MLM54 WEB FINAL
Transform your PDFs into Flipbooks and boost your revenue!
Leverage SEO-optimized Flipbooks, powerful backlinks, and multimedia content to professionally showcase your products and significantly increase your reach.
Issue 54<br />
ISSN 2050-5744<br />
THE BUSINESS OF LAW<br />
CUSTOMER<br />
IS KING<br />
P6 Jo Causon P9 Theo P56<br />
Service Can Be a<br />
Key Differentiator<br />
Paphitis<br />
Enter the Dragon<br />
David Clarke<br />
Demystifying Transformation:<br />
The Experience of Being Legal<br />
Supported by
Wherever you<br />
roam, client<br />
onboarding<br />
with eCOS is<br />
pitch-perfect<br />
Technology that connects you,<br />
wherever that happens to be<br />
Are you trudging through the process of gathering client information to start a transaction?<br />
Onboarding your clients shouldn’t peg you in. eCOS, our electronic client onboarding solution,<br />
brings together everything you need to achieve remote onboarding. Access to client care packs,<br />
verification of identity and source of funds solutions, onboarding questionnaires and Law<br />
Society TA forms, all integrated into your CMS. eCOS gives you visibility over your onboarding<br />
process within a single platform.<br />
Embark on a new adventure.<br />
Start onboarding digitally with eCOS from InfoTrack.<br />
Visit www.infotrack.co.uk/ecos or call us<br />
on 0207 186 8090 to say no to paper and<br />
onboard clients electronically.
Will Cotton<br />
Customer is King<br />
“Focusing on the customer makes a company more resilient.” Jeff Bezos.<br />
Welcome back to Modern Law. As Mr Amazon blasts into<br />
space on his maiden voyage this summer, I sit here and<br />
ponder to myself… he must be doing something right?!<br />
I certainly don’t agree with everything Jeff Bezos does in this<br />
world, but as a very clever man voiced to me in this edition,<br />
there’s a lot that Amazon do that is truly admirable. Now… I<br />
must note that this introduction is certainly not a secret bit of<br />
marketing for the company, I can promise you that! Instead, it’s<br />
an acknowledgement – a tip of the cowboy hat – to a company<br />
that is a true king or queen of the customer journey. Amazon<br />
is undeniably ubiquitous in our lives now, whether that be for<br />
their exceptional ability to deliver a product readily, or their<br />
questionable treatment of staff in doing so.<br />
“Make the customer king” … It’s sounds easy, doesn’t it? But<br />
there’s a fine balance between making a customer feel special<br />
and ramming your product or service down their throat – no one<br />
likes an overzealous waiter.<br />
My hope for you as a reader, is that we can some shed some light<br />
on how to get that spirit level nice and steady.<br />
We kick things off with interviews with Theo Paphitis, Theo<br />
Paphitis Retail Group, global bestselling author Joe Pine and<br />
ex-Head of customer service at John Lewis, Andrew McMillan.<br />
Both Sussanah Hewson and Jo Causon write fantastic articles<br />
on the importance of good customer service and ways for you to<br />
improve your own.<br />
Price Bailey host another fascinating roundtable with some<br />
great law firms, this time discussing the lessons learnt from the<br />
pandemic and the opportunities for the future.<br />
We have features from the former Digital Strategy & Innovation<br />
Leader at PwC, David Clarke, as well as Bill Guthrie, Glenesk and<br />
Trustpilot – all of whom give outstanding arguments towards the<br />
importance of reviews and transforming your law firm.<br />
And finally, on the back of last editions incredible Law Law<br />
Land, Chrissie Lightfoot returns to host our next instalment<br />
of debate, aptly named ‘Happy Customer = Jolly Lawyer’. With<br />
our ambassadors weighing in on some extremely hot topics – the<br />
Naked Lawyer had plenty to write about for this edition!<br />
Anyway, enough from me, time to hear from the real experts. I<br />
have been quite loquacious with this introduction… maybe it’s a<br />
habit I should continue.<br />
Will Cotton<br />
Editor, Modern Law Magazine<br />
01765 600909 | william@charltongrant.co.uk | modernlawmagazine.com<br />
Editorial Contributors<br />
David Seager, SIFA Professional<br />
Alex Holt, Cashroom<br />
Bronwyn Townsend, InfoTrack<br />
Martin Cheek, Smartsearch<br />
Bernadette Bennett, Moneypenny<br />
Mark Holt, Frenkel Topping<br />
Eileen O’Mahony, WM Promus<br />
Howard Sears, Price Bailey<br />
Annabelle Lofthouse, Breakthrough Case Management<br />
Jayne Shawcross, CLS<br />
Marc Lansdell, Evolve Law<br />
Laura Fisher, Gunnercooke<br />
David Grossman, Simplify<br />
Craig Matthews, Osprey Approach<br />
Ian Keith, Dual Asset<br />
Anava Baruch, Design for Independence<br />
Martin Ellis, Howden UK Group<br />
Richard McCall, Armalytix<br />
Neville Dinshaw, Law Mergers & Acquisitions<br />
Tim Champney, Future Climate Info<br />
Andrew Mckie, Mckie Recruitment<br />
Pam Loch, Loch Associates<br />
Amanda Illing, Gatehouse Chambers<br />
Willie Pienaar, Nuvalaw<br />
ISSUE 54<br />
ISSN 2050-5744<br />
Editor<br />
Will Cotton<br />
Project Manager & Events Sales<br />
Kate McKittrick<br />
Modern Law Magazine is published by Charlton Grant Ltd ©2021<br />
All material is copyrighted both written and illustrated.<br />
Reproduction in part or whole is strictly forbidden without<br />
the written permission of the publisher. All images and<br />
information is collated from extensive research and along<br />
with advertisements is published in good faith. Although<br />
the author and publisher have made every effort to ensure<br />
that the information in this publication was correct at press<br />
time, the author and publisher do not assume and hereby<br />
disclaim any liability to any party for any loss, damage, or<br />
disruption caused by errors or omissions, whether such<br />
errors or omissions result from negligence, accident, or<br />
any other cause.<br />
3
INSIGHT<br />
INTERVIEW<br />
IN-DEPTH<br />
EDITORIAL<br />
BOARD<br />
Disclaimer: Our publications contain advertising material<br />
submitted by third parties. Each individual advertiser is solely<br />
responsible for the content of its advertising material. We<br />
accept no responsibility for the content of advertising material,<br />
including, without limitation, any error, omission or inaccuracy<br />
therein. We do not endorse, and are not responsible or liable<br />
for, any advertising or products in such advertising, nor for any<br />
any damage, loss or offence caused or alleged to be caused<br />
by, or in connection with, the use of or reliance on any such<br />
advertising or products in such advertising.<br />
CONTENTS<br />
06 Service Can Be a Key Differentiator<br />
Jo Causon, CEO at The Institute of Customer Service gives us an insight into<br />
how those organisations that achieve high levels of service, also enjoy higher<br />
levels of profitability – what they call the customer service dividend.<br />
09 Enter the Dragon<br />
Joining Modern Law is the ever-impressive Theo Paphitis. Having dominated<br />
the retail sector for the past three decades, no one is better placed to discuss<br />
the importance of the customer.<br />
13 The Experience Economy<br />
B. Joseph Pine II is an internationally acclaimed author, speaker, and<br />
management advisor to Fortune 500 companies. Modern Law found out how<br />
experiences can transform what law firms offer.<br />
17 It’s Simple but It’s Not Easy<br />
Responsible for customer service and quality of selling across the John Lewis<br />
Department Store Division for almost a decade, Andrew McMillan, concludes<br />
our interviews for this edition.<br />
20 The Human Touch – Business Growth Through the CX Journey<br />
In order to grow and succeed, every business needs to acquire new customers<br />
and hold on to existing ones. Susannah Hewson explores how Customer<br />
Experience (CX) is the key.<br />
25 Dealing with Highly Sensitive Issues<br />
Pam Loch, Loch Associates<br />
25 How to Exceed Client Expectations amid Ever Increasing Demands<br />
Craig Matthews, Osprey Approach<br />
27 Your Website is Your Shop Window<br />
David Seager, SIFA Professional<br />
27 Changing Consumer Habits<br />
Alex Holt, The Cashroom<br />
29 Why Digital Onboarding is Changing Client Experiences for Law Firms<br />
Bronwyn Townsend, InfoTrack<br />
29 Automated Technology and Personal Relationships Go Side-by-Side<br />
Chantelle Wren and Anthony O’Hanlon, CLS<br />
31 Customer Interaction: Face to Frace, Virtual or Both?<br />
Neville Dinshaw, Law Mergers and Acquisitions<br />
31 Establishing a Better Relationship<br />
Mark Holt, Frenkel Topping<br />
33 Developing Our New Website<br />
Annabelle Lofthouse, Breakthrough Case Management<br />
33 Delivering a Fluid Customer Journey<br />
Eillen O’Mahony, WM Promus<br />
35 How Much Should You Spend on Marketing?<br />
Howard Sears, Price Bailey LLP<br />
35 Understanding the Journey<br />
David Grossman, Simplify<br />
37 Growing Customer Expectations<br />
Mark Dennis, DUAL Asset<br />
EDITORIAL BOARD CONTRIBUTORS<br />
4
EDITORIAL<br />
BOARD<br />
37 How a Shoe Collection Highlights the Importance of Designing for<br />
Emotional Needs<br />
Anava Baruch, Design for Independence<br />
39 Conversation, not Technology, is the Gold Standard in Customer Experience<br />
Willie Pienaar, Nuvalaw<br />
39 Opportunities and Challenges of Contemporary Legal<br />
Marc Lansdell, Evolve Law<br />
41 The Unexpected Combination of Better AML Checks and Happier Clients<br />
Richard McCall, Armalytix<br />
41 Reviewing Our Core Values<br />
Amanda Illing, Gatehouse Chambers<br />
43 The Three Principles for Creating a Great Work Culture<br />
Tim Champney, Future Climate Info<br />
43 Client Experience is Central to Recruitment<br />
Andrew Mckie, Mckie Recruitment<br />
45 Technology At Its Best<br />
Martin Cheek, Smartsearch<br />
45 If You're Not Adding Value, You're A Cost<br />
Laura Fisher, Gunnercooke<br />
46 Supercharging Customer Service<br />
Bernadette Bennett, Moneypenny<br />
10 MINS WITH 47 Helen Burness<br />
Director at Saltmarsh Marketing<br />
ROUNDTABLE<br />
FEATURE<br />
KEY CONTRIBUTOR<br />
CUSTOMER<br />
CELEBRATION<br />
48 Price Bailey Roundtable<br />
Will Cotton, Modern Law<br />
54 Consumer Behaviour is Changing<br />
Bill Guthrie, Director at Glenesk, gives a detailed insight into the<br />
opportunities for law firms surrounding online reviews.<br />
56 The Power of Online Reviews<br />
An Infographic by Trustpilot<br />
58 Demystifying Transformation: The Experience of Being Legal<br />
David Clarke, Chief Commercial Experience Officer at UnitedLex, makes the<br />
case for ‘legal experience transformation’.<br />
60 Customer Reviews Pilot – Wins for Firms and Consumers<br />
Jane Malcolm, SRA<br />
61 Customer Celebration<br />
Modern Law wish to turn your attention to some of the outstanding work<br />
that companies are undertaking in and around the sector right now. By<br />
creating the opportunity for those involved to discuss the incredible work<br />
they’re doing and the outstanding customer service they’re renowned for, we<br />
aim to create a section that celebrates the customer.<br />
TECHNOLOGY 79 Happy Customer = Jolly Lawyer<br />
Chrissie Lightfoot, Entrepreneur Lawyer<br />
䰀 愀 眀 䴀 攀 爀 最 攀 爀 猀 ☀ 䄀 挀 焀 甀 椀 猀 椀 琀 椀 漀 渀 猀<br />
䈀 甀 猀 椀 渀 攀 猀 猀 䘀 愀 挀 椀 氀 椀 琀 愀 琀 漀 爀 猀 琀 漀 琀 栀 攀 䰀 攀 最 愀 氀 倀 爀 漀 昀 攀 猀 猀 椀 漀 渀 猀 眀 椀 琀 栀 圀 漀 爀 氀 搀 圀 椀 搀 攀 䌀 氀 椀 攀 渀 琀 䈀 愀 猀 攀<br />
A mission to change the way law firms<br />
operate, everywhere and forever.<br />
gunnercooke is an award-winning full service law firm founded in 2010, to<br />
challenge, improve and evolve the way that lawyers work.<br />
5<br />
The gunnercooke model offers experienced lawyers the freedom and flexibility<br />
to build their own practice, in the way they choose. Each lawyer sets their own<br />
targets and decides which clients to work for. Their earning potential is unlimited.<br />
Our role is to deliver a world-class support service, making it as easy as possible<br />
to maximise the opportunity that the model provides.
INSIGHT<br />
Service Can Be a<br />
Key Differentiator<br />
Whatever sector a business operates in, providing a<br />
high standard of customer service is clearly an essential<br />
requirement. Service excellence drives higher customer<br />
satisfaction, loyalty, repeat business and advocacy to<br />
others. In fact, our research at The Institute of Customer<br />
Service repeatedly shows that those organisations that<br />
achieve high levels of service, also enjoy higher levels of<br />
profitability – what we call the customer service dividend.<br />
Customer service has always been important, but during the<br />
pandemic we have all seen the critical difference that a brilliant<br />
service experience can make. In times of uncertainty and stress,<br />
customers will gravitate even more towards those organisations<br />
they feel they can trust and rely on.<br />
Customer Satisfaction Index trends<br />
At The Institute, we have been tracking customer sentiment<br />
and satisfaction through our UK Customer Satisfaction Index<br />
(UKCSI) twice a year since 2008. Over the years we have gathered<br />
data on over 500,000 customer responses covering 13 sectors<br />
across 26 different service-related metrics. We have built up a<br />
truly comprehensive view of customer experience and identified<br />
the key factors behind service excellence. The Index measures<br />
functional and emotional dimensions and is based on customer<br />
and consumer priorities.<br />
Before I turn to the legal sector specifically, what are the highlevel<br />
trends?<br />
In general terms, we have seen a decline in overall customer<br />
satisfaction levels over the last 4-5 years, most likely because,<br />
in the digital ‘always-on’ age, customer expectations have risen<br />
whilst some organisations have under-invested in service. But<br />
more encouragingly, this trend has just begun to stabilise. From<br />
July 2017, when satisfaction stood at 78.2 points (out of 100), it<br />
declined in almost every six-month period for the next four years,<br />
reaching a low of 76.8 in January of this year. But our most recent<br />
Index for July 2021 reported an increase to 77.4.<br />
“We have seen a decline in<br />
overall customer satisfaction<br />
levels over the last 4-5 years”<br />
Whether this becomes a sustained improvement remains to be<br />
seen, but customers reported some positive improvements during<br />
Covid-19 including better scheduling of appointments, better<br />
support to improve wellbeing and more proactive communications.<br />
Over a quarter of customers said they had experienced a change<br />
in customer service during Covid-19, with 55% of those saying the<br />
change was positive and 24% saying it was negative.<br />
However, 14.9% of customers said they had experienced a<br />
problem in the last six months which was the highest level since<br />
2009, even if there were signs that complaint handling had<br />
improved. A quarter of customers also felt that organisations<br />
have sometimes used Covid-19 as an excuse for poor service.<br />
The ‘because of Covid’ refrain has become something that many<br />
customers are well and truly fed up with!<br />
Another key finding was that, for the first time in the UKCSI’s<br />
history, over 50% of reported customer experiences were digital<br />
– underlining the extent to which online and app-based channels<br />
have accelerated through the pandemic.<br />
Legal sector (Services) – could do better<br />
So where does this leave the legal sector? Legal falls within our<br />
‘Services’ classification, within which we ask consumers about their<br />
experience with ‘your local solicitor’. In short, there is certainly room<br />
for improvement. Services tends to perform towards the lower end<br />
of the 13 sectors that we benchmark. In the most recent UKCSI,<br />
Services scored 76.6 points (‘your local solicitor’ was lower on<br />
average at 74.7), putting it just ninth out of 13. It was also one of<br />
the only sectors to record a fall in its score compared to a year ago<br />
(in July 2020, the score for Services was 77.1).<br />
Gathering customer feedback<br />
When I think about legal specifically, one of the key factors that<br />
distinguishes it from other sectors is that customer interactions<br />
(on the consumer side) are relatively infrequent. Whereas a<br />
retailer or bank, for example, may have regular dealings with<br />
6
INSIGHT<br />
“For the first time in the UKCSI’s<br />
history, over 50% of reported<br />
customer experiences were digital”<br />
customers enabling them to gather data,<br />
monitor changes and analyse trends, the<br />
very intermittent nature of the customer<br />
relationship in legal makes this much<br />
harder to do. If a customer never comes<br />
back to you, will you notice? If they don’t,<br />
will you know why? It may be because<br />
they’ve moved away or had a significant<br />
life change – but it may be because the<br />
service they received disappointed them.<br />
The greater difficulty of pinpointing<br />
this only makes it even more important,<br />
I would argue, that every law firm has<br />
a rigorous system to ensure customer<br />
feedback is obtained after every piece of<br />
work performed. The rarer the interaction,<br />
the more essential this is.<br />
Obtaining this feedback will then become<br />
a key feature in enabling you to map the<br />
customer journey from beginning to end<br />
through a process, highlighting any pinch<br />
points or frustrations along the way.<br />
Key trends for law firms<br />
There are a number of emerging trends<br />
in our UKCSI that I believe are directly<br />
relevant to law firms. First, as I have<br />
already touched upon, we have the<br />
growth of digital. The ability to interact<br />
digitally is increasingly becoming a hygiene<br />
factor expectation amongst consumers,<br />
regardless of what type of business they<br />
are dealing with. So, ask yourself whether<br />
your firm has sufficiently developed digital<br />
channels. Can customers communicate<br />
with you in convenient ways? Are there<br />
any non-digitised processes that frustrate<br />
customers? Is your website clear and easy<br />
to navigate?<br />
Another significant trend is the increase in<br />
customers who are prepared to pay more<br />
for excellent service. This now stands at<br />
31.6%, up from 25.9% in January 2020. At<br />
the same time, the proportion of customers<br />
who say they look for a low cost-no frills<br />
service, has fallen, from 14.2% to 12.2%. This<br />
could present a significant opportunity in<br />
the legal sector. The most common reason<br />
given for being prepared to pay more for<br />
excellent service is that the customer wants<br />
to be able to trust the company they’re<br />
using. Surely, nowhere is this trust more<br />
important than in legal when customers are<br />
placing their confidence in legal experts to<br />
help them do something that really matters<br />
to them – whether that’s buying/selling a<br />
house, drawing up a Will, resolving a family<br />
matter, etc.<br />
The importance of trust is another theme<br />
that has been emerging more broadly<br />
through the UKCSI in recent years. We<br />
analyse the results across five dimensions:<br />
Experience, Complaint Handling,<br />
Customer Ethos, Emotional Connection,<br />
and Ethics. The last three of these are<br />
especially bound up in issues of trust.<br />
We find that a growing proportion of<br />
customers really care about whether the<br />
organisations they deal with care about<br />
them and put customers first (Customer<br />
Ethos), are committed to building<br />
long-term relationships that enhance<br />
the customer experience (Emotional<br />
Connection) and are committed to<br />
‘doing the right thing’ across issues<br />
such as sustainability, the environment,<br />
community engagement, and the<br />
treatment of staff, suppliers and other<br />
stakeholders (Ethics).<br />
Opportunity knocking<br />
I believe there is a real opportunity for those<br />
law firms that put such issues at the heart<br />
of how they do business. Those firms that<br />
have clear and strong values and purpose,<br />
communicate them effectively to customers,<br />
and put them into action backed up by a<br />
dedication to the customer experience, will<br />
be the winners of the future.<br />
In an age where customers can<br />
increasingly self-serve through the web<br />
for cheap standardised services in areas<br />
such as Wills or conveyancing, creating a<br />
compelling customer service experience<br />
is in fact becoming more essential than<br />
ever. Knowledge is no longer power –<br />
because knowledge is everywhere. The<br />
law firms that differentiate through truly<br />
outstanding customer service will be the<br />
firms most resilient in the face of change.<br />
“The customer wants to be able to trust<br />
the company they’re using. Surely,<br />
nowhere is this trust more important<br />
than in legal…”<br />
Jo Causon<br />
is CEO at The Institute of Customer<br />
Service<br />
7
INTERVIEWS<br />
Building a<br />
business back up<br />
is about listening,<br />
learning and then<br />
knowing more<br />
than the next<br />
person”the door”<br />
Enter the Dragon<br />
Joining Modern Law for our lead interview is the ever-impressive Theo Paphitis.<br />
Having dominated the retail sector for the past three decades, no one is better<br />
placed to lend their insight on the importance of the customer. Read on to find<br />
out more from the Dragon who’s built a fierce reputation for great customer<br />
service, especially in a world where customer habits are constantly changing.<br />
9
INTERVIEWS<br />
To what extent does employee wellbeing lead to<br />
better service and customer experience, and in your<br />
own experience, does it ultimately have a positive<br />
impact on the bottom line?<br />
The pandemic has put the importance of mental health more in the<br />
spotlight than ever, and I truly believe happy colleagues equals happy<br />
customers. If you look after your colleagues first then they will always<br />
look after your business and your customers.<br />
Going into lockdown last March was ‘the unknown’ for everyone<br />
and we had to shut our 300 shops quickly, and without knowing<br />
when they would reopen. Everyone sprang into action and<br />
knew that we had to work very differently during that time, for<br />
however long it lasted. I was so impressed with my colleagues<br />
throughout the pandemic.<br />
I had daily calls with my exec team, featuring key leaders in the<br />
business, to ensure we were working as a team and focusing<br />
on every new twist in the pandemic tale. This was essential to<br />
address business needs, and importantly to support all of our<br />
colleagues, ensuring we communicated with them regularly.<br />
The team is all important in this situation, and the people you<br />
surround yourself with, and how they are, matters. They matter to<br />
your business, to your brand, to your customers and ultimately to<br />
you and your mental health too. It’s all connected.<br />
We have Mental Health First Aiders in our business, who are there<br />
for our colleagues whenever they need them, and have been helping<br />
colleagues throughout the business since being introduced. We also<br />
work with the Retail Trust who help our retail colleagues on every<br />
level from financial assistance, through to mental health challenges,<br />
bereavement and general advice. It’s an all-important area to focus<br />
on as it is connected to the wellbeing of everything - your people<br />
and your business.<br />
Often the reason people fail anything is because they haven’t<br />
done their homework. You wouldn’t sit an exam without doing<br />
any preparation and running a business is no different. I would do<br />
my homework before buying any business, as without that you<br />
don’t know what you’re walking into. I don’t want surprises and I<br />
want to avoid the banana skins.<br />
Building a business back up is about listening, learning and then<br />
knowing more than the next person. The only way to perform<br />
better is through knowledge. It’s often going back to basics in<br />
some instances. Understanding your reason to exist and building<br />
on that is key; whether a product, your price point, your service<br />
proposition or your IT capability. Once you are confident in that,<br />
the world’s your oyster and you just need to build on it.<br />
In total, it is estimated that you serve around 28 million<br />
customers a year. With a client base that vast, coupled<br />
with the fact it is such a diverse retail portfolio, how do<br />
you look to deliver a valued service to all your customers?<br />
The people you surround yourself with in business matter. They<br />
matter to your business, to your brand, to your customers and<br />
ultimately to you and your mental health.<br />
A fantastic person, with a great skill set and a can-do attitude can<br />
be a game changer for your business, and it’s important to develop,<br />
support and hold on to these people, especially as you grow into<br />
an even bigger company. I surround myself with people who are<br />
You once said, “Great customer service does not come by<br />
chance. It is the result of training and ensuring there are<br />
enough assistants to serve the customers.” Has Covid<br />
changed shopping habits in relation to needing that instore<br />
assistance you stress is so important?<br />
Everything had to be different during the pandemic, and<br />
our Learning and Development team created a brilliant new<br />
eLearning platform that could reach all of our colleagues at<br />
whatever time they wanted to do their training, whether in store<br />
or behind the scenes. A digital learning revolution kicked in, so<br />
we could continue the good work.<br />
The face-to-face element of retail will always play a part in the<br />
success of the sector, and our store colleagues were so keen to get<br />
back out there and serve their customers. Training had to adapt<br />
like everything else. It was undoubtedly harder to coordinate, but<br />
the teams made it work and are once again adapting the training<br />
model as we edge back to normality.<br />
It’s no secret that you have acquired companies that<br />
are on the brink of collapse such as Ryman, and<br />
completely transformed them into highly successful<br />
and profitable businesses. Given that you didn’t rip up<br />
the manual of what the companies sold or did – what<br />
did you change that got the customers flooding back?<br />
“We mustn’t lose sight of the important part that<br />
the high street plays in our communities”<br />
10
INTERVIEWS<br />
experts in their field to ensure that as each<br />
area needs to develop and thrive, you’re in<br />
safe hands. You don’t need ‘yes men and<br />
women’, you need people who have the<br />
skills that you don’t to help you grow. It<br />
is through expertise, passion for what you<br />
do and understanding your customers and<br />
their needs that you will still stay sharp and<br />
focussed despite no longer being one man<br />
and a dog without the added distractions.<br />
You have spoken regularly about<br />
the impact that Covid will have on<br />
the high street and how the move<br />
to online for many businesses has<br />
been sped up. How can you keep<br />
your finger on the pulse of the<br />
ever-changing consumer demand<br />
landscape, especially now in the<br />
digital arena?<br />
The pandemic has undoubtedly<br />
accelerated the shift to online retail by<br />
a good five years in a very short space<br />
of time. It highlighted the importance<br />
of having been ahead of the game too,<br />
especially for those who found their<br />
physical retail stores closed overnight.<br />
“The online retail genie is well and<br />
truly out of the bottle now”<br />
Those who hadn’t invested ahead of the<br />
pandemic, were playing catch up and this<br />
was a dangerous place to be.<br />
The online retail genie is well and truly<br />
out of the bottle now, and people<br />
will stick with online where they have<br />
adopted it, but we mustn’t lose sight of<br />
the important part that the high street<br />
plays in our communities.<br />
The high street is varied, and has lots of<br />
moving parts, so predicting its future is<br />
not just a binary black and white answer.<br />
However, to help physical retail thrive<br />
once more, and find its place alongside<br />
digital retail, the Government must<br />
address the ancient business rates tax,<br />
ensuring fairness between the taxation of<br />
digital and physical retail.<br />
Theo runs #SBS Small Business<br />
Sunday - helping small<br />
businesses to think big. Entries<br />
to the ongoing competition are<br />
every Sunday on Twitter via @<br />
theopaphitis with networking,<br />
events and growth opportunities<br />
for all. For more information:<br />
www.theopaphitissbs.com<br />
LOGO<br />
Theo Paphitis<br />
is the Chairman at Theo Paphitis Retail<br />
Group, Dragon from BBC’s Dragons’ Den<br />
11
INTERVIEWS<br />
The Experience Economy<br />
B. Joseph Pine II is an internationally acclaimed author, speaker, and management advisor to<br />
Fortune 500 companies and entrepreneurial start-ups alike. He is Co-Founder of Strategic Horizons<br />
LLP and in 2020 re-released ‘The Experience Economy: Competing for Customer Time, Attention,<br />
and Money’, featuring an all-new Preview to their best-selling 1999 book ‘The Experience Economy:<br />
Work Is Theatre & Every Business a Stage.’ Modern Law sat down with Joe to discover more about<br />
his work and how it can help transform the experiences that law firms offer.<br />
12
INTERVIEWS<br />
Translated into thirteen<br />
languages, ‘Experience Economy’<br />
has become a must-read for<br />
leaders of enterprises large and<br />
small, global and local and sits in<br />
the top 100 best business books<br />
of all time. Can you give us a short<br />
synopsis of your career Joe?<br />
Of course! I’m a nerd from way back,<br />
and started at IBM in technical and<br />
then managerial & strategy positions.<br />
When IBM sent me to MIT for a year<br />
to get my Masters degree, I took the<br />
opportunity to turn my thesis into my<br />
first book, Mass Customisation. After<br />
that, I left IBM to found Strategic<br />
Horizons, a small consulting company<br />
now with three people, and quickly<br />
discovered the Experience Economy.<br />
Ever since I have been writing,<br />
speaking, teaching, and advising on<br />
how companies can create greater<br />
economic value through their offerings.<br />
Having popularised the concept,<br />
what is the ‘Experience Economy’<br />
and can it be applied to the legal<br />
sector both for service providers<br />
and law firms?<br />
The Experience Economy is the<br />
latest stage in a progression of how<br />
businesses create economic value. It<br />
began with the Agrarian Economy,<br />
based on commodities, which was<br />
supplanted by the Industrial Economy,<br />
based on goods, which in turn gave<br />
way to the Service Economy, and<br />
today experiences have become the<br />
predominant economic offering.<br />
Experiences are memorable events that<br />
engage each individual in an inherently<br />
personal way, creating a memory as<br />
the hallmark of the experience. They<br />
are distinct economic offerings - as<br />
distinct from services as services are<br />
from goods.<br />
If you stage experiences, then<br />
your work IS theatre – and no one<br />
understands that better than trial<br />
lawyers! Also, like most industries<br />
today the legal sector is facing<br />
commoditisation, as low-cost firms<br />
and especially technology create<br />
tremendous price pressure. To create<br />
differentiation, then, lawyers need to<br />
focus now just on what they do, but<br />
how they do it. That can turn mundane<br />
interactions into engaging encounters.<br />
Now with a brand-new preface,<br />
yourself and Gilmore make an even<br />
stronger case for experiences as<br />
the critical link between a company<br />
and its customers. In an increasingly<br />
distractible and time-starved world,<br />
why are money, attention and time<br />
now so interconnected?<br />
These are the currencies of the<br />
Experience Economy! Time is limited; we<br />
only have twenty-four hours a day, seven<br />
days a week in which to experience all<br />
that life has to offer – and we have to fit<br />
sleep in there some time. But if current<br />
or potential clients are spending time<br />
with some other company, they are not<br />
spending it with you. Likewise, in today’s<br />
media-fragmented world attention is<br />
increasingly scarce – and if some other<br />
company captures clients’ attention,<br />
they’re not giving it to you. And money<br />
is consumable; if clients spend their<br />
money elsewhere, they cannot spend<br />
that money with you.<br />
So, the only way to capture people’s<br />
time, attention, and money is with an<br />
experience so engaging that they spend<br />
their time with you, give you their<br />
attention, and buy your offerings.<br />
What do you mean in your work<br />
by ‘transformative experiences’<br />
and why do they hold the ultimate<br />
value to your business?<br />
Ah, this is the concept crucial for the<br />
legal sector to understand! Beyond<br />
even experiences lies one more distinct<br />
economic offering: transformations – the<br />
fifth and final level of economic value<br />
where customers seek change; they<br />
want companies to help them achieve<br />
their aspirations. It might be to go from<br />
flabby to fit with fitness centres, from<br />
sick to well with hospitals, from smoker<br />
to non-smoker with cessation programs,<br />
from mediocre golfer to single-digit<br />
handicapper through coaching -- among<br />
a host of examples that could be cited,<br />
for we all have aspirations we desire to<br />
come to fruition that are as individual as<br />
we are.<br />
“To create differentiation, then, lawyers need to<br />
focus now just on what they do, but how they do it”<br />
This is especially important for people who<br />
sell to other businesses (including in-house<br />
legal activity), for no business buys your<br />
offering because they want your offering;<br />
it is but a means to an end. If you sell the<br />
end, rather than the means, then you will<br />
create greater economic value.<br />
And perhaps – if you forgive – no sector<br />
is less desired than legal (unless it be<br />
accounting). All lawyers need to view<br />
themselves as in the transformation<br />
business, understand the aspirational jobs<br />
of individual clients – aspirants would be<br />
a better term here – and guide them in<br />
achieving those aspirations.<br />
Please discuss what you mean by<br />
the term ‘customer sacrifice’ and<br />
how can one look to eliminate it?<br />
Let me contrast it with something we<br />
all know – customer satisfaction, which<br />
measures how well a company meets (or<br />
not) our expectations. But expectations<br />
often have nothing to do with what we<br />
really and truly want and need. So, we<br />
need to measure customer sacrifice – the<br />
difference between what some individual<br />
wants exactly and what they have to<br />
settle for today.<br />
Once we discover dimensions along<br />
with people sacrifice by putting up with<br />
standard offerings, then we can design<br />
offerings that we can mass customise<br />
to each individual customer, primarily<br />
through modularity, like LEGO building<br />
bricks or, even more robustly, with the<br />
zeroes and ones of digital technology.<br />
How can savvy law firms excel by<br />
offering compelling experiences<br />
for their customers, resulting<br />
not only in increased customer<br />
allegiance but also in a more<br />
profitable bottom line?<br />
I suggest starting with the<br />
transformation level, actually, and<br />
then figure out the set of experiences<br />
required to guide clients in achieving<br />
their aspirations. The first such<br />
experience is diagnosis – determining<br />
the client’s aspirations and where they<br />
are today relative to them. Then you<br />
design the set of experiences that take<br />
them to that higher level – which in<br />
turn are built atop the legal service<br />
activities you do for them. The last stage<br />
is follow-through. Not “follow up” – just<br />
checking in – but ensuring that the<br />
transformations take hold over time<br />
(and, yes, that may just mean a retainer<br />
relationship of some sort….).<br />
13
INTERVIEWS<br />
As for designing the experiences<br />
themselves, in our 2020 re-release of<br />
The Experience Economy: Competing for<br />
Customer Time, Attention, and Money<br />
we introduced five core elements of<br />
experience staging, the last of which<br />
is transformative. So in addition to<br />
that, you need to create and stage<br />
experiences that are robust – that hit<br />
the sweet spot between entertainment,<br />
educational, escapist, and esthetic<br />
experiences {note: not “aesthetic”; we<br />
call it our 4E model!]; cohesive – that<br />
are organised around an underlying<br />
principle, called the theme; personal<br />
– that reach inside of people and<br />
engage them, ideally using the mass<br />
customisation principles I mentioned<br />
earlier; and dramatic – that not only<br />
employ acting as a model but have a<br />
dramatic structure to them that rises to a<br />
climax and comes back down again.<br />
If you do all that, you cannot help<br />
but design engaging, remarkable, and<br />
memorable experiences for your clients.<br />
“All lawyers need to view themselves<br />
as in the transformation business”<br />
In your opinion, should law firms<br />
be looking to appoint a Chief<br />
Experience Officer (CXO)?<br />
Absolutely! A Chief Experience Officer is<br />
a great way of focusing your company on<br />
the experiences it needs to design and<br />
create for its customers. The only one I<br />
know of in the greater legal sector is David<br />
Clarke, who first attained the position<br />
at consultancy PwC but is now CXO of<br />
UnitedLex, which provides an enterprise<br />
legal platform for legal functions.<br />
I’ve written that CXOs should focus on<br />
four key roles facing both internally<br />
and externally: catalyst, orchestrator,<br />
designer, and champion. And one more:<br />
guide. For me, CXOs need to lead the<br />
internal transformation from delivering<br />
services to staging experiences and<br />
guiding transformations.<br />
14
INTERVIEWS<br />
“If you stage experiences, then your work IS<br />
theatre – and no one understands that<br />
better than trial lawyers!”<br />
“Experiences offer<br />
time well spent –<br />
clients value the time<br />
they spend with you”<br />
Let’s say hypothetically you make<br />
all these changes you suggest to<br />
your law firm. How do you then<br />
determine the ROI of experience<br />
improvements?<br />
Measuring experiences and<br />
transformations is still more an art<br />
form than a science, but the effects of<br />
it in client acquisition and retention<br />
as well as greater revenue and profits<br />
should be easy to see – if, that is, one<br />
follows the prescriptions we’ve been<br />
talking about.<br />
And one clear way to see the ROI is to<br />
charge explicitly for experiences and<br />
transformations. Services are about<br />
time well saved – doing the functional<br />
activities better than I could do, saving<br />
clients the time it would take them<br />
(including going to school and passing<br />
the bar!), time they could better<br />
spend elsewhere. So one charges for<br />
those activities via hours spent on<br />
such activities.<br />
Experiences offer time well spent<br />
– clients value the time they spend<br />
with you, whether because they learn<br />
more (often about themselves and<br />
their business), gain confidence in<br />
the potential outcomes, find value in<br />
improving their own processes, and so<br />
forth. So experience stagers charge for<br />
time customers spend with them via<br />
admission fees, membership fees, or<br />
other ways. Note this is not charging for<br />
time and materials – that’s the lawyers’<br />
time and materials, not customer time!<br />
And transformations generate time well<br />
invested, in that they gain outcomes<br />
that provide compound interest and<br />
yield dividends now and into the future.<br />
Transformation companies should<br />
therefore charge for the demonstrated<br />
outcomes that customers achieve!<br />
That makes the company’s (or legal<br />
function’s) income dependent on the<br />
client’s outcome. I’ve long said that<br />
any company that helps its customers<br />
become – to use Ben Franklin’s famous<br />
phrase – healthy, wealthy, and wise will<br />
eventually move to outcomes-based<br />
compensation.<br />
One doesn’t have to charge solely for<br />
experiences and transformations; a<br />
portion, perhaps the majority, of revenue<br />
could be via service activities, with<br />
specific experiences charging for time<br />
and with a significant slice via outcomes.<br />
Before we finish, it’s important<br />
to underline that when you speak<br />
of experiences, you don’t mean<br />
‘customer experience’ do you?<br />
Even though the CX movement<br />
came about because of the shift into<br />
today’s Experience Economy, so-called<br />
“customer experience” is not the same<br />
thing as what I am talking about. CX<br />
involves making our interactions with<br />
customers nice, easy, and convenient<br />
– but these are service characteristics,<br />
not elements of experiences. Nice is<br />
nice, but rarely does it rise to the level<br />
of memorability. Easy often means we<br />
routinise things to make it easy for our<br />
employees to service customers, but<br />
that gets in the way of making the<br />
encounter memorable. And convenience<br />
is the antithesis of experience staging,<br />
providing only time well saved, not time<br />
well spent. Experiences, which again<br />
are a distinct economic offering, cannot<br />
be frictionless; they require friction to<br />
create that dramatic structure necessary<br />
for engagement.<br />
Joe Pine<br />
is an Author and Cofounder at Strategic<br />
Horizons LLP<br />
15
INTERVIEWS<br />
“It’s a<br />
consistency<br />
game”<br />
It’s Simple but It’s Not Easy<br />
