Evolucao Molecular.pdf - Instituto de Biologia da UFRJ

biologia.ufrj.br

Evolucao Molecular.pdf - Instituto de Biologia da UFRJ

Evolução Molecular


Dobzhansky, 1973

Nada em Biologia faz sentido senão à luz da Evolução


Dobzhansky, 1973

Molecular

Molecular

Nada em Biologia faz sentido senão à luz da Evolução


Evolução molecular

• Origem da Vida: transição da matéria não viva para

viva, síntese de moléculas orgânicas a partir de

inorgânicas espontaneamente (Stanley & Miller 1953)

• Evolução de Macromoléculas: como as moléculas

evoluem (Watson & Crick, 1953)

• Filogenia Molecular: quais são as relações

filogenéticas entre organismos, quando determinada

linhagem passou a evoluir independentemente,

relógio molecular (Zuckerkandl & Pauling, 1962)


Os organismos possuem padrões


Reconstrução dos padrões de

especiação = Filogenia


Moléculas também possuem

padrões

•Platyrrhini CTAATTTCCCATCAACTAAATCACCTTCACCCCATAAAACCACCCCAAACCACCCCAAACCACCCCAAACTGA

•Catarrhini

•Tarsii

•Strepsirhini

CAAATTTCCCATCAACTAAATCTACTTTACCTCATAAAACCACCCCAAACCACCCCAAACCACCCCAAACTGA

CTAACTCTCCCTCCATTAAACACTCCCTCCCACATAAAACAACCCCAAACCACCCCAAACCACCCCAAACTGA

CTAACCCCCCTATCAATAAATCATCTAAACACACTAAAACAAACCACCCCAAACCACCCCAAACCCCTCCTGA


Evolução molecular

• Filogenia Molecular: quais são as relações

filogenéticas entre organismos, quando determinada

linhagem passou a evoluir independentemente,

relógio molecular (Zuckerkandl & Pauling, 1962)

• Evolução de Macromoléculas: como as moléculas

evoluem (Watson & Crick, 1953)

• Origem da Vida: transição da matéria não viva para

viva, síntese de moléculas orgânicas a partir de

inorgânicas espontaneamente (Stanley & Miller 1953)


Vamos especificar melhor...

Molecular = DNA, proteínas. Não lipídeos,

carbohidratos.

• Níveis hierárquicos acima (proteínas, células,

organismos) que a seqüência de DNA possuem

menos informação, enquanto níveis abaixo

(estrutura de nucleotídeos) não adicionam

informação útil.


O que é publicado em Evol Mol

• Descrição da variabilidade num nível molecular

• Desenvolvimento de modelos para os padrões

observados

• Inferência de processos evolutivos a partir de

padrões de diversidade

• Relacionar nível molecular ao resto da biologia

• Aplicações: desenvolvimento de drogas


Mudança de focus

• Gene para genoma

• Retorno ao fenótipo

• Mudança de habilidades:

manual para computacional


Dificuldades da Morfologia no

Estudo de Evolução

• Variabilidade

intraespecífica e

interespecífica

• Estudo populacional

para detecção de

características

diagnósticas de uma

espécie


Dificuldades da Morfologia

• Diferenciação de

características

ambientais e

diagnósticas


Dificuldades da Morfologia

• Como estudar

organismos tão

diferentes


O que todos eles têm

em comum

• Todos eles tem

que sintetizar

proteínas,

então podemos

usar genes

ribossomais

para fazer

filogenias


Replicação do DNA


DNA

Proteína

DNA


Indels


Árvore de spp x Árvore de genes


Outros problemas: contaminação

• Xenoturbella não tem

celoma, nem estômago,

gônadas organizadas

Xenoturbella sp.

• Em 1997, era molusco

por filogenia molecular

• “Seqüência” de

Xenoturbella = 97,2 %

similar a Nucula

(molusco), enquanto

duas spp. de Nucula são

similares em 75%!

Nucula sp.

Bourlat et al. 2003 Nature


O que aconteceu

• Mas a árvore ao lado

mostra ML com SSU

rRNA = deuterostomo

Xenoturbella sp.

• Contaminação, pois

Xenoturbella se

alimenta de moluscos

Nucula!!!


Posição filogenética

•A, monfilia de deuterostomos

(incluindo Xenoturbella) suportado

pela ordem de genes mitocondriais

•B, monofilia de Ambulacraria

(hemichordados + equinodermos)

excluindo Xenoturbella suportado

por uma mudança no código

genético

•C, monofilia de crown group de

equinodermas suportado por uma

mudança no código genética e uma

mudança na ordem de genes.


