Manual - New England Biolabs

Catalog #E3000S
Store at –20°C
RheoSwitch ® Mammalian
Inducible Expression System
Precise Control of Gene Expression in Mammalian Cells
I n s t r u c t i o n M a n u a l
Version 1.3
11/07

Table of Contents:
Supplied Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Experimental Outline . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Example Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
Appendix
pNEBR-X1Hygro Plasmid Map and MCS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
pNEBR-R1 Plasmid Map. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
Kit Components Sold Separately/Companion Products . . . . . . . . . . . . . . . . . . . . . . . . 21
Licensing Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
RheoSwitch ® is a registered trademark of RheoGene, Inc.
TransPass is a trademark of New England Biolabs, Inc.
1

2
Supplied Components:
The RheoSwitch ® Mammalian Inducible Expression System contains plasmids
and ligand inducer necessary to express genes in mammalian tissue culture.
Store at –20°C.
Vectors:
pNEBR-R1 Regulator Plasmid (500 µg/ml) 20 µg
Expresses an engineered nuclear receptor heterodimer, consisting of two
proteins, RheoReceptor-1 and RheoActivator. The two proteins constitute the
holoreceptor and regulate transcription of genes cloned into the expression
vector, pNEBR-X1. The two proteins are expressed from the constitutive ubiquitin
UbC and UbB promoters, respectively. The plasmid also contains the neomycin
resistance gene under control of the SV40 early promoter for the generation of
stable cell lines.
pNEBR-X1Hygro Vector (500 µg/ml) 20 µg
Used to clone the gene of interest. The plasmid, has five copies of the GAL4
response element (5XRE) upstream of a TATA box and a short leader sequence
followed by multiple cloning sites and an SV40 polyA signal. The plasmid also
contains the hygromycin resistance gene under control of the thymidine kinase
promoter for generation of stable cell lines.
pNEBR-X1GLuc Control Plasmid (500 µg/ml) 20 µg
Used as a positive control for expression analysis. This plasmid expresses
secreted Gaussia luciferase.

Inducer:
RheoSwitch ® Ligand RSL1 (5 mM in DMSO) 50 µl
Sequencing Primer:
RheoSwitch R-X1 Sequencing Primer
5´ (GGGTATATAATGGGGGC) 3´ 200 pmol
This primer can be used to confirm correct insertion of gene to be expressed in
pNEBR-X1. Supplied as a lyophilized triethylammonium salt.
Luciferase Assay Reagents:
GLuc Substrate (100X) 50 µl
GLuc Assay Buffer 5 ml
3

4
Introduction:
The RheoSwitch ® Mammalian Inducible Expression System permits maximum control
of gene expression in mammalian cells. Analogous to the operation of a rheostat, the
RheoSwitch technology allows induction and adjustable control of gene expression.
This precise regulation of gene expression is achieved through the highly specific
interaction of a synthetic inducer, RheoSwitch Ligand RSL1, and a chimeric bipartite
nuclear receptor. This receptor is activated in the presence of RSL1 ligand, and the
level of gene expression can be regulated by adjusting the concentration of RSL1
ligand in the tissue culture media.
The RheoSwitch technology offers several advantages over other inducible systems.
Its precise control is unrivaled among mammalian expression systems, giving negligible
levels of basal expression in the absence of inducer and greater than 10,000 fold
induction when RSL1 ligand is present. Unlike other systems, which rely on steroids
or other drugs, the synthetic ligand RSL1 shows no pleiotropic effects in mammalian
cells and exhibits no cross talk with endogenous transcription factors. In addition, the
RheoSwitch System has no special culture media requirements.
Applications:
• Inducible protein expression
• Expression of toxic genes
• Overexpression/mutant rescue studies
Features:
• Precise regulation of expression levels
• Negligible basal expression
• Synthetic inducer and engineered receptor eliminate non-specific side effects

