Mutually-dependent localization of megalin and ... - Renal Physiology

Articles in PresS. Am J Physiol Renal Physiol (May 3, 2005). doi:10.1152/ajprenal.00292.2004
Mutually-dependent localization of megalin and Dab2 in the renal
proximal tubule
Nagai J 1,2 , Christensen EI 2 , Morris SM 3 , Willnow TE 4 , Cooper JA 3 , Nielsen R 2
1 Department of Pharmaceutics and Therapeutics, Hiroshima University, Hiroshima 734-8551, Japan, 2
Cell Biology, Institute of Anatomy, University of Aarhus, 8000 Aarhus, Denmark, 3 Fred Hutchinson Cancer
Research Center, Seattle, Washington 98109-1024, USA, and 4 Max-Delbrueck-Center for Molecular
Medicine, 13125 Berlin, Germany
Running title: Dab2 localization in the renal proximal tubule
Correspondence: Rikke Nielsen M.Sc., Ph.D.
Cell Biology, Institute of Anatomy, University of Aarhus,
University Park, Building 234, DK-8000 Aarhus C,
Denmark
Telephone number: +45-8942-3030
FAX number: +45-8619-8664
E-mail address: rn@ana.au.dk
Copyright © 2005 by the American Physiological Society.

Abstract
Disabled-2 (Dab2) is a cytoplasmic adaptor protein that binds to the cytoplasmic tail of
the multiligand endocytic receptor megalin, abundantly expressed in renal proximal
tubules. Deletion of Dab2 induces urinary increase in specific plasma proteins such as
vitamin D binding protein and retinol binding protein (Morris et al. EMBO J., 21: 1555-
1564, 2002). However, the subcellular localization of Dab2 in the renal proximal tubule
and its function has not been fully elucidated yet. Here we report the characterization
of Dab2 in the renal proximal tubule. Immunohistocytochemistry revealed co-
localization with megalin in coated- pits and vesicles, but not in dense apical tubules
and the brush border. Kidney-specific megalin knock-out almost abolished Dab2
staining, indicating that Dab2 subcellular localization requires megalin in the proximal
tubule. Reciprocally, knock-out of Dab2 led to a redistribution of megalin from
endosomes to microvilli. In addition, there was an overall decrease in levels of megalin
protein observed by immunoblotting, but no decrease in clathrin or -adaptin protein
levels or in megalin mRNA. In rat yolk sac epithelial BN16 cells Dab2 was present
apically and co-localized with megalin. Introduction of anti-Dab2 antibody into BN16
cells decreased the internalization of 125 I-RAP, substantiating the role of Dab2 in
megalin-mediated endocytosis. The present study shows that Dab2 is localized in the
apical endocytic apparatus of the renal proximal tubule and that this localization
requires megalin. Furthermore, the study suggests that the urinary loss of megalin
ligands observed in Dab2 knock-out mice is caused by suboptimal trafficking of megalin
leading to decreased megalin levels.
Keywords: receptor mediated endocytosis, kidney, adaptor proteins

Introduction
Recent research has demonstrated that megalin (35) is one of the most important
receptors for protein reabsorption in the renal proximal tubules (reviewed in 4,5). The
giant endocytic receptor (600 kDa) is abundantly expressed in the endocytic apparatus
of the renal proximal tubule, including the brush-border, clathrin-coated pits, clathrin-
coated vesicles and dense apical tubules. Its ligands include Ca 2+ , vitamin binding
proteins, apolipoproteins, hormones, enzymes, and drugs as well as receptor-
associated protein (RAP), a chaperone for the low density lipoprotein receptor (LDLR)
gene family (38). Megalin has a large amino-terminal extracellular region, a single
transmembrane domain and a short carboxy-terminal cytoplasmic tail (11,35). The
extracellular region contains four clusters of cysteine-rich complement-type repeats
forming the ligand-binding regions characteristic of the LDLR gene family. The
sequence of the cytoplasmic tail has little similarity to that of other members of the
LDLR gene family except for the NPXY motifs, which are known to serve as the sorting
signal for rapid endocytosis of the LDLR via clathrin-coated pits (2,11,35).
Dab2 was isolated as a phosphoprotein involved in colony stimulating factor-1
signal transduction (40). Interestingly, Dab2 expression is down-regulated during
prostate degeneration and in many human carcinomas and accordingly is also called
DOC-2, deleted in ovarian cancer-2 (6,25,26,37). In addition, Dab1, a related protein
expressed predominantly in the brain, binds to the NPXY motif(s) in the cytoplasmic tail
of very low density lipoprotein receptor (VLDLR) and apolipoprotein E receptor2
(ApoER2) through the phosphotyrosine binding (PTB) domain of Dab1 (9,12-16,22).
This interaction between the members of LDLR gene family and Dab1 plays an
important role in neuronal positioning (12,13,15). Thus, some of the members of LDLR
gene family might serve as transmembrane signal transduction molecules (9,16,32,39).
Much attention has been focused on the involvement of the cytoplasmic tail
domain of megalin in subcellular localization, endocytic trafficking and signaling (5,32-