Filogenia Molecular

• Uso de macromoléculas para reconstrução

filogenética

• Como fazer


Metodologia mais comum...

Apertar o enter várias vezes até aparecer

uma árvore na tela


...mas existe outra maneira

1) Alinhamento – estabelecimento de homologias

2) Estimativa da árvore – reconhecimento de

padrões entre seqüências

3) Interpretação da árvore – interpretação das

relações filogenéticas entre organismos


Alinhamento, mas para quê

#Ppaniscus AACTAATACTAGTATTTCAGACGCCCAGGA

#Ptroglodytes AACTAATACTAGTATTTCAGACGCCCAGGA

#Homo

AACTAATACTAACATCTCAGACGCTCAGGA

#Gorilla AACTAACAACAACATCTCAGACGCCCAAGA

#Pongo CACCAACACTAACATCTCAGATGCCCAAGA

#Pongoabelli CACCAACACCAGCATCTCAGACGCCCAAGA

#Hylobates AACCAACACTAACATTACGGATGCCCAAGA

#Papio AACCAACACTAACATCACGGACGCCCAAGA

#Ateles AACTCATACCAGTACTATAAATGCCCAAGA

#Lagothrix AACCCACACCAGTACCATAAATGCTCAAGA

#Alouatta AACTCATACCAGCACAATAAATGCCCAAGA

#Brachyteles CACCCACACCAGTACCATGAACGCCCAAGA

#Daubentonia TACCCATACAAACACCATAAACGCCCAAGA

#Microcebus CACTCATACAAGCACCATAGACGCTCAAGA

#Hapalemur AATACATACAAATACCATAGACGCCCAAGA

#Varecia CACACATACAAGCACTATAGATGCTCAAGA

#Eulemur TATCCATACAAGTACTATAGATGCTCAAGA

#Propithecus CATACACACCAGCACCATGGACGCACAAGA

#Xenopus AACTAATACAAACCTAATGGACGCACAAGA

#Falco ATCC---TCCAACACTGTAGATGCACAAGA


Quando

Schrago & Russo, 2003 MBE


Alinhamento

• Estabelece as posições homólogas entre

as seqüências

• Homologia pode ser confiavelmente

inferida a partir de alta similaridade

• Se o alinhamento estiver ruim, toda a

análise proveniente dele também o será


Homologia= similaridade com

origem comum


Alinhamento ruim (sem

homologia)

Aythya americana GACACAACCTCA-ACTAGCGG-------ATAAATCCAACCACCAACCTTA

Guira guira

TACTAAGCCTAG-GCCTACTCT----CTATAATCCTAGTCAT-AATCCAA

Neomorphus geoffroyi TATATATCCTGACACTAATACTAA--TAGAAAAATTATCCTCAAACACAG

Ortalis vetula CATCTACCTCCACATTGGTCGCGGT-TTTTACTATGGCTCAT-ACCTCTA

Rhea americana CAATCGCTGAGTCACCAATCGCTTC-TCCACCCTCCAATCATGATTCCTT

Gallus gallus CTTTCATTACTTAGCAGGTGTTTCCTCCATTCTAGGAGCCATCAACTTTA

*


Alinhamento ruim (região

codificadora)

Z68025HO AGG AGA AAT AAT A-G GAA ATA TAA GAC AAG CAC ATT GTA ACA TTA

U00407RJ TGG GGA AAT AAT A-G GAA ATA TAA GAC AAG CAC ATT GTA ACC TTA

U00402RJ AGG AGA AAT TCT A-G GAG ATA TAA GAC AAG CAG CTT GT- --- ---

U00424SP AGG AGA AAT AAT A-G GAG ATA TAA GAC GAG CAC ATT GTA ACC TTA

L20963BA AGG AGA AAT AAT A-G GAG CTA TAA GAC --- --- --- --- --- ---

U66418UR AGA AGG AAT AAA A-G GAA CTA TAA GAC AAG CAC ATT GTA ACC TTA

U00406RJ -GG AGA CAT AAT A-G GAG ATA TAA GAC AAG CAT ATT G-- --- ---

AF025918MG AGG AGA CAT AAT A-G GAG ATA TAA G-- --- --- --- --- --- ---

AF025926MG A-- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

Alinhamento de env de HIV


Alinhamento ruim (perfeito

demais)

Guzmania monostachya ATG GAA GAA TTA CAA GGA TAT TTA GAA AAA GAT AGA

Vriesea malzinei ... ... ... ... ... ... ... ..W .R. ... .G. W..

Hechtia glabra ... ... ... ... ... ... ... ... ... ... ... ...

