MLM54 WEB FINAL

Issue 54
ISSN 2050-5744
THE BUSINESS OF LAW
CUSTOMER
IS KING
P6 Jo Causon P9 Theo P56
Service Can Be a
Key Differentiator
Paphitis
Enter the Dragon
David Clarke
Demystifying Transformation:
The Experience of Being Legal
Supported by

Wherever you
roam, client
onboarding
with eCOS is
pitch-perfect
Technology that connects you,
wherever that happens to be
Are you trudging through the process of gathering client information to start a transaction?
Onboarding your clients shouldn’t peg you in. eCOS, our electronic client onboarding solution,
brings together everything you need to achieve remote onboarding. Access to client care packs,
verification of identity and source of funds solutions, onboarding questionnaires and Law
Society TA forms, all integrated into your CMS. eCOS gives you visibility over your onboarding
process within a single platform.
Embark on a new adventure.
Start onboarding digitally with eCOS from InfoTrack.
Visit www.infotrack.co.uk/ecos or call us
on 0207 186 8090 to say no to paper and
onboard clients electronically.

Will Cotton
Customer is King
“Focusing on the customer makes a company more resilient.” Jeff Bezos.
Welcome back to Modern Law. As Mr Amazon blasts into
space on his maiden voyage this summer, I sit here and
ponder to myself… he must be doing something right?!
I certainly don’t agree with everything Jeff Bezos does in this
world, but as a very clever man voiced to me in this edition,
there’s a lot that Amazon do that is truly admirable. Now… I
must note that this introduction is certainly not a secret bit of
marketing for the company, I can promise you that! Instead, it’s
an acknowledgement – a tip of the cowboy hat – to a company
that is a true king or queen of the customer journey. Amazon
is undeniably ubiquitous in our lives now, whether that be for
their exceptional ability to deliver a product readily, or their
questionable treatment of staff in doing so.
“Make the customer king” … It’s sounds easy, doesn’t it? But
there’s a fine balance between making a customer feel special
and ramming your product or service down their throat – no one
likes an overzealous waiter.
My hope for you as a reader, is that we can some shed some light
on how to get that spirit level nice and steady.
We kick things off with interviews with Theo Paphitis, Theo
Paphitis Retail Group, global bestselling author Joe Pine and
ex-Head of customer service at John Lewis, Andrew McMillan.
Both Sussanah Hewson and Jo Causon write fantastic articles
on the importance of good customer service and ways for you to
improve your own.
Price Bailey host another fascinating roundtable with some
great law firms, this time discussing the lessons learnt from the
pandemic and the opportunities for the future.
We have features from the former Digital Strategy & Innovation
Leader at PwC, David Clarke, as well as Bill Guthrie, Glenesk and
Trustpilot – all of whom give outstanding arguments towards the
importance of reviews and transforming your law firm.
And finally, on the back of last editions incredible Law Law
Land, Chrissie Lightfoot returns to host our next instalment
of debate, aptly named ‘Happy Customer = Jolly Lawyer’. With
our ambassadors weighing in on some extremely hot topics – the
Naked Lawyer had plenty to write about for this edition!
Anyway, enough from me, time to hear from the real experts. I
have been quite loquacious with this introduction… maybe it’s a
habit I should continue.
Will Cotton
Editor, Modern Law Magazine
01765 600909 | william@charltongrant.co.uk | modernlawmagazine.com
Editorial Contributors
David Seager, SIFA Professional
Alex Holt, Cashroom
Bronwyn Townsend, InfoTrack
Martin Cheek, Smartsearch
Bernadette Bennett, Moneypenny
Mark Holt, Frenkel Topping
Eileen O’Mahony, WM Promus
Howard Sears, Price Bailey
Annabelle Lofthouse, Breakthrough Case Management
Jayne Shawcross, CLS
Marc Lansdell, Evolve Law
Laura Fisher, Gunnercooke
David Grossman, Simplify
Craig Matthews, Osprey Approach
Ian Keith, Dual Asset
Anava Baruch, Design for Independence
Martin Ellis, Howden UK Group
Richard McCall, Armalytix
Neville Dinshaw, Law Mergers & Acquisitions
Tim Champney, Future Climate Info
Andrew Mckie, Mckie Recruitment
Pam Loch, Loch Associates
Amanda Illing, Gatehouse Chambers
Willie Pienaar, Nuvalaw
ISSUE 54
ISSN 2050-5744
Editor
Will Cotton
Project Manager & Events Sales
Kate McKittrick
Modern Law Magazine is published by Charlton Grant Ltd ©2021
All material is copyrighted both written and illustrated.
Reproduction in part or whole is strictly forbidden without
the written permission of the publisher. All images and
information is collated from extensive research and along
with advertisements is published in good faith. Although
the author and publisher have made every effort to ensure
that the information in this publication was correct at press
time, the author and publisher do not assume and hereby
disclaim any liability to any party for any loss, damage, or
disruption caused by errors or omissions, whether such
errors or omissions result from negligence, accident, or
any other cause.
3

INSIGHT
INTERVIEW
IN-DEPTH
EDITORIAL
BOARD
Disclaimer: Our publications contain advertising material
submitted by third parties. Each individual advertiser is solely
responsible for the content of its advertising material. We
accept no responsibility for the content of advertising material,
including, without limitation, any error, omission or inaccuracy
therein. We do not endorse, and are not responsible or liable
for, any advertising or products in such advertising, nor for any
any damage, loss or offence caused or alleged to be caused
by, or in connection with, the use of or reliance on any such
advertising or products in such advertising.
CONTENTS
06 Service Can Be a Key Differentiator
Jo Causon, CEO at The Institute of Customer Service gives us an insight into
how those organisations that achieve high levels of service, also enjoy higher
levels of profitability – what they call the customer service dividend.
09 Enter the Dragon
Joining Modern Law is the ever-impressive Theo Paphitis. Having dominated
the retail sector for the past three decades, no one is better placed to discuss
the importance of the customer.
13 The Experience Economy
B. Joseph Pine II is an internationally acclaimed author, speaker, and
management advisor to Fortune 500 companies. Modern Law found out how
experiences can transform what law firms offer.
17 It’s Simple but It’s Not Easy
Responsible for customer service and quality of selling across the John Lewis
Department Store Division for almost a decade, Andrew McMillan, concludes
our interviews for this edition.
20 The Human Touch – Business Growth Through the CX Journey
In order to grow and succeed, every business needs to acquire new customers
and hold on to existing ones. Susannah Hewson explores how Customer
Experience (CX) is the key.
25 Dealing with Highly Sensitive Issues
Pam Loch, Loch Associates
25 How to Exceed Client Expectations amid Ever Increasing Demands
Craig Matthews, Osprey Approach
27 Your Website is Your Shop Window
David Seager, SIFA Professional
27 Changing Consumer Habits
Alex Holt, The Cashroom
29 Why Digital Onboarding is Changing Client Experiences for Law Firms
Bronwyn Townsend, InfoTrack
29 Automated Technology and Personal Relationships Go Side-by-Side
Chantelle Wren and Anthony O’Hanlon, CLS
31 Customer Interaction: Face to Frace, Virtual or Both?
Neville Dinshaw, Law Mergers and Acquisitions
31 Establishing a Better Relationship
Mark Holt, Frenkel Topping
33 Developing Our New Website
Annabelle Lofthouse, Breakthrough Case Management
33 Delivering a Fluid Customer Journey
Eillen O’Mahony, WM Promus
35 How Much Should You Spend on Marketing?
Howard Sears, Price Bailey LLP
35 Understanding the Journey
David Grossman, Simplify
37 Growing Customer Expectations
Mark Dennis, DUAL Asset
EDITORIAL BOARD CONTRIBUTORS
4

EDITORIAL
BOARD
37 How a Shoe Collection Highlights the Importance of Designing for
Emotional Needs
Anava Baruch, Design for Independence
39 Conversation, not Technology, is the Gold Standard in Customer Experience
Willie Pienaar, Nuvalaw
39 Opportunities and Challenges of Contemporary Legal
Marc Lansdell, Evolve Law
41 The Unexpected Combination of Better AML Checks and Happier Clients
Richard McCall, Armalytix
41 Reviewing Our Core Values
Amanda Illing, Gatehouse Chambers
43 The Three Principles for Creating a Great Work Culture
Tim Champney, Future Climate Info
43 Client Experience is Central to Recruitment
Andrew Mckie, Mckie Recruitment
45 Technology At Its Best
Martin Cheek, Smartsearch
45 If You're Not Adding Value, You're A Cost
Laura Fisher, Gunnercooke
46 Supercharging Customer Service
Bernadette Bennett, Moneypenny
10 MINS WITH 47 Helen Burness
Director at Saltmarsh Marketing
ROUNDTABLE
FEATURE
KEY CONTRIBUTOR
CUSTOMER
CELEBRATION
48 Price Bailey Roundtable
Will Cotton, Modern Law
54 Consumer Behaviour is Changing
Bill Guthrie, Director at Glenesk, gives a detailed insight into the
opportunities for law firms surrounding online reviews.
56 The Power of Online Reviews
An Infographic by Trustpilot
58 Demystifying Transformation: The Experience of Being Legal
David Clarke, Chief Commercial Experience Officer at UnitedLex, makes the
case for ‘legal experience transformation’.
60 Customer Reviews Pilot – Wins for Firms and Consumers
Jane Malcolm, SRA
61 Customer Celebration
Modern Law wish to turn your attention to some of the outstanding work
that companies are undertaking in and around the sector right now. By
creating the opportunity for those involved to discuss the incredible work
they’re doing and the outstanding customer service they’re renowned for, we
aim to create a section that celebrates the customer.
TECHNOLOGY 79 Happy Customer = Jolly Lawyer
Chrissie Lightfoot, Entrepreneur Lawyer
䰀 愀 眀 䴀 攀 爀 最 攀 爀 猀 ☀ 䄀 挀 焀 甀 椀 猀 椀 琀 椀 漀 渀 猀
䈀 甀 猀 椀 渀 攀 猀 猀 䘀 愀 挀 椀 氀 椀 琀 愀 琀 漀 爀 猀 琀 漀 琀 栀 攀 䰀 攀 最 愀 氀 倀 爀 漀 昀 攀 猀 猀 椀 漀 渀 猀 眀 椀 琀 栀 圀 漀 爀 氀 搀 圀 椀 搀 攀 䌀 氀 椀 攀 渀 琀 䈀 愀 猀 攀
A mission to change the way law firms
operate, everywhere and forever.
gunnercooke is an award-winning full service law firm founded in 2010, to
challenge, improve and evolve the way that lawyers work.
5
The gunnercooke model offers experienced lawyers the freedom and flexibility
to build their own practice, in the way they choose. Each lawyer sets their own
targets and decides which clients to work for. Their earning potential is unlimited.
Our role is to deliver a world-class support service, making it as easy as possible
to maximise the opportunity that the model provides.

INSIGHT
Service Can Be a
Key Differentiator
Whatever sector a business operates in, providing a
high standard of customer service is clearly an essential
requirement. Service excellence drives higher customer
satisfaction, loyalty, repeat business and advocacy to
others. In fact, our research at The Institute of Customer
Service repeatedly shows that those organisations that
achieve high levels of service, also enjoy higher levels of
profitability – what we call the customer service dividend.
Customer service has always been important, but during the
pandemic we have all seen the critical difference that a brilliant
service experience can make. In times of uncertainty and stress,
customers will gravitate even more towards those organisations
they feel they can trust and rely on.
Customer Satisfaction Index trends
At The Institute, we have been tracking customer sentiment
and satisfaction through our UK Customer Satisfaction Index
(UKCSI) twice a year since 2008. Over the years we have gathered
data on over 500,000 customer responses covering 13 sectors
across 26 different service-related metrics. We have built up a
truly comprehensive view of customer experience and identified
the key factors behind service excellence. The Index measures
functional and emotional dimensions and is based on customer
and consumer priorities.
Before I turn to the legal sector specifically, what are the highlevel
trends?
In general terms, we have seen a decline in overall customer
satisfaction levels over the last 4-5 years, most likely because,
in the digital ‘always-on’ age, customer expectations have risen
whilst some organisations have under-invested in service. But
more encouragingly, this trend has just begun to stabilise. From
July 2017, when satisfaction stood at 78.2 points (out of 100), it
declined in almost every six-month period for the next four years,
reaching a low of 76.8 in January of this year. But our most recent
Index for July 2021 reported an increase to 77.4.
“We have seen a decline in
overall customer satisfaction
levels over the last 4-5 years”
Whether this becomes a sustained improvement remains to be
seen, but customers reported some positive improvements during
Covid-19 including better scheduling of appointments, better
support to improve wellbeing and more proactive communications.
Over a quarter of customers said they had experienced a change
in customer service during Covid-19, with 55% of those saying the
change was positive and 24% saying it was negative.
However, 14.9% of customers said they had experienced a
problem in the last six months which was the highest level since
2009, even if there were signs that complaint handling had
improved. A quarter of customers also felt that organisations
have sometimes used Covid-19 as an excuse for poor service.
The ‘because of Covid’ refrain has become something that many
customers are well and truly fed up with!
Another key finding was that, for the first time in the UKCSI’s
history, over 50% of reported customer experiences were digital
– underlining the extent to which online and app-based channels
have accelerated through the pandemic.
Legal sector (Services) – could do better
So where does this leave the legal sector? Legal falls within our
‘Services’ classification, within which we ask consumers about their
experience with ‘your local solicitor’. In short, there is certainly room
for improvement. Services tends to perform towards the lower end
of the 13 sectors that we benchmark. In the most recent UKCSI,
Services scored 76.6 points (‘your local solicitor’ was lower on
average at 74.7), putting it just ninth out of 13. It was also one of
the only sectors to record a fall in its score compared to a year ago
(in July 2020, the score for Services was 77.1).
Gathering customer feedback
When I think about legal specifically, one of the key factors that
distinguishes it from other sectors is that customer interactions
(on the consumer side) are relatively infrequent. Whereas a
retailer or bank, for example, may have regular dealings with
6

INSIGHT
“For the first time in the UKCSI’s
history, over 50% of reported
customer experiences were digital”
customers enabling them to gather data,
monitor changes and analyse trends, the
very intermittent nature of the customer
relationship in legal makes this much
harder to do. If a customer never comes
back to you, will you notice? If they don’t,
will you know why? It may be because
they’ve moved away or had a significant
life change – but it may be because the
service they received disappointed them.
The greater difficulty of pinpointing
this only makes it even more important,
I would argue, that every law firm has
a rigorous system to ensure customer
feedback is obtained after every piece of
work performed. The rarer the interaction,
the more essential this is.
Obtaining this feedback will then become
a key feature in enabling you to map the
customer journey from beginning to end
through a process, highlighting any pinch
points or frustrations along the way.
Key trends for law firms
There are a number of emerging trends
in our UKCSI that I believe are directly
relevant to law firms. First, as I have
already touched upon, we have the
growth of digital. The ability to interact
digitally is increasingly becoming a hygiene
factor expectation amongst consumers,
regardless of what type of business they
are dealing with. So, ask yourself whether
your firm has sufficiently developed digital
channels. Can customers communicate
with you in convenient ways? Are there
any non-digitised processes that frustrate
customers? Is your website clear and easy
to navigate?
Another significant trend is the increase in
customers who are prepared to pay more
for excellent service. This now stands at
31.6%, up from 25.9% in January 2020. At
the same time, the proportion of customers
who say they look for a low cost-no frills
service, has fallen, from 14.2% to 12.2%. This
could present a significant opportunity in
the legal sector. The most common reason
given for being prepared to pay more for
excellent service is that the customer wants
to be able to trust the company they’re
using. Surely, nowhere is this trust more
important than in legal when customers are
placing their confidence in legal experts to
help them do something that really matters
to them – whether that’s buying/selling a
house, drawing up a Will, resolving a family
matter, etc.
The importance of trust is another theme
that has been emerging more broadly
through the UKCSI in recent years. We
analyse the results across five dimensions:
Experience, Complaint Handling,
Customer Ethos, Emotional Connection,
and Ethics. The last three of these are
especially bound up in issues of trust.
We find that a growing proportion of
customers really care about whether the
organisations they deal with care about
them and put customers first (Customer
Ethos), are committed to building
long-term relationships that enhance
the customer experience (Emotional
Connection) and are committed to
‘doing the right thing’ across issues
such as sustainability, the environment,
community engagement, and the
treatment of staff, suppliers and other
stakeholders (Ethics).
Opportunity knocking
I believe there is a real opportunity for those
law firms that put such issues at the heart
of how they do business. Those firms that
have clear and strong values and purpose,
communicate them effectively to customers,
and put them into action backed up by a
dedication to the customer experience, will
be the winners of the future.
In an age where customers can
increasingly self-serve through the web
for cheap standardised services in areas
such as Wills or conveyancing, creating a
compelling customer service experience
is in fact becoming more essential than
ever. Knowledge is no longer power –
because knowledge is everywhere. The
law firms that differentiate through truly
outstanding customer service will be the
firms most resilient in the face of change.
“The customer wants to be able to trust
the company they’re using. Surely,
nowhere is this trust more important
than in legal…”
Jo Causon
is CEO at The Institute of Customer
Service
7

INTERVIEWS
Building a
business back up
is about listening,
learning and then
knowing more
than the next
person”the door”
Enter the Dragon
Joining Modern Law for our lead interview is the ever-impressive Theo Paphitis.
Having dominated the retail sector for the past three decades, no one is better
placed to lend their insight on the importance of the customer. Read on to find
out more from the Dragon who’s built a fierce reputation for great customer
service, especially in a world where customer habits are constantly changing.
9

INTERVIEWS
To what extent does employee wellbeing lead to
better service and customer experience, and in your
own experience, does it ultimately have a positive
impact on the bottom line?
The pandemic has put the importance of mental health more in the
spotlight than ever, and I truly believe happy colleagues equals happy
customers. If you look after your colleagues first then they will always
look after your business and your customers.
Going into lockdown last March was ‘the unknown’ for everyone
and we had to shut our 300 shops quickly, and without knowing
when they would reopen. Everyone sprang into action and
knew that we had to work very differently during that time, for
however long it lasted. I was so impressed with my colleagues
throughout the pandemic.
I had daily calls with my exec team, featuring key leaders in the
business, to ensure we were working as a team and focusing
on every new twist in the pandemic tale. This was essential to
address business needs, and importantly to support all of our
colleagues, ensuring we communicated with them regularly.
The team is all important in this situation, and the people you
surround yourself with, and how they are, matters. They matter to
your business, to your brand, to your customers and ultimately to
you and your mental health too. It’s all connected.
We have Mental Health First Aiders in our business, who are there
for our colleagues whenever they need them, and have been helping
colleagues throughout the business since being introduced. We also
work with the Retail Trust who help our retail colleagues on every
level from financial assistance, through to mental health challenges,
bereavement and general advice. It’s an all-important area to focus
on as it is connected to the wellbeing of everything - your people
and your business.
Often the reason people fail anything is because they haven’t
done their homework. You wouldn’t sit an exam without doing
any preparation and running a business is no different. I would do
my homework before buying any business, as without that you
don’t know what you’re walking into. I don’t want surprises and I
want to avoid the banana skins.
Building a business back up is about listening, learning and then
knowing more than the next person. The only way to perform
better is through knowledge. It’s often going back to basics in
some instances. Understanding your reason to exist and building
on that is key; whether a product, your price point, your service
proposition or your IT capability. Once you are confident in that,
the world’s your oyster and you just need to build on it.
In total, it is estimated that you serve around 28 million
customers a year. With a client base that vast, coupled
with the fact it is such a diverse retail portfolio, how do
you look to deliver a valued service to all your customers?
The people you surround yourself with in business matter. They
matter to your business, to your brand, to your customers and
ultimately to you and your mental health.
A fantastic person, with a great skill set and a can-do attitude can
be a game changer for your business, and it’s important to develop,
support and hold on to these people, especially as you grow into
an even bigger company. I surround myself with people who are
You once said, “Great customer service does not come by
chance. It is the result of training and ensuring there are
enough assistants to serve the customers.” Has Covid
changed shopping habits in relation to needing that instore
assistance you stress is so important?
Everything had to be different during the pandemic, and
our Learning and Development team created a brilliant new
eLearning platform that could reach all of our colleagues at
whatever time they wanted to do their training, whether in store
or behind the scenes. A digital learning revolution kicked in, so
we could continue the good work.
The face-to-face element of retail will always play a part in the
success of the sector, and our store colleagues were so keen to get
back out there and serve their customers. Training had to adapt
like everything else. It was undoubtedly harder to coordinate, but
the teams made it work and are once again adapting the training
model as we edge back to normality.
It’s no secret that you have acquired companies that
are on the brink of collapse such as Ryman, and
completely transformed them into highly successful
and profitable businesses. Given that you didn’t rip up
the manual of what the companies sold or did – what
did you change that got the customers flooding back?
“We mustn’t lose sight of the important part that
the high street plays in our communities”
10

INTERVIEWS
experts in their field to ensure that as each
area needs to develop and thrive, you’re in
safe hands. You don’t need ‘yes men and
women’, you need people who have the
skills that you don’t to help you grow. It
is through expertise, passion for what you
do and understanding your customers and
their needs that you will still stay sharp and
focussed despite no longer being one man
and a dog without the added distractions.
You have spoken regularly about
the impact that Covid will have on
the high street and how the move
to online for many businesses has
been sped up. How can you keep
your finger on the pulse of the
ever-changing consumer demand
landscape, especially now in the
digital arena?
The pandemic has undoubtedly
accelerated the shift to online retail by
a good five years in a very short space
of time. It highlighted the importance
of having been ahead of the game too,
especially for those who found their
physical retail stores closed overnight.
“The online retail genie is well and
truly out of the bottle now”
Those who hadn’t invested ahead of the
pandemic, were playing catch up and this
was a dangerous place to be.
The online retail genie is well and truly
out of the bottle now, and people
will stick with online where they have
adopted it, but we mustn’t lose sight of
the important part that the high street
plays in our communities.
The high street is varied, and has lots of
moving parts, so predicting its future is
not just a binary black and white answer.
However, to help physical retail thrive
once more, and find its place alongside
digital retail, the Government must
address the ancient business rates tax,
ensuring fairness between the taxation of
digital and physical retail.
Theo runs #SBS Small Business
Sunday - helping small
businesses to think big. Entries
to the ongoing competition are
every Sunday on Twitter via @
theopaphitis with networking,
events and growth opportunities
for all. For more information:
www.theopaphitissbs.com
LOGO
Theo Paphitis
is the Chairman at Theo Paphitis Retail
Group, Dragon from BBC’s Dragons’ Den
11

INTERVIEWS
The Experience Economy
B. Joseph Pine II is an internationally acclaimed author, speaker, and management advisor to
Fortune 500 companies and entrepreneurial start-ups alike. He is Co-Founder of Strategic Horizons
LLP and in 2020 re-released ‘The Experience Economy: Competing for Customer Time, Attention,
and Money’, featuring an all-new Preview to their best-selling 1999 book ‘The Experience Economy:
Work Is Theatre & Every Business a Stage.’ Modern Law sat down with Joe to discover more about
his work and how it can help transform the experiences that law firms offer.
12

INTERVIEWS
Translated into thirteen
languages, ‘Experience Economy’
has become a must-read for
leaders of enterprises large and
small, global and local and sits in
the top 100 best business books
of all time. Can you give us a short
synopsis of your career Joe?
Of course! I’m a nerd from way back,
and started at IBM in technical and
then managerial & strategy positions.
When IBM sent me to MIT for a year
to get my Masters degree, I took the
opportunity to turn my thesis into my
first book, Mass Customisation. After
that, I left IBM to found Strategic
Horizons, a small consulting company
now with three people, and quickly
discovered the Experience Economy.
Ever since I have been writing,
speaking, teaching, and advising on
how companies can create greater
economic value through their offerings.
Having popularised the concept,
what is the ‘Experience Economy’
and can it be applied to the legal
sector both for service providers
and law firms?
The Experience Economy is the
latest stage in a progression of how
businesses create economic value. It
began with the Agrarian Economy,
based on commodities, which was
supplanted by the Industrial Economy,
based on goods, which in turn gave
way to the Service Economy, and
today experiences have become the
predominant economic offering.
Experiences are memorable events that
engage each individual in an inherently
personal way, creating a memory as
the hallmark of the experience. They
are distinct economic offerings - as
distinct from services as services are
from goods.
If you stage experiences, then
your work IS theatre – and no one
understands that better than trial
lawyers! Also, like most industries
today the legal sector is facing
commoditisation, as low-cost firms
and especially technology create
tremendous price pressure. To create
differentiation, then, lawyers need to
focus now just on what they do, but
how they do it. That can turn mundane
interactions into engaging encounters.
Now with a brand-new preface,
yourself and Gilmore make an even
stronger case for experiences as
the critical link between a company
and its customers. In an increasingly
distractible and time-starved world,
why are money, attention and time
now so interconnected?
These are the currencies of the
Experience Economy! Time is limited; we
only have twenty-four hours a day, seven
days a week in which to experience all
that life has to offer – and we have to fit
sleep in there some time. But if current
or potential clients are spending time
with some other company, they are not
spending it with you. Likewise, in today’s
media-fragmented world attention is
increasingly scarce – and if some other
company captures clients’ attention,
they’re not giving it to you. And money
is consumable; if clients spend their
money elsewhere, they cannot spend
that money with you.
So, the only way to capture people’s
time, attention, and money is with an
experience so engaging that they spend
their time with you, give you their
attention, and buy your offerings.
What do you mean in your work
by ‘transformative experiences’
and why do they hold the ultimate
value to your business?
Ah, this is the concept crucial for the
legal sector to understand! Beyond
even experiences lies one more distinct
economic offering: transformations – the
fifth and final level of economic value
where customers seek change; they
want companies to help them achieve
their aspirations. It might be to go from
flabby to fit with fitness centres, from
sick to well with hospitals, from smoker
to non-smoker with cessation programs,
from mediocre golfer to single-digit
handicapper through coaching -- among
a host of examples that could be cited,
for we all have aspirations we desire to
come to fruition that are as individual as
we are.
“To create differentiation, then, lawyers need to
focus now just on what they do, but how they do it”
This is especially important for people who
sell to other businesses (including in-house
legal activity), for no business buys your
offering because they want your offering;
it is but a means to an end. If you sell the
end, rather than the means, then you will
create greater economic value.
And perhaps – if you forgive – no sector
is less desired than legal (unless it be
accounting). All lawyers need to view
themselves as in the transformation
business, understand the aspirational jobs
of individual clients – aspirants would be
a better term here – and guide them in
achieving those aspirations.
Please discuss what you mean by
the term ‘customer sacrifice’ and
how can one look to eliminate it?
Let me contrast it with something we
all know – customer satisfaction, which
measures how well a company meets (or
not) our expectations. But expectations
often have nothing to do with what we
really and truly want and need. So, we
need to measure customer sacrifice – the
difference between what some individual
wants exactly and what they have to
settle for today.
Once we discover dimensions along
with people sacrifice by putting up with
standard offerings, then we can design
offerings that we can mass customise
to each individual customer, primarily
through modularity, like LEGO building
bricks or, even more robustly, with the
zeroes and ones of digital technology.
How can savvy law firms excel by
offering compelling experiences
for their customers, resulting
not only in increased customer
allegiance but also in a more
profitable bottom line?
I suggest starting with the
transformation level, actually, and
then figure out the set of experiences
required to guide clients in achieving
their aspirations. The first such
experience is diagnosis – determining
the client’s aspirations and where they
are today relative to them. Then you
design the set of experiences that take
them to that higher level – which in
turn are built atop the legal service
activities you do for them. The last stage
is follow-through. Not “follow up” – just
checking in – but ensuring that the
transformations take hold over time
(and, yes, that may just mean a retainer
relationship of some sort….).
13

INTERVIEWS
As for designing the experiences
themselves, in our 2020 re-release of
The Experience Economy: Competing for
Customer Time, Attention, and Money
we introduced five core elements of
experience staging, the last of which
is transformative. So in addition to
that, you need to create and stage
experiences that are robust – that hit
the sweet spot between entertainment,
educational, escapist, and esthetic
experiences {note: not “aesthetic”; we
call it our 4E model!]; cohesive – that
are organised around an underlying
principle, called the theme; personal
– that reach inside of people and
engage them, ideally using the mass
customisation principles I mentioned
earlier; and dramatic – that not only
employ acting as a model but have a
dramatic structure to them that rises to a
climax and comes back down again.
If you do all that, you cannot help
but design engaging, remarkable, and
memorable experiences for your clients.
“All lawyers need to view themselves
as in the transformation business”
In your opinion, should law firms
be looking to appoint a Chief
Experience Officer (CXO)?
Absolutely! A Chief Experience Officer is
a great way of focusing your company on
the experiences it needs to design and
create for its customers. The only one I
know of in the greater legal sector is David
Clarke, who first attained the position
at consultancy PwC but is now CXO of
UnitedLex, which provides an enterprise
legal platform for legal functions.
I’ve written that CXOs should focus on
four key roles facing both internally
and externally: catalyst, orchestrator,
designer, and champion. And one more:
guide. For me, CXOs need to lead the
internal transformation from delivering
services to staging experiences and
guiding transformations.
14

INTERVIEWS
“If you stage experiences, then your work IS
theatre – and no one understands that
better than trial lawyers!”
“Experiences offer
time well spent –
clients value the time
they spend with you”
Let’s say hypothetically you make
all these changes you suggest to
your law firm. How do you then
determine the ROI of experience
improvements?
Measuring experiences and
transformations is still more an art
form than a science, but the effects of
it in client acquisition and retention
as well as greater revenue and profits
should be easy to see – if, that is, one
follows the prescriptions we’ve been
talking about.
And one clear way to see the ROI is to
charge explicitly for experiences and
transformations. Services are about
time well saved – doing the functional
activities better than I could do, saving
clients the time it would take them
(including going to school and passing
the bar!), time they could better
spend elsewhere. So one charges for
those activities via hours spent on
such activities.
Experiences offer time well spent
– clients value the time they spend
with you, whether because they learn
more (often about themselves and
their business), gain confidence in
the potential outcomes, find value in
improving their own processes, and so
forth. So experience stagers charge for
time customers spend with them via
admission fees, membership fees, or
other ways. Note this is not charging for
time and materials – that’s the lawyers’
time and materials, not customer time!
And transformations generate time well
invested, in that they gain outcomes
that provide compound interest and
yield dividends now and into the future.
Transformation companies should
therefore charge for the demonstrated
outcomes that customers achieve!
That makes the company’s (or legal
function’s) income dependent on the
client’s outcome. I’ve long said that
any company that helps its customers
become – to use Ben Franklin’s famous
phrase – healthy, wealthy, and wise will
eventually move to outcomes-based
compensation.
One doesn’t have to charge solely for
experiences and transformations; a
portion, perhaps the majority, of revenue
could be via service activities, with
specific experiences charging for time
and with a significant slice via outcomes.
Before we finish, it’s important
to underline that when you speak
of experiences, you don’t mean
‘customer experience’ do you?
Even though the CX movement
came about because of the shift into
today’s Experience Economy, so-called
“customer experience” is not the same
thing as what I am talking about. CX
involves making our interactions with
customers nice, easy, and convenient
– but these are service characteristics,
not elements of experiences. Nice is
nice, but rarely does it rise to the level
of memorability. Easy often means we
routinise things to make it easy for our
employees to service customers, but
that gets in the way of making the
encounter memorable. And convenience
is the antithesis of experience staging,
providing only time well saved, not time
well spent. Experiences, which again
are a distinct economic offering, cannot
be frictionless; they require friction to
create that dramatic structure necessary
for engagement.
Joe Pine
is an Author and Cofounder at Strategic
Horizons LLP
15