34,36,39). The cytoplasmic tail domain of megalin has binding sites for some
intracellular protein-protein interaction domains including Src homology 3 (SH3) binding
motifs (PXXP) and NPXY motifs, which bind to SH3 domains and PTB domains,
respectively (11,35). Recently, it has been found that Dab2 binds to the cytoplasmic tail
of megalin by using in vitro methods such as co-immunoprecipitation and binding
assays (33). Furthermore, Morris et al. (29) observed that the deletion of the Dab2
gene in mice induced an increase in urinary excretion of vitamin D binding protein
(DBP) and retinol binding protein (RBP), ligands of megalin (5). These observations
may indicate an involvement of Dab2 in megalin-mediated endocytosis in renal proximal
tubules under in vivo conditions. However, the precise localization of Dab2 in the renal
proximal tubules has not been determined and the role of Dab2 in megalin-mediated
endocytosis has not been fully characterized.
The present study was performed to investigate the subcellular localization of
Dab2 in the renal proximal tubules by immunohistocytochemistry and to approach the
mechanism underlying increased urinary excretion of megalin ligands in Dab2 knock-
out mice by investigation of Dab2 and megalin levels in knock-out mouse models.

Materials and Methods
Animals
Dab2 conditional knockout mice were prepared by breeding Dab2 fl/fl to Dab2 +/- Meox2
cre/+ This circumvents the embryonic lethality caused by Dab2 deletion, and allows the
generation of mice lacking Dab2 genes in most cells (29). Young adult Dab2 -/- and
Dab2 -/+ were anaesthetized, perfused with 4% paraformaldehyde in PBS, and kidneys
were further processed (3).
The generation of mice carrying a kidney-specific megalin gene deletion has
been described before (19). Cre recombinase-mediated inactivation of the megalin
gene in the kidney results in a complete loss of receptor expression in approximately
80-90% of all cells in the renal proximal tubule.
Antibodies
Rabbit anti-Dab2 polyclonal antibody (H-110) and goat anti-clathrin HC polyclonal
antibody (C-20) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA,
USA). Sheep anti-megalin polyclonal antibody and rabbit megalin polyclonal antibody
were obtained as described previously (3,24,41). Mouse anti- -adaptin monoclonal
antibody was from Affinity BioReagents Inc. (Golden, CO, USA). Horseradish
peroxidase-conjugated goat anti-rabbit Ig (P448), rabbit anti-sheep Ig (P163), rabbit
anti-goat Ig (P449), goat anti-mouse Ig (P447) and TRITC coupled to swine anti-rabbit
Ig (R156) were from Dako A/S (Copenhagen, Denmark). Alexa Fluor488 donkey anti-
sheep Ig (A11015) was obtained from Molecular Probes (Leiden, the Netherlands).
Immunocytochemistry
For light microscopy, semithin (0.8 µm) cryosections were cut at –80 o C on an FCS
Reichert Ultracut S cryomicrotome (Reichert-Jung, Vienna, Austria) and placed on