Hechtia lindmanioides ... ... ... ... ... ... ... ... ... ... ... ...

Hechtia glomerata ... ... ... ... ... ... ... ... ... ... ... ...

Hechtia guatemalensis ... ... ... ... ... ... ... ... ... ... ... ...

Brocchinia acuminata ... ... ... ... ... .A. ... ... ... ... ... ...

Brocchinia micrantha ... ... ... ... ... .A. ... ... ... ... ... ...

Cottendorfia florida ... ... ... ... ... ... ... ... ... ... ... ...

Navia phelpsiae ... ... ... ... ... ... ... ... ... ... ... ...

Pepinia beachiae ... ... ... ... ... ... ... ... ... ... ... ...

Pitcairnia rubronigriflora ... ... ... ... ... ... ... ... ... ... ... ...

Pepinia corallina ... ... ... ... ... ... ... ... ... ... ... ...

Pepinia sprucei ... ... ... ... ... ... ... ... ... ... ... ...

Pitcairnia smithiorum ... ... ... ... ... ... ... ... ... ... ... ...

Pitcairnia orchidifolia ... ... ... ... ... ... ... ... ... ... ... ...

Pitcairnia recurvata ... ... ... ... ... ... ... ... ... ... ... ...

Pitcairnia squarrosa ... ... ... ... ... ... ... ... ... ... ... ...

Navia igneosicola ... ... ... ... ... ... ... ... ... ... ... ...

Deuterocohnia longipetala ... ... ... ... ... ... ... ... ... ... ... ...

Deuterocohnia sp. ... ... ... ... ... ... ... ... ... ... ... ...

Deuterocohnia lotteae ... ... ... ... ... ... ... ... ... ... ... ...

Pitcairnia heterophylla ... ... ... ... ... ... ... ... ... ... ... ...

Bromeliaceas gene MatK cloroplasto


Escolha do Gen

• O segmento deve ter variabilidade compatível

com problema filogenético, cheque GenBank

• Seja criativo, use amino ácidos, terceiras

posições, primeiras e segundas, todas elas

• Cheque seu alinhamento


Cheque seu alinhamento

S.salar

AAGAGGTCCCGCCTGCCCTGTGACTATGGGTTTAACGGCC--GCGGT-ATTTTGACCGTG

O.mykiss

--------CCGCCTGCCCTGTGACTATGGGTTTAACGGCC--GCGGT-ATTTTGACCGTG

E.lucius

AAGAGGTCCCGCCTGCCCTGTGACTATACGTTTAACGGCC--GCGGT-ATTTTAACCGTG

Tilapia sp -AGAGGTCCCGCCTGCCCTGTGACTATAAGTTTAACGGCC--GCGGT-ATTTTGACCGTG

H.bimac

-AGAGGTCCCGCCTGCCCTGTGAC-ACATGTTTAACGGCC--GCGGT-ATTTTGACCGTG

C.amazonarum -AGAGGTCCCGCCTGCCCAGTGACTATAAGTTCAACGGCC--GCGGT-ATTTTGACCGTG

G.morhua

AAGAGGTCCCGCCTGCCCTGTGACTATAAGTTTAACGGCC--GCGGT-ATTTTGACCGTG

C.carpio

--GAGGTCCAGCCTGCCCAGTGACTACAAGTTCAACGGCCCGGCGGTTATTTTGACCGTG

L.chalumnae --GAGGTCCCGCCTGCCCAGTGACAAGA--TTTAACGGCC--GCGGT-ATCCTGACCGTG

S.canicula AAGAGGTCCCGCCTGCCCTGTGACAATG--TTCAACGGCC--GCGGT-ATTTTGACCGTG

P.marinus

------------------------------------GGCC--GCGGT-ACTTTGACCGTG

**** ***** * * ******


Alinhamentos (quase) infinitos

ATTGC

ATGCT

TGCAT

GACTG

CATGA

10 18 possibilidades!


Opções

1. Reduzir mismatches :

TCAG-ACG-ATTG

|| | | | | |

TC-GGA-GC-T-G

0 mis 7 mat 6 gaps

3. Opção 3 :

TCAG-ACGATTG

|| | | | |

TC-GGA-GCTG-

2 mis 6 mat 4 gaps

2. Reduzir gaps :

TCAGACGATTG

|| ||

TCGGAGCTG–-

5 mis 4 mat 2 gaps

4. Opção 4:

TCAG-ACGATTG

|| | | | | |

TC-GGA-GCT-G

1 mis 7 mat 4 gaps


www.ebi.ac.uk/clustalw


Alinhando


Número de bases ou aa


Algorítmo de alinhamento

1) Dot matriz de id seqüências par a par

2) Seleção de melhores diagonais

3) Max. score pp, com melhores diagonais

4) Construção da matriz de melhores sc pp

5) Construção do Dendrograma

6) Maximização do score múltiplo

7) Alinhamento múltiplo final


Alinhamento par a par


Dot Matrix

A T G A G C A A T

A

C

G

A

C

T

A

T

. . . .