Background:
The RheoSwitch System represents the next generation of inducible gene expression
systems for mammalian cells. It is composed of an engineered nuclear receptor and
a synthetic ligand inducer that is highly specific. The system is built on a two-hybrid
switch format that activates transcription in the presence of inducer and represses
gene expression in its absence (1,2,3 and unpublished observations). The synthetic
receptor is composed of two proteins, RheoReceptor-1 and RheoActivator, that dimerize
to make a holoreceptor. Both are expressed from strong constitutive promoters on
plasmid pNEBR-R1. The RheoReceptor-1 protein is a highly engineered ligand-binding
domain (LBD) of an insect EcR nuclear receptor fused to the yeast GAL4 DNA
binding domain. The RheoActivator protein is an insect/mammalian RXR hybrid LBD
fused to the viral activation domain VP16. The gene to be expressed is cloned into
the pNEBR-X1 plasmid under control of five tandem repeats of the GAL4 response
element (5XRE). In the absence of RSL1 ligand, the receptor represses transcription
by binding to the GAL4 elements in a transcriptionally inactive conformation.
Upon induction, the RSL1 ligand tightly binds and changes the conformation of the
RheoReceptor-1 protein which stabilizes the holoreceptor heterodimer on the 5XRE.
The activated holoreceptor and the VP16 activation domain bind and recruit to the
promoter transcriptional coactivators along with basal machinery, resulting in a highly
induced transcriptional state (Figure 2).
This high induction of transcription coupled with extremely low basal expression
results in extremely high induction levels (greater than 10,000 fold induction), with a
degree of control that is superior to other systems.
RSL1 ligand induces transcription over a broad range of concentrations from
picomolar to micromolar. As illustrated in Figure 3, Gaussia Luciferase activity
increases in an almost linear fashion with increasing amounts of RSL1. Likewise,
increasing amounts of protein are observed, via immunoblot assay, with increasing
5

6
amounts of RSL1 (Figure 4). Even with a longer exposure, no protein is observed
in non-induced cells (Figure 4, Lane 5), further demonstrating the degree of control
of over expression. Induced expression can be seen in as little as 1 hour, reaching
a maximum level between 48 and 72 hours (Figure 5). The RheoSwitch System is
very responsive to RSL1 and its removal from the medium will rapidly turn off gene
expression (Figure 6).
RSL1 ligand is a synthetic diacylhydrazine, [N-(2-ethyl-3-methoxybenzoyl)-N´-
(3,5-dimethylbenzoyl)-N´-tert-butylhydrazine] (Figure 1) (4). It is one of a family of
compounds that have been found to act as non-steroidal ecdysone agonists and can
function as gene inducers (4,5). RSL1 binds tightly and selectively to RheoReceptor-1,
altering its conformation so that it releases bound negative regulatory cofactors and
stabilizes the RheoReceptor/RheoActivator heterodimer. RSL1 is not a steroid—it is
invisible to mammalian nuclear receptors and has been shown to be inert within all
cell lines tested to date. The result is an inducible system that specifically controls the
gene of interest without unwanted effects on the host cells.
O
O
N
H
N
Figure 1: Chemical structure of RheoSwitch
Ligand RSL1 (MW=382.5 daltons).
O

pNEBR-R1
RheoReceptor-1 P1 P2 RheoActivator
OFF ON
pNEBR-X1Hygro
5X RE
Gene of Interest
pNEBR-R1
RheoReceptor-1 P1 P2 RheoActivator
pNEBR-X1Hygro
5X RE
Basal
Transcription
Complex
Gene of Interest
Figure 2: Transcriptional control using the RheoSwitch System. "OFF" state: In the
absence of RSL1 ligand, the RheoReceptor and RheoActivator proteins exist in an inactive
conformation and transcription is kept off. "ON" State: In the presence of RSL1 ligand, the
two proteins stably dimerize and bind to the response element of pNEBR-X1Hygro in an
active conformation and transcription is turned on.
RSL1
7

8
Luciferase Activity (RLU)
90,000 45,000
80,000
70,000
60,000
50,000
40,000
30,000
20,000
10,000
0
0 800 pM 4 nM 20 nM 100 nM 500 nM
RSL1 Concentration
40,000
35,000
30,000
25,000
20,000
15,000
10,000
5,000
Figure 3: Luciferase expression in response to increasing RSL1 concentrations. NIH 3T3
cells co-transfected with pNEBR-R1 and pNEBR-X1 expressing firefly luciferase were
induced with the indicated RSL1 concentrations. Expression was measured 48 hours postinduction.
0
Fold Induction