Andrew McMillan is one of the leading experts in the UK for customer experience. Having began his<br />
career on the shopfloor of John Lewis, Andrew worked his way up through the company over two<br />
decades, ultimately being responsible for customer service and quality of selling across the John Lewis<br />
Department Store Division. Since leaving this pivotal role in 2008, Andrew has successfully gone on to<br />
run his own Management Consulting firm, ‘Engaging Service’, and is now recognised as a leading figure<br />
in the world of the customer. Modern Law sat down with him to find out what he identifies as the four<br />
key elements to customer service and how law firms can better apply them to effectively drive-up profits.<br />
17
INTERVIEWS<br />
What do you identify as the<br />
four key elements of the customer<br />
experience?<br />
If you’re going to develop customer<br />
experience, then you must firstly<br />
understand what an enormous task this<br />
will be and you need to break it down<br />
into four distinct elements.<br />
The first element is the product or service<br />
that you sell. Is the service or product that<br />
you sell fit for purpose? Does it meet the<br />
requirements of your target customers? Is<br />
it good value? And is it appealing? If it’s<br />
not, you might as well pack up there and<br />
not bother. My experience in professional<br />
services (particularly law), is that firms are<br />
very service centric and tend to forget about<br />
the other elements I am about to discuss.<br />
Though having a great service is obviously<br />
key, having it alone is very dangerous.<br />
The second element is the processes by<br />
which you deliver that service or product.<br />
Can you do what you say you’re going<br />
to do? At the time you said you’re going<br />
to do it? And, how you said you’d do<br />
it? If you can keep those promises, then<br />
that builds real and authentic trust. If<br />
you have the most amazing service in<br />
the world or the best legal brains in the<br />
universe, but you can’t actually meet<br />
customers on time for appointments,<br />
you’re going to decay that trust very<br />
quickly and lose business. Process is<br />
really important and it can be as simple<br />
as keeping a diary accurately or it can<br />
be as complex as supply chain processes<br />
in retail. Amazon are a great example<br />
of process expertise and though I don’t<br />
necessarily like everything they do, their<br />
process is absolutely admirable.<br />
The third element is drawn out of process<br />
and is what I refer to as channel. Are you<br />
able to communicate on the channels<br />
that your customers want - not just what<br />
you want? And, are you using channels<br />
appropriately? Channel has become so<br />
important with the dot.com revolution<br />
and even more so now with the pandemic.<br />
People are having to explore new channels<br />
such as Teams and Zoom or branch out<br />
into social media with platforms like Twitter<br />
to reach their customers.<br />
Finally, the fourth element is<br />
engagement. This is very much the people<br />
side of things. What did it feel like? The<br />
example I always give is that they may<br />
have the most fantastic legal brain out<br />
there and their process is fantastic, but if<br />
they’re the most miserable, awful person<br />
you’d ever want to deal with - totally<br />
non-empathetic, harsh and cold towards<br />
their clients - you’re probably not going<br />
to use them again!<br />
PRODUCT<br />
In summary, it’s not about one of those<br />
things being dominant, it’s a matter of<br />
having them all in balance. In fact, to a<br />
certain degree, it’s that balance that will<br />
determine the personality of your firm.<br />
Why do you believe that efforts to<br />
stand out by defining values and<br />
purpose, commonly fail through<br />
lack of management commitment?<br />
Someone once wrote “Being a loved<br />
brand isn’t rocket science, you just<br />
have to be lovely. It’s simple but it’s not<br />
easy.” Why wouldn’t you have all of your<br />
employees being absolutely lovely and<br />
looking after your clients to the best of<br />
their ability? It sounds so simplistic and<br />
just a derivative of common sense, but<br />
actually it’s really difficult. The difficulty<br />
is the consistency. You might have a<br />
wonderful group of people who do<br />
their best for the firm, but can you get<br />
everybody working to that high standard<br />
every day, every week, every year? The<br />
answer is no, but the closer you can get<br />
to 100% consistency, the better your<br />
reputation will be.<br />
If I were selling a software to a law firm,<br />
and I could say, well, ‘if you install this,<br />
you’ll recoup the cost within a year and<br />
within three you’ll be more profitable and<br />
efficient’ – that’s an easy sell. Whereas,<br />
if I say ‘we want all your people to be<br />
really happy, engaging, empathetic and<br />
supportive to your clients so that you<br />
stand out in the market’ - that’s going to<br />
“…they need to feel ‘welcome, wanted,<br />
remembered and cared for’”<br />
take about three or four years to achieve<br />
that level of consistency.<br />
Consequently, in that time people just<br />
simply lose faith or lose heart because<br />
they won’t commit to that length of time<br />
to do it properly. To achieve this level of<br />
consistency, it’s a long-term commitment<br />
to grinding away.<br />
Why do you believe law firm<br />
leaders should spend up to half<br />
their time on tasks such as looking<br />
after the interests of staff and<br />
checking clients are properly<br />
welcomed at the firm – especially<br />
when many in this position would<br />
argue this is an unrealistic use of<br />
their time?<br />
I used to say it was an 80/20 rule.<br />
20% of your week should be spent on<br />
developing your people and coaching<br />
them – something which is just mind<br />
blowing for a lot of people. I’m not saying<br />
that no one does this well. I once worked<br />
with a law firm in the home counties and<br />
their lead partner is a fantastic guy who<br />
is really people-focused. You can see the<br />
team absolutely love him and they’re<br />
always smiling and genuinely happy to<br />
see him when he walks into the office.<br />
My role is not to teach them how to do<br />
this from the ground up, instead I’m<br />
actually giving them a framework for<br />
future development and expansion - so it<br />
doesn’t dilute as they grow.<br />
There are people who are just naturally<br />
people-focused who will find the time.<br />
The hard thing is - going back to the<br />
elements of customer experience – there<br />
are lots of leaders who simply don’t feel<br />
they have the time, so it’s really important<br />
to work with them to create time in their<br />
diary for that 20%.<br />
PROCESS<br />
If they’re not naturally wanting to do that<br />
as an individual, what will happen is very<br />
quickly that 20% gap that you’ve created<br />
will get filled up with more meetings and<br />
spreadsheets because naturally that’s<br />
where their skills lie. It’s a fairly common<br />
18
INTERVIEWS<br />
situation not just in legal but professional<br />
services generally. People in those roles<br />
usually have a very high degree of<br />
intellect but that often doesn’t carry<br />
itself with being empathetic and peoplefocused<br />
on using softer skills.<br />
“I used to say it was an 80/20 rule”<br />
So that’s the challenge. It can lead to<br />
some hard decisions if you want to<br />
transform your business because you start<br />
saying, well, do we need this person’s<br />
legal brain enough to keep them -<br />
knowing that they are not ideally suited<br />
to the way this firm is moving? It can lead<br />
to some really difficult decisions, really<br />
difficult. I don’t take any pleasure in that,<br />
but it’s a consistency game. If you’ve got<br />
somebody in the senior leadership role<br />
who just won’t play the game, they’ve got<br />
to change or go.<br />
CHANNEL<br />
While staff development can<br />
improve service by setting<br />
standards and teaching a tangible<br />
process, such as query handling,<br />
it cannot fundamentally change<br />
an organisation’s culture or the<br />
attitude of its employees towards<br />
customers and service. Please<br />
discuss why training is not the<br />
answer to consistency?<br />
I don’t like the word culture because it’s<br />
very ambiguous so I tend to talk about<br />
behaviour and attitude. You can articulate<br />
behaviour and attitude and to a certain<br />
degree, you can measure it. Sometimes<br />
I get new clients who say they want to<br />
change their culture and if I’m feeling<br />
cheeky, I’ll say “from what, to what?” and<br />
watch them fidget as they try and describe<br />
it because they can’t! You need to be more<br />
defined than that, which is why you need<br />
to start to articulate the behaviours that<br />
you want people to be guided by.<br />
If the training is to say, “you will say<br />
good morning and smile as the client<br />
walks in through the front door, you will<br />
offer them a seat, tell them how long<br />
that appointment is going to be, and<br />
offer them a cup of coffee or tea”. In<br />
my opinion, not only are you assuming<br />
that’s what the clients wants, but you’re<br />
also taking the initiative away from the<br />
receptionist and insinuating that he<br />
or she is a bit stupid and needs strict<br />
instructions. It also assumes that they’ll<br />
do it, which of course they may not!<br />
There’s nothing wrong with training in<br />
terms of setting a standard framework<br />
- but it doesn’t mean they’ll do it if<br />
they’re not engaged employees. The<br />
trick with it is that they need to feel<br />
‘welcome, wanted, remembered and<br />
cared for’ themselves. If the receptionist<br />
is working in a law firm where he or she<br />
feels that, and the leadership have got<br />
those softer skills, it is highly probable<br />
that they in turn, will make the client<br />
feel welcome, wanted, remembered and<br />
cared for.<br />
You can then start to manage that<br />
proactively. Whereas saying we want a<br />
softer, gentler, more friendly culture, what<br />
does that mean?! The ambiguity it brings<br />
when you try and performance manage it<br />
is huge because you just can’t measure it.<br />
How do you believe law firms can use<br />
customer experience to drive profit?<br />
In general, I don’t believe law firms have<br />
orientated themselves around the element<br />
of engagement as much as they could do.<br />
In its current state, the legal is market is<br />
oversupplied, so engagement is a very easy<br />
way to differentiate yourselves.<br />
Every law firm website that I look at has<br />
the same format - endless black and white<br />
photographs of all the partners, followed<br />
by a short claim to have the best legal<br />
brains in the area.<br />
ENGAGEMENT<br />
So, where’s my point of difference? On<br />
what basis am I making my choice? If you<br />
can actually say ‘here’s some feedback<br />
that our clients have given us in the last<br />
six months’, that starts to sound much<br />
more exciting. A good law firm can also<br />
employ a Head of client experience whom<br />
will bring that mindset to the firm.<br />
I think the challenge is that this softer<br />
stuff isn’t as tangible as putting a new<br />
CRM system in. So, where the new CRM<br />
system can be evaluated on a costbenefit<br />
basis over the next two years -<br />
this can’t be and is a leap of faith.<br />
However… if you do it properly, I promise<br />
you will get MORE repeat business,<br />
MORE word-of-mouth business and<br />
MORE happy customers.<br />
Andrew McMillan<br />
is Director at Engaging Services<br />
www.engagingservice.com<br />
19
IN-DEPTH<br />
The Human Touch -<br />
BUSINESS GROWTH<br />
THROUGH THE CX JOURNEY<br />
In order to grow and succeed, every business needs to<br />
acquire new customers and hold on to existing ones.<br />
Customer acquisition and retention is challenging enough,<br />
even without our world being turned up-side-down<br />
with the unprecedented arrival of a pandemic. Equally,<br />
finding exceptional employees and retaining them, can be<br />
challenging, not to mention costly.<br />
Customer Experience (CX) is the key differentiator and<br />
driver for business growth. According to Bain and Company,<br />
companies with a CX mindset drive revenue 4-8% higher than<br />
the rest of their industry. With benefits such as; customer<br />
acquisition and retention, increased sales, advocacy and also<br />
employee satisfaction and retention, it’s no wonder businesses<br />
all over the world are adapting to a more human focus through<br />
customer experience.<br />
What is CX?<br />
CX is how the customer (or client)<br />
feels during every interaction with your<br />
business. It is different to customer<br />
service which focuses on the functional<br />
aspect such as conveyancing the sale of a<br />
property or providing legal advice. Often<br />
with legal services we are working with<br />
highly emotional and sometimes sensitive<br />
aspects of people’s lives. This simply<br />
cannot be ignored if we’re looking to<br />
separate ourselves from our competitors.<br />
We need to constantly consider at every<br />
part of the customer’s journey, what it<br />
must be like to walk in their shoes. If we<br />
don’t stop and think in each individual<br />
situation how they must be feeling, it<br />
simply isn’t possible to give them the<br />
experience they need.<br />
Realistic perspective<br />
Many businesses feel that they already<br />
offer a good customer experience. This<br />
misconception has been highlighted in<br />
a study by Bain and Company in which<br />
80% of businesses interviewed felt they<br />
gave a superior customer experience,<br />
and just 8% of their customers agreed.<br />
This is not because businesses don’t<br />
work hard for their customers. This is<br />
because there are consistent knowledge<br />
gaps around what really matters to<br />
customers, so it’s difficult to give<br />
the right experience if we don’t fully<br />
understand what matters to them. It is<br />
also because there are common internal<br />
barriers that hinder the experiences<br />
delivered which are not identified and<br />
addressed, resulting in customers and<br />
employees silently slipping away.<br />
What matters to customers<br />
A robust study from KPMG Nunwood has<br />
established that there are six key drivers<br />
when it comes to customer experience:<br />
Personalisation – getting to know<br />
your client and their circumstances and<br />
making the experience specific to this. If<br />
the experience you give is the same for<br />
every client, it’s not possible to connect<br />
with them and it’s no different to what<br />
your competitors are doing.<br />
Integrity – being trustworthy is critical<br />
in any business relationship. We may feel<br />
that our expertise is enough to build trust<br />
upon, however it’s often very small things<br />
that can erode trust e.g., not doing what<br />
you say you’re going to do, delaying<br />
processes or not acting in your client’s<br />
best interest such as finding ways to<br />
save them time or money. Transparency<br />
around costs is also vital when it comes to<br />
fee sensitivity.<br />
20
IN-DEPTH<br />
“The mistake a lot of businesses make is being obsessed with getting<br />
positive feedback when it’s the negative feedback that will transform<br />
your business”<br />
Expectations – setting and managing<br />
expectations. Issues around expectation<br />
management are very common. Your client<br />
often has no idea how long things can<br />
take, the processes involved and the cost.<br />
We must always set realistic expectations<br />
at the early stages of the relationship. It’s<br />
particularly important to flag any potential<br />
issues/delays/additional costs that could<br />
arise. If they do happen, the client was<br />
prepared and their expectations were met.<br />
If they weren’t prepared, this can have<br />
a very negative impact on trust in the<br />
relationship.<br />
Time and Effort – making it easy to<br />
do business with your clients. Simple<br />
processes and helpful moments along the<br />
journey e.g., handy check-list reminders<br />
if they need to submit documentation,<br />
timeline updates etc., can really improve<br />
time and effort for clients.<br />
Empathy – the core of customer<br />
experience, empathy is about walking in<br />
your client’s shoes and showing clients<br />
that you understand their circumstances.<br />
Showing you care is a key driver for loyalty.<br />
Resolution – fixing problems brilliantly<br />
when they arise. Things go wrong from time<br />
to time, especially when relying on other<br />
stakeholders, but the problem is businesses<br />
often don’t show they care when they<br />
do. Demonstrating heroic resolution will<br />
dramatically improve customer loyalty and is<br />
a natural stimulant for advocacy.<br />
Not understanding and addressing the<br />
key drivers also impacts negatively on the<br />
employee. If perhaps a colleague didn’t<br />
set realistic expectations with the client,<br />
the employee who is undertaking the<br />
task can be under enormous pressure<br />
which has a negative knock-on effect<br />
on other clients they are working with.<br />
By setting and managing expectations<br />
along the customer journey, it improves<br />
the customer experience as clients know<br />
where they stand, and also improves the<br />
employee experience as it reduces the<br />
instances of pressure.<br />
The power of<br />
emotional connections<br />
It is through making emotional<br />
connections with your clients that your<br />
business will thrive. The legal sector is<br />
fact based, around a system or rules. The<br />
expertise is naturally the most important<br />
factor when it comes to providing legal<br />
services, however there are many legal<br />
firms who have a similar offering, so the<br />
choices are enormous for clients. It is<br />
through emotional connections that we<br />
make the choice more obvious for them.<br />
Humans are emotionally led and our brains<br />
rule emotion over logic. By taking the time<br />
to get to know our clients, how they need<br />
to work together, and continually building<br />
trust through expectation management,<br />
you will keep your clients loyal.<br />
Providing your service can be complex,<br />
particularly in regulated sectors such<br />
as legal and financial services where<br />
compliance is critical and they require<br />
so much attention to detail. It’s<br />
understandable that the emotional<br />
aspect often gets left out, but this is<br />
what’s going to grow your business and<br />
it must be a key area of focus. Employee<br />
education and training around customer<br />
experience or the human side of doing<br />
business together is extremely important.<br />
A study from Harvard Business Review<br />
called ‘The new science of customer<br />
emotions’ tells us that fully connected<br />
customers are 52% more valuable than<br />
those who are just highly satisfied. To bring<br />
this to life, we recently undertook the<br />
conveyancing services of a solicitor. She<br />
was very nice, did the job, but from time<br />
to time I felt that we had to chase her for<br />
updates causing minor delays along the<br />
way, but nothing too upsetting. She did<br />
the job well in the end and I would say we<br />
were very satisfied with her work.<br />
That all sounds very positive, however<br />
if someone asked me to recommend<br />
a solicitor for conveyancing services, I<br />
would not recommend her. She didn’t do<br />
anything wrong, but she didn’t connect<br />
with us and embed trust. Advocacy is<br />
incredibly effective when a customer<br />
connects with a brand and they will go out<br />
of their way to recommend you if you do.<br />
To me, the cost of customer acquisition is<br />
so high, it doesn’t make business sense to<br />
ignore the opportunity for advocacy.<br />
21
FREE<br />
Expert Training for Expert Practitioners<br />
from Frenkel Topping knowledge Hub<br />
The knowledge Hub – from Frenkel Topping Training academy<br />
delivers FREE virtual and face-to-face training to our professional<br />
clients - helping you stay up to speed and informed.<br />
Courses available from knowledge Hub.<br />
1 2 3<br />
4<br />
Avoiding<br />
Professional<br />
Negligence<br />
Application<br />
of Periodical<br />
Payment Orders<br />
Understanding<br />
Pension Loss<br />
Trusts for<br />
Minors<br />
Welfare<br />
Benefits<br />
5 6 7<br />
8<br />
Investing for<br />
Vulnerable<br />
Clients<br />
Personal<br />
Injury<br />
Trusts<br />
Loss of Earnings<br />
Self Employed<br />
Claimants<br />
One hour expert<br />
training modules<br />
All our training is<br />
APIL accredited<br />
Counts towards<br />
your CPD hours<br />
Achieve the right<br />
financial outcome<br />
for your clients<br />
With over 30 years’ experience of delivering financial expert reports and advice,<br />
find out how Frenkel Topping knowledge Hub could help you.<br />
contactus@frenkeltopping.co.uk or call 0161 886 8000<br />
knowledge Hub<br />
Frenkel topping training<br />
academy<br />
frenkel<br />
topping<br />
GROUP<br />
Let us worry about what’s<br />
beneath the surface<br />
• We save firms money<br />
• We agree a fixed monthly price<br />
• We employ qualified cashiers<br />
• We ensure compliance with the Solicitors Accounts Rules<br />
• Holiday, sickness and maternity cover are our problem, not yours<br />
• We work with any practice management system<br />
• We save firms valuable office space<br />
• We run firms’ payroll and complete VAT returns<br />
• We have won multiple industry awards<br />
• We provide accurate and timely Management Accounts<br />
and Management Information<br />
Alex Holt<br />
Director of Business Development<br />
E: Alex.Holt@thecashroom.co.uk<br />
T: 07817 420 466<br />
Gregor Angus<br />
Senior Business Development Manager<br />
E: Gregor.Angus@thecashroom.co.uk<br />
T: 07875 598 593<br />
@TheCashroomLtd<br />
www.thecashroom.co.uk
IN-DEPTH<br />
“With email communications, there’s a tendency to<br />
be to be very formal and get straight to business”<br />
Identify the internal barriers<br />
There are also common barriers that hinder<br />
the experiences delivered and again we<br />
see the critical link between customer<br />
experience and employee experience.<br />
One of those barriers for example, is being<br />
busy. As obvious as it may seem, it is most<br />
damaging when it comes to both the<br />
customer and employee experience. It’s<br />
almost impossible for employees nowadays<br />
to be really ‘present’ for customers with<br />
the volume of work they are managing.<br />
Time and time again when I’m training<br />
employees, they tell me that they are simply<br />
too busy to really focus on the customer<br />
and go beyond getting the task done.<br />
Often, they are overwhelmed. If they aren’t<br />
‘present’ for that client, how can they<br />
possibly learn about their circumstances and<br />
understand their needs and challenges?<br />
If we can’t do this, we miss out on<br />
opportunities to connect with them.<br />
The workload cannot change - yet<br />
we cannot improve the customer or<br />
employee experience if we don’t address<br />
this. The answer is to look at better, more<br />
efficient ways of working.<br />
Address customer pain points<br />
Unfortunately, customers tend not to<br />
complain. If they did, we could act on it and<br />
our businesses would be superb! According<br />
to Esteban Kolsky, only 1 in 26 unhappy<br />
customers will actually complain. With my<br />
example of selling our house, the times<br />
I felt we were chasing our solicitor was<br />
frustrating, but we didn’t feel there was any<br />
point in complaining as the job was done. If<br />
we don’t pick up these small client niggles<br />
along the journey, not only can we never<br />
improve, the next time they need legal<br />
services they’ll go elsewhere, and there are<br />
plenty of alternatives for them.<br />
It’s important to establish pain points.<br />
These pain points tend to be common<br />
and have an equally negative impact on<br />
your employees as well as your clients.<br />
I find that by talking to your employees<br />
they know the things that bother clients<br />
the most. They hear the grumbles or can<br />
simply ‘sense’ when clients are irritated<br />
and that’s where to start making changes.<br />
The mistake a lot of businesses make<br />
is being obsessed with getting positive<br />
feedback when it’s the negative feedback<br />
that will transform your business.<br />
Employee engagement<br />
The most powerful auxiliary you have is<br />
your employees. The service cannot be<br />
provided without them and the emotional<br />
connections with customers won’t occur<br />
if they are not themselves connected<br />
emotionally to the business. From my<br />
experience (working with employees<br />
in all sectors), I often hear them saying<br />
they don’t feel valued. Interestingly, I<br />
usually find their leaders do indeed value<br />
them, they just don’t realise they aren’t<br />
demonstrating it to them in ways that<br />
matter to employees.<br />
When I am training employees, I do so<br />
in a collaborative way. As far as I am<br />
concerned, they are the experts and no<br />
external person can possibly understand<br />
what it’s like to work in your business.<br />
By empowering your employees to<br />
‘co-design’ the right experience for your<br />
clients, they will feel valued as their input<br />
really matters, and therefore are much<br />
more behind the initiative. This greatly<br />
improves morale and the customer can<br />
really feel it.<br />
Be human<br />
We’ve recently been forced to open<br />
new channels to communicate with<br />
our customers due to the pandemic.<br />
We have to ensure we are establishing<br />
how customers want to communicate.<br />
There’s no doubt that face-to-face<br />
communication is most effective when it<br />
comes to building relationships - so try<br />
to make up for the loss of this form of<br />
communication. The telephone is also a<br />
great way to connect. You’ll best get to<br />
know your client when you are talking<br />
to them. This is where those natural<br />
conversations occur. Try to avoid constant<br />
emails by telephoning now and again.<br />
With email communications, there’s a<br />
tendency to be to be very formal and get<br />
straight to business. We must ensure we<br />
make it easy for clients to understand. It’s<br />
much more difficult for them to quickly<br />
ask you to explain what something means<br />
over email. Your language must be clear<br />
and simple to understand. There should be<br />
100% clarity around next actions e.g., who<br />
needs to do what and by when. We live<br />
in an era of people not reading content.<br />
They tend to skim, which is frustrating<br />
as often important information can be<br />
missed, but it can’t be ignored that this is<br />
the way people behave. Make it easier to<br />
pick up the important points e.g., highlight<br />
the key points or actions, or put the most<br />
important information at the start.<br />
Start today<br />
By addressing the key drivers, connecting<br />
with your clients, and doing the basics<br />
brilliantly, your clients will remain loyal, do<br />
more business with you and recommend<br />
you to others. The beauty of CX is that<br />
it has an equally positive impact on your<br />
employees, ensuring they naturally want<br />
to improve things for your clients and<br />
really enjoy their jobs more. A human<br />
approach has never been more important<br />
and effective when it comes to business<br />
growth and there’s no time like the<br />
present to be more human.<br />
Susannah Hewson<br />
is Founder at CX Change<br />
23
EXPERIENCE MAKES THE DIFFERENCE<br />
HIGH IMPACT CASE MANAGEMENT DELIVERED BY WELL QUALIFIED, PEER<br />
SUPERVISED CLINICIANS - SUPPORTING YOU WITH SAFE AND KNOWLEDGEABLE<br />
HANDS FROM THE VERY START<br />
breakthroughcasemanagement.com<br />
Annabelle Lofthouse: 07703 103843 Catrin May: 07595 226097
EDITORIAL<br />
BOARD<br />
Dealing with<br />
Highly Sensitive Issues<br />
At Loch Associates Group we aim<br />
to provide a range of services from<br />
employment law advice, HR support,<br />
health and safety consultancy,<br />
employee wellbeing programmes and<br />
mediation services to ensure clients<br />
have access to all their people needs<br />
from a single-trusted partner. The<br />
very nature of our work can be<br />
highly sensitive.<br />
We may be carrying out an investigation,<br />
managing disciplinaries and grievances, or<br />
helping clients to look after employees’<br />
wellbeing with mental health training or<br />
absence management support. Our HR<br />
Medical Specialists are also processing<br />
highly sensitive medical and personal<br />
information too. This often involves<br />
emotional issues and it can be stressful<br />
and tense for both the employee and<br />
their employer.<br />
There is not a one-size-fits-all approach<br />
we can take, as each client may want to<br />
take a different approach. So instead,<br />
when we start working with a new client,<br />
we spend time understanding their culture.<br />
This is done not only to tailor our services<br />
and develop bespoke solutions for them,<br />
but also to ensure we work with our clients<br />
so they have peace of mind that we can be<br />
their trusted and secure partner.<br />
Our work must remain confidential and<br />
therefore we often ensure we discuss with<br />
new clients who we should correspond<br />
with, whether or not a work email address<br />
is appropriate and when we invoice, we<br />
are careful to check who is allowed access<br />
to the time recording narratives.<br />
We use encryption and passwords to<br />
ensure emails and documents cannot be<br />
accessed by a third party and we ensure<br />
our communication with an accounts<br />
team are managed carefully. We also<br />
agree what information will appear on<br />
invoices and who is authorised to make<br />
requests for additional information. It is<br />
so easy for a small piece of information<br />
to be released which results in the<br />
disclosure of confidential information<br />
internally, with unintended and very<br />
damaging consequences.<br />
"When we start working with<br />
a new client, we spend time<br />
understanding their culture"<br />
Pam Loch<br />
is Managing Director at<br />
Loch Associates Group<br />
How to Exceed Client Expectation amid<br />
Ever Increasing Demands<br />
Clients have high expectations of<br />
the legal services you provide, so<br />
it’s vitally important that law firms<br />
have the technology and software<br />
solutions in place to deliver a<br />
seamless, cost-effective, digital<br />
experience that removes friction<br />
from their clients’ journey.<br />
Your average consumer does not have the<br />
qualifications or knowledge to understand<br />
the complexities of the legal services you<br />
provide. They will not know if you’ve<br />
utilised every area of the law to win/<br />
progress their case, or whether another<br />
lawyer could have done a better job.<br />
However, they do understand what quality<br />
customer service looks like, and that’s how<br />
they will value the services you deliver.<br />
In the case of law firms, and many other<br />
professional services, the benchmark for<br />
quality customer service is set incredibly<br />
high. Every day, your clients experience<br />
exceptional service from brands who are<br />
pushing the boundaries of what is means<br />
to be client-centric. Market-leaders are<br />
removing pain points for clients that<br />
they had previously learnt to accept and<br />
therefore emphasising what it means to go<br />
above and beyond for your customer.<br />
What is your law firm<br />
competing against?<br />
Instant message online chats that offer<br />
immediate support and guidance. Access to<br />
transparent pricing, services, and products<br />
online so consumers can complete their own<br />
research and comparisons. Continuous and<br />
real-time progression updates – via text,<br />
email, and/or an online account – keep<br />
consumers up to date on when purchases<br />
have been dispatched, are enroute or have<br />
been delivered.<br />
It isn’t just online retailers that have<br />
drastically improved their services. Online<br />
forms, digital documents and e-signatures<br />
that avoid the annoyance of printing,<br />
scanning, and posting are standard<br />
for most insurance companies, banks,<br />
building societies and energy providers.<br />
This is highlighted further during property<br />
transactions. Consumers can research, book,<br />
and enquire online, including having virtual<br />
tools via the likes of Zoopla and Rightmove,<br />
but then typically wait to receive a client<br />
care letter in the post to sign and return<br />
from their conveyancer.<br />
Recommendations<br />
Implement a practice and case<br />
management solution that enables you<br />
to offer digital onboarding, secure client<br />
portals, e-signature tools, automated text<br />
updates, timely notifications and much<br />
more so you can meet – and strive to<br />
exceed - the expectations of your clients.<br />
Demonstrate to clients that you are<br />
providing value by delivering a seamless,<br />
simple, and stress-free experience and<br />
you’ll receive repeat business, five-star<br />
reviews and recommendations in return.<br />
"Every day, your clients<br />
experience exceptional service<br />
from brands who are pushing<br />
the boundaries of what is<br />
means to be client-centric"<br />
Craig Matthews<br />
is CEO at Osprey Approach<br />
25
Compare up<br />
to 4 quotes in<br />
60 seconds<br />
1<br />
Platform<br />
4<br />
Quotes<br />
4<br />
A Rated Insurers<br />
It’s never been easier<br />
to obtain legal<br />
indemnity insurance<br />
in just a few clicks.<br />
Register today at<br />
my-legal-indemnity-shop.com<br />
T: 0203 808 6030<br />
E: assetunderwriting@dualgroup.com<br />
DUAL Asset underwriting Limited is an Appointed Representative<br />
of DUAL Corporate Risks Limited which is authorised and regulated<br />
by the Financial Conduct Authority number 312593. Insurer strength<br />
ratings provided by AM Best and Standard & Poor’s<br />
The housing occupational<br />
therapy specialists<br />
A private housing occupational therapy company, searching, designing and<br />
adapting homes for clients with physical, sensory and cognitive disabilities.<br />
These are just some of the services we offer:<br />
• Accommodation expert, under Part 35 of Civil Law<br />
• Property search<br />
• Sourcing and liaising with building professionals<br />
• Creating specifications for the building work<br />
• Supporting the contractors during the adaptation work<br />
• Sourcing all equipment fixtures and fittings<br />
Visit designforindependence.co.uk to find out more
EDITORIAL<br />
BOARD<br />
David Seager<br />
is Consulting Adviser to<br />
SIFA Professional<br />
Your Website is Your<br />
Shop Window<br />
Whilst I do feel that I have written often about the<br />
SRA’s push for ‘Transparency’, I am not surprised to<br />
do so, and I feel it remains important and will continue<br />
to be. Modern Law advised us on the Editorial Board<br />
that in a recent survey, 83% of consumers are now<br />
influenced by a company’s website and will choose one<br />
that provides clear information.<br />
Given this modern phenomenon, how appealing, welcoming,<br />
and clear your website is, becomes critical. Your website<br />
becomes your shop window for the undecided consumer<br />
browser, who based on the Legal Services Consumer Panel and<br />
the SRA’s own research, might be assessing 2 or 3 sites, or even<br />
more. This is why, since the rules came into force in December<br />
2018, I have encouraged solicitors to see the regulator’s<br />
Transparency Rules, not as a begrudgingly undertaken<br />
compulsory chore but as an exciting challenge to embrace and<br />
enter the spirit of.<br />
This is your opportunity to differentiate your firm from the<br />
other local legal services providers, solicitors or otherwise.<br />
It is about describing the services you offer in concise plain<br />
language and not in legalese. It is not about the possible price<br />
you feel you should not have to display, but about detailing all<br />
work and stages of delivery for the service and the qualifications<br />
and experience of who will be delivering it, so the potential<br />
client can truly see the value on offer. It is your chance to have<br />
biographies of your staff, and the whole team - not just the lead<br />
solicitor. It should also include not just professional but personal<br />
detail to make your firm more approachable.<br />
In short, it is recognising that your firm is in competition with<br />
other firms for the next client. Consider yourself in a beauty<br />
parade and having accepted this, decide how you might add<br />
those final touches to your website that might be the deciding<br />
differentiators. For example, it might be blogs written by<br />
members of your team about how they work with clients, it<br />
could be using short punchy videos to describe your services<br />
or even interactive tools or calculators that don’t require<br />
personal information.<br />
One final point I always stress is that whilst the website is<br />
vital, it will only come into play in the absence of a personal<br />
referral. Without a trusted adviser recommending me to a<br />
provider, I will start the research process, but with one, I may<br />
not need to. So please, ensure to make the positive referral<br />
to financial advisers or accountants when your clients need<br />
complementary financial planning or tax advice and encourage<br />
them to do the same with you.<br />
"It is about describing the<br />
services you offer in concise plain<br />
language and not in legalese"<br />
Alex Holt<br />
is Business Development<br />
Director at The Cashroom<br />
Changing<br />
Consumer Habits<br />
I’ve said this before...I am old. Putting it into context,<br />
when I was a newly qualified lawyer, we didn’t have mobile<br />
phones. Computers were only just arriving, and they were<br />
mainly for word processing. Email wasn’t a thing.<br />
Looking back, time pressures were very different, as was client<br />
expectation surrounding speed of response. If I dealt with a<br />
matter, it meant I would dictate something. It would then go<br />
to a secretary for typing, then back to me for signature, then it<br />
would be posted. Very regularly it would be over a week before<br />
I would receive a response.<br />
Compare that to the present.<br />
Clients expect an almost immediate response to email. They<br />
expect to be able to contact their lawyer whenever they want,<br />
and they also expect that lawyers in a transaction will be<br />
constantly progressing their matter at either end. All of this<br />
is often accompanied with a requirement that fees will not<br />
be excessive – especially in conveyancing where the client’s<br />
demands are particularly strident.<br />
So, what habits do consumers now exhibit when choosing to<br />
purchase something?<br />
They expect to have access to a clear and concise website with<br />
fully detailed products and clear pricing. They’ll be viewing<br />
things on their phone of course and will expect to be able to<br />
communicate questions at that point. They will look at ‘star<br />
ratings’- google reviews, trust pilot etc. And when they decide<br />
to purchase, in this case a service, they expect to be able to<br />
track its progress. To be kept updated. To receive the promised<br />
outcome timeously.<br />
These pressures need a response, and that response comes in<br />
two forms I’d suggest. Technology and outsourcing.<br />
Tech tools are now available which ease the onboarding<br />
process, manage the flow of data, enable communication, and<br />
create cost efficiency as a result. Practice management systems<br />
provide workflows and data to help with management and<br />
business decisions.<br />
Outsourcing elements of the business enables a law firm to<br />
create flexible resource, expert in a particular element that<br />
lawyers themselves might not be. This resource can augment<br />
the tech, support the lawyers, and create a much-improved<br />
experience for the firm’s clients.<br />
So, the pressure on a modern lawyer has changed in many<br />
respects, but at least they now have the incredible tech tools<br />
and skilled support to meet the challenges. It’s actually exciting!<br />
"They expect to be able to contact their<br />
lawyer whenever they want"<br />
27
Solicitors Professional Indemnity Insurance<br />
At times like this you need<br />
solid dependable advice<br />
Professional Indemnity Insurance<br />
Howden’s Professional Indemnity division is one of the most<br />
experienced teams in the market, with over 150 PII specialists<br />
and more than 30 dedicated to servicing the legal sector.<br />
Our size and presence allows us to obtain quotations directly<br />
from insurers and we offer one of the widest selections of A<br />
rated providers available. This in combination with the strength<br />
of our relationships in the market sets us apart as one of the<br />
leading brokers when placing insurance. Our clients range from<br />
sole practitioners to the UKs Top 100 legal firms.<br />
Other Insurances<br />
We also offer a range of other services and insurance<br />
products from bespoke risk management audits through<br />
to tailored Employee Benefits & Wellbeing packages, Cyber<br />
Liability, Office & Contents and Public Liability Insurance.<br />
Get In Touch<br />
E<br />
Info@howdengroup.com<br />
W howdengroup.co.uk<br />
Howden is a trading name of Howden Insurance Brokers Limited, part of Howden Group Holdings. Howden Insurance Brokers<br />
Limited is authorised and regulated by the Financial Conduct Authority in respect of general insurance business. Registered<br />
in England and Wales under company registration number 725875. Registered Office: One Creechurch Place, London, EC3A<br />
5AF. Calls may be monitored and recorded for quality assurance purposes.