INTERVIEWS
“It’s a
consistency
game”
It’s Simple but It’s Not Easy
Andrew McMillan is one of the leading experts in the UK for customer experience. Having began his
career on the shopfloor of John Lewis, Andrew worked his way up through the company over two
decades, ultimately being responsible for customer service and quality of selling across the John Lewis
Department Store Division. Since leaving this pivotal role in 2008, Andrew has successfully gone on to
run his own Management Consulting firm, ‘Engaging Service’, and is now recognised as a leading figure
in the world of the customer. Modern Law sat down with him to find out what he identifies as the four
key elements to customer service and how law firms can better apply them to effectively drive-up profits.
17

INTERVIEWS
What do you identify as the
four key elements of the customer
experience?
If you’re going to develop customer
experience, then you must firstly
understand what an enormous task this
will be and you need to break it down
into four distinct elements.
The first element is the product or service
that you sell. Is the service or product that
you sell fit for purpose? Does it meet the
requirements of your target customers? Is
it good value? And is it appealing? If it’s
not, you might as well pack up there and
not bother. My experience in professional
services (particularly law), is that firms are
very service centric and tend to forget about
the other elements I am about to discuss.
Though having a great service is obviously
key, having it alone is very dangerous.
The second element is the processes by
which you deliver that service or product.
Can you do what you say you’re going
to do? At the time you said you’re going
to do it? And, how you said you’d do
it? If you can keep those promises, then
that builds real and authentic trust. If
you have the most amazing service in
the world or the best legal brains in the
universe, but you can’t actually meet
customers on time for appointments,
you’re going to decay that trust very
quickly and lose business. Process is
really important and it can be as simple
as keeping a diary accurately or it can
be as complex as supply chain processes
in retail. Amazon are a great example
of process expertise and though I don’t
necessarily like everything they do, their
process is absolutely admirable.
The third element is drawn out of process
and is what I refer to as channel. Are you
able to communicate on the channels
that your customers want - not just what
you want? And, are you using channels
appropriately? Channel has become so
important with the dot.com revolution
and even more so now with the pandemic.
People are having to explore new channels
such as Teams and Zoom or branch out
into social media with platforms like Twitter
to reach their customers.
Finally, the fourth element is
engagement. This is very much the people
side of things. What did it feel like? The
example I always give is that they may
have the most fantastic legal brain out
there and their process is fantastic, but if
they’re the most miserable, awful person
you’d ever want to deal with - totally
non-empathetic, harsh and cold towards
their clients - you’re probably not going
to use them again!
PRODUCT
In summary, it’s not about one of those
things being dominant, it’s a matter of
having them all in balance. In fact, to a
certain degree, it’s that balance that will
determine the personality of your firm.
Why do you believe that efforts to
stand out by defining values and
purpose, commonly fail through
lack of management commitment?
Someone once wrote “Being a loved
brand isn’t rocket science, you just
have to be lovely. It’s simple but it’s not
easy.” Why wouldn’t you have all of your
employees being absolutely lovely and
looking after your clients to the best of
their ability? It sounds so simplistic and
just a derivative of common sense, but
actually it’s really difficult. The difficulty
is the consistency. You might have a
wonderful group of people who do
their best for the firm, but can you get
everybody working to that high standard
every day, every week, every year? The
answer is no, but the closer you can get
to 100% consistency, the better your
reputation will be.
If I were selling a software to a law firm,
and I could say, well, ‘if you install this,
you’ll recoup the cost within a year and
within three you’ll be more profitable and
efficient’ – that’s an easy sell. Whereas,
if I say ‘we want all your people to be
really happy, engaging, empathetic and
supportive to your clients so that you
stand out in the market’ - that’s going to
“…they need to feel ‘welcome, wanted,
remembered and cared for’”
take about three or four years to achieve
that level of consistency.
Consequently, in that time people just
simply lose faith or lose heart because
they won’t commit to that length of time
to do it properly. To achieve this level of
consistency, it’s a long-term commitment
to grinding away.
Why do you believe law firm
leaders should spend up to half
their time on tasks such as looking
after the interests of staff and
checking clients are properly
welcomed at the firm – especially
when many in this position would
argue this is an unrealistic use of
their time?
I used to say it was an 80/20 rule.
20% of your week should be spent on
developing your people and coaching
them – something which is just mind
blowing for a lot of people. I’m not saying
that no one does this well. I once worked
with a law firm in the home counties and
their lead partner is a fantastic guy who
is really people-focused. You can see the
team absolutely love him and they’re
always smiling and genuinely happy to
see him when he walks into the office.
My role is not to teach them how to do
this from the ground up, instead I’m
actually giving them a framework for
future development and expansion - so it
doesn’t dilute as they grow.
There are people who are just naturally
people-focused who will find the time.
The hard thing is - going back to the
elements of customer experience – there
are lots of leaders who simply don’t feel
they have the time, so it’s really important
to work with them to create time in their
diary for that 20%.
PROCESS
If they’re not naturally wanting to do that
as an individual, what will happen is very
quickly that 20% gap that you’ve created
will get filled up with more meetings and
spreadsheets because naturally that’s
where their skills lie. It’s a fairly common
18

INTERVIEWS
situation not just in legal but professional
services generally. People in those roles
usually have a very high degree of
intellect but that often doesn’t carry
itself with being empathetic and peoplefocused
on using softer skills.
“I used to say it was an 80/20 rule”
So that’s the challenge. It can lead to
some hard decisions if you want to
transform your business because you start
saying, well, do we need this person’s
legal brain enough to keep them -
knowing that they are not ideally suited
to the way this firm is moving? It can lead
to some really difficult decisions, really
difficult. I don’t take any pleasure in that,
but it’s a consistency game. If you’ve got
somebody in the senior leadership role
who just won’t play the game, they’ve got
to change or go.
CHANNEL
While staff development can
improve service by setting
standards and teaching a tangible
process, such as query handling,
it cannot fundamentally change
an organisation’s culture or the
attitude of its employees towards
customers and service. Please
discuss why training is not the
answer to consistency?
I don’t like the word culture because it’s
very ambiguous so I tend to talk about
behaviour and attitude. You can articulate
behaviour and attitude and to a certain
degree, you can measure it. Sometimes
I get new clients who say they want to
change their culture and if I’m feeling
cheeky, I’ll say “from what, to what?” and
watch them fidget as they try and describe
it because they can’t! You need to be more
defined than that, which is why you need
to start to articulate the behaviours that
you want people to be guided by.
If the training is to say, “you will say
good morning and smile as the client
walks in through the front door, you will
offer them a seat, tell them how long
that appointment is going to be, and
offer them a cup of coffee or tea”. In
my opinion, not only are you assuming
that’s what the clients wants, but you’re
also taking the initiative away from the
receptionist and insinuating that he
or she is a bit stupid and needs strict
instructions. It also assumes that they’ll
do it, which of course they may not!
There’s nothing wrong with training in
terms of setting a standard framework
- but it doesn’t mean they’ll do it if
they’re not engaged employees. The
trick with it is that they need to feel
‘welcome, wanted, remembered and
cared for’ themselves. If the receptionist
is working in a law firm where he or she
feels that, and the leadership have got
those softer skills, it is highly probable
that they in turn, will make the client
feel welcome, wanted, remembered and
cared for.
You can then start to manage that
proactively. Whereas saying we want a
softer, gentler, more friendly culture, what
does that mean?! The ambiguity it brings
when you try and performance manage it
is huge because you just can’t measure it.
How do you believe law firms can use
customer experience to drive profit?
In general, I don’t believe law firms have
orientated themselves around the element
of engagement as much as they could do.
In its current state, the legal is market is
oversupplied, so engagement is a very easy
way to differentiate yourselves.
Every law firm website that I look at has
the same format - endless black and white
photographs of all the partners, followed
by a short claim to have the best legal
brains in the area.
ENGAGEMENT
So, where’s my point of difference? On
what basis am I making my choice? If you
can actually say ‘here’s some feedback
that our clients have given us in the last
six months’, that starts to sound much
more exciting. A good law firm can also
employ a Head of client experience whom
will bring that mindset to the firm.
I think the challenge is that this softer
stuff isn’t as tangible as putting a new
CRM system in. So, where the new CRM
system can be evaluated on a costbenefit
basis over the next two years -
this can’t be and is a leap of faith.
However… if you do it properly, I promise
you will get MORE repeat business,
MORE word-of-mouth business and
MORE happy customers.
Andrew McMillan
is Director at Engaging Services
www.engagingservice.com
19

IN-DEPTH
The Human Touch -
BUSINESS GROWTH
THROUGH THE CX JOURNEY
In order to grow and succeed, every business needs to
acquire new customers and hold on to existing ones.
Customer acquisition and retention is challenging enough,
even without our world being turned up-side-down
with the unprecedented arrival of a pandemic. Equally,
finding exceptional employees and retaining them, can be
challenging, not to mention costly.
Customer Experience (CX) is the key differentiator and
driver for business growth. According to Bain and Company,
companies with a CX mindset drive revenue 4-8% higher than
the rest of their industry. With benefits such as; customer
acquisition and retention, increased sales, advocacy and also
employee satisfaction and retention, it’s no wonder businesses
all over the world are adapting to a more human focus through
customer experience.
What is CX?
CX is how the customer (or client)
feels during every interaction with your
business. It is different to customer
service which focuses on the functional
aspect such as conveyancing the sale of a
property or providing legal advice. Often
with legal services we are working with
highly emotional and sometimes sensitive
aspects of people’s lives. This simply
cannot be ignored if we’re looking to
separate ourselves from our competitors.
We need to constantly consider at every
part of the customer’s journey, what it
must be like to walk in their shoes. If we
don’t stop and think in each individual
situation how they must be feeling, it
simply isn’t possible to give them the
experience they need.
Realistic perspective
Many businesses feel that they already
offer a good customer experience. This
misconception has been highlighted in
a study by Bain and Company in which
80% of businesses interviewed felt they
gave a superior customer experience,
and just 8% of their customers agreed.
This is not because businesses don’t
work hard for their customers. This is
because there are consistent knowledge
gaps around what really matters to
customers, so it’s difficult to give
the right experience if we don’t fully
understand what matters to them. It is
also because there are common internal
barriers that hinder the experiences
delivered which are not identified and
addressed, resulting in customers and
employees silently slipping away.
What matters to customers
A robust study from KPMG Nunwood has
established that there are six key drivers
when it comes to customer experience:
Personalisation – getting to know
your client and their circumstances and
making the experience specific to this. If
the experience you give is the same for
every client, it’s not possible to connect
with them and it’s no different to what
your competitors are doing.
Integrity – being trustworthy is critical
in any business relationship. We may feel
that our expertise is enough to build trust
upon, however it’s often very small things
that can erode trust e.g., not doing what
you say you’re going to do, delaying
processes or not acting in your client’s
best interest such as finding ways to
save them time or money. Transparency
around costs is also vital when it comes to
fee sensitivity.
20

IN-DEPTH
“The mistake a lot of businesses make is being obsessed with getting
positive feedback when it’s the negative feedback that will transform
your business”
Expectations – setting and managing
expectations. Issues around expectation
management are very common. Your client
often has no idea how long things can
take, the processes involved and the cost.
We must always set realistic expectations
at the early stages of the relationship. It’s
particularly important to flag any potential
issues/delays/additional costs that could
arise. If they do happen, the client was
prepared and their expectations were met.
If they weren’t prepared, this can have
a very negative impact on trust in the
relationship.
Time and Effort – making it easy to
do business with your clients. Simple
processes and helpful moments along the
journey e.g., handy check-list reminders
if they need to submit documentation,
timeline updates etc., can really improve
time and effort for clients.
Empathy – the core of customer
experience, empathy is about walking in
your client’s shoes and showing clients
that you understand their circumstances.
Showing you care is a key driver for loyalty.
Resolution – fixing problems brilliantly
when they arise. Things go wrong from time
to time, especially when relying on other
stakeholders, but the problem is businesses
often don’t show they care when they
do. Demonstrating heroic resolution will
dramatically improve customer loyalty and is
a natural stimulant for advocacy.
Not understanding and addressing the
key drivers also impacts negatively on the
employee. If perhaps a colleague didn’t
set realistic expectations with the client,
the employee who is undertaking the
task can be under enormous pressure
which has a negative knock-on effect
on other clients they are working with.
By setting and managing expectations
along the customer journey, it improves
the customer experience as clients know
where they stand, and also improves the
employee experience as it reduces the
instances of pressure.
The power of
emotional connections
It is through making emotional
connections with your clients that your
business will thrive. The legal sector is
fact based, around a system or rules. The
expertise is naturally the most important
factor when it comes to providing legal
services, however there are many legal
firms who have a similar offering, so the
choices are enormous for clients. It is
through emotional connections that we
make the choice more obvious for them.
Humans are emotionally led and our brains
rule emotion over logic. By taking the time
to get to know our clients, how they need
to work together, and continually building
trust through expectation management,
you will keep your clients loyal.
Providing your service can be complex,
particularly in regulated sectors such
as legal and financial services where
compliance is critical and they require
so much attention to detail. It’s
understandable that the emotional
aspect often gets left out, but this is
what’s going to grow your business and
it must be a key area of focus. Employee
education and training around customer
experience or the human side of doing
business together is extremely important.
A study from Harvard Business Review
called ‘The new science of customer
emotions’ tells us that fully connected
customers are 52% more valuable than
those who are just highly satisfied. To bring
this to life, we recently undertook the
conveyancing services of a solicitor. She
was very nice, did the job, but from time
to time I felt that we had to chase her for
updates causing minor delays along the
way, but nothing too upsetting. She did
the job well in the end and I would say we
were very satisfied with her work.
That all sounds very positive, however
if someone asked me to recommend
a solicitor for conveyancing services, I
would not recommend her. She didn’t do
anything wrong, but she didn’t connect
with us and embed trust. Advocacy is
incredibly effective when a customer
connects with a brand and they will go out
of their way to recommend you if you do.
To me, the cost of customer acquisition is
so high, it doesn’t make business sense to
ignore the opportunity for advocacy.
21

FREE
Expert Training for Expert Practitioners
from Frenkel Topping knowledge Hub
The knowledge Hub – from Frenkel Topping Training academy
delivers FREE virtual and face-to-face training to our professional
clients - helping you stay up to speed and informed.
Courses available from knowledge Hub.
1 2 3
4
Avoiding
Professional
Negligence
Application
of Periodical
Payment Orders
Understanding
Pension Loss
Trusts for
Minors
Welfare
Benefits
5 6 7
8
Investing for
Vulnerable
Clients
Personal
Injury
Trusts
Loss of Earnings
Self Employed
Claimants
One hour expert
training modules
All our training is
APIL accredited
Counts towards
your CPD hours
Achieve the right
financial outcome
for your clients
With over 30 years’ experience of delivering financial expert reports and advice,
find out how Frenkel Topping knowledge Hub could help you.
contactus@frenkeltopping.co.uk or call 0161 886 8000
knowledge Hub
Frenkel topping training
academy
frenkel
topping
GROUP
Let us worry about what’s
beneath the surface
• We save firms money
• We agree a fixed monthly price
• We employ qualified cashiers
• We ensure compliance with the Solicitors Accounts Rules
• Holiday, sickness and maternity cover are our problem, not yours
• We work with any practice management system
• We save firms valuable office space
• We run firms’ payroll and complete VAT returns
• We have won multiple industry awards
• We provide accurate and timely Management Accounts
and Management Information
Alex Holt
Director of Business Development
E: Alex.Holt@thecashroom.co.uk
T: 07817 420 466
Gregor Angus
Senior Business Development Manager
E: Gregor.Angus@thecashroom.co.uk
T: 07875 598 593
@TheCashroomLtd
www.thecashroom.co.uk

IN-DEPTH
“With email communications, there’s a tendency to
be to be very formal and get straight to business”
Identify the internal barriers
There are also common barriers that hinder
the experiences delivered and again we
see the critical link between customer
experience and employee experience.
One of those barriers for example, is being
busy. As obvious as it may seem, it is most
damaging when it comes to both the
customer and employee experience. It’s
almost impossible for employees nowadays
to be really ‘present’ for customers with
the volume of work they are managing.
Time and time again when I’m training
employees, they tell me that they are simply
too busy to really focus on the customer
and go beyond getting the task done.
Often, they are overwhelmed. If they aren’t
‘present’ for that client, how can they
possibly learn about their circumstances and
understand their needs and challenges?
If we can’t do this, we miss out on
opportunities to connect with them.
The workload cannot change - yet
we cannot improve the customer or
employee experience if we don’t address
this. The answer is to look at better, more
efficient ways of working.
Address customer pain points
Unfortunately, customers tend not to
complain. If they did, we could act on it and
our businesses would be superb! According
to Esteban Kolsky, only 1 in 26 unhappy
customers will actually complain. With my
example of selling our house, the times
I felt we were chasing our solicitor was
frustrating, but we didn’t feel there was any
point in complaining as the job was done. If
we don’t pick up these small client niggles
along the journey, not only can we never
improve, the next time they need legal
services they’ll go elsewhere, and there are
plenty of alternatives for them.
It’s important to establish pain points.
These pain points tend to be common
and have an equally negative impact on
your employees as well as your clients.
I find that by talking to your employees
they know the things that bother clients
the most. They hear the grumbles or can
simply ‘sense’ when clients are irritated
and that’s where to start making changes.
The mistake a lot of businesses make
is being obsessed with getting positive
feedback when it’s the negative feedback
that will transform your business.
Employee engagement
The most powerful auxiliary you have is
your employees. The service cannot be
provided without them and the emotional
connections with customers won’t occur
if they are not themselves connected
emotionally to the business. From my
experience (working with employees
in all sectors), I often hear them saying
they don’t feel valued. Interestingly, I
usually find their leaders do indeed value
them, they just don’t realise they aren’t
demonstrating it to them in ways that
matter to employees.
When I am training employees, I do so
in a collaborative way. As far as I am
concerned, they are the experts and no
external person can possibly understand
what it’s like to work in your business.
By empowering your employees to
‘co-design’ the right experience for your
clients, they will feel valued as their input
really matters, and therefore are much
more behind the initiative. This greatly
improves morale and the customer can
really feel it.
Be human
We’ve recently been forced to open
new channels to communicate with
our customers due to the pandemic.
We have to ensure we are establishing
how customers want to communicate.
There’s no doubt that face-to-face
communication is most effective when it
comes to building relationships - so try
to make up for the loss of this form of
communication. The telephone is also a
great way to connect. You’ll best get to
know your client when you are talking
to them. This is where those natural
conversations occur. Try to avoid constant
emails by telephoning now and again.
With email communications, there’s a
tendency to be to be very formal and get
straight to business. We must ensure we
make it easy for clients to understand. It’s
much more difficult for them to quickly
ask you to explain what something means
over email. Your language must be clear
and simple to understand. There should be
100% clarity around next actions e.g., who
needs to do what and by when. We live
in an era of people not reading content.
They tend to skim, which is frustrating
as often important information can be
missed, but it can’t be ignored that this is
the way people behave. Make it easier to
pick up the important points e.g., highlight
the key points or actions, or put the most
important information at the start.
Start today
By addressing the key drivers, connecting
with your clients, and doing the basics
brilliantly, your clients will remain loyal, do
more business with you and recommend
you to others. The beauty of CX is that
it has an equally positive impact on your
employees, ensuring they naturally want
to improve things for your clients and
really enjoy their jobs more. A human
approach has never been more important
and effective when it comes to business
growth and there’s no time like the
present to be more human.
Susannah Hewson
is Founder at CX Change
23

EXPERIENCE MAKES THE DIFFERENCE
HIGH IMPACT CASE MANAGEMENT DELIVERED BY WELL QUALIFIED, PEER
SUPERVISED CLINICIANS - SUPPORTING YOU WITH SAFE AND KNOWLEDGEABLE
HANDS FROM THE VERY START
breakthroughcasemanagement.com
Annabelle Lofthouse: 07703 103843 Catrin May: 07595 226097

EDITORIAL
BOARD
Dealing with
Highly Sensitive Issues
At Loch Associates Group we aim
to provide a range of services from
employment law advice, HR support,
health and safety consultancy,
employee wellbeing programmes and
mediation services to ensure clients
have access to all their people needs
from a single-trusted partner. The
very nature of our work can be
highly sensitive.
We may be carrying out an investigation,
managing disciplinaries and grievances, or
helping clients to look after employees’
wellbeing with mental health training or
absence management support. Our HR
Medical Specialists are also processing
highly sensitive medical and personal
information too. This often involves
emotional issues and it can be stressful
and tense for both the employee and
their employer.
There is not a one-size-fits-all approach
we can take, as each client may want to
take a different approach. So instead,
when we start working with a new client,
we spend time understanding their culture.
This is done not only to tailor our services
and develop bespoke solutions for them,
but also to ensure we work with our clients
so they have peace of mind that we can be
their trusted and secure partner.
Our work must remain confidential and
therefore we often ensure we discuss with
new clients who we should correspond
with, whether or not a work email address
is appropriate and when we invoice, we
are careful to check who is allowed access
to the time recording narratives.
We use encryption and passwords to
ensure emails and documents cannot be
accessed by a third party and we ensure
our communication with an accounts
team are managed carefully. We also
agree what information will appear on
invoices and who is authorised to make
requests for additional information. It is
so easy for a small piece of information
to be released which results in the
disclosure of confidential information
internally, with unintended and very
damaging consequences.
"When we start working with
a new client, we spend time
understanding their culture"
Pam Loch
is Managing Director at
Loch Associates Group
How to Exceed Client Expectation amid
Ever Increasing Demands
Clients have high expectations of
the legal services you provide, so
it’s vitally important that law firms
have the technology and software
solutions in place to deliver a
seamless, cost-effective, digital
experience that removes friction
from their clients’ journey.
Your average consumer does not have the
qualifications or knowledge to understand
the complexities of the legal services you
provide. They will not know if you’ve
utilised every area of the law to win/
progress their case, or whether another
lawyer could have done a better job.
However, they do understand what quality
customer service looks like, and that’s how
they will value the services you deliver.
In the case of law firms, and many other
professional services, the benchmark for
quality customer service is set incredibly
high. Every day, your clients experience
exceptional service from brands who are
pushing the boundaries of what is means
to be client-centric. Market-leaders are
removing pain points for clients that
they had previously learnt to accept and
therefore emphasising what it means to go
above and beyond for your customer.
What is your law firm
competing against?
Instant message online chats that offer
immediate support and guidance. Access to
transparent pricing, services, and products
online so consumers can complete their own
research and comparisons. Continuous and
real-time progression updates – via text,
email, and/or an online account – keep
consumers up to date on when purchases
have been dispatched, are enroute or have
been delivered.
It isn’t just online retailers that have
drastically improved their services. Online
forms, digital documents and e-signatures
that avoid the annoyance of printing,
scanning, and posting are standard
for most insurance companies, banks,
building societies and energy providers.
This is highlighted further during property
transactions. Consumers can research, book,
and enquire online, including having virtual
tools via the likes of Zoopla and Rightmove,
but then typically wait to receive a client
care letter in the post to sign and return
from their conveyancer.
Recommendations
Implement a practice and case
management solution that enables you
to offer digital onboarding, secure client
portals, e-signature tools, automated text
updates, timely notifications and much
more so you can meet – and strive to
exceed - the expectations of your clients.
Demonstrate to clients that you are
providing value by delivering a seamless,
simple, and stress-free experience and
you’ll receive repeat business, five-star
reviews and recommendations in return.
"Every day, your clients
experience exceptional service
from brands who are pushing
the boundaries of what is
means to be client-centric"
Craig Matthews
is CEO at Osprey Approach
25

Compare up
to 4 quotes in
60 seconds
1
Platform
4
Quotes
4
A Rated Insurers
It’s never been easier
to obtain legal
indemnity insurance
in just a few clicks.
Register today at
my-legal-indemnity-shop.com
T: 0203 808 6030
E: assetunderwriting@dualgroup.com
DUAL Asset underwriting Limited is an Appointed Representative
of DUAL Corporate Risks Limited which is authorised and regulated
by the Financial Conduct Authority number 312593. Insurer strength
ratings provided by AM Best and Standard & Poor’s
The housing occupational
therapy specialists
A private housing occupational therapy company, searching, designing and
adapting homes for clients with physical, sensory and cognitive disabilities.
These are just some of the services we offer:
• Accommodation expert, under Part 35 of Civil Law
• Property search
• Sourcing and liaising with building professionals
• Creating specifications for the building work
• Supporting the contractors during the adaptation work
• Sourcing all equipment fixtures and fittings
Visit designforindependence.co.uk to find out more

EDITORIAL
BOARD
David Seager
is Consulting Adviser to
SIFA Professional
Your Website is Your
Shop Window
Whilst I do feel that I have written often about the
SRA’s push for ‘Transparency’, I am not surprised to
do so, and I feel it remains important and will continue
to be. Modern Law advised us on the Editorial Board
that in a recent survey, 83% of consumers are now
influenced by a company’s website and will choose one
that provides clear information.
Given this modern phenomenon, how appealing, welcoming,
and clear your website is, becomes critical. Your website
becomes your shop window for the undecided consumer
browser, who based on the Legal Services Consumer Panel and
the SRA’s own research, might be assessing 2 or 3 sites, or even
more. This is why, since the rules came into force in December
2018, I have encouraged solicitors to see the regulator’s
Transparency Rules, not as a begrudgingly undertaken
compulsory chore but as an exciting challenge to embrace and
enter the spirit of.
This is your opportunity to differentiate your firm from the
other local legal services providers, solicitors or otherwise.
It is about describing the services you offer in concise plain
language and not in legalese. It is not about the possible price
you feel you should not have to display, but about detailing all
work and stages of delivery for the service and the qualifications
and experience of who will be delivering it, so the potential
client can truly see the value on offer. It is your chance to have
biographies of your staff, and the whole team - not just the lead
solicitor. It should also include not just professional but personal
detail to make your firm more approachable.
In short, it is recognising that your firm is in competition with
other firms for the next client. Consider yourself in a beauty
parade and having accepted this, decide how you might add
those final touches to your website that might be the deciding
differentiators. For example, it might be blogs written by
members of your team about how they work with clients, it
could be using short punchy videos to describe your services
or even interactive tools or calculators that don’t require
personal information.
One final point I always stress is that whilst the website is
vital, it will only come into play in the absence of a personal
referral. Without a trusted adviser recommending me to a
provider, I will start the research process, but with one, I may
not need to. So please, ensure to make the positive referral
to financial advisers or accountants when your clients need
complementary financial planning or tax advice and encourage
them to do the same with you.
"It is about describing the
services you offer in concise plain
language and not in legalese"
Alex Holt
is Business Development
Director at The Cashroom
Changing
Consumer Habits
I’ve said this before...I am old. Putting it into context,
when I was a newly qualified lawyer, we didn’t have mobile
phones. Computers were only just arriving, and they were
mainly for word processing. Email wasn’t a thing.
Looking back, time pressures were very different, as was client
expectation surrounding speed of response. If I dealt with a
matter, it meant I would dictate something. It would then go
to a secretary for typing, then back to me for signature, then it
would be posted. Very regularly it would be over a week before
I would receive a response.
Compare that to the present.
Clients expect an almost immediate response to email. They
expect to be able to contact their lawyer whenever they want,
and they also expect that lawyers in a transaction will be
constantly progressing their matter at either end. All of this
is often accompanied with a requirement that fees will not
be excessive – especially in conveyancing where the client’s
demands are particularly strident.
So, what habits do consumers now exhibit when choosing to
purchase something?
They expect to have access to a clear and concise website with
fully detailed products and clear pricing. They’ll be viewing
things on their phone of course and will expect to be able to
communicate questions at that point. They will look at ‘star
ratings’- google reviews, trust pilot etc. And when they decide
to purchase, in this case a service, they expect to be able to
track its progress. To be kept updated. To receive the promised
outcome timeously.
These pressures need a response, and that response comes in
two forms I’d suggest. Technology and outsourcing.
Tech tools are now available which ease the onboarding
process, manage the flow of data, enable communication, and
create cost efficiency as a result. Practice management systems
provide workflows and data to help with management and
business decisions.
Outsourcing elements of the business enables a law firm to
create flexible resource, expert in a particular element that
lawyers themselves might not be. This resource can augment
the tech, support the lawyers, and create a much-improved
experience for the firm’s clients.
So, the pressure on a modern lawyer has changed in many
respects, but at least they now have the incredible tech tools
and skilled support to meet the challenges. It’s actually exciting!
"They expect to be able to contact their
lawyer whenever they want"
27

Solicitors Professional Indemnity Insurance
At times like this you need
solid dependable advice
Professional Indemnity Insurance
Howden’s Professional Indemnity division is one of the most
experienced teams in the market, with over 150 PII specialists
and more than 30 dedicated to servicing the legal sector.
Our size and presence allows us to obtain quotations directly
from insurers and we offer one of the widest selections of A
rated providers available. This in combination with the strength
of our relationships in the market sets us apart as one of the
leading brokers when placing insurance. Our clients range from
sole practitioners to the UKs Top 100 legal firms.
Other Insurances
We also offer a range of other services and insurance
products from bespoke risk management audits through
to tailored Employee Benefits & Wellbeing packages, Cyber
Liability, Office & Contents and Public Liability Insurance.
Get In Touch
E
Info@howdengroup.com
W howdengroup.co.uk
Howden is a trading name of Howden Insurance Brokers Limited, part of Howden Group Holdings. Howden Insurance Brokers
Limited is authorised and regulated by the Financial Conduct Authority in respect of general insurance business. Registered
in England and Wales under company registration number 725875. Registered Office: One Creechurch Place, London, EC3A
5AF. Calls may be monitored and recorded for quality assurance purposes.