gelatin-coated glass slides. The sections were incubated with rabbit anti-Dab2 antibody
(1:20 – 1:80) or sheep anti-megalin antibody (1:20,000) at room temperature for 1 hour
following preincubation in 10 mM phosphate-buffered saline (PBS) containing 50 mM
glycine and 0.1% skimmed milk. After incubation for 1 hour with horseradish
peroxidase-conjugated secondary antibodies, the peroxidase was visualized with
diaminobenzidine, and sections were counterstained with Meier’s hematoxyline stain
and examined in a Leica DMR microscope equipped with a Sony 3CCD color video
camera and a Sony Digital Still recorder (Sony Corp., Tokyo, Japan). For electron
microscopy, ultrathin (70 to 90 nm) cryosections were obtained, and the sections were
incubated with rabbit anti-Dab2 antibody (1:80 - 1:240) and/or sheep anti-megalin
antibody (1:20,000) followed by incubation with gold conjugated secondary antibodies
(British BioCell International, Cardiff, UK). The cryosections were embedded in 2%
methylcellulose containing 0.3% uranyl acetate and were examined in a Phillips CM
100 electron microscope.
Morphometric determination of megalin localization in kidneys from normal and
Dab2 knock-out mice
Sections from control and Dab2 knock-out mice were prepared for electron microscopy
as described above. The sections were stained with sheep anti megalin antibody
1:20,000 and developed with a secondary antibody conjugated to 10 nm gold particles.
Eight randomized pictures were taken from 6 control and 6 knock-out mice at a
magnifiacation of 25,000X. All pictures were from tubules which were sectioned in the
longitudinal axis of the microvilli. Areas encompassing the microvilli and cytoplasm were
measured as well as gold particles were counted by the use of AnalySIS.

Immunoblotting
Crude kidney membranes for immunoblotting were prepared as described previously
(1,21). Briefly, the excised kidneys were homogenized in an ice-cold buffer (0.3 M
sucrose, 25 mM imidazole, 1 mM ethylenediaminetetraacetic acid (EDTA), 8.5 µM
leupeptin, and 1 mM phenylmethylsulfonyl fluoride, pH 7.2) for 30 sec with an IKA
ULTRA-TURRAX T8 homogenizer (IKA LABORTENIK, Germany). The homogenate
was centrifuged at 4,000 g for 15 min at 4 o C. The supernatant was transferred to an
ULTRA-CLEAR tube (Beckman Instruments, Fullerton, CA, USA) and centrifuged at
17,000 g for 30 min at 4 o C in an L8-70 M ultracentrifuge (Beckman Instruments) with
rotor 70.1 T1. The pellet was suspended in the ice-cold buffer used for the
homogenization and was heated for 5 min at 95 o C in Laemmli sample buffer containing
2.5% sodium dodecyl sulfate (SDS) and 1% 2-mercaptoethanol. The samples (5 µg of
protein) were run on 3 to 16% SDS polyacrylamide gradient gels and were then
transferred to a nitrocellulose membrane for 60 min at 4 o C. Subsequently, the
membrane was blocked in 5% skimmed milk in phosphate-buffered saline (PBS-T; 80
mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, 0.1% Tween 20, pH 7.5) for 1 hour.
The membranes were washed for 15 min in PBS-T followed by washing for 5 min twice
and incubated overnight at 4 o C with primary antibody in PBS-T with 1% bovine serum
albumin (BSA) [rabbit anti-Dab2 antibody (1:100), rabbit anti-rat megalin antibody
(1:1,000), goat anti-clathrin HC antibody (1:400) or mouse anti- -adaptin antibody
(1:100)]. After washing for 15 min in PBS-T followed by washing twice for 5 min, the
blots were incubated for 1 hour with the horseradish peroxidase-conjugated secondary
antibody, washed 3 times in PBS-T, and visualized with enhanced chemiluminescence
(ECL; Amersham International, Buckinghamshire, United Kingdom).

Cell culture
Rat yolk sac carcinoma cells BN16 were cultured as described previously (7,20).
Briefly, BN16 cells were grown in 25 cm 2 plastic culture flasks (Corning Costar,
Badhoevedrop, Holland), in Eagle’s Minimal Essential Medium (Bio-Whittaker,
Welkersville, MD, USA) supplemented with 10% fetal calf serum (Biological Industries,
Fredensborg, Denmark), 2 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml
streptomycin (Bio-Whittaker) in a humidified atmosphere of 5% CO2 and 95% air at 37 o
C. The cells were subcultured every fourth day with a split ratio of 1:5 by using 0.02%
EDTA and 0.05% trypsin (Bio-Whittaker). Experiments were carried out with confluent
monolayers of BN16 cells cultured in 24-well plates (Nagle Nunc International) for
quantitative uptake studies.
Immunofluorescence microscopy
Co-localization of Dab2 and megalin. Immunohistochemistry was performed on cells
grown confluent in flasks, fixed in 2% paraformaldehyde in 0.1 M cacodylate (Cac)
buffer, washed 3 times in Cac buffer and scraped off in 1% gelatin in Cac buffer, 37º C.
The cells were centrifuged twice in 1% gelatin and finally a few drops of 12% gelatin
were added. The gelatin containing the cells was cooled on ice and infiltrated with 2.3 M
sucrose in 0.01 M PBS, pH 7,4 for two hours. The blocks were frozen on nails. Sections
were made and labeled with a mixture of primary antibodies: rabbit polyclonal anti-Dab2
1:10 (H110) and sheep polyclonal anti-rat megalin 1:4,000 and then incubated with a
mixture of secondary antibodies: TRITC coupled to swine anti-rabbit Ig 1:20 and Alexa
Fluor488 donkey anti-sheep IgG(H+L) 1:300).
Effect of Anti-Dab2 antibody transfection on iodinated RAP uptake. Anti-Dab2 antibody
was transfected into BN16 cells with the BioPorter protein delivery reagent from
BioCarta (CA, USA). Briefly, BN16 cells cultured on 24-well plate for 3 days were
incubated with the protein delivery reagent (5 µl) containing rabbit polyclonal anti-Dab2