EDITORIAL<br />
BOARD<br />
Why Digital Onboarding is Changing<br />
Client Experiences for Law Firms<br />
How do you manage your banking on<br />
the go? Do you shop online and opt<br />
for next-day delivery? Perhaps you<br />
relieve the burden of cooking dinner<br />
after a long day by ordering through<br />
an app on your phone. The way we<br />
operate daily tasks has continually<br />
evolved over the last decade, with<br />
consumers squarely at the centre of<br />
the entire experience.<br />
Speed, convenience, and accessibility<br />
have all become priorities for users in an<br />
instant-gratification culture. With further<br />
acceleration of technology aiding consumer<br />
experiences over the last 18 months, as the<br />
pandemic forced businesses to pivot, the<br />
same level of service is expected within the<br />
legal sector more than ever before.<br />
Digital onboarding is a key focus for firms<br />
as recognition grows of the pressure it<br />
relieves related to challenges presented by<br />
restrictions on face-to-face contact. From<br />
digital forms and eSignatures to biometric<br />
ID and source of funds verification, clients<br />
have come to expect their onboarding to<br />
be completed digitally.<br />
Concerns have been raised around security<br />
related to digital ID verification - a genuine<br />
query where due diligence is particularly<br />
pertinent. However, the introduction of<br />
HMLR’s Digital Identity Standard provides<br />
a safe harbour for firms when identifying<br />
their clients digitally. Accessing the same<br />
bank-grade security that is used by leading<br />
financial institutions, clients have come<br />
to expect digital ID checks as standard.<br />
Increased convenience is a cornerstone of<br />
the modern user experience.<br />
The completion of onboarding<br />
documentation can take weeks, with<br />
delays caused by post, incompletion of the<br />
forms and lack of access to devices such as<br />
printers and scanners. The solution for both<br />
firms and their clients is digital onboarding.<br />
It’s not only the client experience that<br />
benefits, but that of the firms’ staff as well.<br />
Reducing the time to gather onboarding<br />
information, creating transparency so<br />
legal practitioners can advise their clients<br />
if queries arise, and the ability to access<br />
documentation from anywhere on any<br />
device – it’s all part of a greater future for<br />
law firm client onboarding.<br />
However you view it, digital onboarding is<br />
the way forward for legal. More than a bandaid<br />
solution to counteract a brief change<br />
to how we work, it’s a long term solution<br />
that will swiftly enhance client and law firm<br />
experiences from the first engagement,<br />
setting you up for success from the outset.<br />
"Accessing the same bankgrade<br />
security that is used by<br />
leading financial institutions,<br />
clients have come to expect<br />
digital ID checks as standard"<br />
Bronwyn Townsend<br />
is Senior Marketing Manager at InfoTrack<br />
Automated Technology<br />
and Personal Relationships<br />
Go Side-by-Side<br />
Bill Gates once said “Robotics<br />
and other combinations will make<br />
the world a pretty fantastic place<br />
compared with today”. In some<br />
way we can all identify with this –<br />
the speed with which technology<br />
can replace mundane tasks is<br />
phenomenal. But where does it end?<br />
According to Anthony O’Hanlon, Head of<br />
Customer Development “As a provider to<br />
the legal sector, we can definitely see a role<br />
for technology in helping make the lives<br />
of lawyers more efficient. We have spent<br />
hours meeting with law firms of all sizes,<br />
listening to their frustrations and pain<br />
points, allowing them to set our roadmap<br />
for future technical developments. This<br />
has resulted in important, market-leading<br />
changes such as Variable Statements<br />
of Fact (VSOF) – a service we believe is<br />
unique to CLS in offering Legal Indemnity<br />
Insurance. By replacing the need to go<br />
offline and request a bespoke quote, a<br />
solicitor can now tailor a policy to their<br />
clients need in real time and all within one<br />
simple online experience.”<br />
However, there will always be a role for<br />
relationships between people. Chantelle<br />
Wren, Underwriting Manager at CLS,<br />
explains that “being able to turn around a<br />
quote quickly is only part of the solution<br />
for our clients. When a case becomes too<br />
complex, we delight in being able to provide<br />
a personal service from our team of experts.<br />
The route it would take for that to be done<br />
online would become clunky and tiresome<br />
very quickly. Pursuing a technology-based<br />
solution in those instances, for the sake<br />
of it, doesn’t bring the client any joy.<br />
That’s why we wouldn’t force it on people<br />
- instead we spend time listening to our<br />
clients and problem-solving for them.”<br />
At CLS we have huge amounts of technical<br />
skill, paired with over 1.5bn data points and<br />
the experience under our belt of over 10<br />
million property transactions. We actively<br />
recruit diverse, passionate and creative<br />
people with a deeply ingrained ability to<br />
adapt to the problem at hand through<br />
collaboration – whether that’s through<br />
the use of technology or in-person<br />
relationships. By exploring and learning<br />
from our personal experiences with<br />
technology, and embracing opportunities<br />
to remove silos or administrative burdens,<br />
we can be a positive catalyst for change in<br />
our clients work life.<br />
"When a case becomes too<br />
complex, we delight in<br />
being able to provide a<br />
personal service"<br />
Chantelle Wren<br />
is Underwriting Manager at CLS<br />
Anthony O’Hanlon<br />
Head of Customer Development<br />
29
EDITORIAL<br />
BOARD<br />
Neville Dinshaw<br />
is Managing Director at Law<br />
Mergers and Acquisitions<br />
Customer Interaction:<br />
Face to Face,<br />
Virtual or Both?<br />
We are living in an era of digital transformation, and<br />
the COVID19 pandemic truly highlighted the imperative<br />
need to embrace new tools to maintain business<br />
continuity in all industries. However, striking a balance<br />
between how these new tools are used and reassuring<br />
your customers through human interaction, is a delicate<br />
art. It can either catapult your productivity and success<br />
or leave your clients with an unsettling feeling that<br />
could drive them away and towards your competitors.<br />
If used correctly, technology is meant to be your biggest ally -<br />
your organisation can have the agility to find information and<br />
provide responses with reduced time scales which translates to<br />
better value for money to your customers…. as we all know,<br />
time has a cost!<br />
What’s more, we have become more comfortable holding virtual<br />
meetings and interacting via camera through digital platforms.<br />
We can still read body language during a conversation whilst<br />
maximising our time by avoiding onerous commutes. This is also<br />
benefiting our team members, as they can now have a better<br />
balance between work and personal life. Research about successful<br />
organisations provides evidence regarding the undeniable<br />
correlation between job satisfaction from staff members and<br />
the success of the company. Creating opportunities for work-life<br />
balance equips your staff with the flexibility to work in a way that<br />
allows their skills to shine, and your clients will notice it.<br />
What is important to have in mind is that as humans we are all<br />
different and so are our preferences, therefore it is paramount<br />
that you invest effort in understanding the needs and<br />
preferences of your clients to customise their experience.<br />
However, a resilient law firm will not just focus on adapting<br />
to the current needs of clients, it will work proactively, setting<br />
the grounds to adopt change (digital, cultural, technical,<br />
governmental and financial) to become the “practice of choice”<br />
for its future clients. Market research and observing trends will<br />
provide your organisation with a good flavour of what is needed<br />
and will enable you to start developing the strategies required<br />
to portray your firm as the best option in the industry in terms<br />
of fulfilling new expectations.<br />
Mark Holt<br />
is COO at Frenkel Topping<br />
Establishing a<br />
Better Relationship<br />
I believe most business leaders would like to think they<br />
are delivering the best service they can but sometimes<br />
it can take a personal experience, away from the day<br />
job, to widen your scope and highlight the opportunity<br />
to improve.<br />
Frenkel Topping’s service is outstanding! Our client retention<br />
rate of 99% speaks for itself. But it took a recent purchase of<br />
some home improvement supplies to remind me that there<br />
is always potential to do better. I received a call at the same<br />
time, on the same day each week to update me on my order.<br />
I’ve no doubt in that situation the supply process was largely<br />
automated and technology plays its part in the customer<br />
journey, but the human touch of a phone call from someone<br />
who understood my specific circumstances – it took the<br />
situation from a simple transaction to an experience and I’ve<br />
now got an established relationship with that retailer.<br />
The fundamentals that made their service extraordinary –<br />
keeping the customer informed, managing expectations, being<br />
reliable, delivering on a promise, making every customer feel<br />
looked after and special – all of that applies regardless of the<br />
industry you operate in. Even if you’re the best in your field,<br />
you should strive to be better.<br />
We’ve invested hugely in technology in recent years in order to<br />
improve the experience for our clients. However, technology has<br />
in no way replaced our people-led approach to managing the<br />
customer relationship. For us, technology allows us to create<br />
efficiencies that free up time for our team to spend directly with<br />
our clients. All human characteristics are difficult to replicate<br />
artificially but those of empathy, compassion and understanding<br />
particularly, are so important in the field of personal injury and<br />
clinical negligence.<br />
"It took the situation from a<br />
simple transaction to an experience<br />
and I’ve now got an established<br />
relationship with that retailer"<br />
The combination of an agile service underpinned by digital<br />
tools, a customised approach to clients and a conscious effort<br />
to incorporate incoming trends and aspirations will definitely set<br />
your firm apart from the crowd.<br />
"It is paramount that you invest<br />
effort in understanding the needs and<br />
preferences of your clients"<br />
31
DigiAssist<br />
RPA as a Service<br />
Your simple solution to automate business<br />
processes with no technology overheads.<br />
DigiAssist offers the benefits of RPA - digital<br />
workers on demand, improved efficiency, increased<br />
productivity, enhanced accuracy, timeliness, 24/7<br />
availability, operational flexibility and data<br />
confidentiality – with the additional benefits of<br />
SaaS – lower running costs, reduced time to ROI,<br />
increased scalability and ease of use.<br />
enquiries@wmpromus.com +44(0)2039466226<br />
WM Promus are automation specialists guiding organisations along their transformation journey.
EDITORIAL<br />
BOARD<br />
Developing Our<br />
New Website<br />
It’s significant that eight out of<br />
ten consumers are influenced by<br />
company websites. However, when it<br />
comes to our potential clients, they<br />
are much more than just consumers.<br />
Visitors to the Breakthrough website<br />
are here because either a loved one, or<br />
they themselves, have experienced a life<br />
changing injury. While website design and<br />
SEO are important, there’s so much more<br />
to it. It’s about providing people with<br />
support and information – who we are,<br />
and what we stand for.<br />
That’s why our team recently embarked<br />
on a project to develop a new website. We<br />
won’t pretend it’s been easy. There’s been<br />
a lot of soul searching, questions asked<br />
and (amicable) differences of opinion.<br />
Nevertheless, we are excited about our<br />
new website and everything we have learnt<br />
in the process will shape our wider strategy,<br />
identity and purpose as a business.<br />
The first challenge was our brand. We’ve<br />
had the same logo since we started<br />
Breakthrough Case Management. We<br />
recognise that the business has progressed<br />
and developed over the years and decided<br />
that a refresh will reflect our growth and<br />
authority in the sector.<br />
The imagery on our website needs to<br />
provide reassurance, a tone of integrity<br />
and professionalism delivered with<br />
understanding and a sense of optimism for<br />
the future for our clients. Our hope is that<br />
the images we have chosen reflect positivity<br />
and demonstrate the potential for individual<br />
breakthroughs throughout and beyond<br />
their rehabilitation. Someone who may<br />
have experienced a catastrophic injury but<br />
nevertheless is living with purpose, energy,<br />
drive and determination. Because that’s<br />
what we strive to achieve every day for<br />
every single one of our clients.<br />
When it comes to user experience we keep<br />
it simple. What do people need to know?<br />
How do we express this in clear, jargon<br />
free writing that isn’t intimidating? We<br />
stick to plain English, use flow diagrams to<br />
explain our processes and provide different<br />
audiences with what they need. For<br />
example, individuals and their families will<br />
have different questions to our colleagues<br />
in the legal and insurance professions.<br />
Ultimately our website is more than selling a<br />
product or service. It’s about demonstrating<br />
to people why Breakthrough exists. The job<br />
of a case management company is to make<br />
life easier - for our clients and their families,<br />
and the various professionals we work with.<br />
Our website should do the same. Please do<br />
take a look and let us know what you think.<br />
"The images we have<br />
chosen reflect positivity and<br />
demonstrate the potential for<br />
individual breakthroughs<br />
throughout and beyond their<br />
rehabilitation"<br />
Annabelle Lofthouse<br />
is Owner of Breakthrough Case Management<br />
Delivering a<br />
Fluid Customer Journey<br />
Technology-backed service<br />
improvements in the legal sector<br />
typically deliver a customer experience<br />
that feels seamless, faster, and<br />
familiar. “Familiar” because it reflects<br />
day-to-day life where clients engage<br />
with Amazon, Uber, online banking<br />
services and so on. Today’s clients are<br />
comfortable online.<br />
With services and pricing so competitive,<br />
many organisations seek competitive<br />
advantage by kick-starting technical projects<br />
related to customer experience. Doing<br />
so without any real understanding of the<br />
customer journey is unlikely to deliver the<br />
desired improvements. The starting point has<br />
to be mapping the customer journey.<br />
As you map the journey, note the customer’s<br />
expectations, their pain points and those<br />
’make or break’ touchpoints that define<br />
how they feel about your organisation.<br />
In this way, you can see what areas need<br />
improvement and at which stages technology<br />
might deliver benefits. Negative impacts<br />
occur when organisations employ technology<br />
for technologies sake - feeling pressurised<br />
to “digitally transform” without pausing to<br />
reflect on what’s truly needed.<br />
Customer journey mapping highlights<br />
where service responsiveness, accuracy,<br />
knowledge, availability, reliability and so<br />
on is lacking. Increasingly organisations<br />
are choosing Robotic Process Automation<br />
(RPA) to revolutionise process efficiencies<br />
and deliver the very improvements needed.<br />
Put simply, RPA is just software (known<br />
as bots) that automates a process e.g.<br />
onboarding a client, invoicing, searching<br />
through files, providing answers to<br />
frequently asked questions and so on. By<br />
its very nature it provides those levels of<br />
response, accuracy, reliability etc. associated<br />
with a superior service experience.<br />
We’re talking about immediate responses<br />
to client emails. 100% accurate billing. Bots<br />
are designed to handle and manage data, to<br />
open and ‘read’ emails, to scan and process<br />
documents, to screen scrape – so much of<br />
that forms the bedrock of a legal firm’s service.<br />
Clients don’t need a human to send emails<br />
that acknowledge contact, or download,<br />
search and provide data. Clients don’t care if<br />
a bot does those tasks; they just want their<br />
issues resolved quickly without mistakes.<br />
Without question, there are points in the<br />
journey where a human touch is what is<br />
required. Any task that requires creativity,<br />
ingenuity or empathy is better suited to a<br />
human than a bot. Using RPA for the logical<br />
tasks liberates your employees to focus<br />
on clients that need a human connection.<br />
The future holds this combination of<br />
human workers and bots delivering the<br />
customer experience. Your employees will<br />
drive improvements using their emotional<br />
intelligence. RPA is a huge opportunity to<br />
complement your employee’s abilities to<br />
overcome customer hurdles and deliver<br />
an experience fit for today’s competitive<br />
landscape and the future.<br />
Eileen O’Mahony<br />
is General Manager at WM Promus<br />
33
EDITORIAL<br />
BOARD<br />
Howard Sears<br />
is Chairman at Price Bailey<br />
Chartered Accountants<br />
How Much Should You<br />
Spend on Marketing?<br />
Just like any other department, marketing requires<br />
investment, and technological advances are changing<br />
how that investment is deployed. Though marketing<br />
spend can be tough to justify sometimes due to<br />
the difficultly in quantifying a tangible return, a<br />
recent survey concluded that 83% of consumers said<br />
they were influenced by a company’s website when<br />
searching for a product or service.<br />
Consequently, website usage can now be monitored more<br />
easily than ever before, and consumers can even be tracked to<br />
understand their buying patterns. So, is marketing an area that<br />
we are now, more than ever, able to tangibly calculate a return<br />
on expenditure?<br />
A marketing team within a law firm will have different priorities<br />
to most others. Consumers are likely to be already aware that<br />
they require a law firm when they are looking for your services,<br />
so the marketing teams must put greater focus on being<br />
found quicker, looking more attractive by comparison to their<br />
competitors, and building credibility.<br />
According to research by the SRA, firms of solicitors spend the<br />
least amount on marketing as a percentage of turnover in the<br />
legal industry, while alternative business structures spend far<br />
more. The industry has seen an increase in a firm’s average<br />
marketing spend of 0.5% in the last 5 years. This increase is<br />
likely due to firms bolstering their brand as new players come to<br />
market in their local areas.<br />
So… the answer to the question I posed will depend on the<br />
firm and its aims. The likelihood is that law should be spending<br />
more on marketing, but with good reason. Law firms were<br />
traditionally chosen due to location, and a firm’s whereabouts<br />
had a big impact on its consumer demographic, its sphere of<br />
influence and often its success. The pandemic has, in part,<br />
removed these geographical barriers and made consumers<br />
far more comfortable with virtual meetings and remote<br />
relationships. It has also forced governing bodies to adapt<br />
regulations to support transacting in a distanced environment.<br />
This means that markets that were previously untouchable<br />
due to geography have opened up to law firms. The industry<br />
averagely still only spends 2.6% of its revenue on marketing<br />
in spite of the reported 0.5% increase. Tapping into locations<br />
in which you have no physical presence can be difficult, but<br />
marketing teams are best placed to lay the foundations, whilst<br />
protecting your existing brand.<br />
"The industry has seen an increase<br />
in a firm’s average marketing spend<br />
of 0.5% in the last 5 years"<br />
David Grossman<br />
is CEO at Simplify<br />
Understanding<br />
the Journey<br />
It’s no surprise that our experience of shopping online<br />
has become second nature. For a £10 item we may<br />
glance at the star rating before clicking ‘buy’, but rarely<br />
do we want a chat with the manufacturer first. Yet,<br />
when it comes to a purchase of significance, financially<br />
or emotionally, then our rules change – and rightly so.<br />
As consumers we go on a journey and never more so than<br />
when buying or selling a home. There are always aspects of<br />
that journey which we’re happy for technology to facilitate<br />
– where once we relied on the postman, we’re now happy<br />
for technology to deliver our messages via email, uploaded<br />
attachments or SMS; but we need our journey to be punctuated<br />
by human interaction, for experts to guide us and explain the<br />
intricacies of the transaction to us. Ultimately, we as consumers<br />
want to feel supported, to have trust in the company/service<br />
being provided and reassured we’re doing it right. We want to<br />
feel cared for.<br />
Market leaders need to understand this journey, to know when<br />
to engage the technology to aid someone’s day and manage<br />
the admin, and when to pick up the phone and offer human<br />
reassurance. This understanding adds value and is essential.<br />
When this balance isn’t met it can be catastrophic – consumers<br />
venting via social media springs to mind. Very quickly a<br />
frustration of not knowing escalates into worry, panic and<br />
anger. Businesses must remember to put themselves in<br />
their customers’ shoes. By pre-empting these moments and<br />
developing ways to keep the client informed, the worry and<br />
stress can disappear. Just think how happy you feel knowing a<br />
train is only 2 minutes away thanks to the information board,<br />
compared to when the board is broken, and you’re left waiting<br />
in limbo.<br />
That said, companies mustn’t rely so heavily on technology<br />
that they fail to engage with their customers; otherwise the<br />
stereotype of online providers being nothing more than<br />
interfaces and systems comes true. Finding the balance in big<br />
business is crucial.<br />
Listening to customer feedback provides the key to creating the<br />
balance – adapting, blending and tweaking as required. Moving<br />
home is an emotional experience but when the balance is right<br />
between using technology and human interaction, it can be a<br />
great one.<br />
"Businesses must remember to put<br />
themselves in their customers’ shoes"<br />
35
A mission to change the way law firms<br />
operate, everywhere and forever.<br />
gunnercooke is an award-winning full service law firm founded in 2010, to<br />
challenge, improve and evolve the way that lawyers work.<br />
The gunnercooke model offers experienced lawyers the freedom and flexibility<br />
to build their own practice, in the way they choose. Each lawyer sets their own<br />
targets and decides which clients to work for. Their earning potential is unlimited.<br />
Our role is to deliver a world-class support service, making it as easy as possible<br />
to maximise the opportunity that the model provides.<br />
In a recent feedback survey, 95% of our lawyers said that they were happier at<br />
gunnercooke than in their previous firm.<br />
Join gunnercooke<br />
We want to speak to senior lawyers who enjoy the freedom of working<br />
collaboratively amongst highly experienced peers.<br />
People with the appetite and ambition to change the way that legal services are<br />
delivered to businesses. If this is you, get in touch at info@gunnercooke.com.<br />
Choose flexibility | gunnercooke.com<br />
Looking for a<br />
company that invests<br />
in your future?<br />
Simplify Works for you<br />
We’ll give you the time and support<br />
to make the most of your future.<br />
We care about the success of our<br />
people; we’ll develop your skills<br />
through our award-winning training<br />
academy so you can realise your<br />
full potential.<br />
We are always looking for inspiring,<br />
innovative, and caring conveyancers,<br />
so if you want a company that invests<br />
in your future, why not see how<br />
Simplify ‘works for you’?<br />
recruitment@simplify.co.uk<br />
www.simplify.co.uk/careers<br />
Simplify incorporates six of the largest UK conveyancers; Advantage Property Lawyers, Cook Taylor Woodhouse, DC Law, Gordon Brown Law, JS Law and Premier Property Lawyers.
EDITORIAL<br />
BOARD<br />
Growing<br />
Customer Expectations<br />
The insurance industry has itself<br />
been accused of being something<br />
of a laggard in taking on the mantle<br />
of customer-centricity. I believe we<br />
can offer a different, and hopefully<br />
interesting perspective.<br />
At DUAL Asset, we’re very much in the<br />
legal sector, but not truly of the legal<br />
sector. We’re a specialist insurance MGA,<br />
that is, a tailor and reseller of insurers’<br />
insurance capacity to property, probate<br />
and M&A lawyers and insurance brokers.<br />
In short, we’ve got customer relationships<br />
left, right and centre, the full 360°.<br />
We’re a learned middleman, educating all<br />
sides to the needs of others, in what is<br />
essentially a relationships business. That<br />
means being open and fair to all parties,<br />
and unfailing in treating everyone as you<br />
yourself would expect to be treated.<br />
The problem is, the way that people expect<br />
to be treated is going through the roof.<br />
The indirect competition in this area is<br />
a powerful, influential force. The other<br />
day, I was buying a gift online – a spa<br />
day experience for my wife’s birthday. I<br />
chose one, and then a minute later, saw<br />
a better one.<br />
I spoke to the company’s live chat: at first<br />
a triaging chat-bot, then a countdown<br />
of where I was in the queue, then three<br />
minutes later, a real person, Ben. I typed<br />
him a quick message, explaining that I<br />
bought the wrong one. Not only did Ben<br />
say he’d refund my card straight away,<br />
but he volunteered that if I took store<br />
credit instead, I would be refunded an<br />
extra £7 towards buying the correct one<br />
immediately. I essentially got paid £7 for<br />
my own mistake.<br />
Can you imagine the legal or insurance<br />
sector doing anything like that?<br />
To impress clients long-term, expertise<br />
isn’t always enough (although we do<br />
have plenty of it) and we’ve become<br />
committed to the modern client<br />
experience. As such, we’re the only<br />
insurance specialist who provides legal<br />
indemnity cover for property transactions<br />
through an online price comparison<br />
tool. My Legal Indemnity Shop provides<br />
a choice of competitive quote/insurer<br />
options and lets property lawyers insure<br />
clients instantly, in just a few clicks. This,<br />
hopefully, helps our clients exceed their<br />
own client’s expectations.<br />
That’s what our clients told us they<br />
needed. So that’s what they got, because<br />
listening and reacting proactively is<br />
everything. The client has always been<br />
king and queen. The difference now in<br />
2021, is that they very confidently know it.<br />
"The way that people expect<br />
to be treated is going through<br />
the roof"<br />
Mark Dennis<br />
is Head of Online Services<br />
at DUAL Asset<br />
How a Shoe Collection<br />
Highlights the Importance of<br />
Designing for Emotional Needs<br />
It is a privilege to step into a client’s<br />
life at a time when they have suffered<br />
a catastrophe and the future is<br />
unpredictable. Our task is to equip<br />
them with the accommodation they<br />
need for a future they may struggle to<br />
imagine. It’s crucial for us to identify<br />
those needs in the first place – and<br />
that means looking at a client’s<br />
existing home environment for clues<br />
to their personality, way of life and any<br />
family members who live with them.<br />
Observation skills are vital when it<br />
comes to assessing clients. A lot of<br />
written information is provided by legal<br />
representatives or case managers. But we<br />
need to see for ourselves a client’s abilities,<br />
relationships, lifestyle, culture and priorities.<br />
There’s no substitute for walking around a<br />
home, chatting and meeting other family<br />
members. That’s what enables us to provide<br />
a unique, personalised design – rather than<br />
just a functional, usable space.<br />
The crucial role played by this personal<br />
touch is illustrated by the example of Mr B,<br />
whose case was settled during the Covid-19<br />
pandemic. With a deteriorating spinal<br />
condition, he was looking for a house for<br />
his family to live in. The written information<br />
we were given suggested that he was able<br />
to walk safely now but he would become a<br />
wheelchair user in the next 5-10 years.<br />
We met Mr B via Zoom initially due to<br />
social distancing restrictions. But our<br />
property search proved to be challenging<br />
as most of the houses we found were<br />
rejected by him with little explanation.<br />
As the restrictions lifted, we asked to meet<br />
Mr B and his family at home to review the<br />
search. That was when we came across<br />
Mrs B’s shoe collection. We also saw the<br />
number of computers Mr B had to operate<br />
at one time for his work. We then assessed<br />
Mr B negotiating the stairs, which was<br />
when it became clear that a ground-floor<br />
bedroom and bathroom were required<br />
immediately to prevent future falls.<br />
Soon after our visit, we found the right<br />
house for Mr B and his family – with<br />
storage for Mrs B’s shoe collection a<br />
priority. Mr B was delighted – although it<br />
had nothing to do with his disability, his<br />
wife’s happiness was everything to him.<br />
The emotional aspects of accommodation<br />
needs are often overlooked as the focus<br />
is usually on people’s functional abilities.<br />
At Design for Independence, we believe<br />
emotional needs are equally important.<br />
"The crucial role played by this<br />
personal touch is illustrated by<br />
the example of Mr B"<br />
Anava Baruch<br />
is Managing Director at<br />
Design for Independence<br />
37
Future-proof<br />
your law firm<br />
Cloud practice<br />
management software<br />
that puts you in control<br />
Deliver first-class client<br />
service that wins more<br />
business<br />
Streamline and<br />
automate processes to<br />
improve profitability<br />
Improve scalability<br />
and agility to remain<br />
competitive<br />
Software solutions that help lawyers succeed<br />
ospreyapproach.com | enquiries@pracctice.net | 03300 604940
EDITORIAL<br />
BOARD<br />
Willie Pienaar<br />
is Co-Founder & Chief<br />
Executive at Nuvalaw<br />
Conversation, not<br />
Technology, is the<br />
Gold Standard in<br />
Customer Experience<br />
Customer service can make or break a company, which<br />
is why it should be at the forefront of every business<br />
decision that you make. Over time it has evolved to<br />
include more and more technology-based interactions<br />
with customers. This development has brought us many<br />
advantages, but with them come certain risks.<br />
The advantages are clear: instantaneous feedback channels,<br />
automated product onboarding and education, and the ability<br />
to serve more clients more efficiently. The ideal outcome being a<br />
thriving business and happy customers. The reality is somewhat<br />
different. With the enthusiasm around digital transformation<br />
in law and insurance, technology providers run the risk of<br />
inadvertently introducing more complexity and frustration.<br />
At Nuvalaw, we have a saying, ‘Don’t automate the mistake’.<br />
It arose in response to our awareness of the very real risk in<br />
technology development of simply automating everything<br />
according to its existing structure. Following this route, you make<br />
the fatal assumption that the way that things are, is the way that<br />
they should be. Why does this happen? Usually, it is because one<br />
has not spent enough time on customer service and experience.<br />
Human-to-human interactions are the single most important<br />
moments in your business relationship with customers, as they<br />
represent a unique opportunity to deepen understanding of<br />
their particular issues and to integrate this feedback into how<br />
you think about developing your products and services.<br />
Customer service is not about answering questions; it’s about<br />
solving problems, and the best way to solve a customer’s<br />
problem is to make absolutely certain that you understand<br />
it before you propose a solution. You may discover a process<br />
that hasn’t been questioned for decades (or, in the case of<br />
law, centuries!) and can be greatly simplified by collaborative<br />
innovation with the customer.<br />
Nuvalaw developed the first inter-party claims resolution<br />
platform allowing lawyers and insurers to interact to resolve<br />
claims and part of their success has been our constant<br />
communication with them. We hold weekly calls to iron out any<br />
issues they might have and to gain deeper insight into their<br />
pain points. We were the first ever platform to offer liability<br />
determination through online ADR. This capability development<br />
arose out of customer experience interviews.<br />
So, while we have technology to thank for many things, let’s<br />
guard against letting it obtrude into customer experience.<br />
"Customer service is not about answering<br />
questions; it’s about solving problems"<br />
Marc Lansdell<br />
is Managing Director at<br />
Evolve Law<br />
Opportunities<br />
and Challenges of<br />
Contemporary Legal<br />
The internet has accelerated the ability for instant<br />
access to goods and service. It has shaped a world<br />
where information is demanded in real time and<br />
goods can be delivered the same day. This has and will<br />
continue to pose both an opportunity and a challenge<br />
for those in the legal sector.<br />
In our area of conveyancing, I hope that we have woken up<br />
and have reacted fairly quickly to these new demands, however<br />
there is more work to be done. Conveyancing transaction times<br />
have slipped even further and we can argue until we are blue in<br />
the face as to why that is, but whilst we do clients expectations<br />
continue to move in the opposite direction.<br />
Clients to some extent, do not care about the process, only<br />
the end result. It is our challenge but also our opportunity to<br />
increase the speed in the process, being ever mindful of our<br />
compliance and risk obligations.<br />
If we are ignorant and do not accept that society is dictating<br />
the pace of change then those outside our industry will snatch<br />
the opportunity to commoditise the process. If we cannot offer<br />
a solution - then our clients will find a solution elsewhere. I am<br />
sure that no party wishes to see a property market backed by<br />
title insurance and which negates the need for a lawyer to play<br />
any part. Well perhaps some do, until it goes wrong!<br />
I am pleased to see that as an industry we have collectively<br />
woken up to the use of modern technology and my hope is that<br />
all firms continue to work both internally and with third parties<br />
to innovate and create new systems and ideas that will help us<br />
catch up on the lost years. It’s no longer ok to say “well this is<br />
how we do things”.<br />