EDITORIAL
BOARD
Why Digital Onboarding is Changing
Client Experiences for Law Firms
How do you manage your banking on
the go? Do you shop online and opt
for next-day delivery? Perhaps you
relieve the burden of cooking dinner
after a long day by ordering through
an app on your phone. The way we
operate daily tasks has continually
evolved over the last decade, with
consumers squarely at the centre of
the entire experience.
Speed, convenience, and accessibility
have all become priorities for users in an
instant-gratification culture. With further
acceleration of technology aiding consumer
experiences over the last 18 months, as the
pandemic forced businesses to pivot, the
same level of service is expected within the
legal sector more than ever before.
Digital onboarding is a key focus for firms
as recognition grows of the pressure it
relieves related to challenges presented by
restrictions on face-to-face contact. From
digital forms and eSignatures to biometric
ID and source of funds verification, clients
have come to expect their onboarding to
be completed digitally.
Concerns have been raised around security
related to digital ID verification - a genuine
query where due diligence is particularly
pertinent. However, the introduction of
HMLR’s Digital Identity Standard provides
a safe harbour for firms when identifying
their clients digitally. Accessing the same
bank-grade security that is used by leading
financial institutions, clients have come
to expect digital ID checks as standard.
Increased convenience is a cornerstone of
the modern user experience.
The completion of onboarding
documentation can take weeks, with
delays caused by post, incompletion of the
forms and lack of access to devices such as
printers and scanners. The solution for both
firms and their clients is digital onboarding.
It’s not only the client experience that
benefits, but that of the firms’ staff as well.
Reducing the time to gather onboarding
information, creating transparency so
legal practitioners can advise their clients
if queries arise, and the ability to access
documentation from anywhere on any
device – it’s all part of a greater future for
law firm client onboarding.
However you view it, digital onboarding is
the way forward for legal. More than a bandaid
solution to counteract a brief change
to how we work, it’s a long term solution
that will swiftly enhance client and law firm
experiences from the first engagement,
setting you up for success from the outset.
"Accessing the same bankgrade
security that is used by
leading financial institutions,
clients have come to expect
digital ID checks as standard"
Bronwyn Townsend
is Senior Marketing Manager at InfoTrack
Automated Technology
and Personal Relationships
Go Side-by-Side
Bill Gates once said “Robotics
and other combinations will make
the world a pretty fantastic place
compared with today”. In some
way we can all identify with this –
the speed with which technology
can replace mundane tasks is
phenomenal. But where does it end?
According to Anthony O’Hanlon, Head of
Customer Development “As a provider to
the legal sector, we can definitely see a role
for technology in helping make the lives
of lawyers more efficient. We have spent
hours meeting with law firms of all sizes,
listening to their frustrations and pain
points, allowing them to set our roadmap
for future technical developments. This
has resulted in important, market-leading
changes such as Variable Statements
of Fact (VSOF) – a service we believe is
unique to CLS in offering Legal Indemnity
Insurance. By replacing the need to go
offline and request a bespoke quote, a
solicitor can now tailor a policy to their
clients need in real time and all within one
simple online experience.”
However, there will always be a role for
relationships between people. Chantelle
Wren, Underwriting Manager at CLS,
explains that “being able to turn around a
quote quickly is only part of the solution
for our clients. When a case becomes too
complex, we delight in being able to provide
a personal service from our team of experts.
The route it would take for that to be done
online would become clunky and tiresome
very quickly. Pursuing a technology-based
solution in those instances, for the sake
of it, doesn’t bring the client any joy.
That’s why we wouldn’t force it on people
- instead we spend time listening to our
clients and problem-solving for them.”
At CLS we have huge amounts of technical
skill, paired with over 1.5bn data points and
the experience under our belt of over 10
million property transactions. We actively
recruit diverse, passionate and creative
people with a deeply ingrained ability to
adapt to the problem at hand through
collaboration – whether that’s through
the use of technology or in-person
relationships. By exploring and learning
from our personal experiences with
technology, and embracing opportunities
to remove silos or administrative burdens,
we can be a positive catalyst for change in
our clients work life.
"When a case becomes too
complex, we delight in
being able to provide a
personal service"
Chantelle Wren
is Underwriting Manager at CLS
Anthony O’Hanlon
Head of Customer Development
29

EDITORIAL
BOARD
Neville Dinshaw
is Managing Director at Law
Mergers and Acquisitions
Customer Interaction:
Face to Face,
Virtual or Both?
We are living in an era of digital transformation, and
the COVID19 pandemic truly highlighted the imperative
need to embrace new tools to maintain business
continuity in all industries. However, striking a balance
between how these new tools are used and reassuring
your customers through human interaction, is a delicate
art. It can either catapult your productivity and success
or leave your clients with an unsettling feeling that
could drive them away and towards your competitors.
If used correctly, technology is meant to be your biggest ally -
your organisation can have the agility to find information and
provide responses with reduced time scales which translates to
better value for money to your customers…. as we all know,
time has a cost!
What’s more, we have become more comfortable holding virtual
meetings and interacting via camera through digital platforms.
We can still read body language during a conversation whilst
maximising our time by avoiding onerous commutes. This is also
benefiting our team members, as they can now have a better
balance between work and personal life. Research about successful
organisations provides evidence regarding the undeniable
correlation between job satisfaction from staff members and
the success of the company. Creating opportunities for work-life
balance equips your staff with the flexibility to work in a way that
allows their skills to shine, and your clients will notice it.
What is important to have in mind is that as humans we are all
different and so are our preferences, therefore it is paramount
that you invest effort in understanding the needs and
preferences of your clients to customise their experience.
However, a resilient law firm will not just focus on adapting
to the current needs of clients, it will work proactively, setting
the grounds to adopt change (digital, cultural, technical,
governmental and financial) to become the “practice of choice”
for its future clients. Market research and observing trends will
provide your organisation with a good flavour of what is needed
and will enable you to start developing the strategies required
to portray your firm as the best option in the industry in terms
of fulfilling new expectations.
Mark Holt
is COO at Frenkel Topping
Establishing a
Better Relationship
I believe most business leaders would like to think they
are delivering the best service they can but sometimes
it can take a personal experience, away from the day
job, to widen your scope and highlight the opportunity
to improve.
Frenkel Topping’s service is outstanding! Our client retention
rate of 99% speaks for itself. But it took a recent purchase of
some home improvement supplies to remind me that there
is always potential to do better. I received a call at the same
time, on the same day each week to update me on my order.
I’ve no doubt in that situation the supply process was largely
automated and technology plays its part in the customer
journey, but the human touch of a phone call from someone
who understood my specific circumstances – it took the
situation from a simple transaction to an experience and I’ve
now got an established relationship with that retailer.
The fundamentals that made their service extraordinary –
keeping the customer informed, managing expectations, being
reliable, delivering on a promise, making every customer feel
looked after and special – all of that applies regardless of the
industry you operate in. Even if you’re the best in your field,
you should strive to be better.
We’ve invested hugely in technology in recent years in order to
improve the experience for our clients. However, technology has
in no way replaced our people-led approach to managing the
customer relationship. For us, technology allows us to create
efficiencies that free up time for our team to spend directly with
our clients. All human characteristics are difficult to replicate
artificially but those of empathy, compassion and understanding
particularly, are so important in the field of personal injury and
clinical negligence.
"It took the situation from a
simple transaction to an experience
and I’ve now got an established
relationship with that retailer"
The combination of an agile service underpinned by digital
tools, a customised approach to clients and a conscious effort
to incorporate incoming trends and aspirations will definitely set
your firm apart from the crowd.
"It is paramount that you invest
effort in understanding the needs and
preferences of your clients"
31

DigiAssist
RPA as a Service
Your simple solution to automate business
processes with no technology overheads.
DigiAssist offers the benefits of RPA - digital
workers on demand, improved efficiency, increased
productivity, enhanced accuracy, timeliness, 24/7
availability, operational flexibility and data
confidentiality – with the additional benefits of
SaaS – lower running costs, reduced time to ROI,
increased scalability and ease of use.
enquiries@wmpromus.com +44(0)2039466226
WM Promus are automation specialists guiding organisations along their transformation journey.

EDITORIAL
BOARD
Developing Our
New Website
It’s significant that eight out of
ten consumers are influenced by
company websites. However, when it
comes to our potential clients, they
are much more than just consumers.
Visitors to the Breakthrough website
are here because either a loved one, or
they themselves, have experienced a life
changing injury. While website design and
SEO are important, there’s so much more
to it. It’s about providing people with
support and information – who we are,
and what we stand for.
That’s why our team recently embarked
on a project to develop a new website. We
won’t pretend it’s been easy. There’s been
a lot of soul searching, questions asked
and (amicable) differences of opinion.
Nevertheless, we are excited about our
new website and everything we have learnt
in the process will shape our wider strategy,
identity and purpose as a business.
The first challenge was our brand. We’ve
had the same logo since we started
Breakthrough Case Management. We
recognise that the business has progressed
and developed over the years and decided
that a refresh will reflect our growth and
authority in the sector.
The imagery on our website needs to
provide reassurance, a tone of integrity
and professionalism delivered with
understanding and a sense of optimism for
the future for our clients. Our hope is that
the images we have chosen reflect positivity
and demonstrate the potential for individual
breakthroughs throughout and beyond
their rehabilitation. Someone who may
have experienced a catastrophic injury but
nevertheless is living with purpose, energy,
drive and determination. Because that’s
what we strive to achieve every day for
every single one of our clients.
When it comes to user experience we keep
it simple. What do people need to know?
How do we express this in clear, jargon
free writing that isn’t intimidating? We
stick to plain English, use flow diagrams to
explain our processes and provide different
audiences with what they need. For
example, individuals and their families will
have different questions to our colleagues
in the legal and insurance professions.
Ultimately our website is more than selling a
product or service. It’s about demonstrating
to people why Breakthrough exists. The job
of a case management company is to make
life easier - for our clients and their families,
and the various professionals we work with.
Our website should do the same. Please do
take a look and let us know what you think.
"The images we have
chosen reflect positivity and
demonstrate the potential for
individual breakthroughs
throughout and beyond their
rehabilitation"
Annabelle Lofthouse
is Owner of Breakthrough Case Management
Delivering a
Fluid Customer Journey
Technology-backed service
improvements in the legal sector
typically deliver a customer experience
that feels seamless, faster, and
familiar. “Familiar” because it reflects
day-to-day life where clients engage
with Amazon, Uber, online banking
services and so on. Today’s clients are
comfortable online.
With services and pricing so competitive,
many organisations seek competitive
advantage by kick-starting technical projects
related to customer experience. Doing
so without any real understanding of the
customer journey is unlikely to deliver the
desired improvements. The starting point has
to be mapping the customer journey.
As you map the journey, note the customer’s
expectations, their pain points and those
’make or break’ touchpoints that define
how they feel about your organisation.
In this way, you can see what areas need
improvement and at which stages technology
might deliver benefits. Negative impacts
occur when organisations employ technology
for technologies sake - feeling pressurised
to “digitally transform” without pausing to
reflect on what’s truly needed.
Customer journey mapping highlights
where service responsiveness, accuracy,
knowledge, availability, reliability and so
on is lacking. Increasingly organisations
are choosing Robotic Process Automation
(RPA) to revolutionise process efficiencies
and deliver the very improvements needed.
Put simply, RPA is just software (known
as bots) that automates a process e.g.
onboarding a client, invoicing, searching
through files, providing answers to
frequently asked questions and so on. By
its very nature it provides those levels of
response, accuracy, reliability etc. associated
with a superior service experience.
We’re talking about immediate responses
to client emails. 100% accurate billing. Bots
are designed to handle and manage data, to
open and ‘read’ emails, to scan and process
documents, to screen scrape – so much of
that forms the bedrock of a legal firm’s service.
Clients don’t need a human to send emails
that acknowledge contact, or download,
search and provide data. Clients don’t care if
a bot does those tasks; they just want their
issues resolved quickly without mistakes.
Without question, there are points in the
journey where a human touch is what is
required. Any task that requires creativity,
ingenuity or empathy is better suited to a
human than a bot. Using RPA for the logical
tasks liberates your employees to focus
on clients that need a human connection.
The future holds this combination of
human workers and bots delivering the
customer experience. Your employees will
drive improvements using their emotional
intelligence. RPA is a huge opportunity to
complement your employee’s abilities to
overcome customer hurdles and deliver
an experience fit for today’s competitive
landscape and the future.
Eileen O’Mahony
is General Manager at WM Promus
33

EDITORIAL
BOARD
Howard Sears
is Chairman at Price Bailey
Chartered Accountants
How Much Should You
Spend on Marketing?
Just like any other department, marketing requires
investment, and technological advances are changing
how that investment is deployed. Though marketing
spend can be tough to justify sometimes due to
the difficultly in quantifying a tangible return, a
recent survey concluded that 83% of consumers said
they were influenced by a company’s website when
searching for a product or service.
Consequently, website usage can now be monitored more
easily than ever before, and consumers can even be tracked to
understand their buying patterns. So, is marketing an area that
we are now, more than ever, able to tangibly calculate a return
on expenditure?
A marketing team within a law firm will have different priorities
to most others. Consumers are likely to be already aware that
they require a law firm when they are looking for your services,
so the marketing teams must put greater focus on being
found quicker, looking more attractive by comparison to their
competitors, and building credibility.
According to research by the SRA, firms of solicitors spend the
least amount on marketing as a percentage of turnover in the
legal industry, while alternative business structures spend far
more. The industry has seen an increase in a firm’s average
marketing spend of 0.5% in the last 5 years. This increase is
likely due to firms bolstering their brand as new players come to
market in their local areas.
So… the answer to the question I posed will depend on the
firm and its aims. The likelihood is that law should be spending
more on marketing, but with good reason. Law firms were
traditionally chosen due to location, and a firm’s whereabouts
had a big impact on its consumer demographic, its sphere of
influence and often its success. The pandemic has, in part,
removed these geographical barriers and made consumers
far more comfortable with virtual meetings and remote
relationships. It has also forced governing bodies to adapt
regulations to support transacting in a distanced environment.
This means that markets that were previously untouchable
due to geography have opened up to law firms. The industry
averagely still only spends 2.6% of its revenue on marketing
in spite of the reported 0.5% increase. Tapping into locations
in which you have no physical presence can be difficult, but
marketing teams are best placed to lay the foundations, whilst
protecting your existing brand.
"The industry has seen an increase
in a firm’s average marketing spend
of 0.5% in the last 5 years"
David Grossman
is CEO at Simplify
Understanding
the Journey
It’s no surprise that our experience of shopping online
has become second nature. For a £10 item we may
glance at the star rating before clicking ‘buy’, but rarely
do we want a chat with the manufacturer first. Yet,
when it comes to a purchase of significance, financially
or emotionally, then our rules change – and rightly so.
As consumers we go on a journey and never more so than
when buying or selling a home. There are always aspects of
that journey which we’re happy for technology to facilitate
– where once we relied on the postman, we’re now happy
for technology to deliver our messages via email, uploaded
attachments or SMS; but we need our journey to be punctuated
by human interaction, for experts to guide us and explain the
intricacies of the transaction to us. Ultimately, we as consumers
want to feel supported, to have trust in the company/service
being provided and reassured we’re doing it right. We want to
feel cared for.
Market leaders need to understand this journey, to know when
to engage the technology to aid someone’s day and manage
the admin, and when to pick up the phone and offer human
reassurance. This understanding adds value and is essential.
When this balance isn’t met it can be catastrophic – consumers
venting via social media springs to mind. Very quickly a
frustration of not knowing escalates into worry, panic and
anger. Businesses must remember to put themselves in
their customers’ shoes. By pre-empting these moments and
developing ways to keep the client informed, the worry and
stress can disappear. Just think how happy you feel knowing a
train is only 2 minutes away thanks to the information board,
compared to when the board is broken, and you’re left waiting
in limbo.
That said, companies mustn’t rely so heavily on technology
that they fail to engage with their customers; otherwise the
stereotype of online providers being nothing more than
interfaces and systems comes true. Finding the balance in big
business is crucial.
Listening to customer feedback provides the key to creating the
balance – adapting, blending and tweaking as required. Moving
home is an emotional experience but when the balance is right
between using technology and human interaction, it can be a
great one.
"Businesses must remember to put
themselves in their customers’ shoes"
35

A mission to change the way law firms
operate, everywhere and forever.
gunnercooke is an award-winning full service law firm founded in 2010, to
challenge, improve and evolve the way that lawyers work.
The gunnercooke model offers experienced lawyers the freedom and flexibility
to build their own practice, in the way they choose. Each lawyer sets their own
targets and decides which clients to work for. Their earning potential is unlimited.
Our role is to deliver a world-class support service, making it as easy as possible
to maximise the opportunity that the model provides.
In a recent feedback survey, 95% of our lawyers said that they were happier at
gunnercooke than in their previous firm.
Join gunnercooke
We want to speak to senior lawyers who enjoy the freedom of working
collaboratively amongst highly experienced peers.
People with the appetite and ambition to change the way that legal services are
delivered to businesses. If this is you, get in touch at info@gunnercooke.com.
Choose flexibility | gunnercooke.com
Looking for a
company that invests
in your future?
Simplify Works for you
We’ll give you the time and support
to make the most of your future.
We care about the success of our
people; we’ll develop your skills
through our award-winning training
academy so you can realise your
full potential.
We are always looking for inspiring,
innovative, and caring conveyancers,
so if you want a company that invests
in your future, why not see how
Simplify ‘works for you’?
recruitment@simplify.co.uk
www.simplify.co.uk/careers
Simplify incorporates six of the largest UK conveyancers; Advantage Property Lawyers, Cook Taylor Woodhouse, DC Law, Gordon Brown Law, JS Law and Premier Property Lawyers.

EDITORIAL
BOARD
Growing
Customer Expectations
The insurance industry has itself
been accused of being something
of a laggard in taking on the mantle
of customer-centricity. I believe we
can offer a different, and hopefully
interesting perspective.
At DUAL Asset, we’re very much in the
legal sector, but not truly of the legal
sector. We’re a specialist insurance MGA,
that is, a tailor and reseller of insurers’
insurance capacity to property, probate
and M&A lawyers and insurance brokers.
In short, we’ve got customer relationships
left, right and centre, the full 360°.
We’re a learned middleman, educating all
sides to the needs of others, in what is
essentially a relationships business. That
means being open and fair to all parties,
and unfailing in treating everyone as you
yourself would expect to be treated.
The problem is, the way that people expect
to be treated is going through the roof.
The indirect competition in this area is
a powerful, influential force. The other
day, I was buying a gift online – a spa
day experience for my wife’s birthday. I
chose one, and then a minute later, saw
a better one.
I spoke to the company’s live chat: at first
a triaging chat-bot, then a countdown
of where I was in the queue, then three
minutes later, a real person, Ben. I typed
him a quick message, explaining that I
bought the wrong one. Not only did Ben
say he’d refund my card straight away,
but he volunteered that if I took store
credit instead, I would be refunded an
extra £7 towards buying the correct one
immediately. I essentially got paid £7 for
my own mistake.
Can you imagine the legal or insurance
sector doing anything like that?
To impress clients long-term, expertise
isn’t always enough (although we do
have plenty of it) and we’ve become
committed to the modern client
experience. As such, we’re the only
insurance specialist who provides legal
indemnity cover for property transactions
through an online price comparison
tool. My Legal Indemnity Shop provides
a choice of competitive quote/insurer
options and lets property lawyers insure
clients instantly, in just a few clicks. This,
hopefully, helps our clients exceed their
own client’s expectations.
That’s what our clients told us they
needed. So that’s what they got, because
listening and reacting proactively is
everything. The client has always been
king and queen. The difference now in
2021, is that they very confidently know it.
"The way that people expect
to be treated is going through
the roof"
Mark Dennis
is Head of Online Services
at DUAL Asset
How a Shoe Collection
Highlights the Importance of
Designing for Emotional Needs
It is a privilege to step into a client’s
life at a time when they have suffered
a catastrophe and the future is
unpredictable. Our task is to equip
them with the accommodation they
need for a future they may struggle to
imagine. It’s crucial for us to identify
those needs in the first place – and
that means looking at a client’s
existing home environment for clues
to their personality, way of life and any
family members who live with them.
Observation skills are vital when it
comes to assessing clients. A lot of
written information is provided by legal
representatives or case managers. But we
need to see for ourselves a client’s abilities,
relationships, lifestyle, culture and priorities.
There’s no substitute for walking around a
home, chatting and meeting other family
members. That’s what enables us to provide
a unique, personalised design – rather than
just a functional, usable space.
The crucial role played by this personal
touch is illustrated by the example of Mr B,
whose case was settled during the Covid-19
pandemic. With a deteriorating spinal
condition, he was looking for a house for
his family to live in. The written information
we were given suggested that he was able
to walk safely now but he would become a
wheelchair user in the next 5-10 years.
We met Mr B via Zoom initially due to
social distancing restrictions. But our
property search proved to be challenging
as most of the houses we found were
rejected by him with little explanation.
As the restrictions lifted, we asked to meet
Mr B and his family at home to review the
search. That was when we came across
Mrs B’s shoe collection. We also saw the
number of computers Mr B had to operate
at one time for his work. We then assessed
Mr B negotiating the stairs, which was
when it became clear that a ground-floor
bedroom and bathroom were required
immediately to prevent future falls.
Soon after our visit, we found the right
house for Mr B and his family – with
storage for Mrs B’s shoe collection a
priority. Mr B was delighted – although it
had nothing to do with his disability, his
wife’s happiness was everything to him.
The emotional aspects of accommodation
needs are often overlooked as the focus
is usually on people’s functional abilities.
At Design for Independence, we believe
emotional needs are equally important.
"The crucial role played by this
personal touch is illustrated by
the example of Mr B"
Anava Baruch
is Managing Director at
Design for Independence
37

Future-proof
your law firm
Cloud practice
management software
that puts you in control
Deliver first-class client
service that wins more
business
Streamline and
automate processes to
improve profitability
Improve scalability
and agility to remain
competitive
Software solutions that help lawyers succeed
ospreyapproach.com | enquiries@pracctice.net | 03300 604940

EDITORIAL
BOARD
Willie Pienaar
is Co-Founder & Chief
Executive at Nuvalaw
Conversation, not
Technology, is the
Gold Standard in
Customer Experience
Customer service can make or break a company, which
is why it should be at the forefront of every business
decision that you make. Over time it has evolved to
include more and more technology-based interactions
with customers. This development has brought us many
advantages, but with them come certain risks.
The advantages are clear: instantaneous feedback channels,
automated product onboarding and education, and the ability
to serve more clients more efficiently. The ideal outcome being a
thriving business and happy customers. The reality is somewhat
different. With the enthusiasm around digital transformation
in law and insurance, technology providers run the risk of
inadvertently introducing more complexity and frustration.
At Nuvalaw, we have a saying, ‘Don’t automate the mistake’.
It arose in response to our awareness of the very real risk in
technology development of simply automating everything
according to its existing structure. Following this route, you make
the fatal assumption that the way that things are, is the way that
they should be. Why does this happen? Usually, it is because one
has not spent enough time on customer service and experience.
Human-to-human interactions are the single most important
moments in your business relationship with customers, as they
represent a unique opportunity to deepen understanding of
their particular issues and to integrate this feedback into how
you think about developing your products and services.
Customer service is not about answering questions; it’s about
solving problems, and the best way to solve a customer’s
problem is to make absolutely certain that you understand
it before you propose a solution. You may discover a process
that hasn’t been questioned for decades (or, in the case of
law, centuries!) and can be greatly simplified by collaborative
innovation with the customer.
Nuvalaw developed the first inter-party claims resolution
platform allowing lawyers and insurers to interact to resolve
claims and part of their success has been our constant
communication with them. We hold weekly calls to iron out any
issues they might have and to gain deeper insight into their
pain points. We were the first ever platform to offer liability
determination through online ADR. This capability development
arose out of customer experience interviews.
So, while we have technology to thank for many things, let’s
guard against letting it obtrude into customer experience.
"Customer service is not about answering
questions; it’s about solving problems"
Marc Lansdell
is Managing Director at
Evolve Law
Opportunities
and Challenges of
Contemporary Legal
The internet has accelerated the ability for instant
access to goods and service. It has shaped a world
where information is demanded in real time and
goods can be delivered the same day. This has and will
continue to pose both an opportunity and a challenge
for those in the legal sector.
In our area of conveyancing, I hope that we have woken up
and have reacted fairly quickly to these new demands, however
there is more work to be done. Conveyancing transaction times
have slipped even further and we can argue until we are blue in
the face as to why that is, but whilst we do clients expectations
continue to move in the opposite direction.
Clients to some extent, do not care about the process, only
the end result. It is our challenge but also our opportunity to
increase the speed in the process, being ever mindful of our
compliance and risk obligations.
If we are ignorant and do not accept that society is dictating
the pace of change then those outside our industry will snatch
the opportunity to commoditise the process. If we cannot offer
a solution - then our clients will find a solution elsewhere. I am
sure that no party wishes to see a property market backed by
title insurance and which negates the need for a lawyer to play
any part. Well perhaps some do, until it goes wrong!
I am pleased to see that as an industry we have collectively
woken up to the use of modern technology and my hope is that
all firms continue to work both internally and with third parties
to innovate and create new systems and ideas that will help us
catch up on the lost years. It’s no longer ok to say “well this is
how we do things”.
Now is the time to look at your business. Are you proactively
thinking ahead rather than reacting to what others are doing?
The chances are that if you are reacting then it might already
be too late such is the pace of change. Our opportunity is to be
players in the game rather than fans cheering on the side lines.
In our business we would rather be scoring the winning goal
than singing Three Lions.
"Clients to some extent, do not care about
the process, only the end result"
39

EDITORIAL
BOARD
Richard McCall
is CEO & Co-Founder
at Armalytix
The Unexpected
Combination of Better
AML Checks and
Happier Clients
For the legal profession, not only is it important to do
the right thing but also to be seen to do the right thing.
As regulation on the legal profession has grown, the industry
has needed to respond. The Solicitor’s Regulatory Authority
(SRA) cites both the 2017 Money Laundering, Terrorist Financing
and the Transfer of Funds Regulations as two critical pieces of
legislation for the industry. To follow up on this, in 2019 the SRA
wrote to 400 firms, asking them to demonstrate compliance. Of
these, 21 percent could not do so. As recently as April 2021, a law
firm based in Surrey was fined £10,000 for breaches of the Anti-
Money Laundering rules - based partly around a conveyancing
transaction that produced just £850 in fees.
Law firms want to demonstrate that they are doing the right
thing by their clients and showcase their compliance to the
letter of the law. To be in breach, risks not only fines but
significant negative publicity.
Technology has the capability to speed and simplify the process
of complying with legislation, for example by digitising the
process of collating and analysing source of funds information.
Traditionally, a request to a client is sent out via letter or
email. Time passes while the client gathers all the relevant
documentation and shares it, typically either as a series of bank
statements or a digital file. The law firm then sifts through this
and tries to make sense of the information. The process is slow
and manually intensive – the equivalent of seeking a needle in a
financial haystack.
The modern law firm can now use a variety of apps and
services, such as Armalytix, to turn these tiresome and repetitive
processes into a superior digital experience for them and their
clients. Compliance checks can be digitally requested and
approved across multiple accounts in moments, delivering
the relevant data as well as automatically highlighting key
transactions that may need further investigation.
For the law firm the benefits are significant; time and money
saved, resources freed-up and crucially, more efficient and
effective compliance checks. The real beauty is that all those
advantages come whilst providing clients a simpler, smarter and
more secure way of providing their sensitive financial information.
A better client experience with peace of mind, a more efficient firm
and simpler compliance checks. Technology worth embracing.
"To be in breach, risks not only fines but
significant negative publicity"
Amanda Illing
is CEO at
Gatehouse Chambers
Reviewing Our
Core Values
A year ago, I would have said that the culture and
values of our business were important to clients
because particularly in a professional service business,
people buy people. A year on, I would say it is
absolutely vital!
I appreciate that some think that the modern-day customer
is interested in the cheapest, fastest service. However, when
complex legal knowledge and expertise is needed, people look to
their trusted advisers to provide a quality service for which they
are prepared to pay. They also have a better client relationship if
there is a feeling that culture and values are aligned.
Barristers’ chambers are not known for being open about
culture and values, or even prepared to express a strong view
about issues that are emotive or political.
During the course of 2020 and the Black Lives Matter protests
following the murder of George Floyd, a number of legal
bloggers started to investigate historic legal figures, including
Lord Hardwicke, the 18 th century Lord Chancellor. In 1729, Lord
Hardwicke was one of two authors of the Yorke-Talbot opinion
– a legal opinion which provided slave owners with the legal
justification for slavery for many years.
The premises of Hardwicke Building, named by Lincoln’s Inn,
became the name of our chambers in which we occupied since
1991 - until our recent move to 1 lady Hale Gate, Gray’s Inn.
It was of regret that no-one had investigated Lord Hardwicke
or his legacy when we assumed his name as our business
name three decades ago. Once discovered, the name did not
sit comfortably with our values. We were planning to move
location by then, and the concept of perpetuating the legacy
of Lord Hardwicke by taking the name with us when we moved,
was unthinkable and didn’t make any business sense.
The name-change and building move enabled us to review
our core values and agree on an organisational ‘Gatehouse
Chambers Charter’, setting out an internal pledge that is shared
publicly on our website.
An announcement to our clients of the name change, the
Charter, and the reasons why elicited an overwhelmingly
positive response and has brought us closer to many of our key
clients. If we operate in a way that is consistent with our clients’
culture and values, we will have stronger, more loyal client
relationships. It was a brave decision to change our name, but it
was the right one.
"Barristers’ chambers are not known for
being open about culture and values"
41

Mckie Legal Recruitment
Mckie Recruit are a specialist legal
recruiter in personal injury, clinical
negligence, costs and housing.
We have established law firm clients
looking to recruit now:-
• Clinical negligence Solicitors
• Costs lawyers
• Housing Disrepair Litigators
• Personal injury Solicitors (RTA / EL/ PL / disease)
Most of our roles and clients are across the North West.
If you are looking to move roles please contact us on info@mckierecruit.com
or check out our current vacancies at www.mckierecruit.com

EDITORIAL
BOARD
The Three Principles for
Creating a Great Work Culture
A great workplace culture runs
throughout an organisation. It can’t
just be a directive from management
and thinly acted upon just by
mounting some inspiring slogans on
the office walls, it’s fundamentally
driven by the attitudes and values of
the personalities within a business.
For this reason, I think that culture is
significantly affected during growth as
new people join, which makes it a critical
time to consider what core attitudes and
values you want to cultivate. FCI has more
than doubled its headcount in the past
two years, and we’ve found that selecting
like-minded colleagues has been key in
maintaining and improving our culture.
In my experience great working culture
also rests on the three principles of trust,
ownership and accountability. Tweaks to
structure can quickly establish individual
and team responsibility for certain tasks
or goals. If these are fair and realistic,
they can help to create a universal sense
of business ownership. At FCI our team
don’t just work for the business, they are
the business. We have also found success
with a ‘no blame’ ethos which drives trust
and avoids the professional paralysis often
symptomatic of a ‘fear of failure’ culture.
This gives people the freedom to make
decisions and innovate.
Lastly, in my view one of the most
fundamental ingredients is simply
understanding the ‘why?’ of what we do.
It sounds like a cliché, and perhaps it is,
but I have found that for most people to
feel truly content, myself included, we
need to understand what our professional
contribution means in the wider picture of
social or emotional benefit.
At FCI we focus on the fact that even
the smallest of actions affects ordinary
people in the home buying process. At
a stressful time, a speedy response, or
going above and beyond to solve an
environmental concern are all small acts
which achieve the ‘why?’ of what we do,
which is to help people. Ensuring that the
team have the guidance to understand
the significance of their individual
contribution, no matter where it sits in
the business, is a great place to start
building a positive ownership culture.
Though our culture has always been
centred around kindness and respect, the
pandemic has helped us achieve a better
understanding of individual circumstances.
It has given us insight which we might not
otherwise have had, and a valuable lesson
we’d be remiss to quickly lose sight of.
"At FCI our team don’t just
work for the business, they
are the business"
Tim Champney
is Managing Director at
Future Climate Info
Client Experience is
Central to Recruitment
As a Legal Recruitment business, the
client experience is central to our aims
as a business. We are first and foremost
a people business and law firms instruct
us because we engage with them
carefully to find out what their needs
are in terms of legal recruitment and
how we can best assist.
We set up our firm to look specifically at
what a law firm wants in a recruitment
partner - not only in terms of fees, but also
service delivery. Our business is built on
making the recruitment journey easy and
hassle free. Technology has been crucial to
our customer experience and this can be
seen in our creation of a clear and succinct
website, as well as in our use of online
outlets including LinkedIn and Twitter.
We also strive to operate a top-rate candidate
experience and therefore look carefully
at how we engage with candidates, how
we assist them and what they experience
when they engage with us. We focus on
making sure that candidates know exactly
what roles we are putting them forward
for, congratulating a successful one and
giving helpful feedback if a candidate is not
successful. By combining a great experience
for law firms and candidates, it means repeat
business from both becomes inevitable.
Since our inception we have concentrated
on what really matters to our law firm
clients and designed our processes around
that. These are our core principles:
1. Reasonable fees - we charge 12.5%.
2. Vetted candidates - our clients don’t
have the time to sift CVs.
3. Access to a good range of candidates
- to that end we have arranged to advertise
in key publications that our clients’
candidates read, such as Modern Law!
4. An end-to-end process - we take
care of the whole process until our
candidates start.
We are an effective outsource of
recruitment for small firms with no internal
HR Team, so all these things are important
to them.
"We also strive to operate a
top-rate candidate experience
and therefore look carefully
at how we engage with
candidates"
Andrew Mckie
is Director at Mckie Recruitment
43

