. Gene mutations and treatment
outcome in chronic lymphocytic leukemia: results from the CLL8 trial. Blood
2014:123:3247-3254.
9. Buhl AM, James DF, Neuberg D, Jain S, Rassenti LZ, Kipps TJ. Analysis of
CLLU1 expression levels before and after therapy in patients with chronic
lymphocytic leukemia. Eur J Haematol 2011;86:405-411.
10. Schoch C, Schnittger S, Bursch S, Gerstner D, Hochhaus A, Berger U,
Hehlmann R, Hiddemann W, Haferlach T. Comparison of chromosome
banding analysis, interphase and hypermetaphase-FISH, qualitative and
quantitative PCR for diagnosis and for follow-up in chronic myeloid
leukemia: a study on 350 cases. Leukemia 2002;16:53-59.
11. Josefsson P, Geisler CH, Leffers H, Petersen JH, Andersen MK, Jurlander J,
Buhl AM. CLLU1 expression analysis adds prognostic information to risk
prediction in chronic lymphocytic leukemia. Blood 2007;109:4973-4979.
12. Ripollés L, Ortega M, Ortuño F, González A, Losada J, Ojanguren J, Soler JA,
Bergua J, Coll MD, Caballín MR. Genetic abnormalities and clinical outcome
in chronic lymphocytic leukemia. Cancer Genet Cytogenet 2006;171:57-64.
13. Pittman S, Catovsky D. Prognostic significance of chromosome abnormalities
in chronic lymphocytic leukaemia. Br J Haematol 1984;58:649-660.
14. Cavazzini F, Hernandez JA, Gozzetti A, Russo Rossi A, De Angeli C, Tiseo R,
Bardi A, Tammiso E, Crupi R, Lenoci MP, Forconi F, Lauria F, Marasca R, Maffei
R, Torelli G, Gonzalez M, Martin-Jimenez P, Maria Hernandez J, Rigolin GM,
Cuneo A. Chromosome 14q32 translocations involving the immunoglobulin
heavy chain locus in chronic lymphocytic leukaemia identify a disease
subset with poor prognosis. Br J Haematol 2008;142:529-537.
15. Stilgenbauer S, Sander S, Bullinger L, Benner A, Leupolt E, Winkler D, Kröber
A, Kienle D, Lichter P, Döhner H. Clonal evolution in chronic lymphocytic
leukemia: acquisition of high-risk genomic aberrations associated with
unmutated VH, resistance to therapy, and short survival. Haematologica
2007;92:1242-1245.
16. Shanafelt TD, Witzig TE, Fink SR, Jenkins RB, Paternoster SF, Smoley SA,
Stockero KJ, Nast DM, Flynn HC, Tschumper RC, Geyer S, Zent CS, Call TG,
Jelinek DF, Kay NE, Dewald GW. Prospective evaluation of clonal evolution
during long-term follow-up of patients with untreated early-stage chronic
lymphocytic leukemia. J Clin Oncol 2006;24:4634-4641.
17. Puiggros A, Delgado J, Rodriguez-Vicente A, Collado R, Aventín A, Luño
E, Grau J, Hernandez JÁ, Marugán I, Ardanaz M, González T, Valiente A,
Osma M, Calasanz MJ, Sanzo C, Carrió A, Ortega M, Santacruz R, Abrisqueta
P, Abella E, Bosch F, Carbonell F, Solé F, Hernández JM, Espinet B; Grupo
Cooperativo Español de Citogenética Hematológica (GCECGH) and Grupo
Español de Leucemia Linfática Crónica (GELLC). Biallelic losses of 13q do not
confer a poorer outcome in chronic lymphocytic leukaemia: analysis of 627
patients with isolated 13q deletion. Br J Haematol 2013;163:47-54.
18. Buhl AM, Jurlander J, Geisler CH, Pedersen LB, Andersen MK, Josefsson P,
Petersen JH, Leffers H. CLLU1 expression levels predict time to initiation
of therapy and overall survival in chronic lymphocytic leukemia. Eur J
Haematol 2006;76:455-464.
19. Gonzalez D, Else M, Wren D, Usai M, Buhl AM, Parker A, Oscier D, Morgan G,
Catovsky D. CLLU1 expression has prognostic value in chronic lymphocytic
leukemia after first-line therapy in younger patients and in those with
mutated IGHV genes. Haematologica 2013;98:274-278.
20. Chen L, Li J, Zheng W, Zhang Y, Wu Y, Li L, Qian S, Xu W. The prognostic
evaluation of CLLU1 expression levels in 50 Chinese patients with chronic
lymphocytic leukemia. Leuk Lymphoma 2007;48:1785-1792.
21. Buhl AM, Jurlander J, Jørgensen FS, Ottesen AM, Cowland JB, Gjerdrum
LM, Hansen BV, Leffers H. Identification of a gene on chromosome
12q22 uniquely overexpressed in chronic lymphocytic leukemia. Blood
2006;107:2904-2911.
65
BRIEF REPORT
DOI: 10.4274/tjh.2017.0266
Turk J Hematol 2018;35:66-70
Glomerular and Tubular Functions in Children and Adults with
Transfusion-Dependent Thalassemia
Transfüzyona Bağımlı Çocuk ve Erişkin Talasemi Hastalarında Glomerüler ve Tubuler Böbrek
Fonksiyonları
Agageldi Annayev 1 , Zeynep Karakaş 1 , Serap Karaman 1 , Altan Yalçıner 2 , Alev Yılmaz 3 , Sevinç Emre 3
1
İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey
2
Düzen Laboratories, İstanbul, Turkey
3
İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Nephrology, İstanbul, Turkey
Abstract
This study aimed at assessing renal functions in patients with
transfusion-dependent thalassemia (TDT). Fifty patients and 30
controls were enrolled in this prospective study. Serum levels of
electrolytes and albumin were measured by a spectrophotometer.
Serum levels of cystatin-C and urinary levels of β2-microglobulin
were measured by nephelometric method. Thirty-eight patients were
receiving deferasirox and 8 were on deferiprone. Serum electrolytes
and albumin levels of the patients were found to be within normal
ranges. Urinary β2-microglobulin and serum cystatin-C levels were
significantly higher in patients than controls. They did not significantly
differ between the subgroup of patients on deferiprone and the
control group, whereas they were found to be higher in patients using
deferasirox compared to controls. Urinary β2-microglobulin levels
significantly increased in patients who were receiving high-dose
deferasirox compared to those who were receiving a daily dose of
15-20 mg/kg or controls. Subclinical renal injury may be present in
TDT patients.
Keywords: Thalassemia, Tubulopathy, Glomerulopathy, β2-
Microglobulin, Cystatin
Öz
Bu çalışmada transfüzyona bağımlı talasemi (TBT) hastalarında
böbrek fonksiyonlarının değerlendirilmesi amaçlanmıştır. Prospektif
çalışmaya, 50 TBT ve 30 kontrol grubu dahil edildi. Serum elektrolitleri
ve albumin düzeyleri spektrofotometre ile ölçüldü. Serum sistatin-C ve
idrar β2-mikroglobülin düzeyleri nefelometrik yöntemle ölçüldü. Otuz
sekiz hasta deferasiroks, 8 hasta deferipron alıyordu. Hastaların serum
elektrolitleri ve albumin düzeyleri normal sınırlardaydı. İdrar β2-
mikroglobulin ve serum sistatin-C düzeyleri hasta grubunda kontrol
grubundakilere göre anlamlı derecede yüksekti. Serum Cys-C ve idrar
β2-mikroglobulin düzeyleri, deferipron kullananlar ve kontrol grubu
arasında anlamlı farklılık göstermezken, deferasiroks kullananlarda
kontrol grubuna göre daha yüksek bulundu. İdrar β2 mikroglobulin
düzeyleri, yüksek doz deferasiroks alan hastalarda, 15-20 mg/kg/
gün deferasiroks alanlara veya kontrol grubuna göre anlamlı şekilde
artmıştı. Transfüzyona bağımlı talasemi hastalarında subklinik olarak
renal hasar mevcut olabilir.
Anahtar Sözcükler: Talasemi, Tubulopati, Glomerulopati, β2-
Mikroglobulin, Sistatin C
Introduction
Iron accumulation may lead to renal damage in transfusiondependent
thalassemia (TDT) [1,2]. Cystatin C (Cys-C), a small
molecular weight protein, is filtered from the glomeruli,
reabsorbed from the tubular cells, and metabolized from the
kidneys. It is a good marker for glomerular filtration rate (GFR).
β2-Microglobulin (β2MG), a single-chain, low-molecular-weight
polypeptide, is filtered by the glomeruli, then reabsorbed and
catabolized in the proximal tubular cells. Increased urinary
excretion of β2MG may demonstrate tubular dysfunction. Our
study assessed kidney function in patients with TDT using serum
Cys-C (SCys-C) and urinary β2MG (Uβ2MG) measurements in
addition to routine tests, as well as the utility of these markers as
indicators for early glomerulopathy and tubulopathy.
Materials and Methods
Fifty patients with TDT, 25 under and 25 above the age of 18,
have been followed since their childhood by the Thalassemia
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Serap KARAMAN, M.D., İstanbul University İstanbul
Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey
Phone : +90 533 437 81 30
E-mail : drkaramans@yahoo.com ORCID-ID: orcid.org/0000-0002-7428-3897
Received/Geliş tarihi: July 17, 2017
Accepted/Kabul tarihi: July 28, 2017
66
Turk J Hematol 2018;35:66-70
Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients
Center at the İstanbul Faculty of Medicine of İstanbul University.
Twenty-two patients were male and 28 were female. The mean
age was 18.4±11.8 years (range: 2-45). Thirty age- and sexmatched
subjects were included in the control group. Ethical
approval was granted by the institutional review board and
patient consent was obtained.
Serum electrolytes, urine calcium/creatinine (uCa/Cr) and
fractional excretion of sodium (FENa), GFR, proteinuria, serum
Cr, and albumin levels were measured and were compared to
their reference ranges in the patient group. SCys-C and Uβ2MG
levels in the patient group were compared to those of the
controls and potential correlations between SCys-C or Uβ2MG
levels and the severity of anemia, ferritin levels, and chelation
therapy were also evaluated. Blood samples collected to
measure SCys-C were cold-centrifuged at 4000 rpm for 10 min.
A photometric analysis of serum albumin, urea, Cr, uric acid, and
electrolyte levels was conducted. Ferritin levels were measured
by the electrochemiluminescent immunoassay method. SCys-C
and Uβ2MG levels were measured by nephelometry.
Statistical analysis was done using SPSS 17.0.
Results
No significant differences were found between the patients
and controls in terms of age or sex (p>0.05). Demographic and
clinical characteristics of the patients are summarized in Table
1. In the patients, serum Na, K, Ca, P, Mg, urea, Cr, and albumin
were within normal limits. None of the patients had proteinuria.
The mean uCa/Cr ratio was found to be higher than the normal
level. Estimated GFR was elevated in the patient group (Table
2). SCys-C and Uβ2MG levels were higher in patients than
controls (p=0.001, p=0.010) (Table 3). SCys-C was increased with
age (r=0.376; p=0.007). No correlations were found between
Uβ2MG levels and age (r=-0.186, p=0.217).
Renal dysfunction was detected in 30 out of 50 patients. FENa
levels were increased in 8 patients, while Uβ2MG and SCys-C
levels were increased in 9 and 25 patients, respectively. In our
study, renal involvement was observed in 54% of the patients
under the age of 18 and 64% of the patients above the age of
18. No correlations were observed between the mean SCys-C
and Uβ2MG levels and pretransfusion hemoglobin and iron load
(p>0.05) (Figures 1 and 2). No correlations were found between
SCys-C and ferritin levels. The assessment of the correlations
between the Uβ2MG and ferritin levels in patients revealed that
Uβ2MG levels were greater than in the controls, particularly
in those who had a ferritin level of <500 ng/mL or >1000 ng/
mL (p=0.001). Although Uβ2MG levels were slightly elevated in
the patients who had ferritin levels between 500 and 1000 ng/
mL, the difference between the patients and controls was not
statistically significant (p>0.05).