antibody (H-110, 1 µg of protein) in a 5% CO2 incubator at 37 o C for 1 hour. As control
the same amount of rabbit Ig (X903, DAKO A/S, Denmark) was used. After washing
three times, the cells were preincubated with serum-free EMEM containing 0.5%
ovalbumin for 10 min at 37 o C and then were incubated with the above medium
including iodinated RAP for 30 min in the 5% CO2 incubator. At the end of the
incubation, the uptake buffer was removed and 200 µl of 0.1 M NaOH was added to
dissolve the cells. The amount of the ligand taken up by the cells was measured by
counting the radioactivity. Protein was determined by the Bio-Rad Protein Assay ® with
bovine serum albumin as the standard.
Northern blotting
Dig-labeled RNA probes for megalin and actin were produced by RT-PCR and in vitro
transcription. RT reaction: Total RNA was purified from mouse kidney cortex by TRIzol
reagent (InVitrogen, CA). Purified RNA (0.1 µg) was incubated in a reverse
transcriptase reaction mixture for 30 min at 42° C in a Genius thermocycler (Techne).
PCR reaction: The PCR reaction was performed with Hotstartaq master mix kit (Qiagen,
UK), 1 µl of RT reaction and 10 pmol of each primer. The identity of the products was
confirmed by Big Dye termination sequencing and analyzed on an ABI PRISM 310
Genetic Analyzer (Perkin Elmer, USA). Megalin primers had the following sequences
and localization in the rat sequence (gi 561852): sense 5’ cacaggtgactgtaccagaa 3’,
position 13762-13781; antisense 5’ gtgagtgtctaaatgttccc 3’, position 14141-14122 giving
a 380 bp product. The PCR reaction was conducted with an annealing temperature of
60° C. Actin primers had the following sequences and localization in the rat sequence
(gi 57573): sense 5’ tacgtgggtgatgaggccca 3’, position 180-199; antisense 5’
tagccctcatagatgggcac 3’, position 529-510 giving a 350 bp product. The PCR reaction
was conducted with annealing temperature of 65° C. PCR products containing the T7
promoter sequence were produced from the purified PCR products and the primers

described above except that the sense primer included a T7 sequence in the 5’ end.
The T7 DNA was used for in vitro transcription in a mixture containing dig -11-UTP
(Roche) to produce the dig labeled RNA probes.
Blotting: 10 µg of total RNA was separated on a 1% agarose-2% formaldehyde gel.
The loaded amount of RNA was adjusted according to the optical density of the purified
RNA. After electrophoresis the integrity of the RNA was confirmed and the RNA was
transferred to a nylon membrane (Roche) by capillary blotting and finally the RNA was
linked to the membrane by UV-linking (Hoefer UVC 500). The blots were prehybridized
and hybridized with dig-labeled RNA probes (megalin 20-24 µg, actin 8 µg) over night
at 68° C. Afterwards the blots were washed and blocked. Anti-digoxin-AP conjugate
(SIGMA) 1:10,000 was applied and incubated with CSPD (Roche). The developed
bands were quantified by the Fluor-S TM MultiImager system (BioRad). The intensity of
the actin bands was used to standardize the megalin bands.