62
47.5
32.5
25
16.5
A B C
10 50 100 500 0
nM RSL1
62
47.5
32.5
25
16.5
10 50 100 500 0 10 50 100 500 0
nM RSL1
Figure 4: NIH 3T3 (A) and RheoSwitch HEK293-A7 (B) (NEB #C2003) cells were transfected
with pNEBR-X1Hygro encoding a HA-tagged protein using TransPass D2 (NEB #M2554).
NIH 3T3 cells were also co-transfected with pNEBR-R1. RSL1 was added to transfected cells
16 hours later, and cells were harvested 24 hours after induction (Note: DMSO is added as a
control for 0 nM RSL1). Harvested cells were lysed, and equivalent amounts of protein
(as determined by Coomassie Stain) were electrophoresed and transferred to nitrocellulose.
An immunoblot assay was performed on the filter using anti-HA as primary antibody and
detected using anti-mouse secondary antibody and reagents. A longer exposure of the
HEK293-A7 immunoblot is shown (C) to illustrate that no protein is detected in the
absence of RSL1.
9

Luciferase Activity (RLU)
10
100,000
10,000
1,000
100
10
1
RSL1 (500 nM)
DMSO
0 4 8 12 16 20 24
Time Post Induction (Hours)
Figure 5: Induction time course. NIH 3T3 cells co-transfected with pNEBR-R1 and pNEBR-
X1GLuc control plasmid were induced with RSL1. Gaussia luciferase activity was assayed
between 1 and 24 hours post-induction.

Luciferase Activity (RLU)
25,000
20,000
15,000
10,000
5,000
RSL1
Addition
RSL1 (500 nM)
DMSO Control
RSL1
Removal
RSL1
Addition
RSL1
Removal
0
0 12 24 36 48
Hours
60 72 84 96
Figure 6: Rapid ON:OFF switch response to two cycles of addition and removal of RSL1.
NIH 3T3 cells were co-transfected with pNEBR-R1 and pNEBR-X1 expressing a destabilized
firefly luciferase and induced with RSL1 followed by removal of RSL1 at 24 hours. A second
cycle of addition/removal of RSL1 results in a new ON:OFF switch response. To remove RSL1
and turn off expression, cells were washed and RSL1-free media was added at the times
indicated. The blue line represents induced expression. The red line represents uninduced
expression.
11

12
Gaussia Luciferase (GLuc) Control Reporter
The RheoSwitch Mammalian Inducible Expression System includes a control reporter
plasmid (pNEBR-X1GLuc) encoding a secreted luciferase. GLuc is a new luciferase
from the marine copepod Gaussia princeps (6). This luciferase, which does not
require ATP, catalyzes the oxidation of the substrate coelenterazine in a reaction that
produces light (470 nm), and has considerable advantages over other luminescent
reporter genes.
Features of GLuc Control Reporter:
• It possesses a natural secretory signal and upon expression is secreted
in the cell culture medium facilitating assays.
• Produces 1,000 fold higher light intensity than Renilla or firefly luciferases.
• Multiple samples can be assayed from the same transfected cells, for example, at
different time points.
• The sequence has been “codon-optimized” for expression in mammalian cells.
• The secreted protein is very stable and has extremely high activity in light
production allowing for very sensitive assays.