The distribution of patients by their chelation therapy was
as follows: 38 patients (75.5%) were on deferasirox (DFX); 8
(16.3%) were on deferiprone (DFP). Among the patients who
were on DFX, 11 (31%) were receiving a dose of 15-20 mg/kg/
day, 13 (33%) were receiving a dose of 20-30 mg/kg/day, and 14
(36%) were receiving a dose of 30-40 mg/kg/day. When SCys-C
concentrations were categorized by iron chelation therapy, there
were no differences between the patients who were on DFP and
the controls, while significant differences were found between
Table 1. Demographics and clinical characteristics of the
patient group.
Mean
Age 18.4±11.8
years
Pretransfusion hemoglobin (g/dL) 8.7±0.78
Serum ferritin (ng/mL) 1770.8±1883
TSH (mIU/L) 2.7±1.14
fT4 (pmol/L) 11.3±2.15
n %
Age <18 years 25 50
>18 years 25 50
Sex Male 22 44
Female 28 56
Ferritin (ng/mL) <500 8 -
500-1000 10 -
1000-2500 23 -
>2500 9 -
Chelator Deferasirox 38 75.5
Deferiprone 8 16.3
None 4 8.2
Splenectomy No 33 66
Yes 17 34
Osteoporosis Yes 24 48
Liver iron concentration
(mg/g dry weight)
No 26 52
<7 21 50
7-15 11 26
>15 10 24
Non-MRI - 8 -
Heart T2* (ms) <10 2 4
10-20 3 6
>20 37 74
Non-MRI - 8 -
MRI: Magnetic resonance imaging.
67
Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients
Turk J Hematol 2018;35:66-70
Table 2. Renal function test results in the patient group and reference ranges.
Renal function tests Mean ± SD Min - Max Reference ranges*
FENa 0.65±0.32 0.15-1.54 <1%
Na, mmol/L 137.8±2.04 135-142 136-145
K, mmol/L 4.65±0.5 3.8-5.3 3.5-5.1
Ca, mg/dL 9.39±0.56 8.1-10.9 9.2-11
P, mg/dL 4.7±0.79 3.2-6 3.4-4.2
Mg, mg/dL 1.1±2.3 1.1-2.3 1.5-2.5
uCa/Cr 0.22±0.11 0.1-0.4 <0.2
Urea, mg/dL 30.24±9.44 9-45 5-50
Cr, mg/dL 0.42±0.16 0.2-0.79 0.4-0.7
Albumin, g/dL 4.64±0.36 4.1-5.3 2.9-4.6
GFR, mL/min/1.73 m 2 , 2-12 years 216±57.2 90-302 113±27
GFR, mL/min/1.73 m 2 , 13-21 years (female) 213±65 99-213 126±22
GFR, mL/min/1.73 m 2 , 13-21 years (male) 206±20.8 110-300 140±30
GFR, mL/min/1.73 m 2 , >21 years 180±55 81-248 70-145
*Reference ranges of the Clinical Biochemistry Laboratory of the Faculty Medicine of İstanbul University.
FENa: Fractional excretion of sodium, Ca: calcium, uCa: urine calcium Cr: creatinine, GFR: glomerular filtration rate, SD: standard deviation, min: minute.
Table 3. Serum cystatin-C and urinary β2-microglobulin
levels in the patient and control groups.
Patient group
(mean ± SD)
Control group
(mean ± SD)
p-value
SCys-C, mg/L 0.75±0.12 0.66±0.09 0.001
Uβ2MG, mg/L 0.35±0.43 0.20±0.01 0.010
SCys-C: Serum cystatin-C, Uβ2MG: urinary β2-microglobulin, SD: standard deviation.
the patients who were on DFX and the controls (p=0.002) (Table
4). No correlations were found between DFX dosages and SCys-C
concentrations. When urinary β2MG levels were categorized by
iron chelation therapy, there were no differences between the
patients who were on DFP and the controls, while significant
differences were found between the patients who were on DFX
and the controls (p=0.004) (Table 4). In the subgroup of patients
on DFX, the assessment of Uβ2MG and SCys-C levels by DFX doses
revealed that there were no significant differences between the
controls and patients who were taking DFX at a dose of 15-
20 mg/kg, while statistically significant differences were found
between controls and patients who were taking DFX at a dose
of 20-40 mg/kg (p=0.011). Uβ2MG levels were increased with
increasing DFX doses. SCys-C levels were higher in all patient
groups in comparison to the control group (p=0.013), but the
difference was not dose-related.
Discussion
In our study, serum electrolytes were within reference ranges,
but FENa levels were elevated in 8 patients. In another study,
FENa was elevated in 29% of 103 TBT patients [3]. Several
studies have reported normal FENa levels [4,5]. In our study
the Ca/Cr ratio was found to be higher than the upper limit of
the normal range in 28% of the patients. Higher Ca/Cr ratios
may be associated with tubular dysfunction as well as with
impaired calcium homeostasis or bone disorders. In our study,
osteoporosis was diagnosed in almost half of the patients. Some
studies have reported high levels of Uβ2MG in patients with
TBT [6,7,8], while other studies reported the opposite [5]. In our
study, Uβ2MG concentrations in patients were significantly
higher than in the controls. No significant differences were
found between the controls and the subgroup of patients who
were on DFP, whereas statistically significant differences were
found between the controls and the DFX subgroup. Positive
68
Turk J Hematol 2018;35:66-70
Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients
Table 4. The comparisons of urinary β2-microglobulin and serum cystatin-C levels between the control group and the subgroups
of patients who were on chelation therapy with deferiprone or deferasirox.
Deferiprone (n=8) Deferasirox (n=38) Controls (mean ± SD) p-value* p-value**
SCys-C, mg/L 0.73±0.09 0.75±0.13 0.66±0.09 NS 0.002
Uβ2MG, mg/L 0.20±0.01 0.39±0.49 0.20±0.01 NS 0.004
*p: DFP vs. controls; **p: DFX vs. controls.
NS: Nonsignificant, Uβ2MG: urinary β2-microglobulin, SCys-C: serum cystatin-C, SD: standard deviation.
Figure 1. Correlations between pretransfusion hemoglobin and
urinary β2-microglobulin and serum cystatin-C.
Uβ2MG: Urinary β2-microglobulin, SCys-C: serum cystatin-C, Hb:
hemoglobin.
correlations between the Uβ2MG levels and DFX doses suggested
that DFX might cause dose-dependent tubulopathy. Uβ2MG
levels were significantly higher in patients than the controls,
particularly in patients who had ferritin levels of <500 ng/mL or
Figure 2. Correlations between heart T2* and Uβ2MG and SCys-C.
Uβ2MG: Urinary β2-microglobulin, SCys-C: serum cystatin-C, MRI:
magnetic resonance imaging.
>1000 ng/mL, whereas even though Uβ2MG levels were slightly
elevated in the subgroup of patients with ferritin between 500
and 1000 ng/mL, the difference between this subgroup and the
control group was not statistically significant. No associations
were found between Uβ2MG levels and iron load.
69
Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients
Turk J Hematol 2018;35:66-70
GFR has been a commonly used method to measure kidney
functions. In two studies, no significant differences were found
in GFR between patients and controls [3,9]. In our study, GFR
in the patient group was higher than the upper limit of the
age-adjusted reference range. The routine markers of kidney
function, including serum urea and Cr levels, were within
normal limits in all patients, in line with similar studies in the
literature [10,11,12].
Some studies reported higher SCys-C levels in patients with
TBT [13,14,15]. In our study, SCys-C levels were found to
be significantly higher in the patients in comparison to the
controls. No differences were found between the patients who
were taking DFP and the controls, while SCys-C levels were
significantly higher in patients on DFX in comparison to the
controls. No correlations were found between SCys-C or ferritin
levels and pretransfusion Hb, liver, and heart T2* values, while
SCys-C levels increased with age. Koliakos et al. [16] revealed
that the urinary markers of tubular dysfunctions correlated
positively with serum ferritin and liver iron deposition in
patients with TBT. Papassotiriou et al. [17] detected elevated
SCys-C in patients who received DFX at doses of 20-40 mg/kg/
day. Acute kidney injury has been reported in 40% of patients
on deferoxamine [18]. None of our patients were taking
deferoxamine during this study.
Conclusion
In conclusion, patients with TDT may develop renal dysfunction.
In follow-up, regular testing for early markers in addition to
routine kidney function tests may be beneficial to prevent
future severe kidney dysfunction.
Ethics
Ethics Committee Approval: İstanbul University İstanbul
Faculty of Medicine (approval number: 07.03.2014/05).
Informed Consent: Patients consent was obtained.
Authorship Contributions
Surgical and Medical Practices: Z.K., A.A.; Concept: Z.K., S.E.;
Design: S.K., A.Y.; Data Collection or Processing: A.A.; Analysis
or Interpretation: A.Y.; Literature Search: A.A., A.Y., S.K.; Writing:
S.K., A.A., Z.K.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Steinberg MH, Forget, BG, Higgs DR, Weatherall DJ. Disorders of Hemoglobin:
Genetics, Pathophysiology, Clinical Management. 2 nd ed. Cambridge,
Cambridge University Press, 2009.
2. Musallam KM, Capellini MD, Taher AT. Iron overload in β-thalassemia
intermedia: an emerging concern. Curr Opin Hematol 2013;20:187-192.
3. Mohkam M, Shamsian BS, Gharib A, Nariman S, Arzanian MT. Early markers
of renal dysfunction in patients with beta-thalassemia major. Pediatr
Nephrol 2008;23:971-976.
4. Aldudak B, Karabay Bayazit A, Noyan A, Ozel A, Anarat A, Sasmaz I, Kilinç Y,
Gali E, Anarat R, Dikmen N. Renal function in pediatric patients with betathalassemia
major. Pediatr Nephrol 2000;15:109-112.
5. Jafari HM, Vahidshahi K, Kosaryan M, Karami H, Mandavi MR. Ehteshami S.
Major beta-thalassemia, use of desferiexamine and renal proximal tubular
damage. Bratisl Lek Listy 2011;112:278-281.
6. Sadeghi-Bojd S, Hashemi M, Karimi M. Renal tubular function in patients
with beta-thalassaemia major in Zahedan, southeast Iran. Singapore Med J
2008;49:410-412.
7. Mula-Abed WA, Al-Hashmi HS, Al-Muslahi MN. Indicators of renal
glomerular and tubular functions in patients with beta-thalassaemia major:
A cross sectional study at the Royal Hospital, Oman. Sultan Qaboos Univ
Med J 2011;11:69-76.
8. Deveci B, Kurtoglu A, Kurtoglu E, Salim O, Toptas T. Documentation of
renal glomerular and tubular impairment and glomerular hyperfiltration in
multitransfused patients with beta thalassemia. Ann Hematol 2016;95:375-
381.
9. Kalman S, Atay AA, Sakallioglu O, Ozgürtaş T, Gök F, Kurt I, Kürekçi AE, Ozcan
O, Gökçay E. Renal tubular function in children with beta-thalassemia
minor. Nephrology (Carlton) 2005;10:427-429.
10. Smolkin V, Halevy R, Levin C, Mines M, Sakran W, Ilia K, Koren A. Renal
function in children with beta-thalassemia major and thalassemia
intermedia. Pediatr Nephrol 2008;23:1847-1851.
11. Lai ME, Spiga A, Vacquer S, Carta MP, Corrias C, Ponticelli C. Renal function
in patients with β-thalassaemia major: a long-term follow-up study.
Nephrol Dial Transplant 2012;27:3547-3551.
12. Almadzadeh A, Jalali A, Assar S, Khalilian H, Zandian K, Pedram M. Renal
tubular dysfunction in pediatric patients with beta-thalassemia major.
Saudi J Kid Dis Transpl 2011;22:497-450.
13. Economou M, Printza N, Teli A, Tzimouli V, Tsatra I, Papachristou F,
Athanassiou-Metaxa M. Renal dysfunction in patients with beta-thalassemia
major receiving iron chelation therapy either with deferoxamine and
deferiprone or with deferasirox. Acta Haematol 2010;123:148-152.
14. Ali BA, Mahmoud AM. Frequency of glomerular dysfunction in children
with beta thalassaemia major. Sultan Qaboos Univ Med J 2014;14:88-94.