NEED HELP SCALING YOUR
LEGAL OPERATIONS?
DANACON.
Legal Operations Consultancy for
Modern Legal Teams
SOME OF THE THINGS WE CAN
DO FOR YOU:
LEGAL OPERATIONS
STRATEGY
TECHNOLOGY ROADMAP &
IMPLEMENTATION
We know
the unique
challenges faced by
in-house teams.
Led by Sonia Hadjadj - Founder
Brings real-life experience as an
in-house at global corporate legal
departments & tech scale-up GC.
HELLO@DANACON.CO
WWW.DANACON.CO
167-169 GREAT PORLTAND STREET
5TH FLOOR LONDON W1W 5PF

EDITORIAL
BOARD
Martin Cheek
is Managing Director
at Smartsearch
Technology At Its Best
Technology has always gone hand-in-hand with
customer experience, arguably as far back as the Caxton
printing press 500-years-ago which revolutionised the
experience of reading books in this country.
For most people in their 20s the use of technology is just what
they have grown up with, but for others from a more analogue
generation, there is a perception that doing everything online is
a barrier, because they’re not necessarily ‘tech savvy’.
This is the crux of the issue in my view because the best use of
technology is when the end-user sees it as customer service,
not technology.
When it comes to the use of technology in the legal sector,
whether it’s for conveyancing processes or anti-money
laundering systems, that is the approach that needs to be at the
heart of the matter.
There needs to be as much focus on the front-end userexperience,
as there is in the functionality of the tech itself
when developing a new app or platform. In the digital AML
solution sector, we see a lot of investment going into start-ups
and fintech firms that are making claims about their tech which
don’t stack up when it comes to the end-user experience.
Essentially it doesn’t matter how advanced you claim your solution
is because if the person with the responsibility for onboarding
new customers and going through AML due diligence in a busy
conveyancer’s office can’t work with it, it’s a non-starter.
The direction of travel at the moment is for more and more
remote working and mobile apps to enable customers to access
services wherever they are. This has been borne out of necessity
to a certain extent as the pandemic forced an end to face-toface
meetings, although it probably accelerated the shift that
was already happening towards more remote access.
The best examples of this will ensure that the user can access
the technology with the support of an informed and responsive
customer services team either in live chat or on the phone.
Where it could have a negative impact is if people are left to
negotiate the process with no support if they hit a snag, as they
will lose faith in the tech and the firm promoting its use.
To use a motoring analogy, you would not expect the owner
of a new electric vehicle to have to understand the technology
that goes into generating the power necessary to make the car
move. All they need to do is press the start button.
"A negative impact is if people are left to
negotiate the process with no support"
Laura Fisher
is Marketing Director at
Gunnercooke
If You're Not Adding
Value, You're A Cost
Is it time for a new approach to winning legal work?
My first professional job was in corporate finance, where
I proudly worked up to the title ‘Head of Intelligence’. In
hindsight this was a rather lofty name for ‘researcher’, but it did
teach me the importance of understanding each client’s team,
competitors, sector, and ecosystem. One phrase was used that I
still reflect on often – ‘if you’re not adding value, you’re a cost’.
I had presumed that the approach to winning work in a law
firm would be the same – demonstrate that you understand
and empathise with a business problem and present a solution
to fix it. Yet often, lawyers are trained to head out armed with
only their CV to denote their worth. A client is presented with
a detailed list of every matter the lawyer has ever advised on
and an understanding that the higher their charge out rate, the
more competent this lawyer must therefore be.
As I am not a lawyer, I initially felt unable to question this
approach – who am I to judge the way that they win work
(because as we know this approach works, and lawyers do win
work!). But as time goes on, and we come to expect a more
bespoke, personal customer service in almost every area of our
lives, is it time for lawyers to shirk their own preconceptions
of being a distressed purchase and adopt a new approach to
communicating the value they add?
I know many lawyers who are ‘trusted advisors’ to their clients.
Their remit goes far beyond a distress purchase. They are
on hand around the clock to listen and provide counsel and
they genuinely understand the context of their work. So,
how do they use this experience to add value? They ask great
questions. They truly listen to the answers. They are flexible
and non-prescriptive in their approach, willing to adapt to what
makes most sense for the client.
In the new world, lawyers are not only competing with one
another for work, they are also competing with technology,
solution design, security, and data manipulation. The
expectations are ever higher, but there are many opportunities
for firms to take a new approach to demonstrating their worth.
The ‘value’ of a trusted advisor lies in simple acts of personal
connection, understanding and genuinely caring about making
their client’s life easier, more compliant, and future proof.
Finding compelling ways to communicate and deliver this to
clients has a value far greater than the CV… or the cost.
"Is it time for lawyers to shirk
their own preconceptions of being
a distressed purchase"
45

EDITORIAL
BOARD
Supercharging
Customer Service
We’ve all experienced it. That
moment when you desperately need
to talk to your service provider, but
can’t get through to a real person.
Email forms are met with vague
automated responses, chat bots
fail to understand your nuance
and calling results in a neverending
barrage of ‘press 1 for …’
instructions or worse still voicemail.
In these instances technology is simply
not working well enough. While it
provides the foundations for improved
accessibility, efficiency and commercial
advantage, in these moments the lack of
human insight or touch is costly. It erodes
goodwill, breeds annoyance and delivers
substandard customer care.
However, when digital tools are coupled
with the human touch – the benefits are
supercharged. Working in tandem, tech
and people can improve brand perception,
deliver exceptional and memorable
customer service and create happy clients.
It’s the human touch that shapes how you
make customers feel.
We’ve always believed that technology
needs to support people so they can do
a fantastic job. This company-wide ethos
stems from understanding the nature of
customer enquiries and how they expect
to be treated. For law firms this is typically
because people have an urgent need i.e.
‘my query is really important and timesensitive’,
when a requirement is complex ‘I
want to explain my specific issue and gain
clarity’ and when they require sensitivity
i.e. ’I need empathy; I want a human to
reassure me.’
Increasingly, customers need to be heard
and understood on their terms. So, a
potential client might use live chat because
they need reassurance about a sensitive
issue and a quote in real time. They might
use social media to ask a quick question
out of traditional hours, or perhaps, they’ll
pick up the phone to discuss a complex set
of circumstances in detail.
Digital tools provide the channels or the
means through which to capture these
requests and expedite the issues – but
their real efficacy is determined by people
and their ability to listen, show empathy,
be helpful and embody professionalism.
The legal industry needs technology
that enables it to get closer to clients
and deliver better outcomes. It needs
technology-powered people.
"This company-wide ethos
stems from understanding
the nature of customer
enquiries and how they
expect to be treated"
Bernadette Bennett
is Head of Legal Sector
at Moneypenny
#1 provider of tailored answering
services for the legal industry
Exceptional firms, including sole practitioners and the Magic Circle,
outsource their calls and live chat to Moneypenny.
We give you dedicated receptionists from our specialist legal team, on
hand 24/7, to look after everything your in-house team does and more.
Their can-do attitude and attention to detail delivers outstanding
service to your clients and staff, and significant cost savings for you.
0333 202 1005 | moneypenny.co.uk/legal

10 MINS WITH
Helen Burness
Who inspires/ inspired you
Q and why?
For me, it’s what you might call
A ‘ordinary’ people that inspire me
the most. Hardworking people who
dedicate themselves to caring for others,
especially those who are vulnerable.
I think it is the most important job in
the world and I want to shine a light on
amazing carers everywhere, especially
after this past year and a half on the
front line.
Recently it’s been the English football
team led by Gareth Southgate. The way
they have role modelled throughout this
year has been incredible. I am in absolute
awe of their passion, their talent, their
determination and how they use their
platforms to tackle social issues. I think
Gareth Southgate’s leadership has been
exemplary. As someone who watched the
notorious 1996 penalty shoot-out, I love
this story arc and how he has used this
experience to be such a strong leader
for the team. He is honest, authentic
and leads by example. Marcus Rashford
is a shining example for young children
– I bought his book on “How To Be A
Champion” for my son…. But I think it is
actually for me.
Finally, but certainly not least, I want to
acknowledge (with my legal hat firmly
on) Ruth Bader-Ginsburg, such a huge
inspiration for all she did for gender
equality during her time in office.
What has been the most valuable
Q piece of advice given to you?
To always look to work with people I
A like and respect. It sounds so simple,
but it’s also so easy to forget. The other
piece of advice would be to think about
“Think about
the legacy you
want to leave”
Helen Burness
is Director at Saltmarsh Marketing
the legacy you want to leave. This has
inspired me to do more than just the day
job, and look to use professional privilege
around other issues that impact the legal
profession, such as equality and inclusion.
If you were not in your current
Q position, what would you have
liked to have done?
I actually had a very real dream to
A be an actress! My TikTok content
highlights this if you’ve ever seen it.
The reality was that the talent and
competition was unreal and I wasn’t
actually that good at the serious stuff
- I mainly liked to partake in comedy
(also – see my TikTok). Away from
acting, I would also still love to write a
book… You can probably tell that I’m
basically a frustrated artist at heart!
Oh, the other dream I have is that I would
also quite like to own my own vineyard
and make nice wine. I don’t know much
about the process at the moment, but I
feel certain I could figure it out?
What three items would you put on
Q display in a museum of your life?
This is such a great question! An
A old 1980s cassette of one of my
recordings of the Sunday chart show
(this reference will be lost on so many.) A
photo of me, my husband and the kids.
A glass of red wine.
What three guests would you
Q invite to a dinner party?
Phoebe Waller-Bridge (Fleabag) and
A French and Saunders. That would
be such a fun dinner party! Maybe Ruth
(Bader Ginsburg) could also join us….
47

ROUNDTABLE
Price Bailey Roundtable
For this current edition, Modern Law hosted an exciting new roundtable in
collaboration with Price Bailey LLP. By drawing on 12 voices, from 12 firms across
the country, we hoped to find out more about the important questions that have
come out of the past 18 months. What lessons were learnt from the change in
our ways of working i.e. flexi working, virtual meetings, remote management?
Have these things led to an increase in bottom-line figures? What impact has this
had on maintaining firms’ culture and attracting new talent into the firm? How
can firms look to maximise the opportunities out there and will they look to add
additional service lines in order to mitigate revenue stream risks?
48

ROUNDTABLE
Joining me for the discussions will be the Chair of the
roundtable, Howard Sears, Board Member and Practice
Chairman at Price Bailey LLP. Alongside him will also be
Chris Godsave, Partner and Chand Chudasama, Strategy
& Corporate Finance Partner – both of Price Bailey LLP.
Finally, Graham Martin, Relationship Director at Barclays
Bank PLC, will be lending his knowledge on the financial
impact he has seen across the legal sector this past year.
So, before we begin, who are Price Bailey?
Price Bailey LLP
Price Bailey is a multidiscipline firm of chartered accountants.
The firm has 10 offices covering East Anglia and London, with a
strategic international presence. Price Bailey has grown to be the
26th largest accounting firm in the UK, and bases its success on
forming strong, trusted lasting relationships with its clients and
professional contacts.
Price Bailey has 31 partners with varying specialities and aims
to have a service line to support clients at every stage of their
life cycle; offering audit and compliance services, specialist tax
advice, systems support, a fully outsourced finance function,
private client services and strategic advisory services.
Price Bailey has been in existence, in the same name, for over
80 years. Keeping its name for that time, and growing mainly
economically, the firm has a strong and supportive ethos,
providing a supportive environment for its staff and clients.
‘Contact Time’, is time recorded with clients but at zero rate.
The team spend as much of this time with their clients as they
can, using the time to understand them and their business, and
personal ambitions.
49

ROUNDTABLE
ROUNDTABLE
CHAIR: What’s been the key lessons that you’ve
learnt in the last 18 months and what positives
have come out of having to go into lockdown for
your law firm? Has productivity increased?
Kicking off the discussion was Roger Bull, Burges Salmon
LLP. “From the client perspective, our firm received an
overwhelmingly positive response and it also helped develop
relationships because we were all fighting the same fire. I think
there was some initial concern that the client relationships
would suffer and in turn business development, but in fact we
found a lot more of our clients were willing to use technology
to have a 20-minute meeting or catch up.” Roger goes on to
speak about how it had also driven collaboration within their
team. “People have pulled together with an absolute common
goal. We’ve taken some real positives around transparency and
communication - being a lot more open with what’s happening
to the business, what the leadership thinking is and why we’re
doing what we’re doing at this current time.”
Jessica Szczelkun, O’Neill Patient Solicitors, agreed with
this view before adding her own insight to this question posed
by the Chair. “We’ve found that a real positive has been how
it’s built greater trust in our firm. We didn’t see productivity
suffer; we saw it shift. Though our workforce were working
slightly different hours and people would be logging in after
the children had gone to bed, we supported that and were able
to offer more flexible style working. I feel it has really helped
strengthen the relationship across the board and has pulled us
much closer as an organisation. There’s more accountability
and there’s more communication because we knew we had
to make the effort to get in touch with people, rather than just
being busy or doing all day jobs.”
“Yeah, I completely agree with that” says Nadia Biles Davies,
Sharpe Pritchard LLP. “For us, there was a concern around a
dilution of culture because everyone’s working further apart.
However, actually we’ve been working more closely than ever
because you can have an all firm meeting, but you don’t have to
get everyone in the room - everyone can join in. Nadia outlines
some of the initiatives they have set up in order to keep the
team connected and strengthen the culture of the firm. “We
recently did a ‘Desert Island Discs’ where everyone had to share
their island discs with a bit of a story behind it. It was actually
the brainchild of our wonderful trainees and by getting everyone
from across the firm involved, within a few short months we
really got to know each other in a way that I think we wouldn’t
have done before lockdown. In many ways, that culture of us all
being in it together - like Roger mentioned earlier - meant that
our culture continued to be enhanced as opposed to diluted.”
CHAIR: That’s great to hear that you feel there
have been huge positives for your firm. So,
with that in mind, what’s your message about
returning to the office for you as a firm?
“For us, it’s about trying to take your team along on your
journey and providing that flexibility” says Richard Baker,
Stephens Scown LLP. “We’ve gone for, in principle, two days
a week in the office but are leaving it very flexible. We wanted
to allow our team leaders to make a lot of those decisions and
have given them the training around that in order to try and
balance what we call the ‘scowner’ experience (people who
work here), with the client experience.” Richard believes it’s
really important to provide people with the flexibility because
there are very genuine concerns coming out in the sector
around wellbeing. “We’ve tried to pick up on them, but we
haven’t necessarily seen the full extent of it yet. It’s not just
about work is it, it’s about what people have been through in
their personal lives, whether that’s their parents, friends or
other relatives who might have suffered - it’s been a very hard
time for people.”
“With us, I don’t want to be controversial, but our experience has
been a mixed bag” claims Abu Kibla, Stuart Miller Solicitors.
“I found that many of our staff didn’t know how to manage
themselves working at home. They actively called me and said,
look, can I come back to the office? Surprisingly it was mainly
the younger members of staff that did this.” For Kibla - whose
firm litigates criminal cases - having your own caseload can
be very isolating and what he’s seen is that most of his team
are happy to be back in the office. “I see the connections that
people have made since coming back and though I share the
sentiments of others round this table, in terms of the massive
improvements in cost savings and being more efficient, I think
on a human level when you take into account the type of work
we do - it has been very difficult.”
Jeff Lewis, Brabners, picks up on the point that Kibla makes
about junior members of staff. “That’s the one thing that
we probably do need to keep a real eye on going forward -
supervision, mentoring and training our junior people. As I
always say to junior people or those that are newly qualified
- you can read as many books as you like and go to as many
training courses as you like, but actually sitting in the office
and watching the people who have been doing the job for a
long time is priceless.” Lewis explains that you need to make
sure that there is still the ability for people to learn from those
who have been doing it for a long time and has learnt over the
past 18 months that this is not always the same when working
from home. “We also need to make sure that our senior people
have got people on hand who they can delegate the work to.
Otherwise, it’s very easy for senior people to cling onto the work
and say, well, I can do it faster myself, but that’s not doing the
firm or the junior people any benefit in the long term.”
With everyone talking about the generational differences in
wants and needs, Chris Godsave, Price Bailey, suggested
people need to feel connected to other people and to place.
The hardest thing is to work out
what makes an attractive client
and then working out how to
develop a relationship with them
and how you can add value to
that relationship
50

ROUNDTABLE
We’ve found that a
real positive has been
how it’s built greater trust
in our firm. We didn’t see
productivity suffer;
we saw it shift.
“Place plays a big part in creating that ethos and culture. If
people are going to be working remotely, you might suggest
that maybe the older generation - with their nice family homes
and gardens - are happier to work from home than the younger
generations who are in much smaller spaces. Consequently,
there’s then a danger that your office is unevenly split between
juniors and those with more experience.”
CHAIR: That’s an interesting point Chris… how
important do you think office space is in in
keeping your culture?
“I think it’s really important for the younger generation” claims
Ayesha Nayyar, Nayyars Solicitors. “A lot of the reasons
they get these jobs in the city is to be a part of the whole
graduate training vibe and comradeship. You want to enjoy
those friendships where you go out for lunch/ dinner or drinks
after work and you want that network culture. I think we have
to have an office so that even those members of staff who
don’t come in regularly have still got somewhere to go.” In
fact, Ayesha introduced an outside garden area at their office,
which is something that she says would never have happened
two years ago. “When the weather is lovely, it’s absolutely
fabulous. Even on the colder days they want to be outside
because some of the staff have made it beautiful. Recently
we’ve enjoyed a Euros party out there and have many more
social gatherings planned now things are opening up - it’s
great for the team spirit.”
After a short break, the Chair decided to move the conversation
on to pastures new...
Taking the opportunity to pose a question was Chand
Chudasama, Price Bailey, who asked if anyone had found the
need to diversify how work is won? “I think for many lawyers,
work is won through referral and cross-selling other services
to the existing client base. This might be harder if we stay in a
remote environment, but not necessarily. Have people found
that digital marketing and other ways of attracting new clients
has been high on the agenda?”
51

ROUNDTABLE
I definitely feel from a recruitment perspective it’s been massive. Most people
we speak to that work in and around the legal sector are finding tremendous
problems with recruitment
“Definitely so. We’re quite systematic about it and we do a lot
of big data analytics to work out who we want to work with in
order to segment the market” states Stephen Crow, Clarion
Solicitors. “The traditional approach for professionals is that
you meet somebody for dinner or at some sort of event, you
exchange business cards and you might then convert them
into being a client. However, the risk is that you then realise
they’re not the client you wanted or they might not want to pay
for your service at all. The hardest thing is to work out what
makes an attractive client and then working out how to develop
a relationship with them and how you can add value to that
relationship. That’s what we spend a lot of our time doing.”
Ian Jones, Backhouse Jones followed this by explaining what
they had done to diversify how their work was won. “We did two
things and we diversified into two areas: the training side we
took online and we set ourselves a modest revenue aspiration
shall we say. Thankfully, we completely smashed through that
five-fold and we’re now charging for the training that we provide
to the transport industry.” Ian goes onto explain how the other
way that they expanded was equally interesting. “The one thing
that I’ve always wanted to do for 20 years was take our brand
and diversify it into an insurance brokerage. We had all this time
last year where we could rethink our business model and so we
started BACKsure. Though it’s a different regulatory framework
(which we had to get our heads around), it’s now up and
running. So certainly, from a diversification point of view, we’ve
done two things – BACKsure and BACKacademy.”
Coming in from a banking angle was Graham Martin, Barclays
Bank. “Another model that I’ve seen being adopted is the
consultancy model. A firm that I work with is very much a
consumer, high-volume model but about two years ago, they
started to also introduce the consultancy model. What I’m now
seeing is an escalation in this due to the flexibility of working
from home and geographical restrictions being lifted. I’m not
saying it’s right for every firm, but it’s certainly worked for that
firm and has diversified their income stream so that when the
conveyancing market does subside - they’ve got that model
there as half their income. I definitely see that model having a
place for firms going forward.”
CHAIR: Are you finding that the changes you’ve
made to your firm are in turn changing the
geography of your client base? Are you now
picking up clients where the geography isn’t
important to them anymore? And same with
staff as well?
Though most of the attendees around the table nodded in
agreement to this question posed by the Chair, it was Joanna
Kingston-Davies, Jackson Lees Group who began the
discussion. “I definitely feel from a recruitment perspective
it’s been massive. Most people we speak to that work in and
around the legal sector are finding tremendous problems
with recruitment.” Joanna explains that they are now seeing
city firms able to pay city rates to people who are not
necessarily working in the city but instead are able to work
in the countryside or less urban areas remotely. “People are
attracted by London or Manchester salaries without the need
to commute anymore, so it’s huge.” “I think client wise we’re
seeing that a little bit less, although, obviously the fact that
people can communicate with you via Zoom exclusively means
that the opportunities are there - whether anybody has I’m not
sure just yet - but the opportunity I think is there for the taking.”
“One of our pushes has been on social media” states Verity Slater,
Stephens Scown LLP. “We’ve invested heavily in digital marketing
over the years and punch well above our weight. In January of this
year DSMN8 ranked us the UK and Ireland’s 7th most active law
and legal professionals on social media. That’s definitely brought
in quite a lot of national clients for us that otherwise you might
not have attracted to the Southwest.” Funnily enough, Verity tells
the group that they’re not having too much of a problem with
recruitment because there’s an awful lot of people that want to
52

ROUNDTABLE
get out of the cities and come and live with their families in the
southwest (where they’re based). “For those that do want to leave
the traditional city firm but also want a firm who has great work
and a strong culture - we’re a strong choice. However, we are
losing the odd person up the other way who are being attracted
by corporate jobs. They’ve been enticed into going in-house for
big nationals because they’re getting larger salaries and they’ve
only got to go up to those places once or twice a week, whereas
previously they wouldn’t have even considered that they could get
a job with one of those firms if they lived down in the Southwest.”
Bringing the roundtable to a close, and from an interesting angle
of a law firm working in the international arena, was Sunil Sheth,
Fladgate LLP. “Personally, I think we’re seeing a talent war out
there. Recruitment is a challenging process anyway but over the
past 18 months, it’s become more challenging because people
have left the profession and the development of associates has
stalled because of not having the experience that they would
have had working in the office. This has resulted in the salaries
moving on an upward trajectory and that’s been quite hard for
us.” Despite the challenges, Sunil is quick to point out that there
are plenty of opportunities too. “We found that people started
thinking more about things like estate planning, will, trusts and
power of attorney because they were worried about what was
going on.” He goes on to explain that about 30% of their revenue
is also generated from foreign clients. “We’ve seen a lot of
clients based abroad who think that Britain is a great place to
be because our vaccine program is so far advanced and we’re a
safe haven for their funds. Consequently, we’ve recently set up
a family office catering for high-net-worth individuals who have
assets that need looking after from here - so there are obviously
opportunities out there to diversify. But again, it’s a question of
being fleet of foot and getting in there as early as possible.”
Attendees
CONCLUSION
Earlier this year, Price Bailey hosted a roundtable with the
aim of gaining a better understanding of how law firms
were coping with the third national lockdown and the
impact this was having on their law firms. Fast forward
a few months and after a careful navigation of the
government roadmap, Modern Law sat down with them
again to discover what lessons have now been learnt, what
positives there have been and how the attendees’ law firms
had changed both from the inside and the out.
The discussion was hugely positive and from the write up,
our hope has been to show you a slight glimpse into their
experiences over the past 18 months. Not only did we hear
that people had ironically come closer together during a
time when we were told to stay apart, but culture within the
firms had grown too.
What’s more, we heard how many of our attendees had
adapted their businesses in order to win more work –
whilst others told us of their excitement and need to be
back in the office environment.
Yes, there were common concerns about the recruitment
of talent after such a challenging year, but there was also
huge optimism due to the perquisites of technology that
have made geographical restrictions a thing of the past.
The pandemic isn’t going away any time soon and we may
never return to the normality we all knew before in the legal
sector… but what this roundtable has shown is – is this
necessarily a bad thing?
Stephen Crow
is Director at Clarion
Solicitors Ltd
Ian Jones​
is Director / Solicitor
at Backhouse Jones
Verity Slater
is Partner and Board
Member at Stephens
Scown LLP
Joanna Kingston-
Davies
is Director at Jackson
Lees Group
Sunil Sheth
is Senior Partner​ at
Fladgate LLP
Graham Martin
is Relationship
Director at
Barclays Bank
Chris Godsave
is Partner at Price
Bailey
Chand Chudasama
is Strategy &
Corporate Finance
Partner at Price Bailey
Howard Sears
is Practice Chairman
at Price Bailey
Nadia Biles Davies​
is Chief Operating
Officer at Sharpe
Pritchard LLP
Ayesha Nayyar
is Director at Nayyars
Solicitors
Roger Bull
is Managing Partner
at Burges Salmon
LLP
Jessica Szczelkun
is Group Sales
Director at O’Neill
Patient Solicitors
Richard Baker
is Managing Partner
at Stephens Scown
LLP
Jeff Lewis
is Head of Litigation &
Member at Brabners
Abu Kibla
is Director & Solicitor
at Stuart Miller
Solicitors Limited
53

FEATURE
Consumer Behaviour
is Changing
Founded in 2017, Glenesk look to improve the profitability of their clients by identifying the
opportunities for sustained improvements in operating performance and reducing cost,
cash lock-up and risk for businesses across the UK. Bill Guthrie, Director at Glenesk, gives
a detailed insight into the opportunities for law firms surrounding online reviews.
Changes in behaviour
According to our recent analysis of online
reviews for Top UK Consumer Law firms,
consumers wrote 136% more reviews in
2020, than they did in 2019. This mirrors a
wider trend that has seen UK consumers
rely more and more upon online reviews as
a way of quickly checking the reputation
of firms they are inclined to do business
with. The trend has been accelerated
during lockdown because of fewer
opportunities to ask for recommendations
in-person and online review sites are now
the consumers trusted go-to source for
referrals, after family and friends.
Currently, Google reviews and Trustpilot
are by some margin the most popular
review sites for the sector, though due to
the fact that Google reviews are linked
to a geographical site (which is great
for reviewing shops and local services),
it is less well suited to evaluating a firm
or practice’s reputation when they run
multiple offices.
Managing your online brand
Changing consumer behaviour matters
because legal service purchases are based
first and foremost on the reputation of the
firm 1 . This trumps price as the key purchase
consideration across all matter types - with
the exception of Residential Conveyancing,
where reputation comes a close second.
Consumers are looking for assurance that
their potential provider will deliver a high
standard of practice/service quality through
clear communications and timely progress
with a matter. Online reviews provide very
limited feedback on the first point but lots of
feedback on the second, which is why firms
need to engage with the topic. There is only
a limited degree to which online reputation
can be influenced short of delivering a
consistently great service. Not all consumers
will respond to requests to leave feedback
and the evidence shows that there are many
who will leave a review unprompted.
Some partners may be unaware that
online scores, especially on Trustpilot,
are weighted based on the recency and
volume of reviews left, which provides a
further reason for firms to actively engage
with online reviews as an ongoing activity.
Most of the biggest firms in UK
Consumer law are alive to the value of
online reviews and have taken active
steps to encourage and respond to
them. However, approximately 20% of
the firms in our analysis haven’t and
more widely only half of bad reviews
across the sector get a response from
the relevant firm – this must provide an
opportunity for improvement.
Adopting a clear strategy
So, what is it that firms need to do to
drive the great customer experience
that leads to great reviews? The answer
from thousands of online posts is clear;
effective client communication. Both
online compliments and complaints
are dominated by issues of clarity,
consistency, and the timeliness of client
communications. Most firms do this well
most of the time, but only a select few
do it consistently all the time, which is
reflected in their near perfect scores.
Customer’s value feeling respected
and listened to when dealing with their
case; which is understandable given the
stressful circumstances and lack of control
“Most firms do this well most of the time, but
only a select few do it consistently all the time”
experienced during the course of many
matters. Given that 5* reviews outnumber
1* reviews by a ratio of 8:1, there is much
for the sector to be proud of in this regard,
but also variation between practices and
firms that is hard to ignore.
The very best firms at customer
experience do three things differently
from the rest of the sector:
Firstly, they design customer experience
into their ways of working. That could
mean configuring your case management
systems to provide prompts to
communicate based on case progress or
elapsed time since last contact. Or it might
involve designing discovery processes with
as much thought to giving the client the
information about the matter ahead, as it
does to collecting the information needed
by case managers to proceed. What
matters is that you don’t leave customer
feedback to chance and design customer
service into your data, systems, processes,
and staff supervision in a coherent way so
that it is done consistently at scale.
The second thing they do differently is to
learn from experience. No firm is perfect,
but the best ones use their data to
identify patterns in less favourable reviews
and then address the underlying issues.
From an analysis of all the Trustpilot
reviews left for the top firms in our
analysis, almost all show the same issues
occurring year after year, indicating that
lessons aren’t identified, or worse, that
they aren’t addressed once known.
Finally, the best firms are also committed
to addressing customer service when
something goes wrong. A little over half
of 1* online reviews receive a response
from the relevant firm, but an even
smaller percentage get a personalised
message and a smaller proportion still
54