Now is the time to look at your business. Are you proactively<br />
thinking ahead rather than reacting to what others are doing?<br />
The chances are that if you are reacting then it might already<br />
be too late such is the pace of change. Our opportunity is to be<br />
players in the game rather than fans cheering on the side lines.<br />
In our business we would rather be scoring the winning goal<br />
than singing Three Lions.<br />
"Clients to some extent, do not care about<br />
the process, only the end result"<br />
39
EDITORIAL<br />
BOARD<br />
Richard McCall<br />
is CEO & Co-Founder<br />
at Armalytix<br />
The Unexpected<br />
Combination of Better<br />
AML Checks and<br />
Happier Clients<br />
For the legal profession, not only is it important to do<br />
the right thing but also to be seen to do the right thing.<br />
As regulation on the legal profession has grown, the industry<br />
has needed to respond. The Solicitor’s Regulatory Authority<br />
(SRA) cites both the 2017 Money Laundering, Terrorist Financing<br />
and the Transfer of Funds Regulations as two critical pieces of<br />
legislation for the industry. To follow up on this, in 2019 the SRA<br />
wrote to 400 firms, asking them to demonstrate compliance. Of<br />
these, 21 percent could not do so. As recently as April 2021, a law<br />
firm based in Surrey was fined £10,000 for breaches of the Anti-<br />
Money Laundering rules - based partly around a conveyancing<br />
transaction that produced just £850 in fees.<br />
Law firms want to demonstrate that they are doing the right<br />
thing by their clients and showcase their compliance to the<br />
letter of the law. To be in breach, risks not only fines but<br />
significant negative publicity.<br />
Technology has the capability to speed and simplify the process<br />
of complying with legislation, for example by digitising the<br />
process of collating and analysing source of funds information.<br />
Traditionally, a request to a client is sent out via letter or<br />
email. Time passes while the client gathers all the relevant<br />
documentation and shares it, typically either as a series of bank<br />
statements or a digital file. The law firm then sifts through this<br />
and tries to make sense of the information. The process is slow<br />
and manually intensive – the equivalent of seeking a needle in a<br />
financial haystack.<br />
The modern law firm can now use a variety of apps and<br />
services, such as Armalytix, to turn these tiresome and repetitive<br />
processes into a superior digital experience for them and their<br />
clients. Compliance checks can be digitally requested and<br />
approved across multiple accounts in moments, delivering<br />
the relevant data as well as automatically highlighting key<br />
transactions that may need further investigation.<br />
For the law firm the benefits are significant; time and money<br />
saved, resources freed-up and crucially, more efficient and<br />
effective compliance checks. The real beauty is that all those<br />
advantages come whilst providing clients a simpler, smarter and<br />
more secure way of providing their sensitive financial information.<br />
A better client experience with peace of mind, a more efficient firm<br />
and simpler compliance checks. Technology worth embracing.<br />
"To be in breach, risks not only fines but<br />
significant negative publicity"<br />
Amanda Illing<br />
is CEO at<br />
Gatehouse Chambers<br />
Reviewing Our<br />
Core Values<br />
A year ago, I would have said that the culture and<br />
values of our business were important to clients<br />
because particularly in a professional service business,<br />
people buy people. A year on, I would say it is<br />
absolutely vital!<br />
I appreciate that some think that the modern-day customer<br />
is interested in the cheapest, fastest service. However, when<br />
complex legal knowledge and expertise is needed, people look to<br />
their trusted advisers to provide a quality service for which they<br />
are prepared to pay. They also have a better client relationship if<br />
there is a feeling that culture and values are aligned.<br />
Barristers’ chambers are not known for being open about<br />
culture and values, or even prepared to express a strong view<br />
about issues that are emotive or political.<br />
During the course of 2020 and the Black Lives Matter protests<br />
following the murder of George Floyd, a number of legal<br />
bloggers started to investigate historic legal figures, including<br />
Lord Hardwicke, the 18 th century Lord Chancellor. In 1729, Lord<br />
Hardwicke was one of two authors of the Yorke-Talbot opinion<br />
– a legal opinion which provided slave owners with the legal<br />
justification for slavery for many years.<br />
The premises of Hardwicke Building, named by Lincoln’s Inn,<br />
became the name of our chambers in which we occupied since<br />
1991 - until our recent move to 1 lady Hale Gate, Gray’s Inn.<br />
It was of regret that no-one had investigated Lord Hardwicke<br />
or his legacy when we assumed his name as our business<br />
name three decades ago. Once discovered, the name did not<br />
sit comfortably with our values. We were planning to move<br />
location by then, and the concept of perpetuating the legacy<br />
of Lord Hardwicke by taking the name with us when we moved,<br />
was unthinkable and didn’t make any business sense.<br />
The name-change and building move enabled us to review<br />
our core values and agree on an organisational ‘Gatehouse<br />
Chambers Charter’, setting out an internal pledge that is shared<br />
publicly on our website.<br />
An announcement to our clients of the name change, the<br />
Charter, and the reasons why elicited an overwhelmingly<br />
positive response and has brought us closer to many of our key<br />
clients. If we operate in a way that is consistent with our clients’<br />
culture and values, we will have stronger, more loyal client<br />
relationships. It was a brave decision to change our name, but it<br />
was the right one.<br />
"Barristers’ chambers are not known for<br />
being open about culture and values"<br />
41
Mckie Legal Recruitment<br />
Mckie Recruit are a specialist legal<br />
recruiter in personal injury, clinical<br />
negligence, costs and housing.<br />
We have established law firm clients<br />
looking to recruit now:-<br />
• Clinical negligence Solicitors<br />
• Costs lawyers<br />
• Housing Disrepair Litigators<br />
• Personal injury Solicitors (RTA / EL/ PL / disease)<br />
Most of our roles and clients are across the North West.<br />
If you are looking to move roles please contact us on info@mckierecruit.com<br />
or check out our current vacancies at www.mckierecruit.com
EDITORIAL<br />
BOARD<br />
The Three Principles for<br />
Creating a Great Work Culture<br />
A great workplace culture runs<br />
throughout an organisation. It can’t<br />
just be a directive from management<br />
and thinly acted upon just by<br />
mounting some inspiring slogans on<br />
the office walls, it’s fundamentally<br />
driven by the attitudes and values of<br />
the personalities within a business.<br />
For this reason, I think that culture is<br />
significantly affected during growth as<br />
new people join, which makes it a critical<br />
time to consider what core attitudes and<br />
values you want to cultivate. FCI has more<br />
than doubled its headcount in the past<br />
two years, and we’ve found that selecting<br />
like-minded colleagues has been key in<br />
maintaining and improving our culture.<br />
In my experience great working culture<br />
also rests on the three principles of trust,<br />
ownership and accountability. Tweaks to<br />
structure can quickly establish individual<br />
and team responsibility for certain tasks<br />
or goals. If these are fair and realistic,<br />
they can help to create a universal sense<br />
of business ownership. At FCI our team<br />
don’t just work for the business, they are<br />
the business. We have also found success<br />
with a ‘no blame’ ethos which drives trust<br />
and avoids the professional paralysis often<br />
symptomatic of a ‘fear of failure’ culture.<br />
This gives people the freedom to make<br />
decisions and innovate.<br />
Lastly, in my view one of the most<br />
fundamental ingredients is simply<br />
understanding the ‘why?’ of what we do.<br />
It sounds like a cliché, and perhaps it is,<br />
but I have found that for most people to<br />
feel truly content, myself included, we<br />
need to understand what our professional<br />
contribution means in the wider picture of<br />
social or emotional benefit.<br />
At FCI we focus on the fact that even<br />
the smallest of actions affects ordinary<br />
people in the home buying process. At<br />
a stressful time, a speedy response, or<br />
going above and beyond to solve an<br />
environmental concern are all small acts<br />
which achieve the ‘why?’ of what we do,<br />
which is to help people. Ensuring that the<br />
team have the guidance to understand<br />
the significance of their individual<br />
contribution, no matter where it sits in<br />
the business, is a great place to start<br />
building a positive ownership culture.<br />
Though our culture has always been<br />
centred around kindness and respect, the<br />
pandemic has helped us achieve a better<br />
understanding of individual circumstances.<br />
It has given us insight which we might not<br />
otherwise have had, and a valuable lesson<br />
we’d be remiss to quickly lose sight of.<br />
"At FCI our team don’t just<br />
work for the business, they<br />
are the business"<br />
Tim Champney<br />
is Managing Director at<br />
Future Climate Info<br />
Client Experience is<br />
Central to Recruitment<br />
As a Legal Recruitment business, the<br />
client experience is central to our aims<br />
as a business. We are first and foremost<br />
a people business and law firms instruct<br />
us because we engage with them<br />
carefully to find out what their needs<br />
are in terms of legal recruitment and<br />
how we can best assist.<br />
We set up our firm to look specifically at<br />
what a law firm wants in a recruitment<br />
partner - not only in terms of fees, but also<br />
service delivery. Our business is built on<br />
making the recruitment journey easy and<br />
hassle free. Technology has been crucial to<br />
our customer experience and this can be<br />
seen in our creation of a clear and succinct<br />
website, as well as in our use of online<br />
outlets including LinkedIn and Twitter.<br />
We also strive to operate a top-rate candidate<br />
experience and therefore look carefully<br />
at how we engage with candidates, how<br />
we assist them and what they experience<br />
when they engage with us. We focus on<br />
making sure that candidates know exactly<br />
what roles we are putting them forward<br />
for, congratulating a successful one and<br />
giving helpful feedback if a candidate is not<br />
successful. By combining a great experience<br />
for law firms and candidates, it means repeat<br />
business from both becomes inevitable.<br />
Since our inception we have concentrated<br />
on what really matters to our law firm<br />
clients and designed our processes around<br />
that. These are our core principles:<br />
1. Reasonable fees - we charge 12.5%.<br />
2. Vetted candidates - our clients don’t<br />
have the time to sift CVs.<br />
3. Access to a good range of candidates<br />
- to that end we have arranged to advertise<br />
in key publications that our clients’<br />
candidates read, such as Modern Law!<br />
4. An end-to-end process - we take<br />
care of the whole process until our<br />
candidates start.<br />
We are an effective outsource of<br />
recruitment for small firms with no internal<br />
HR Team, so all these things are important<br />
to them.<br />
"We also strive to operate a<br />
top-rate candidate experience<br />
and therefore look carefully<br />
at how we engage with<br />
candidates"<br />
Andrew Mckie<br />
is Director at Mckie Recruitment<br />
43
NEED HELP SCALING YOUR<br />
LEGAL OPERATIONS?<br />
DANACON.<br />
Legal Operations Consultancy for<br />
Modern Legal Teams<br />
SOME OF THE THINGS WE CAN<br />
DO FOR YOU:<br />
LEGAL OPERATIONS<br />
STRATEGY<br />
TECHNOLOGY ROADMAP &<br />
IMPLEMENTATION<br />
We know<br />
the unique<br />
challenges faced by<br />
in-house teams.<br />
Led by Sonia Hadjadj - Founder<br />
Brings real-life experience as an<br />
in-house at global corporate legal<br />
departments & tech scale-up GC.<br />
HELLO@DANACON.CO<br />
WWW.DANACON.CO<br />
167-169 GREAT PORLTAND STREET<br />
5TH FLOOR LONDON W1W 5PF
EDITORIAL<br />
BOARD<br />
Martin Cheek<br />
is Managing Director<br />
at Smartsearch<br />
Technology At Its Best<br />
Technology has always gone hand-in-hand with<br />
customer experience, arguably as far back as the Caxton<br />
printing press 500-years-ago which revolutionised the<br />
experience of reading books in this country.<br />
For most people in their 20s the use of technology is just what<br />
they have grown up with, but for others from a more analogue<br />
generation, there is a perception that doing everything online is<br />
a barrier, because they’re not necessarily ‘tech savvy’.<br />
This is the crux of the issue in my view because the best use of<br />
technology is when the end-user sees it as customer service,<br />
not technology.<br />
When it comes to the use of technology in the legal sector,<br />
whether it’s for conveyancing processes or anti-money<br />
laundering systems, that is the approach that needs to be at the<br />
heart of the matter.<br />
There needs to be as much focus on the front-end userexperience,<br />
as there is in the functionality of the tech itself<br />
when developing a new app or platform. In the digital AML<br />
solution sector, we see a lot of investment going into start-ups<br />
and fintech firms that are making claims about their tech which<br />
don’t stack up when it comes to the end-user experience.<br />
Essentially it doesn’t matter how advanced you claim your solution<br />
is because if the person with the responsibility for onboarding<br />
new customers and going through AML due diligence in a busy<br />
conveyancer’s office can’t work with it, it’s a non-starter.<br />
The direction of travel at the moment is for more and more<br />
remote working and mobile apps to enable customers to access<br />
services wherever they are. This has been borne out of necessity<br />
to a certain extent as the pandemic forced an end to face-toface<br />
meetings, although it probably accelerated the shift that<br />
was already happening towards more remote access.<br />
The best examples of this will ensure that the user can access<br />
the technology with the support of an informed and responsive<br />
customer services team either in live chat or on the phone.<br />
Where it could have a negative impact is if people are left to<br />
negotiate the process with no support if they hit a snag, as they<br />
will lose faith in the tech and the firm promoting its use.<br />
To use a motoring analogy, you would not expect the owner<br />
of a new electric vehicle to have to understand the technology<br />
that goes into generating the power necessary to make the car<br />
move. All they need to do is press the start button.<br />
"A negative impact is if people are left to<br />
negotiate the process with no support"<br />
Laura Fisher<br />
is Marketing Director at<br />
Gunnercooke<br />
If You're Not Adding<br />
Value, You're A Cost<br />
Is it time for a new approach to winning legal work?<br />
My first professional job was in corporate finance, where<br />
I proudly worked up to the title ‘Head of Intelligence’. In<br />
hindsight this was a rather lofty name for ‘researcher’, but it did<br />
teach me the importance of understanding each client’s team,<br />
competitors, sector, and ecosystem. One phrase was used that I<br />
still reflect on often – ‘if you’re not adding value, you’re a cost’.<br />
I had presumed that the approach to winning work in a law<br />
firm would be the same – demonstrate that you understand<br />
and empathise with a business problem and present a solution<br />
to fix it. Yet often, lawyers are trained to head out armed with<br />
only their CV to denote their worth. A client is presented with<br />
a detailed list of every matter the lawyer has ever advised on<br />
and an understanding that the higher their charge out rate, the<br />
more competent this lawyer must therefore be.<br />
As I am not a lawyer, I initially felt unable to question this<br />
approach – who am I to judge the way that they win work<br />
(because as we know this approach works, and lawyers do win<br />
work!). But as time goes on, and we come to expect a more<br />
bespoke, personal customer service in almost every area of our<br />
lives, is it time for lawyers to shirk their own preconceptions<br />
of being a distressed purchase and adopt a new approach to<br />
communicating the value they add?<br />
I know many lawyers who are ‘trusted advisors’ to their clients.<br />
Their remit goes far beyond a distress purchase. They are<br />
on hand around the clock to listen and provide counsel and<br />
they genuinely understand the context of their work. So,<br />
how do they use this experience to add value? They ask great<br />
questions. They truly listen to the answers. They are flexible<br />
and non-prescriptive in their approach, willing to adapt to what<br />
makes most sense for the client.<br />
In the new world, lawyers are not only competing with one<br />
another for work, they are also competing with technology,<br />
solution design, security, and data manipulation. The<br />
expectations are ever higher, but there are many opportunities<br />
for firms to take a new approach to demonstrating their worth.<br />
The ‘value’ of a trusted advisor lies in simple acts of personal<br />
connection, understanding and genuinely caring about making<br />
their client’s life easier, more compliant, and future proof.<br />
Finding compelling ways to communicate and deliver this to<br />
clients has a value far greater than the CV… or the cost.<br />
"Is it time for lawyers to shirk<br />
their own preconceptions of being<br />
a distressed purchase"<br />
45
EDITORIAL<br />
BOARD<br />
Supercharging<br />
Customer Service<br />
We’ve all experienced it. That<br />
moment when you desperately need<br />
to talk to your service provider, but<br />
can’t get through to a real person.<br />
Email forms are met with vague<br />
automated responses, chat bots<br />
fail to understand your nuance<br />
and calling results in a neverending<br />
barrage of ‘press 1 for …’<br />
instructions or worse still voicemail.<br />
In these instances technology is simply<br />
not working well enough. While it<br />
provides the foundations for improved<br />
accessibility, efficiency and commercial<br />
advantage, in these moments the lack of<br />
human insight or touch is costly. It erodes<br />
goodwill, breeds annoyance and delivers<br />
substandard customer care.<br />
However, when digital tools are coupled<br />
with the human touch – the benefits are<br />
supercharged. Working in tandem, tech<br />
and people can improve brand perception,<br />
deliver exceptional and memorable<br />
customer service and create happy clients.<br />
It’s the human touch that shapes how you<br />
make customers feel.<br />
We’ve always believed that technology<br />
needs to support people so they can do<br />
a fantastic job. This company-wide ethos<br />
stems from understanding the nature of<br />
customer enquiries and how they expect<br />
to be treated. For law firms this is typically<br />
because people have an urgent need i.e.<br />
‘my query is really important and timesensitive’,<br />
when a requirement is complex ‘I<br />
want to explain my specific issue and gain<br />
clarity’ and when they require sensitivity<br />
i.e. ’I need empathy; I want a human to<br />
reassure me.’<br />
Increasingly, customers need to be heard<br />
and understood on their terms. So, a<br />
potential client might use live chat because<br />
they need reassurance about a sensitive<br />
issue and a quote in real time. They might<br />
use social media to ask a quick question<br />
out of traditional hours, or perhaps, they’ll<br />
pick up the phone to discuss a complex set<br />
of circumstances in detail.<br />
Digital tools provide the channels or the<br />
means through which to capture these<br />
requests and expedite the issues – but<br />
their real efficacy is determined by people<br />
and their ability to listen, show empathy,<br />
be helpful and embody professionalism.<br />
The legal industry needs technology<br />
that enables it to get closer to clients<br />
and deliver better outcomes. It needs<br />
technology-powered people.<br />
"This company-wide ethos<br />
stems from understanding<br />
the nature of customer<br />
enquiries and how they<br />
expect to be treated"<br />
Bernadette Bennett<br />
is Head of Legal Sector<br />
at Moneypenny<br />
#1 provider of tailored answering<br />
services for the legal industry<br />
Exceptional firms, including sole practitioners and the Magic Circle,<br />
outsource their calls and live chat to Moneypenny.<br />
We give you dedicated receptionists from our specialist legal team, on<br />
hand 24/7, to look after everything your in-house team does and more.<br />
Their can-do attitude and attention to detail delivers outstanding<br />
service to your clients and staff, and significant cost savings for you.<br />
0333 202 1005 | moneypenny.co.uk/legal
10 MINS WITH<br />
Helen Burness<br />
Who inspires/ inspired you<br />
Q and why?<br />
For me, it’s what you might call<br />
A ‘ordinary’ people that inspire me<br />
the most. Hardworking people who<br />
dedicate themselves to caring for others,<br />
especially those who are vulnerable.<br />
I think it is the most important job in<br />
the world and I want to shine a light on<br />
amazing carers everywhere, especially<br />
after this past year and a half on the<br />
front line.<br />
Recently it’s been the English football<br />
team led by Gareth Southgate. The way<br />
they have role modelled throughout this<br />
year has been incredible. I am in absolute<br />
awe of their passion, their talent, their<br />
determination and how they use their<br />
platforms to tackle social issues. I think<br />
Gareth Southgate’s leadership has been<br />
exemplary. As someone who watched the<br />
notorious 1996 penalty shoot-out, I love<br />
this story arc and how he has used this<br />
experience to be such a strong leader<br />
for the team. He is honest, authentic<br />
and leads by example. Marcus Rashford<br />
is a shining example for young children<br />
– I bought his book on “How To Be A<br />
Champion” for my son…. But I think it is<br />
actually for me.<br />
Finally, but certainly not least, I want to<br />
acknowledge (with my legal hat firmly<br />
on) Ruth Bader-Ginsburg, such a huge<br />
inspiration for all she did for gender<br />
equality during her time in office.<br />
What has been the most valuable<br />
Q piece of advice given to you?<br />
To always look to work with people I<br />
A like and respect. It sounds so simple,<br />
but it’s also so easy to forget. The other<br />
piece of advice would be to think about<br />
“Think about<br />
the legacy you<br />
want to leave”<br />
Helen Burness<br />
is Director at Saltmarsh Marketing<br />
the legacy you want to leave. This has<br />
inspired me to do more than just the day<br />
job, and look to use professional privilege<br />
around other issues that impact the legal<br />
profession, such as equality and inclusion.<br />
If you were not in your current<br />
Q position, what would you have<br />
liked to have done?<br />
I actually had a very real dream to<br />
A be an actress! My TikTok content<br />
highlights this if you’ve ever seen it.<br />
The reality was that the talent and<br />
competition was unreal and I wasn’t<br />
actually that good at the serious stuff<br />
- I mainly liked to partake in comedy<br />
(also – see my TikTok). Away from<br />
acting, I would also still love to write a<br />
book… You can probably tell that I’m<br />
basically a frustrated artist at heart!<br />
Oh, the other dream I have is that I would<br />
also quite like to own my own vineyard<br />
and make nice wine. I don’t know much<br />
about the process at the moment, but I<br />
feel certain I could figure it out?<br />
What three items would you put on<br />
Q display in a museum of your life?<br />
This is such a great question! An<br />
A old 1980s cassette of one of my<br />
recordings of the Sunday chart show<br />
(this reference will be lost on so many.) A<br />
photo of me, my husband and the kids.<br />
A glass of red wine.<br />
What three guests would you<br />
Q invite to a dinner party?<br />
Phoebe Waller-Bridge (Fleabag) and<br />
A French and Saunders. That would<br />
be such a fun dinner party! Maybe Ruth<br />
(Bader Ginsburg) could also join us….<br />
47
ROUNDTABLE<br />
Price Bailey Roundtable<br />
For this current edition, Modern Law hosted an exciting new roundtable in<br />
collaboration with Price Bailey LLP. By drawing on 12 voices, from 12 firms across<br />
the country, we hoped to find out more about the important questions that have<br />
come out of the past 18 months. What lessons were learnt from the change in<br />
our ways of working i.e. flexi working, virtual meetings, remote management?<br />
Have these things led to an increase in bottom-line figures? What impact has this<br />
had on maintaining firms’ culture and attracting new talent into the firm? How<br />
can firms look to maximise the opportunities out there and will they look to add<br />
additional service lines in order to mitigate revenue stream risks?<br />
48
ROUNDTABLE<br />
Joining me for the discussions will be the Chair of the<br />
roundtable, Howard Sears, Board Member and Practice<br />
Chairman at Price Bailey LLP. Alongside him will also be<br />
Chris Godsave, Partner and Chand Chudasama, Strategy<br />
& Corporate Finance Partner – both of Price Bailey LLP.<br />
Finally, Graham Martin, Relationship Director at Barclays<br />
Bank PLC, will be lending his knowledge on the financial<br />
impact he has seen across the legal sector this past year.<br />
So, before we begin, who are Price Bailey?<br />
Price Bailey LLP<br />
Price Bailey is a multidiscipline firm of chartered accountants.<br />
The firm has 10 offices covering East Anglia and London, with a<br />
strategic international presence. Price Bailey has grown to be the<br />
26th largest accounting firm in the UK, and bases its success on<br />
forming strong, trusted lasting relationships with its clients and<br />
professional contacts.<br />
Price Bailey has 31 partners with varying specialities and aims<br />
to have a service line to support clients at every stage of their<br />
life cycle; offering audit and compliance services, specialist tax<br />
advice, systems support, a fully outsourced finance function,<br />
private client services and strategic advisory services.<br />
Price Bailey has been in existence, in the same name, for over<br />
80 years. Keeping its name for that time, and growing mainly<br />
economically, the firm has a strong and supportive ethos,<br />
providing a supportive environment for its staff and clients.<br />
‘Contact Time’, is time recorded with clients but at zero rate.<br />
The team spend as much of this time with their clients as they<br />
can, using the time to understand them and their business, and<br />
personal ambitions.<br />
49
ROUNDTABLE<br />
ROUNDTABLE<br />
CHAIR: What’s been the key lessons that you’ve<br />
learnt in the last 18 months and what positives<br />
have come out of having to go into lockdown for<br />
your law firm? Has productivity increased?<br />
Kicking off the discussion was Roger Bull, Burges Salmon<br />
LLP. “From the client perspective, our firm received an<br />
overwhelmingly positive response and it also helped develop<br />
relationships because we were all fighting the same fire. I think<br />
there was some initial concern that the client relationships<br />
would suffer and in turn business development, but in fact we<br />
found a lot more of our clients were willing to use technology<br />
to have a 20-minute meeting or catch up.” Roger goes on to<br />
speak about how it had also driven collaboration within their<br />
team. “People have pulled together with an absolute common<br />
goal. We’ve taken some real positives around transparency and<br />
communication - being a lot more open with what’s happening<br />
to the business, what the leadership thinking is and why we’re<br />
doing what we’re doing at this current time.”<br />
Jessica Szczelkun, O’Neill Patient Solicitors, agreed with<br />
this view before adding her own insight to this question posed<br />
by the Chair. “We’ve found that a real positive has been how<br />
it’s built greater trust in our firm. We didn’t see productivity<br />
suffer; we saw it shift. Though our workforce were working<br />
slightly different hours and people would be logging in after<br />
the children had gone to bed, we supported that and were able<br />
to offer more flexible style working. I feel it has really helped<br />
strengthen the relationship across the board and has pulled us<br />
much closer as an organisation. There’s more accountability<br />
and there’s more communication because we knew we had<br />
to make the effort to get in touch with people, rather than just<br />
being busy or doing all day jobs.”<br />
“Yeah, I completely agree with that” says Nadia Biles Davies,<br />
Sharpe Pritchard LLP. “For us, there was a concern around a<br />
dilution of culture because everyone’s working further apart.<br />
However, actually we’ve been working more closely than ever<br />
because you can have an all firm meeting, but you don’t have to<br />
get everyone in the room - everyone can join in. Nadia outlines<br />
some of the initiatives they have set up in order to keep the<br />
team connected and strengthen the culture of the firm. “We<br />
recently did a ‘Desert Island Discs’ where everyone had to share<br />
their island discs with a bit of a story behind it. It was actually<br />
the brainchild of our wonderful trainees and by getting everyone<br />
from across the firm involved, within a few short months we<br />
really got to know each other in a way that I think we wouldn’t<br />
have done before lockdown. In many ways, that culture of us all<br />
being in it together - like Roger mentioned earlier - meant that<br />
our culture continued to be enhanced as opposed to diluted.”<br />
CHAIR: That’s great to hear that you feel there<br />
have been huge positives for your firm. So,<br />
with that in mind, what’s your message about<br />
returning to the office for you as a firm?<br />
“For us, it’s about trying to take your team along on your<br />
journey and providing that flexibility” says Richard Baker,<br />
Stephens Scown LLP. “We’ve gone for, in principle, two days<br />
a week in the office but are leaving it very flexible. We wanted<br />
to allow our team leaders to make a lot of those decisions and<br />
have given them the training around that in order to try and<br />
balance what we call the ‘scowner’ experience (people who<br />
work here), with the client experience.” Richard believes it’s<br />
really important to provide people with the flexibility because<br />
there are very genuine concerns coming out in the sector<br />
around wellbeing. “We’ve tried to pick up on them, but we<br />
haven’t necessarily seen the full extent of it yet. It’s not just<br />
about work is it, it’s about what people have been through in<br />
their personal lives, whether that’s their parents, friends or<br />
other relatives who might have suffered - it’s been a very hard<br />
time for people.”<br />
“With us, I don’t want to be controversial, but our experience has<br />
been a mixed bag” claims Abu Kibla, Stuart Miller Solicitors.<br />
“I found that many of our staff didn’t know how to manage<br />
themselves working at home. They actively called me and said,<br />
look, can I come back to the office? Surprisingly it was mainly<br />
the younger members of staff that did this.” For Kibla - whose<br />
firm litigates criminal cases - having your own caseload can<br />
be very isolating and what he’s seen is that most of his team<br />
are happy to be back in the office. “I see the connections that<br />
people have made since coming back and though I share the<br />
sentiments of others round this table, in terms of the massive<br />
improvements in cost savings and being more efficient, I think<br />
on a human level when you take into account the type of work<br />
we do - it has been very difficult.”<br />
Jeff Lewis, Brabners, picks up on the point that Kibla makes<br />
about junior members of staff. “That’s the one thing that<br />
we probably do need to keep a real eye on going forward -<br />
supervision, mentoring and training our junior people. As I<br />
always say to junior people or those that are newly qualified<br />
- you can read as many books as you like and go to as many<br />
training courses as you like, but actually sitting in the office<br />
and watching the people who have been doing the job for a<br />
long time is priceless.” Lewis explains that you need to make<br />
sure that there is still the ability for people to learn from those<br />
who have been doing it for a long time and has learnt over the<br />
past 18 months that this is not always the same when working<br />
from home. “We also need to make sure that our senior people<br />
have got people on hand who they can delegate the work to.<br />
Otherwise, it’s very easy for senior people to cling onto the work<br />
and say, well, I can do it faster myself, but that’s not doing the<br />
firm or the junior people any benefit in the long term.”<br />
With everyone talking about the generational differences in<br />
wants and needs, Chris Godsave, Price Bailey, suggested<br />
people need to feel connected to other people and to place.<br />
The hardest thing is to work out<br />
what makes an attractive client<br />
and then working out how to<br />
develop a relationship with them<br />
and how you can add value to<br />
that relationship<br />
50
ROUNDTABLE<br />
We’ve found that a<br />
real positive has been<br />
how it’s built greater trust<br />
in our firm. We didn’t see<br />
productivity suffer;<br />
we saw it shift.<br />
“Place plays a big part in creating that ethos and culture. If<br />
people are going to be working remotely, you might suggest<br />
that maybe the older generation - with their nice family homes<br />
and gardens - are happier to work from home than the younger<br />
generations who are in much smaller spaces. Consequently,<br />
there’s then a danger that your office is unevenly split between<br />
juniors and those with more experience.”<br />
CHAIR: That’s an interesting point Chris… how<br />
important do you think office space is in in<br />
keeping your culture?<br />
“I think it’s really important for the younger generation” claims<br />
Ayesha Nayyar, Nayyars Solicitors. “A lot of the reasons<br />
they get these jobs in the city is to be a part of the whole<br />
graduate training vibe and comradeship. You want to enjoy<br />
those friendships where you go out for lunch/ dinner or drinks<br />
after work and you want that network culture. I think we have<br />
to have an office so that even those members of staff who<br />
don’t come in regularly have still got somewhere to go.” In<br />
fact, Ayesha introduced an outside garden area at their office,<br />
which is something that she says would never have happened<br />
two years ago. “When the weather is lovely, it’s absolutely<br />
fabulous. Even on the colder days they want to be outside<br />
because some of the staff have made it beautiful. Recently<br />
we’ve enjoyed a Euros party out there and have many more<br />
social gatherings planned now things are opening up - it’s<br />
great for the team spirit.”<br />
After a short break, the Chair decided to move the conversation<br />
on to pastures new...<br />
Taking the opportunity to pose a question was Chand<br />
Chudasama, Price Bailey, who asked if anyone had found the<br />
need to diversify how work is won? “I think for many lawyers,<br />
work is won through referral and cross-selling other services<br />
to the existing client base. This might be harder if we stay in a<br />