15. Hamed AE, Elmelegy NT. Renal functions in pediatric patients with betathalassemia
major: relation to chelation therapy: original prospective study.
Ital J Pediatr 2010;30:36-39.
16. Koliakos G, Papachristou F, Koussi A, Perifanis V, Tsatra I, Souliou E,
Athanasiou M. Urine biochemical markers of early renal dysfunction are
associated with iron overload in beta-thalassaemia. Clin Lab Haematol
2003;25:105-109.
17. Papassotiriou I, Margeli A, Hantzi E, Delaporta P, Sergounioti A, Goussetis
E, Ladis V, Kattamis A. Cystatin C levels in patients with beta-thalassemia
during deferasirox treatment. Blood Cells Mol Dis 2010;44;152-155.
18. Prasannan L, Flynn JT, Levine JE. Acute renal failure following deferoxamine
overdose. Pedi¬atr Nephrol 2003;18:283-285.
70
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2016.0262
Turk J Hematol 2018;35:71-72
Ascites in the Course of Plasma Cell Myeloma Complicated by AL
Amyloidosis
AL Amiloidoz ile Komplike Plazma Hücre Miyeloması Seyrindeki Asitler
Jakub Debski 1 , Lidia Usnarska-Zubkiewicz 1 , Katarzyna Kapelko-Słowik 1 , Aleksander Pawluś 2 , Urszula Zaleska-Dorobisz 1 ,
Kazimierz Kuliczkowski 1
1
Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Hematology, Blood Neoplasms and Bone Marrow Transplantation,
Wroclaw, Poland
2
Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Radiology, Wroclaw, Poland
A 60-year-old Caucasian male with plasma cell myeloma
(PCM) immunoglobulin G (IgG) kappa, International Staging
System stage 3, diagnosed 5 months ago, was admitted to the
department of hematology due to progression of the disease.
He had completed three cycles of chemotherapy comprising
bortezomib, thalidomide, and dexamethasone; one cycle
comprising vincristine, doxorubicin, and dexamethasone;
and two cycles comprising lenalidomide and dexamethasone,
without any clinically significant response. Three weeks before
visiting the hospital, the patient also started complaining
of progressive weakness, impaired respiratory function,
and abdominal distension; an abdominal ultrasound at the
time revealed hepatosplenomegaly with ascites, most likely
associated with portal hypertension and protein disturbance,
which initially he tolerated very well. Physical examination
revealed crackles over the basal areas of the lungs, an enlarged
spleen and liver, ascites (stage 2), and peripheral pitting edema.
Bone marrow aspiration revealed that plasmacytes accounted
for 58% of all nucleated cells. Laboratory tests revealed the
following: serum monoclonal IgG, 88.4 g/L (normal: 8-17) and
β2-microglobulin, 26.8 mg/L (normal: 1.09-2.53). An abdominal
wall fat pad biopsy was positive for amyloid by Congo red
staining; this correlated with elevated B-type natriuretic peptide
levels (818.7 pg/mL; normal: 0-125). Peritoneal paracentesis was
performed and 650 mL of red fluid was aspirated. Laboratory
tests revealed a serum-ascites albumin gradient of 1.1 g/dL,
with elevated lactate dehydrogenase. Microscopic examination
of slide preparations revealed extensive monotonous infiltration
by plasmacytes and plasmablasts with highly atypical nuclei
Figure 1. A) Microscopic evaluation of plasmacytes and
plasmablasts in an ascitic fluid smear (modified Wright-Giemsa
stain, 400 x ). B) Multiple myelomatous infiltrations of the
peritoneal cavity (computed tomography scan, axial plane).
C) Multiple myelomatous infiltrations of the peritoneal cavity
(computed tomography scan, sagittal plane).
and wide polymorphism; monoclonality (CD38+ CD56+ CD45+
CD138+ cyκ+) was confirmed by immunophenotyping (Figure
1A). Computed tomography of the abdomen and thorax
revealed interstitial changes in the lower lobes of the lungs;
pathological contrast enhancement of enlarged (up to 16-20
mm in diameter) paraaortic, paratracheal, and mediastinal
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Jakub DEBSKI, M.D.,
Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Hematology, Blood Neoplasms and
Bone Marrow Transplantation, Wroclaw, Poland
Phone : +48 71 784 2610
E-mail : jmdebski@gmail.com ORCID-ID: orcid.org/0000-0002-2944-0929
Received/Geliş tarihi: July 05, 2016
Accepted/Kabul tarihi: August 15, 2016
71
Debski J, et al: Plasma Cell Myeloma
Turk J Hematol 2018;35:71-72
lymph nodes; hepatosplenomegaly with ascites and dilatation
of the portal venous system; multiple infiltrations of the
abdominal wall (described as peritoneal carcinomatosis);
focal osteolysis of the thoracic and lumbar vertebrae; and
enlargement of the right ventricle (Figures 1B and 1C). This
clinical presentation reflected aggressive features of advanced,
chemoresistant PCM with coexisting AL amyloidosis. Due to the
high level of monoclonal proteins in the serum, we performed
plasmapheresis and implemented a salvage chemotherapy
regimen based on bendamustine. However, despite intensive
treatment, the patient died of disease progression.
Ascites is an extremely rare extramedullary manifestation of a
heterogeneous clinical entity such as PCM, although it is worth
noting that it has a greater predilection for the IgA subtype than
for IgG [1,2]. Similarly, as in the current case, the condition may
have multifactorial etiology associated with PCM progression,
i.e. infiltration of the liver, heart failure, renal failure, portal
hypertension, amyloidosis, and, finally, peritoneal myelomatous
deposits [3]. Despite multimodal treatment, including radiation
therapy, plasmapheresis, systemic chemotherapy based on
novel drugs, and hematopoietic stem cell transplantation, the
appearance of ascites heralds a dismal prognosis; median overall
survival is usually no longer than 2 months [2,4].
Keywords: Myeloma, Amyloidosis, Ascites
Anahtar Sözcükler: Miyelom, Amiloidoz, Asit
Informed Consent: It was received.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Morgan D, Cieplinski W. Myelomatous ascites. Am J Med Sci 1985;290:159-
164.
2. Mitra S, Mukherjee S, Chakraborty H, Bhattacharyya M. IgG lambda
myeloma presenting as plasmacytic ascites: case report and review of
literature. Indian J Hematol Blood Transfus 2015;31:472-479.
3. Karp SJ, Shareef D. Ascites as a presenting feature multiple myeloma. J R
Soc Med 1987;80:182-184.
4. Kyle RA, Gertz MA, Witzig TE, Lust JA, Lacy MQ, Dispenzieri A, Fonseca R,
Rajkumar SV, Offord JR, Larson DR, Plevak ME, Therneau TM, Greipp PR.
Review of 1027 patients with newly diagnosed multiple myeloma. Mayo
Clin Proc 2003;78:21-33.
72
IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2016.0404
Turk J Hematol 2018;35:73-74
Pachymeningeal Involvement with Blindness as the Presenting
Manifestation of Non-Hodgkin Lymphoma
Hodgkin Dışı Lenfomada Başlangıç Bulgusu Olarak Körlük ile Birlikte Pakimeningeal Tutulum
Charanpreet Singh 1 , Arjun Lakshman 1 , Aditya Jandial 2 , Sudha Sharma 3 , Ram Nampoothiri 2 , Gaurav Prakash 2 ,
Pankaj Malhotra 2
1
Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Chandigarh, India
2
Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Clinical Hematology and Bone Marrow Division,
Chandigarh, India
3
Postgraduate Institute of Medical Training and Research, Department of Pathology, Chandigarh, India
A 44-year-old female presented with fever for 6 months and
gradual-onset progressive diminution of vision in both eyes for 1
month. On examination, she had enlarged cervical, axillary, and
inguinal lymph nodes; hepatomegaly (7 cm under the right costal
margin); splenomegaly (5 cm under the left costal margin); and
bilateral renomegaly. Examination of the optic fundi (Figures
1A and 1B) showed bilateral disc edema (black arrowhead) with
hemorrhages in the right eye (white arrowhead). Contrastenhanced
magnetic resonance imaging of the brain (Figure 2A)
was done, which showed pachymeningeal enhancement (white
arrow). Histopathological examination of the excised cervical
lymph node showed infiltration by atypical lymphoid cells, with
immunohistochemistry suggesting diffuse large B-cell lymphoma
(DLBCL)-activated B-cell-like. Microscopic examination of
cerebrospinal fluid showed infiltration by malignant lymphoid
cells (Figure 2B). A diagnosis of non-Hodgkin lymphoma-DLBCL
with secondary central nervous system (CNS) involvement and
bilateral grade 4 papilledema, likely due to pachymeningeal
involvement, was made. The patient was started on systemic
and intrathecal chemotherapy.
CNS involvement with aggressive lymphomas is uncommon
at initial presentation and usually occurs during relapse after
primary therapy [1]. Ophthalmological abnormalities are usually
Figure 1. A) Right fundus photograph showing optic disc edema
with multiple hemorrhages. B) Left fundus photograph showing
large optic disc with blurred margins suggestive of papilledema.
Figure 2. A) Contrast-enhanced magnetic resonance imaging
of the brain showing patchy meningeal enhancement and
thickening, suggestive of pachymeningitis. B) Cerebrospinal fluid
cytology showing atypical lymphoid cells 2-3 times the size of
normal lymphoid cells with prominent nucleoli.
©Copyright 2018 by Turkish Society of Hematology
Turkish Journal of Hematology, Published by Galenos Publishing House
Address for Correspondence/Yazışma Adresi: Pankaj MALHOTRA, M.D.,
Postgraduate Institute of Medical Training and Research, Department of Internal Medicine,
Clinical Hematology and Bone Marrow Division, Chandigarh, India
Phone : +91 386 280 38 08
E-mail : pgimerhemat@gmail.com ORCID-ID: orcid.org/0000-0003-1198-8491
Received/Geliş tarihi: October 12, 2016
Accepted/Kabul tarihi: November 15, 2016
73
Singh C, et al: Pachymeningeal Involvement with Blindness
Turk J Hematol 2018;35:73-74
attributed to the direct invasion of the optic nerve and ocular
structures by the lymphoma [2], which was not seen in our case.
Keywords: Non-Hodgkin lymphoma, Central nervous system
involvement, Blindness, Papilledema
Anahtar Sözcükler: Hodgkin dışı lenfoma, Merkezi sinir sistemi
tutulumu, Körlük, Papilödem
Informed Consent: It was received.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Gleissner B, Chamberlain M. Treatment of CNS dissemination in systemic
lymphoma. J Neurooncol 2007;84:107-117.
2. Güler E, Kutluk T, Akalan N, Akyüz C, Atahan L, Büyükpamukçu M. Acute
blindness as a presenting sign in childhood non-Hodgkin lymphoma. J
Pediatr Hematol Oncol 2003;25:69-72.
74
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
Leukoagglutination, Mycoplasma pneumoniae Pneumonia, and
EDTA Acid Blood
Lökosit Agregasyonu, Mycoplasma pneumoniae Pnömonisi ve EDTA’lı Kan
Beuy Joob 1 , Viroj Wiwanitkit 2
1
Sanitation 1 Medical Academic Center, Bangkok, Thailand
2
Hainan Medical University, Hainan Sheng, China; DY Patil University Faculty of Medicine, Pune, India
To the Editor,
We read the report “Peculiar Cold-Induced Leukoagglutination
in Mycoplasma pneumoniae Pneumonia” with great interest [1].
Kubota et al. [1] reported an interesting patient with Mycoplasma
pneumoniae pneumonia who had leukoagglutination. They
noted that this is a rare condition. We agree that the patient
had leukoagglutination and Mycoplasma pneumoniae
pneumonia. Nevertheless, the leukoagglutination in this case
may or may not have been due to Mycoplasma pneumoniae
pneumonia. A common problem that might be forgotten is
EDTA-induced leukoagglutination [2]. This basic laboratory
interference phenomenon cannot be ruled out in the present
case. As noted by Grob and Angelillo-Scherrer, EDTA-dependent
leukoagglutination can be seen in healthy individuals and this is
not related to Mycoplasma pneumoniae pneumonia [3].