FEATURE
“A little over half of 1* online
reviews receive a response
from the relevant firm”
show evidence that the firm is proactively
trying to recover the situation. For those
firms that go the extra mile, there is not
just an opportunity to change the views of
a lost advocate, but also to communicate
powerfully to potential customers that
customer service really does matter at
your firm.
Role of the Regulators
Changing consumer behaviour is the
most important element driving online
quality measures, but the increasing
interventions of the regulators stemming
from the findings of the Competition
& Markets Authority 2 , will also play a
role given their conclusion that there is
a lack of competition in the legal sector
creating adverse consumer outcomes.
Given the limited progress perceived
since the CMAs initial report in 2016,
the regulators will play a role to
facilitate market growth, by promoting
innovation and the commercial
incentives for legal services providers to
meet the consumer demand.
The focus on the work commenced in
March of this year by the SRA, CLC, CILEX
and BSB, is to pilot various initiatives
to address the persisting lack of easily
accessible and comparable data on
quality measures and to learn which may
positively provide more meaningful data
for consumers to access before they select
a legal services provider, with the initial
focus on conveyancing and employment.
The pilot period has been extended and
there were more than 70 firms 3 by July
who had signed up to the pilot, with
more having joined since.
The work of the LSB as the oversight
regulator is going to be important
alongside of the front-line regulators.
The LSB have recently recognised in their
response to their own discussion paper
on improving the transparency of quality
measures 4 , that there are a range of
further initiatives required to stimulate
a market response to the dysfunction,
including creating a digital register
comparing as a minimum a base level of
information on transparency measures
which can be easily compared.
Key Findings
A couple of notes of caution should
be sounded when evaluating online
quality measures. It should be noted
that your mix of business will in turn
influence the feedback you receive
from consumers. There is a consistent
pattern in the data that ranks from top
to bottom, Residential Conveyancing,
Personal Injury, Wills/Trusts and Probate,
Employment, then Family matters.
Though the cause of this is not proven,
we suspect from summaries of key
words contained in reviews (that have
been grouped by practice area), that
there is a link between the degree to
which the client felt they achieved a
satisfying result following the end of
their matter and the score provided.
It should also be remembered that the
majority of reviews are left by customers
rather than those who chose not to engage
your services. The reasons why not can
be both instructive and very valuable to
firms as enquiries usually far outstrip new
business. When dealing with enquiries, a
clear split emerges between Alternative
Business Structures, who typically manage
them much more effectively, and Limited
Liability Partnerships. A more detailed
discussion on this and other points raised
in this article can be found at https://
www.gleneskgroup.com/legal-services/
customer-service-review/.
Bill Guthrie
is Director at Glenesk
1. How consumers are choosing legal services, Legal
Services Consumer Panel, August 2020
2. Final report (publishing.service.gov.uk)
3. SRA | SRA Update 94 comparison websites pilot |
Solicitors Regulation Authority
4. Quality Indicators Discussion Paper response
document (legalservicesboard.org.uk)
55

Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyyyy
22002200
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst
Whhhaaaaatttttttt dddooooooo ccooooooonnnnsssssssummmmmeeeeeeeerrrrrrsssssss wwwaaaaannnntttttttt ttttttttooooooo ssssssseeeeeeeeeeeeeeee
ffrrrrrrooooooommmmm rrrrrreeeeeeeevviiiieeeeeeeewwwsssssss aaaaannnnddd rrrrrreeeeeeeevviiiieeeeeeeewww
ppllaaaaattttttttffooooooorrrrrrmmmmmsssssss ttttttttooooooo hhheeeeeeeellpp tttttttthhheeeeeeeemmmmm
beeeeeeeetttttttttttttttteeeeeeeerrrrrr
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk
rrrrrrreeeeeeeevviiiiitiiieeeeeeeewssssssss tttttttthhhhhhaaaaaaaannnnannn tttttttthhhhhheeeeeeeeyyay hhhhhhaaaaaaaavvieeeeeeee iiiitiiinnnnannn tttttttthhhhhheeeeeeee
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyy 2222000022220000 00002222/00002222
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst
Peeeeeeeeooooopppplleeeeeeee
ssssseeeeeeeeeeeeeeeek
aaaaauuttttttttheeeeeeeennnnnnnttttttttiiiiicciiiiitttttttty,
nnnnnnnoooootttttttt
Assssssssssssoooooooocciiiiiaaaaatttttteeeeee PPrrrrroooooooofffeeeeeessssssssssssoooooooorrrrr oooooooofff Maaaaarrrrrkeeeeeettttttiiiiinnnnnng, Whhhaaaaarrrrrttttttoooooooonnnnnn Scchhhooooooooooooooooll aaaaatttttt tttttthhheeeeee Unnnnnniiiiivveeeeeerrrrrssssssiiiiittttttyy oooooooofff
ppppeeeeeeeerrrrrrffeeeeeeeeccttttttttiiiiiooooon
Auuuuutttttttthhhhhhhheeeeeeeennnnnnnnttttttttiiiiiiiiccccccciiiiiiiittttttttyyyyy aaaaaaaannnnnnnndddddd ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnncccccccyyyyy
aaaaaaaarrrrrrrreeeeeeee ttttttttwwoooooooo ooooooooffff tttttttthhhhhhhheeeeeeee mmmmmoooooooosssssssstttttttt iiiiiiiimmmmmppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnntttttttt
tttttttthhhhhhhhiiiiiiiinnnnnnnngggssssssss cccccccuuuuussssssssttttttttoooooooommmmmeeeeeeeerrrrrrrrssssssss sssssssseeeeeeeeeeeeeeeekkk ffffoooooooorrrrrrrr wwhhhhhhhheeeeeeeennnnnnnn
lllllllooooooooooooooookkkiiiiiiiinnnnnnnnggg ffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiirrrrrrrrdddddd-ppppppaaaaaaaarrrrrrrrttttttttyyyyy
vvaaaaaaaallllllliiiiiiiiddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn, aaaaaaaannnnnnnndddddd tttttttthhhhhhhheeeeeeeeyyyyy sssssssshhhhhhhhoooooooouuuuulllllllddddddnnnnnnnn’tttttttt
bbbeeeeeeee
dddeeeeeeeecciiiisssssssiiiiooooooonnnnsssssss ?
Reeeeeeeeviieeeeeeeewsssssss aaarrrrrrreeeeeeee oooooooonneeeeeeee oooooooofffff ttttheeeeeeee
mmoooooooossssssstttt ttttrrrrrrrussssssstttteeeeeeeed fffffoooooooorrrrrrrmmsssssss oooooooofffff
sssssssoooooooociiaaal
prrrrrrroooooooooooooooofffff
SSooooootoccceccciiiitiiiaaaaaaaalllll pprrrrrrrooooootoooooootofffff iiiitiiissssssss beeeeeeeecccecccooooootommmiiiitiiinnnnannngg
iiiitiiinnnnannncccecccrrrrrrreeeeeeeeaaaaaaaassssssssiiiitiiinnnnannngglllllyyay eeeeeeeefeeeeeeeecccecccttttttttiiiitiiivvieeeeeeeeye aaaaaaaannnnannnon ttttttttooooootoonaaaaaaaayyayye
aaaaaaaalllllmmmooooootosssssssstttttttt hhhhhhaaaaaaaalllllfffff ooooootofffff UK cccecccooooootonnnnannnssssssssuummmeeeeeeeerrrrrrrssssssss
aaaaaaaarrrrrrreeeeeeee rrrrrrreeeeeeeelllllyyayiiiitiiinnnnannngg mmmooooootorrrrrrreeeeeeee ooooootonnnnannn ooooootonnnnannnllllliiiitiiinnnnannneeeeeeee
ppaaaaaaaasssssssstttttttt 2 yyayeeeeeeeeaaaaaaaarrrrrrrssssssss.
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.
oooooooovveeeeeeeerrrrrrrrlllllllooooooooooooooookkkeeeeeeeedddddd.
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!
Cooooonnnnnnnsssssuumeeeeeeeerrrrrrsssss pppprrrrrreeeeeeeeffeeeeeeeerrrrrr ttttttttooooo
lleeeeeeeeaaaaaveeeeeeee rrrrrreeeeeeeeviiiiieeeeeeeewsssss iiiiinnnnnnn aaaaannnnnnn
yyoouurr
Prrrrrrrooooooodddduuuuucttttt
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss
oooooppppeeeeeeeennnnnnn aaaaannnnnnnd ttttttttrrrrrraaaaannnnnnnsssssppppaaaaarrrrrreeeeeeeennnnnnntttttttt
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss
Reeplyy
frroom
buusssineessssss
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee
Reeplyy
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee
yyoouurr
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd
bbbyyyy
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss
Jaaaaaanneeeeeee
frroom
buusssineessssss
yyoouurr
Reeplyy
frroom
buusssineessssss
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee
Prrrrrrrooooooodddduuuuucttttt
yyoouurr
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd
bbbyyyy
Reeplyy
mmmmmaaaaakeeeeeeee
“TThhhhhhhhiiiiiiiinnnnnnnngggssssssss tttttttthhhhhhhhaaaaaaaatttttttt aaaaaaaarrrrrrrreeeeeeee uuuunnnnnnnnbbbbbiiiiiiiiaaaaaaaasssssssseeeeeeeedddddddd aaaaaaaarrrrrrrreeeeeeee sssssssseeeeeeeeeeeeeeeennnnnnnn aaaaaaaassssssss
nnnnnnnnooooooootttttttt hhhhhhhhaaaaaaaavvvvvviiiiiiiinnnnnnnnggg aaaaaaaannnnnnnn aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa,,,,, eeeeeeeevvvvvveeeeeeeennnnnnnn ssssssssccccchhhhhhhhoooooooooooooooollllllssssssss
Jaaaaaanneeeeeee
aaaaaaaannnnnnnndddddddd mmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaa +ccccchhhhhhhhaaaaaaaannnnnnnnnnnnnnnneeeeeeeellllllssssssss,,,,, wwhhhhhhhheeeeeeeetttttttthhhhhhhheeeeeeeerrrrrrrr lllllliiiiiiiibbbbbeeeeeeeerrrrrrrraaaaaaaallllll
oooooooorrrrrrrr cccccoooooooonnnnnnnnsssssssseeeeeeeerrrrrrrrvvvvvvaaaaaaaattttttttiiiiiiiivvvvvveeeeeeee mmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaa,,,,, tttttttthhhhhhhheeeeeeeeyyyyy hhhhhhhhaaaaaaaavvvvvveeeeeeee aaaaaaaannnnnnnn
aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa. —ooooooooccccciiiiiiiiaaaaaaaallllll mmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaa ttttttttoooooooooooooooo. Faaaaaaaaccccceeeeeeeebbbbboooooooooooooooo{,,,,,
frroom
CNETT,,,,, Ammmmmaaaaaaaazoooooooonnnnnnnn oooooooorrrrrrrr eeeeeeeeBaaaaaaaayyyyy cccccoooooooouuuulllllldddddddd bbbbbeeeeeeee sssssssseeeeeeeeeeeeeeeennnnnnnn
buusssineessssss
aaaaaaaassssssss hhhhhhhhaaaaaaaavvvvvviiiiiiiinnnnnnnnggg aaaaaaaannnnnnnn aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa’ hhhhhhhheeeeeeeennnnnnnn yyyyyoooooooouuuu sssssssseeeeeeeeeeeeeeee
ssssssssttttttttaaaaaaaannnnnnnnddddddddaaaaaaaalllllloooooooonnnnnnnneeeeeeee cccccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr rrrrrrrreeeeeeeevvvvvviiiiiiiieeeeeeeewwssssssss,,,,, tttttttthhhhhhhheeeeeeeeyyyyy ’rrrrrrrreeeeeeee
nnnnnnnnooooooootttttttt peeeeeeeerrrrrrrrccccceeeeeeeeiiiiiiiivvvvvveeeeeeeedddddddd ttttttttoooooooo hhhhhhhhaaaaaaaavvvvvveeeeeeee aaaaaaaannnnnnnn aaaaaaaacccccttttttttoooooooorrrrrrrr oooooooorrrrrrrr
eeeeeeeennnnnnnnttttttttiiiiiiiittttttttyyyyy bbbbbeeeeeeeehhhhhhhhiiiiiiiinnnnnnnndddddddd tttttttthhhhhhhheeeeeeeemmmmm.”
Prrrooofeeessssooorrr Jooonah Beeerrrgeeer
PPeeeeeennnnnnnnnnnnssssssyyllvvaaaaannnnnniiiiia
499%%
ooooooff
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss
sesssssseeeecueeleeeecueenccccttttteeeecueed
pppoooooosessssssiiiiiiiitttttiiiiiiiivvveeeecuee
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrr rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss iiiiiiiinennnn
ttttt hhheeeecueeiiiiiiiirrrrrrrr tttttooooooppp ttttt hhhrrrrrrrreeeecueeeeeecuee
pppluuurrrrrrrrncccchhhaasesssssseeeecuee
iiiiiiiinennnnfluuueeeecueenennnnncccceeeecueesesssssss
66Æ%%%%
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr ttttttttoooooooo bbbbuuuuuuuyyyyyyy
fffffffrrrrrrrroooooooommmmmmmm aaaaaaaa rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnnyyyyyyy oooooooovvvvvvvveeeeeeeerrrrrrrr oooooooonnnnnnnneeeeeeee
tttttttt hhhhhhhhaaaaaaaatttttttt aaaaaaaappppppppppppppppeeeeeeeeaaaaaaaarrrrrrrrssssssss ppppppppeeeeeeeerrrrrrrr fffffffeeeeeeeecccccccctttttttt ....
566%%%%
IIonhwThhhhaaahaaaavveeeeemeeontttt a oootoooonnnrnnnnssss'rssonoootooooffoniitiiiiddddeeeeemeeaaahaaaassss'rssonffoootoooorrrrruirongggggrrrrruiroootoooowww wwiitiiiinnnrnnnngggggonmimmyhyyon
bbuutuussss'rssiitiiiinnnrnnnneeeeemeessss'rssssss'rss,onbbuutuutttt a onIIonddddoootoooonnnrnnnn't'tttt a onaaahaaaalllwww wwaaahaaaayhyyssss'rssongggggeeeeemeetttt a ontttt a hwThhhheeeeemeemimmon
rrrrruiriitiiiiggggghwThhhhtttt a ontttt a hwThhhheeeeemeeonfrrrrruirssss'rsstttt a ontttt a iitiiiimimmeeeeemeeeon hwThhhhaaahaaaatttt a 't'ssss'rssonwww wwhwThhhhyhyyonIIontttt a uutuurrrrruir nnnrnnnnontttt a oootooooon
cuutuussss'rsstttt a oootoooomimmeeeeemeerrrrruironrrrrruireeeeemeevviitiiiieeeeemeewww wwssss'rssontttt a oootooooonuutuunnnrnnnnddddeeeeemeerrrrruirssss'rsstttt a aaahaaaannnrnnnnddddon
wwwwhwThhhhaaahaaaatttt a 't'ssss'rssonrrrrruireeeeemeeaaahaaaallllllyhyyonwwwwoootoooorrrrruirkiitiiiinnnrnnnnggggg.
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy
/
899%%
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee
/
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.
822%%%%
oooooooofffffff UK ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee vvvvvvvviiiiiiiieeeeeeeewwwwwwww
ttttttttoooooooowwwwwwwwaaaaaaaarrrrrrrrddddddssssssss
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss
tttttttt hhhhhhhhaaaaaaaatttttttt rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnndddddd ttttttttoooooooo
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss
ooooooff nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss rrrrrrrreeeecueepppoooooorrrrrrrrttttt
ncccchhheeeecueencccckiiiiiiiinennnng
beeeecueeffoooooorrrrrrrreeeecuee
rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss
mmmaakiiiiiiiinennnng
pppluuurrrrrrrrncccchhhaasesssssseeeecueesessssss.
“I ttthiiiinnnk mmooooorrreeeeee aannnd
mmooooorrreeeeee pppeeeeeeooooopppleeeeee aarrreeeeee
yyoouurr
Prrrrrrrooooooodddduuuuucttttt
yyoouurr
Reeplyy
55%%%%
frroom
buusssineessssss
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee
ggeeeeeettttttiiiinnngg sssuussspppiiiiciiiiooooouusss ooooof
5 ssstttaarrr rrraatttiiiinnnggsss‰k
Prrrrrrroooooooofffffeeeeeeeessssssssssssssoooooooorrrrrrr Kaaarrrrrrreeeeeeeenn Cooooooooooooooook
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd
bbbyyyy
Reeplyy
Diiiitiiirrrrrrreeeeeeeecccecccttttttttooooootorrrrrrr ooooootofffff tttttttthhhhhheeeeeeee Innnnannnssssssssttttttttiiiitiiittttttttuutttttttteeeeeeee ooooootofffff Reeeeeeeesssssssseeeeeeeeaaaaaaaarrrrrrrccceccchhhhhh fffffooooootorrrrrrr SSooooootoccceccciiiitiiiaaaaaaaalllll
SSccceccciiiitiiieeeeeeeennnnannnccceccceeeeeeeessssssssye
SSttttttttaaaaaaaannnnannnfffffooooootorrrrrrr d
01/0›
Jaaaaaanneeeeeee
frroom
buusssineessssss
FEATURE
The Power of
Online Reviews
In a world where trust is harder to find
than ever, it’s no surprise that consumers
increasingly seek reassurance before
purchasing decisions. As the internet
provides more and more information
at our fingertips and with traditional
advertising no longer holding the power
it once did, consumers are smarter and
want to know they’re making the right
decision when buying online. In order
to better understand internet consumer
trust, Trustpilot commissioned
independent behavioural insights practice
Canvas8 to explore what consumers
value online and how reviews impact
their behaviour. The following infographic
illustrates the insights that emerged.
56

Auuuuutttttttthhhhhhhheeeeeeeennnnnnnnttttttttiiiiiiiiccccccciiiiiiiittttttttyyyyy aaaaaaaannnnnnnndddddd ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnncccccccyyyyy
aaaaaaaarrrrrrrreeeeeeee ttttttttwwoooooooo ooooooooffff tttttttthhhhhhhheeeeeeee mmmmmoooooooosssssssstttttttt iiiiiiiimmmmmppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnntttttttt
tttttttthhhhhhhhiiiiiiiinnnnnnnngggssssssss cccccccuuuuussssssssttttttttoooooooommmmmeeeeeeeerrrrrrrrssssssss sssssssseeeeeeeeeeeeeeeekkk ffffoooooooorrrrrrrr wwhhhhhhhheeeeeeeennnnnnnn
lllllllooooooooooooooookkkiiiiiiiinnnnnnnnggg ffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiirrrrrrrrdddddd-ppppppaaaaaaaarrrrrrrrttttttttyyyyy
vvaaaaaaaallllllliiiiiiiiddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn, aaaaaaaannnnnnnndddddd tttttttthhhhhhhheeeeeeeeyyyyy sssssssshhhhhhhhoooooooouuuuulllllllddddddnnnnnnnn’tttttttt
bbbeeeeeeee
oooooooovveeeeeeeerrrrrrrrlllllllooooooooooooooookkkeeeeeeeedddddd.
Cooooonnnnnnnsssssuumeeeeeeeerrrrrrsssss pppprrrrrreeeeeeeeffeeeeeeeerrrrrr ttttttttooooo
Reeeeeeviiieeeeeew cceeeeeennnssssoooorrrsssshiiip iiissss nnnoooottt
tttooooleeeeeerrrattteeeeeed by ccoooonnnssssumeeeeeerrrs
lleeeeeeeeaaaaaveeeeeeee rrrrrreeeeeeeeviiiiieeeeeeeewsssss iiiiinnnnnnn aaaaannnnnnn
Allllllllllllllll rrrrrrrreeeeeeeeviiiiiiieeeeeeeewwwssssssss,,, wwwhhhhheeeeeeeetttthhhhheeeeeeeerrrrrrrr ggoooooooooooooooodddddddd oooooooorrrrrrrr
oooooppppeeeeeeeennnnnnn aaaaannnnnnnd ttttttttrrrrrraaaaannnnnnnsssssppppaaaaarrrrrreeeeeeeennnnnnntttttttt
bbbbbaaaaaaaadddddddd,,, sssssssshhhhhoooooooouuuulllllllldddddddd aaaaaaaallllllllwwwaaaaaaaayyyssssssss bbbbbeeeeeeee
ddddddddiiiiiiisssssssspppppllllllllaaaaaaaayyyeeeeeeeedddddddd. Beeeeeeeeiiiiiiinnnnnnnngg aaaaaaaassssssss
waaaaay
ttttrrrrrrrraaaaaaaannnnnnnnsssssssspppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttt aaaaaaaassssssss pppppoooooooossssssssssssssssiiiiiiibbbbblllllllleeeeeeee
Thhhhhhhheeeeeeee nnnnnnnnoooooooottttttttiiiiiiiioooooooonnnnnnnn ooooooooffff cccccccoooooooommmmmppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss bbbeeeeeeeeiiiiiiiinnnnnnnnggg
hhhhheeeeeeeellllllllpppppssssssss cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrrssssssss mmmmmaaaaaaaakeeeeeeee
aaaaaaaabbbllllllleeeeeeee ttttttttoooooooo rrrrrrrreeeeeeeemmmmmoooooooovveeeeeeee nnnnnnnneeeeeeeegggaaaaaaaattttttttiiiiiiiivveeeeeeee oooooooorrrrrrrr
mmmmmoooooooorrrrrrrreeeeeeee iiiiiiinnnnnnnnfoooooooorrrrrrrrmmmmmeeeeeeeedddddddd ddddddddeeeeeeeeccciiiiiiissssssssiiiiiiioooooooonnnnnnnnssssssss,,,
aaaaaaaannnnnnnndddddddd hhhhheeeeeeeellllllllpppppssssssss bbbbboooooooooooooooosssssssstttt cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr
uuuuunnnnnnnnlfaaaaaaaatttttttttttttttteeeeeeeerrrrrrrriiiiiiiinnnnnnnnggg ffffeeeeeeeeeeeeeeeeddddddbbbaaaaaaaaccccccckkk iiiiiiiissssssss
ttttrrrrrrrruuuusssssssstttt iiiiiiinnnnnnnn bbbbbuuuussssssssiiiiiiinnnnnnnneeeeeeeesssssssssssssssseeeeeeeessssssss.
cccccccoooooooommmmmppppppllllllleeeeeeeetttttttteeeeeeeelllllllyyyyy uuuuunnnnnnnnaaaaaaaacccccccccccccceeeeeeeeppppppttttttttaaaaaaaabbbllllllleeeeeeee ttttttttoooooooo
cccccccoooooooonnnnnnnnssssssssuuuuummmmmeeeeeeeerrrrrrrrssssssss .
Cooooonnnnnnnsssssuumeeeeeeeerrrrrrsssss Reeeeeeviiieeeeeew cceeeeeennnssssoooorrrsssshiiip pppprrrrrreeeeeeeeffeeeeeeeerrrrrr iiissss nnnoooottt
ttttttttooooo
tttooooleeeeeerrrattteeeeeed by ccoooonnnssssumeeeeeerrrs
Allllllllllllllll rrrrrrrreeeeeeeeviiiiiiieeeeeeeewwwssssssss,,, wwwhhhhheeeeeeeetttthhhhheeeeeeeerrrrrrrr ggoooooooooooooooodddddddd oooooooorrrrrrrr
bbbbbaaaaaaaadddddddd,,, sssssssshhhhhoooooooouuuulllllllldddddddd aaaaaaaallllllllwwwaaaaaaaayyyssssssss bbbbbeeeeeeee
ddddddddiiiiiiisssssssspppppllllllllaaaaaaaayyyeeeeeeeedddddddd. Beeeeeeeeiiiiiiinnnnnnnngg aaaaaaaassssssss
ttttrrrrrrrraaaaaaaannnnnnnnsssssssspppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttt aaaaaaaassssssss pppppoooooooossssssssssssssssiiiiiiibbbbblllllllleeeeeeee
hhhhheeeeeeeellllllllpppppssssssss cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrrssssssss mmmmmaaaaaaaakeeeeeeee
mmmmmoooooooorrrrrrrreeeeeeee iiiiiiinnnnnnnnfoooooooorrrrrrrrmmmmmeeeeeeeedddddddd ddddddddeeeeeeeeccciiiiiiissssssssiiiiiiioooooooonnnnnnnnssssssss,,,
aaaaaaaannnnnnnndddddddd hhhhheeeeeeeellllllllpppppssssssss bbbbboooooooooooooooosssssssstttt cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr
ttttrrrrrrrruuuusssssssstttt iiiiiiinnnnnnnn bbbbbuuuussssssssiiiiiiinnnnnnnneeeeeeeesssssssssssssssseeeeeeeessssssss.
((445%%))
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr ttttttttoooooooo bbbbuuuuuuuyyyyyyy
fffffffrrrrrrrroooooooommmmmmmm aaaaaaaa rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnnyyyyyyy oooooooovvvvvvvveeeeeeeerrrrrrrr oooooooonnnnnnnneeeeeeee
tttttttt hhhhhhhhaaaaaaaatttttttt aaaaaaaappppppppppppppppeeeeeeeeaaaaaaaarrrrrrrrssssssss ppppppppeeeeeeeerrrrrrrr fffffffeeeeeeeecccccccctttttttt ....
70%%%%
566%%%%
oooooooofffffff ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss iiiiiiiinnnnnnnn tttttttt hhhhhhhheeeeeeee
UK,, tttttttt hhhhhhhhiiiiiiiinnnnnnnnkkk iiiiiiiitttttttt’ssssssss vvvvvvvveeeeeeeerrrrrrrryyyyyyy
6622%%%%
iiiiiiiimmmmmmmmppppppppoooooooorrrrrrrrtttttttt aaaaaaaannnnnnnntttttttt ttttttttoooooooo kkknnnnnnnnoooooooowwwwwwww
eeeeeeeexaaaaaaaaccccccccttttttttllllllllyyyyyyy hhhhhhhhoooooooowwwwwwww rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww
wwwwwwwweeeeeeeebbbbssssssssiiiiiiiitttttttteeeeeeeessssssss cccccccchhhhhhhhoooooooooooooooosssssssseeeeeeee ttttttttoooooooo
ppppppppuuuuuuubbbblllllllliiiiiiiisssssssshhhhhhhh
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
70%%%%
6622%%%%
55%%%%
oooooooofffffff
aaaaaaaannnnnnnndddddd ddddddaaaaaaaammmmmmmmaaaaaaaa ggggeeeeeeeessssssss fffffffrrrrrrrreeeeeeeeeeeeeeeeddddddoooooooommmmmmmm oooooooofffffff ssssssssppppppppeeeeeeeeeeeeeeeecccccccchhhhhhhh ((442%%)) ....
oooooooofffffff UK ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee vvvvvvvviiiiiiiieeeeeeeewwwwwwww
Coooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp lllllllleeeeeeeeaaaaaaaaddddddssssssss ttttttttoooooooo wwwwwwwwaaaaaaaasssssssstttttttteeeeeeeedddddd mmmmmmmmoooooooonnnnnnnneeeeeeeeyyyyyyy
((445%%))
aaaaaaaannnnnnnndddddd ddddddaaaaaaaammmmmmmmaaaaaaaa ggggeeeeeeeessssssss fffffffrrrrrrrreeeeeeeeeeeeeeeeddddddoooooooommmmmmmm oooooooofffffff ssssssssppppppppeeeeeeeeeeeeeeeecccccccchhhhhhhh ((442%%)) ....
ttttttttoooooooowwwwwwwwaaaaaaaarrrrrrrrddddddssssssss
ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
gggglllllllloooooooobbbbaaaaaaaallllllllllllllllyyyyyyy,, wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr
ttttttttoooooooo uuuuuuusssssssseeeeeeee aaaaaaaannnnnnnn ooooooooppppppppeeeeeeeennnnnnnn
ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmm....
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss
tttttttt hhhhhhhhaaaaaaaatttttttt rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnndddddd ttttttttoooooooo
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyy 2222000022220000 00002222/00002222
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst
Peeeeeeeeooooopppplleeeeeeee
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyyyy
22002200
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee tttttttt hhhhhhhhaaaaaaaatttttttt
tttttttt hhhhhhhheeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp oooooooofffffff ccccccccuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss iiiiiiiissssssss aaaaaaaa sssssssseeeeeeeerrrrrrrriiiiiiiioooooooouuuuuuussssssss ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrnnnnnnnn....
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss wwwwwwwwoooooooouuuuuuulllllllldddddd ssssssssttttttttoooooooopppppppp
uuuuuuussssssssiiiiiiiinnnnnnnngggg [rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww] ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmmssssssss iiiiiiiifffffff tttttttt hhhhhhhheeeeeeeeyyyyyyy
kkknnnnnnnneeeeeeeewwwwwwww tttttttt hhhhhhhheeeeeeeeyyyyyyy wwwwwwwweeeeeeeerrrrrrrreeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrriiiiiiiinnnnnnnngggg rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
Coooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp lllllllleeeeeeeeaaaaaaaaddddddssssssss ttttttttoooooooo wwwwwwwwaaaaaaaasssssssstttttttteeeeeeeedddddd mmmmmmmmoooooooonnnnnnnneeeeeeeeyyyyyyy
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst
Whhhaaaaatttttttt dddooooooo ccooooooonnnnsssssssummmmmeeeeeeeerrrrrrsssssss wwwaaaaannnntttttttt ttttttttooooooo ssssssseeeeeeeeeeeeeeee
ffrrrrrrooooooommmmm rrrrrreeeeeeeevviiiieeeeeeeewwwsssssss aaaaannnnddd rrrrrreeeeeeeevviiiieeeeeeeewww
ppllaaaaattttttttffooooooorrrrrrmmmmmsssssss ttttttttooooooo hhheeeeeeeellpp tttttttthhheeeeeeeemmmmm
beeeeeeeetttttttttttttttteeeeeeeerrrrrr
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy
dddeeeeeeeecciiiisssssssiiiiooooooonnnnsssssss ?
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!
Reeeeeeeeviieeeeeeeewsssssss aaarrrrrrreeeeeeee oooooooonneeeeeeee oooooooofffff ttttheeeeeeee
mmoooooooossssssstttt ttttrrrrrrrussssssstttteeeeeeeed fffffoooooooorrrrrrrmmsssssss oooooooofffff
sssssssoooooooociiaaal
ssssseeeeeeeeeeeeeeeek
aaaaauuttttttttheeeeeeeennnnnnnttttttttiiiiicciiiiitttttttty,
ppppeeeeeeeerrrrrrffeeeeeeeeccttttttttiiiiiooooon
Reeeeeeviiieeeeeew cceeeeeennnssssoooorrrsssshiiip iiissss nnnoooottt
tttooooleeeeeerrrattteeeeeed by ccoooonnnssssumeeeeeerrrs
prrrrrrroooooooooooooooofffff
Allllllllllllllll rrrrrrrreeeeeeeeviiiiiiieeeeeeeewwwssssssss,,, wwwhhhhheeeeeeeetttthhhhheeeeeeeerrrrrrrr ggoooooooooooooooodddddddd oooooooorrrrrrrr
bbbbbaaaaaaaadddddddd,,, sssssssshhhhhoooooooouuuulllllllldddddddd aaaaaaaallllllllwwwaaaaaaaayyyssssssss bbbbbeeeeeeee
SSooooootoccceccciiiitiiiaaaaaaaalllll pprrrrrrrooooootoooooootofffff iiiitiiissssssss beeeeeeeecccecccooooootommmiiiitiiinnnnannngg
ddddddddiiiiiiisssssssspppppllllllllaaaaaaaayyyeeeeeeeedddddddd. Beeeeeeeeiiiiiiinnnnnnnngg aaaaaaaassssssss
nnnnnnnoooootttttttt
Auuuuutttttttthhhhhhhheeeeeeeennnnnnnnttttttttiiiiiiiiccccccciiiiiiiittttttttyyyyy aaaaaaaannnnnnnndddddd ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnncccccccyyyyy
aaaaaaaarrrrrrrreeeeeeee ttttttttwwoooooooo ooooooooffff tttttttthhhhhhhheeeeeeee mmmmmoooooooosssssssstttttttt iiiiiiiimmmmmppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnntttttttt
tttttttthhhhhhhhiiiiiiiinnnnnnnngggssssssss cccccccuuuuussssssssttttttttoooooooommmmmeeeeeeeerrrrrrrrssssssss sssssssseeeeeeeeeeeeeeeekkk ffffoooooooorrrrrrrr wwhhhhhhhheeeeeeeennnnnnnn
lllllllooooooooooooooookkkiiiiiiiinnnnnnnnggg ffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiirrrrrrrrdddddd-ppppppaaaaaaaarrrrrrrrttttttttyyyyy
vvaaaaaaaallllllliiiiiiiiddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn, aaaaaaaannnnnnnndddddd tttttttthhhhhhhheeeeeeeeyyyyy sssssssshhhhhhhhoooooooouuuuulllllllddddddnnnnnnnn’tttttttt
bbbeeeeeeee
oooooooovveeeeeeeerrrrrrrrlllllllooooooooooooooookkkeeeeeeeedddddd.
lleeeeeeeeaaaaaveeeeeeee rrrrrreeeeeeeeviiiiieeeeeeeewsssss iiiiinnnnnnn aaaaannnnnnn
oooooppppeeeeeeeennnnnnn aaaaannnnnnnd ttttttttrrrrrraaaaannnnnnnsssssppppaaaaarrrrrreeeeeeeennnnnnntttttttt
waaaaay
Thhhhhhhheeeeeeee nnnnnnnnoooooooottttttttiiiiiiiioooooooonnnnnnnn ooooooooffff cccccccoooooooommmmmppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss bbbeeeeeeeeiiiiiiiinnnnnnnnggg
aaaaaaaabbbllllllleeeeeeee ttttttttoooooooo rrrrrrrreeeeeeeemmmmmoooooooovveeeeeeee nnnnnnnneeeeeeeegggaaaaaaaattttttttiiiiiiiivveeeeeeee oooooooorrrrrrrr
uuuuunnnnnnnnlfaaaaaaaatttttttttttttttteeeeeeeerrrrrrrriiiiiiiinnnnnnnnggg ffffeeeeeeeeeeeeeeeeddddddbbbaaaaaaaaccccccckkk iiiiiiiissssssss
cccccccoooooooommmmmppppppllllllleeeeeeeetttttttteeeeeeeelllllllyyyyy uuuuunnnnnnnnaaaaaaaacccccccccccccceeeeeeeeppppppttttttttaaaaaaaabbbllllllleeeeeeee ttttttttoooooooo
cccccccoooooooonnnnnnnnssssssssuuuuummmmmeeeeeeeerrrrrrrrssssssss .
iiiitiiinnnnannncccecccrrrrrrreeeeeeeeaaaaaaaassssssssiiiitiiinnnnannngglllllyyay eeeeeeeefeeeeeeeecccecccttttttttiiiitiiivvieeeeeeeeye aaaaaaaannnnannnon ttttttttooooootoonaaaaaaaayyayye
aaaaaaaalllllmmmooooootosssssssstttttttt hhhhhhaaaaaaaalllllfffff ooooootofffff UK cccecccooooootonnnnannnssssssssuummmeeeeeeeerrrrrrrssssssss
aaaaaaaarrrrrrreeeeeeee rrrrrrreeeeeeeelllllyyayiiiitiiinnnnannngg mmmooooootorrrrrrreeeeeeee ooooootonnnnannn ooooootonnnnannnllllliiiitiiinnnnannneeeeeeee
rrrrrrreeeeeeeevviiiiitiiieeeeeeeewssssssss tttttttthhhhhhaaaaaaaannnnannn tttttttthhhhhheeeeeeeeyyay hhhhhhaaaaaaaavvieeeeeeee iiiitiiinnnnannn tttttttthhhhhheeeeeeee
ttttrrrrrrrruuuusssssssstttt iiiiiiinnnnnnnn bbbbbuuuussssssssiiiiiiinnnnnnnneeeeeeeesssssssssssssssseeeeeeeessssssss.
ppaaaaaaaasssssssstttttttt 2 yyayeeeeeeeeaaaaaaaarrrrrrrssssssss.
((445%%))
ttttrrrrrrrraaaaaaaannnnnnnnsssssssspppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttt aaaaaaaassssssss pppppoooooooossssssssssssssssiiiiiiibbbbblllllllleeeeeeee
hhhhheeeeeeeellllllllpppppssssssss cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrrssssssss mmmmmaaaaaaaakeeeeeeee
mmmmmoooooooorrrrrrrreeeeeeee iiiiiiinnnnnnnnfoooooooorrrrrrrrmmmmmeeeeeeeedddddddd ddddddddeeeeeeeeccciiiiiiissssssssiiiiiiioooooooonnnnnnnnssssssss,,,
aaaaaaaannnnnnnndddddddd hhhhheeeeeeeellllllllpppppssssssss bbbbboooooooooooooooosssssssstttt cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss
yyoouurr
Prrrrrrrooooooodddduuuuucttttt
66Æ%%%%
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr ttttttttoooooooo bbbbuuuuuuuyyyyyyy
fffffffrrrrrrrroooooooommmmmmmm aaaaaaaa rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnnyyyyyyy oooooooovvvvvvvveeeeeeeerrrrrrrr oooooooonnnnnnnneeeeeeee
tttttttt hhhhhhhhaaaaaaaatttttttt aaaaaaaappppppppppppppppeeeeeeeeaaaaaaaarrrrrrrrssssssss ppppppppeeeeeeeerrrrrrrr fffffffeeeeeeeecccccccctttttttt ....
566%%%%
oooooooofffffff ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss iiiiiiiinnnnnnnn tttttttt hhhhhhhheeeeeeee
UK,, tttttttt hhhhhhhhiiiiiiiinnnnnnnnkkk iiiiiiiitttttttt’ssssssss vvvvvvvveeeeeeeerrrrrrrryyyyyyy
iiiiiiiimmmmmmmmppppppppoooooooorrrrrrrrtttttttt aaaaaaaannnnnnnntttttttt ttttttttoooooooo kkknnnnnnnnoooooooowwwwwwww
eeeeeeeexaaaaaaaaccccccccttttttttllllllllyyyyyyy hhhhhhhhoooooooowwwwwwww rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww
wwwwwwwweeeeeeeebbbbssssssssiiiiiiiitttttttteeeeeeeessssssss cccccccchhhhhhhhoooooooooooooooosssssssseeeeeeee ttttttttoooooooo
ppppppppuuuuuuubbbblllllllliiiiiiiisssssssshhhhhhhh
yyoouurr
Reeplyy
frroom
buusssineessssss
499%%
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee
ooooooff
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss
sesssssseeeecueeleeeecueenccccttttteeeecueed
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd
bbbyyyy
Reeplyy
Jaaaaaanneeeeeee
frroom
buusssineessssss
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee tttttttt hhhhhhhhaaaaaaaatttttttt
tttttttt hhhhhhhheeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp oooooooofffffff ccccccccuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss iiiiiiiissssssss aaaaaaaa sssssssseeeeeeeerrrrrrrriiiiiiiioooooooouuuuuuussssssss ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrnnnnnnnn....
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss wwwwwwwwoooooooouuuuuuulllllllldddddd ssssssssttttttttoooooooopppppppp
uuuuuuussssssssiiiiiiiinnnnnnnngggg [rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww] ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmmssssssss iiiiiiiifffffff tttttttt hhhhhhhheeeeeeeeyyyyyyy
kkknnnnnnnneeeeeeeewwwwwwww tttttttt hhhhhhhheeeeeeeeyyyyyyy wwwwwwwweeeeeeeerrrrrrrreeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrriiiiiiiinnnnnnnngggg rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
mmmmmaaaaakeeeeeeee
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy
pppoooooosessssssiiiiiiiitttttiiiiiiiivvveeeecuee
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrr rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss iiiiiiiinennnn
ttttt hhheeeecueeiiiiiiiirrrrrrrr tttttooooooppp ttttt hhhrrrrrrrreeeecueeeeeecuee
pppluuurrrrrrrrncccchhhaasesssssseeeecuee
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
70%%%%
6622%%%%
“TThhhhhhhhiiiiiiiinnnnnnnngggssssssss tttttttthhhhhhhhaaaaaaaatttttttt aaaaaaaarrrrrrrreeeeeeee uuuunnnnnnnnbbbbbiiiiiiiiaaaaaaaasssssssseeeeeeeedddddddd aaaaaaaarrrrrrrreeeeeeee sssssssseeeeeeeeeeeeeeeennnnnnnn aaaaaaaassssssss
nnnnnnnnooooooootttttttt hhhhhhhhaaaaaaaavvvvvviiiiiiiinnnnnnnnggg aaaaaaaannnnnnnn aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa,,,,, eeeeeeeevvvvvveeeeeeeennnnnnnn ssssssssccccchhhhhhhhoooooooooooooooollllllssssssss
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss
/
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss
yyoouurr
Prrrrrrrooooooodddduuuuucttttt
Reeplyy
frroom
buusssineessssss
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd
Reeplyy
frroom
yyoouurr
buusssineessssss
ssssuuuuurrrrrrreeeeeeee tttttooooooo uuuuuuussssssssiiiiiiiinnnnnnnngggg ssssuuuuupppplllllllyy [rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww] mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.
ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmmssssssss iiiiiiiifffffff tttttttt hhhhhhhheeeeeeeeyyyyyyy
iiiiiiiinennnnfluuueeeecueenennnnncccceeeecueesesssssss
/
55%%%%
oooooooofffffff
aaaaaaaannnnnnnndddddd ddddddaaaaaaaammmmmmmmaaaaaaaa ggggeeeeeeeessssssss fffffffrrrrrrrreeeeeeeeeeeeeeeeddddddoooooooommmmmmmm oooooooofffffff ssssssssppppppppeeeeeeeeeeeeeeeecccccccchhhhhhhh ((442%%)) ....
822%%%%
oooooooofffffff UK ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee vvvvvvvviiiiiiiieeeeeeeewwwwwwww
ttttttttoooooooowwwwwwwwaaaaaaaarrrrrrrrddddddssssssss
ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss
899%%
bbbyyyy
Jaaaaaanneeeeeee
ooooooff nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss rrrrrrrreeeecueepppoooooorrrrrrrrttttt
ncccchhheeeecueencccckiiiiiiiinennnng
beeeecueeffoooooorrrrrrrreeeecuee
rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss
mmmaakiiiiiiiinennnng
pppluuurrrrrrrrncccchhhaasesssssseeeecueesessssss.
“I ttthiiiinnnk mmooooorrreeeeee aannnd
mmooooorrreeeeee pppeeeeeeooooopppleeeeee aarrreeeeee
01/0›
gggglllllllloooooooobbbbaaaaaaaallllllllllllllllyyyyyyy,, wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr
ttttttttoooooooo uuuuuuusssssssseeeeeeee aaaaaaaannnnnnnn ooooooooppppppppeeeeeeeennnnnnnn
ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmm....
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss
tttttttt hhhhhhhhaaaaaaaatttttttt rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnndddddd ttttttttoooooooo
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
Coooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp lllllllleeeeeeeeaaaaaaaaddddddssssssss ttttttttoooooooo wwwwwwwwaaaaaaaasssssssstttttttteeeeeeeedddddd mmmmmmmmoooooooonnnnnnnneeeeeeeeyyyyyyy
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee tttttttt hhhhhhhhaaaaaaaatttttttt
tttttttt hhhhhhhheeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp oooooooofffffff ccccccccuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss iiiiiiiissssssss aaaaaaaa sssssssseeeeeeeerrrrrrrriiiiiiiioooooooouuuuuuussssssss ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrnnnnnnnn....
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss wwwwwwwwoooooooouuuuuuulllllllldddddd ssssssssttttttttoooooooopppppppp
kkknnnnnnnneeeeeeeewwwwwwww tttttttt hhhhhhhheeeeeeeeyyyyyyy wwwwwwwweeeeeeeerrrrrrrreeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrriiiiiiiinnnnnnnngggg rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....
FEATURE
57