Results
Localization of Dab2 in the endocytic apparatus of the renal proximal tubule
In kidneys from Dab2 knock-out mice, Dab2 labeling could not be detected in proximal
tubules by light microscopic immunohistochemistry confirming the complete loss of
Dab2 and the specificity of the antibody used for the detection of Dab2 (Figure 1A).
Kidneys from control mice showed a band of Dab2 labeling below the brush-border as
well as labeling of endocytic vacuoles were observed in the cytoplasm of the renal
proximal tubules from control mice (Figure 1B). Electron microscopic
immunocytochemistry of cryosections from control mice confirmed labeling of the
endocytic apparatus. More specifically, labeling was detected in apical coated pits and
apical vesicles, but virtually not in dense apical tubules (DAT, defined as membrane
limited longitudinal structures with diameters slightly smaller than the diameter of a
microvillus) (Figure 2).
Absence of Dab2 in megalin deficient cells from kidney specific megalin knock-
out mice
Kidney-specific megalin knock-out mice lack megalin in most but not all kidney cells
(19). Investigation of Dab2 in kidney sections from these mice by fluorescence
microscopy revealed Dab2 only in cells that still expressed megalin (Figure 3). Most of
the proximal tubule cells apparently lacked both megalin and Dab2. Immunoelectron
microscopy for megalin and Dab2 also demonstrated that Dab2 labeling was virtually
absent in megalin-deficient cells (Figure 4). In the renal proximal tubular cells that did
express megalin, Dab2 co-localized with megalin in the apical endocytic apparatus such
as coated pits and small endocytic vacuoles, but was almost undetectable in dense
apical tubules, where megalin is present. The reduced staining of Dab2 in megalin -/-
cells could be due to a decrease in Dab2 protein levels or due to decreased sensitivity
of detection owing to diffuse localization within the cell. These possibilities could not be

conclusively distinguished because of the mosaic nature of the kidney-specific
knockout. However, immunoblotting of kidney homogenates from mice with megalin
knock-out in all cells did not reveal any decrease of Dab2 compared to controls (result
not shown). This suggests that Dab2 accumulation in apical endocytic pits and vesicles
requires megalin.
Decreased megalin levels in Dab2 knock-out mice
Immunohistocytochemistry for megalin in the proximal tubule from Dab2-knock out mice
was examined and compared with megalin in control mouse kidney. As shown in
Figure 5, there was apparently a decrease in the subcellular compartments containing
megalin of the renal proximal tubule in addition to an apparent reduction in the number
of coated pits and coated vesicles as described previously (29). Decreased levels of
megalin in the apical cytoplasm were supported by morphometric analysis of electron
microscope sections (110 gold particles/µm 2 in controls versus 72 gold particles/µm 2 in
knock-outs, Table 1). Furthermore, this analysis showed that megalin levels were
increased in the microvilli (96 gold particles/µm 2 and 150 gold particles/µm 2 in controls
and knock-outs respectively, Table 1). This suggests a redistribution of megalin from
vesicles of the apical cytoplasm to microvilli, consistent with decreased endocytosis,
when Dab2 is absent.
Surprisingly, immunoblotting of crude membranes from Dab2 knock-out mice and
control mice revealed an overall decrease in megalin levels when Dab2 was absent
(Figure 6). In contrast, no obvious differences in protein levels of clathrin and -
adaptin, the subunit of clathrin adaptor protein AP-2, were found between Dab2
knock-out mice and control mice. As expected, Dab2 was not detected in kidney from
knock-out mice. Northern blot analysis did not reveal any differences in megalin mRNA
expression between kidneys from Dab2 knock-out mice and control mice (Figure 7).

This suggests that decreases in megalin protein levels are due to a decreased
rate of protein synthesis or increased megalin protein turnover.
Involvement of Dab2 in megalin-mediated endocytosis
To examine the role of Dab2 in receptor-mediated endocytosis, uptake studies were
performed in BN16 cells, a cell line derived from the rat yolk sac highly expressing
megalin. First, we performed double labeling immunofluorescence on confluent BN16
cell monolayers with anti-Dab2 antibody and anti-megalin antibody. The labeling
pattern for Dab2 was present apically and partly co-localized with megalin (Figure 8).
Next, we introduced anti-Dab2 antibody into the confluent BN16 cell monolayers in
order to inhibit the function of Dab2 and then uptake and binding of iodinated RAP in
the cells was measured (Figure 9). Uptake and binding of 125 I-RAP was slightly but
significantly reduced in the transfected cells.