remote environment, but not necessarily. Have people found<br />
that digital marketing and other ways of attracting new clients<br />
has been high on the agenda?”<br />
51
ROUNDTABLE<br />
I definitely feel from a recruitment perspective it’s been massive. Most people<br />
we speak to that work in and around the legal sector are finding tremendous<br />
problems with recruitment<br />
“Definitely so. We’re quite systematic about it and we do a lot<br />
of big data analytics to work out who we want to work with in<br />
order to segment the market” states Stephen Crow, Clarion<br />
Solicitors. “The traditional approach for professionals is that<br />
you meet somebody for dinner or at some sort of event, you<br />
exchange business cards and you might then convert them<br />
into being a client. However, the risk is that you then realise<br />
they’re not the client you wanted or they might not want to pay<br />
for your service at all. The hardest thing is to work out what<br />
makes an attractive client and then working out how to develop<br />
a relationship with them and how you can add value to that<br />
relationship. That’s what we spend a lot of our time doing.”<br />
Ian Jones, Backhouse Jones followed this by explaining what<br />
they had done to diversify how their work was won. “We did two<br />
things and we diversified into two areas: the training side we<br />
took online and we set ourselves a modest revenue aspiration<br />
shall we say. Thankfully, we completely smashed through that<br />
five-fold and we’re now charging for the training that we provide<br />
to the transport industry.” Ian goes onto explain how the other<br />
way that they expanded was equally interesting. “The one thing<br />
that I’ve always wanted to do for 20 years was take our brand<br />
and diversify it into an insurance brokerage. We had all this time<br />
last year where we could rethink our business model and so we<br />
started BACKsure. Though it’s a different regulatory framework<br />
(which we had to get our heads around), it’s now up and<br />
running. So certainly, from a diversification point of view, we’ve<br />
done two things – BACKsure and BACKacademy.”<br />
Coming in from a banking angle was Graham Martin, Barclays<br />
Bank. “Another model that I’ve seen being adopted is the<br />
consultancy model. A firm that I work with is very much a<br />
consumer, high-volume model but about two years ago, they<br />
started to also introduce the consultancy model. What I’m now<br />
seeing is an escalation in this due to the flexibility of working<br />
from home and geographical restrictions being lifted. I’m not<br />
saying it’s right for every firm, but it’s certainly worked for that<br />
firm and has diversified their income stream so that when the<br />
conveyancing market does subside - they’ve got that model<br />
there as half their income. I definitely see that model having a<br />
place for firms going forward.”<br />
CHAIR: Are you finding that the changes you’ve<br />
made to your firm are in turn changing the<br />
geography of your client base? Are you now<br />
picking up clients where the geography isn’t<br />
important to them anymore? And same with<br />
staff as well?<br />
Though most of the attendees around the table nodded in<br />
agreement to this question posed by the Chair, it was Joanna<br />
Kingston-Davies, Jackson Lees Group who began the<br />
discussion. “I definitely feel from a recruitment perspective<br />
it’s been massive. Most people we speak to that work in and<br />
around the legal sector are finding tremendous problems<br />
with recruitment.” Joanna explains that they are now seeing<br />
city firms able to pay city rates to people who are not<br />
necessarily working in the city but instead are able to work<br />
in the countryside or less urban areas remotely. “People are<br />
attracted by London or Manchester salaries without the need<br />
to commute anymore, so it’s huge.” “I think client wise we’re<br />
seeing that a little bit less, although, obviously the fact that<br />
people can communicate with you via Zoom exclusively means<br />
that the opportunities are there - whether anybody has I’m not<br />
sure just yet - but the opportunity I think is there for the taking.”<br />
“One of our pushes has been on social media” states Verity Slater,<br />
Stephens Scown LLP. “We’ve invested heavily in digital marketing<br />
over the years and punch well above our weight. In January of this<br />
year DSMN8 ranked us the UK and Ireland’s 7th most active law<br />
and legal professionals on social media. That’s definitely brought<br />
in quite a lot of national clients for us that otherwise you might<br />
not have attracted to the Southwest.” Funnily enough, Verity tells<br />
the group that they’re not having too much of a problem with<br />
recruitment because there’s an awful lot of people that want to<br />
52
ROUNDTABLE<br />
get out of the cities and come and live with their families in the<br />
southwest (where they’re based). “For those that do want to leave<br />
the traditional city firm but also want a firm who has great work<br />
and a strong culture - we’re a strong choice. However, we are<br />
losing the odd person up the other way who are being attracted<br />
by corporate jobs. They’ve been enticed into going in-house for<br />
big nationals because they’re getting larger salaries and they’ve<br />
only got to go up to those places once or twice a week, whereas<br />
previously they wouldn’t have even considered that they could get<br />
a job with one of those firms if they lived down in the Southwest.”<br />
Bringing the roundtable to a close, and from an interesting angle<br />
of a law firm working in the international arena, was Sunil Sheth,<br />
Fladgate LLP. “Personally, I think we’re seeing a talent war out<br />
there. Recruitment is a challenging process anyway but over the<br />
past 18 months, it’s become more challenging because people<br />
have left the profession and the development of associates has<br />
stalled because of not having the experience that they would<br />
have had working in the office. This has resulted in the salaries<br />
moving on an upward trajectory and that’s been quite hard for<br />
us.” Despite the challenges, Sunil is quick to point out that there<br />
are plenty of opportunities too. “We found that people started<br />
thinking more about things like estate planning, will, trusts and<br />
power of attorney because they were worried about what was<br />
going on.” He goes on to explain that about 30% of their revenue<br />
is also generated from foreign clients. “We’ve seen a lot of<br />
clients based abroad who think that Britain is a great place to<br />
be because our vaccine program is so far advanced and we’re a<br />
safe haven for their funds. Consequently, we’ve recently set up<br />
a family office catering for high-net-worth individuals who have<br />
assets that need looking after from here - so there are obviously<br />
opportunities out there to diversify. But again, it’s a question of<br />
being fleet of foot and getting in there as early as possible.”<br />
Attendees<br />
CONCLUSION<br />
Earlier this year, Price Bailey hosted a roundtable with the<br />
aim of gaining a better understanding of how law firms<br />
were coping with the third national lockdown and the<br />
impact this was having on their law firms. Fast forward<br />
a few months and after a careful navigation of the<br />
government roadmap, Modern Law sat down with them<br />
again to discover what lessons have now been learnt, what<br />
positives there have been and how the attendees’ law firms<br />
had changed both from the inside and the out.<br />
The discussion was hugely positive and from the write up,<br />
our hope has been to show you a slight glimpse into their<br />
experiences over the past 18 months. Not only did we hear<br />
that people had ironically come closer together during a<br />
time when we were told to stay apart, but culture within the<br />
firms had grown too.<br />
What’s more, we heard how many of our attendees had<br />
adapted their businesses in order to win more work –<br />
whilst others told us of their excitement and need to be<br />
back in the office environment.<br />
Yes, there were common concerns about the recruitment<br />
of talent after such a challenging year, but there was also<br />
huge optimism due to the perquisites of technology that<br />
have made geographical restrictions a thing of the past.<br />
The pandemic isn’t going away any time soon and we may<br />
never return to the normality we all knew before in the legal<br />
sector… but what this roundtable has shown is – is this<br />
necessarily a bad thing?<br />
Stephen Crow<br />
is Director at Clarion<br />
Solicitors Ltd<br />
Ian Jones<br />
is Director / Solicitor<br />
at Backhouse Jones<br />
Verity Slater<br />
is Partner and Board<br />
Member at Stephens<br />
Scown LLP<br />
Joanna Kingston-<br />
Davies<br />
is Director at Jackson<br />
Lees Group<br />
Sunil Sheth<br />
is Senior Partner at<br />
Fladgate LLP<br />
Graham Martin<br />
is Relationship<br />
Director at<br />
Barclays Bank<br />
Chris Godsave<br />
is Partner at Price<br />
Bailey<br />
Chand Chudasama<br />
is Strategy &<br />
Corporate Finance<br />
Partner at Price Bailey<br />
Howard Sears<br />
is Practice Chairman<br />
at Price Bailey<br />
Nadia Biles Davies<br />
is Chief Operating<br />
Officer at Sharpe<br />
Pritchard LLP<br />
Ayesha Nayyar<br />
is Director at Nayyars<br />
Solicitors<br />
Roger Bull<br />
is Managing Partner<br />
at Burges Salmon<br />
LLP<br />
Jessica Szczelkun<br />
is Group Sales<br />
Director at O’Neill<br />
Patient Solicitors<br />
Richard Baker<br />
is Managing Partner<br />
at Stephens Scown<br />
LLP<br />
Jeff Lewis<br />
is Head of Litigation &<br />
Member at Brabners<br />
Abu Kibla<br />
is Director & Solicitor<br />
at Stuart Miller<br />
Solicitors Limited<br />
53
FEATURE<br />
Consumer Behaviour<br />
is Changing<br />
Founded in 2017, Glenesk look to improve the profitability of their clients by identifying the<br />
opportunities for sustained improvements in operating performance and reducing cost,<br />
cash lock-up and risk for businesses across the UK. Bill Guthrie, Director at Glenesk, gives<br />
a detailed insight into the opportunities for law firms surrounding online reviews.<br />
Changes in behaviour<br />
According to our recent analysis of online<br />
reviews for Top UK Consumer Law firms,<br />
consumers wrote 136% more reviews in<br />
2020, than they did in 2019. This mirrors a<br />
wider trend that has seen UK consumers<br />
rely more and more upon online reviews as<br />
a way of quickly checking the reputation<br />
of firms they are inclined to do business<br />
with. The trend has been accelerated<br />
during lockdown because of fewer<br />
opportunities to ask for recommendations<br />
in-person and online review sites are now<br />
the consumers trusted go-to source for<br />
referrals, after family and friends.<br />
Currently, Google reviews and Trustpilot<br />
are by some margin the most popular<br />
review sites for the sector, though due to<br />
the fact that Google reviews are linked<br />
to a geographical site (which is great<br />
for reviewing shops and local services),<br />
it is less well suited to evaluating a firm<br />
or practice’s reputation when they run<br />
multiple offices.<br />
Managing your online brand<br />
Changing consumer behaviour matters<br />
because legal service purchases are based<br />
first and foremost on the reputation of the<br />
firm 1 . This trumps price as the key purchase<br />
consideration across all matter types - with<br />
the exception of Residential Conveyancing,<br />
where reputation comes a close second.<br />
Consumers are looking for assurance that<br />
their potential provider will deliver a high<br />
standard of practice/service quality through<br />
clear communications and timely progress<br />
with a matter. Online reviews provide very<br />
limited feedback on the first point but lots of<br />
feedback on the second, which is why firms<br />
need to engage with the topic. There is only<br />
a limited degree to which online reputation<br />
can be influenced short of delivering a<br />
consistently great service. Not all consumers<br />
will respond to requests to leave feedback<br />
and the evidence shows that there are many<br />
who will leave a review unprompted.<br />
Some partners may be unaware that<br />
online scores, especially on Trustpilot,<br />
are weighted based on the recency and<br />
volume of reviews left, which provides a<br />
further reason for firms to actively engage<br />
with online reviews as an ongoing activity.<br />
Most of the biggest firms in UK<br />
Consumer law are alive to the value of<br />
online reviews and have taken active<br />
steps to encourage and respond to<br />
them. However, approximately 20% of<br />
the firms in our analysis haven’t and<br />
more widely only half of bad reviews<br />
across the sector get a response from<br />
the relevant firm – this must provide an<br />
opportunity for improvement.<br />
Adopting a clear strategy<br />
So, what is it that firms need to do to<br />
drive the great customer experience<br />
that leads to great reviews? The answer<br />
from thousands of online posts is clear;<br />
effective client communication. Both<br />
online compliments and complaints<br />
are dominated by issues of clarity,<br />
consistency, and the timeliness of client<br />
communications. Most firms do this well<br />
most of the time, but only a select few<br />
do it consistently all the time, which is<br />
reflected in their near perfect scores.<br />
Customer’s value feeling respected<br />
and listened to when dealing with their<br />
case; which is understandable given the<br />
stressful circumstances and lack of control<br />
“Most firms do this well most of the time, but<br />
only a select few do it consistently all the time”<br />
experienced during the course of many<br />
matters. Given that 5* reviews outnumber<br />
1* reviews by a ratio of 8:1, there is much<br />
for the sector to be proud of in this regard,<br />
but also variation between practices and<br />
firms that is hard to ignore.<br />
The very best firms at customer<br />
experience do three things differently<br />
from the rest of the sector:<br />
Firstly, they design customer experience<br />
into their ways of working. That could<br />
mean configuring your case management<br />
systems to provide prompts to<br />
communicate based on case progress or<br />
elapsed time since last contact. Or it might<br />
involve designing discovery processes with<br />
as much thought to giving the client the<br />
information about the matter ahead, as it<br />
does to collecting the information needed<br />
by case managers to proceed. What<br />
matters is that you don’t leave customer<br />
feedback to chance and design customer<br />
service into your data, systems, processes,<br />
and staff supervision in a coherent way so<br />
that it is done consistently at scale.<br />
The second thing they do differently is to<br />
learn from experience. No firm is perfect,<br />
but the best ones use their data to<br />
identify patterns in less favourable reviews<br />
and then address the underlying issues.<br />
From an analysis of all the Trustpilot<br />
reviews left for the top firms in our<br />
analysis, almost all show the same issues<br />
occurring year after year, indicating that<br />
lessons aren’t identified, or worse, that<br />
they aren’t addressed once known.<br />
Finally, the best firms are also committed<br />
to addressing customer service when<br />
something goes wrong. A little over half<br />
of 1* online reviews receive a response<br />
from the relevant firm, but an even<br />
smaller percentage get a personalised<br />
message and a smaller proportion still<br />
54
FEATURE<br />
“A little over half of 1* online<br />
reviews receive a response<br />
from the relevant firm”<br />
show evidence that the firm is proactively<br />
trying to recover the situation. For those<br />
firms that go the extra mile, there is not<br />
just an opportunity to change the views of<br />
a lost advocate, but also to communicate<br />
powerfully to potential customers that<br />
customer service really does matter at<br />
your firm.<br />
Role of the Regulators<br />
Changing consumer behaviour is the<br />
most important element driving online<br />
quality measures, but the increasing<br />
interventions of the regulators stemming<br />
from the findings of the Competition<br />
& Markets Authority 2 , will also play a<br />
role given their conclusion that there is<br />
a lack of competition in the legal sector<br />
creating adverse consumer outcomes.<br />
Given the limited progress perceived<br />
since the CMAs initial report in 2016,<br />
the regulators will play a role to<br />
facilitate market growth, by promoting<br />
innovation and the commercial<br />
incentives for legal services providers to<br />
meet the consumer demand.<br />
The focus on the work commenced in<br />
March of this year by the SRA, CLC, CILEX<br />
and BSB, is to pilot various initiatives<br />
to address the persisting lack of easily<br />
accessible and comparable data on<br />
quality measures and to learn which may<br />
positively provide more meaningful data<br />
for consumers to access before they select<br />
a legal services provider, with the initial<br />
focus on conveyancing and employment.<br />
The pilot period has been extended and<br />
there were more than 70 firms 3 by July<br />
who had signed up to the pilot, with<br />
more having joined since.<br />
The work of the LSB as the oversight<br />
regulator is going to be important<br />
alongside of the front-line regulators.<br />
The LSB have recently recognised in their<br />
response to their own discussion paper<br />
on improving the transparency of quality<br />
measures 4 , that there are a range of<br />
further initiatives required to stimulate<br />
a market response to the dysfunction,<br />
including creating a digital register<br />
comparing as a minimum a base level of<br />
information on transparency measures<br />
which can be easily compared.<br />
Key Findings<br />
A couple of notes of caution should<br />
be sounded when evaluating online<br />
quality measures. It should be noted<br />
that your mix of business will in turn<br />
influence the feedback you receive<br />
from consumers. There is a consistent<br />
pattern in the data that ranks from top<br />
to bottom, Residential Conveyancing,<br />
Personal Injury, Wills/Trusts and Probate,<br />
Employment, then Family matters.<br />
Though the cause of this is not proven,<br />
we suspect from summaries of key<br />
words contained in reviews (that have<br />
been grouped by practice area), that<br />
there is a link between the degree to<br />
which the client felt they achieved a<br />
satisfying result following the end of<br />
their matter and the score provided.<br />
It should also be remembered that the<br />
majority of reviews are left by customers<br />
rather than those who chose not to engage<br />
your services. The reasons why not can<br />
be both instructive and very valuable to<br />
firms as enquiries usually far outstrip new<br />
business. When dealing with enquiries, a<br />
clear split emerges between Alternative<br />
Business Structures, who typically manage<br />
them much more effectively, and Limited<br />
Liability Partnerships. A more detailed<br />
discussion on this and other points raised<br />
in this article can be found at https://<br />
www.gleneskgroup.com/legal-services/<br />
customer-service-review/.<br />
Bill Guthrie<br />
is Director at Glenesk<br />
1. How consumers are choosing legal services, Legal<br />
Services Consumer Panel, August 2020<br />
2. Final report (publishing.service.gov.uk)<br />
3. SRA | SRA Update 94 comparison websites pilot |<br />
Solicitors Regulation Authority<br />
4. Quality Indicators Discussion Paper response<br />
document (legalservicesboard.org.uk)<br />
55
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyyyy<br />
22002200<br />
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt<br />
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd<br />
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst<br />
Whhhaaaaatttttttt dddooooooo ccooooooonnnnsssssssummmmmeeeeeeeerrrrrrsssssss wwwaaaaannnntttttttt ttttttttooooooo ssssssseeeeeeeeeeeeeeee<br />
ffrrrrrrooooooommmmm rrrrrreeeeeeeevviiiieeeeeeeewwwsssssss aaaaannnnddd rrrrrreeeeeeeevviiiieeeeeeeewww<br />
ppllaaaaattttttttffooooooorrrrrrmmmmmsssssss ttttttttooooooo hhheeeeeeeellpp tttttttthhheeeeeeeemmmmm<br />
beeeeeeeetttttttttttttttteeeeeeeerrrrrr<br />
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk<br />
rrrrrrreeeeeeeevviiiiitiiieeeeeeeewssssssss tttttttthhhhhhaaaaaaaannnnannn tttttttthhhhhheeeeeeeeyyay hhhhhhaaaaaaaavvieeeeeeee iiiitiiinnnnannn tttttttthhhhhheeeeeeee<br />
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr<br />
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy<br />
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyy 2222000022220000 00002222/00002222<br />
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt<br />
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd<br />
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst<br />
Peeeeeeeeooooopppplleeeeeeee<br />
ssssseeeeeeeeeeeeeeeek<br />
aaaaauuttttttttheeeeeeeennnnnnnttttttttiiiiicciiiiitttttttty,<br />
nnnnnnnoooootttttttt<br />
Assssssssssssoooooooocciiiiiaaaaatttttteeeeee PPrrrrroooooooofffeeeeeessssssssssssoooooooorrrrr oooooooofff Maaaaarrrrrkeeeeeettttttiiiiinnnnnng, Whhhaaaaarrrrrttttttoooooooonnnnnn Scchhhooooooooooooooooll aaaaatttttt tttttthhheeeeee Unnnnnniiiiivveeeeeerrrrrssssssiiiiittttttyy oooooooofff<br />
ppppeeeeeeeerrrrrrffeeeeeeeeccttttttttiiiiiooooon<br />
Auuuuutttttttthhhhhhhheeeeeeeennnnnnnnttttttttiiiiiiiiccccccciiiiiiiittttttttyyyyy aaaaaaaannnnnnnndddddd ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnncccccccyyyyy<br />
aaaaaaaarrrrrrrreeeeeeee ttttttttwwoooooooo ooooooooffff tttttttthhhhhhhheeeeeeee mmmmmoooooooosssssssstttttttt iiiiiiiimmmmmppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnntttttttt<br />
tttttttthhhhhhhhiiiiiiiinnnnnnnngggssssssss cccccccuuuuussssssssttttttttoooooooommmmmeeeeeeeerrrrrrrrssssssss sssssssseeeeeeeeeeeeeeeekkk ffffoooooooorrrrrrrr wwhhhhhhhheeeeeeeennnnnnnn<br />
lllllllooooooooooooooookkkiiiiiiiinnnnnnnnggg ffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiirrrrrrrrdddddd-ppppppaaaaaaaarrrrrrrrttttttttyyyyy<br />
vvaaaaaaaallllllliiiiiiiiddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn, aaaaaaaannnnnnnndddddd tttttttthhhhhhhheeeeeeeeyyyyy sssssssshhhhhhhhoooooooouuuuulllllllddddddnnnnnnnn’tttttttt<br />
bbbeeeeeeee<br />
dddeeeeeeeecciiiisssssssiiiiooooooonnnnsssssss ?<br />
Reeeeeeeeviieeeeeeeewsssssss aaarrrrrrreeeeeeee oooooooonneeeeeeee oooooooofffff ttttheeeeeeee<br />
mmoooooooossssssstttt ttttrrrrrrrussssssstttteeeeeeeed fffffoooooooorrrrrrrmmsssssss oooooooofffff<br />
sssssssoooooooociiaaal<br />
prrrrrrroooooooooooooooofffff <br />
SSooooootoccceccciiiitiiiaaaaaaaalllll pprrrrrrrooooootoooooootofffff iiiitiiissssssss beeeeeeeecccecccooooootommmiiiitiiinnnnannngg<br />
iiiitiiinnnnannncccecccrrrrrrreeeeeeeeaaaaaaaassssssssiiiitiiinnnnannngglllllyyay eeeeeeeefeeeeeeeecccecccttttttttiiiitiiivvieeeeeeeeye aaaaaaaannnnannnon ttttttttooooootoonaaaaaaaayyayye<br />
aaaaaaaalllllmmmooooootosssssssstttttttt hhhhhhaaaaaaaalllllfffff ooooootofffff UK cccecccooooootonnnnannnssssssssuummmeeeeeeeerrrrrrrssssssss<br />
aaaaaaaarrrrrrreeeeeeee rrrrrrreeeeeeeelllllyyayiiiitiiinnnnannngg mmmooooootorrrrrrreeeeeeee ooooootonnnnannn ooooootonnnnannnllllliiiitiiinnnnannneeeeeeee<br />
ppaaaaaaaasssssssstttttttt 2 yyayeeeeeeeeaaaaaaaarrrrrrrssssssss.<br />
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!<br />
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss<br />
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee<br />
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.<br />
oooooooovveeeeeeeerrrrrrrrlllllllooooooooooooooookkkeeeeeeeedddddd.<br />
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk<br />
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr<br />
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy<br />
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!<br />
Cooooonnnnnnnsssssuumeeeeeeeerrrrrrsssss pppprrrrrreeeeeeeeffeeeeeeeerrrrrr ttttttttooooo<br />
lleeeeeeeeaaaaaveeeeeeee rrrrrreeeeeeeeviiiiieeeeeeeewsssss iiiiinnnnnnn aaaaannnnnnn<br />
yyoouurr<br />
Prrrrrrrooooooodddduuuuucttttt<br />
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss<br />
oooooppppeeeeeeeennnnnnn aaaaannnnnnnd ttttttttrrrrrraaaaannnnnnnsssssppppaaaaarrrrrreeeeeeeennnnnnntttttttt<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss<br />
Reeplyy<br />
frroom<br />
buusssineessssss<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee<br />
Reeplyy<br />
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee<br />
yyoouurr<br />
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.<br />
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd<br />
bbbyyyy<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss<br />
Jaaaaaanneeeeeee<br />
frroom<br />
buusssineessssss<br />
yyoouurr<br />
Reeplyy<br />
frroom<br />
buusssineessssss<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee<br />
Prrrrrrrooooooodddduuuuucttttt<br />
yyoouurr<br />
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd<br />
bbbyyyy<br />
Reeplyy<br />
mmmmmaaaaakeeeeeeee<br />
“TThhhhhhhhiiiiiiiinnnnnnnngggssssssss tttttttthhhhhhhhaaaaaaaatttttttt aaaaaaaarrrrrrrreeeeeeee uuuunnnnnnnnbbbbbiiiiiiiiaaaaaaaasssssssseeeeeeeedddddddd aaaaaaaarrrrrrrreeeeeeee sssssssseeeeeeeeeeeeeeeennnnnnnn aaaaaaaassssssss<br />
nnnnnnnnooooooootttttttt hhhhhhhhaaaaaaaavvvvvviiiiiiiinnnnnnnnggg aaaaaaaannnnnnnn aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa,,,,, eeeeeeeevvvvvveeeeeeeennnnnnnn ssssssssccccchhhhhhhhoooooooooooooooollllllssssssss<br />
Jaaaaaanneeeeeee<br />
aaaaaaaannnnnnnndddddddd mmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaa +ccccchhhhhhhhaaaaaaaannnnnnnnnnnnnnnneeeeeeeellllllssssssss,,,,, wwhhhhhhhheeeeeeeetttttttthhhhhhhheeeeeeeerrrrrrrr lllllliiiiiiiibbbbbeeeeeeeerrrrrrrraaaaaaaallllll<br />
oooooooorrrrrrrr cccccoooooooonnnnnnnnsssssssseeeeeeeerrrrrrrrvvvvvvaaaaaaaattttttttiiiiiiiivvvvvveeeeeeee mmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaa,,,,, tttttttthhhhhhhheeeeeeeeyyyyy hhhhhhhhaaaaaaaavvvvvveeeeeeee aaaaaaaannnnnnnn<br />
aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa. —ooooooooccccciiiiiiiiaaaaaaaallllll mmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaa ttttttttoooooooooooooooo. Faaaaaaaaccccceeeeeeeebbbbboooooooooooooooo{,,,,,<br />
frroom<br />
CNETT,,,,, Ammmmmaaaaaaaazoooooooonnnnnnnn oooooooorrrrrrrr eeeeeeeeBaaaaaaaayyyyy cccccoooooooouuuulllllldddddddd bbbbbeeeeeeee sssssssseeeeeeeeeeeeeeeennnnnnnn<br />
buusssineessssss<br />
aaaaaaaassssssss hhhhhhhhaaaaaaaavvvvvviiiiiiiinnnnnnnnggg aaaaaaaannnnnnnn aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa’ hhhhhhhheeeeeeeennnnnnnn yyyyyoooooooouuuu sssssssseeeeeeeeeeeeeeee<br />
ssssssssttttttttaaaaaaaannnnnnnnddddddddaaaaaaaalllllloooooooonnnnnnnneeeeeeee cccccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr rrrrrrrreeeeeeeevvvvvviiiiiiiieeeeeeeewwssssssss,,,,, tttttttthhhhhhhheeeeeeeeyyyyy ’rrrrrrrreeeeeeee<br />
nnnnnnnnooooooootttttttt peeeeeeeerrrrrrrrccccceeeeeeeeiiiiiiiivvvvvveeeeeeeedddddddd ttttttttoooooooo hhhhhhhhaaaaaaaavvvvvveeeeeeee aaaaaaaannnnnnnn aaaaaaaacccccttttttttoooooooorrrrrrrr oooooooorrrrrrrr<br />
eeeeeeeennnnnnnnttttttttiiiiiiiittttttttyyyyy bbbbbeeeeeeeehhhhhhhhiiiiiiiinnnnnnnndddddddd tttttttthhhhhhhheeeeeeeemmmmm.”<br />
Prrrooofeeessssooorrr Jooonah Beeerrrgeeer<br />
PPeeeeeennnnnnnnnnnnssssssyyllvvaaaaannnnnniiiiia<br />
499%%<br />
ooooooff<br />
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss<br />
sesssssseeeecueeleeeecueenccccttttteeeecueed<br />
pppoooooosessssssiiiiiiiitttttiiiiiiiivvveeeecuee<br />
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrr rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss iiiiiiiinennnn<br />
ttttt hhheeeecueeiiiiiiiirrrrrrrr tttttooooooppp ttttt hhhrrrrrrrreeeecueeeeeecuee<br />
pppluuurrrrrrrrncccchhhaasesssssseeeecuee<br />
iiiiiiiinennnnfluuueeeecueenennnnncccceeeecueesesssssss<br />
66Æ%%%%<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr ttttttttoooooooo bbbbuuuuuuuyyyyyyy<br />
fffffffrrrrrrrroooooooommmmmmmm aaaaaaaa rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee<br />
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnnyyyyyyy oooooooovvvvvvvveeeeeeeerrrrrrrr oooooooonnnnnnnneeeeeeee<br />
tttttttt hhhhhhhhaaaaaaaatttttttt aaaaaaaappppppppppppppppeeeeeeeeaaaaaaaarrrrrrrrssssssss ppppppppeeeeeeeerrrrrrrr fffffffeeeeeeeecccccccctttttttt ....<br />
566%%%%<br />
IIonhwThhhhaaahaaaavveeeeemeeontttt a oootoooonnnrnnnnssss'rssonoootooooffoniitiiiiddddeeeeemeeaaahaaaassss'rssonffoootoooorrrrruirongggggrrrrruiroootoooowww wwiitiiiinnnrnnnngggggonmimmyhyyon<br />
bbuutuussss'rssiitiiiinnnrnnnneeeeemeessss'rssssss'rss,onbbuutuutttt a onIIonddddoootoooonnnrnnnn't'tttt a onaaahaaaalllwww wwaaahaaaayhyyssss'rssongggggeeeeemeetttt a ontttt a hwThhhheeeeemeemimmon<br />
rrrrruiriitiiiiggggghwThhhhtttt a ontttt a hwThhhheeeeemeeonfrrrrruirssss'rsstttt a ontttt a iitiiiimimmeeeeemeeeon hwThhhhaaahaaaatttt a 't'ssss'rssonwww wwhwThhhhyhyyonIIontttt a uutuurrrrruir nnnrnnnnontttt a oootooooon<br />
cuutuussss'rsstttt a oootoooomimmeeeeemeerrrrruironrrrrruireeeeemeevviitiiiieeeeemeewww wwssss'rssontttt a oootooooonuutuunnnrnnnnddddeeeeemeerrrrruirssss'rsstttt a aaahaaaannnrnnnnddddon<br />
wwwwhwThhhhaaahaaaatttt a 't'ssss'rssonrrrrruireeeeemeeaaahaaaallllllyhyyonwwwwoootoooorrrrruirkiitiiiinnnrnnnnggggg.<br />
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk<br />
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr<br />
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy<br />
/<br />
899%%<br />
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!<br />
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss<br />
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee<br />
/<br />
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.<br />
822%%%%<br />
oooooooofffffff UK ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee vvvvvvvviiiiiiiieeeeeeeewwwwwwww<br />
ttttttttoooooooowwwwwwwwaaaaaaaarrrrrrrrddddddssssssss<br />
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss<br />
tttttttt hhhhhhhhaaaaaaaatttttttt rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnndddddd ttttttttoooooooo<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss<br />
ooooooff nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss rrrrrrrreeeecueepppoooooorrrrrrrrttttt<br />
ncccchhheeeecueencccckiiiiiiiinennnng<br />
beeeecueeffoooooorrrrrrrreeeecuee<br />
rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss<br />
mmmaakiiiiiiiinennnng<br />
pppluuurrrrrrrrncccchhhaasesssssseeeecueesessssss.<br />
“I ttthiiiinnnk mmooooorrreeeeee aannnd<br />
mmooooorrreeeeee pppeeeeeeooooopppleeeeee aarrreeeeee<br />
yyoouurr<br />
Prrrrrrrooooooodddduuuuucttttt<br />
yyoouurr<br />
Reeplyy<br />
55%%%%<br />
frroom<br />
buusssineessssss<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee<br />
ggeeeeeettttttiiiinnngg sssuussspppiiiiciiiiooooouusss ooooof<br />
5 ssstttaarrr rrraatttiiiinnnggsss‰k<br />
Prrrrrrroooooooofffffeeeeeeeessssssssssssssoooooooorrrrrrr Kaaarrrrrrreeeeeeeenn Cooooooooooooooook<br />
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd<br />
bbbyyyy<br />
Reeplyy<br />
Diiiitiiirrrrrrreeeeeeeecccecccttttttttooooootorrrrrrr ooooootofffff tttttttthhhhhheeeeeeee Innnnannnssssssssttttttttiiiitiiittttttttuutttttttteeeeeeee ooooootofffff Reeeeeeeesssssssseeeeeeeeaaaaaaaarrrrrrrccceccchhhhhh fffffooooootorrrrrrr SSooooootoccceccciiiitiiiaaaaaaaalllll<br />
SSccceccciiiitiiieeeeeeeennnnannnccceccceeeeeeeessssssssye<br />
SSttttttttaaaaaaaannnnannnfffffooooootorrrrrrr d<br />
01/0›<br />
Jaaaaaanneeeeeee<br />
frroom<br />
buusssineessssss<br />
FEATURE<br />
The Power of<br />
Online Reviews<br />
In a world where trust is harder to find<br />
than ever, it’s no surprise that consumers<br />
increasingly seek reassurance before<br />
purchasing decisions. As the internet<br />
provides more and more information<br />
at our fingertips and with traditional<br />
advertising no longer holding the power<br />
it once did, consumers are smarter and<br />
want to know they’re making the right<br />
decision when buying online. In order<br />
to better understand internet consumer<br />
trust, Trustpilot commissioned<br />
independent behavioural insights practice<br />
Canvas8 to explore what consumers<br />
value online and how reviews impact<br />
their behaviour. The following infographic<br />
illustrates the insights that emerged.<br />
56
Auuuuutttttttthhhhhhhheeeeeeeennnnnnnnttttttttiiiiiiiiccccccciiiiiiiittttttttyyyyy aaaaaaaannnnnnnndddddd ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnncccccccyyyyy<br />
aaaaaaaarrrrrrrreeeeeeee ttttttttwwoooooooo ooooooooffff tttttttthhhhhhhheeeeeeee mmmmmoooooooosssssssstttttttt iiiiiiiimmmmmppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnntttttttt<br />
tttttttthhhhhhhhiiiiiiiinnnnnnnngggssssssss cccccccuuuuussssssssttttttttoooooooommmmmeeeeeeeerrrrrrrrssssssss sssssssseeeeeeeeeeeeeeeekkk ffffoooooooorrrrrrrr wwhhhhhhhheeeeeeeennnnnnnn<br />
lllllllooooooooooooooookkkiiiiiiiinnnnnnnnggg ffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiirrrrrrrrdddddd-ppppppaaaaaaaarrrrrrrrttttttttyyyyy<br />
vvaaaaaaaallllllliiiiiiiiddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn, aaaaaaaannnnnnnndddddd tttttttthhhhhhhheeeeeeeeyyyyy sssssssshhhhhhhhoooooooouuuuulllllllddddddnnnnnnnn’tttttttt<br />
bbbeeeeeeee<br />
oooooooovveeeeeeeerrrrrrrrlllllllooooooooooooooookkkeeeeeeeedddddd.<br />
Cooooonnnnnnnsssssuumeeeeeeeerrrrrrsssss pppprrrrrreeeeeeeeffeeeeeeeerrrrrr ttttttttooooo<br />
Reeeeeeviiieeeeeew cceeeeeennnssssoooorrrsssshiiip iiissss nnnoooottt<br />
tttooooleeeeeerrrattteeeeeed by ccoooonnnssssumeeeeeerrrs<br />
lleeeeeeeeaaaaaveeeeeeee rrrrrreeeeeeeeviiiiieeeeeeeewsssss iiiiinnnnnnn aaaaannnnnnn<br />
Allllllllllllllll rrrrrrrreeeeeeeeviiiiiiieeeeeeeewwwssssssss,,, wwwhhhhheeeeeeeetttthhhhheeeeeeeerrrrrrrr ggoooooooooooooooodddddddd oooooooorrrrrrrr<br />
oooooppppeeeeeeeennnnnnn aaaaannnnnnnd ttttttttrrrrrraaaaannnnnnnsssssppppaaaaarrrrrreeeeeeeennnnnnntttttttt<br />
bbbbbaaaaaaaadddddddd,,, sssssssshhhhhoooooooouuuulllllllldddddddd aaaaaaaallllllllwwwaaaaaaaayyyssssssss bbbbbeeeeeeee<br />
ddddddddiiiiiiisssssssspppppllllllllaaaaaaaayyyeeeeeeeedddddddd. Beeeeeeeeiiiiiiinnnnnnnngg aaaaaaaassssssss<br />
waaaaay<br />
ttttrrrrrrrraaaaaaaannnnnnnnsssssssspppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttt aaaaaaaassssssss pppppoooooooossssssssssssssssiiiiiiibbbbblllllllleeeeeeee<br />
Thhhhhhhheeeeeeee nnnnnnnnoooooooottttttttiiiiiiiioooooooonnnnnnnn ooooooooffff cccccccoooooooommmmmppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss bbbeeeeeeeeiiiiiiiinnnnnnnnggg<br />
hhhhheeeeeeeellllllllpppppssssssss cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrrssssssss mmmmmaaaaaaaakeeeeeeee<br />
aaaaaaaabbbllllllleeeeeeee ttttttttoooooooo rrrrrrrreeeeeeeemmmmmoooooooovveeeeeeee nnnnnnnneeeeeeeegggaaaaaaaattttttttiiiiiiiivveeeeeeee oooooooorrrrrrrr<br />
mmmmmoooooooorrrrrrrreeeeeeee iiiiiiinnnnnnnnfoooooooorrrrrrrrmmmmmeeeeeeeedddddddd ddddddddeeeeeeeeccciiiiiiissssssssiiiiiiioooooooonnnnnnnnssssssss,,,<br />
aaaaaaaannnnnnnndddddddd hhhhheeeeeeeellllllllpppppssssssss bbbbboooooooooooooooosssssssstttt cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr<br />
uuuuunnnnnnnnlfaaaaaaaatttttttttttttttteeeeeeeerrrrrrrriiiiiiiinnnnnnnnggg ffffeeeeeeeeeeeeeeeeddddddbbbaaaaaaaaccccccckkk iiiiiiiissssssss<br />
ttttrrrrrrrruuuusssssssstttt iiiiiiinnnnnnnn bbbbbuuuussssssssiiiiiiinnnnnnnneeeeeeeesssssssssssssssseeeeeeeessssssss.<br />
cccccccoooooooommmmmppppppllllllleeeeeeeetttttttteeeeeeeelllllllyyyyy uuuuunnnnnnnnaaaaaaaacccccccccccccceeeeeeeeppppppttttttttaaaaaaaabbbllllllleeeeeeee ttttttttoooooooo<br />
cccccccoooooooonnnnnnnnssssssssuuuuummmmmeeeeeeeerrrrrrrrssssssss .<br />
Cooooonnnnnnnsssssuumeeeeeeeerrrrrrsssss Reeeeeeviiieeeeeew cceeeeeennnssssoooorrrsssshiiip pppprrrrrreeeeeeeeffeeeeeeeerrrrrr iiissss nnnoooottt<br />
ttttttttooooo<br />
tttooooleeeeeerrrattteeeeeed by ccoooonnnssssumeeeeeerrrs<br />
Allllllllllllllll rrrrrrrreeeeeeeeviiiiiiieeeeeeeewwwssssssss,,, wwwhhhhheeeeeeeetttthhhhheeeeeeeerrrrrrrr ggoooooooooooooooodddddddd oooooooorrrrrrrr<br />