Experimental Outline:
Expressing your gene of interest with the RheoSwitch System is accomplished in the
following steps:
• Clone gene of interest into the pNEBR-X1Hygro Vector.
• Perform transient transfection and test induction of cloned gene.
• Establish a stable cell line expressing the RheoSwitch Receptor.
• Introduce cloned gene into the RheoSwitch Receptor stable cell line.
1. Clone gene of interest into the pNEBR-X1Hygro Vector:
Clone your gene of interest into pNEBR-X1Hygro using any restriction site in the
multiple cloning site (MCS) (Figure 6). The gene sequence must have its own functional
ATG initiation and termination (stop) codons. Sequence at the 5´ junction of the
cloned gene can be confirmed using primer NEB #S1280 (included in the kit) and at
the 3´ end with NEB #S1272.
2. Perform transient transfection and test induction of cloned gene:
Once the gene of interest has been cloned, test its expression in the desired cell line
by co-transfecting with the RheoSwitch Receptor expressing plasmid, pNEBR-R1. Culture
conditions and transfection protocols will depend on the particular cell line used.
We recommend our TransPass D1 (NEB #M2553) or TransPass D2 (NEB #M2554)
transfection reagents; see for protocols and additional information. A
molar ratio of receptor plasmid to expression plasmid between 1:2 and 1:8 is recommended.
The supplied pNEBR-X1GLuc can be used as a positive control.
13

14
To induce expression, RSL1 ligand is added to the transfected cells. RSL1 ligand can
induce gene expression over a broad range of concentrations (Figure 3). Use a final
concentration of 500 nM for full induction. Cells can be assayed for expression 24
hours post induction. Maximum fold induction depends on cell type and transfection
efficiency. See the "Example Protocol" for transient transfection and induction in
NIH 3T3 cells.
3. Establish a stable cell line expressing the RheoSwitch Receptor:
The neomycin resistance gene in pNEBR-R1 can be used to construct stable cell lines
expressing the RheoReceptor and RheoActivator proteins. After transfection, cells
are selected via their ability to grow in media containing the antibiotic G418 using
standard techniques. G418-resistant clones can be screened for RheoSwitch function
using transient transfection of pNEBR-X1GLuc. Screen multiple clones and select
those with high RSL1 induction ratios. For a detailed protocol see:
Current Protocols in Molecular Biology, Chapter 16, Protein Expression, Section III,
Expression in Mammalian cells.
4. Introduce the cloned gene into the RheoSwitch Receptor stable cell line:
The cloned gene in pNEBR-X1Hygro can be introduced by transient transfection in
the stable cell line expressing the RheoSwitch Receptor and induced as described in
step 2. The hygromycin resistance gene in pNEBR-X1Hygro can be used to construct
a stable line expressing the cloned gene. After transfection, cells are selected via their
ability to grow on media containing hygromycin using standard techniques and assayed
for expression of the cloned gene.

Example Protocol:
Transient transfection and induction in NIH 3T3 cells using Gaussia luciferase
control reporter plasmid, pNEBR-X1GLuc:
This protocol is optimized for transfection with NEB's TransPass D2 Transfection
Reagent (NEB #M2554S). If a different reagent is used, modify protocol accordingly.
Day 1:
Plate NIH 3T3 cells in a 24 well plate. Seed 2.5 x 104 cells per well in 0.5 ml DMEM
containing 5% FBS to achieve approximately 50–70% confluence.
Day 2:
The following protocol is given for transfecting 6 wells. The transfection mixture must
be prepared in serum-free medium. However, cells may be transfected in the presence
of up to 5% serum.
1. Prepare a plasmid master mix by adding 600 ng pNEBR-R1 (100 ng/well) and
2.4 µg pNEBR-X1GLuc (400 ng/well) to 0.6 ml serum-free DMEM.
2. Add 9 µl of TransPass D2 Transfection Reagent to the plasmid master mix and
mix gently. Incubate the transfection mixture at room temperature for 20 to 30
minutes.
3. Mix gently and pipet 100 µl of transfection mixture into each of the 6 wells.
Gently rock the plate and return to incubator for at least 1 hour. There is no need
to remove the transfection mixture.
15

16
4. Add RSL1 ligand to a final concentration of 500 nM to three wells and an equivalent
amount of DMSO to the remaining wells as a control. RSL1 can be added to
cells by one of two methods: 1) RSL1, diluted in DMSO, can be added directly to
each well; or 2) Culture medium can be replaced with fresh medium containing
500 nM RSL1.
Notes: a) DMSO concentration should not exceed 0.1 % (v/v) per well. b) RSL1 is not
soluble in culture media at concentrations higher than 10 µM. c) Level of expression
can be adjusted by varying the final RSL1 concentration.
5. Collect at least 20 µl of cell culture supernatant from each well 4–24 hours postinduction
for luciferase assay. Samples may be stored at –20°C without loss of
activity.
Gaussia luciferase assay:
i. Prepare assay working solution by diluting GLuc Substrate 100-fold in GLuc
Assay Buffer. 50 µl of working solution is required for each assay.
ii. Pipet 20 µl of each culture supernatant into a microtiter plate well or sample tube
as appropriate for luminometer being used.
iii. Add 50 µl of assay working solution to the sample and promptly measure the
luminescence. Integrate for 5–10 seconds.