Discussion
Dab2 is present in various tissues including heart, lung, liver and skeletal muscle, and is
highly abundant in kidney (6,29), where it has been localized to the renal proximal
tubule by immunohistochemistry (29,33). Dab2 has been demonstrated to bind to the
cytoplasmic tail of megalin by several approaches such as two-hybrid screening, protein
binding assay and co-immunoprecipitation (33). Recently, an increase in urinary
excretion of specific plasma proteins such as DBP and RBP in Dab2 knock-out mice
was reported (29). These proteins represent ligands to megalin. Thus, Dab2 may play
an important role in megalin-mediated endocytosis in the renal proximal tubule. The
present study has been performed to clarify the cellular localization of Dab2 in the renal
proximal tubule and its role in megalin-meditated endocytosis.
We found that Dab2 is abundantly expressed in the apical endocytic apparatus
such as coated pits and coated vesicles, but almost absent in the brush border and
dense apical tubules of the renal proximal tubules from normal mice. The low Dab2
staining in the brush border is in contrast to immunofluorescence data obtained by
Oleinikov et al. (33). The reason for this discrepancy is unknown and difficult to
comment further as micrographs were not shown in the paper of Oleinikov et al.
However, in fibroblasts and non-polarized epithelial cells (HeLa), Dab2 localization
depends on a region that binds to adaptin and clathrin (23,27), which are present in
coated structures and not associated with the microvillar membrane. Immunoelectron
microscope analysis revealed that labeling for Dab2 was present at the cytoplasmic side
of the vesicular membrane of the endocytic apparatus, suggesting that Dab2 serves as
a cytoplasmic adaptor protein mediating protein-protein interactions. In addition, co-
localization of megalin and Dab2 was observed in apical coated pits and vesicles, but
not in dense apical tubules of the renal proximal tubules. Considering that the
cytoplasmic tail of megalin has been shown to interact with Dab2 (33), Dab2 may be
involved in megalin-mediated endocytosis in the renal proximal tubular cells by directly

interacting with the cytoplasmic tail of megalin during endocytosis, but dissociating from
megalin during recycling of the receptor. Similarly, Dab2 was absent from uncoated
endosomes in fibroblasts (27).
Analysis of kidney-specific megalin knock-out mice, which show a severe
impairment in renal absorption of protein owing to a significant decrease in the number
of proximal tubular cells expressing megalin (8,19), revealed that Dab2 localization to
the endocytic apparatus is strictly dependent on megalin. An almost complete loss of
Dab2 in the endocytic apparatus was observed in megalin-deficient cells of the renal
proximal tubule, whereas Dab2 was expressed normally and partly co-localized with
megalin in normal tubular cells expressing megalin. These results suggest that Dab2
association with coated pits in polarized cells may require cooperative association with
the megalin cargo as well as with clathrin and AP-2, whereas in fibroblasts, association
with coated pits appears to be independent of cargo (27).
Several recent studies (10,23,27) have demonstrated that Dab2 interacts directly
with phosphoinositides, clathrin and -adaptin subunit of the clathrin adaptor protein
AP-2, which are components of clathrin-coated pits and vesicles. The subcellular
localization of Dab2 in non-polarized cells is not due to the PTB domain but due to the
central region that binds to the -adaptin subunit of AP-2 (23,27). In addition, a C-
terminal region of Dab2 binds to myosin VI, an actin-based motor protein involved in
cargo movement such as vesicular trafficking (17,28). Thus it is possible that none of
the interactions is tight enough on its own to recruit Dab2, and the absence of megalin
is enough to reduce formation of clathrin-, AP-2- and Dab2-containing structures.
Alternatively, the absence of Dab2 in the endocytotic compartments of megalin-deficient
cells may be due to a lack of other proteins than megalin that could regulate the
localization of Dab2. In fact, clathrin and -adaptin are less concentrated in apical
endocytic structures in megalin knock-out mice as judged by immunohistochemistry
(results not shown).