bbbbbaaaaaaaadddddddd,,, sssssssshhhhhoooooooouuuulllllllldddddddd aaaaaaaallllllllwwwaaaaaaaayyyssssssss bbbbbeeeeeeee<br />
ddddddddiiiiiiisssssssspppppllllllllaaaaaaaayyyeeeeeeeedddddddd. Beeeeeeeeiiiiiiinnnnnnnngg aaaaaaaassssssss<br />
ttttrrrrrrrraaaaaaaannnnnnnnsssssssspppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttt aaaaaaaassssssss pppppoooooooossssssssssssssssiiiiiiibbbbblllllllleeeeeeee<br />
hhhhheeeeeeeellllllllpppppssssssss cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrrssssssss mmmmmaaaaaaaakeeeeeeee<br />
mmmmmoooooooorrrrrrrreeeeeeee iiiiiiinnnnnnnnfoooooooorrrrrrrrmmmmmeeeeeeeedddddddd ddddddddeeeeeeeeccciiiiiiissssssssiiiiiiioooooooonnnnnnnnssssssss,,,<br />
aaaaaaaannnnnnnndddddddd hhhhheeeeeeeellllllllpppppssssssss bbbbboooooooooooooooosssssssstttt cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr<br />
ttttrrrrrrrruuuusssssssstttt iiiiiiinnnnnnnn bbbbbuuuussssssssiiiiiiinnnnnnnneeeeeeeesssssssssssssssseeeeeeeessssssss.<br />
((445%%))<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr ttttttttoooooooo bbbbuuuuuuuyyyyyyy<br />
fffffffrrrrrrrroooooooommmmmmmm aaaaaaaa rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee<br />
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnnyyyyyyy oooooooovvvvvvvveeeeeeeerrrrrrrr oooooooonnnnnnnneeeeeeee<br />
tttttttt hhhhhhhhaaaaaaaatttttttt aaaaaaaappppppppppppppppeeeeeeeeaaaaaaaarrrrrrrrssssssss ppppppppeeeeeeeerrrrrrrr fffffffeeeeeeeecccccccctttttttt ....<br />
70%%%%<br />
566%%%%<br />
oooooooofffffff ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss iiiiiiiinnnnnnnn tttttttt hhhhhhhheeeeeeee<br />
UK,, tttttttt hhhhhhhhiiiiiiiinnnnnnnnkkk iiiiiiiitttttttt’ssssssss vvvvvvvveeeeeeeerrrrrrrryyyyyyy<br />
6622%%%%<br />
iiiiiiiimmmmmmmmppppppppoooooooorrrrrrrrtttttttt aaaaaaaannnnnnnntttttttt ttttttttoooooooo kkknnnnnnnnoooooooowwwwwwww<br />
eeeeeeeexaaaaaaaaccccccccttttttttllllllllyyyyyyy hhhhhhhhoooooooowwwwwwww rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww<br />
wwwwwwwweeeeeeeebbbbssssssssiiiiiiiitttttttteeeeeeeessssssss cccccccchhhhhhhhoooooooooooooooosssssssseeeeeeee ttttttttoooooooo<br />
ppppppppuuuuuuubbbblllllllliiiiiiiisssssssshhhhhhhh<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
70%%%%<br />
6622%%%%<br />
55%%%%<br />
oooooooofffffff<br />
aaaaaaaannnnnnnndddddd ddddddaaaaaaaammmmmmmmaaaaaaaa ggggeeeeeeeessssssss fffffffrrrrrrrreeeeeeeeeeeeeeeeddddddoooooooommmmmmmm oooooooofffffff ssssssssppppppppeeeeeeeeeeeeeeeecccccccchhhhhhhh ((442%%)) ....<br />
oooooooofffffff UK ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee vvvvvvvviiiiiiiieeeeeeeewwwwwwww<br />
Coooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp lllllllleeeeeeeeaaaaaaaaddddddssssssss ttttttttoooooooo wwwwwwwwaaaaaaaasssssssstttttttteeeeeeeedddddd mmmmmmmmoooooooonnnnnnnneeeeeeeeyyyyyyy<br />
((445%%))<br />
aaaaaaaannnnnnnndddddd ddddddaaaaaaaammmmmmmmaaaaaaaa ggggeeeeeeeessssssss fffffffrrrrrrrreeeeeeeeeeeeeeeeddddddoooooooommmmmmmm oooooooofffffff ssssssssppppppppeeeeeeeeeeeeeeeecccccccchhhhhhhh ((442%%)) ....<br />
ttttttttoooooooowwwwwwwwaaaaaaaarrrrrrrrddddddssssssss<br />
ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
gggglllllllloooooooobbbbaaaaaaaallllllllllllllllyyyyyyy,, wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr<br />
ttttttttoooooooo uuuuuuusssssssseeeeeeee aaaaaaaannnnnnnn ooooooooppppppppeeeeeeeennnnnnnn<br />
ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmm....<br />
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss<br />
tttttttt hhhhhhhhaaaaaaaatttttttt rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnndddddd ttttttttoooooooo<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyy 2222000022220000 00002222/00002222<br />
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt<br />
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd<br />
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst<br />
Peeeeeeeeooooopppplleeeeeeee<br />
Feeeeeeeebbbbbrrrrrrrruuuuaaaaaaaarrrrrrrryyyyy<br />
22002200<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee tttttttt hhhhhhhhaaaaaaaatttttttt<br />
tttttttt hhhhhhhheeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp oooooooofffffff ccccccccuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss iiiiiiiissssssss aaaaaaaa sssssssseeeeeeeerrrrrrrriiiiiiiioooooooouuuuuuussssssss ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrnnnnnnnn....<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss wwwwwwwwoooooooouuuuuuulllllllldddddd ssssssssttttttttoooooooopppppppp<br />
uuuuuuussssssssiiiiiiiinnnnnnnngggg [rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww] ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmmssssssss iiiiiiiifffffff tttttttt hhhhhhhheeeeeeeeyyyyyyy<br />
kkknnnnnnnneeeeeeeewwwwwwww tttttttt hhhhhhhheeeeeeeeyyyyyyy wwwwwwwweeeeeeeerrrrrrrreeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrriiiiiiiinnnnnnnngggg rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
Coooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp lllllllleeeeeeeeaaaaaaaaddddddssssssss ttttttttoooooooo wwwwwwwwaaaaaaaasssssssstttttttteeeeeeeedddddd mmmmmmmmoooooooonnnnnnnneeeeeeeeyyyyyyy<br />
Theeeeee ccrrrrriiiitttttiiiiccall rrrrroolleeeeee oof rrrrreeeeeeviiiieeeeeewss iiiinnn Innnttttteeeeeerrrrrnnneeeeeettttt tttttrrrrrussttttt<br />
Hoooww dddiiffffffeeeeeeeerrrrrreeeeeeeennnnntttttt ttttttypeeeeeeeessss ooofff Innnnntttttteeeeeeeerrrrrrnnnnneeeeeeeetttttt rrrrrreeeeeeeeviieeeeeeeewwssss ccrrrrrreeeeeeeeaaaatttttteeeeeeee aaaannnnnddd<br />
dddaaaammaaaa geeeeeeee ccooonnnnnssssuummeeeeeeeerrrrrr ttttttrrrrrruusssst<br />
Whhhaaaaatttttttt dddooooooo ccooooooonnnnsssssssummmmmeeeeeeeerrrrrrsssssss wwwaaaaannnntttttttt ttttttttooooooo ssssssseeeeeeeeeeeeeeee<br />
ffrrrrrrooooooommmmm rrrrrreeeeeeeevviiiieeeeeeeewwwsssssss aaaaannnnddd rrrrrreeeeeeeevviiiieeeeeeeewww<br />
ppllaaaaattttttttffooooooorrrrrrmmmmmsssssss ttttttttooooooo hhheeeeeeeellpp tttttttthhheeeeeeeemmmmm<br />
beeeeeeeetttttttttttttttteeeeeeeerrrrrr<br />
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk<br />
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr<br />
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy<br />
dddeeeeeeeecciiiisssssssiiiiooooooonnnnsssssss ?<br />
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!<br />
Reeeeeeeeviieeeeeeeewsssssss aaarrrrrrreeeeeeee oooooooonneeeeeeee oooooooofffff ttttheeeeeeee<br />
mmoooooooossssssstttt ttttrrrrrrrussssssstttteeeeeeeed fffffoooooooorrrrrrrmmsssssss oooooooofffff<br />
sssssssoooooooociiaaal<br />
ssssseeeeeeeeeeeeeeeek<br />
aaaaauuttttttttheeeeeeeennnnnnnttttttttiiiiicciiiiitttttttty,<br />
ppppeeeeeeeerrrrrrffeeeeeeeeccttttttttiiiiiooooon<br />
Reeeeeeviiieeeeeew cceeeeeennnssssoooorrrsssshiiip iiissss nnnoooottt<br />
tttooooleeeeeerrrattteeeeeed by ccoooonnnssssumeeeeeerrrs<br />
prrrrrrroooooooooooooooofffff <br />
Allllllllllllllll rrrrrrrreeeeeeeeviiiiiiieeeeeeeewwwssssssss,,, wwwhhhhheeeeeeeetttthhhhheeeeeeeerrrrrrrr ggoooooooooooooooodddddddd oooooooorrrrrrrr<br />
bbbbbaaaaaaaadddddddd,,, sssssssshhhhhoooooooouuuulllllllldddddddd aaaaaaaallllllllwwwaaaaaaaayyyssssssss bbbbbeeeeeeee<br />
SSooooootoccceccciiiitiiiaaaaaaaalllll pprrrrrrrooooootoooooootofffff iiiitiiissssssss beeeeeeeecccecccooooootommmiiiitiiinnnnannngg<br />
ddddddddiiiiiiisssssssspppppllllllllaaaaaaaayyyeeeeeeeedddddddd. Beeeeeeeeiiiiiiinnnnnnnngg aaaaaaaassssssss<br />
nnnnnnnoooootttttttt<br />
Auuuuutttttttthhhhhhhheeeeeeeennnnnnnnttttttttiiiiiiiiccccccciiiiiiiittttttttyyyyy aaaaaaaannnnnnnndddddd ttttttttrrrrrrrraaaaaaaannnnnnnnssssssssppppppaaaaaaaarrrrrrrreeeeeeeennnnnnnncccccccyyyyy<br />
aaaaaaaarrrrrrrreeeeeeee ttttttttwwoooooooo ooooooooffff tttttttthhhhhhhheeeeeeee mmmmmoooooooosssssssstttttttt iiiiiiiimmmmmppppppoooooooorrrrrrrrttttttttaaaaaaaannnnnnnntttttttt<br />
tttttttthhhhhhhhiiiiiiiinnnnnnnngggssssssss cccccccuuuuussssssssttttttttoooooooommmmmeeeeeeeerrrrrrrrssssssss sssssssseeeeeeeeeeeeeeeekkk ffffoooooooorrrrrrrr wwhhhhhhhheeeeeeeennnnnnnn<br />
lllllllooooooooooooooookkkiiiiiiiinnnnnnnnggg ffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiirrrrrrrrdddddd-ppppppaaaaaaaarrrrrrrrttttttttyyyyy<br />
vvaaaaaaaallllllliiiiiiiiddddddaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn, aaaaaaaannnnnnnndddddd tttttttthhhhhhhheeeeeeeeyyyyy sssssssshhhhhhhhoooooooouuuuulllllllddddddnnnnnnnn’tttttttt<br />
bbbeeeeeeee<br />
oooooooovveeeeeeeerrrrrrrrlllllllooooooooooooooookkkeeeeeeeedddddd.<br />
lleeeeeeeeaaaaaveeeeeeee rrrrrreeeeeeeeviiiiieeeeeeeewsssss iiiiinnnnnnn aaaaannnnnnn<br />
oooooppppeeeeeeeennnnnnn aaaaannnnnnnd ttttttttrrrrrraaaaannnnnnnsssssppppaaaaarrrrrreeeeeeeennnnnnntttttttt<br />
waaaaay<br />
Thhhhhhhheeeeeeee nnnnnnnnoooooooottttttttiiiiiiiioooooooonnnnnnnn ooooooooffff cccccccoooooooommmmmppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss bbbeeeeeeeeiiiiiiiinnnnnnnnggg<br />
aaaaaaaabbbllllllleeeeeeee ttttttttoooooooo rrrrrrrreeeeeeeemmmmmoooooooovveeeeeeee nnnnnnnneeeeeeeegggaaaaaaaattttttttiiiiiiiivveeeeeeee oooooooorrrrrrrr<br />
uuuuunnnnnnnnlfaaaaaaaatttttttttttttttteeeeeeeerrrrrrrriiiiiiiinnnnnnnnggg ffffeeeeeeeeeeeeeeeeddddddbbbaaaaaaaaccccccckkk iiiiiiiissssssss<br />
cccccccoooooooommmmmppppppllllllleeeeeeeetttttttteeeeeeeelllllllyyyyy uuuuunnnnnnnnaaaaaaaacccccccccccccceeeeeeeeppppppttttttttaaaaaaaabbbllllllleeeeeeee ttttttttoooooooo<br />
cccccccoooooooonnnnnnnnssssssssuuuuummmmmeeeeeeeerrrrrrrrssssssss .<br />
iiiitiiinnnnannncccecccrrrrrrreeeeeeeeaaaaaaaassssssssiiiitiiinnnnannngglllllyyay eeeeeeeefeeeeeeeecccecccttttttttiiiitiiivvieeeeeeeeye aaaaaaaannnnannnon ttttttttooooootoonaaaaaaaayyayye<br />
aaaaaaaalllllmmmooooootosssssssstttttttt hhhhhhaaaaaaaalllllfffff ooooootofffff UK cccecccooooootonnnnannnssssssssuummmeeeeeeeerrrrrrrssssssss<br />
aaaaaaaarrrrrrreeeeeeee rrrrrrreeeeeeeelllllyyayiiiitiiinnnnannngg mmmooooootorrrrrrreeeeeeee ooooootonnnnannn ooooootonnnnannnllllliiiitiiinnnnannneeeeeeee<br />
rrrrrrreeeeeeeevviiiiitiiieeeeeeeewssssssss tttttttthhhhhhaaaaaaaannnnannn tttttttthhhhhheeeeeeeeyyay hhhhhhaaaaaaaavvieeeeeeee iiiitiiinnnnannn tttttttthhhhhheeeeeeee<br />
ttttrrrrrrrruuuusssssssstttt iiiiiiinnnnnnnn bbbbbuuuussssssssiiiiiiinnnnnnnneeeeeeeesssssssssssssssseeeeeeeessssssss.<br />
ppaaaaaaaasssssssstttttttt 2 yyayeeeeeeeeaaaaaaaarrrrrrrssssssss.<br />
((445%%))<br />
ttttrrrrrrrraaaaaaaannnnnnnnsssssssspppppaaaaaaaarrrrrrrreeeeeeeennnnnnnntttt aaaaaaaassssssss pppppoooooooossssssssssssssssiiiiiiibbbbblllllllleeeeeeee<br />
hhhhheeeeeeeellllllllpppppssssssss cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrrssssssss mmmmmaaaaaaaakeeeeeeee<br />
mmmmmoooooooorrrrrrrreeeeeeee iiiiiiinnnnnnnnfoooooooorrrrrrrrmmmmmeeeeeeeedddddddd ddddddddeeeeeeeeccciiiiiiissssssssiiiiiiioooooooonnnnnnnnssssssss,,,<br />
aaaaaaaannnnnnnndddddddd hhhhheeeeeeeellllllllpppppssssssss bbbbboooooooooooooooosssssssstttt cccoooooooonnnnnnnnssssssssuuuummmmmeeeeeeeerrrrrrrr<br />
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss<br />
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee<br />
ssssuuuuurrrrrrreeeeeeee tttttooooooo ssssuuuuupppplllllllyy mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss<br />
yyoouurr<br />
Prrrrrrrooooooodddduuuuucttttt<br />
66Æ%%%%<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr ttttttttoooooooo bbbbuuuuuuuyyyyyyy<br />
fffffffrrrrrrrroooooooommmmmmmm aaaaaaaa rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiivvvvvvvveeeeeeee<br />
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnnyyyyyyy oooooooovvvvvvvveeeeeeeerrrrrrrr oooooooonnnnnnnneeeeeeee<br />
tttttttt hhhhhhhhaaaaaaaatttttttt aaaaaaaappppppppppppppppeeeeeeeeaaaaaaaarrrrrrrrssssssss ppppppppeeeeeeeerrrrrrrr fffffffeeeeeeeecccccccctttttttt ....<br />
566%%%%<br />
oooooooofffffff ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss iiiiiiiinnnnnnnn tttttttt hhhhhhhheeeeeeee<br />
UK,, tttttttt hhhhhhhhiiiiiiiinnnnnnnnkkk iiiiiiiitttttttt’ssssssss vvvvvvvveeeeeeeerrrrrrrryyyyyyy<br />
iiiiiiiimmmmmmmmppppppppoooooooorrrrrrrrtttttttt aaaaaaaannnnnnnntttttttt ttttttttoooooooo kkknnnnnnnnoooooooowwwwwwww<br />
eeeeeeeexaaaaaaaaccccccccttttttttllllllllyyyyyyy hhhhhhhhoooooooowwwwwwww rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww<br />
wwwwwwwweeeeeeeebbbbssssssssiiiiiiiitttttttteeeeeeeessssssss cccccccchhhhhhhhoooooooooooooooosssssssseeeeeeee ttttttttoooooooo<br />
ppppppppuuuuuuubbbblllllllliiiiiiiisssssssshhhhhhhh<br />
yyoouurr<br />
Reeplyy<br />
frroom<br />
buusssineessssss<br />
499%%<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee<br />
ooooooff<br />
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss<br />
sesssssseeeecueeleeeecueenccccttttteeeecueed<br />
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd<br />
bbbyyyy<br />
Reeplyy<br />
Jaaaaaanneeeeeee<br />
frroom<br />
buusssineessssss<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee tttttttt hhhhhhhhaaaaaaaatttttttt<br />
tttttttt hhhhhhhheeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp oooooooofffffff ccccccccuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss iiiiiiiissssssss aaaaaaaa sssssssseeeeeeeerrrrrrrriiiiiiiioooooooouuuuuuussssssss ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrnnnnnnnn....<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss wwwwwwwwoooooooouuuuuuulllllllldddddd ssssssssttttttttoooooooopppppppp<br />
uuuuuuussssssssiiiiiiiinnnnnnnngggg [rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww] ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmmssssssss iiiiiiiifffffff tttttttt hhhhhhhheeeeeeeeyyyyyyy<br />
kkknnnnnnnneeeeeeeewwwwwwww tttttttt hhhhhhhheeeeeeeeyyyyyyy wwwwwwwweeeeeeeerrrrrrrreeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrriiiiiiiinnnnnnnngggg rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
mmmmmaaaaakeeeeeeee<br />
Thhhaaaaaannkkkssss ffooooorrrrrrr yyyyooooouuuurrrrrrr ffeeeeeeeeeeeeeeddddbbbaaaaaaccckkk<br />
Chhhrrrrrrriiiiissss, wwwweeeeeeee wwwwiiiiiiiillllllllllllll rrrrrrreeeeeeeevvvviiiiiiiissssiiiiiiiittttt ooooooouuuuurrrrrrr<br />
ddddeeeeeeeellllllliiiiiiiivvvveeeeeeeerrrrrrryy<br />
pppoooooosessssssiiiiiiiitttttiiiiiiiivvveeeecuee<br />
nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrr rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss iiiiiiiinennnn<br />
ttttt hhheeeecueeiiiiiiiirrrrrrrr tttttooooooppp ttttt hhhrrrrrrrreeeecueeeeeecuee<br />
pppluuurrrrrrrrncccchhhaasesssssseeeecuee<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
70%%%%<br />
6622%%%%<br />
“TThhhhhhhhiiiiiiiinnnnnnnngggssssssss tttttttthhhhhhhhaaaaaaaatttttttt aaaaaaaarrrrrrrreeeeeeee uuuunnnnnnnnbbbbbiiiiiiiiaaaaaaaasssssssseeeeeeeedddddddd aaaaaaaarrrrrrrreeeeeeee sssssssseeeeeeeeeeeeeeeennnnnnnn aaaaaaaassssssss<br />
nnnnnnnnooooooootttttttt hhhhhhhhaaaaaaaavvvvvviiiiiiiinnnnnnnnggg aaaaaaaannnnnnnn aaaaaaaagggeeeeeeeennnnnnnnddddddddaaaaaaaa,,,,, eeeeeeeevvvvvveeeeeeeennnnnnnn ssssssssccccchhhhhhhhoooooooooooooooollllllssssssss<br />
ssssooooooollllllluuuuutttttiiiiiiiiooooooon!<br />
Weeeeeee’rrrrrrreeeeeee ssssooooo glllaaaaaadddd yyyyooooouuuu llliiiiikkkeeeeeeedddd ttthhhiiiiissss<br />
/<br />
ppaaaaaarrrrrrrtttiiiiicccuuuulllaaaaaarrrrrrr pprrrrrrrooooodddduuuucccttt. Weeeeeeee’llllllllllllll mmakeeeeeeee<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Chhhrrrrrrriiiiissss<br />
yyoouurr<br />
Prrrrrrrooooooodddduuuuucttttt<br />
Reeplyy<br />
frroom<br />
buusssineessssss<br />
Reeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd bbbyyyy Aiiiiimeeeeeee<br />
rrrrrrreeeeeeeevvvviiiiiiiieeeeeeeewwwweeeeeeeedddd<br />
Reeplyy<br />
frroom<br />
yyoouurr<br />
buusssineessssss<br />
ssssuuuuurrrrrrreeeeeeee tttttooooooo uuuuuuussssssssiiiiiiiinnnnnnnngggg ssssuuuuupppplllllllyy [rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww] mmooooooorrrrrrreeeeeeee ooooooof iiiiiiiittttt.<br />
ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmmssssssss iiiiiiiifffffff tttttttt hhhhhhhheeeeeeeeyyyyyyy<br />
iiiiiiiinennnnfluuueeeecueenennnnncccceeeecueesesssssss<br />
/<br />
55%%%%<br />
oooooooofffffff<br />
aaaaaaaannnnnnnndddddd ddddddaaaaaaaammmmmmmmaaaaaaaa ggggeeeeeeeessssssss fffffffrrrrrrrreeeeeeeeeeeeeeeeddddddoooooooommmmmmmm oooooooofffffff ssssssssppppppppeeeeeeeeeeeeeeeecccccccchhhhhhhh ((442%%)) ....<br />
822%%%%<br />
oooooooofffffff UK ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiivvvvvvvveeeeeeee vvvvvvvviiiiiiiieeeeeeeewwwwwwww<br />
ttttttttoooooooowwwwwwwwaaaaaaaarrrrrrrrddddddssssssss<br />
ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss<br />
899%%<br />
bbbyyyy<br />
Jaaaaaanneeeeeee<br />
ooooooff nccccoooooonennnnsessssssluuummmeeeecueerrrrrrrrsessssss rrrrrrrreeeecueepppoooooorrrrrrrrttttt<br />
ncccchhheeeecueencccckiiiiiiiinennnng<br />
beeeecueeffoooooorrrrrrrreeeecuee<br />
rrrrrrrreeeecueevvviiiiiiiieeeecueewwsessssss<br />
mmmaakiiiiiiiinennnng<br />
pppluuurrrrrrrrncccchhhaasesssssseeeecueesessssss.<br />
“I ttthiiiinnnk mmooooorrreeeeee aannnd<br />
mmooooorrreeeeee pppeeeeeeooooopppleeeeee aarrreeeeee<br />
01/0›<br />
gggglllllllloooooooobbbbaaaaaaaallllllllllllllllyyyyyyy,, wwwwwwwwoooooooouuuuuuulllllllldddddd pppppppprrrrrrrreeeeeeeefffffffeeeeeeeerrrrrrrr<br />
ttttttttoooooooo uuuuuuusssssssseeeeeeee aaaaaaaannnnnnnn ooooooooppppppppeeeeeeeennnnnnnn<br />
ppppppppllllllllaaaaaaaattttttttfffffffoooooooorrrrrrrrmmmmmmmm....<br />
ccccccccoooooooommmmmmmmppppppppaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss<br />
tttttttt hhhhhhhhaaaaaaaatttttttt rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnndddddd ttttttttoooooooo<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
Coooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp lllllllleeeeeeeeaaaaaaaaddddddssssssss ttttttttoooooooo wwwwwwwwaaaaaaaasssssssstttttttteeeeeeeedddddd mmmmmmmmoooooooonnnnnnnneeeeeeeeyyyyyyy<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss bbbbeeeeeeeelllllllliiiiiiiieeeeeeeevvvvvvvveeeeeeee tttttttt hhhhhhhhaaaaaaaatttttttt<br />
tttttttt hhhhhhhheeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrrsssssssshhhhhhhhiiiiiiiipppppppp oooooooofffffff ccccccccuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr<br />
rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss iiiiiiiissssssss aaaaaaaa sssssssseeeeeeeerrrrrrrriiiiiiiioooooooouuuuuuussssssss ccccccccoooooooonnnnnnnncccccccceeeeeeeerrrrrrrrnnnnnnnn....<br />
oooooooofffffff gggglllllllloooooooobbbbaaaaaaaallllllll ccccccccoooooooonnnnnnnnssssssssuuuuuuummmmmmmmeeeeeeeerrrrrrrrssssssss wwwwwwwwoooooooouuuuuuulllllllldddddd ssssssssttttttttoooooooopppppppp<br />
kkknnnnnnnneeeeeeeewwwwwwww tttttttt hhhhhhhheeeeeeeeyyyyyyy wwwwwwwweeeeeeeerrrrrrrreeeeeeee cccccccceeeeeeeennnnnnnnssssssssoooooooorrrrrrrriiiiiiiinnnnnnnngggg rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwwssssssss....<br />
FEATURE<br />
57
FEATURE<br />
Demystifying Transformation:<br />
The Experience of Being Legal<br />
Everyday millions of people forgo cheaper coffee and instead stop into Starbucks for their<br />
morning java. They are paying a premium not only for the coffee, but for the Starbucks<br />
experience. Hundreds of thousands of patients were satisfied with their doctors but<br />
switched to virtual care providers like One Medical at the first opportunity, proving how<br />
essential a convenient healthcare experience had been to them all along.<br />
The quality of products and services is important, but we<br />
judge these products and services by the experience we<br />
associate with them. While there are a lot of things you<br />
can fake, you can’t fake how you make people feel. That’s<br />
exactly why you’d be hard pressed to find an industry or segment of<br />
the business that hasn’t gone through an experience transformation,<br />
from pizza delivery to mortgage financing to human resources.<br />
Until recently, the primary focus of human resources was on the<br />
behind-the-scenes management and administration of things like<br />
payroll and benefits. However, today’s progressive CHROs work to<br />
elevate the whole human experience. Programs like flexible work<br />
arrangements, apprenticeships, paid tuition and parental leave,<br />
demonstrate the board-level of commitment to the talent experience.<br />
So why hasn’t legal had a transformation experience? The answer<br />
is steeped in legal’s DNA and goes beyond the services they<br />
provide. Legal departments, built to constantly react and transact,<br />
have been too tactically focused. Their experience is more aligned<br />
to a service centre, than to other departments.<br />
Making the Case for Legal Experience Transformation<br />
It is not often acknowledged, but the legal function sets the pace<br />
of business. Whether it is managing compliance risks, protecting<br />
a company’s unique assets, or determining how fast contracts can<br />
be executed, legal directly impacts the financial P&L of a business.<br />
Now, legal is being asked to do more with less. They are feeling<br />
pressure to transition from being transactional in how they operate,<br />
to delivering transformational experiences that drive business value.<br />
The pandemic accelerated the imperative for legal to transform. As<br />
legal’s adoption of technology has increased over the last year, so has<br />
the data collection on legal’s performance. In the past, the C-suite<br />
might have let legal slide. Now, however, CFOs are questioning the<br />
legal function’s fitness for growth. As a result, legal is going through<br />
cost-takeout and optimisation programs. Budgets are being reduced,<br />
and yet the business expects legal to move at a quicker clip.<br />
To garner the attention of the C-Suite, legal transformation<br />
needs to be based on a bigger vision and be relevant beyond<br />
the tactical and reactionary needs of a business. The experience<br />
transformation of legal needs to take a holistic view and account<br />
for new ways of working, data and insights, people and culture,<br />
and automation and enablement. Legal teams need to establish<br />
an experience mission and roadmap, one that is focused on their<br />
business role in generating revenue – and not just serving as the<br />
gatekeeper for other departments.<br />
Here are the four areas of the customer and employee experience<br />
that legal needs to re-think:<br />
“Legal departments, built to constantly react and transact, have been too tactically focused”<br />
58
FEATURE<br />
“We’re in a day and age where we can track a pizza, but we can’t track a contract approval”<br />
Automation &<br />
Enablement<br />
New Ways<br />
of Working<br />
Data &<br />
Insights<br />
Culture &<br />
People<br />
There are many pain points<br />
that a legal department<br />
faces, and not having enough<br />
budget or enough people are<br />
two of the most significant.<br />
Automation and enablement<br />
combat both problems.<br />
There is no shortage of<br />
software tools that can help<br />
a legal department. The<br />
problem is they are often<br />
cobbled together, underfunded,<br />
have low adoption<br />
or don’t enable legal teams<br />
to operate more efficiently.<br />
When good automation<br />
happens, you don’t realise<br />
it’s happening. When<br />
automation happens properly,<br />
it significantly cuts down on<br />
time spent doing tedious<br />
tasks and allows employees to<br />
focus on the strategic goals of<br />
the business and to develop<br />
purpose-driven relationships.<br />
Legal’s customers will get<br />
more timely responses to<br />
their questions, an optimised<br />
workflow experience, and the<br />
ability to quickly get<br />
new strategic initiatives off<br />
the ground.<br />
The most innovative<br />
legal departments are<br />
working to define the best<br />
processes and workflow for<br />
creating better partnering<br />
experiences. You can have<br />
the best talent and tools<br />
that money can buy, but if<br />
you do not have a seamless<br />
process and workflow, it<br />
will create a lack of visibility<br />
into what matters most<br />
and exhaust legal and its<br />
partners in the process of<br />
chasing information. New<br />
ways of working help legal<br />
teams meet the challenge of<br />
not having enough people<br />
or having to repeatedly<br />
engage in unnecessary and<br />
unproductive process steps.<br />
As businesses are challenged<br />
to reduce costs and time<br />
to execute, there is a<br />
heightened reliance on<br />
making real-time decisions<br />
based on data. General<br />
counsels and team leaders<br />
need to take the guess work<br />
out of decision making<br />
through intelligence.<br />
We’re in a day and age where<br />
we can track a pizza, but<br />
we can’t track a contract<br />
approval. Legal departments<br />
don’t yet empower their<br />
consumers to know what<br />
stage a contract approval<br />
is in. Legal is positioned to<br />
provide insights that can<br />
enable the business to get<br />
ahead of questions and allow<br />
people to focus on more<br />
critical activities. The feeling<br />
of not knowing is only<br />
compounded by the effort<br />
it takes to know. Increasing<br />
contract transparency<br />
is essential to providing<br />
the business a great legal<br />
experience.<br />
Legal teams are bringing in<br />
top tier talent. The problem<br />
is that talent is not being<br />
nurtured and developed.<br />
Legal employees exhaust<br />
themselves on projects<br />
without understanding the<br />
importance their work has<br />
on the overall business,<br />
or how it’s connected to<br />
other initiatives. Some<br />
departments get territorial<br />
over certain projects, even<br />
though they could use<br />
additional help. There is<br />
often minimal efficiency<br />
in resource allocation, and<br />
even less transparency.<br />
Legal departments often<br />
also have a “micro culture”<br />
that is not aligned with the<br />
broader enterprise’s culture<br />
and purpose.<br />
Legal departments will<br />
find that cultivating their<br />
talent, building digital-first<br />
skill sets and mindsets, will<br />
produce a happier and more<br />
productive team – and a<br />
better overall culture.<br />
Experience Transformation<br />
The best companies are attracting the best talent and customers and keeping them for longer. For legal to<br />
take its rightful seat at the table of every business, they need to realise they are in the experience business.<br />
The experience they provide to customers is core to their success. Demystifying legal transformation will<br />
happen only when a holistic approach includes the human element, not just technology.<br />
Experience transformation is easy to start but requires commitment to make it real. Begin by asking<br />
yourself: What are the frustrations and friction points in our operating model? And if they are all<br />
removed, what would we look and feel like - and how would it propel the business? Then, define the role<br />
of experience and the objectives to be the foundation for your transformation blueprint.<br />
Do not focus just on how much percentage by which you need to reduce your budget or<br />
increase productivity. If you have the right experience, the metrics will take care of themselves. A<br />
transformative experience will empower legal to accelerate business performance and deliver on the<br />
metrics that matter.<br />
David Clarke<br />
is Chief Commercial and<br />
Experience Officer at<br />
UnitedLex<br />
59
KEY<br />
CONTRIBUTORS<br />
Customer<br />
reviews pilot -<br />
wins for firms<br />
and consumers<br />
We told you in the spring about<br />
our customer review pilot scheme,<br />
run with the Council for Licensed<br />
Conveyancers and CILEx Regulation<br />
(we’ve since been joined by the Bar<br />
Standards Board). To recap, more than<br />
70 firms and eight leading comparison<br />
sites started the pilot working to<br />
develop how they can better work<br />
together, and encouraging firms to<br />
take a more active role in engaging<br />
with such sites. Initially this work<br />
has focussed on conveyancing and<br />
employment law.<br />
Why do we think this is<br />
important? Searching online<br />
is fast becoming the first<br />
port of call for those looking<br />
for advice or to buy services, so customer<br />
review sites are the new “word of mouth”<br />
recommendations – but with far greater<br />
reach. A comparison site will instantly give<br />
far more information about a firm than a<br />
conversation with a friend would. That’s<br />
because law firms now have to publish<br />
details about indicative prices and the<br />
professional background of the people<br />
carrying out the work for many services.<br />
This information is mandated by our<br />
transparency rules, introduced in 2018<br />
to help tackle the problem that the vast<br />
majority of those with a legal need do<br />
not currently use a regulated professional.<br />
Research shows two of the key reasons<br />
for this are that people think law firms will<br />
be too expensive, and they don’t know<br />
enough about what going to a law firm will<br />
entail. Therefore, putting more information<br />
out there, challenges misconceptions<br />
about costs and helps people make the<br />
choice that’s right for them.<br />
“We have published some<br />
guidance on how to deal<br />
with poor reviews”<br />
Early wins for the pilot<br />
The early signs from our pilot scheme<br />
are encouraging. The firms involved are<br />
changing their behaviours, not only in<br />
terms of managing the reputation of their<br />
firm and marketing their services, but also<br />
when it comes to staff development. Many<br />
of them routinely monitor for reviews and<br />
are making reviews more visible to potential<br />
clients through their own websites. Online<br />
reviews are a key part of managing client<br />
feedback, both good and bad. And for<br />
some firms, client reviews are part of staff<br />
reward programmes.<br />
Talking of bad reviews, firms in the pilot<br />
tell us that when these happen, as they<br />
inevitably do, they are using them to their<br />
advantage. Unlike critical comments being<br />
passed around verbally, they know what is<br />
being said and can respond. By engaging<br />
with bad reviews, they not only appear<br />
more open to other potential clients,<br />
but they can also use learnings to either<br />
improve their service or perhaps better<br />
manage customer expectations from the<br />
outset. We have published some guidance<br />
on how to deal with poor reviews, which<br />
firms tell us they have found helpful.<br />
One firm told us about a poor review they<br />
were given about slow service. The review<br />
was posted 12 hours after the client had sent<br />
an email late in the evening. The firm learnt<br />
it should let clients know in advance how<br />
long it would take to respond to queries.<br />
Potential clients are also good at spotting<br />
unreasonable or unfair reviews and tend<br />
to focus on the ones relevant to their<br />
own needs. And of course, a whole<br />
host of positive reviews offsets the odd<br />
negative one.<br />
It is not just firms in the pilot who seem<br />
to be embracing the power of the online<br />
review. Since the start of the year,<br />
Trustpilot have reported a 25% increase<br />
in firms claiming their profile on the<br />
platform, while Review Solicitors reported<br />
a 350% increase in firms using its paidfor<br />
services (adjusted to allow for the<br />
pandemic) and a 180% increase in firms<br />
signing up for their free services. Other<br />
providers have since signed up.<br />
Next steps<br />
We felt a pilot was the best way to gain<br />
useful insights into using comparison<br />
websites, and it’s exceeded all<br />
expectations. There has been so much<br />
interest and engagement that we are<br />
extending and expanding it to capture all<br />
the great work that firms are doing.<br />
On the back of this, we will carry out<br />
research to find the best way to raise<br />
awareness among consumers of the benefits<br />
of shopping around for legal services. We<br />
are also beginning to explore objective data<br />
available to help consumers compare quality<br />
and will be liaising with comparison website<br />
providers and firms involved in the pilot.<br />
Our recently-published innovation<br />
research showed that marketing was one<br />
of the main areas that firms might be<br />
using new technologies – giving them a<br />
commercial advantage by reaching out to<br />
previously-untapped markets. It looks as<br />
though customer reviews of law firms are<br />
here to stay. The question you and your<br />
firm need to ask itself is whether you want<br />
to take advantage of the opportunities -<br />
or can you afford to stand back and watch<br />
your competitors do so?<br />
Jane Malcolm<br />
is SRA at Executive Director<br />
60
CUSTOMER<br />
CELEBRATION<br />
Customer<br />
Celebration<br />
In order to be a successful business, Richard Branson once said<br />
“The key is to set realistic customer expectations, and then not to just meet<br />
them, but to exceed them — preferably in unexpected and helpful ways.”<br />
However, it’s one thing to acknowledge this and another to implement it…<br />
With this in mind, Modern Law wish to turn your attention to some of the outstanding<br />
work that companies are undertaking in and around the sector right now. Our<br />
participants discuss a wide range of subject matter that covers talent, training, interaction<br />
with customers, recruitment and customer feedback. By creating the opportunity for<br />
those involved to discuss the incredible work they’re doing and the outstanding customer<br />
service they’re renowned for, we aim to create a section that celebrates the customer.<br />
61
We are always available...<br />
Paul Paul Challoner, Commercial Director<br />
Jo Haslam, Head of Fast Track RTA<br />
We are one of the largest and the leading providers of<br />
end-to-end complete claims and legal solutions.<br />
Right People | Right Skills | Right Technology<br />
Right People Right Skills Right Technology<br />
www.carpentersgroup.co.uk<br />
www.carpentersgroup.co.uk
CUSTOMER<br />
CELEBRATION<br />
Partnership Approach<br />
– Insurers, Brokers<br />
and MGA’s<br />
I joined Carpenters Group 5 years ago after<br />
spending 20 great years at RSA. Having had<br />
a few conversations with the leadership team<br />
at Carpenters, I was reminded of a quote<br />
by the great Bill Shankly; it was clear that<br />
“Carpenters was made for me and I was made<br />
for Carpenters”. Well, he said Liverpool, not<br />
Carpenters, but you catch my drift.<br />
Our approach to putting the customer first starts with our<br />
insurer, broker and MGA clients, with whom we have<br />
worked in partnership with, across the motor and home<br />
claims industry for over 27 years, delivering a variety of fully<br />
outsourced insurance and legal services.<br />
Our long-standing relationships are built upon fully transparent,<br />
fair, sustainable commercial agreements with real time data,<br />
driving strong MI analysis to support decisions; but most of all,<br />
open and honest conversations where we look for solutions and<br />
innovations for shared success stories.<br />
I could bore you with the detail about our monthly performance<br />
reviews and how we drive to remove friction and unnecessary<br />
touch points but that is pretty standard stuff.<br />
The best strategic and innovation-based sessions are when we<br />
go back to basics with “why can’t we just…” chats. We flip<br />
everything on its head and look to not simply improve things, but<br />
do things completely differently. These sessions always bring fresh<br />
ideas to the table and ultimately new products or services that we<br />
can then implement for our partners.<br />
Atlanta group’s Daniel Athorn agrees.<br />
“Carpenters Group are a key strategic partner to Atlanta and<br />
provide us with much more than just a claims service with<br />
constant dialogue ensuring we are ahead of the claims curve at<br />
all times. Our relationship is built on trust and openness - which<br />
despite our businesses individual scale - enables us to be agile<br />
when dealing with challenges or new schemes. Nothing is ever too<br />
much for the Carpenters Group team.”<br />
We have recently built new solutions for Insurers who were<br />
looking to outsource elements of their insurance services and<br />
having just joined the MGAA, we are currently refining our<br />
products and services with new partners each week.<br />
Money On My Mind – End to End Supply Chain Benefits<br />
At Carpenters Group we are very aware of both the commercial<br />