Keywords: EDTA, Leukoagglutination, Mycoplasma
Anahtar Sözcükler: EDTA, Lökosit agregasyonu, Mikoplazma
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Kubota Y, Hirakawa Y, Wakayama K, Kimura S. Peculiar cold-induced
leukoagglutination in Mycoplasma pneumoniae pneumonia. Turk J Hematol
2017;34:354-355.
2. Anand M, Gulati HK, Joshi AR. Pseudoleukopenia due to
ethylenediaminetetraacetate induced leukoagglutination in a case of
hypovolemic shock. Indian J Crit Care Med 2012;16:113-114.
3. Grob AV, Angelillo-Scherrer A. Leukoagglutination reported as platelet
clumps. Blood 2011;118:2940.
Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D.,
Sanitation 1 Medical Academic Center, Bangkok, Thailand
Phone : +90 386 280 38 08
E-mail : beuyjoob@hotmail.com ORCID-ID: orcid.org/0000-0002-5281-0369
Received/Geliş tarihi: November 28, 2017
Accepted/Kabul tarihi: December 01, 2017
DOI: 10.4274/tjh.2017.0425
75
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
Reply to the Authors:
To the Editor,
We thank Joob and Wiwanitkit [1] for their helpful comments regarding the cause of leukoagglutination in our case [2]. Although
the underlying mechanism of in vitro leukoagglutination has not been fully clarified, leukoagglutination can be classified into two
groups: (1) EDTA-dependent leukoagglutination, and (2) EDTA-independent cold-induced leukoagglutination [3,4]. As pointed out
by Joob and Wiwanitkit [1], both EDTA and cold agglutinin (CA) may have been implicated in our case, although high-titer CA was
detected, and numerous erythrocyte agglutinations were observed in the peripheral blood smear.
Screening for CA has shown that low-titer CAs may be found in the serum of healthy adults [5]; this may suggest the possibility
that naturally occurring CA is somewhat involved in EDTA-dependent leukoagglutination in healthy subjects. Nonetheless, when
leukoagglutination occurs in an EDTA-anticoagulated blood sample, additional examination of the sample using other anticoagulants
could be recommended to confirm the relationship between leukoagglutination and EDTA.
References
1. Joob B, Wiwanitkit V. Leukoagglutination, Mycoplasma pneumoniae pneumonia and EDTA blood. Turk J Hematol 2018;35:75.
Best Regards
Yasushi Kubota, Shinya Kimura
2. Kubota Y, Hirakawa Y, Wakayama K, Kimura S. Peculiar cold-induced leukoagglutination in Mycoplasma pneumoniae pneumonia. Turk J Hematol 2017;34:354-
355.
3. Goyal P, Agrawal D, Kailash J, Singh S. Cold-induced pseudoneutropenia in human immunodeficiency virus infection: first case report and review of related
articles. Indian J Hematol Blood Transfus 2014;30(Suppl 1):148-150.
4. Lee JH. Neutrophil aggregation on the peripheral blood smear in a patient with cold agglutinin disease. Ann Hematol 2017:96:885-886.
5. Dacie J. Auto-immune haemolytic anaemia (AIHA): cold-antibody syndromes II: immunochemistry and specificity of the antibodies; serum complement in autoimmune
haemolytic anaemia. In: Dacie J (ed). The Haemolytic Anaemias. Vol. 3. London, Churchill Livingstone, 1992.
76
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Cyclic Guanosine Monophosphate-Dependent Protein Kinase I
Stimulators and Activators Are Therapeutic Alternatives for Sickle
Cell Disease
Siklik Guanozin Monofosfat Bağımlı Protein Kinaz I Uyarıcıları ve Aktivatörleri Orak Hücreli
Anemide Tedavi Alternatifleridir
Mohankrishna Ghanta 1 , Elango Panchanathan 1 , Bhaskar VKS Lakkakula 2
1
Sri Ramachandra Medical College and Research Institute-DU, Faculty of Medicine, Department of Pharmacology, Chennai, Tamil Nadu, India
2
Sickle Cell Institute Chhattisgarh, Department of Molecular Genetics, Division of Research, Raipur, Chhattisgarh, India
To the Editor,
Sickle cell anemia (SCA) can lead to a host of complications,
including hemolysis, vaso-occlusive episodes (painful crises),
pulmonary hypertension, acute chest syndrome, and multiorgan
damage. SCA has no widely available cure. Furthermore, the
available treatments have unfavorable side effects, such
as myelosuppression of blood cells from continuous use of
hydroxyurea, iron overload from repeated blood transfusions,
or immunosuppressive treatments required to sustain a bone
marrow transplant. In patients with SCA, hemoglobin-induced
damage of endothelial cells can lead to endothelial dysfunction
due to the deficiency of nitric oxide (NO) [1]. NO is continuously
synthesized by the endothelium to maintain vascular tone.
The NO-soluble guanylate cyclase (sGC)-cyclic guanosine
monophosphate (cGMP) signaling (NO-sGC-cGMaP) pathway is
one of the three important signaling pathways that are regulated
by NO in maintaining the vascular tone. NO stimulates sGC in
the vascular smooth muscle cells to induce formation of cGMP.
This produced cGMP causes stimulation of cGMP-dependent
protein kinases (cGKs), which in turn stimulate voltagedependent
ion channels. The cGKs are serene and threonine
kinases, substrates for cGMP to elicit physiological functions.
cGKs inhibit calcium release from the endoplasmic reticulum
through the inositol 1,4,5-trisphosphate receptor-associated
cGMP kinase substrate (IRAG) and alternatively activate myosinlight-chain
phosphatase by inhibiting the MLC kinases, with
both mechanisms resulting in smooth muscle relaxation [2].
Two types of cGKs have been revealed to date. Mammalian cGKs
exist as two isoforms, cGKI and cGKII, which are coded by the
prkg1 and prkg2 genes, respectively. In humans two isoforms of
cGKI have been described, cGKI-α and cGKI-β, differing only in
their N-terminal parts and generated by alternative splicing of a
single gene. Northern blot analysis revealed that human cGKI-α
mRNA was present in the aorta, heart, kidneys, and adrenal
glands. In contrast, human cGKI-β mRNA was present only in
the uterus.
In SCA, vascular tone control is compromised due to
vasculopathy associated with hemolysis. As NO is considered
beneficial, hydroxyurea and inhalational NO were administered
to increase the bioavailability of NO, which raises cGMP levels
[3]. Phosphodiesterases (PDEs) are enzymes that catalyze
cGMP to GMP. Inhibitors of PDEs also increase cGMP levels
by decreasing the degradation of cGMP. Inhibition of PDE9A
enzyme with the specific inhibitor BAY73-6691 reversed the
increased adhesive properties of neutrophils in sickle cell disease
and increased production of the γ-globin gene (HBG) in K562
cells. Furthermore, sGC activators were suggested for treatment
of sickle cell disease (Figure 1) [4].
Figure 1. Schema of the nitric oxide-soluble guanylate cyclasecyclic
guanosine monophosphate-protein kinases I signaling
pathway in the treatment of sickle cell anemia vasculopathies.
NO: Nitric oxide, sGC: soluble guanylate cyclase, cGMP: cyclic guanosine
monophosphate, cGKI: protein kinases.
77
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
NO can lead to excess production of reactive oxygen species (ROS)
and peroxynitrites. NO was also shown to induce cyclooxygenase
and its isoforms, resulting in formation of prostaglandins,
which leads to neuroinflammation [5]. NO also increases cGMP
levels and leads to glutamate-induced toxicity resulting in
neurodegeneration in the central nervous system (CNS) [6].
Furthermore, NO-dependent and NO-independent activators of
sGC and inhibitors of PDEs tend to increase cGMP levels and
similarly lead to glutamate toxicity and neurodegeneration
in the CNS upon prolonged usage. The above-mentioned
limitations show that there is a need for developing a potent
drug similar to it with a safer pharmacological profile using
the candidates of the pathway. Hence, another member of the
same pathway, cGKI, can help as a therapeutic target, because
cGK activity was reported to be spared on cGMP-dependent
ion channels, which were shown to cause neurotoxicity [7].
cGKI activators that regulate IP3/IRAG calcium channels of
the endoplasmic reticulum are therapeutically valuable and
may change the phase of treatment. cGKI-β was reported to
be abundant in platelets and inhibited platelet aggregation
by decreasing intracellular calcium by blocking IRAG/IP3
calcium channels [8]. A study reported cGK’s regulatory role
in stimulation of γ-gene expression of fetal hemoglobin [9].
Activators of cGKI may provide drugs with safer pharmacological
profiles in the treatment of SCA vasculopathies and pulmonary
hypertension. To date, S-tides have been reported as activator
drugs produced as synthetic peptides stimulating cGKI-α [10].
New drug discoveries targeting cGKI-α and cGKI-β may ensure
safer pharmacological drug profiles of the NO-sGC-cGMP-cGK
pathway in the treatment of SCA.
Keywords: Sickle cell anemia, cGK activation, Nitric oxide
Anahtar Sözcükler: Orak hücreli anemi, cGK aktivasyonu, Nitrik
oksit
Conflicts of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Verma H, Mishra H, Khodiar PK, Patra PK, Bhaskar LV. NOS3 27-bp and IL4
70-bp VNTR polymorphisms do not contribute to the risk of sickle cell crisis.
Turk J Hematol 2016;33:365-366.
2. Schlossmann J, Ammendola A, Ashman K, Zong X, Huber A, Neubauer G,
Wang GX, Allescher HD, Korth M, Wilm M, Hofmann F, Ruth P. Regulation
of intracellular calcium by a signalling complex of IRAG, IP 3
receptor and
cGMP kinase Iβ. Nature 2000;404:197-201.
3. Weiner DL, Hibberd PL, Betit P, Cooper AB, Botelho CA, Brugnara C.
Preliminary assessment of inhaled nitric oxide for acute vaso-occlusive
crisis in pediatric patients with sickle cell disease. JAMA 2003;289:1136-
1142.
4. Sharma D, Potoka K, Kato GJ. Nitric oxide, phosphodiesterase inhibitors
and soluble guanylate cyclase stimulators as candidate treatments for
sickle cell disease. Journal of Sickle Cell Disease and Hemoglobinopathies
2016:JSCDH-D-16-00097.
5. Mancuso C, Scapagini G, Curro D, Giuffrida Stella AM, De Marco C,
Butterfield DA, Calabrese V. Mitochondrial dysfunction, free radical
generation and cellular stress response in neurodegenerative disorders.
Front Biosci 2007;12:1107-1123.
6. Ghanta M, Panchanathan E, Lakkakula BVKS, Narayanaswamy A.
Retrospection on the role of soluble guanylate cyclase in Parkinson’s
disease. J Pharmacol Pharmacother 2017;8:87-91.
7. Li Y, Maher P, Schubert D. Requirement for cGMP in nerve cell death caused
by glutathione depletion. J Cell Biol 1997;139:1317-1324.
8. Antl M, von Brühl ML, Eiglsperger C, Werner M, Konrad I, Kocher T, Wilm
M, Hofmann F, Massberg S, Schlossmann J. IRAG mediates NO/cGMPdependent
inhibition of platelet aggregation and thrombus formation.
Blood 2007;109:552-559.
9. Ikuta T, Ausenda S, Cappellini MD. Mechanism for fetal globin gene
expression: role of the soluble guanylate cyclase-cGMP-dependent protein
kinase pathway. Proc Natl Acad Sci USA 2001;98:1847-1852.
10. Moon TM, Tykocki NR, Sheehe JL, Osborne BW, Tegge W, Brayden JE,
Dostmann WR. Synthetic peptides as cGMP-independent activators of
cGMP-dependent protein kinase Iα. Chem Biol 2015;22:1653-1661.