FEATURE
Demystifying Transformation:
The Experience of Being Legal
Everyday millions of people forgo cheaper coffee and instead stop into Starbucks for their
morning java. They are paying a premium not only for the coffee, but for the Starbucks
experience. Hundreds of thousands of patients were satisfied with their doctors but
switched to virtual care providers like One Medical at the first opportunity, proving how
essential a convenient healthcare experience had been to them all along.
The quality of products and services is important, but we
judge these products and services by the experience we
associate with them. While there are a lot of things you
can fake, you can’t fake how you make people feel. That’s
exactly why you’d be hard pressed to find an industry or segment of
the business that hasn’t gone through an experience transformation,
from pizza delivery to mortgage financing to human resources.
Until recently, the primary focus of human resources was on the
behind-the-scenes management and administration of things like
payroll and benefits. However, today’s progressive CHROs work to
elevate the whole human experience. Programs like flexible work
arrangements, apprenticeships, paid tuition and parental leave,
demonstrate the board-level of commitment to the talent experience.
So why hasn’t legal had a transformation experience? The answer
is steeped in legal’s DNA and goes beyond the services they
provide. Legal departments, built to constantly react and transact,
have been too tactically focused. Their experience is more aligned
to a service centre, than to other departments.
Making the Case for Legal Experience Transformation
It is not often acknowledged, but the legal function sets the pace
of business. Whether it is managing compliance risks, protecting
a company’s unique assets, or determining how fast contracts can
be executed, legal directly impacts the financial P&L of a business.
Now, legal is being asked to do more with less. They are feeling
pressure to transition from being transactional in how they operate,
to delivering transformational experiences that drive business value.
The pandemic accelerated the imperative for legal to transform. As
legal’s adoption of technology has increased over the last year, so has
the data collection on legal’s performance. In the past, the C-suite
might have let legal slide. Now, however, CFOs are questioning the
legal function’s fitness for growth. As a result, legal is going through
cost-takeout and optimisation programs. Budgets are being reduced,
and yet the business expects legal to move at a quicker clip.
To garner the attention of the C-Suite, legal transformation
needs to be based on a bigger vision and be relevant beyond
the tactical and reactionary needs of a business. The experience
transformation of legal needs to take a holistic view and account
for new ways of working, data and insights, people and culture,
and automation and enablement. Legal teams need to establish
an experience mission and roadmap, one that is focused on their
business role in generating revenue – and not just serving as the
gatekeeper for other departments.
Here are the four areas of the customer and employee experience
that legal needs to re-think:
“Legal departments, built to constantly react and transact, have been too tactically focused”
58

FEATURE
“We’re in a day and age where we can track a pizza, but we can’t track a contract approval”
Automation &
Enablement
New Ways
of Working
Data &
Insights
Culture &
People
There are many pain points
that a legal department
faces, and not having enough
budget or enough people are
two of the most significant.
Automation and enablement
combat both problems.
There is no shortage of
software tools that can help
a legal department. The
problem is they are often
cobbled together, underfunded,
have low adoption
or don’t enable legal teams
to operate more efficiently.
When good automation
happens, you don’t realise
it’s happening. When
automation happens properly,
it significantly cuts down on
time spent doing tedious
tasks and allows employees to
focus on the strategic goals of
the business and to develop
purpose-driven relationships.
Legal’s customers will get
more timely responses to
their questions, an optimised
workflow experience, and the
ability to quickly get
new strategic initiatives off
the ground.
The most innovative
legal departments are
working to define the best
processes and workflow for
creating better partnering
experiences. You can have
the best talent and tools
that money can buy, but if
you do not have a seamless
process and workflow, it
will create a lack of visibility
into what matters most
and exhaust legal and its
partners in the process of
chasing information. New
ways of working help legal
teams meet the challenge of
not having enough people
or having to repeatedly
engage in unnecessary and
unproductive process steps.
As businesses are challenged
to reduce costs and time
to execute, there is a
heightened reliance on
making real-time decisions
based on data. General
counsels and team leaders
need to take the guess work
out of decision making
through intelligence.
We’re in a day and age where
we can track a pizza, but
we can’t track a contract
approval. Legal departments
don’t yet empower their
consumers to know what
stage a contract approval
is in. Legal is positioned to
provide insights that can
enable the business to get
ahead of questions and allow
people to focus on more
critical activities. The feeling
of not knowing is only
compounded by the effort
it takes to know. Increasing
contract transparency
is essential to providing
the business a great legal
experience.
Legal teams are bringing in
top tier talent. The problem
is that talent is not being
nurtured and developed.
Legal employees exhaust
themselves on projects
without understanding the
importance their work has
on the overall business,
or how it’s connected to
other initiatives. Some
departments get territorial
over certain projects, even
though they could use
additional help. There is
often minimal efficiency
in resource allocation, and
even less transparency.
Legal departments often
also have a “micro culture”
that is not aligned with the
broader enterprise’s culture
and purpose.
Legal departments will
find that cultivating their
talent, building digital-first
skill sets and mindsets, will
produce a happier and more
productive team – and a
better overall culture.
Experience Transformation
The best companies are attracting the best talent and customers and keeping them for longer. For legal to
take its rightful seat at the table of every business, they need to realise they are in the experience business.
The experience they provide to customers is core to their success. Demystifying legal transformation will
happen only when a holistic approach includes the human element, not just technology.
Experience transformation is easy to start but requires commitment to make it real. Begin by asking
yourself: What are the frustrations and friction points in our operating model? And if they are all
removed, what would we look and feel like - and how would it propel the business? Then, define the role
of experience and the objectives to be the foundation for your transformation blueprint.
Do not focus just on how much percentage by which you need to reduce your budget or
increase productivity. If you have the right experience, the metrics will take care of themselves. A
transformative experience will empower legal to accelerate business performance and deliver on the
metrics that matter.
David Clarke
is Chief Commercial and
Experience Officer at
UnitedLex
59

KEY
CONTRIBUTORS
Customer
reviews pilot -
wins for firms
and consumers
We told you in the spring about
our customer review pilot scheme,
run with the Council for Licensed
Conveyancers and CILEx Regulation
(we’ve since been joined by the Bar
Standards Board). To recap, more than
70 firms and eight leading comparison
sites started the pilot working to
develop how they can better work
together, and encouraging firms to
take a more active role in engaging
with such sites. Initially this work
has focussed on conveyancing and
employment law.
Why do we think this is
important? Searching online
is fast becoming the first
port of call for those looking
for advice or to buy services, so customer
review sites are the new “word of mouth”
recommendations – but with far greater
reach. A comparison site will instantly give
far more information about a firm than a
conversation with a friend would. That’s
because law firms now have to publish
details about indicative prices and the
professional background of the people
carrying out the work for many services.
This information is mandated by our
transparency rules, introduced in 2018
to help tackle the problem that the vast
majority of those with a legal need do
not currently use a regulated professional.
Research shows two of the key reasons
for this are that people think law firms will
be too expensive, and they don’t know
enough about what going to a law firm will
entail. Therefore, putting more information
out there, challenges misconceptions
about costs and helps people make the
choice that’s right for them.
“We have published some
guidance on how to deal
with poor reviews”
Early wins for the pilot
The early signs from our pilot scheme
are encouraging. The firms involved are
changing their behaviours, not only in
terms of managing the reputation of their
firm and marketing their services, but also
when it comes to staff development. Many
of them routinely monitor for reviews and
are making reviews more visible to potential
clients through their own websites. Online
reviews are a key part of managing client
feedback, both good and bad. And for
some firms, client reviews are part of staff
reward programmes.
Talking of bad reviews, firms in the pilot
tell us that when these happen, as they
inevitably do, they are using them to their
advantage. Unlike critical comments being
passed around verbally, they know what is
being said and can respond. By engaging
with bad reviews, they not only appear
more open to other potential clients,
but they can also use learnings to either
improve their service or perhaps better
manage customer expectations from the
outset. We have published some guidance
on how to deal with poor reviews, which
firms tell us they have found helpful.
One firm told us about a poor review they
were given about slow service. The review
was posted 12 hours after the client had sent
an email late in the evening. The firm learnt
it should let clients know in advance how
long it would take to respond to queries.
Potential clients are also good at spotting
unreasonable or unfair reviews and tend
to focus on the ones relevant to their
own needs. And of course, a whole
host of positive reviews offsets the odd
negative one.
It is not just firms in the pilot who seem
to be embracing the power of the online
review. Since the start of the year,
Trustpilot have reported a 25% increase
in firms claiming their profile on the
platform, while Review Solicitors reported
a 350% increase in firms using its paidfor
services (adjusted to allow for the
pandemic) and a 180% increase in firms
signing up for their free services. Other
providers have since signed up.
Next steps
We felt a pilot was the best way to gain
useful insights into using comparison
websites, and it’s exceeded all
expectations. There has been so much
interest and engagement that we are
extending and expanding it to capture all
the great work that firms are doing.
On the back of this, we will carry out
research to find the best way to raise
awareness among consumers of the benefits
of shopping around for legal services. We
are also beginning to explore objective data
available to help consumers compare quality
and will be liaising with comparison website
providers and firms involved in the pilot.
Our recently-published innovation
research showed that marketing was one
of the main areas that firms might be
using new technologies – giving them a
commercial advantage by reaching out to
previously-untapped markets. It looks as
though customer reviews of law firms are
here to stay. The question you and your
firm need to ask itself is whether you want
to take advantage of the opportunities -
or can you afford to stand back and watch
your competitors do so?
Jane Malcolm
is SRA at Executive Director
60

CUSTOMER
CELEBRATION
Customer
Celebration
In order to be a successful business, Richard Branson once said
“The key is to set realistic customer expectations, and then not to just meet
them, but to exceed them — preferably in unexpected and helpful ways.”
However, it’s one thing to acknowledge this and another to implement it…
With this in mind, Modern Law wish to turn your attention to some of the outstanding
work that companies are undertaking in and around the sector right now. Our
participants discuss a wide range of subject matter that covers talent, training, interaction
with customers, recruitment and customer feedback. By creating the opportunity for
those involved to discuss the incredible work they’re doing and the outstanding customer
service they’re renowned for, we aim to create a section that celebrates the customer.
61

We are always available...
Paul Paul Challoner, Commercial Director
Jo Haslam, Head of Fast Track RTA
We are one of the largest and the leading providers of
end-to-end complete claims and legal solutions.
Right People | Right Skills | Right Technology
Right People Right Skills Right Technology
www.carpentersgroup.co.uk
www.carpentersgroup.co.uk

CUSTOMER
CELEBRATION
Partnership Approach
– Insurers, Brokers
and MGA’s
I joined Carpenters Group 5 years ago after
spending 20 great years at RSA. Having had
a few conversations with the leadership team
at Carpenters, I was reminded of a quote
by the great Bill Shankly; it was clear that
“Carpenters was made for me and I was made
for Carpenters”. Well, he said Liverpool, not
Carpenters, but you catch my drift.
Our approach to putting the customer first starts with our
insurer, broker and MGA clients, with whom we have
worked in partnership with, across the motor and home
claims industry for over 27 years, delivering a variety of fully
outsourced insurance and legal services.
Our long-standing relationships are built upon fully transparent,
fair, sustainable commercial agreements with real time data,
driving strong MI analysis to support decisions; but most of all,
open and honest conversations where we look for solutions and
innovations for shared success stories.
I could bore you with the detail about our monthly performance
reviews and how we drive to remove friction and unnecessary
touch points but that is pretty standard stuff.
The best strategic and innovation-based sessions are when we
go back to basics with “why can’t we just…” chats. We flip
everything on its head and look to not simply improve things, but
do things completely differently. These sessions always bring fresh
ideas to the table and ultimately new products or services that we
can then implement for our partners.
Atlanta group’s Daniel Athorn agrees.
“Carpenters Group are a key strategic partner to Atlanta and
provide us with much more than just a claims service with
constant dialogue ensuring we are ahead of the claims curve at
all times. Our relationship is built on trust and openness - which
despite our businesses individual scale - enables us to be agile
when dealing with challenges or new schemes. Nothing is ever too
much for the Carpenters Group team.”
We have recently built new solutions for Insurers who were
looking to outsource elements of their insurance services and
having just joined the MGAA, we are currently refining our
products and services with new partners each week.
Money On My Mind – End to End Supply Chain Benefits
At Carpenters Group we are very aware of both the commercial
challenges and opportunities within the industry and we have
regular dialogue with our partners about increasing their bottom
line through either improved rates, securing additional available
income within the claims journey or stripping out layers of costs.
Our agnostic approach to using the insurers choice of repair,
hire, medical and any other onward service providers, allows
insurers to plug in their preferred supply chain and utilise current
contractual arrangements.
Should an insurer, broker or MGA not have a supply chain in
place or if they are not benefitting fully from the opportunities in
the market, then, rather than having a one stop shop approach
which restricts who they can use, Carpenters Group will effectively
‘bespoke tailor’ the supply chain to fit the customer base and
services required with our fully transparent commercial modelling
– thus ensuring we maximise the bottom line impact.
Turning back to Shankly, it feels appropriate to finish with another
of his famous quotes and something I keep close to my thoughts
when working with our partners, “Football is a simple game based
on the giving and taking of passes, of controlling the ball when
you have it and of making yourself available to receive a pass”.
We flip everything on its
head and look to not simply
improve things, but do things
completely differently
Paul Challoner
is Commercial Director at
Carpenters Group
63

Not all views are safe.
Our reports educate property buyers
about development risk.
Don’t find out when it’s too late.
PROTECTING BUYERS, SOLICITORS & LENDERS
Request a sample report and ask
your provider to add DevAssist
to your conveyancing package.
www.devassist.co.uk
t: 01342 890010
e: orders@devassist.co.uk

CUSTOMER
CELEBRATION
Whirlwind year
of insight and
innovation
DevAssist are reflecting on what has
been one of the most challenging
but ultimately inspiring years in the
industry. Like every business, we had
to evolve, adapt, adopt new ways
of working, and still continue to
perform to the standards we and our
customers are accustomed to.
If you haven’t yet worked with us, DevAssist are research
experts in property, planning and development. We offer
in-depth development risk reports and specialist training for
solicitors. We are hugely proud of what our team and our industry
has achieved in the last 12 months. So, what did a booming
property market against the backdrop of a pandemic teach us?
We need more housing, but not in my backyard
30% of our reports in the last year exposed one or more high
risks of development in close proximity to a subject property.
A further 10% exposed a medium or high risk of development.
With a government backing the construction industry and a
relaxation in planning policy, in combination with a property
market favouring more rural locations, development in our
local areas is increasingly likely. Ensuring buyers have all the
information before purchase is crucial.
Buyers will pay more for peace for mind
One of the most interesting trends we’ve tracked is a huge
increase in demand for our DevAssess Premium report. This is our
most comprehensive search report at £300+ VAT and offers our
customers and their client’s, absolute reassurance that no stone
has gone unturned. The DevAssess Premium report assesses the
risk of development in close proximity to a subject property. It
looks at traveller sites, the Strategic Housing Land Availability
Assessment, local policy, listed buildings, the five-year housing
supply and changes to nearby major infrastructure.
Where buyers are moving
to unfamiliar areas and
seeking rural settings,
knowing about local
planning and development
has become a priority
Buyers have welcomed the opportunity to understand all the
development risks in their neighbourhood. This has been especially
important to the multitude of buyers leaving urban environments
for rural and village locations. Where buyers are moving to
unfamiliar areas and seeking rural settings, knowing about local
planning and development has become a priority. This need for
greater insight has really driven demand for DevAssess Premium
and we continue to highly recommend it for buyers in this position.
“Devassist and their range of searches have been a game
changer for our property team. Their searches not only
show existing/live planning permissions, but also potential
developments as well as providing an opinion as to risk. This has
allowed us to provide additional protection and advice to our
clients - allowing them to make informed choices. Their search
should be used by all property lawyers.” Caroline Roberjot,
Partner, Adams & Remers LLP
An industry to be proud of
Our customers and our team have delivered and performed
under the most exceptional circumstances and we have been so
proud of the role we’ve played in this unprecedented year in the
property market. Working under the pressures we all experienced
last year was challenging, but so inspiring in many ways to see
what was achieved and to the same exacting standards.
Our reports have never felt more pertinent as the market moved
at such speed, delivering valuable insight and peace of mind on
such a scale.
To learn more about DevAssist and how we protect solicitors,
buyers and lenders from unforeseen development risk, head to
devassist.co.uk or get in touch at info@devassist.co.uk.
65

SafeMove
CLEARLY
ESSENTIAL
#WhyRiskAnythingElse

CUSTOMER
CELEBRATION
Continuing to
Punch Above Our Weight
67

Total
Rehabilitation
Enabling Prosthetic and Orthotic clients
to achieve their goals since 1989.
To find out more about all of the rehabilitation and supporting
services we supply please call us on 0800 433 2239
or contact us at enquiries@dorset-ortho.com

CUSTOMER
CELEBRATION
Striving
for Better
for over 30 Years
'STRIVE FOR BETTER’ is not
just our slogan, it’s our way of
seeing the world, the driving force
behind our history, philosophy and
innovation and the reason we have
achieved a worldwide reputation
for excellence.
Established in 1989, Dorset Orthopaedic is one of the UK’s
leading independent providers of prosthetic, orthotic,
silicone and rehabilitation services. Not only does it have
comprehensive experience in meeting the needs of complex cases,
but is also a world leader in cosmetic silicone solutions, providing
a bespoke service generating incredible lifelike solutions.
All manufacturing processes are undertaken in-house, ensuring
that the highest standards are maintained throughout. The aim
is to support and enable each patient to archive the highest level
of functionality, mobility, and independence possible, striving for
total rehabilitation for each patient.
Keeping at the forefront of innovation and technology
Dorset Orthopaedics’ investment in innovation and advanced
technology is centred on delivering dedicated and individual
patient care, procedures and services, ultimately giving
more options to their patients in terms of prosthetics and
rehabilitation services and a better chance at a more mobile
life. Technology assists with the outcomes of the rehabilitation
journey, such as leading to earlier assessments, sometimes
ahead of amputation, providing wider support for patients, while
enabling clinicians to enhance the efficiency and productivity of
their clinics and the rehabilitation process.
The clinical teams are actively involved in sourcing new tools to
enhance patient’s rehabilitation, such as the Symphonie Aqua
Casting System and 3D L.A.S.A.R Posture, which assist the
clinicians in providing optimal prosthetic and orthotic alignment
and improving patient’s balance and posture.
The people
The company has over 70 employees across three full time
sites, boasting highly skilled silicone and prosthetic technicians
The crucial side of the
equation is listening and
understanding patients
challenges and concerns
and clinicians who are experts in their fields. Undertaking
training using the most up to date techniques, technologies and
componentry from across the world. Their training programmes
are a combination of in-house clinical experts and skilled
trainers from a variety of manufacturers.
Listening to their patients
It’s one thing to be highly skilled and dedicated to providing
the best possible treatment for patients, but the crucial side of
the equation is listening and understanding patients challenges
and concerns, and giving them the most valued commodity –
time! The teams at Dorset are dedicated to connecting with
their patients and spending the time needed to address their
concerns and ensure they are working to the same goal.
Feedback is requested directly from the patient during their
appointments and surveys are sent out periodically. This gives
both short-term feedback as well as the longer term; feedback in
turn helps clinicians to adapt and develop their treatments, which
then ultimately benefits patients during future treatments.
Keeping everyone safe
Despite the easing of restrictions, Dorset has decided to keep
the Covid-19 protocols in place to ensure all patients and staff
are kept safe while the country adapts. Having fewer people in
the clinics at any one time provides a safe space for patients to
attend appointments with peace of mind and an increased sense
of security.
Casting an eye to the future
What should we expect from the future of prosthetic technology?
Dorset believes in continuing to search for ways to improve a
patient’s prosthetic or orthotic rehabilitation experience. Treatments
like osseointegration will become further normalised, while we
will see continued research and development to make prosthetics
work better with the body. We should expect prosthetics to
become more bionic as we see better cohesion between patients
and prostheses as we start to see prosthetics being driven by the
patient. As advanced technology becomes more readily available,
we can expect a completely new range of medical devices both
technologically and mechanically advanced, aiming to serve
patients with high-tech but also high functionality products.
69