.

. .

. . . .

.

. .

. . . .

. .


Parâmetros do alinhamento par a

par

• KTUP – Tamanho da palavra procurada

• Window – Tamanho da janela (para fora da diagonal

procurada)

• SCORE – Score mínimo para ser levado em consideração

• TOPDIAG – Número de grandes diagonais

• PAIRGAP – Penalidade de intervalo

(mude as opções apenas para tornar alinhamento mais rápido)


Alinhamento múltiplo


Parâmetros do alinhamento

múltiplo

• GAPOPEN (default 10),

• GAPEND,

• GAPEXT (0,05),

• GAPDIST (8)

• Matrizes

Blosum* – muitos dados sem indel;

PAM – poucos dados com indels;

Gonnet – muitos dados com indels;

id – idêntico = 10 e diferente = 0


Alinhamento


Matriz PAM250

= 250 subst. em 100

% dif/ PAM

•1 •1

•10 •11

•20 •23

•30 •38

•40 •56

•50 •80

•60 •112

•70 •159

•80 •246


Matriz Blosom 62


Pressuposições

• Todas as seqüências são homólogas,

• Todos os sítios são homólogos,

• Nenhuma transferência horizontal

• Monofiletismo dos taxa terminais

• Posições evoluem independentemente


Dois processos complicadores


Paralogia

Bone Morphogenetic Protein


Tempo de duplicação

Vertebrados:

Mioglobina + globina

Mandibulados: Mioglobina + 1

α globina + 1 β globina

Mamíferos: Mioglobina X α

globina + Y β globina

Primatas: possuem também

δ + β

Diferenças no

desenvolvimento


Globinas em Humanos


Superfamília das Globinas

Type

alphalike

betalike

Hb

embryonic

Hb

zeta epsilon zzee

fetal Hb alpha gamma aagg

adult Hb alpha beta aabb


Para estudos de:

• Famílias gênicas

• Filogenia de espécies

• Use cópias parálogas

dos genes em

diferentes espécies

• Use a mesma cópia

ortóloga nas espécies

da filogenia


Como saber

• Xenopus tem centenas de cópias de 18S

• Muitos genes em múltiplas cópias

• Quem são parálogos Quem são

ortólogos


Evolução em concerto


Mecanismo de evolução

em concerto

• Crossing over desigual – muda o tamanho

dos fragmentos

• Conversão gênica – não muda o tamanho


Duplicações gênicas

• Evento comum

• Geram genes novos

• Cópia backup do

gene

• Novas funções para o

gene

• Pseudogenes


Como estudar evolução de

função

• Reconstrução por

probabilidade de

seqüências ancestrais

• Estudar a biologia do

organismo ancestral

Função

Gen

Proteína

• Induzir mutações através

de mutagênese

Estrutura


Evolução da enzima rubisco

Delwiche et al. 1996 MBE 13:873


Paralogias não são apenas

complicadores


Atpase

Archea

Catalítica

Eukarya

Bacteria

Archea

Não catalítica

Oto & Honjo 1981

Eukarya

Bacteria


Origem do X

Clark 2003 PNAS


Visão colorida

• Anfíbios, aves, vêem UV

• Usam para caça, seleção

de parceiros, etc.

• Portanto, todos humanos

são daltônicos!

Zhang 2003 PNAS


Visão colorida

•Os símbolos em preto

significam visão UV

•Os símbolos em azul

indicam visão violeta

•E símbolos abertos

indicam SWS1 gens

não funcionais

•A seta mostra a raiz da

árvore e o ancestral

comum de vertebrados.

• A visão UV/violeta

dos ancestrais foi

inferida por Shi and

Yokoyama

Zhang 2003 PNAS


Filogenia no tribunal

• Médico é processado

por antiga namorada

por tê-la contaminado

com HIV de paciente

• Seqüências do

paciente em roxo

• Seqüências da vítima

em rosa

Metzker et al 2002 PNAS


Ilhas Galápagos e filogenias

• Baixa diversidade de

tartarugas em uma ilha

(com mesma idade de

outras ilhas) do

arquipélago

• Bottleneck que extinguiu

a maior parte das

linhagens da época há 88

mil anos

Beheregaray et al. 2003 Science

More magazines by this user
Similar magazines