Address for Correspondence/Yazışma Adresi: Bhaskar VKS LAKKAKULA, Ph.D., Sickle Cell Institute
Chhattisgarh, Department of Molecular Genetics, Division of Research, Raipur, Chhattisgarh, India
Phone : +91 8224979600
E-mail : lvksbhaskar@gmail.com ORCID-ID: orcid.org/0000-0003-2977-6454
Received/Geliş tarihi: November 17, 2017
Accepted/Kabul tarihi: December 01, 2017
DOI: 10.4274/tjh.2017.0407
78
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Three Factor 11 Mutations Associated with Factor XI Deficiency in
a Turkish Family
Türk Bir Ailede Faktör XI Yetersizliği ile İlişkili Üç Faktör 11 Mutasyonu
Veysel Sabri Hançer 1 , Zafer Gökgöz 2 , Murat Büyükdoğan 1
1İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey
2Medicana International Ankara Hospital, Clinic of Hematology, Ankara, Turkey
To the Editor,
Factor XI (FXI) is a homodimeric serine protease, which is
produced in the liver and circulates in the plasma complexed
with high-molecular-weight kininogen. FXI plays an important
role in the amplification of the initial coagulation response via
a positive feedback mechanism for the generation of additional
thrombin [1,2,3,4]. Congenital FXI deficiency is characterized by
decreased levels or activity of FXI in the plasma and may cause
an inherited bleeding disorder. The FXI gene is located on 4q34-
35 and consists of 15 exons.
The index case was a 10 year-old-boy with bleeding diathesis
(excessive bleeding after tooth extraction). His activated partial
thromboplastin time (aPTT) was 84.3 s (normal range: 32-39 s),
FXI activity was 0%, and he was diagnosed with FXI deficiency.
His parents were related. The father had a mild bleeding tendency
with prolonged aPTT (48.2 s). FXI activity was found to be 4%.
The mother and the second child had no bleeding history with
mildly decreased FXI activities (40% and 60%, respectively). We
performed a mutational analysis for the whole family, including
the patient’s grandparents. Genomic DNA was extracted from
whole blood. All exons and approximately 25-bp exon-intron
boundaries of the factor 11 (F11) gene were amplified using
sets of designed primers. After polymerase chain reaction, the
amplified fragments were sequenced.
The patient and his father had a p.Ala109Thr (ENST00000492972.6,
p.A109T, c.325 G>A, rs768474112) homozygous mutation for
F11; the patient also had novel heterozygous p.I454T and p.Y472*
mutations (Figure 1). The presence of a homozygous p.A109T
mutation in the father and the index patient caused severe FXI
deficiency. The mother and the second child had heterozygous
p.I454T and p.Y472* mutations. As shown in Figure 2, p.I454T
and p.Y472* heterozygosity moderately decreases the activity
of FXI. In this family, we found two novel mutations, p.I454T
and p.Y472*, associated with a homozygous p.A109T mutation.
p.I454T is probably damaging with a PolyPhen score of 0.9. This
is the first case reported in the literature with homozygous
p.A109T. Previously, Guella et al. [5] reported a heterozygous
p.A109T mutation in an Italian family with FXI deficiency. They
showed that exon-skipping had occurred due to a heterozygous
p.A109T mutation and they explained that the unchanged
enzyme activity was due to a non-sense mediated RNA decay
mechanism. With this mechanism, due to p.A109T mutation,
incorrectly spliced transcripts are not allowed to exit the nucleus
to the cytoplasm. Our cases confirmed their results, such that a
heterozygous p.A109T mutation did not affect enzyme activity;
the enzyme activity of a person who has two heterozygous
mutations (p.Y472* and p.I454T) is the same as that of someone
Figure 1. Electropherogram results.
Figure 2. Pedigree of the family.
AE: Activity of the enzyme, +: heterozygous, ++: homozygous.
79
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
who has three heterozygous mutations (p.A109T, p.Y472*, and
p.I454T). However, when p.A109T was homozygous, like in our
index patient and his father, the enzyme activity decreased by
approximately 96% as shown in the pedigree. Another interesting
point was the presence of a homozygous p.A109T mutation in
the patient while his mother had no p.A109T mutation. This may
be explained by a second-hit de novo mutation in the index
case. Further expression studies evaluating the effects of these
mutations will improve our understanding of the functional and
structural features of the FXI enzyme.
Keywords: Factor XI, Mutation, Family
Anahtar Sözcükler: Faktör XI, Mutasyon, Aile
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Thompson RE, Mandle R Jr, Kaplan AP. Studies of binding of prekallikrein
and factor XI to high molecular weight kininogen and its light chain. Proc
Natl Acad Sci USA 1979;76:4862-4866.
2. Geng Y, Verhamme IM, Smith SM, Sun MF, Matafonov A, Cheng Q, Smith
SA, Morrisey JH, Gailani D. The dimeric structure of factor XI and zymogen
activation. Blood 2013;121:3962-3969.
3. Kravtsov DV, Wu W, Meijers JC, Sun MF, Blinder MA, Dang TP, Wang H,
Gailani D. Dominant factor XI deficiency caused by mutations in the factor
XI catalytic domain. Blood 2004;104:128-134.
4. Whelihan MF, Orfeo T, Gissel MT, Mann KG. Coagulation procofactor
activation by factor XIa. J Thromb Haemost 2010;8:1532-1539.
5. Guella I, Solda G, Spena S, Asselta R, Ghiotto R, Tenchini ML, Castaman G,
Duga S. Molecular characterization of two novel mutations causing factor
XI deficiency: a splicing defect and a missense mutation responsible for a
CRM+ defect. Thromb Haemost 2008;99:523-530.
Address for Correspondence/Yazışma Adresi: Veysel Sabri HANÇER, M.D.,
İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey
Phone : +90 533 634 30 14
E-mail : vshancer@yahoo.com ORCID-ID: orcid.org/0000-0003-2994-1077
Received/Geliş tarihi: April 01, 2017
Accepted/Kabul tarihi: September 25, 2017
DOI: 10.4274/tjh.2017.0140
80
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Participation in Physical and Sportive Activities among Adult
Turkish People with Hemophilia: A Single-Center Experience
Türk Hemofili Hastalarında Fiziksel Etkinlik ve Sportif Faaliyetlere Katılım: Tek Merkez Deneyimi
Arni Lehmeier 1 , Muhlis Cem Ar 1 , Sevil Sadri 1 , Mehmet Yürüyen 2 , Zafer Başlar 1
1
İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
2
İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Geriatrics, İstanbul, Turkey
To the Editor,
Because of the increased bleeding risk, people with hemophilia
(PwH) were advised to avoid physical activity (PA) until the 1970s
[1]. However, with the advent of modern treatment modalities
and regarding the numerous benefits that PA offers, currently
PwH are encouraged to participate in PA and sports as much as
possible [2]. Nevertheless, how physically active are adult PwH?
This question has readily been studied in high-income countries
with unrestricted access to coagulation factors [3], but facts
are lacking about the awareness level on PA and its prevalence
among adult hemophiliacs in developing countries, such as
Turkey, where the market entrance of coagulation factors and
the practice of prophylaxis have been relatively recent.
In order to assess this question, 70 Turkish PwH with hemophilia
A (84.3%) and B (15.7%) aged 19-61 years (mean: 38.0±11.8)
were asked to complete a questionnaire that included questions
on the sociodemographic characteristics and bleeding patterns
of the patients, their attitudes towards exercise and sports, and
their levels of involvement in PA.
The study strikingly showed that Turkish PwH had a low level of
awareness about PA. Less than one-fifth of the patients reported
being sufficiently involved in PA. The level of involvement was
highest (35%) in young adults (18-29 years) and lowest (0%)
in patients aged 50-69 years (p<0.05). Conversely, in a German
study [4], more than half of the adult hemophiliacs were very
interested in exercise and sports. Although sportive activity is
not equal to PA, German PwH seem to be more involved in an
active lifestyle than Turkish patients.
However, the present results might be associated with the
severity of hemophiliac arthropathy, which is significantly more
prevalent in older age groups (p<0.05).
Despite the low awareness of PA, more than 40% of the patients
met the current World Health Organization recommendations
for PA [5], with young adults (65%) again being significantly
more involved in physical activities than older PwH (23%)
(p<0.05).
Our results indicate that most of the patients avoid sportive
activities (60%). Those who are physically active reported
preferring moderate-intensity PA like walking or climbing stairs,
instead of vigorous-intensity activities. As expected, the level
of sportive activity significantly declined with increasing age
(p<0.05).
What are the reasons underlying the low level of PA in adult PwH
in Turkey? Pain, fear of being injured, and lack of motivation
were the most frequently reported reasons for avoiding PA. This
is not surprising, given the late implementation of prophylaxis
in Turkey (in 2005) and the resultant high prevalence of
hemophilic arthropathy among elderly Turkish PwH causing
pain and immobility.
A multidisciplinary approach for implementation of suitable/
safe physical exercises associated with less or no pain would help
patients overcome the fear of being injured and thus increase
their involvement in PA. The risk of injury can be minimized by
following the recommendations for safe PA for hemophiliacs
[6], which are often ignored, as shown by the patients (Table 1).
In conclusion, a reasonable treatment program for hemophilia
should include much more than just factor replacement. PwH
should be educated on the positive impact of PA on their
physical, social, and psychological well-being. Furthermore, they
should be well instructed about the recommendations for safe
PA and what happens if they ignore the safety issues. PA should
be considered as an integrated part of modern hemophilia
treatment, which requires the collaboration of experts from
various scientific fields.
Keywords: Hemophilia, Physical activity, Sports, Turkey
Anahtar Sözcükler: Hemofili, Fiziksel aktivite, Spor, Türkiye
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
81
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
Table 1. Results of the questionnaire according to age groups.
Variable Category Total 18-29 30-39 40-49 50-69
Treatment
Inhibitors
Severity
Joint replacement
Arthropathy
On-demand
Prophylaxis
Never
Currently
Healed
Severe
Moderate
Mild
No
Yes
No
Yes, 1 joint
Yes, 2 joints
Yes, 3+ joints
27.5
72.5
88.1
10.4
1.5
84.1
10.1
1.5
90.0
10.0
12.9
32.9
20.0
34.2
Awareness for adequate PA Little 54.3 35.3 53.6 41.7 92.3
17.6
82.4
100.0
-
-
94.1
5.9
-
100.0
-
23.5
58.8
11.8
5.9
18.5
81.5
92.3
7.7
-
81.5
14.8
3.7
85.7
14.3
7.1
25.0
32.1
35.7
41.7
58.3
75.0
16.7
8.3
66.7
16.7
16.7
83.3
16.7
16.7
33.3
16.7
33.3
Partial 27.1 29.4 28.6 41.7 7.7
Much 18.6 35.3 17.9 16.7 -
WHO guidelines Fulfilled 45.6 64.7 38.5 58.3 23.1
46.2
53.8
76.9
23.1
-
92.3
-
7.7
92.3
7.7
7.7
15.4
7.7
69.3
Unfulfilled 54.4 35.3 61.5 41.7 76.9
Swimming Swimmer 57.1 64.7 35.7 75.0 76.9
Non-swimmer 42.9 35.3 64.3 25.0 23.1
Sporting activity None 60.0 29.4 60.7 66.7 92.3
Paying attention to
adequate blood
clotting activity
Up to 2 h/week 24.3 41.1 32.2 8.3 -
At least 2 h/week 15.7 29.4 7.2 25.0 7.7
Never or rarely 58.5 53.3 50.0 66.7 75.0
Sometimes 16.9 26.7 23.1 8.3 -
Always or usually 24.6 20.0 26.9 25.0 25.0
Paying attention to safety Never or rarely 63.1 53.3 69.2 50.0 75.0
Sometimes 13.8 20.0 15.4 8.3 8.3
Always or usually 23.1 26.7 15.4 41.7 16.7
Participation in school sports Never or rarely 60.0 29.4 71.4 58.3 76.9
Data in percentages.
WHO: World Health Organization, PA: physical activity.
Sometimes 22.9 35.3 21.4 25.0 7.7
Always or usually 17.1 35.3 7.1 16.7 15.4
References
1. von Mackensen S. Quality of life and sports activities in patients with
haemophilia. Haemophilia 2007;13(Suppl 2):38-43.
2. Srivastava A, Brewer AK, Mauser-Bunschoten EP, Key NS, Kitchen S, Llinas
A, Ludlam CA, Mahlangu JN, Mulder K, Poon MC, Street A; Treatment
Guidelines Working Group on Behalf of The World Federation Of Hemophilia.
Guidelines for the management of hemophilia. Haemophilia 2013;19:1-47.
3. Goto M, Takedani H, Yokota K, Haga N. Strategies to encourage physical
activity in patients with hemophilia to improve quality of life. J Blood Med
2016;7:85-98.