challenges and opportunities within the industry and we have<br />
regular dialogue with our partners about increasing their bottom<br />
line through either improved rates, securing additional available<br />
income within the claims journey or stripping out layers of costs.<br />
Our agnostic approach to using the insurers choice of repair,<br />
hire, medical and any other onward service providers, allows<br />
insurers to plug in their preferred supply chain and utilise current<br />
contractual arrangements.<br />
Should an insurer, broker or MGA not have a supply chain in<br />
place or if they are not benefitting fully from the opportunities in<br />
the market, then, rather than having a one stop shop approach<br />
which restricts who they can use, Carpenters Group will effectively<br />
‘bespoke tailor’ the supply chain to fit the customer base and<br />
services required with our fully transparent commercial modelling<br />
– thus ensuring we maximise the bottom line impact.<br />
Turning back to Shankly, it feels appropriate to finish with another<br />
of his famous quotes and something I keep close to my thoughts<br />
when working with our partners, “Football is a simple game based<br />
on the giving and taking of passes, of controlling the ball when<br />
you have it and of making yourself available to receive a pass”.<br />
We flip everything on its<br />
head and look to not simply<br />
improve things, but do things<br />
completely differently<br />
Paul Challoner<br />
is Commercial Director at<br />
Carpenters Group<br />
63
Not all views are safe.<br />
Our reports educate property buyers<br />
about development risk.<br />
Don’t find out when it’s too late.<br />
PROTECTING BUYERS, SOLICITORS & LENDERS<br />
Request a sample report and ask<br />
your provider to add DevAssist<br />
to your conveyancing package.<br />
www.devassist.co.uk<br />
t: 01342 890010<br />
e: orders@devassist.co.uk
CUSTOMER<br />
CELEBRATION<br />
Whirlwind year<br />
of insight and<br />
innovation<br />
DevAssist are reflecting on what has<br />
been one of the most challenging<br />
but ultimately inspiring years in the<br />
industry. Like every business, we had<br />
to evolve, adapt, adopt new ways<br />
of working, and still continue to<br />
perform to the standards we and our<br />
customers are accustomed to.<br />
If you haven’t yet worked with us, DevAssist are research<br />
experts in property, planning and development. We offer<br />
in-depth development risk reports and specialist training for<br />
solicitors. We are hugely proud of what our team and our industry<br />
has achieved in the last 12 months. So, what did a booming<br />
property market against the backdrop of a pandemic teach us?<br />
We need more housing, but not in my backyard<br />
30% of our reports in the last year exposed one or more high<br />
risks of development in close proximity to a subject property.<br />
A further 10% exposed a medium or high risk of development.<br />
With a government backing the construction industry and a<br />
relaxation in planning policy, in combination with a property<br />
market favouring more rural locations, development in our<br />
local areas is increasingly likely. Ensuring buyers have all the<br />
information before purchase is crucial.<br />
Buyers will pay more for peace for mind<br />
One of the most interesting trends we’ve tracked is a huge<br />
increase in demand for our DevAssess Premium report. This is our<br />
most comprehensive search report at £300+ VAT and offers our<br />
customers and their client’s, absolute reassurance that no stone<br />
has gone unturned. The DevAssess Premium report assesses the<br />
risk of development in close proximity to a subject property. It<br />
looks at traveller sites, the Strategic Housing Land Availability<br />
Assessment, local policy, listed buildings, the five-year housing<br />
supply and changes to nearby major infrastructure.<br />
Where buyers are moving<br />
to unfamiliar areas and<br />
seeking rural settings,<br />
knowing about local<br />
planning and development<br />
has become a priority<br />
Buyers have welcomed the opportunity to understand all the<br />
development risks in their neighbourhood. This has been especially<br />
important to the multitude of buyers leaving urban environments<br />
for rural and village locations. Where buyers are moving to<br />
unfamiliar areas and seeking rural settings, knowing about local<br />
planning and development has become a priority. This need for<br />
greater insight has really driven demand for DevAssess Premium<br />
and we continue to highly recommend it for buyers in this position.<br />
“Devassist and their range of searches have been a game<br />
changer for our property team. Their searches not only<br />
show existing/live planning permissions, but also potential<br />
developments as well as providing an opinion as to risk. This has<br />
allowed us to provide additional protection and advice to our<br />
clients - allowing them to make informed choices. Their search<br />
should be used by all property lawyers.” Caroline Roberjot,<br />
Partner, Adams & Remers LLP<br />
An industry to be proud of<br />
Our customers and our team have delivered and performed<br />
under the most exceptional circumstances and we have been so<br />
proud of the role we’ve played in this unprecedented year in the<br />
property market. Working under the pressures we all experienced<br />
last year was challenging, but so inspiring in many ways to see<br />
what was achieved and to the same exacting standards.<br />
Our reports have never felt more pertinent as the market moved<br />
at such speed, delivering valuable insight and peace of mind on<br />
such a scale.<br />
To learn more about DevAssist and how we protect solicitors,<br />
buyers and lenders from unforeseen development risk, head to<br />
devassist.co.uk or get in touch at info@devassist.co.uk.<br />
65
SafeMove<br />
CLEARLY<br />
ESSENTIAL<br />
#WhyRiskAnythingElse
CUSTOMER<br />
CELEBRATION<br />
Continuing to<br />
Punch Above Our Weight<br />
67
Total<br />
Rehabilitation<br />
Enabling Prosthetic and Orthotic clients<br />
to achieve their goals since 1989.<br />
To find out more about all of the rehabilitation and supporting<br />
services we supply please call us on 0800 433 2239<br />
or contact us at enquiries@dorset-ortho.com
CUSTOMER<br />
CELEBRATION<br />
Striving<br />
for Better<br />
for over 30 Years<br />
'STRIVE FOR BETTER’ is not<br />
just our slogan, it’s our way of<br />
seeing the world, the driving force<br />
behind our history, philosophy and<br />
innovation and the reason we have<br />
achieved a worldwide reputation<br />
for excellence.<br />
Established in 1989, Dorset Orthopaedic is one of the UK’s<br />
leading independent providers of prosthetic, orthotic,<br />
silicone and rehabilitation services. Not only does it have<br />
comprehensive experience in meeting the needs of complex cases,<br />
but is also a world leader in cosmetic silicone solutions, providing<br />
a bespoke service generating incredible lifelike solutions.<br />
All manufacturing processes are undertaken in-house, ensuring<br />
that the highest standards are maintained throughout. The aim<br />
is to support and enable each patient to archive the highest level<br />
of functionality, mobility, and independence possible, striving for<br />
total rehabilitation for each patient.<br />
Keeping at the forefront of innovation and technology<br />
Dorset Orthopaedics’ investment in innovation and advanced<br />
technology is centred on delivering dedicated and individual<br />
patient care, procedures and services, ultimately giving<br />
more options to their patients in terms of prosthetics and<br />
rehabilitation services and a better chance at a more mobile<br />
life. Technology assists with the outcomes of the rehabilitation<br />
journey, such as leading to earlier assessments, sometimes<br />
ahead of amputation, providing wider support for patients, while<br />
enabling clinicians to enhance the efficiency and productivity of<br />
their clinics and the rehabilitation process.<br />
The clinical teams are actively involved in sourcing new tools to<br />
enhance patient’s rehabilitation, such as the Symphonie Aqua<br />
Casting System and 3D L.A.S.A.R Posture, which assist the<br />
clinicians in providing optimal prosthetic and orthotic alignment<br />
and improving patient’s balance and posture.<br />
The people<br />
The company has over 70 employees across three full time<br />
sites, boasting highly skilled silicone and prosthetic technicians<br />
The crucial side of the<br />
equation is listening and<br />
understanding patients<br />
challenges and concerns<br />
and clinicians who are experts in their fields. Undertaking<br />
training using the most up to date techniques, technologies and<br />
componentry from across the world. Their training programmes<br />
are a combination of in-house clinical experts and skilled<br />
trainers from a variety of manufacturers.<br />
Listening to their patients<br />
It’s one thing to be highly skilled and dedicated to providing<br />
the best possible treatment for patients, but the crucial side of<br />
the equation is listening and understanding patients challenges<br />
and concerns, and giving them the most valued commodity –<br />
time! The teams at Dorset are dedicated to connecting with<br />
their patients and spending the time needed to address their<br />
concerns and ensure they are working to the same goal.<br />
Feedback is requested directly from the patient during their<br />
appointments and surveys are sent out periodically. This gives<br />
both short-term feedback as well as the longer term; feedback in<br />
turn helps clinicians to adapt and develop their treatments, which<br />
then ultimately benefits patients during future treatments.<br />
Keeping everyone safe<br />
Despite the easing of restrictions, Dorset has decided to keep<br />
the Covid-19 protocols in place to ensure all patients and staff<br />
are kept safe while the country adapts. Having fewer people in<br />
the clinics at any one time provides a safe space for patients to<br />
attend appointments with peace of mind and an increased sense<br />
of security.<br />
Casting an eye to the future<br />
What should we expect from the future of prosthetic technology?<br />
Dorset believes in continuing to search for ways to improve a<br />
patient’s prosthetic or orthotic rehabilitation experience. Treatments<br />
like osseointegration will become further normalised, while we<br />
will see continued research and development to make prosthetics<br />
work better with the body. We should expect prosthetics to<br />
become more bionic as we see better cohesion between patients<br />
and prostheses as we start to see prosthetics being driven by the<br />
patient. As advanced technology becomes more readily available,<br />
we can expect a completely new range of medical devices both<br />
technologically and mechanically advanced, aiming to serve<br />
patients with high-tech but also high functionality products.<br />
69
How is your<br />
culture measuring<br />
culture measuring<br />
How up in is your the<br />
up in the<br />
culture post-pandemic<br />
measuring<br />
post-pandemic<br />
up world? in the<br />
world?<br />
post-pandemic<br />
world?<br />
The fact is, your business culture largely<br />
The fact determines is, your business the level of culture commercial largely success<br />
determines you will the have, level regardless of commercial of the success best<br />
The fact is, your business culture largely<br />
you intentions will have, regardless and strategies of the you best lay down.<br />
determines the level of commercial success<br />
intentions and strategies you lay down.<br />
you will have, regardless of the best<br />
intentions "Culture and eats strategies strategy you for lay breakfast" down. Peter<br />
"Culture Drucker, eats so, strategy as it's for the breakfast" most important Peter mea<br />
Drucker,<br />
"Culture of the so,<br />
eats day, as<br />
strategy make it's the<br />
for sure most<br />
breakfast" your important culture Peter is meal well fed<br />
of Drucker, the day, so, make as it's sure the your most culture important is well meal fed.<br />
Because in today’s world the consequential<br />
of the day, make sure your culture is well fed.<br />
Because impact in today’s of a business' world the culture consequential<br />
the potenti<br />
impact Because<br />
for of errors,<br />
in a today’s business' complaints<br />
world culture the<br />
and<br />
consequential<br />
ultimately the potential claims,<br />
for impact errors, of a complaints business' culture and ultimately on the potential<br />
will determine the level of risk you claims, present<br />
will<br />
for<br />
determine<br />
errors, complaints<br />
the level<br />
and<br />
of<br />
ultimately<br />
risk you<br />
claims,<br />
to an insurer.<br />
present<br />
will determine the level of risk you present<br />
to an insurer.<br />
to an To insurer. find out exactly how your culture is<br />
To find measuring out exactly up how you can your apply culture today is for a free<br />
To find out exactly how your culture is<br />
measuring up you can apply today for a free<br />
measuring assessment* up you and can apply an independent today for a free appraisal<br />
assessment* and an independent appraisal<br />
assessment* of your available and an independent Indemnity Insurance appraisal<br />
of of your your Markets: available available Text Indemnity Indemnity ‘Culture’ Insurance to Insurance 07539357293 and<br />
Markets: we’ll Text call you ‘Culture’ back, to to email 07539357293 and and<br />
we’ll mark@newedenway.com call you back, email<br />
or call Mark or<br />
mark@newedenway.com<br />
Lloyd now on 03333449260<br />
or or call call Mark or or<br />
Lloyd now on 03333449260<br />
*Terms & Conditions apply<br />
*Terms & Conditions apply<br />
*Terms & Conditions apply<br />
www.newedenway.com<br />
www.newedenway.com
CUSTOMER<br />
CELEBRATION<br />
The Growing Importance<br />
of Cultural Analytics<br />
The culture and values of a<br />
business are of course very<br />
important, however it all depends<br />
in the first place on what kind of<br />
business you want to be.<br />
This can be done by accepting<br />
that there are 3 broad markets<br />
within which you can position<br />
your service business:<br />
1. Price:<br />
Where your focus is being the cheapest and<br />
competing as such.<br />
2. Value for Money:<br />
Here, there is less emphasis on price as you aim to point up the<br />
‘added value service’ you provide beyond mere cost.<br />
3. ‘Luxury’:<br />
Or perceived, significant added value whereby your brand or<br />
reputation allows you charge more for your services regardless of<br />
the competition.<br />
“Culture eats strategy<br />
for breakfast any day”<br />
Speed of service applies to all 3, irrespective of price and it<br />
actually doesn’t matter which ‘market’ you choose to be in since<br />
‘Culture eats strategy for breakfast any day’ (Peter Drucker c1987),<br />
ergo, ‘Culture eats your business proposition for breakfast every<br />
time too’ (New Eden 2021).<br />
In fact, because ‘culture differentiates’ regardless, your vision<br />
and values are on display for the client all the time and it’s the<br />
‘perceptions of service’, or ‘the moments of truth’ as Tom Peters<br />
said in the ‘80s, that ultimately determine whether your client<br />
will want to come back for more.<br />
“The bitterness of poor<br />
quality remains long after<br />
the sweetness of low price<br />
is forgotten”<br />
As Benjamin Franklin put it so succinctly over 200 years ago:<br />
“The bitterness of poor quality remains long after the sweetness<br />
of low price is forgotten”. So, decide what business you want<br />
to be in first, align your culture to the market and clients you<br />
wish to attract and if the clients don’t match or align with your<br />
business proposition, you will need to let them go gently, or<br />
quickly deal with their different expectations. To do otherwise<br />
will serve neither of you.<br />
“The consequential<br />
impact of a service<br />
organisation’s culture”<br />
Those organisations who are able to align their culture with the<br />
kind of clients who value and match that culture, will deliver<br />
a less risky service business outcome and be more successful.<br />
In turn, the consequential impact of a service organisation’s<br />
culture on the potential for mistakes, complaints and ultimately<br />
claims, will determine the level of risk they present to an insurer.<br />
The SRA and indemnity insurers are beginning to accept and<br />
see that ‘cultural analytics’ data will become as important as<br />
transactional, historical, and conventional PII data since they<br />
both already know that up to 90% of ‘mistakes, complaints and<br />
ultimately claims’, are not down to ‘the law’, and that they arise<br />
predominantly through the inherent, culture-driven behaviours<br />
of the service organisation itself.<br />
Now what do you fancy eating<br />
for breakfast?<br />
Mark Langley-Sowter<br />
is Founder and CEO<br />
at New Eden<br />
71
Avista,<br />
Homebuyers<br />
and Homescreen<br />
Built by conveyancers, for conveyancers.<br />
“I have to say that they look really great and much clearer in<br />
terms of the results and how to interpret them”<br />
Thomas Parkinson, Head of Residential Property, Rowlinsons Solicitors<br />
To find out more, visit: www.groundsure.com/residential-report-revolution<br />
or contact your preferred search provider.<br />
@groundsure Info@groundsure.com +44 (0)1273 257 755
CUSTOMER<br />
CELEBRATION<br />
Always Putting the Customer First<br />
Groundsure prides itself on how we put the customer first and it’s no surprise that we have excellent<br />
customer service - we are renowned for speedy yet informative responses to all manner of queries.<br />
Number of<br />
staff<br />
8<br />
Number of<br />
emails p/m<br />
average around 4,000<br />
Number of<br />
calls p/m<br />
average around 1,400<br />
Number of<br />
Live chats p/m<br />
average around 150<br />
The team consists of 8 people who know our products<br />
and services inside and out. We operate in a fast-paced<br />
environment, with a huge variety of queries coming daily<br />
from a broad array of customers ranging from homebuyers to<br />
conveyancers, search providers to environmental consultants. We<br />
have to tailor our knowledge and insight to cater for all levels of<br />
understanding - dealing with queries from customers with a very<br />
basic and limited understanding, to experts in the field.<br />
When onboarding our customer service staff, they embark<br />
immediately on an intense training programme to get them to<br />
learn and understand our products inside and out. Often the<br />
unsung heroes of the organisation, our customer service team is<br />
often faced with challenging queries that they deal with politely,<br />
professionally and with absolute aplomb.<br />
Groundsure is famous for its customer service and client feedback<br />
is always extolling the virtues of our team, be it regarding the<br />
fast turnaround of queries, the expansive knowledge that our<br />
customer service has, or the “never leave a stone unturned”<br />
approach in resolving queries and issues.<br />
Customer feedback<br />
Our business is built on customer feedback. All of our Customer<br />
Service team members have a Net Promoter Score feedback<br />
mechanism on their email signatures where customers can<br />
provide a score as to how their query was dealt with. We also<br />
run an annual NPS survey to all our customers for Groundsure as<br />
a whole. The score we receive is insightful in itself and we have<br />
continued to get a higher NPS score over the last five years. Part<br />
of the NPS survey includes an open-ended feedback question<br />
where customers can provide feedback on what we do particularly<br />
well and what we could do better. This feeds into each team so we<br />
can address issues and continue to improve.<br />
The importance of our customers is always at the forefront of<br />
everything we do. We invest in the best technology to aid our<br />
team and we put the customer first on all levels. We have customer<br />
portals where customers can download all manner of marketing and<br />
product collateral to aid them in their work. We involve customers<br />
in all of our product development and provide in-depth qualitative<br />
and quantitative surveys, focus groups and research panels. Finally,<br />
we fully understand how important our products are in helping our<br />
customers to succeed - or to make the most informed decision in<br />
matters that can be emotive and close to the customer - especially<br />
where residential transactions are concerned.<br />
We love our customers and they love us…. But don’t just take<br />
our word for it - here is what our customers say about our<br />
customer service.<br />
Groundshare Reviews<br />
“I want to pass on my<br />
thanks to Vic, who has<br />
been absolutely brilliant. I<br />
phoned about three times<br />
today about the same<br />
issue and Vic was friendly,<br />
professional, and incredibly<br />
knowledgeable. Because<br />
of him, I have sorted my<br />
complex survey issue<br />
and have recommended<br />
Groundsure and Vic, to<br />
friends and family”<br />
Direct customer feedback May June 2021<br />
“Great customer service<br />
& always looking at new<br />
ways to improve products<br />
to make them easier to use<br />
and more efficient.”<br />
NPS Survey 2020<br />
“All the staff at Groundsure,<br />
that I have spoken to, have<br />
excellent customer skills”<br />
NPS Survey 2020<br />
73
Last chance<br />
to nominate<br />
the clock is ticking<br />
Nominations Close Friday 17 th September<br />
Thursday 25 th November 2021<br />
The Rum Warehouse, Liverpool<br />
www.mlconveyancingawards.co.uk<br />
Event Enquiries ellie@charltongrant.co.uk<br />
Sponsorship Enquiries kate@charltongrant.co.uk<br />
01765 600909
Categories List<br />
Conveyancing Firm of the Year - NORTH<br />
Conveyancing Firm of the Year - MIDLANDS<br />
Conveyancing Firm of the Year - SOUTH<br />
Conveyancing Firm of the Year - WALES<br />
Search Provider of the Year<br />
Innovation of the Year<br />
Rising Star of the Year<br />
Service Provider of the Year<br />
Client Care Award<br />
Best Use of Technology<br />
Outstanding Commitment to Training<br />
Property Team of the Year<br />
Conveyancer of the Year<br />
National Conveyancing Firm of the Year<br />
*new* Managing Partner of the Year<br />
*new* Resilience Award<br />
*new* Mental Health & Wellbeing Award<br />
Outstanding Achievement<br />
Lifetime Achievement Award<br />
Sponsored by
Issue 3<br />
Happy Customer<br />
= Jolly Lawyer<br />
In search of happiness …<br />
TECHNOLOGY IN<br />
LAW LAW LAND<br />
Candid. Controversial. Cathartic.
inCase cuts<br />
conveyancing<br />
completion<br />
times by 42%<br />
House Purchase<br />
O’Neill Patient<br />
Scan here to<br />
learn more!<br />
email<br />
NEXT<br />
• ID/AML<br />
• Process Flows<br />
• Digital Signature<br />
• Secure Messages<br />
• Client ‘To-Do’ List<br />
• Client Document Upload<br />
• Branded App<br />
• Forms & Questionnaires<br />
• Push Notifications<br />
• Integration Guarantee<br />
in-case.co.uk<br />
Arrange your FREE product tour today<br />
0161 410 0800
Meet the Tech Ambassadors<br />
Becki Cassia<br />
Transparently,<br />
CEO and Co-Founder<br />
Sonia Hadjadj<br />
Legal Counsel & Legal<br />
Ops Consultant<br />
Sam Borrett<br />
Legmark,<br />
CEO and Founder<br />
Nick Cousins<br />
Exizent, CEO and Founder<br />
Sucheet Amin<br />
(aka Such)<br />
inCase, CEO and Founder<br />
James Moore<br />
Kulahub, Director<br />
Dror Levy<br />
LegalDrop, CEO and<br />
Co-Founder<br />
Martyn Best<br />
Document Direct,<br />
Managing Director<br />
Jo Liston<br />
Wipro, Senior Commercial<br />
Manager<br />
Alex Grux<br />
Hyperlex, CEO and<br />
Co-Founder<br />
Vincent Perrin (aka Vinnie)<br />
Salesforce UK, Regional Vice<br />
President – Professional Services
Join hundreds of law<br />
firms already using<br />
our flexible, 24/7<br />
typing service<br />
No dictation system?<br />
No dictation system?<br />
No problem<br />
No problem<br />
Use Use our our free free smartphone app app to to<br />
Use Use our our free free smartphone app app to to<br />
dictate your work wherever you you are are<br />
dictate your work wherever you you are are<br />
The Document Direct<br />
The Document Direct<br />
typing service provides<br />
typing service provides<br />
these benefits:<br />
these benefits:<br />
Reduced overhead costs<br />
Reduced overhead costs<br />
Time saving<br />
Time saving<br />
Enhanced gross profit<br />
Enhanced gross profit<br />
Enhanced working<br />
Enhanced working<br />
capital earlier billing<br />
capital - earlier - billing<br />
Reduced delays on on file file<br />
Reduced delays on on a a file file<br />
Highest quality<br />
Highest quality<br />
documentation<br />
documentation<br />
24/7 service<br />
24/7 service<br />
Contact us us to to learn more<br />
Contact us us to to learn more<br />
or or start free 30 30 minute trial<br />
or or start a a free 30 30 minute trial<br />
info@documentdirect.co.uk<br />
info@documentdirect.co.uk<br />
+44 (0) (0) 1926 821900<br />
+44 (0) (0) 1926 821900<br />
Better working flexibility<br />
Better working flexibility<br />
for for fee fee earners<br />
for for fee fee earners<br />
Secure, compliant, and<br />
Secure, compliant, and<br />
GDPR friendly<br />
GDPR friendly<br />
Happier clients<br />
Happier clients<br />
Cert. Cert. no. no. 10046 10046<br />
Cert. Cert. no. no. 10046 10046
Intro<br />
Golly gosh.<br />
Here we are again already. It doesn’t seem at all that<br />
long since issue II “Fusing People and Machines” dropped<br />
on the quasi-remote ivory tower mats. I simply cannot<br />
believe how quickly the summer has come and gone?<br />
Can you?<br />
Whilst many lawyers I know, in spite of the Covid travel rule blunders, have been sunning<br />
themselves at their R&R villas (that’s Rest and Recuperation for the uninitiated and/or<br />
less privileged of us), we at Modern Law, together with the ever-expanding number of<br />
tech ambassadors, have been beavering away to bring you this candid, controversial<br />
and hopefully cathartic edition.<br />
Personally, I have LOVE LOVE LOVED being involved in bringing this roundtable feature<br />
to you as its subject focus is super close to my heart. When given her remit on this<br />
theme, The Naked Lawyer was so excited that you would be forgiven if observing her<br />
and thinking that she and her Segway could have positively twirled their way onto the<br />
Olympic podium for artistic sporting flair!<br />
*Whizz-bang* *Whoosh* … Incoming… The Naked Lawyer chucks<br />
her first muse bomb into the centre of the ring, part in protest<br />
as we had kept her waiting as we all faffed around for so long<br />
settling down for the duration, and part mischief-making, as<br />
usual, just to remind us all that she is present and doesn’t like<br />
to be ignored! Okay, she has a point, of course. Less superfluous<br />
chatter and more ‘on point’ rigorous discussion, opinion and<br />
practical tips are called for.<br />
So, without further ado, let’s get stuck into “The Customer, Not Client, is<br />
Queen.“ With such a VAST theme which has had plenty written on<br />
the subject to date, yet, as the saying goes, “times they have a<br />
changed so much over the past year or two”, I decided to address<br />
a handful of controversial and long-standing issues with the tech<br />
ambassadors that have been debated in the past as well as<br />
a number of really pertinent current topics which are highly<br />
relevant now and will affect us in the future.<br />
Hoping to avoid a full-blown muse grenade<br />
assault from The Naked Lawyer at the outset<br />
I decided to warm up the ambassadors<br />
with the question “What is your view on<br />
whether users of legal services should<br />
be called ‘client’ or ‘customer’?” I’m<br />
curious, as are you, no doubt, our readers.<br />
Which is it? Does it matter? Should it<br />
matter? Why? Is there a place for both?<br />
81
Vinnie: I think this is very much open for debate.<br />
Ultimately the use of the term client by law<br />
firms probably stems from professional advice<br />
given. If seeking advice from professionals like a<br />
consultant, a doctor and lawyers, you are a client.<br />
If, however, you are purchasing goods or nonprofessional<br />
services (for instance an electrician/<br />
plumber) you’re a customer.<br />
Dictionary terms are interesting:<br />
Client - a person or organisation using the services of a lawyer or other professional person or company.<br />
Customer – a person who buys goods or services from a shop or business.<br />
Hmmm … a neat starter-for-ten, Vinnie. Like it. But let’s chew the cud on these definitions further.<br />
A law firm is a business. Some even provide goods in the form of LegalTech and/or LawTech<br />
products, commodities in effect. Ergo, the buyer could be either a client or a customer, perhaps?<br />
Such: The same question could be posed in the health profession….’patient’ or ‘customer’. But is a patient a<br />
‘customer’ buying health care services? They certainly are using health care services and even through taxes,<br />
paying for the provision of it through the NHS if not private.<br />
The same goes for ‘client’ and ‘customer’. They are totally interchangeable, and does it really matter? I think not.<br />
The legal profession will certainly lean towards the term ‘client’ and indeed, a quick flick through the SRA Code<br />
of Conduct reveals ‘client’ or ‘clients’ in regular use…not a ‘customer’ to be seen!<br />
I feel as though ‘customer’ is used in the provision of commodities, whether that be a superstore selling food or<br />
an online platform selling books and electronics. I can see the legal profession putting up a good argument that<br />
the provision of a legal service is not a commodity. Yet I’d challenge that…given the increasing fixed fee models,<br />
in commercial as well as private client work, legal services have been commoditised for a long time and will<br />
continue to be. Consequently, users of legal services are as much a customer as they are a client.<br />
Indeed. I’d be inclined to agree, Such, particularly as we are witnessing an ever-increasing<br />
supply of LegalTech and LawTech products welcomed by users/buyers.<br />
Becki: Normally, I am completely anti-labels as I think they can lead to stereotypes being formed, or assumptions<br />
being made that result in things being placed into boxes, when they don’t necessarily belong there. Putting that<br />
Pandora’s box to one side (and in answer to this question), I think that it really depends on the type of relationship<br />
that either exists, or that you want to establish, between the individuals.<br />
Whenever I was working through my issues with my legal team, I always considered myself to be a client rather<br />
than a customer. I was paying my legal team for, and was a beneficiary of, their knowledge and expertise.<br />
I entered into the process with a long-term view, as opposed to the transactional and dare I say it, faceless<br />
relationship I had with somewhere like a shop. For me, the difference between the two types of user depends<br />
on the ‘buy-in’ process or experience, and also type of company you are buying from.<br />
Thanks to the likes of Apple and Amazon, the balance of power has moved away from supply, towards one<br />
of demand. In this digital age, the customer is now King (or Queen!). But if you cater your services primarily<br />
towards customers, you will need to continually search for them and have a robust strategy in place to replace<br />
them as they come and go. Customers simply view your business as a commodity. On the other hand, clients<br />
don’t need to be replaced and you gain repeat business, with little or no effort.<br />
So, in roundup, I suppose it really comes down to the relationship you have, and want to have, with the users<br />
of your service.<br />
This is a really cool and interesting perspective, Becki.<br />
Sam: Does it matter? I think the answer (like all SEO answers) is - ‘it depends’. Does calling them<br />
a customer over client impact on the bottom line? If so, then do it. How do we find this out is the<br />
interesting part?<br />
THE RUM WAREHOUSE,<br />
LIVERPOOL<br />
25/11/2021<br />
www.mlconveyancingawards.co.uk
Tradition dictates that law firms have ‘clients’ because they are service users bound by a<br />
contracted relationship. However, if you have a legal app or you have subscribers to a monthly<br />
legal service, are they ‘users’ or ‘members’ and how much does that matter?<br />
When you’re talking about them internally it probably doesn’t. When you’re addressing them<br />
directly, it sets out expectations and perceptions of what that relationship is and that can affect<br />
how the client/user/customer feels about your organisation.<br />
In a world where law firms are needing to appear more ‘user friendly’, it may well be beneficial<br />
to reference the ‘customer’ in website content and other communications. While that’s my gut<br />
feeling, the only way to know for sure is to ask the clients directly – or run some A/B tests on<br />
identical landing pages with ‘client’ on one and ‘customer’ on the other.<br />
Who’s going to do it? I’d love to see the results!<br />
Wouldn’t we all, Sam!<br />
Dror: I personally like to use ‘customer’ as I associate it with customer support,<br />
customer service, and customer satisfaction.<br />
What matters is the meaning legal professionals attach to these words. How do they<br />
view the user in the context of each word and is the way they communicate affected by<br />
it? If a lawyer refers to a user as a client and another refers to them as a customer, do<br />
the two different lawyers presume that they need to give different treatment / level of<br />
service to the other party? For example, would they give a client a more ‘professional’<br />
service and would they give a customer a more ‘personable’ service, and if so, why?<br />
Another great point, Dror. Which supports the view that the two ought to be<br />
interchangeable? Or, better still, maybe we should just have ONE word in the English<br />
language that means both?! …<br />
Alex: Interesting question, also because in French we don’t make the distinction between<br />
customer and client, we just have one word: client (à dire avec l’accent).<br />
In English, the definitions of these two words are pretty clear… One could say that like<br />
doctors, lawyers should not have customers but clients, because they provide people with<br />
advice. But it’s changing!<br />
As a LegalTech provider for example, it’s easier to say that we have customers, even<br />
though we provide legal advice in addition to the tech. Maybe it’s due to the fact that<br />
when you work in tech, you always think about the customer: it comes first in the way you<br />
think and develop the product. Is it possible that technology influenced the legal sector<br />
and ended the lawyer hegemony, and now, lawyers should call their clients customers?<br />
In our solution, I used to call the internal client of my client the consumer because they are<br />
consuming legal services defined by our clients through Hyperlex.<br />
Ugh. I hate to admit it, Alex, but for once I’m with the French *raucous laughter* *guffaws*<br />
Martyn: As the great Louis Armstrong sang to the equally iconic and wonderful Ella Fitzgerald, “You like<br />
potato and I like potahto, You like tomato and I like tomahto. Potato, potahto, Tomato, tomahto. Let’s call<br />
the whole thing off”<br />
In a way that sums the matter up. Interchangeable words; two words separated by the same meaning.<br />
But before we conclude, let us hear further from Louis and Ella: “But oh, if we call the whole thing off, then<br />
we must part. And oh, if we ever part, then that might break my heart.”<br />
So, we should endeavour to respect the difference, and with a vague shrug of the shoulders, accept that it<br />
is more mildly appropriate to use client in our legal world, but let us not forget that, as they say elsewhere,<br />
“the customer is king.”<br />
NOMINATIONS<br />
CLOSE<br />
Friday 17 th September!