Megalin protein levels and subcellular localization also depend on Dab2.
Electron immunohistochemical analysis showed a decrease in megalin in endosomes,
and an increase in megalin in microvilli, in renal proximal tubular cells from Dab2 knock-
out mice, consistent with a role for Dab2 in megalin endocytosis. Surprisingly, total
megalin levels were reduced in Dab2 knock-out mice, as observed by immunoblotting.
However, there was no significant change in megalin mRNA level between Dab2 knock-
out mice and control mice, suggesting that the decrease in megalin protein is due to
decreased protein synthesis or increased protein turnover. The first and third NPXY
motifs in the cytoplasmic tail of megalin are responsible for efficient endocytosis,
whereas the second NPXY-like motif is essential for the apical sorting of megalin (36).
In addition, the third NPXY motif has been suggested to be involved in the interaction
between the PTB domain of Dab2 and the cytoplasmic tail of megalin (33). Therefore,
decrease in megalin levels in Dab2 knock-out mice may result from an impaired
trafficking of megalin through the endocytic/recycling pathway, leading to increased
megalin shedding or degradation.
Even though Dab2 interacts with clathrin and AP-2, and there is a decrease in
the number of apical coated pits and apical coated vesicles in the renal proximal tubular
cells from Dab2 knock-out mice (29) and megalin knock-out mice (18), the levels of
clathrin and -adaptin in Dab2 knock-out mouse kidneys were normal.
Immunohistochemistry for clathrin also revealed equal levels in Dab2 knock-out mice
and control mice (data not shown).
To investigate the impact of decreased megalin levels induced by Dab2 knock-
out, we transfected anti-Dab2 rabbit antibodies into BN16 cells. This slightly but
significantly decreased internalization of receptor-associated protein (RAP), a high
affinity ligand for megalin, as compared with that of control rabbit Ig. This is in
accordance with the observations obtained by immunohistochemistry in Dab2 knock-out

mice, where deletion of Dab2 does not completely abolish endocytosis of RBP and
DBP (results not shown).
Dab2 knock-out mice present an increase in urinary excretion of DBP and RBP,
but the increases are not as severe as in full megalin knock-out mice, which exhibit
vitamin D deficiency and bone formation defects (31). Indeed, there was a decreased
endosomal level of megalin in Dab2 knock-out mice, and megalin protein levels were
reduced but not completely disrupted by the absence of Dab2. Thus, another adaptor
protein binding to the cytoplasmic tail of megalin, such as ARH (30), may substitute for
Dab2 in Dab2 knock-out mice.
In conclusion these experiments show the presence of Dab2 in coated structures
of the endocytic apparatus of the proximal tubule. Here its presence seems to be
dependent on megalin or other factors associated with megalin. On the other hand
knock-out of the Dab2 gene decreases megalin levels and alters the subcellular
distribution of megalin. These results indicate that Dab2 and megalin mutually regulate
each others localization in renal proximal tubule cells.

Acknowledgments
The authors thank Inger Blenker Kristoffersen, Hanne Sidelmann, Pia Kamuk Nielsen,
Anne Merete Hass and Priscilla Kronstadt O’Brien for excellent technical assistance.
This study was founded by Novo Nordisk, Karen Elise Jensen Foundation, NIH
(GMO66257), The European Commission (EU Framework Program 6, EureGene,
contract number 05085) and The Carlsberg Foundation.

References
1. Birn H, Vorum H, Verroust PJ, Moestrup SK, and Christensen EI. Receptor-
associated protein is important for normal processing of megalin in kidney proximal
tubules. J Am Soc Nephrol 11: 191-202, 2000.
2. Chen WJ, Goldstein JL, and Brown MS. NPXY, a sequence often found in
cytoplasmic tails, is required for coated pit-mediated internalization of the low density
lipoprotein receptor. J Biol Chem 265: 3116-3123, 1990.
3. Christensen EI, Nielsen S, Moestrup SK, Borre C, Maunsbach AB, de Heer E,
Ronco P, Hammond TG, and Verroust P. Segmental distribution of the endocytosis
receptor gp330 in renal proximal tubules. Eur J Cell Biol 66: 349-364, 1995.
4. Christensen EI, and Birn H. Megalin and cubilin: synergistic endocytic receptors in
renal proximal tubule. Am J Physiol Renal Physiol 280: F562-F573, 2001.
5. Christensen EI, and Birn H. Megalin and cubilin: Multifunctional endocytic
receptors. Nat Rev Mol Cell Biol 3: 256-266, 2002.
6. Fazili Z, Sun W, Mittelstaedt S, Cohen C, and Xu XX. Disabled-2 inactivation is an
early step in ovarian tumorigenicity. Oncogene 18: 3104-3113, 1999.
7. Gburek J, Verroust PJ, Willnow TE, Fyfe JC, Nowacki W, Jacobsen C, Moestrup
SK, and Christensen EI. Megalin and cubilin are endocytic receptors involved in renal
clearance of hemoglobin. J Am Soc Nephrol 13: 423-430, 2002.
8. Gburek J, Birn H, Verroust PJ, Goj B, Jacobsen C, Moestrup SK, Willnow TE,
and Christensen EI. Renal uptake of myoglobin is mediated by the endocytic receptors
megalin and cubilin. Am J Physiol Renal Physiol 285: F451-F458, 2003.
9. Gotthardt M, Trommsdorff M, Nevitt MF, Shelton J, Richardson JA, Stockinger
W, Nimpf J, and Herz J. Interactions of the low density lipoprotein receptor gene family
with cytosolic adaptor and scaffold proteins suggest diverse biological functions in
cellular communication and signal transduction. J Biol Chem 275: 25616-25624, 2000.