Appendix:
A.
Pci I 5142
BsaA I 4158
ori
BstB I 3808
Sac I 5883
Aat II - Zra I 3644
PshA I 3640
Pvu II 6153
5XRE
MCS
BfuA I - BspM I 3355
pNEBRX1-Hygro
6268 bp
Hyg R
PflM I 155
Bsg I 389
polyA SV40
Sac II 2890
BsaB I 615
Bcg I 1245
Sap I 2071
PpuM I 2348
Xcm I 2365
Figure 6A: pNEBR-X1Hygro plasmid map. Used to clone the gene of interest, it has five
copies of the GAL4 response element (5XRE) upstream of a TATA box and a short leader
sequence followed by multiple cloning sites and an SV40 polyA signal. Only unique restric-
5XRE
TATA box
tion enzyme sites are shown.
...CTCCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCTAGAGGGTATATAATGGGGGCCGTCAGCT
. . . .
RheoSwitch
.
5820 5840
predicted
R-X1 primer (#S1280S)
transcription
start
Ap R
17

18
B.
PshA I 3640
BfuA I - BspM I 3355
Sac II 2890
5XRE
TATA box
...CTCCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCTAGAGGGTATATAATGGGGGCCGTCAGCT
. . . .
RheoSwitch
.
5820 5840
predicted
R-X1 primer (#S1280S)
transcription
start
SacI ApaI NarI HindIII EcoRV
ACTACCAGAGCTCATGGGCCCGTGCAATTGAAGCCGGCTGGCGCCAAGCTTCTCTGCAGGATAT
. . . . . .
5880 5900 5920
XhoI BssHII
BamHI PacI FseI PspXI NotI NheI AscI
CTGGATCCACGAATTCTTAATTAAGGCCGGCCTCGAGCGGCCGCTAGCGATCGCGGCGCGCCAC
. . . . . . .
5940 5960 5980 6000
StuI T7 minimal primer
BsrGI SphI SalI
(#S1272S)
GCGTCTCCGGATGTACAGGCATGCGTCGACCCTCTAGTCAAGGCCTATAGTGAGTCGTATTACG...
. . . . . .
6020 6040 6060
Figure 6B: pNEBR-X1Hygro multiple cloning sites (MCS). To minimize uninduced expression,
a short sequence containing the TATA box separates the end of the 5XRE from the
predicted transcription start. Only unique restriction enzyme sites are shown.

Ale I 8125
BsiW I 8109
Ahd I 9421
Neo R
Xmn I 10021
Sca I 9904
ori
polyA
P SV40early
Ap R
polyASV40late
R heoA ctivator
pNEBR-R1
10338 bp
polyA
SnaB I 655
TK
RheoReceptor
EcoR V 43
Asc I 4327
Figure 7: pNEBR-R1 plasmid map. Expresses an engineered nuclear receptor heterodimer,
consisting of two proteins, RheoReceptor-1, and RheoActivator. The two proteins constitute
the holoreceptor and regulate transcription of genes cloned into the expression vector,
pNEBR-X1. The two proteins are expressed from the constitutive UbC and UbB promoters,
respectively. The plasmid also contains the neomycin resistance gene under control of the
SV40 early promoter for the generation of stable cell lines.
P UbC
P UbB
19