How is your
culture measuring
culture measuring
How up in is your the
up in the
culture post-pandemic
measuring
post-pandemic
up world? in the
world?
post-pandemic
world?
The fact is, your business culture largely
The fact determines is, your business the level of culture commercial largely success
determines you will the have, level regardless of commercial of the success best
The fact is, your business culture largely
you intentions will have, regardless and strategies of the you best lay down.
determines the level of commercial success
intentions and strategies you lay down.
you will have, regardless of the best
intentions "Culture and eats strategies strategy you for lay breakfast" down. Peter
"Culture Drucker, eats so, strategy as it's for the breakfast" most important Peter mea
Drucker,
"Culture of the so,
eats day, as
strategy make it's the
for sure most
breakfast" your important culture Peter is meal well fed
of Drucker, the day, so, make as it's sure the your most culture important is well meal fed.
Because in today’s world the consequential
of the day, make sure your culture is well fed.
Because impact in today’s of a business' world the culture consequential
the potenti
impact Because
for of errors,
in a today’s business' complaints
world culture the
and
consequential
ultimately the potential claims,
for impact errors, of a complaints business' culture and ultimately on the potential
will determine the level of risk you claims, present
will
for
determine
errors, complaints
the level
and
of
ultimately
risk you
claims,
to an insurer.
present
will determine the level of risk you present
to an insurer.
to an To insurer. find out exactly how your culture is
To find measuring out exactly up how you can your apply culture today is for a free
To find out exactly how your culture is
measuring up you can apply today for a free
measuring assessment* up you and can apply an independent today for a free appraisal
assessment* and an independent appraisal
assessment* of your available and an independent Indemnity Insurance appraisal
of of your your Markets: available available Text Indemnity Indemnity ‘Culture’ Insurance to Insurance 07539357293 and
Markets: we’ll Text call you ‘Culture’ back, to to email 07539357293 and and
we’ll mark@newedenway.com call you back, email
or call Mark or
mark@newedenway.com
Lloyd now on 03333449260
or or call call Mark or or
Lloyd now on 03333449260
*Terms & Conditions apply
*Terms & Conditions apply
*Terms & Conditions apply
www.newedenway.com
www.newedenway.com

CUSTOMER
CELEBRATION
The Growing Importance
of Cultural Analytics
The culture and values of a
business are of course very
important, however it all depends
in the first place on what kind of
business you want to be.
This can be done by accepting
that there are 3 broad markets
within which you can position
your service business:
1. Price:
Where your focus is being the cheapest and
competing as such.
2. Value for Money:
Here, there is less emphasis on price as you aim to point up the
‘added value service’ you provide beyond mere cost.
3. ‘Luxury’:
Or perceived, significant added value whereby your brand or
reputation allows you charge more for your services regardless of
the competition.
“Culture eats strategy
for breakfast any day”
Speed of service applies to all 3, irrespective of price and it
actually doesn’t matter which ‘market’ you choose to be in since
‘Culture eats strategy for breakfast any day’ (Peter Drucker c1987),
ergo, ‘Culture eats your business proposition for breakfast every
time too’ (New Eden 2021).
In fact, because ‘culture differentiates’ regardless, your vision
and values are on display for the client all the time and it’s the
‘perceptions of service’, or ‘the moments of truth’ as Tom Peters
said in the ‘80s, that ultimately determine whether your client
will want to come back for more.
“The bitterness of poor
quality remains long after
the sweetness of low price
is forgotten”
As Benjamin Franklin put it so succinctly over 200 years ago:
“The bitterness of poor quality remains long after the sweetness
of low price is forgotten”. So, decide what business you want
to be in first, align your culture to the market and clients you
wish to attract and if the clients don’t match or align with your
business proposition, you will need to let them go gently, or
quickly deal with their different expectations. To do otherwise
will serve neither of you.
“The consequential
impact of a service
organisation’s culture”
Those organisations who are able to align their culture with the
kind of clients who value and match that culture, will deliver
a less risky service business outcome and be more successful.
In turn, the consequential impact of a service organisation’s
culture on the potential for mistakes, complaints and ultimately
claims, will determine the level of risk they present to an insurer.
The SRA and indemnity insurers are beginning to accept and
see that ‘cultural analytics’ data will become as important as
transactional, historical, and conventional PII data since they
both already know that up to 90% of ‘mistakes, complaints and
ultimately claims’, are not down to ‘the law’, and that they arise
predominantly through the inherent, culture-driven behaviours
of the service organisation itself.
Now what do you fancy eating
for breakfast?
Mark Langley-Sowter
is Founder and CEO
at New Eden
71

Avista,
Homebuyers
and Homescreen
Built by conveyancers, for conveyancers.
“I have to say that they look really great and much clearer in
terms of the results and how to interpret them”
Thomas Parkinson, Head of Residential Property, Rowlinsons Solicitors
To find out more, visit: www.groundsure.com/residential-report-revolution
or contact your preferred search provider.
@groundsure Info@groundsure.com +44 (0)1273 257 755

CUSTOMER
CELEBRATION
Always Putting the Customer First
Groundsure prides itself on how we put the customer first and it’s no surprise that we have excellent
customer service - we are renowned for speedy yet informative responses to all manner of queries.
Number of
staff
8
Number of
emails p/m
average around 4,000
Number of
calls p/m
average around 1,400
Number of
Live chats p/m
average around 150
The team consists of 8 people who know our products
and services inside and out. We operate in a fast-paced
environment, with a huge variety of queries coming daily
from a broad array of customers ranging from homebuyers to
conveyancers, search providers to environmental consultants. We
have to tailor our knowledge and insight to cater for all levels of
understanding - dealing with queries from customers with a very
basic and limited understanding, to experts in the field.
When onboarding our customer service staff, they embark
immediately on an intense training programme to get them to
learn and understand our products inside and out. Often the
unsung heroes of the organisation, our customer service team is
often faced with challenging queries that they deal with politely,
professionally and with absolute aplomb.
Groundsure is famous for its customer service and client feedback
is always extolling the virtues of our team, be it regarding the
fast turnaround of queries, the expansive knowledge that our
customer service has, or the “never leave a stone unturned”
approach in resolving queries and issues.
Customer feedback
Our business is built on customer feedback. All of our Customer
Service team members have a Net Promoter Score feedback
mechanism on their email signatures where customers can
provide a score as to how their query was dealt with. We also
run an annual NPS survey to all our customers for Groundsure as
a whole. The score we receive is insightful in itself and we have
continued to get a higher NPS score over the last five years. Part
of the NPS survey includes an open-ended feedback question
where customers can provide feedback on what we do particularly
well and what we could do better. This feeds into each team so we
can address issues and continue to improve.
The importance of our customers is always at the forefront of
everything we do. We invest in the best technology to aid our
team and we put the customer first on all levels. We have customer
portals where customers can download all manner of marketing and
product collateral to aid them in their work. We involve customers
in all of our product development and provide in-depth qualitative
and quantitative surveys, focus groups and research panels. Finally,
we fully understand how important our products are in helping our
customers to succeed - or to make the most informed decision in
matters that can be emotive and close to the customer - especially
where residential transactions are concerned.
We love our customers and they love us…. But don’t just take
our word for it - here is what our customers say about our
customer service.
Groundshare Reviews
“I want to pass on my
thanks to Vic, who has
been absolutely brilliant. I
phoned about three times
today about the same
issue and Vic was friendly,
professional, and incredibly
knowledgeable. Because
of him, I have sorted my
complex survey issue
and have recommended
Groundsure and Vic, to
friends and family”
Direct customer feedback May June 2021
“Great customer service
& always looking at new
ways to improve products
to make them easier to use
and more efficient.”
NPS Survey 2020
“All the staff at Groundsure,
that I have spoken to, have
excellent customer skills”
NPS Survey 2020
73

Last chance
to nominate
the clock is ticking
Nominations Close Friday 17 th September
Thursday 25 th November 2021
The Rum Warehouse, Liverpool
www.mlconveyancingawards.co.uk
Event Enquiries ellie@charltongrant.co.uk
Sponsorship Enquiries kate@charltongrant.co.uk
01765 600909

Categories List
Conveyancing Firm of the Year - NORTH
Conveyancing Firm of the Year - MIDLANDS
Conveyancing Firm of the Year - SOUTH
Conveyancing Firm of the Year - WALES
Search Provider of the Year
Innovation of the Year
Rising Star of the Year
Service Provider of the Year
Client Care Award
Best Use of Technology
Outstanding Commitment to Training
Property Team of the Year
Conveyancer of the Year
National Conveyancing Firm of the Year
*new* Managing Partner of the Year
*new* Resilience Award
*new* Mental Health & Wellbeing Award
Outstanding Achievement
Lifetime Achievement Award
Sponsored by

Issue 3
Happy Customer
= Jolly Lawyer
In search of happiness …
TECHNOLOGY IN
LAW LAW LAND
Candid. Controversial. Cathartic.

inCase cuts
conveyancing
completion
times by 42%
House Purchase
O’Neill Patient
Scan here to
learn more!
email
NEXT
• ID/AML
• Process Flows
• Digital Signature
• Secure Messages
• Client ‘To-Do’ List
• Client Document Upload
• Branded App
• Forms & Questionnaires
• Push Notifications
• Integration Guarantee
in-case.co.uk
Arrange your FREE product tour today
0161 410 0800

Meet the Tech Ambassadors
Becki Cassia
Transparently,
CEO and Co-Founder
Sonia Hadjadj
Legal Counsel & Legal
Ops Consultant
Sam Borrett
Legmark,
CEO and Founder
Nick Cousins
Exizent, CEO and Founder
Sucheet Amin
(aka Such)
inCase, CEO and Founder
James Moore
Kulahub, Director
Dror Levy
LegalDrop, CEO and
Co-Founder
Martyn Best
Document Direct,
Managing Director
Jo Liston
Wipro, Senior Commercial
Manager
Alex Grux
Hyperlex, CEO and
Co-Founder
Vincent Perrin (aka Vinnie)
Salesforce UK, Regional Vice
President – Professional Services

Join hundreds of law
firms already using
our flexible, 24/7
typing service
No dictation system?
No dictation system?
No problem
No problem
Use Use our our free free smartphone app app to to
Use Use our our free free smartphone app app to to
dictate your work wherever you you are are
dictate your work wherever you you are are
The Document Direct
The Document Direct
typing service provides
typing service provides
these benefits:
these benefits:
Reduced overhead costs
Reduced overhead costs
Time saving
Time saving
Enhanced gross profit
Enhanced gross profit
Enhanced working
Enhanced working
capital earlier billing
capital - earlier - billing
Reduced delays on on file file
Reduced delays on on a a file file
Highest quality
Highest quality
documentation
documentation
24/7 service
24/7 service
Contact us us to to learn more
Contact us us to to learn more
or or start free 30 30 minute trial
or or start a a free 30 30 minute trial
info@documentdirect.co.uk
info@documentdirect.co.uk
+44 (0) (0) 1926 821900
+44 (0) (0) 1926 821900
Better working flexibility
Better working flexibility
for for fee fee earners
for for fee fee earners
Secure, compliant, and
Secure, compliant, and
GDPR friendly
GDPR friendly
Happier clients
Happier clients
Cert. Cert. no. no. 10046 10046
Cert. Cert. no. no. 10046 10046

Intro
Golly gosh.
Here we are again already. It doesn’t seem at all that
long since issue II “Fusing People and Machines” dropped
on the quasi-remote ivory tower mats. I simply cannot
believe how quickly the summer has come and gone?
Can you?
Whilst many lawyers I know, in spite of the Covid travel rule blunders, have been sunning
themselves at their R&R villas (that’s Rest and Recuperation for the uninitiated and/or
less privileged of us), we at Modern Law, together with the ever-expanding number of
tech ambassadors, have been beavering away to bring you this candid, controversial
and hopefully cathartic edition.
Personally, I have LOVE LOVE LOVED being involved in bringing this roundtable feature
to you as its subject focus is super close to my heart. When given her remit on this
theme, The Naked Lawyer was so excited that you would be forgiven if observing her
and thinking that she and her Segway could have positively twirled their way onto the
Olympic podium for artistic sporting flair!
*Whizz-bang* *Whoosh* … Incoming… The Naked Lawyer chucks
her first muse bomb into the centre of the ring, part in protest
as we had kept her waiting as we all faffed around for so long
settling down for the duration, and part mischief-making, as
usual, just to remind us all that she is present and doesn’t like
to be ignored! Okay, she has a point, of course. Less superfluous
chatter and more ‘on point’ rigorous discussion, opinion and
practical tips are called for.
So, without further ado, let’s get stuck into “The Customer, Not Client, is
Queen.“ With such a VAST theme which has had plenty written on
the subject to date, yet, as the saying goes, “times they have a
changed so much over the past year or two”, I decided to address
a handful of controversial and long-standing issues with the tech
ambassadors that have been debated in the past as well as
a number of really pertinent current topics which are highly
relevant now and will affect us in the future.
Hoping to avoid a full-blown muse grenade
assault from The Naked Lawyer at the outset
I decided to warm up the ambassadors
with the question “What is your view on
whether users of legal services should
be called ‘client’ or ‘customer’?” I’m
curious, as are you, no doubt, our readers.
Which is it? Does it matter? Should it
matter? Why? Is there a place for both?
81

Vinnie: I think this is very much open for debate.
Ultimately the use of the term client by law
firms probably stems from professional advice
given. If seeking advice from professionals like a
consultant, a doctor and lawyers, you are a client.
If, however, you are purchasing goods or nonprofessional
services (for instance an electrician/
plumber) you’re a customer.
Dictionary terms are interesting:
Client - a person or organisation using the services of a lawyer or other professional person or company.
Customer – a person who buys goods or services from a shop or business.
Hmmm … a neat starter-for-ten, Vinnie. Like it. But let’s chew the cud on these definitions further.
A law firm is a business. Some even provide goods in the form of LegalTech and/or LawTech
products, commodities in effect. Ergo, the buyer could be either a client or a customer, perhaps?
Such: The same question could be posed in the health profession….’patient’ or ‘customer’. But is a patient a
‘customer’ buying health care services? They certainly are using health care services and even through taxes,
paying for the provision of it through the NHS if not private.
The same goes for ‘client’ and ‘customer’. They are totally interchangeable, and does it really matter? I think not.
The legal profession will certainly lean towards the term ‘client’ and indeed, a quick flick through the SRA Code
of Conduct reveals ‘client’ or ‘clients’ in regular use…not a ‘customer’ to be seen!
I feel as though ‘customer’ is used in the provision of commodities, whether that be a superstore selling food or
an online platform selling books and electronics. I can see the legal profession putting up a good argument that
the provision of a legal service is not a commodity. Yet I’d challenge that…given the increasing fixed fee models,
in commercial as well as private client work, legal services have been commoditised for a long time and will
continue to be. Consequently, users of legal services are as much a customer as they are a client.
Indeed. I’d be inclined to agree, Such, particularly as we are witnessing an ever-increasing
supply of LegalTech and LawTech products welcomed by users/buyers.
Becki: Normally, I am completely anti-labels as I think they can lead to stereotypes being formed, or assumptions
being made that result in things being placed into boxes, when they don’t necessarily belong there. Putting that
Pandora’s box to one side (and in answer to this question), I think that it really depends on the type of relationship
that either exists, or that you want to establish, between the individuals.
Whenever I was working through my issues with my legal team, I always considered myself to be a client rather
than a customer. I was paying my legal team for, and was a beneficiary of, their knowledge and expertise.
I entered into the process with a long-term view, as opposed to the transactional and dare I say it, faceless
relationship I had with somewhere like a shop. For me, the difference between the two types of user depends
on the ‘buy-in’ process or experience, and also type of company you are buying from.
Thanks to the likes of Apple and Amazon, the balance of power has moved away from supply, towards one
of demand. In this digital age, the customer is now King (or Queen!). But if you cater your services primarily
towards customers, you will need to continually search for them and have a robust strategy in place to replace
them as they come and go. Customers simply view your business as a commodity. On the other hand, clients
don’t need to be replaced and you gain repeat business, with little or no effort.
So, in roundup, I suppose it really comes down to the relationship you have, and want to have, with the users
of your service.
This is a really cool and interesting perspective, Becki.
Sam: Does it matter? I think the answer (like all SEO answers) is - ‘it depends’. Does calling them
a customer over client impact on the bottom line? If so, then do it. How do we find this out is the
interesting part?
THE RUM WAREHOUSE,
LIVERPOOL
25/11/2021
www.mlconveyancingawards.co.uk

Tradition dictates that law firms have ‘clients’ because they are service users bound by a
contracted relationship. However, if you have a legal app or you have subscribers to a monthly
legal service, are they ‘users’ or ‘members’ and how much does that matter?
When you’re talking about them internally it probably doesn’t. When you’re addressing them
directly, it sets out expectations and perceptions of what that relationship is and that can affect
how the client/user/customer feels about your organisation.
In a world where law firms are needing to appear more ‘user friendly’, it may well be beneficial
to reference the ‘customer’ in website content and other communications. While that’s my gut
feeling, the only way to know for sure is to ask the clients directly – or run some A/B tests on
identical landing pages with ‘client’ on one and ‘customer’ on the other.
Who’s going to do it? I’d love to see the results!
Wouldn’t we all, Sam!
Dror: I personally like to use ‘customer’ as I associate it with customer support,
customer service, and customer satisfaction.
What matters is the meaning legal professionals attach to these words. How do they
view the user in the context of each word and is the way they communicate affected by
it? If a lawyer refers to a user as a client and another refers to them as a customer, do
the two different lawyers presume that they need to give different treatment / level of
service to the other party? For example, would they give a client a more ‘professional’
service and would they give a customer a more ‘personable’ service, and if so, why?
Another great point, Dror. Which supports the view that the two ought to be
interchangeable? Or, better still, maybe we should just have ONE word in the English
language that means both?! …
Alex: Interesting question, also because in French we don’t make the distinction between
customer and client, we just have one word: client (à dire avec l’accent).
In English, the definitions of these two words are pretty clear… One could say that like
doctors, lawyers should not have customers but clients, because they provide people with
advice. But it’s changing!
As a LegalTech provider for example, it’s easier to say that we have customers, even
though we provide legal advice in addition to the tech. Maybe it’s due to the fact that
when you work in tech, you always think about the customer: it comes first in the way you
think and develop the product. Is it possible that technology influenced the legal sector
and ended the lawyer hegemony, and now, lawyers should call their clients customers?
In our solution, I used to call the internal client of my client the consumer because they are
consuming legal services defined by our clients through Hyperlex.
Ugh. I hate to admit it, Alex, but for once I’m with the French *raucous laughter* *guffaws*
Martyn: As the great Louis Armstrong sang to the equally iconic and wonderful Ella Fitzgerald, “You like
potato and I like potahto, You like tomato and I like tomahto. Potato, potahto, Tomato, tomahto. Let’s call
the whole thing off”
In a way that sums the matter up. Interchangeable words; two words separated by the same meaning.
But before we conclude, let us hear further from Louis and Ella: “But oh, if we call the whole thing off, then
we must part. And oh, if we ever part, then that might break my heart.”
So, we should endeavour to respect the difference, and with a vague shrug of the shoulders, accept that it
is more mildly appropriate to use client in our legal world, but let us not forget that, as they say elsewhere,
“the customer is king.”
NOMINATIONS
CLOSE
Friday 17 th September!

LEGM LEGM RK RK

Client-centricity
Ah, therein lies the rub, Martyn. If the customer really is King, or Queen
(let’s tick the diversity and inclusion box shall we ladies and gents?), it begs
us to address the question: “Do you believe that solicitors / lawyers /
barristers are TRULY client-centric? Do they really put the client first?”
Vinnie: To me this really depends on the term ‘truly client-centric’ but the
answer is probably no. Law firms typically have very siloed data, that sits in
stand-alone point solutions. Maybe a couple of partners/fee earners/lawyers
within the firm might know the clients very well, but this will probably only be
from one viewpoint, i.e., current matters they are working on, past matters they
have worked on, or maybe the needs and requirements of the client. But they are
highly unlikely to know all the touch points within the firm, for example maybe
some of the bills submitted have been rejected by the client, or maybe the firms
marketing has been sending them untargeted emails.
Such: As a solicitor myself, I’d be a total hypocrite if I didn’t say that the vast majority of
solicitors, lawyers and barrister are genuinely client-centric…I know I am. But we have to be
honest that often the pressures of the matter at hand, the job, the work environment, demands
from the employer, clunky processes and systems, all get in the way of making that a reality.
Being a lawyer (speaking from experience) is tough. The hours can be very long, the work
very complex and you have to balance that with treating every client as your only client
because that is how they feel they should be treated. It can be an impossible situation.
This is definitely where tech plays its part. Clients have been gradually ‘trained’ to
experience amazing service all through the use of technology…with little or no human
contact. The legal sector has woken up to this and I’m certainly seeing more firms
recognise that tech has a larger part to play other than just improving efficiencies and
the bottom line.
Becki: I recently had to send my iPhone phone away
for repair (in our household we are big believers in the
repair ahead of replace mentality, my partner and our
10 year old daughter have even been known to take a
lawnmower completely apart, replace the broken bit
and then build it back up again, using detailed parts
drawings) and I was reminded of what true clientcentric
service is. Despite what you may think of him,
Steve Jobs once said that “You’ve got to start with the customer experience and work
backwards to the technology—not the other way around” and he was absolutely right.
Along with a number of other visionaries, companies such as Apple came along and drove
a sledgehammer through traditional business models. Much like our lawnmower exercise,
they took apart workflow processes, customer service models and company culture, and
rebuilt them again with the customer in mind. To them, the experience of the customer at
every touchpoint was paramount; whether that was the sensory experience of opening
the box of your new Apple product or the seamless repair process you needed later on.
I think that many law firms believe that they are client-centric, but being client-centric is
not the same as being client-focused. If you are client-focused, the approach tends to be
based on looking at the customer and working out what to sell them. Conversely, being
client-centric means that you approach the world from the customers’ point of view; you
look to deeply understand your customers’ problems and deliver solutions for them.
Nick: In a world where there is so much technology available to law firms - enabling
them to automate a huge amount of their work and digitise key parts of the client
journey - legal professionals have a duty to their clients to make their services as
efficient and accessible as they can; clients should not be paying for hours of a legal
professionals’ time for a task that could be improved through the use of technology.
Legal sector technology has come on leaps and bounds over the past few years, with a
huge number of solutions now available to automate repetitive and administrative tasks,
so there is very little excuse for those firms not yet embracing tech. However, the onus
85

should not be entirely on law firms - they also need developers creating solutions to the issues they
are facing – technology that adds real value, not technology that is there for technology’s sake.
That service design-led ethos is central to what we do at Exizent. We work closely with our
customers (and more broadly through our Research Community), to find out exactly what the
problems are around probate processes. We then use this insight to inform the development of our
platform. Going forward, collaboration and integration will become more and more important; if law
firms are going to become truly efficient, they need to be able to bring all the various technologies
and platforms they use together in order to create more efficient workflows and ultimately, a better
service for their clients.
Alex: I think they should! But maybe they don’t all do it... We’re all humans
after all! Like every sector, people have been influenced by the emergence
of products and services which put the customer at the centre of everything.
And they probably have become more eager to receive a customer approach.
Even though, like doctors, lawyers are not used to this approach. Now, do I think
solicitors / lawyers / barristers etc should be truly client-centric? Yes! I think it would be
very beneficial for them.
Sam: Ever since getting into the legal sector I’ve said that it’s largely behind
the times when it comes to customer service – I don’t think many people will
disagree with me even now!
Yes, there are some exceptions, but I’d challenge anyone reading this to
honestly admit they’ve given the necessary time and resource into reviewing
and optimising their entire customer journey (to use marketing jargon).
Whether it’s low-quality website content, poorly written or confusing
onboarding documentation (that’s typically your client care pack and Ts
and Cs etc), or obfuscated updates from solicitors and legal teams, the
general standard of law firm communication is not where it should be.
I spent years trying to improve this process and communication – something
that was essential when dealing with up to 100,000 clients at any one time on
low margin work. A breakdown in communication could trigger thousands of
phone calls and emails from existing clients – all impacting the profitability of
the work.
My view in the main is that the only reason a client contacts you for an update,
is because you’ve failed to provide the right information, at the right time, in the
right way.
Imagine the impact if your reviews feed was full of people saying how refreshingly easy it was
to understand the process, the correspondence and updates you sent, and that they didn’t
need to contact you at all for an update or to clarify what your latest letter actually meant!
I’d certainly be tempted to choose that firm, based on those reviews.
Martyn: The world has certainly changed with regard to the lawyer/client dynamic. A hundred or more years ago,
and even less, there was a sense of an almost class divide – especially between the ‘oh so honourable, professions,
and the rest of the world, who might have been classed as ‘tradesmen, retailers, workers’. Was there a sense that
the term ‘profession’ could not apply to these ne’er do wells – and therefore, was there an entitled sense that
these vagabonds were jolly lucky to be able to call upon the services of us ‘professional gentlemen’?
If this attitude existed then what has changed it? Well – this is probably a major treatise on social history
and development, the rise of a meritocracy, the breaking of barriers, and the ease of entry for new
‘professionals’. If it did exist, however, I do feel that it is being well-eroded, and clients need to know, feel
and be treated with respect. We must all reflect that they are truly the first line of our existence, without
which, there is no purpose.
86

client
This can even start at the first or second point of contact, and I am always astonished and perplexed why
even the simplest opportunity to shine is lost. For example, how would you feel if receiving this email out
of office message from your lawyer:
“At this time, we are still experiencing unprecedented numbers of email and telephone enquiries.
We need you to understand that we will not always be able to get back to you in the timescale you would expect,
as we need to carry out our work and deal with other enquiries as well as yours and must give priority to matters
that are about to complete.
Emailing us numerous times a day and phoning us constantly will not change this.
Within this firm we do not treat emails any differently than ordinary post.
We usually respond within 48 hours - where we have an answer - or within 7 days if we are waiting for information.“
That is a true out of office, believe me! So basically, “You’re not that important to us; we’re too busy to deal
with you, and actually stop pestering us!”
*Howls of laughter* *Boisterous belly chuckles* The Naked Lawyer falls off her spit
bucket! Finding this all so very amusing she beckons me over to help her back on her
perch and whispers something in my ear…
Encouraging me to pursue this line I pose the question: “What IYHO differentiates
those lawyers / GCs / Barristers who deliver great client/customer service in
contrast to those who do not?”
James: Ok, this is a relatively easy one. Having worked with several firms across
the UK, the ones that put data at the heart of the client experience are the ones
that are able to generate longer-term, stronger more profitable relationships.
Unfortunately, not many do put data at the heart of their businesses, and as
such, opportunities to identify new ways to strengthen the client bond go
missing. I guess a key question here is how do you measure great client service?
For me it’s about extending a relationship beyond the immediate, and that
means building trust and empathy. That takes time, getting to know your clients
as people and business owners. Understanding their pain points and their
ambitions, and gathering that information and insight (call it data) and using it
to help them above and beyond the immediate.
James Moore -
Kulahub, Director
Many firms simply see the transaction in front of them, not a long-term
relationship. Meaning short term wins. This is a myopic position and one that could
quite easily be reversed, if, during the on-boarding processes firms really took the
time to get to know the businesses and the bosses better. Yes, they will be engaged,
(more than likely) on a specific issue, but firms can add value through different service
lines when the time is right. I have used the services of several firms throughout my career, and
sadly, I haven’t built a relationship with any of them. Transactional. Do the deal, pay, done!
In my world, repeat business is critical, as it takes twice as much effort to get a new client than to
keep an existing one. How do good firms manage this? By building profiles and plans alongside
clients, allied to their ambitions and challenges. This insight/data is then used to create a
key account/client relationship where opportunities for additional fee-paying work can be
identified well in advance, planned for with the client and optimised at point of delivery.
Assuming you already have wonderful practitioners with great human interaction skills, then
the difference between great client service and the rest, is planning, data and action. Data
87