4. Fromme A, Dreeskamp K, Pollmann H, Thorwesten L, Mooren FC, Völker
K. Participation in sports and physical activity of haemophilia patients.
Haemophilia 2007;13:323-327.
5. World Health Organization. Global Recommendations on Physical Activity
for Health. Geneva, WHO, 2010.
6. Kurme A, Seuser A. Fit durch Bewegung: Ein Ratgeber für Hämophile zu
Spiel, Sport und Tanz. 1st ed. Hamburg, OmniMed-Verl.-Ges, 2002.
Address for Correspondence/Yazışma Adresi: Arni LEHMEIER, M.D.,
İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of
Hematology, İstanbul, Turkey
Phone : +90 541 977 2696
E-mail : arni.lehmeier@gmx.net ORCID-ID: orcid.org/0000-0002-2468-4879
Received/Geliş tarihi: August 06, 2017
Accepted/Kabul tarihi: September 18, 2017
DOI: 10.4274/tjh.2017.0292
82
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
A Lesser Known Side Effect of Tigecycline: Hypofibrinogenemia
Tigesiklinin Daha Az Bilinen Bir Yan Etkisi: Hipofibrinojenemi
Fulya Yılmaz Duran, Halil Yıldırım, Emre Mehmet Şen
Bozyaka Training and Research Hospital, Clinic of Anesthesiology and Reanimation, İzmir, Turkey
To the Editor,
Fibrinogen is a soluble protein that is produced in hepatocytes. It
participates in blood coagulation and is considered as an acute
phase protein with a half-life of 3 to 4 days [1,2]. Fibrinogen values
range from 200 to 400 mg/dL [1,3]. While hyperfibrinogenemia
is correlated with systemic inflammation and malignancy,
hypofibrinogenemia can be observed in chronic inherited diseases,
acquired hepatic dysfunction, severe malnutrition, disseminated
intravascular coagulation, abnormal fibrinolysis, large volumes of
blood transfusions, and drug administration [1,3,4].
Tigecycline is the first member of the glycylcyclines. This is a new
class of drugs structurally similar to tetracyclines [1,5,6]. It can be
used to treat complicated intraabdominal infections, complicated
skin infections, and community-acquired bacterial pneumonia
[6,7]. Tigecycline inhibits protein synthesis by binding to the
30S ribosomal subunit and blocking entry of aminoacyl-transfer
RNA molecules into the A side of the ribosome [1,2]. It has poor
bioavailability and so requires intravenous administration with
a loading dose of 100 mg, followed by 50 mg twice daily [1,6].
In patients with child C cirrhosis, the manufacturer suggests a
reduced dose (25 mg twice daily) [5]. Multiple adverse events
have been reported [1]. A decrease in fibrinogen levels has been
observed and severe coagulopathy has also been reported during
tigecycline treatment [2,6].
A 90-year-old female patient was admitted to the emergency
department with the complaint of nausea and vomiting for 3 days.
Her medical history included asthma and chronic renal failure.
Physical examination revealed respiratory failure, unconsciousness,
and bilateral rhonchi on chest auscultation. Computer tomography of
the thorax revealed bilateral effusion, consolidation, and diaphragm
hernia. She was intubated and transferred to the intensive care
unit (ICU). The initial antiinfective regime consisted of piperacillin/
tazobactam at 3x4.5 g and ciprofloxacin at 2x400 mg intravenously.
On the 15 th day of admission, the antibiotherapy was switched to
tigecycline because of unresponsiveness to the first antibiotherapy.
On the 10 th day of tigecycline therapy, a progressive worsening of
hyperbilirubinemia was noted. Simultaneously, the hemoglobin
level was markedly decreased (Table 1). To exclude hepatic or biliary
pathology and abdominal pathology, abdominal ultrasonography
was performed, followed by computed tomography, but they
revealed no pathological entities. Moreover, fibrinogen was
lower. As we suspected an association with the use of tigecycline,
we discontinued the drug on the 10 th day of therapy. After
discontinuation of tigecycline, fibrinogen levels improved markedly
within 8 days and bilirubin levels tended to be lower. On the 40 th day
of ICU admission, she died.
We hypothesized that the decrease in fibrinogen level was a
side effect of tigecycline because hypofibrinogenemia became
Table 1. Laboratory findings of the patient.
Tigecycline
started
On 10 th day
of tigecycline
therapy (first)
On 10 th day of
tigecycline therapy
(second)
On 5 th day after
tigecycline therapy
cessation
OOn 8 th day after
tigecycline therapy
cessation
On 13 th day after
tigecycline therapy
cessation
Hemoglobin 11.3 6.3 4.9 10 9.5 8.6
Total bilirubin 0.56 1.27 1.44 19.05 18.4 14.7
Direct bilirubin 0.22 - 0.89 7.9 17.6 9
Fibrinogen levels 400 115 115 185 673 203
Platelets 282 310 259 116 121 183
INR 1.28 1.92 1.45 1.34 1.24 1.18
aPTT 31.1 62 45.7 38.2 34.2 34.5
PT 14.2 21.7 16.2 14.9 13.8 13.1
INR: International normalized ratio, aPTT: activated partial thromboplastin time, PT: prothrombin time.
83
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
apparent only after 10 days of antimicrobial therapy and the
fibrinogen level increased after the withdrawal of tigecycline.
Life-threatening coagulopathy and hypofibrinogenemia
cases induced by tigecycline were reported by Rossitto et al.
[5], Pieringer et al. [7], and Sabanis et al. [1]; clinical studies
were reported by Routsi et al. [6] and Zhang et al. [2] in the
literature. However, the main mechanism by which tigecycline
provokes hypofibrinogenemia is ambiguous [1,5]. It could be
by intestinal microflora or by hepatic dysfunction [1,5,7]. The
posttranscriptional regulation of the fibrinogen gene by miRNAs
could be the cornerstone in this field [1].
We suggest routine strict monitoring of coagulation parameters in
patients receiving tigecycline. If patients develop hypofibrinogenemia,
one should consider discontinuation of the drug.
Keywords: Hypofibrinogenemia, Tigecycline, Hemoglobine level
Anahtar Sözcükler: Hipofibrinojenemi, Tigesiklin, Hemoglobin
seviyesi
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Sabanis N, Paschou E, Gavriilaki E, Kalaitzoglou A, Vasileiou S.
Hypofibrinogenemia induced by tigecycline: a potentially life-threatening
coagulation disorder. Infect Dis (Lond) 2015;47:743-746.
2. Zhang Q, Zhou S, Zhou J. Tigecycline treatment causes a decrease in
fibrinogen levels. Antimicrob Agents Chemother 2015;59:1650-1655.
3. Martis N, Chirio D, Queyrel-Moranne V, Zenut MC, Rocher F, Fuzibet JG.
Tocilizumab-induced hypofibrinogenemia: a report of 7 cases. Joint Bone
Spine 2017;84:369-370.
4. Zhou HB. Hypofibrinogenemia caused by hemocoagulase after colon polyps
excision. Am J Case Rep 2017;18:291-293.
5. Rossitto G, Piano S, Rosi S, Simioni P, Angeli P. Life-threatening coagulopathy
and hypofibrinogenaemia induced by tigecycline in a patient with advanced
liver cirrhosis. Eur J Gastroenterol Hepatol 2014;26:681-684.
6. Routsi C, Kokkoris S, Douka E, Ekonomidou F, Karaiskos I, Giamarellou H.
High-dose tigecycline-associated alterations in coagulation parameters
in critically ill patients with severe infections. Int J Antimicrob Agents
2015;45:90-93.
7. Pieringer H, Schmekal B, Biesenbach G, Pohanka E. Severe coagulation
disorder with hypofibrinogenemia associated with the use of tigecycline.
Ann Hematol 2010;89:1063-1064.
Address for Correspondence/Yazışma Adresi: Fulya YILMAZ DURAN, M.D.,
Bozyaka Training and Research Hospital, Clinic of Anesthesiology and Reanimation, İzmir, Turkey
Phone : +90 232 250 50 50
E-mail : drfulya@mynet.com ORCID-ID: orcid.org/0000-0002-6901-7404
Received/Geliş tarihi: August 16, 2017
Accepted/Kabul tarihi: December 06, 2017
DOI: 10.4274/tjh.2017.0310
84
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Effectiveness of Ankaferd BloodStopper in Prophylaxis and
Treatment of Oral Mucositis in Childhood Cancers Evaluated with
Plasma Citrulline Levels
Çocukluk Çağı Kanserlerinde Oral Mukozit Tedavi ve Profilaksisinde Ankaferd BloodStopper
Etkinliği ve Plazma Sitrülin Seviyeleri ile Değerlendirilmesi
Türkan Patıroğlu 1 , Nagihan Erdoğ Şahin 2 , Ekrem Ünal 1 , Mustafa Kendirci 3 , Musa Karakükcü 1 , Mehmet Akif Özdemir 1
1
Erciyes University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology and Oncology, Kayseri, Turkey
2
Erciyes University Faculty of Medicine, Department of Pediatrics, Kayseri, Turkey
3
Erciyes University Faculty of Medicine, Department of Pediatrics, Division of Metabolism, Kayseri, Turkey
To the Editor,
Oral mucositis is one of the toxic effects of chemotherapy [1].
Ankaferd BloodStopper (ABS) is an herbal product that is used as a
hemostatic agent in traditional Turkish medicine. ABS affects the
endothelium, blood cells, angiogenesis, cellular reproduction, and
vascular dynamics and stimulates the mediators that lead to rapidly
progressive wound healing [2]. Additionally, antiinflammatory,
antimicrobial, antifungal, and antioxidative effects have been
attributed to ABS in previous studies [3,4,5].
In this study, we aimed to investigate the effectiveness of ABS
in the prophylaxis and treatment of oral mucositis in patients
receiving chemotherapy in childhood. In addition, plasma levels
of citrulline, which are a biochemical marker for mucosal barrier
injury, were measured and the effectiveness of ABS therapy
in mucositis was correlated by quantitative data in addition to
clinical assessment.
This is a case-control study. The study included 31 patients aged
4-17 years receiving chemotherapy regimens with strong mucotoxic
effects. The standard oral care (SOC) protocol consisted of tooth
brushing and use of 5% sodium bicarbonate, 0.2% chlorhexidine
mouthwash, and nystatin. The patients were asked to perform SOC
starting on the first day of a course of chemotherapy, lasting for
14 days, and oral mucosa was assessed daily upon completion of
chemotherapy based on the World Health Organization scale for
oral mucositis. In addition, blood samples were drawn to measure
citrulline levels immediately before initiation of chemotherapy
and in the period in which mucositis became most severe. The
same patients receiving the same chemotherapeutic agents in the
second course of chemotherapy were asked to gargle with ABS
(3-4 mL, liquid form) four times daily in addition to SOC. Mucosa
ratings were performed before the second chemotherapy course
and in the period in which mucositis became most severe. Of the
patients included, 17 (55%) were male and 14 (45%) were female.
The mean age was 9.3±4.5 years (range: 4-17 years). When the
stages of oral mucositis before and after chemotherapy were
assessed, it was found that there was no significant difference
between chemotherapy sessions given with SOC and with ABS plus
SOC before chemotherapy, while there was a significant difference
between these sessions after chemotherapy regarding stages
of oral mucositis (p=0.004) (Figure 1). When the extent of the
decrease in plasma citrulline levels was compared, it was higher in
chemotherapy sessions with SOC than in those with SOC plus ABS,
indicating a significant difference (p<0.008).
In conclusion, our study is a prospective, clinical trial demonstrating
that ABS is effective in the prophylaxis and treatment of oral
mucositis secondary to chemotherapy in childhood cancers.
Moreover, adding ABS to SOC limits the decrease in plasma
citrulline levels. Further randomized studies with larger samples
will allow the introduction of ABS in the prophylaxis and treatment
protocols of oral mucositis.
Figure 1. Change in oral mucositis grade before and after
chemotherapy treatment between groups. A value of p<0.05 was
considered statistically significant.
SOC: Standard oral care, CT: chemotherapy.
85
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
Acknowledgment
The authors would like to thank Ankaferd Pharmaceuticals for
providing the study drugs and Dr. İbrahim Haznedaroğlu for his
critical review of the manuscript.