20
References:
1. Karzenowski, D., Potter, D.W., and Padidam, M. (2005) BioTechniques. 39, 191-196.
2. Dai, X., Willis, L.G., Palli, S.R., and Theilmann, D.A. (2005) Protein Expr. Purif. 42, 236-245.
3. Palli, S.R., Kapitskaya, M.Z., Kumar, M.B. and Cress, D.E. (2003) Eur. J. Biochem. 270, 1308–1315.
4. Dhadialla, T.S., Carlson, G.R. and Le, D.P. (1998) Annu. Rev. Entomol. 43, 545–569.
5. Kumar, M.B., Potter, D.W., Hormann, R.E., Edwards, A., Tice, C.M., Smith, H.C., Dipietro, M.A.,
Polley, M., Lawless, M., Wolohan, P.R., Kethidi, D.R. and Palli, S.R. (2004). J. Biol. Chem. 279,
27211–27218.
6. Verhaegent, M. and Christopoulos, T.K. (2002) Anal. Chem. 74, 4378–4385.

Kit Components Sold Separately:
RheoSwitch ® Ligand RSL1
#E3301S 0.125 ml (5 mM)
#E3301L 0.625 ml (5 mM)
pNEBR-R1 Regulator Plasmid
#N8079S 20 µg
pNEBR-X1GLuc Control Plasmid
#N8080S 20 µg
pNEBR-X1Hygro Vector
#N8083S 20 µg
RheoSwitch ® R-X1 Sequencing Primer
#S1280S 0.5 A 260 unit
Gaussia Luciferase Assay Kit
#E3300S 100 assays
#E3300L 1,000 assays
Companion Products:
pNEBR-X1 Vector
#N8078S 20 µg
TransPass D1 Transfection Reagent
#M2553S 0.5 ml
TransPass D2 Transfection Reagent
#M2554S 0.5 ml
RheoSwitch ® Cell Line NIH3T3-47
#C2001S 0.5 ml
RheoSwitch ® Cell Line HEK293-A7
#C2002S 0.5 ml
RheoSwitch ® Cell Line NIH3T3-47 and
pNEBR-X1GLuc Control Plasmid
#C2003S 0.5 ml
RheoSwitch ® Cell Line HEK293-A7 and
pNEBR-X1GLuc Control Plasmid
#C2004S 0.5 ml
RheoSwitch ® Cell Line CHO-R5
#C2005S 0.5 ml
RheoSwitch ® Cell Line CHO-R5 and
pNEBR-X1GLuc Control Plasmid
#C2006S 0.5 ml
21