LEGM LEGM RK RK
Client-centricity<br />
Ah, therein lies the rub, Martyn. If the customer really is King, or Queen<br />
(let’s tick the diversity and inclusion box shall we ladies and gents?), it begs<br />
us to address the question: “Do you believe that solicitors / lawyers /<br />
barristers are TRULY client-centric? Do they really put the client first?”<br />
Vinnie: To me this really depends on the term ‘truly client-centric’ but the<br />
answer is probably no. Law firms typically have very siloed data, that sits in<br />
stand-alone point solutions. Maybe a couple of partners/fee earners/lawyers<br />
within the firm might know the clients very well, but this will probably only be<br />
from one viewpoint, i.e., current matters they are working on, past matters they<br />
have worked on, or maybe the needs and requirements of the client. But they are<br />
highly unlikely to know all the touch points within the firm, for example maybe<br />
some of the bills submitted have been rejected by the client, or maybe the firms<br />
marketing has been sending them untargeted emails.<br />
Such: As a solicitor myself, I’d be a total hypocrite if I didn’t say that the vast majority of<br />
solicitors, lawyers and barrister are genuinely client-centric…I know I am. But we have to be<br />
honest that often the pressures of the matter at hand, the job, the work environment, demands<br />
from the employer, clunky processes and systems, all get in the way of making that a reality.<br />
Being a lawyer (speaking from experience) is tough. The hours can be very long, the work<br />
very complex and you have to balance that with treating every client as your only client<br />
because that is how they feel they should be treated. It can be an impossible situation.<br />
This is definitely where tech plays its part. Clients have been gradually ‘trained’ to<br />
experience amazing service all through the use of technology…with little or no human<br />
contact. The legal sector has woken up to this and I’m certainly seeing more firms<br />
recognise that tech has a larger part to play other than just improving efficiencies and<br />
the bottom line.<br />
Becki: I recently had to send my iPhone phone away<br />
for repair (in our household we are big believers in the<br />
repair ahead of replace mentality, my partner and our<br />
10 year old daughter have even been known to take a<br />
lawnmower completely apart, replace the broken bit<br />
and then build it back up again, using detailed parts<br />
drawings) and I was reminded of what true clientcentric<br />
service is. Despite what you may think of him,<br />
Steve Jobs once said that “You’ve got to start with the customer experience and work<br />
backwards to the technology—not the other way around” and he was absolutely right.<br />
Along with a number of other visionaries, companies such as Apple came along and drove<br />
a sledgehammer through traditional business models. Much like our lawnmower exercise,<br />
they took apart workflow processes, customer service models and company culture, and<br />
rebuilt them again with the customer in mind. To them, the experience of the customer at<br />
every touchpoint was paramount; whether that was the sensory experience of opening<br />
the box of your new Apple product or the seamless repair process you needed later on.<br />
I think that many law firms believe that they are client-centric, but being client-centric is<br />
not the same as being client-focused. If you are client-focused, the approach tends to be<br />
based on looking at the customer and working out what to sell them. Conversely, being<br />
client-centric means that you approach the world from the customers’ point of view; you<br />
look to deeply understand your customers’ problems and deliver solutions for them.<br />
Nick: In a world where there is so much technology available to law firms - enabling<br />
them to automate a huge amount of their work and digitise key parts of the client<br />
journey - legal professionals have a duty to their clients to make their services as<br />
efficient and accessible as they can; clients should not be paying for hours of a legal<br />
professionals’ time for a task that could be improved through the use of technology.<br />
Legal sector technology has come on leaps and bounds over the past few years, with a<br />
huge number of solutions now available to automate repetitive and administrative tasks,<br />
so there is very little excuse for those firms not yet embracing tech. However, the onus<br />
85
should not be entirely on law firms - they also need developers creating solutions to the issues they<br />
are facing – technology that adds real value, not technology that is there for technology’s sake.<br />
That service design-led ethos is central to what we do at Exizent. We work closely with our<br />
customers (and more broadly through our Research Community), to find out exactly what the<br />
problems are around probate processes. We then use this insight to inform the development of our<br />
platform. Going forward, collaboration and integration will become more and more important; if law<br />
firms are going to become truly efficient, they need to be able to bring all the various technologies<br />
and platforms they use together in order to create more efficient workflows and ultimately, a better<br />
service for their clients.<br />
Alex: I think they should! But maybe they don’t all do it... We’re all humans<br />
after all! Like every sector, people have been influenced by the emergence<br />
of products and services which put the customer at the centre of everything.<br />
And they probably have become more eager to receive a customer approach.<br />
Even though, like doctors, lawyers are not used to this approach. Now, do I think<br />
solicitors / lawyers / barristers etc should be truly client-centric? Yes! I think it would be<br />
very beneficial for them.<br />
Sam: Ever since getting into the legal sector I’ve said that it’s largely behind<br />
the times when it comes to customer service – I don’t think many people will<br />
disagree with me even now!<br />
Yes, there are some exceptions, but I’d challenge anyone reading this to<br />
honestly admit they’ve given the necessary time and resource into reviewing<br />
and optimising their entire customer journey (to use marketing jargon).<br />
Whether it’s low-quality website content, poorly written or confusing<br />
onboarding documentation (that’s typically your client care pack and Ts<br />
and Cs etc), or obfuscated updates from solicitors and legal teams, the<br />
general standard of law firm communication is not where it should be.<br />
I spent years trying to improve this process and communication – something<br />
that was essential when dealing with up to 100,000 clients at any one time on<br />
low margin work. A breakdown in communication could trigger thousands of<br />
phone calls and emails from existing clients – all impacting the profitability of<br />
the work.<br />
My view in the main is that the only reason a client contacts you for an update,<br />
is because you’ve failed to provide the right information, at the right time, in the<br />
right way.<br />
Imagine the impact if your reviews feed was full of people saying how refreshingly easy it was<br />
to understand the process, the correspondence and updates you sent, and that they didn’t<br />
need to contact you at all for an update or to clarify what your latest letter actually meant!<br />
I’d certainly be tempted to choose that firm, based on those reviews.<br />
Martyn: The world has certainly changed with regard to the lawyer/client dynamic. A hundred or more years ago,<br />
and even less, there was a sense of an almost class divide – especially between the ‘oh so honourable, professions,<br />
and the rest of the world, who might have been classed as ‘tradesmen, retailers, workers’. Was there a sense that<br />
the term ‘profession’ could not apply to these ne’er do wells – and therefore, was there an entitled sense that<br />
these vagabonds were jolly lucky to be able to call upon the services of us ‘professional gentlemen’?<br />
If this attitude existed then what has changed it? Well – this is probably a major treatise on social history<br />
and development, the rise of a meritocracy, the breaking of barriers, and the ease of entry for new<br />
‘professionals’. If it did exist, however, I do feel that it is being well-eroded, and clients need to know, feel<br />
and be treated with respect. We must all reflect that they are truly the first line of our existence, without<br />
which, there is no purpose.<br />
86
client<br />
This can even start at the first or second point of contact, and I am always astonished and perplexed why<br />
even the simplest opportunity to shine is lost. For example, how would you feel if receiving this email out<br />
of office message from your lawyer:<br />
“At this time, we are still experiencing unprecedented numbers of email and telephone enquiries.<br />
We need you to understand that we will not always be able to get back to you in the timescale you would expect,<br />
as we need to carry out our work and deal with other enquiries as well as yours and must give priority to matters<br />
that are about to complete.<br />
Emailing us numerous times a day and phoning us constantly will not change this.<br />
Within this firm we do not treat emails any differently than ordinary post.<br />
We usually respond within 48 hours - where we have an answer - or within 7 days if we are waiting for information.“<br />
That is a true out of office, believe me! So basically, “You’re not that important to us; we’re too busy to deal<br />
with you, and actually stop pestering us!”<br />
*Howls of laughter* *Boisterous belly chuckles* The Naked Lawyer falls off her spit<br />
bucket! Finding this all so very amusing she beckons me over to help her back on her<br />
perch and whispers something in my ear…<br />
Encouraging me to pursue this line I pose the question: “What IYHO differentiates<br />
those lawyers / GCs / Barristers who deliver great client/customer service in<br />
contrast to those who do not?”<br />
James: Ok, this is a relatively easy one. Having worked with several firms across<br />
the UK, the ones that put data at the heart of the client experience are the ones<br />
that are able to generate longer-term, stronger more profitable relationships.<br />
Unfortunately, not many do put data at the heart of their businesses, and as<br />
such, opportunities to identify new ways to strengthen the client bond go<br />
missing. I guess a key question here is how do you measure great client service?<br />
For me it’s about extending a relationship beyond the immediate, and that<br />
means building trust and empathy. That takes time, getting to know your clients<br />
as people and business owners. Understanding their pain points and their<br />
ambitions, and gathering that information and insight (call it data) and using it<br />
to help them above and beyond the immediate.<br />
James Moore -<br />
Kulahub, Director<br />
Many firms simply see the transaction in front of them, not a long-term<br />
relationship. Meaning short term wins. This is a myopic position and one that could<br />
quite easily be reversed, if, during the on-boarding processes firms really took the<br />
time to get to know the businesses and the bosses better. Yes, they will be engaged,<br />
(more than likely) on a specific issue, but firms can add value through different service<br />
lines when the time is right. I have used the services of several firms throughout my career, and<br />
sadly, I haven’t built a relationship with any of them. Transactional. Do the deal, pay, done!<br />
In my world, repeat business is critical, as it takes twice as much effort to get a new client than to<br />
keep an existing one. How do good firms manage this? By building profiles and plans alongside<br />
clients, allied to their ambitions and challenges. This insight/data is then used to create a<br />
key account/client relationship where opportunities for additional fee-paying work can be<br />
identified well in advance, planned for with the client and optimised at point of delivery.<br />
Assuming you already have wonderful practitioners with great human interaction skills, then<br />
the difference between great client service and the rest, is planning, data and action. Data<br />
87
Exizent’s software makes probate easier than ever.<br />
Exizent’s software makes makes probate probate easier easier than than ever. ever.<br />
Exizent’s software makes probate easier than ever.<br />
No No more templates, build probate cases with with dedicated<br />
No<br />
software No more more<br />
to to<br />
templates,<br />
minimise build<br />
data<br />
build<br />
data probate<br />
entry<br />
probate and and cases cases<br />
admin.<br />
with with dedicated dedicated<br />
software No No more to templates, minimise build data probate entry and cases admin. with with dedicated<br />
software to minimise data entry and admin.<br />
software to to minimise data data entry and and admin.<br />
exizent.com<br />
exizent.com<br />
exizent.com
needs to be centrally managed, and ideally harnessed on a tech platform to take the ‘leg work’<br />
out of managing the data, and the communications and the scheduling and the reporting.<br />
Simply put, this is key account planning and client management together. CRM. IMHO that is<br />
the difference between great client service delivered to the benefit of the client, and the firm!<br />
Okay then, so “What would be your key tips to lawyers, GCs, Barristers etc with<br />
regard to empathising with clients / customers?”<br />
Dror: Listen to them. Be human. Disassociate what you think the customer wants or<br />
needs and find out what they are asking for. Look them in the eye, be it in person, or<br />
on Zoom. Don’t wear a suit, let them see you exactly as you are. They are exposing<br />
their vulnerabilities in the hope that you help them at their time of need. Don’t take<br />
their vulnerability for granted. Respond quickly to their enquiries and make them feel<br />
comfortable when asking follow on, clarifying questions.<br />
Sam: Talk to them like you’re down the pub (or maybe in a trendy coffee shop). You’re not in<br />
court, you’re not going to impress clients with your verbosity and eloquence. It will only lead to<br />
more questions at best, or dissatisfied clients - more likely.<br />
I’ve heard lawyers on the phone to clients talking to them like they’re trying to win an argument.<br />
Remember – you’re not doing them a favour, they’re doing you a favour by selecting your<br />
service, treat them with the respect and consideration you would expect to get yourself.<br />
Martyn: Within that mix is also relationship building and nurturing. It’s<br />
about mutual respect and both parties knowing they are working together<br />
towards a common goal.<br />
The relationship shouldn’t be based on the transactional nature of the activity –<br />
it’s about long-term relationship building – even for the smallest of transactions.<br />
Martyn Best<br />
Document Direct,<br />
Managing Director<br />
One of my earlier deals in my ‘30’s was aborted – and there was £30k of<br />
WIP on the clock. Distraught, I was not expected to be taken out for consoling beers by my corporate<br />
lawyer who declared that they would write it off – and pay for the beers. They saw the future value of what<br />
I may get up to – and probably the wonderful future hindsight of well over £200,000 of fees.<br />
It’s about really understanding your client – asking them what they are aiming to achieve, establishing<br />
quite openly how they want to be communicated to, and then delivering totally to, and beyond, their<br />
expectations of you.<br />
Becki: When considering empathy, I have to mention Harper Lee’s classic novel “To Kill a Mockingbird”. I<br />
can remember our class reading and analysing the book in school during our English classes (our teacher<br />
unenviably tasked with educating a group of bored children about empathy), but the following quote<br />
stood out to me; “You never really understand a person until you consider things from his point of view .<br />
. . until you climb into his skin and walk around in it.” It was a little like a eureka moment for me and it has<br />
stayed with me ever since.<br />
As a lawyer, seeing the world through the eyes of your client can help you to provide a level of service that<br />
will make you stand well apart from your competitors. But the task is difficult; empathy assists with the<br />
building of rapport, trust and confidence. Using empathy within dispute resolution can also give you an<br />
advantage as you not only understand your client’s wishes better but seeing the world from the opposing<br />
party’s perspective will help you to understand exactly what they want to get out of the dispute as well.<br />
Although empathy is not an emotion, it does involve an emotional reaction, which doesn’t really<br />
have a central place for a lawyer who is supporting their client through an issue. The practice of<br />
law is based upon reason and rationality. Emotions can be seen to be unpredictable and at times,<br />
illogical in their nature.<br />
As a client, the entire legal process is laden with emotion. Even if the case itself appears to be relatively<br />
neutral, the mere act of searching for, consulting with, or instructing a lawyer, causes an emotional<br />
reaction in the client. Many joke that they would much rather visit their dentist! But people want to be<br />
understood. Not just by their friends and family, but also by the people that they interact with, especially<br />
when they are feeling isolated or vulnerable and during periods of crisis.<br />
89
appiness<br />
When a client feels that their lawyer understands them and is truly interested in a successful solution to<br />
their issues, they become less anxious and more at ease. They become willing to provide information,<br />
even the information that could be embarrassing, or perhaps not show them in the best light, yet is<br />
important to their case.<br />
Outside of the profession, lawyers are not generally known to be empaths. Thinking about it pragmatically,<br />
in reality a true empath would have a pretty difficult time practising in many areas of the law. But to be<br />
truly effective and successful in their job, the lawyer needs to be able to translate their client’s story from<br />
a set of demands to a set of “resonances” with each of the other stakeholders; a successful lawyer needs<br />
to be able to induce empathy.<br />
Although having too much empathy may cause lawyers problems, a lack of empathy will undoubtedly<br />
lead to even bigger ones.<br />
Jo: Don’t Worry, Be Happy!<br />
When did you last need a lawyer? Can you remember how you were feeling<br />
before you made contact? I bet “happy” wouldn’t be the first word you would<br />
use to describe how you felt....<br />
I can count on one hand the number of times I needed a lawyer in my life so far. I<br />
can assure you for every instance there was a sense of trepidation!<br />
For many people it is often a distressing, unplanned or unforeseen circumstance<br />
the individual finds themselves in. For example - a car accident / personal injury,<br />
divorce, driving offences, criminal proceedings, employment dispute. I’d<br />
imagine words like upset, angry, stressed, or distressed might be top of this<br />
list. Certainly not happy!<br />
So how do law firms create happy customers? They should empathise!<br />
Consider the client’s emotional state at the start. Go on the journey with<br />
them, support them as their feelings change. It is likely they have been in a state<br />
of denial for some time but they haven’t sought out legal advice so likely they are<br />
now in a state of chaos and confusion and in need of help and advice to allow them<br />
to think rationally and devise the plan that can lead them to a happy outcome.<br />
Jo Liston<br />
Wipro, Senior Commercial<br />
Manager<br />
Let’s remind ourselves why a person would need a lawyer? Law is complicated! Not only can it<br />
take away paperwork and hassle but great advice and quality interventions can save money, pain,<br />
uncertainty and deliver clarity, certainty and closure. Having a lawyer should deliver a much<br />
better outcome. Great – a pathway to happiness.<br />
The basic emotion that most humans strive towards is HAPPINESS. The good news is that<br />
happiness is how people feel after they have received the legal advice – but what an emotional<br />
roller coaster they have been on!<br />
The Naked Lawyer flashes Jo a smile and a wink as I jokingly tease “Have you been<br />
OD’ing on Ken Dodd’s happy pills again, Jo?” The ambassadors immediately burst into<br />
cohesive vibrant song with hands raised flapping and performing “Happiness, happiness,<br />
the greatest gift that I possess. I thank the Lord that I’ve been blessed. With more than<br />
my share of happiness”...<br />
After much revelry I eventually succeed in cajoling the gang to settle down. “Now, now,<br />
play nicely with our newbie ambassador” I implore. In an attempt to comfort Jo, I turn<br />
to her and opine, “I guess this is like enduring ‘the bumps’ at school or a hazing at<br />
University! But please take it as an acceptance ritual. You are now formally IN the gang”<br />
Playtime over, comedians and comediennes, let’s get back to the task in hand …<br />
90
“What do you see as the key areas that are ripe for improving client/customer<br />
service by using technology now, and in the future, by law firms, businesses of<br />
law, legal departments, new entrants?”<br />
Vinnie: Total transparency of Client Information, giving the client access to matter/client<br />
data 24/7. This could move the firm from being simply reactive to a client’s request, to being<br />
proactive and knowing what information the client is seeking.<br />
Client Self Service – Where clients have unfettered access to data such as matter lifecycle<br />
information, what the status of each client matter is and where they are in terms of matter<br />
budget against granular information around hours billing, by who and for what.<br />
Client Self Service could further be used also to serve up access to parts of the law firm’s<br />
knowledge system; allowing the client to seek answers to general questions and maybe this<br />
could be a good way to expose law firm content to the client; no longer being simply pushed<br />
out to the client, maybe at the wrong time and with the wrong context; but with the client being<br />
able to pull/explore this content when required.<br />
Nick: As a service industry you simply have to cast your eyes (and digits) over the propositions<br />
we all engage with daily in other areas to know the specific elements that, when done well,<br />
fundamentally change your satisfaction (is enjoyment too high a bar for legal services?) with a<br />
service engagement.<br />
Accessibility and ease of use – I can speak to someone on video to arrange a mortgage at 8pm;<br />
simple, multi-channel communications – I can upload docs, sign digitally, chat; transparency with<br />
progress – I know who is delivering my parcel and precisely where it is on the journey; speed of<br />
execution – I can open a bank account in 10 mins; self-service – I can renew my driving licence<br />
online in a few simple steps.<br />
Internally, there are some obvious areas for improvement through technology that have knockon<br />
benefit for customers (lower costs, quicker service). In our view, the ripest area for tech<br />
improvements are the administrative tasks that can simply be completed better by machines. This<br />
includes better use of data, open banking and other resources, risk management, and integration<br />
of different technologies. For example, when someone dies, the procedures surrounding probate<br />
are still heavily reliant on people and manual processes, which are slow and cumbersome, and<br />
this then drags out the process, making it really difficult for those involved. Our platform aims to<br />
connect the data and services used by legal services firms, financial institutions, and executors<br />
to make managing the probate process easier, and it is technology like this – which can connect<br />
different parties and data – that we see making the biggest difference to the legal sector. By using<br />
technology to reduce repetitive, data-centric tasks, legal professionals have more time to focus on<br />
the more complex aspects of their work that computers simply can’t do.<br />
James: Again, this is about data gathering, centralising and using it. Technology can do so much,<br />
if properly considered (the objectives), properly developed (to the objective requirements)<br />
and properly maintained and used (by marketing and business development teams, which<br />
understand why they should be data focused and WORKING IN TANDEM).<br />
I don’t see Partner-driven client development being obsolete anytime soon, but Partners must<br />
come together to understand how technology can help their practices centralise business<br />
development and client revenue opportunities, optimise according to value and priority, then<br />
maximise every single client and prospect revenue opportunity.<br />
In practice, this is a process that is both human and technology-driven. Without one or the<br />
other, client service/CRM/lead management won’t work.<br />
Kulahub offers the technology platform, using data centralisation and manipulation,<br />
prioritisation via lead scoring (value-based) and workflow automation and communications<br />
platforms. With, of course full dashboard reporting.<br />
In my opinion, firms must get behind the principles of client servicing (as adopted in many other<br />
B2B sectors) and then behind the skillset and technology platforms that enable them.<br />
91
client management for next generation lawyers<br />
info@transparently.legal<br />
(c) transparently 2021<br />
LegalDrop offers access to simple and straight<br />
up legal services, to businesses of every size.<br />
With clear and upfront fees and a personalised<br />
service, our customers get to pick their own<br />
legal expert to handle their legal needs.<br />
To apply to join the platform, or to find out<br />
more contact us on:<br />
E: Info@LegalDrop.com<br />
T: 0203 3228205<br />
LegalDrop.com
Alex: If you take the example of audits, I think technology can help to<br />
have a more customer-centric approach.<br />
Rather than providing a written contract audit in<br />
the form of a 500-page report (which your client<br />
will have to translate into concrete actions in his<br />
own management tools) if you know that your<br />
client uses a contract management software, you<br />
can consider providing him with this audit directly<br />
Alex Grux<br />
Hyperlex, CEO<br />
and Co-Founder<br />
uploaded in the tool. The contracts are stored in secured platforms, alerts<br />
are set up, and notifications for important dates, turned on, so that clients<br />
are alerted when an obligation has to be fulfilled.<br />
To Sell documents or templates should disappear in my humble opinion.<br />
Tomorrow the technology will help professionals not to sell the template but the<br />
template machine access in order to create as fast as possible the contract but also<br />
the subscription to keep the document updated. It looks to be a great way to shift from<br />
“one shot services” to “recurring services”.<br />
Such: It’s all about ‘communication’. Using a legal service is frankly a ‘distress purchase’. Clients do not go to a<br />
law firm because they WANT to, they go to a firm because a situation has arisen which means they HAVE to.<br />
That means the client’s starting point in a relationship is ‘I really don’t want to be here spending money<br />
but I have no choice!’ That is as much the case for a straight-forward house purchase as it is a complex<br />
commercial dispute.<br />
In my view, the fastest way to improve service is rapid and regular communication. No client wants to<br />
hear about important information several days after the event and no client wants a wall of silence over a<br />
prolonged period of time.<br />
I’ve seen firms recognise this and embrace the power that already sits within the tech platforms to improve<br />
communication. They simply dial up the regularity of updates by either prompting lawyers to take action or<br />
they automate updates at certain milestones. Others have taken it a step further and provided a platform for<br />
their clients to access to almost ‘self-serve’ their need for communication.<br />
*Whizz-bang* *Whoosh* … Martyn’s nodding profusely so<br />
The Naked Lawyer hurls a muse bomb directly at him. Not<br />
expecting or prepared for this Martyn jumps to narrowly<br />
avoid a direct hit and immediately begins blustering …<br />
Martyn: Yep I agree Such, communication is the key. We now live in the fast, digital age. Our GenY and Z’s (the<br />
ones entering decision making territory) expect quick responses, prompt updates, and easy access to information.<br />
Just look at for example, Amazon, or Naked Wines as two shining examples. They communicate so well<br />
throughout the decision process, the buying process, the delivery process, and the ultimate arrival, and<br />
post-delivery. We all know exactly where our precious purchase is and when to expect it – and when it does<br />
arrive it’s nearly 100% to our expectations.<br />
The rest of the world of legal IT – LegalTech – dare I say is actually mostly irrelevant to your average client.<br />
Who cares about what CMS you have, what document management system you have, if you have AI or not?!<br />
I truly don’t care if your server is in the cloud – just as long as your head isn’t.<br />
communication<br />
93
satisfaction<br />
The number one thing that lawyers can do with better tech is to communicate better – the rest will take<br />
care of itself.<br />
I’m not saying LegalTech is unimportant – of course not – I’m just saying that your clients will not care<br />
what you have, as they will assume you are engaged with the best support you can have, to deliver the best<br />
service at the best price.<br />
Another personal example – I bought a small property recently – and the customer interaction was less<br />
than wonderful. I referred the firm to InCase, which would have both improved the whole delivery of advice<br />
but also actually would have shortened the transaction, and the time they spent on it, and of course their<br />
profitability. Despite a reasonably informed client (i.e. me) suggesting this, the reaction was still, “We don’t<br />
really think that’s for us.” It is this inward-looking state that needs changing, and tech can help this.<br />
Interestingly, I read an article in The Law Society Gazette 1 back in July that was reporting<br />
and commentating on The Legal Services Consumer Panel tracker survey which states<br />
that client satisfaction has hit an all-time high, despite lockdown. “Do you think this is<br />
because more legal service has occurred online due to lockdown?” I ask. “Why now?”<br />
“Is it because lawyers may have been forced to communicate digitally more often?” …<br />
James: That’s quite amusing. Satisfaction has gone up when face-to-face contact has gone<br />
down. What does that say about lawyers, the clients and/or the digital topology? Probably<br />
something about each.<br />
Inevitably, the pandemic has forced all businesses to address the way they conduct business<br />
and manage client service. It is no longer critical to have face-to-face interaction, though this<br />
is not necessarily a perfect way to build or maintain relationships in the longer term. Digital<br />
platforms means that client and internal communications can be more pointed, less travel on<br />
business time means more time to be productive (theoretically) and more profitable.<br />
In my opinion, we have now adjusted to different working rhythms and consumers of professional<br />
services are equally as happy receiving services remotely/digitally as face-to-face. Doing so<br />
saves them time as well. So lawyers have needed to shift and adjust as well as anyone. The<br />
upsides (once the rabbit in the headlights moment passed in March last year) of this MO are<br />
necessarily more touchpoints, via video-conferencing platforms and digital communications.<br />
These can be easily planned and managed via scheduling in Office or other.<br />
*Whizz-bang* *Whoosh* … what feels and looks like a<br />
meteorite storm of muse bombs peppers the entire room<br />
as The Naked Lawyer zips around on her Segway amongst<br />
us all. Immediately intoxicated I begin to tommy-gun the<br />
ambassadors with a plethora of questions who, being<br />
thoroughly warmed up by now, are only too keen to fire<br />
back vociferously …<br />
1. https://www.lawgazette.co.uk/news/client-satisfaction-hits-all-time-high-despite-lockdown/5109090.article?utm_source=gazette_newsletter&utm_medium=email&utm_cam<br />
paign=Borders+bill+%27risks%27+access+to+justice+%7c+Offices+set+for+reopening+%7c+Global+Britain_07%2f06%2f2021<br />
94
“Where do you think the ‘power’ currently lies in the relationship between<br />
the lawyer and the client/customer?”<br />
Such: Power has definitely shifted from the lawyer to the client. I remember 20 years ago when as a<br />
young solicitor, I had the power in the relationship. It was no more obvious than clients waiting patiently<br />
for me to call or write to them…only for their reply to be instant. Then they would wait another week or<br />
two before I next contacted them. Can you imagine the review I would get today if I took that approach?<br />
Oddly, the client has always had the power, they were probably just blindly relinquishing it on the<br />
assumption that the professional lawyer was in control. Let’s not forget the client instructs the lawyer.<br />
The client pays the lawyer. The client tells the lawyer what to do. They are definitely the ones in control<br />
and this shift of power is now squarely with the client and has been for several years.<br />
Alex: I think power currently lies in customers. Simply because, if you think<br />
about all these LegalTech platforms (e.g. Legalplace) where people can<br />
find legal advice for a very cheap price (services are sometimes four times<br />
cheaper!). You realise that clients have choice, they can actually decide where<br />
they want to go to get legal advice.<br />
If we also discuss the power balance between the Law firm and the Legal<br />
department: we could also say that today’s tech revolution definitely empowers<br />
the legal department regarding the law firm. In France, Law firms represent the<br />
legal expertise (vs the legal processes/the day to day business relationship) that<br />
you need to have to be protected against a legal risk. LegalTech emphasises<br />
the importance of the legal department in the contract processes and as a<br />
pilot of its processes inside the company. The Executive committee will have<br />
more data about the contract processes and how it impacts the day to day<br />
businesses. It’s in my humble opinion something which will help to reduce the<br />
power of law firm vs legal department.<br />
Power<br />
Sonia: Ultimately the technology players will have to be customercentric<br />
first in their experience. Otherwise they just won’t last<br />
long term. So in a way that is certainly good news for law/legal<br />
services customers. A great technology solution performs well<br />
when it retains customers and that can only happen when and if<br />
it holds solving customer real frustration points within the core<br />
conception of the product. In the legal tech land of solutions<br />
aimed at Legal departments, it will even be more fundamental<br />
as GCs are expected to be customer-centric and enable<br />
sustainable growth of their business operations. Speed,<br />
innovation and performance are required so technology<br />
relied upon by the legal teams and businesses must enable<br />
that or be discarded.<br />
“If you were a client/customer in need of legal help, how<br />
would you go about choosing a lawyer?”<br />
Sam: Personally, I would ask friends and family and existing contacts<br />
(potentially including my LinkedIn network, so make sure you’re listening<br />
on there!). I might message my tennis club pals, or the neighbourhood WhatsApp<br />
ground. But essentially, I’m looking for a recommendation.<br />
Once I get that, I want to sense-check it. I’ll take a look at their website, the reviews<br />
and comments across Facebook, Google, maybe the TrustPilot or Feefo reviews,<br />
and then decide to give them a call if that all checks out. If I get a good vibe from the<br />
phone call, you’ve got yourself a client!<br />
However, many other people are not as discerning – we know this from data we<br />
collect on searches and website form fills.<br />
Often a potential client will search for your service, click on the first few results, and<br />
fill out a form on the website (if it’s easy enough to do). Then it’s a race to see which<br />
firm can respond the quickest to get that person on the phone.<br />
You all know you convert a higher percentage of calls over form fills, so you need to<br />
get that potential client on the phone to stand more chance of signing them up. If<br />
you’re not converting more phone calls than form fills you need to urgently review<br />
your call handling process and staff!<br />
95
Vinnie: I think that the environment and ESG (Equality, Sustainability and Governance) are<br />
high on client agendas. For the majority of clients ESG is a big factor in law firm selection.<br />
D&I (Diversity and Inclusion) has been part of the RFP/Pitch selection criteria for some time,<br />
however Environmental / sustainability criteria now forms an important part of selection.<br />
Good point, Vinnie. I’m aware Salesforce has the importance of this at its heart and has<br />
even created a solution (“sustainability cloud”) to help its customers use your platform to<br />
monitor and make this a tangible success for them. Super impressed.<br />
Alex: The first thing for me would be reputation and then price. I don’t particularly care<br />
about location because I don’t mind having a digital relationship with a lawyer, so it would<br />
be the last thing I would care about. All I want is the best expert there is! So, specialism<br />
would come third. Also, about speed of delivery, it sure is important, but if the lawyer has<br />
a good reputation, it means (s)he will deliver fast.<br />
Review sites<br />
“As regulators consider forcing law firms to sign up to review websites 1 , what<br />
is your view on legal service comparator sites, and customer review sites?<br />
Are they a good/bad thing for lawyers and/or customers?<br />
Such: Online reviews are now just a way of life. Does anyone not look at<br />
reviews before any purchase, whether modest or not? We are constantly<br />
looking for validation that our chosen purchase is right for us. It is now the<br />
normal habit within the buying process and certainly applies to legal services.<br />
Frankly, if a firm doesn’t have some method to allow clients to leave reviews<br />
for all to see, future prospects will be very sceptical and on top of that, the firm<br />
is missing a great marketing lever. I know that some review sites charge for the<br />
privilege which gives me conflict but they do offer a service that is of value.<br />
However, I sympathise with any business that is in pain of paying to display reviews of its own<br />
service…but this is where Google steps in. It’s totally free to set up a Google Business Account and<br />
from there, invite clients to post reviews. The business can respond to those reviews all of which is<br />
completely free and totally visible…and I’m sure there is some sort of algorithm working in the background<br />
to help the website improve its visibility and ranking! Sam will no doubt have a good expert view on this!<br />
Dror: Review websites are good for all parties. Of course, there are going to be issues, just<br />
as there would be with any review site in any industry (for example, the authenticity of<br />
the reviews, whether the reviews are a fair representation etc), but in general, they are a<br />
good way for reducing friction in accessing legal services. The current government plan<br />
to crack down on fake reviews and make it illegal for people to write or host reviews will<br />
be a positive step in protecting consumers online.<br />
Whilst reviews are not the only factor that should be considered when choosing a legal<br />
professional, they do play an important role in helping the customer decide who to<br />
work with. Word of mouth is a powerful way to assess who to work with and reviews<br />
are an extension of this. If the collection and presentation of reviews are done properly<br />
(reviewsolicitors.co.uk do this well), then reviews have the potential to be even more<br />
effective as they can mitigate personal biases.<br />
From the lawyers’ perspective, I understand it can be scary to be scrutinised publicly.<br />
But for those lawyers who want to survive past the age of the machine, being brave<br />
enough to take a step forward, and showing the world that they are willing to put<br />
customer service at the top of their agenda, is incredibly valuable.<br />
But you can’t have your cake and eat it, you either want to be customer-centric or not.<br />
There is a reason why platforms such as Trustpilot and TripAdvisor are worth billions,<br />
the market is telling us that consumers expect reviews.<br />
1. https://www.lawgazette.co.uk/news/regulators-consider-forcing-firms-to-sign-up-to-review-websites/5108763.article<br />
97
“Do you think clients / customers prefer to use technology 100%, partially<br />
(i.e. in the first instance before then moving on to human lawyer help) or<br />
not at all for their legal service experience?”<br />
Jo: Without wanting to simplify and over-generalise, it might be quite helpful to think<br />
about a person’s preference towards technology in the context of three demographic<br />
characteristics - Baby Boomer, Gen X and Gen Y/Millennials.<br />
Baby boomers were born between 1943 and 1964<br />
Many Baby Boomers now own a smartphone. They also use social media—especially Facebook,<br />
where they’ve doubled their usage since 2015. One could argue that the digital adoption<br />
of smartphones is a necessity, but growth in social media usage shows the opposite.<br />
The pandemic has increased tech adoption with the older generations, but adoption was<br />
already trending upward before COVID-19 forced many businesses online. Like businesses<br />
that were forced to take operations online, Baby Boomers took their business<br />
online, due to safety advantages when COVID-19 hit.<br />
100% Tech<br />
So, it’s good news! Baby Boomers are embracing tech – but make sure you have representation<br />
from this group when designing your customer experiences and journeys. It<br />
might sound patronising – but many on-line apps neglect this demographic and something<br />
as simple as the font size of text is overlooked. Remember they value relationships,<br />
so treat them well and you will be rewarded with loyalty. Don’t lose sight that the<br />
Baby Boomer generation controls around 80 per cent of UK private wealth. Property<br />
is expected to account for 70 per cent of transferred wealth.... that’s a sizeable market<br />
opportunity. Anyone who is likely to be in receipt of this.... Generation X!<br />
Generation X were born between the mid-1960s and 1980<br />
They grew up with minimal adult supervision and learned the value of independence<br />
and work-life balance. They also appreciate informality, are technologically adept, flexible<br />
and tend to be highly educated.<br />
Often termed the sandwich generation - many have parents, children and are homeowners<br />
themselves. They are accumulating wealth and likely to inherit wealth in the not-so-distant<br />
future. They may be married and have an expanding family. They will research and not<br />
go with the first lawyer they find. They will seek recommendations and research a firm’s<br />
successes and failures. Please think about how you attract and retain new customers. New<br />
Gen X customers could have size-able long-term value and they are loyal when they can<br />
see great service and value for money. In 2021, Gen X is at peak buying power.<br />
The Millennial (Gen Y) generation were born between 1980-2000<br />
They make up the fastest growing segment of the workforce. As companies compete for<br />
available talent, employers simply cannot ignore the needs, desires, and attitudes of this<br />
vast generation. As with each generation that preceded it, Millennials have come to be<br />
defined by a set of characteristics formed mainly by the world and culture they grew up<br />
in. Here are a few of their common characteristics:<br />
• Tech-Savvy • Family-Centric • Achievement-Oriented<br />
• Craves Attention • Prone to Job-Hopping<br />
You need to bear this in mind when you consider how often and what medium to keep Gen<br />
Y updated. Lifetime value of a Gen Y customer is also tricky to navigate. How they behave<br />
in the workplace is a strong indicator of how they behave towards firms (brands). You will<br />
need to work exceptionally hard to win repeat business and engender loyalty in Generation<br />
Y. They much prefer self-service and on-demand services. You need to make it intuitive and<br />
easy to do business with. Lazily labelled generation rent, many (if not already) have strong<br />
aspirations for home ownership and are mindful that they may also inherit wealth. Gen Y<br />
wants to handle this responsibly and they care deeply about financial security.<br />
Get to know your customers, how they think, what matters to them, what they value and<br />
need. Market and tailor your services to suit them best.<br />
98
generational<br />
Nick: This is the question that almost all service industries wrestle with. The<br />
answer is (unfortunately) “it depends”. If we start from the position that we<br />
are here to serve our clients and customers, then we must be prepared to<br />
accommodate them on their terms. The circumstances are everything here.<br />
Is your client stressed or under pressure? Is the topic or task difficult or<br />
simple? Is it a transaction or a relationship-focused engagement? Are they<br />
comfortable with technology or do they find it alienating? The variables are<br />
many and, as such, there can be no one-size-fits-all model in a servicefocused<br />
business.<br />
The parallels between the legal sector and the financial services world I worked<br />
in for many years are strong. Banks have been working fanatically for years<br />
to digitise services, with every engagement viewed as a transaction that can<br />
be made easier (from the banks’ perspective perhaps!) by putting it online. In<br />
reality, for all the reasons mentioned above, as a customer you occasionally<br />
just want/need to speak to someone directly to get advice, guidance or<br />
help. There is nothing more frustrating than being unable to escape a digital<br />
journey when it’s not working for you. In many cases digitisation has gone<br />
too far, and banks are now trying to find ways to reconnect human with human.<br />
So, the holy grail of service is, in my mind, a very flexible hybrid model that enables engagement<br />
with clients using technology where it helps (comms, information gathering, progress reporting etc.),<br />
but make access to the expert easy and unconditional.<br />
At Exizent we are completely focused on bereavement. As our lives and therefore probate cases<br />
become more complex, the human aspect is absolutely vital - the help and support that legal<br />
professionals provide the bereaved cannot be overestimated. In fact, the Exizent Bereavement<br />
Index showed that 39% of law firms provided their clients emotional support in at least half of<br />
bereavement cases – unsurprising given 94% of people who had recently lost someone said they<br />
found at least part of the bereavement process stressful.<br />
That’s why we are firm believers in the role of the legal services community in helping the bereaved,<br />
but massive advocates of introducing the right technology to ease the whole process.<br />
If this should be the case, perhaps we should consider the following:<br />
“Lawyers love to say that they are “trusted advisors”. Should trust in people/<br />
lawyers be extended to trust in machines/technology by clients/customers? i.e.<br />
would YOU trust a machine / technology to do as good a job (if not a better job)<br />
than a human lawyer in your hour of need?”<br />
Such: It is often said ‘trust is earned’. Generally, the public do trust lawyers from the outset but that will start<br />
from a low base and improve over time. Once trust is cemented into the relationship, it can be a very hard<br />
bond to break. Of course, there are situations when that trust erodes because the client doesn’t get the service<br />
or result they expect and lawyers can find themselves on a downward spiral. When it comes to machines and<br />
technology, the public is now so ‘hard-wired’ into using tech that trust comes naturally and instantly – trust<br />
isn’t earned here. If that machine or piece of tech fails, that trust can quickly disappear whereas with a human<br />
lawyer, there is a quick route to re-building that trust through face-to-face contact.<br />
But “The ‘trust’ issue often goes hand in hand with what level of ‘risk’ you are<br />
willing to take as a client / customer. Do you think it is riskier using the machine<br />
/ technology than a human lawyer?”<br />
Alex: I think that using one or the other would be riskier! For this to be balanced, humans and<br />
robots would have to work hand in hand. The robot could give plenty of information, and the<br />
human could complete the work by analysing the data and using his free will to advise.<br />
99
Simplify.<br />
Accelerate.<br />
Create.<br />
Wipro delivers enterprise innovations on<br />
the most powerful digital platforms.<br />
In every industry, technology is outpacing<br />
adoption. And customers are expecting<br />
organisations to deliver frictionless<br />
interactions across all channels. We partner<br />
with law firms to design solutions that simplify<br />
their transformation road maps, accelerate<br />
their transition to new platforms, and enable<br />
them to create experiences that matter.<br />
Wipro is a recognised leader in cloud-led transformation<br />
wipro.com/contact-wipro
egulation<br />
Let’s just pick up briefly on the regulatory element again, shall we? Professor<br />
Stephen Mayson has been reading and following our roundtable discussions<br />
and has kindly commented that he loves the focus on the user/consumer<br />
expectation and experience in our Technology in Law Law Land sessions. He<br />
says he’s been “thinking about consumer expectation and experience a lot<br />
recently as part of the next steps in regulatory reform”.<br />
“Is the current legal regulatory framework and system a help or<br />
a hindrance for clients / customers? Should machines / robots be<br />
regulated like human lawyers?”<br />
Martyn: Now that’s a funny one – it’s the people that cause the problems, not the machines.<br />
Regulation<br />
Sonia: Yes – where the activity falls under the scope of regulations of law<br />
activity. The goal of these regulations is to protect the public so whether it<br />
is delivered by humans or via algorithms or a mix. Whilst trying to not hinder<br />
innovations, regulators shall proactively imagine future developments and<br />
precede them to set a regulatory frame around them and not play catch-up.<br />
Regulators should not let industry or players self-regulate or self-police on<br />
these issues of artificial intelligence developments.<br />
Dror: 100% yes, they should be regulated. Just like an unregulated lawyer, an<br />
unregulated machine could potentially create unfair practices or undesired<br />
outcomes. Regulations (when in place correctly) are there to protect the<br />
end user, who is often in a more vulnerable position than the lawyer.<br />
Whether machines can be regulated or not is perhaps a question for a<br />
singularity expert.<br />
Alex: In theory, yes, there should be one rule for everyone.<br />
For example, lawyers should have a very strong code of<br />
ethics. At law school, there are many courses on this subject.<br />
But as the robot lawyer has no free will, it would make no<br />
sense to train him on deontology because we are trying to<br />
correct human failings with this. A robot will not have the idea<br />
to leave with his client’s money and go to the Bahamas.<br />
At the end of the day, Robots are executing Human instructions<br />
(through the dataset or through the code), so it’s likely only the<br />
human element will have to be regulated.<br />
Dror Levy<br />
LegalDrop, CEO<br />
and Co-Founder<br />
Another way to see the question… Imagine that tomorrow<br />
regulators will use robots to execute continuous controls of regulations and<br />
regulated companies will also have software to execute continuous controls<br />
inside their companies, etc.<br />
I’m sure we will see regulator robots which will be used to directly certify the<br />
legal AI of the software etc. It would be a king of machines regulation “by<br />
design”. The future will be amazing.<br />
101
In the previous Technology in Law Law Land issue you will have read that I<br />
shared between 2020 and 2050 more than half of legal services workers<br />
will have lost their jobs and those that remain will be forced to take<br />
“performance-enhancing medication”. Do you think clients/customers<br />
will be accepting of this scenario aka engaging / commissioning a<br />
human lawyer who is ‘medicinally enhanced’?<br />
Martyn: It’s a funny thought but won’t happen. We will need people, and people are<br />
resourceful enough to adapt and apply themselves to the new opportunity of increased<br />
regulation that is looming our way – if only on the laws relating to using machines in a<br />
legal practice.<br />
Oh really? What say you, Alex? …<br />
Alex: Is an antidepressant a performance enhancing medication? If<br />
yes, the future is already here. I think it’s not jobs that will disappear,<br />
it’s tasks. If the job disappears it’s because it was not a job but a<br />
task execution position (and not the best place to work). If we are<br />
thinking about competing against the machine for a similar task,<br />
we will need a lot of medications; it is a lose-lose situation. But,<br />
if we imagine working with machines and associate the power of<br />
computation and the untiring execution of repeatable/boring tasks<br />
of the machine with the emotional capabilities and the creativity<br />
of the Human, we will find a job which gives us time to be happy.<br />
Future<br />
One final question:<br />
*whizz-bang* *Whoosh* *Zing* *Vroom-<br />
Vroom* … The Naked Lawyer dances<br />
on her Segway as we all burst into<br />
animated song again: “Happiness,<br />
happiness, the greatest gift that I<br />
possess. I thank the Lord that I’ve been<br />
blessed. With more than my share of<br />
happiness.” Uh-oh, time to wrap things<br />
up before The Naked Lawyer grabs a<br />
tickling-stick methinks. With only two<br />
muse bombs remaining on her utility<br />
belt things could get very naughty!<br />
“As a buyer of legal service/product aka user of the legal system<br />
(in any capacity i.e. as a tech supplier or actual lay person needing<br />
legal help), if you had the opportunity to chat with any famous<br />
solicitor / lawyer / judge / politician in the world alive today, what<br />
question would you ask, and why?”<br />
Martyn: Curiously, Barack Obama, Vladimir Putin and Xi Jinping are all trained lawyers.<br />
I’d therefore ask them to get their heads together and improve the customer service of<br />
the world, and stop being so short-term and self-centred, build long-term relationships<br />
and really understand what your 8 billion customer base wants.<br />
102
conclusion<br />
Alex: Why are we not changing the system faster? It’s an easy question but a complex<br />
answer with multiple facets of a unique problem which glues our system together. I love<br />
the early adopters of today’s legal system who want to change just to change (with<br />
sometimes no business reasons). They just want to run to the future. However, it's a real<br />
pity to see how sometimes things take so long to be adopted by people who have a<br />
really good reason to change. My biggest example is the law firm vs corporate: when we<br />
founded Hyperlex technologies we had 2 approaches:<br />
• be adopted by lawyers to transform legal services from law firms; and<br />
• be adopted by companies to make improvements for themselves:<br />
4 years later it was still impossible to make law firms in France adopt our kind of<br />
technologies. They are still wondering if it is useful for them, if the cloud is safe enough, if it<br />
will impact their pricing model, etc. But on the other side, some companies are embracing<br />
these new tools and technologies, and are running as fast as possible to deploy this<br />
service to their internal users.<br />
Why?<br />
Oh-oh. Don’t get me and The Naked Lawyer started on THAT topic, Alex. *Raucous<br />
laughter* *smiles* *winks *nods* …<br />
Becki: Without a doubt I would ask to have a chat to Sir James Munby. He was a Judge and the President<br />
of the Family Division of the High Court when we first started Transparently. I can remember the first<br />
time I read his “View from the President’s Chambers” and thinking he completely understands the<br />
struggles and intricacies of life on the “ground”, which for a person at such an elevated level is bluntly…<br />
rare. Everything he said resonated. What would my question be? That’s easy; please can I have a day of<br />
your time so that I can ask you a thousand more questions.<br />
LOVE IT! If only we had more time. If only … TIME … Such a precious element at the<br />
heart of life, business and lawyering. Maybe even cherished as much as happiness,<br />
perhaps? And with that parting thought, The Naked Lawyer zip-zapped across the room<br />
chanting “Happiness, happiness, the greatest gift that I possess. I thank the Lord that<br />
I’ve been blessed” …<br />
See you next time!<br />
By Chrissie Lightfoot Chief Tech Advisor and Writer to Modern Law<br />
(Chair of the ‘Technology in Law Law Land’ roundtable). Chrissie is<br />
an Independent Non-Executive Director and Advisor, a global multi-award<br />
winning Legal Futurist, Consultant, Entrepreneur, Lawyer, AI LawTech<br />
Pioneer, Strategist, Marketeer, Brand builder, best-selling Author and<br />
Keynote Speaker. Founder and CEO of EntrepreneurLawyer Ltd.<br />
103