Keywords: Childhood cancers, Oral mucositis, Ankaferd
BloodStopper, Citrulline
Anahtar Sözcükler: Çocukluk çağı kanserleri, Oral mukozit,
Ankaferd BloodStopper, Sitrülin
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Bonnaure-Mallet M, Bunetel L, Tricot-Doleux S, Guérin J, Bergeron C, LeGall
E. Oral complications during treatment of malignant diseases in childhood:
effects of tooth brushing. Eur J Cancer 1998;34:1588-1591.
2. Bilgili H, Kosar A, Kurt M, Onal IK, Goker H, Captug O, Shorbagi A, Turgut M,
Kekilli M, Kurt OK, Kirazli S, Aksu S, Haznedaroglu IC. Hemostatic efficacy
of Ankaferd Blood Stopper in a swine bleeding model. Med Princ Pract
2009;18:165-169.
3. Koçak E, Akbal E, Taş A, Köklü S, Karaca G, Can M, Kösem B, Üstün H. Antiinflammatory
efficiency of Ankaferd blood stopper in experimental distal
colitis model. Saudi J Gastroenterol 2013;19:126-130.
4. Saribas Z, Sener B, Haznedaroglu IC, Hascelik G, Kirazli S, Goker H.
Antimi¬crobial activity of Ankaferd BloodStopper® against nosocomial
bacterial pathogens. Cen¬tral Eur J Med 2010;5:198-202.
5. Ciftci S, Keskin F, Keceli Ozcan S, Erdem MA, Cankaya B, Bingol R, Kasapoglu
C. In vitro antifungal activity of Ankaferd BloodStopper against Candida
albicans. Curr Ther Res Clin Exp 2011;72:120-126.
Address for Correspondence/Yazışma Adresi: Nagihan ERDOĞ ŞAHİN, M.D.,
Erciyes University Faculty of Medicine, Department of Pediatrics, Kayseri, Turkey
Phone : +90 232 250 50 50
E-mail : dr.nagihansahin@yahoo.com ORCID-ID: orcid.org/0000-0002-7144-064X
Received/Geliş tarihi: August 25, 2017
Accepted/Kabul tarihi: November 20, 2017
DOI: 10.4274/tjh.2017.0320
86
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Late Side Effects of Chemotherapy and Radiotherapy in Early
Childhood on the Teeth: Two Case Reports
Erken Çocukluk Döneminde Alınan Radyoterapi ve Kemoterapinin Dişler Üzerine Geç Dönem
Etkileri: İki Olgu Sunumu
Sevcihan Günen Yılmaz 1 , İbrahim Şevki Bayrakdar 2 , Seval Bayrak 3 , Yasin Yaşa 4
1
Akdeniz University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Antalya, Turkey
2
Eskişehir Osmangazi University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Eskişehir, Turkey
3
Abant İzzet Baysal University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Bolu, Turkey
4
Ordu University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Ordu, Turkey
To the Editor,
Radiotherapy and chemotherapy can generate adverse results
during or after the completion of therapy and these treatments
can also cause some oral anomalies [1,2,3]. Early and late oraldental
abnormalities have been reported in head and neck cancer
patients treated with radiotherapy and chemotherapy. The late
side effects of chemotherapy and radiotherapy on the permanent
teeth of two patients who had cancer treatment in their early
childhood periods are presented here.
Radiotherapy and chemotherapy, which are the main treatments
of cancer for young children, can have long-term adverse effects
pertaining to the growth and development of orofacial and dental
structures.
Case 1: According to the medical history of a 17-year-old female
patient who applied to our clinic for routine dental treatment,
she had received radiotherapy and chemotherapy due to having
Hodgkin lymphoma between the ages of 4 and 5. At the age of 4
years, the patient was admitted to the hospital with an early stage
of Hodgkin lymphoma and 4 cycles of the adriamycin, bleomycin,
vinblastine, dacarbazine (ABVD) chemotherapy protocol and 20 Gy
of neck-region radiotherapy were applied. Complete remission was
obtained.
In the oral and radiographic examinations, microdontia was found
in teeth 11, 15, 17, 21, 25, 36, and 46. The root formations of these
teeth were less developed. Due to the lack of germ of teeth 26, 27,
37, and 47, hypodontia was found (Figure 1A). The unstimulated
salivary rate was low (0.3 mL/min). The mouth opening was normal.
Case 2: According to the medical history of a 24-year-old male
patient who applied to our clinic for routine dental treatment, six
cycles of ABVD chemotherapy protocol and 30 Gy of radiotherapy
to the neck region had been given due to diagnosis of stage III
Hodgkin lymphoma between the ages of 7 and 9 years old.
Complete remission was achieved.
In oral and radiographic examinations, microdontia was found in
teeth 34, 35, 37, 44, 45, 47, and 48 (Figure 1B). The root formations
of these teeth were less developed. The unstimulated salivary rate
was low (0.3 mL/min). The mouth opening was normal.
Figure 1. A) Panoramic radiography of case 1; B) panoramic
radiography of case 2. A) Panoramic radiography of case 1; B)
panoramic radiography of case 2.
87
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
When pediatric patients are exposed to radiation during the period
of tooth development, the formation of dental anomalies such
as hypodontia, the cessation of root development, microdontia,
taurodontism, temporomandibular joint disorders, malocclusion,
and enamel hypoplasia can occur [4,5,6,7,8]. Such problems do
not occur in adults.
These treatments may have different effects depending on the
dose, the duration of treatment, and the age of the patient [8].
In both of our patients, microdontia due to hypodontia and
underdevelopment was observed because dental germs could not
be formed [1,2,3,5]. Both patients had low salivary flow rates. This
has been observed in previous studies [6]. Both of the patients’
mouth openings were normal. In some studies, limitation of the
mouth opening or trismus has been reported.
It has been discovered that chemotherapy and radiotherapy in
early childhood have different effects in relation to the doses
received in the development stages of the teeth. It is important
to inform children who were treated for cancer at early ages and
their parents accordingly.
Keywords: Pediatric hematologic malignancies, Late side effects,
Radiotheraphy and chemotherapy, Teeth, Salivary flow rate
Anahtar Sözcükler: Pediatrik hematolojik maligniteler, Geç yan
etkiler, Radyoterapi ve kemoterapi, Dişler, Tükürük akış hızı
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Tummawanit S, Shrestha B, Thaworanunta S, Srithavaj T. Late effects of
orbital enucleation and radiation on maxillofacial prosthetic rehabilitation:
a clinical report. J Prosthet Dent 2013;109:291-295.
2. Owosho AA, Brady P, Wolden SL, Wexler LH, Antonescu CR, Huryn JM, Estilo
CL. Long-term effect of chemotherapy-intensity-modulated radiation
therapy (chemo-IMRT) on dentofacial development in head and neck
rhabdomyosarcoma patients. Pediatr Hematol Oncol 2016;33:383-392.
3. Jaffe N, Toth BB, Hoar RE, Ried HL, Sullivan MP, McNeese MD. Dental and
maxillofacial abnormalities in long-term survivors of childhood cancer:
effects of treatment with chemotherapy and radiation to the head and neck.
Pediatrics 1984;73:816-823.
4. Lalla RV, Long-Simpson L, Hodges JS, Treister N, Sollecito T, Schmidt B, Patton
LL, Brennan MT; OraRad Study Group. Clinical registry of dental outcomes in
head and neck cancer patients (OraRad): rationale, methods, and recruitment
considerations. BMC Oral Health 2017;17:59.
5. Harorlı A. Ağız, Diş ve Çene Radyolojisi. İstanbul, Nobel Tıp Kitabevleri, 2014.
6. Thouvenin-Doulet S, Fayoux P, Broucqsault H, Bernier-Chastagner V.
Neurosensory, aesthetic and dental late effects of childhood cancer therapy.
Bull Cancer 2015;102:642-647.
7. Cooper JS, Fu K, James Marks J, Silverman S. Late effects of radiation therapy
in the head and neck region. Int J Radiat Oncol Biol Phys 1995;31:1141-1164.
8. Rouers M, Dubourg S, Bornert F, Truntzer P, Antoni D, Couchot J, Ganansia
V, Bourrier C, Guihard S, Noel G. Orodental status before radiation therapy
of the head and neck area: a prospective analysis on 48 patients. Cancer
Radiother 2016;20:199-204.
Address for Correspondence/Yazışma Adresi: Sevcihan GÜNEN YILMAZ, M.D.,
Akdeniz University Faculty of Dentistry, Department of Oral and Maxillofacial Radiology, Antalya, Turkey
Phone : +90 242 310 69 69
E-mail : dentistsevcihan@hotmail.com ORCID-ID: orcid.org/0000-0002-4566-2927
Received/Geliş tarihi: May 27, 2017
Accepted/Kabul tarihi: September 18, 2017
DOI: 10.4274/tjh.2017.0216
88
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
t(9;19)(q22;p13) in Acute Myelomonocytic Leukemia
Akut Miyelomonositik Lösemide t(9;19)(q22;p13)
Moeinadin Safavi 1,2 , Akbar Safaei 2 , Marzieh Hosseini 2
1
Tehran University Faculty of Medicine, Department of Pathology, Molecular Pathology and Cytogenetic Ward, Tehran, Iran
2
Shiraz University of Faculty of Medicine, Department of Pathology, Molecular Pathology and Cytogenetic Ward, Shiraz, Iran
To the Editor,
Chromosomal aberrations play a role in the leukemogenesis of
acute myeloid leukemia. Some chromosomal abnormalities such as
t(8;21), t(15;17), and inv(16) are frequently observed, but hundreds
of uncommon chromosomal translocations also exist and their
significance remains to be clarified [1]. Here we introduce a case of
acute myeloid leukemia with a very rare translocation and explain
its morphologic and immunophenotyping findings.
The patient was a 50-year-old man with malaise and weakness.
Paraclinical evaluation revealed leukocytosis along with anemia
and thrombocytopenia (white blood cells: 24,000/µL, hemoglobin:
7.4 g/dL, platelets: 30,000/µL). Peripheral blood smear exhibited
atypical blastoid cells. Subsequently the patient underwent
bone marrow aspiration, which showed 80% blasts of myeloid
and monocytic type with prominent cytoplasmic vacuolization.
Immunophenotyping by flow cytometry revealed positive
reactions for CD117, HLA-DR, MPO, and CD64. Morphologic
findings and immunophenotyping were compatible with acute
myelomonocytic leukemia. Bone marrow cytogenetic study
showed t(9;19)(q22;p13) (Figure 1). Reverse transcriptase PCR was
performed for t(8;21) (AML1-ETO fusion gene) and inv(16) (CBFB-
MYH11 fusion gene), which was negative for both of them. FLT3
duplication and D835 mutation were also negative. Subsequently,
the patient underwent a 7+3 chemotherapy regimen with
cytarabine continuous infusion (300 mg, IV) over 24 h on days 1
to 7 and daunorubicin (115 mg, IV bolus) on days 1 to 3. Although
remission was achieved after induction therapy (3% blasts in bone
marrow 4 weeks after chemotherapy), unfortunately the patient
contracted sepsis due to neutropenia and died 1.5 months after
treatment initiation.
Acute myeloid leukemia with prominent monocytic lineage
involvement (M4-M5) is usually associated with determined
recurrent cytogenetic aberrations like inv(16), t(v;11) (MLL gene
rearrangement), and t(8;16). According to a literature review,
t(9;19)(q22;p13) has been reported previously only twice. The
Figure 1. Bone marrow karyotype study revealed t(9;19)(q22;p13).
89
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
first case was a 57-year-old man with acute myelomonocytic
leukemia and concomitant inv(16). Exact morphologic and
immunophenotyping characteristics of this case were not
determined [2]. The second case was a 13-year-old boy with
acute myeloid leukemia (M0) who developed multiple clonal
abnormalities during his treatment course [3]. The present case is
the first patient with acute myelomonocytic leukemia with t(9;19)
(q22;p13) as the sole chromosomal abnormality. This cytogenetic
finding and its associated morphologic and immunophenotyping
characteristics are noteworthy and merit attention.