22
Licensing Information:
RheoSwitch ® Mammalian Inducible Expression System Notice to Purchaser
This product is the subject of one or more of U.S. Patent Nos. 5,514,578, 6,245,531, including the corresponding foreign patents (Australian Patent No.
752699, Canadian Patent Application No. 2076386, European Patent 0517805) and patent applications, U.S. Patent Nos. 6,258,603 and 5,530,028, and
U.S. Patent Application Nos. 09/965,697, 09/965,703, 10/239,134, 10/468,199, 10/468,193 licensed to New England Biolabs (NEB). The purchase of this
product conveys to the non-commercial purchaser the non-transferable right to use the purchased amount of the product and components of the product
for research use only conducted by the purchaser. For commercial purchasers using this product for research, the purchase of this product conveys
to the purchaser the non-transferable right to use the purchased amount of the product and components of the product for a six (6) month evaluation
period after the date of purchase for research use only. After the six (6) month evaluation period, the purchaser must contact RheoGene, Inc. to obtain a
commercial research license. Purchaser shall promptly inform RheoGene, Inc. in writing within ten (10) days of discovering, inventing, modifying and/or
improving the RheoSwitch ® System (each an “Alteration”). For a period of thirty (30) days following RheoGene’s receipt of such notification, Purchaser
and RheoGene will negotiate the terms of a royalty-free, irrevocable and perpetual worldwide license to RheoGene to such Alteration; provided, however,
that RheoGene will have no right, title or interest in or to improvements to Purchaser’s applications through use of the RheoSwitch ® System that do not
require an Alteration of the RheoSwitch ® System. If a license agreement for the Alteration is not executed before the expiration of such period of time then
the parties shall be deemed to be joint owners of such Alteration. The purchaser cannot sell or otherwise transfer (a) this product (b) its components or
(c) materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this
product or its components for commercial purposes. The purchaser cannot use this product or its components in whole plants, plant cells or humans. The
purchaser may transfer information or materials made through the use of this product to a scientific collaborator, provided that such transfer is not for
the commercial purposes of the purchaser, and that such collaborator agrees in writing (a) not to transfer such materials to any third party, and (b) to use
such transferred materials and/or information solely for research and not for commercial purposes. Commercial purposes means any activity by a party for
consideration and may include, but is not limited to: (1) use of the product or its components in manufacturing; (2) use of the product or its components
to provide a service, information, or data; (3) use of the product or its components for therapeutic, diagnostic or prophylactic purposes; (4) use of the
product or its components to screen for agonists to the RheoSwitch ® system; or (5) resale of the product or its components, whether or not such product
or its components are resold for use in research. If the purchaser is not willing to accept the limitations of the limited use statement, NEB is willing to
accept return of the products with a full refund. For information on commercial use of this product or obtaining a license to this product for purposes other
than research, contact RheoGene, Inc. by calling Dr. Camille Jolly-Tornetta, Director of Intellectual Property (610-650-8734, ext. 104).
pNEBR-X1GLuc Gaussia Luciferase Control Plasmid
Non-Commercial entities: This product is covered by US Patent # 6,232,107 and other patents that are the legal property as assigned to Prolume
Ltd/NanoLight Technologies. This product is licensed only to the purchasing laboratory-research group. Recipient agrees not to transfer this plasmid or
derivatives of this vector to any other laboratory, person or research group, even if within the same institution.
Recipient agrees not to alter or make any changes to the nucleotide coding sequence or secretory coding sequence of the luciferases(s) contained within
without prior written permission from Prolume Ltd/NanoLight Technologies (www.nanolight.com). Recipient agrees not to file for any patent rights or to
any inventions claiming any portion of the luciferase(s) within this material without prior written permission from Prolume Ltd/NanoLight Technologies.
Commercial For-Profit Entities & Non Profit Foundations (herein referred to as Commercial Recipients): Commercial Recipients wishing to derive products,
engage in the sale or license of any products, discover drugs, or make inventions by use of the materials enclosed, fully agree to the terms mentioned
above for Non-Commercial entities; AND ADDITIONALLY agree to and are hereby bound to use the materials FOR EVALUATION PURPOSES ONLY. Commercial
Recipient hereby agrees to destroy and cease use of any materials or derivatives containing any portion of these materials within 180 days from
receipt. Commercial Recipient agrees not to use the materials for any use, other than the 180 day suitability evaluation without prior written permission or
obtaining a valid license from Prolume/NanoLight Technologies.
Any Recipient that does not accept the license terms mentioned above, shall return the unopened package and materials to NEB for a full refund.

USA
New England Biolabs, Inc.
240 County Road
Ipswich, MA 01938
Telephone (978) 927-5054
Toll Free (USA Orders)1-800-632-5227
Toll Free (USA Tech)1-800-632-7799
Fax (978) 921-1350
e-mail: info@neb.com
www.neb.com
the leader in enzyme technology
Canada
New England Biolabs, Ltd.
Telephone (905) 837-2234
Toll Free 1-800-387-1095
Fax (905) 837-2994
Fax Toll Free 1-800-563-3789
e-mail: info@ca.neb.com
China
New England Biolabs (Beijing), Ltd.
Telephone 010-82378266
Fax 010-82378262
e-mail: info@neb-china.com
Germany
New England Biolabs GmbH
Telephone +49/(0)69/305 23140
Free Call 0800/246 5227 (Germany)
Fax +49/(0)69/305 23149
Free Fax 0800/246 5229 (Germany)
e-mail: info@de.neb.com
Japan
New England Biolabs Japan, Inc.
Telephone +81 (0)3 5669 6191
Fax +81 (0)3 5669 6192
e-mail: info@neb-japan.com
United Kingdom
New England Biolabs (UK) Ltd.
Telephone (01462) 420616
Call Free 0800 318486
Fax (01462) 421057
Fax Free 0800 435682
e-mail: info@uk.neb.com