Exizent’s software makes probate easier than ever.
Exizent’s software makes makes probate probate easier easier than than ever. ever.
Exizent’s software makes probate easier than ever.
No No more templates, build probate cases with with dedicated
No
software No more more
to to
templates,
minimise build
data
build
data probate
entry
probate and and cases cases
admin.
with with dedicated dedicated
software No No more to templates, minimise build data probate entry and cases admin. with with dedicated
software to minimise data entry and admin.
software to to minimise data data entry and and admin.
exizent.com
exizent.com
exizent.com

needs to be centrally managed, and ideally harnessed on a tech platform to take the ‘leg work’
out of managing the data, and the communications and the scheduling and the reporting.
Simply put, this is key account planning and client management together. CRM. IMHO that is
the difference between great client service delivered to the benefit of the client, and the firm!
Okay then, so “What would be your key tips to lawyers, GCs, Barristers etc with
regard to empathising with clients / customers?”
Dror: Listen to them. Be human. Disassociate what you think the customer wants or
needs and find out what they are asking for. Look them in the eye, be it in person, or
on Zoom. Don’t wear a suit, let them see you exactly as you are. They are exposing
their vulnerabilities in the hope that you help them at their time of need. Don’t take
their vulnerability for granted. Respond quickly to their enquiries and make them feel
comfortable when asking follow on, clarifying questions.
Sam: Talk to them like you’re down the pub (or maybe in a trendy coffee shop). You’re not in
court, you’re not going to impress clients with your verbosity and eloquence. It will only lead to
more questions at best, or dissatisfied clients - more likely.
I’ve heard lawyers on the phone to clients talking to them like they’re trying to win an argument.
Remember – you’re not doing them a favour, they’re doing you a favour by selecting your
service, treat them with the respect and consideration you would expect to get yourself.
Martyn: Within that mix is also relationship building and nurturing. It’s
about mutual respect and both parties knowing they are working together
towards a common goal.
The relationship shouldn’t be based on the transactional nature of the activity –
it’s about long-term relationship building – even for the smallest of transactions.
Martyn Best
Document Direct,
Managing Director
One of my earlier deals in my ‘30’s was aborted – and there was £30k of
WIP on the clock. Distraught, I was not expected to be taken out for consoling beers by my corporate
lawyer who declared that they would write it off – and pay for the beers. They saw the future value of what
I may get up to – and probably the wonderful future hindsight of well over £200,000 of fees.
It’s about really understanding your client – asking them what they are aiming to achieve, establishing
quite openly how they want to be communicated to, and then delivering totally to, and beyond, their
expectations of you.
Becki: When considering empathy, I have to mention Harper Lee’s classic novel “To Kill a Mockingbird”. I
can remember our class reading and analysing the book in school during our English classes (our teacher
unenviably tasked with educating a group of bored children about empathy), but the following quote
stood out to me; “You never really understand a person until you consider things from his point of view .
. . until you climb into his skin and walk around in it.” It was a little like a eureka moment for me and it has
stayed with me ever since.
As a lawyer, seeing the world through the eyes of your client can help you to provide a level of service that
will make you stand well apart from your competitors. But the task is difficult; empathy assists with the
building of rapport, trust and confidence. Using empathy within dispute resolution can also give you an
advantage as you not only understand your client’s wishes better but seeing the world from the opposing
party’s perspective will help you to understand exactly what they want to get out of the dispute as well.
Although empathy is not an emotion, it does involve an emotional reaction, which doesn’t really
have a central place for a lawyer who is supporting their client through an issue. The practice of
law is based upon reason and rationality. Emotions can be seen to be unpredictable and at times,
illogical in their nature.
As a client, the entire legal process is laden with emotion. Even if the case itself appears to be relatively
neutral, the mere act of searching for, consulting with, or instructing a lawyer, causes an emotional
reaction in the client. Many joke that they would much rather visit their dentist! But people want to be
understood. Not just by their friends and family, but also by the people that they interact with, especially
when they are feeling isolated or vulnerable and during periods of crisis.
89

appiness
When a client feels that their lawyer understands them and is truly interested in a successful solution to
their issues, they become less anxious and more at ease. They become willing to provide information,
even the information that could be embarrassing, or perhaps not show them in the best light, yet is
important to their case.
Outside of the profession, lawyers are not generally known to be empaths. Thinking about it pragmatically,
in reality a true empath would have a pretty difficult time practising in many areas of the law. But to be
truly effective and successful in their job, the lawyer needs to be able to translate their client’s story from
a set of demands to a set of “resonances” with each of the other stakeholders; a successful lawyer needs
to be able to induce empathy.
Although having too much empathy may cause lawyers problems, a lack of empathy will undoubtedly
lead to even bigger ones.
Jo: Don’t Worry, Be Happy!
When did you last need a lawyer? Can you remember how you were feeling
before you made contact? I bet “happy” wouldn’t be the first word you would
use to describe how you felt....
I can count on one hand the number of times I needed a lawyer in my life so far. I
can assure you for every instance there was a sense of trepidation!
For many people it is often a distressing, unplanned or unforeseen circumstance
the individual finds themselves in. For example - a car accident / personal injury,
divorce, driving offences, criminal proceedings, employment dispute. I’d
imagine words like upset, angry, stressed, or distressed might be top of this
list. Certainly not happy!
So how do law firms create happy customers? They should empathise!
Consider the client’s emotional state at the start. Go on the journey with
them, support them as their feelings change. It is likely they have been in a state
of denial for some time but they haven’t sought out legal advice so likely they are
now in a state of chaos and confusion and in need of help and advice to allow them
to think rationally and devise the plan that can lead them to a happy outcome.
Jo Liston
Wipro, Senior Commercial
Manager
Let’s remind ourselves why a person would need a lawyer? Law is complicated! Not only can it
take away paperwork and hassle but great advice and quality interventions can save money, pain,
uncertainty and deliver clarity, certainty and closure. Having a lawyer should deliver a much
better outcome. Great – a pathway to happiness.
The basic emotion that most humans strive towards is HAPPINESS. The good news is that
happiness is how people feel after they have received the legal advice – but what an emotional
roller coaster they have been on!
The Naked Lawyer flashes Jo a smile and a wink as I jokingly tease “Have you been
OD’ing on Ken Dodd’s happy pills again, Jo?” The ambassadors immediately burst into
cohesive vibrant song with hands raised flapping and performing “Happiness, happiness,
the greatest gift that I possess. I thank the Lord that I’ve been blessed. With more than
my share of happiness”...
After much revelry I eventually succeed in cajoling the gang to settle down. “Now, now,
play nicely with our newbie ambassador” I implore. In an attempt to comfort Jo, I turn
to her and opine, “I guess this is like enduring ‘the bumps’ at school or a hazing at
University! But please take it as an acceptance ritual. You are now formally IN the gang”
Playtime over, comedians and comediennes, let’s get back to the task in hand …
90

“What do you see as the key areas that are ripe for improving client/customer
service by using technology now, and in the future, by law firms, businesses of
law, legal departments, new entrants?”
Vinnie: Total transparency of Client Information, giving the client access to matter/client
data 24/7. This could move the firm from being simply reactive to a client’s request, to being
proactive and knowing what information the client is seeking.
Client Self Service – Where clients have unfettered access to data such as matter lifecycle
information, what the status of each client matter is and where they are in terms of matter
budget against granular information around hours billing, by who and for what.
Client Self Service could further be used also to serve up access to parts of the law firm’s
knowledge system; allowing the client to seek answers to general questions and maybe this
could be a good way to expose law firm content to the client; no longer being simply pushed
out to the client, maybe at the wrong time and with the wrong context; but with the client being
able to pull/explore this content when required.
Nick: As a service industry you simply have to cast your eyes (and digits) over the propositions
we all engage with daily in other areas to know the specific elements that, when done well,
fundamentally change your satisfaction (is enjoyment too high a bar for legal services?) with a
service engagement.
Accessibility and ease of use – I can speak to someone on video to arrange a mortgage at 8pm;
simple, multi-channel communications – I can upload docs, sign digitally, chat; transparency with
progress – I know who is delivering my parcel and precisely where it is on the journey; speed of
execution – I can open a bank account in 10 mins; self-service – I can renew my driving licence
online in a few simple steps.
Internally, there are some obvious areas for improvement through technology that have knockon
benefit for customers (lower costs, quicker service). In our view, the ripest area for tech
improvements are the administrative tasks that can simply be completed better by machines. This
includes better use of data, open banking and other resources, risk management, and integration
of different technologies. For example, when someone dies, the procedures surrounding probate
are still heavily reliant on people and manual processes, which are slow and cumbersome, and
this then drags out the process, making it really difficult for those involved. Our platform aims to
connect the data and services used by legal services firms, financial institutions, and executors
to make managing the probate process easier, and it is technology like this – which can connect
different parties and data – that we see making the biggest difference to the legal sector. By using
technology to reduce repetitive, data-centric tasks, legal professionals have more time to focus on
the more complex aspects of their work that computers simply can’t do.
James: Again, this is about data gathering, centralising and using it. Technology can do so much,
if properly considered (the objectives), properly developed (to the objective requirements)
and properly maintained and used (by marketing and business development teams, which
understand why they should be data focused and WORKING IN TANDEM).
I don’t see Partner-driven client development being obsolete anytime soon, but Partners must
come together to understand how technology can help their practices centralise business
development and client revenue opportunities, optimise according to value and priority, then
maximise every single client and prospect revenue opportunity.
In practice, this is a process that is both human and technology-driven. Without one or the
other, client service/CRM/lead management won’t work.
Kulahub offers the technology platform, using data centralisation and manipulation,
prioritisation via lead scoring (value-based) and workflow automation and communications
platforms. With, of course full dashboard reporting.
In my opinion, firms must get behind the principles of client servicing (as adopted in many other
B2B sectors) and then behind the skillset and technology platforms that enable them.
91

client management for next generation lawyers
info@transparently.legal
(c) transparently 2021
LegalDrop offers access to simple and straight
up legal services, to businesses of every size.
With clear and upfront fees and a personalised
service, our customers get to pick their own
legal expert to handle their legal needs.
To apply to join the platform, or to find out
more contact us on:
E: Info@LegalDrop.com
T: 0203 3228205
LegalDrop.com

Alex: If you take the example of audits, I think technology can help to
have a more customer-centric approach.
Rather than providing a written contract audit in
the form of a 500-page report (which your client
will have to translate into concrete actions in his
own management tools) if you know that your
client uses a contract management software, you
can consider providing him with this audit directly
Alex Grux
Hyperlex, CEO
and Co-Founder
uploaded in the tool. The contracts are stored in secured platforms, alerts
are set up, and notifications for important dates, turned on, so that clients
are alerted when an obligation has to be fulfilled.
To Sell documents or templates should disappear in my humble opinion.
Tomorrow the technology will help professionals not to sell the template but the
template machine access in order to create as fast as possible the contract but also
the subscription to keep the document updated. It looks to be a great way to shift from
“one shot services” to “recurring services”.
Such: It’s all about ‘communication’. Using a legal service is frankly a ‘distress purchase’. Clients do not go to a
law firm because they WANT to, they go to a firm because a situation has arisen which means they HAVE to.
That means the client’s starting point in a relationship is ‘I really don’t want to be here spending money
but I have no choice!’ That is as much the case for a straight-forward house purchase as it is a complex
commercial dispute.
In my view, the fastest way to improve service is rapid and regular communication. No client wants to
hear about important information several days after the event and no client wants a wall of silence over a
prolonged period of time.
I’ve seen firms recognise this and embrace the power that already sits within the tech platforms to improve
communication. They simply dial up the regularity of updates by either prompting lawyers to take action or
they automate updates at certain milestones. Others have taken it a step further and provided a platform for
their clients to access to almost ‘self-serve’ their need for communication.
*Whizz-bang* *Whoosh* … Martyn’s nodding profusely so
The Naked Lawyer hurls a muse bomb directly at him. Not
expecting or prepared for this Martyn jumps to narrowly
avoid a direct hit and immediately begins blustering …
Martyn: Yep I agree Such, communication is the key. We now live in the fast, digital age. Our GenY and Z’s (the
ones entering decision making territory) expect quick responses, prompt updates, and easy access to information.
Just look at for example, Amazon, or Naked Wines as two shining examples. They communicate so well
throughout the decision process, the buying process, the delivery process, and the ultimate arrival, and
post-delivery. We all know exactly where our precious purchase is and when to expect it – and when it does
arrive it’s nearly 100% to our expectations.
The rest of the world of legal IT – LegalTech – dare I say is actually mostly irrelevant to your average client.
Who cares about what CMS you have, what document management system you have, if you have AI or not?!
I truly don’t care if your server is in the cloud – just as long as your head isn’t.
communication
93

satisfaction
The number one thing that lawyers can do with better tech is to communicate better – the rest will take
care of itself.
I’m not saying LegalTech is unimportant – of course not – I’m just saying that your clients will not care
what you have, as they will assume you are engaged with the best support you can have, to deliver the best
service at the best price.
Another personal example – I bought a small property recently – and the customer interaction was less
than wonderful. I referred the firm to InCase, which would have both improved the whole delivery of advice
but also actually would have shortened the transaction, and the time they spent on it, and of course their
profitability. Despite a reasonably informed client (i.e. me) suggesting this, the reaction was still, “We don’t
really think that’s for us.” It is this inward-looking state that needs changing, and tech can help this.
Interestingly, I read an article in The Law Society Gazette 1 back in July that was reporting
and commentating on The Legal Services Consumer Panel tracker survey which states
that client satisfaction has hit an all-time high, despite lockdown. “Do you think this is
because more legal service has occurred online due to lockdown?” I ask. “Why now?”
“Is it because lawyers may have been forced to communicate digitally more often?” …
James: That’s quite amusing. Satisfaction has gone up when face-to-face contact has gone
down. What does that say about lawyers, the clients and/or the digital topology? Probably
something about each.
Inevitably, the pandemic has forced all businesses to address the way they conduct business
and manage client service. It is no longer critical to have face-to-face interaction, though this
is not necessarily a perfect way to build or maintain relationships in the longer term. Digital
platforms means that client and internal communications can be more pointed, less travel on
business time means more time to be productive (theoretically) and more profitable.
In my opinion, we have now adjusted to different working rhythms and consumers of professional
services are equally as happy receiving services remotely/digitally as face-to-face. Doing so
saves them time as well. So lawyers have needed to shift and adjust as well as anyone. The
upsides (once the rabbit in the headlights moment passed in March last year) of this MO are
necessarily more touchpoints, via video-conferencing platforms and digital communications.
These can be easily planned and managed via scheduling in Office or other.
*Whizz-bang* *Whoosh* … what feels and looks like a
meteorite storm of muse bombs peppers the entire room
as The Naked Lawyer zips around on her Segway amongst
us all. Immediately intoxicated I begin to tommy-gun the
ambassadors with a plethora of questions who, being
thoroughly warmed up by now, are only too keen to fire
back vociferously …
1. https://www.lawgazette.co.uk/news/client-satisfaction-hits-all-time-high-despite-lockdown/5109090.article?utm_source=gazette_newsletter&utm_medium=email&utm_cam
paign=Borders+bill+%27risks%27+access+to+justice+%7c+Offices+set+for+reopening+%7c+Global+Britain_07%2f06%2f2021
94

“Where do you think the ‘power’ currently lies in the relationship between
the lawyer and the client/customer?”
Such: Power has definitely shifted from the lawyer to the client. I remember 20 years ago when as a
young solicitor, I had the power in the relationship. It was no more obvious than clients waiting patiently
for me to call or write to them…only for their reply to be instant. Then they would wait another week or
two before I next contacted them. Can you imagine the review I would get today if I took that approach?
Oddly, the client has always had the power, they were probably just blindly relinquishing it on the
assumption that the professional lawyer was in control. Let’s not forget the client instructs the lawyer.
The client pays the lawyer. The client tells the lawyer what to do. They are definitely the ones in control
and this shift of power is now squarely with the client and has been for several years.
Alex: I think power currently lies in customers. Simply because, if you think
about all these LegalTech platforms (e.g. Legalplace) where people can
find legal advice for a very cheap price (services are sometimes four times
cheaper!). You realise that clients have choice, they can actually decide where
they want to go to get legal advice.
If we also discuss the power balance between the Law firm and the Legal
department: we could also say that today’s tech revolution definitely empowers
the legal department regarding the law firm. In France, Law firms represent the
legal expertise (vs the legal processes/the day to day business relationship) that
you need to have to be protected against a legal risk. LegalTech emphasises
the importance of the legal department in the contract processes and as a
pilot of its processes inside the company. The Executive committee will have
more data about the contract processes and how it impacts the day to day
businesses. It’s in my humble opinion something which will help to reduce the
power of law firm vs legal department.
Power
Sonia: Ultimately the technology players will have to be customercentric
first in their experience. Otherwise they just won’t last
long term. So in a way that is certainly good news for law/legal
services customers. A great technology solution performs well
when it retains customers and that can only happen when and if
it holds solving customer real frustration points within the core
conception of the product. In the legal tech land of solutions
aimed at Legal departments, it will even be more fundamental
as GCs are expected to be customer-centric and enable
sustainable growth of their business operations. Speed,
innovation and performance are required so technology
relied upon by the legal teams and businesses must enable
that or be discarded.
“If you were a client/customer in need of legal help, how
would you go about choosing a lawyer?”
Sam: Personally, I would ask friends and family and existing contacts
(potentially including my LinkedIn network, so make sure you’re listening
on there!). I might message my tennis club pals, or the neighbourhood WhatsApp
ground. But essentially, I’m looking for a recommendation.
Once I get that, I want to sense-check it. I’ll take a look at their website, the reviews
and comments across Facebook, Google, maybe the TrustPilot or Feefo reviews,
and then decide to give them a call if that all checks out. If I get a good vibe from the
phone call, you’ve got yourself a client!
However, many other people are not as discerning – we know this from data we
collect on searches and website form fills.
Often a potential client will search for your service, click on the first few results, and
fill out a form on the website (if it’s easy enough to do). Then it’s a race to see which
firm can respond the quickest to get that person on the phone.
You all know you convert a higher percentage of calls over form fills, so you need to
get that potential client on the phone to stand more chance of signing them up. If
you’re not converting more phone calls than form fills you need to urgently review
your call handling process and staff!
95

Vinnie: I think that the environment and ESG (Equality, Sustainability and Governance) are
high on client agendas. For the majority of clients ESG is a big factor in law firm selection.
D&I (Diversity and Inclusion) has been part of the RFP/Pitch selection criteria for some time,
however Environmental / sustainability criteria now forms an important part of selection.
Good point, Vinnie. I’m aware Salesforce has the importance of this at its heart and has
even created a solution (“sustainability cloud”) to help its customers use your platform to
monitor and make this a tangible success for them. Super impressed.
Alex: The first thing for me would be reputation and then price. I don’t particularly care
about location because I don’t mind having a digital relationship with a lawyer, so it would
be the last thing I would care about. All I want is the best expert there is! So, specialism
would come third. Also, about speed of delivery, it sure is important, but if the lawyer has
a good reputation, it means (s)he will deliver fast.
Review sites
“As regulators consider forcing law firms to sign up to review websites 1 , what
is your view on legal service comparator sites, and customer review sites?
Are they a good/bad thing for lawyers and/or customers?
Such: Online reviews are now just a way of life. Does anyone not look at
reviews before any purchase, whether modest or not? We are constantly
looking for validation that our chosen purchase is right for us. It is now the
normal habit within the buying process and certainly applies to legal services.
Frankly, if a firm doesn’t have some method to allow clients to leave reviews
for all to see, future prospects will be very sceptical and on top of that, the firm
is missing a great marketing lever. I know that some review sites charge for the
privilege which gives me conflict but they do offer a service that is of value.
However, I sympathise with any business that is in pain of paying to display reviews of its own
service…but this is where Google steps in. It’s totally free to set up a Google Business Account and
from there, invite clients to post reviews. The business can respond to those reviews all of which is
completely free and totally visible…and I’m sure there is some sort of algorithm working in the background
to help the website improve its visibility and ranking! Sam will no doubt have a good expert view on this!
Dror: Review websites are good for all parties. Of course, there are going to be issues, just
as there would be with any review site in any industry (for example, the authenticity of
the reviews, whether the reviews are a fair representation etc), but in general, they are a
good way for reducing friction in accessing legal services. The current government plan
to crack down on fake reviews and make it illegal for people to write or host reviews will
be a positive step in protecting consumers online.
Whilst reviews are not the only factor that should be considered when choosing a legal
professional, they do play an important role in helping the customer decide who to
work with. Word of mouth is a powerful way to assess who to work with and reviews
are an extension of this. If the collection and presentation of reviews are done properly
(reviewsolicitors.co.uk do this well), then reviews have the potential to be even more
effective as they can mitigate personal biases.
From the lawyers’ perspective, I understand it can be scary to be scrutinised publicly.
But for those lawyers who want to survive past the age of the machine, being brave
enough to take a step forward, and showing the world that they are willing to put
customer service at the top of their agenda, is incredibly valuable.
But you can’t have your cake and eat it, you either want to be customer-centric or not.
There is a reason why platforms such as Trustpilot and TripAdvisor are worth billions,
the market is telling us that consumers expect reviews.
1. https://www.lawgazette.co.uk/news/regulators-consider-forcing-firms-to-sign-up-to-review-websites/5108763.article
97

“Do you think clients / customers prefer to use technology 100%, partially
(i.e. in the first instance before then moving on to human lawyer help) or
not at all for their legal service experience?”
Jo: Without wanting to simplify and over-generalise, it might be quite helpful to think
about a person’s preference towards technology in the context of three demographic
characteristics - Baby Boomer, Gen X and Gen Y/Millennials.
Baby boomers were born between 1943 and 1964
Many Baby Boomers now own a smartphone. They also use social media—especially Facebook,
where they’ve doubled their usage since 2015. One could argue that the digital adoption
of smartphones is a necessity, but growth in social media usage shows the opposite.
The pandemic has increased tech adoption with the older generations, but adoption was
already trending upward before COVID-19 forced many businesses online. Like businesses
that were forced to take operations online, Baby Boomers took their business
online, due to safety advantages when COVID-19 hit.
100% Tech
So, it’s good news! Baby Boomers are embracing tech – but make sure you have representation
from this group when designing your customer experiences and journeys. It
might sound patronising – but many on-line apps neglect this demographic and something
as simple as the font size of text is overlooked. Remember they value relationships,
so treat them well and you will be rewarded with loyalty. Don’t lose sight that the
Baby Boomer generation controls around 80 per cent of UK private wealth. Property
is expected to account for 70 per cent of transferred wealth.... that’s a sizeable market
opportunity. Anyone who is likely to be in receipt of this.... Generation X!
Generation X were born between the mid-1960s and 1980
They grew up with minimal adult supervision and learned the value of independence
and work-life balance. They also appreciate informality, are technologically adept, flexible
and tend to be highly educated.
Often termed the sandwich generation - many have parents, children and are homeowners
themselves. They are accumulating wealth and likely to inherit wealth in the not-so-distant
future. They may be married and have an expanding family. They will research and not
go with the first lawyer they find. They will seek recommendations and research a firm’s
successes and failures. Please think about how you attract and retain new customers. New
Gen X customers could have size-able long-term value and they are loyal when they can
see great service and value for money. In 2021, Gen X is at peak buying power.
The Millennial (Gen Y) generation were born between 1980-2000
They make up the fastest growing segment of the workforce. As companies compete for
available talent, employers simply cannot ignore the needs, desires, and attitudes of this
vast generation. As with each generation that preceded it, Millennials have come to be
defined by a set of characteristics formed mainly by the world and culture they grew up
in. Here are a few of their common characteristics:
• Tech-Savvy • Family-Centric • Achievement-Oriented
• Craves Attention • Prone to Job-Hopping
You need to bear this in mind when you consider how often and what medium to keep Gen
Y updated. Lifetime value of a Gen Y customer is also tricky to navigate. How they behave
in the workplace is a strong indicator of how they behave towards firms (brands). You will
need to work exceptionally hard to win repeat business and engender loyalty in Generation
Y. They much prefer self-service and on-demand services. You need to make it intuitive and
easy to do business with. Lazily labelled generation rent, many (if not already) have strong
aspirations for home ownership and are mindful that they may also inherit wealth. Gen Y
wants to handle this responsibly and they care deeply about financial security.
Get to know your customers, how they think, what matters to them, what they value and
need. Market and tailor your services to suit them best.
98

generational
Nick: This is the question that almost all service industries wrestle with. The
answer is (unfortunately) “it depends”. If we start from the position that we
are here to serve our clients and customers, then we must be prepared to
accommodate them on their terms. The circumstances are everything here.
Is your client stressed or under pressure? Is the topic or task difficult or
simple? Is it a transaction or a relationship-focused engagement? Are they
comfortable with technology or do they find it alienating? The variables are
many and, as such, there can be no one-size-fits-all model in a servicefocused
business.
The parallels between the legal sector and the financial services world I worked
in for many years are strong. Banks have been working fanatically for years
to digitise services, with every engagement viewed as a transaction that can
be made easier (from the banks’ perspective perhaps!) by putting it online. In
reality, for all the reasons mentioned above, as a customer you occasionally
just want/need to speak to someone directly to get advice, guidance or
help. There is nothing more frustrating than being unable to escape a digital
journey when it’s not working for you. In many cases digitisation has gone
too far, and banks are now trying to find ways to reconnect human with human.
So, the holy grail of service is, in my mind, a very flexible hybrid model that enables engagement
with clients using technology where it helps (comms, information gathering, progress reporting etc.),
but make access to the expert easy and unconditional.
At Exizent we are completely focused on bereavement. As our lives and therefore probate cases
become more complex, the human aspect is absolutely vital - the help and support that legal
professionals provide the bereaved cannot be overestimated. In fact, the Exizent Bereavement
Index showed that 39% of law firms provided their clients emotional support in at least half of
bereavement cases – unsurprising given 94% of people who had recently lost someone said they
found at least part of the bereavement process stressful.
That’s why we are firm believers in the role of the legal services community in helping the bereaved,
but massive advocates of introducing the right technology to ease the whole process.
If this should be the case, perhaps we should consider the following:
“Lawyers love to say that they are “trusted advisors”. Should trust in people/
lawyers be extended to trust in machines/technology by clients/customers? i.e.
would YOU trust a machine / technology to do as good a job (if not a better job)
than a human lawyer in your hour of need?”
Such: It is often said ‘trust is earned’. Generally, the public do trust lawyers from the outset but that will start
from a low base and improve over time. Once trust is cemented into the relationship, it can be a very hard
bond to break. Of course, there are situations when that trust erodes because the client doesn’t get the service
or result they expect and lawyers can find themselves on a downward spiral. When it comes to machines and
technology, the public is now so ‘hard-wired’ into using tech that trust comes naturally and instantly – trust
isn’t earned here. If that machine or piece of tech fails, that trust can quickly disappear whereas with a human
lawyer, there is a quick route to re-building that trust through face-to-face contact.
But “The ‘trust’ issue often goes hand in hand with what level of ‘risk’ you are
willing to take as a client / customer. Do you think it is riskier using the machine
/ technology than a human lawyer?”
Alex: I think that using one or the other would be riskier! For this to be balanced, humans and
robots would have to work hand in hand. The robot could give plenty of information, and the
human could complete the work by analysing the data and using his free will to advise.
99

Simplify.
Accelerate.
Create.
Wipro delivers enterprise innovations on
the most powerful digital platforms.
In every industry, technology is outpacing
adoption. And customers are expecting
organisations to deliver frictionless
interactions across all channels. We partner
with law firms to design solutions that simplify
their transformation road maps, accelerate
their transition to new platforms, and enable
them to create experiences that matter.
Wipro is a recognised leader in cloud-led transformation
wipro.com/contact-wipro

egulation
Let’s just pick up briefly on the regulatory element again, shall we? Professor
Stephen Mayson has been reading and following our roundtable discussions
and has kindly commented that he loves the focus on the user/consumer
expectation and experience in our Technology in Law Law Land sessions. He
says he’s been “thinking about consumer expectation and experience a lot
recently as part of the next steps in regulatory reform”.
“Is the current legal regulatory framework and system a help or
a hindrance for clients / customers? Should machines / robots be
regulated like human lawyers?”
Martyn: Now that’s a funny one – it’s the people that cause the problems, not the machines.
Regulation
Sonia: Yes – where the activity falls under the scope of regulations of law
activity. The goal of these regulations is to protect the public so whether it
is delivered by humans or via algorithms or a mix. Whilst trying to not hinder
innovations, regulators shall proactively imagine future developments and
precede them to set a regulatory frame around them and not play catch-up.
Regulators should not let industry or players self-regulate or self-police on
these issues of artificial intelligence developments.
Dror: 100% yes, they should be regulated. Just like an unregulated lawyer, an
unregulated machine could potentially create unfair practices or undesired
outcomes. Regulations (when in place correctly) are there to protect the
end user, who is often in a more vulnerable position than the lawyer.
Whether machines can be regulated or not is perhaps a question for a
singularity expert.
Alex: In theory, yes, there should be one rule for everyone.
For example, lawyers should have a very strong code of
ethics. At law school, there are many courses on this subject.
But as the robot lawyer has no free will, it would make no
sense to train him on deontology because we are trying to
correct human failings with this. A robot will not have the idea
to leave with his client’s money and go to the Bahamas.
At the end of the day, Robots are executing Human instructions
(through the dataset or through the code), so it’s likely only the
human element will have to be regulated.
Dror Levy
LegalDrop, CEO
and Co-Founder
Another way to see the question… Imagine that tomorrow
regulators will use robots to execute continuous controls of regulations and
regulated companies will also have software to execute continuous controls
inside their companies, etc.
I’m sure we will see regulator robots which will be used to directly certify the
legal AI of the software etc. It would be a king of machines regulation “by
design”. The future will be amazing.
101

In the previous Technology in Law Law Land issue you will have read that I
shared between 2020 and 2050 more than half of legal services workers
will have lost their jobs and those that remain will be forced to take
“performance-enhancing medication”. Do you think clients/customers
will be accepting of this scenario aka engaging / commissioning a
human lawyer who is ‘medicinally enhanced’?
Martyn: It’s a funny thought but won’t happen. We will need people, and people are
resourceful enough to adapt and apply themselves to the new opportunity of increased
regulation that is looming our way – if only on the laws relating to using machines in a
legal practice.
Oh really? What say you, Alex? …
Alex: Is an antidepressant a performance enhancing medication? If
yes, the future is already here. I think it’s not jobs that will disappear,
it’s tasks. If the job disappears it’s because it was not a job but a
task execution position (and not the best place to work). If we are
thinking about competing against the machine for a similar task,
we will need a lot of medications; it is a lose-lose situation. But,
if we imagine working with machines and associate the power of
computation and the untiring execution of repeatable/boring tasks
of the machine with the emotional capabilities and the creativity
of the Human, we will find a job which gives us time to be happy.
Future
One final question:
*whizz-bang* *Whoosh* *Zing* *Vroom-
Vroom* … The Naked Lawyer dances
on her Segway as we all burst into
animated song again: “Happiness,
happiness, the greatest gift that I
possess. I thank the Lord that I’ve been
blessed. With more than my share of
happiness.” Uh-oh, time to wrap things
up before The Naked Lawyer grabs a
tickling-stick methinks. With only two
muse bombs remaining on her utility
belt things could get very naughty!
“As a buyer of legal service/product aka user of the legal system
(in any capacity i.e. as a tech supplier or actual lay person needing
legal help), if you had the opportunity to chat with any famous
solicitor / lawyer / judge / politician in the world alive today, what
question would you ask, and why?”
Martyn: Curiously, Barack Obama, Vladimir Putin and Xi Jinping are all trained lawyers.
I’d therefore ask them to get their heads together and improve the customer service of
the world, and stop being so short-term and self-centred, build long-term relationships
and really understand what your 8 billion customer base wants.
102

conclusion
Alex: Why are we not changing the system faster? It’s an easy question but a complex
answer with multiple facets of a unique problem which glues our system together. I love
the early adopters of today’s legal system who want to change just to change (with
sometimes no business reasons). They just want to run to the future. However, it's a real
pity to see how sometimes things take so long to be adopted by people who have a
really good reason to change. My biggest example is the law firm vs corporate: when we
founded Hyperlex technologies we had 2 approaches:
• be adopted by lawyers to transform legal services from law firms; and
• be adopted by companies to make improvements for themselves:
4 years later it was still impossible to make law firms in France adopt our kind of
technologies. They are still wondering if it is useful for them, if the cloud is safe enough, if it
will impact their pricing model, etc. But on the other side, some companies are embracing
these new tools and technologies, and are running as fast as possible to deploy this
service to their internal users.
Why?
Oh-oh. Don’t get me and The Naked Lawyer started on THAT topic, Alex. *Raucous
laughter* *smiles* *winks *nods* …
Becki: Without a doubt I would ask to have a chat to Sir James Munby. He was a Judge and the President
of the Family Division of the High Court when we first started Transparently. I can remember the first
time I read his “View from the President’s Chambers” and thinking he completely understands the
struggles and intricacies of life on the “ground”, which for a person at such an elevated level is bluntly…
rare. Everything he said resonated. What would my question be? That’s easy; please can I have a day of
your time so that I can ask you a thousand more questions.
LOVE IT! If only we had more time. If only … TIME … Such a precious element at the
heart of life, business and lawyering. Maybe even cherished as much as happiness,
perhaps? And with that parting thought, The Naked Lawyer zip-zapped across the room
chanting “Happiness, happiness, the greatest gift that I possess. I thank the Lord that
I’ve been blessed” …
See you next time!
By Chrissie Lightfoot Chief Tech Advisor and Writer to Modern Law
(Chair of the ‘Technology in Law Law Land’ roundtable). Chrissie is
an Independent Non-Executive Director and Advisor, a global multi-award
winning Legal Futurist, Consultant, Entrepreneur, Lawyer, AI LawTech
Pioneer, Strategist, Marketeer, Brand builder, best-selling Author and
Keynote Speaker. Founder and CEO of EntrepreneurLawyer Ltd.
103