Keywords: Acute myeloid leukemia, Cytogenetic, Monocytic
differentiation
Anahtar Sözcükler: Akut miyeloid lösemi, Sitogenetik, Monositik
farklılaşma
References
1. Yang JJ, Park TS, Wan TSK. Recurrent cytogenetic abnormalities in acute
myeloid leukemia. In: Wan TSK (ed). Cancer Cytogenetics. New York,
Springer Nature, 2017.
2. Buonamici S, Ottaviani E, Testoni N, Montefusco V, Visani G, Bonifazi F,
Amabile M, Terragna C, Ruggeri D, Piccaluga PP, Isidori A, Malagola M,
Baccarani M, Tura S, Martinelli G. Real-time quantitation of minimal
residual disease in inv(16)-positive acute myeloid leukemia may indicate
risk for clinical relapse and may identify patients in a curable state. Blood
2002;99:443-449.
3. Ostronoff F, Bueso-Ramos C, Cortes J, Giralt S. Normal hematopoietic
function and multiple bone marrow clonal abnormalities in a patient with
acute myeloid leukemia after two mismatched stem-cell transplants with
graft failure and autologous reconstitution. Am J Hematol 2007;82:744-
747.
Address for Correspondence/Yazışma Adresi: Moeinadin SAFAVI, M.D.,
Tehran University Faculty of Medicine, Department of Pathology, Molecular Pathology and Cytogenetic
Ward, Tehran, Iran
E-mail : safavi_moeinadin@yahoo.com ORCID-ID: orcid.org/0000-0002-4042-7506
Received/Geliş tarihi: October 07, 2017
Accepted/Kabul tarihi: December 28, 2017
DOI: 10.4274/tjh.2017.0368
90
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Invasive Aspergillosis in Refractory Angioimmunoblastic
T-Cell Lymphoma
Refrakter Anjiyoimmünoblastik T-Hücreli Lenfomada İnvaziv Aspergilloz
Prakash NP 1 , Anoop TM 1 , Rakul Nambiar 1 , Jaisankar Puthusseri 1 , Swapna B 2
1
Regional Cancer Centre, Department of Medical Oncology, Thiruvananthapuram, India
2
Regional Cancer Centre, Department of Microbiology, Thiruvananthapuram, India
To the Editor,
A 40-year-old man with angioimmunoblastic T-cell lymphoma, on
palliative chemotherapy with lenalidomide at 20 mg, developed
pancytopenia and progressive loss of vision and conjunctival swelling
over the right eye after the second cycle (Figure 1). Brain magnetic
resonance imaging with orbit demonstrated endophthalmitis. A
pus sample was inoculated onto routine bacteriological media
and Sabouraud’s dextrose agar (SDA) for detection of fungal
pathogens. On the 4 th day, fungal growth was observed on SDA. The
surface of the fungal colony was initially white; it turned to a bluegreen
color and had a powdery texture. Lactose phenol cotton blue
mount showed hyaline septate hyphae with short conidiophores
and vesicle-bearing chains of round conidia covering the upper
half of the vesicle, suggestive of Aspergillus fumigatus. He was
started on parenteral voriconazole, but his condition worsened and
he died following severe fungal sepsis.
Orbital invasive aspergillosis is a fatal condition, often
misdiagnosed, and the mortality rate remains high even after
proper treatment. Patients at risk for invasive aspergillosis include
patients with prolonged neutropenia, allogeneic hematopoietic
stem cell recipients, solid organ transplant recipients, patients on
chronic steroid therapy, and patients with HIV infection or chronic
granulomatous disease [1,2]. Among patients with hematologic
conditions (both benign and malignant), the duration and grade of
neutropenia predict the risk of invasive aspergillosis. The incidence
of invasive aspergillosis in patients with hematologic malignancies
has been reported to be as high as 3.1%, with Aspergillus fumigatus
representing the most commonly isolated species [3]. Compared to
amphotericin B, voriconazole demonstrates a survival benefit, less
systemic toxicity, and better tolerance by patients [4].
Figure 1. Photograph showing red conjunctival swelling over the
right eye.
Keywords: Lymphoma, Endophthalmitis, Aspergillus
Anahtar Sözcükler: Lenfoma, Endoftalmi, Aspergilloz
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
References
1. Weinberger M, Elattar I, Marshall D, Steinberg SM, Redner RL, Young NS,
Pizzo PA. Patterns of infection in patients with aplastic anemia and the
emergence of Aspergillus as a major cause of death. Medicine (Baltimore)
1992;71:24-43.
2. Gerson SL, Talbot GH, Hurwitz S, Strom BL, Lusk EJ, Cassileth PA. Prolonged
granulocytopenia: the major risk factor for invasive pulmonary aspergillosis
in patients with acute leukemia. Ann Intern Med 1984;100:345-351.
3. Nicolle MC, Bénet T, Thiebaut A, Bienvenu AL, Voirin N, Duclos A, Sobh
M, Cannas G, Thomas X, Nicolini FE, De Monbrison F, Piens MA, Picot S,
Michallet M, Vanhems P. Invasive aspergillosis in patients with hematologic
malignancies: incidence and description of 127 cases enrolled in a
single institution prospective survey from 2004 to 2009. Haematologica
2011;96:1685-1691.
4. Ohlstein DH, Hooten C, Perez J, Clark CL 3rd, Samy H. Orbital aspergillosis:
voriconazole – the new standard treatment? Case Rep Ophthalmol
2012;3:46-53.
Address for Correspondence/Yazışma Adresi: Rakul NAMBIAR, M.D.,
Regional Cancer Centre, Department of Medical Oncology, Thiruvananthapuram, India
E-mail : rakulnambiar@yahoo.com ORCID-ID: orcid.org/0000-0001-9670-3453
Received/Geliş tarihi: June 13, 2017
Accepted/Kabul tarihi: November 09, 2017
DOI: 10.4274/tjh.2017.0236
91
LETTERS TO THE EDITOR
Turk J Hematol 2018;35:75-93
Expansion of a Myeloma-associated Lesion from Orbita to the
Cerebrum
Orbitadan Serebruma Kadar Uzanan Miyelom ile İlişkili Lezyon
Sinan Demircioğlu 1 , Demet Aydoğdu 2 , Özcan Çeneli 1
1
Necmettin Erbakan University Meram Faculty of Medicine, Department of Hematology, Konya, Turkey
2
Necmettin Erbakan University Meram Faculty of Medicine, Department of Radiology, Konya, Turkey
To the Editor,
Involvement of the central nervous system due to multiple myeloma
(MM) is a very exceptional presentation with an estimated rate of
1% of all cases [1], showing a poor survival duration of 1-2 months
[2,3,4]. This involvement may present in three different patterns:
1) solitary plasmacytoma, 2) multiple plasmacytomas, and 3)
cerebrospinal fluid involvement with plasma cells [5].
A 64-year-old female diagnosed with MM IgG kappa for 1 year
was admitted with swelling and pain in the right eye. Physical
examination was remarkable for proptosis. Laboratory evaluation
revealed normocytic anemia, hypercalcemia, and M-protein peak in
serum protein electrophoresis. Brain magnetic resonance imaging
showed a retro-orbital mass of 5x6 cm in diameter extending
to the right temporal region and cerebral parenchyma (Figure
1), leading to widespread edema (Figure 2). We did not evaluate
the cerebrospinal fluid because it was an intracranial mass. The
patient was diagnosed with recurrent MM and treated with VCD
(bortezomib, cyclophosphamide, and dexamethasone). After four
cycles of chemotherapy, significant clinical improvement including
the regression of proptosis along with a decrease of radiological
involvement was observed (Figure 3).
Keywords: Multiple myeloma, Orbita, Cerebrum
Anahtar Sözcükler: Multipl miyelom, Orbita, Serebrum
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
Figure 1. Cranial axial contrast magnetic resonance image before
treatment: in the lateral aspect of the right orbit there is a
mass lesion that expands and destroys the zygomatic bone and
temporal lobe (red arrow). The mass lengthened in the cerebral
parenchyma by invading the dura in the temporal region.
Figure 2. There is widespread edema (T2 axial images) around the
joint due to cerebral parenchymal involvement.
92
Turk J Hematol 2018;35:75-93
LETTERS TO THE EDITOR
Figure 3. Significant regression is seen in the lesion after
treatment (red arrow).
References
1. Fassas AB, Muwalla F, Berryman T, Benramdane R, Joseph L, Anaissie
E, Sethi R, Desikan R, Siegel D, Badros A, Toor A, Zangari M, Morris C,
Angtuaco E, Mathew S, Wilson C, Hough A, Harik S, Barlogie B, Tricot
G. Myeloma of the central nervous system: association with high-risk
chromosomal abnormalities, plasmablastic morphology and extramedullary
manifestations. Br J Haematol 2002;117:103-108.
2. Nieuwenhuizen L, Biesma DH. Central nervous system myelomatosis: review
of the literature. Eur J Haematol 2008;80:1-9.
3. Gangatharan SA, Carney DA, Prince HM, Wolf MM, Januszewicz EH, Ritchie
DS, Harrison SJ. Emergence of central nervous system myeloma in the era
of novel agents. Hematol Oncol 2012;30:170-174.
4. Gozzetti A, Cerase A, Lotti F, Rossi D, Palumbo A, Petrucci MT, Patriarca F,
Nozzoli C, Cavo M, Offidani M, Floridia M, Berretta S, Vallone R, Musto
P, Lauria F; GIMEMA (Gruppo Italiano Malattie Ematologiche dell’Adulto)
Myeloma Working Party, Marchini E, Fabbri A, Oliva S, Zamagni E, Sapienza
FG, Ballanti S, Mele G, Galli M, Pirrotta MT, Di Raimondo F. Extramedullary
intracranial localization of multiple myeloma and treatment with novel
agents: a retrospective survey of 50 patients. Cancer 2012;118:1574-1584.
5. Petersen SL, Wagner A, Gimsing P. Cerebral and meningeal multiple myeloma
after autologous stem cell transplantation. A case report and review of the
literature. Am J Hematol 1999;62:228-233.
Address for Correspondence/Yazışma Adresi: Sinan DEMİRCİOĞLU, M.D.,
Necmettin Erbakan University Meram Faculty of Medicine, Department of Hematology, Konya, Turkey
Phone : +90 332 223 78 69
E-mail : sinandemircioglumd@gmail.com ORCID-ID: orcid.org/0000-0003-1277-5105
Received/Geliş tarihi: July 31, 2017
Accepted/Kabul tarihi: December 28, 2017
DOI: 10.4274/tjh.2017.0283
93
Advisory Board of This Issue (March 2018)
Ana Boban, Croatia
Anıl Tombak, Turkey
Antonis Kattamis, Greece
Aysun Adan, Turkey
Berna Ateşağaoğlu, Turkey
Beyza Ener, Turkey
Burhan Ferhanoğlu, Turkey
Caroline Houillier, France
Çiğdem Kader, Turkey
Deniz Aksu Arıca, Turkey
Elif Birtaş Ateşoğlu, Turkey
Ergül Berber, Turkey
Erol Erduran, Turkey
Evgenios Goussetis, Greece
Fahri Şahin, Turkey
Fatih Demirkan, Turkey
Fatma Çağlayan, Turkey
Feride İffet Şahin, Turkey
Ferit Avcu, Turkey
Gabriela Tanasie, Romania
Gülderen Yanıkkaya Demirel, Turkey
Hakan Özdoğu, Turkey
Hamdi Akan, Turkey
Hüseyin Gülen, Turkey
Klara Dalva, Turkey
Mahmut Bayık, Turkey
Mahmut Töbü, Turkey
Mehmet Ertem, Turkey
Mehmet Özen, Turkey
Meral Beksaç, Turkey
Meryem Albayrak, Turkey
Michael Mitchell, United Kingdom
Mutlu Arat, Turkey
Müge Sayitoğlu, Turkey
Nil Güler, Turkey
Nurdan Taçyıldız, Turkey
Olga Meltem Akay, Turkey
Priya Vadhana, India
Rajive Kumar, India
Rein Willemze, The Netherlands
Reyhan Küçükkaya, Turkey
Sema Anak, Turkey
Serena Valsami, Greece
Şebnem Yılmaz Bengoa, Turkey
Şule Ünal, Turkey
Vasilios Berdoukas, China
Yaghoub Yazdani, Iran
Zehra Çoban, Turkey
Zühre Kaya, Turkey