10. Hirst J, and Robinson MS. Clathrin and adaptors. Biochim Biophys Acta 1404:
173-193, 1998.
11. Hjalm G, Murray E, Crumley G, Harazim W, Lundgren S, Onyango I, Ek B,
Larsson M, Juhlin C, Hellman P, Davis H, Akerstrom G, Rask L, and Morse B.
Cloning and sequencing of human gp330, a Ca 2+ -binding receptor with potential
intracellular signaling properties. Eur J Biochem 239: 132-137, 1996.
12. Howell BW, Gertler FB, and Cooper JA. Mouse disabled (mDab1): a Src binding
protein implicated in neuronal development. EMBO J 16: 121-132, 1997.
13. Howell BW, Hawkes R, Soriano P, and Cooper JA. Neuronal position in the
developing brain is regulated by mouse disabled-1. Nature 389: 733-737, 1997.
14. Howell BW, Lanier LM, Frank R, Gertler FB, and Cooper JA. The disabled 1
phosphotyrosine-binding domain binds to the internalization signals of transmembrane
glycoproteins and to phospholipids. Mol Cell Biol 19: 5179-5188, 1999.
15. Howell BW, Herrick TM, and Cooper JA. Reelin-induced tyrosine phosphorylation
of disabled 1 during neuronal positioning. Genes Dev 13: 643-648, 1999.
16. Howell BW, and Herz J. The LDL receptor gene family: signaling functions during
development. Curr Opin Neurobiol 11: 74-81, 2001.
17. Inoue A, Sato O, Homma K, and Ikebe M. DOC-2/DAB2 is the binding partner of
myosin VI. Biochem Biophys Res Commun 292: 300-307, 2002.
18. Leheste JR, Rolinski B, Vorum H, Hilpert J, Nykjaer A, Jacobsen C,
Aucouturier P, Moskaug JO, Otto A, Christensen EI, and Willnow TE. Megalin
knockout mice as an animal model of low molecular weight proteinuria. Am J Pathol
155: 1361-1370, 1999.
19. Leheste JR, Melsen F, Wellner M, Jansen P, Schlichting U, Renner-Muller I,
Andreassen TT, Wolf E, Bachmann S, Nykjaer A, and Willnow TE. Hypocalcemia
and osteopathy in mice with kidney-specific megalin gene defect. FASEB J 17: 247-
249, 2003.

20. Le Panse S, Verroust P, and Christensen EI. Internalization and recycling of
glycoprotein 280 in BN/MSV yolk sac epithelial cells: a model system of relevance to
receptor-mediated endocytosis in the renal proximal tubule. Exp Nephrol 5: 375-383,
1997.
21. Marples D, Knepper MA, Christensen EI, and Nielsen S. Redistribution of
aquaporin-2 water channels induced by vasopressin in rat kidney inner medullary
collecting duct. Am J Physiol 269: C655-C664, 1995.
22. Margolis B, Borg JP, Straight S, and Meyer D. The function of PTB domain
proteins. Kidney Int 56: 1230-1237, 1999.
23. Mishra SK, Keyel PA, Hawryluk MJ, Agostinelli NR, Watkins SC, and Traub LM.
Disabled-2 exhibits the properties of a cargo-selective endocytic clathrin adaptor. EMBO
J 21:4915-4926, 2002.
24. Moestrup SK, Nielsen S, Andreasen P, Jorgensen KE, Nykjaer A, Roigaard H,
Gliemann J, and Christensen EI. Epithelial glycoprotein-330 mediates endocytosis of
plasminogen activator-plasminogen activator inhibitor type-1 complexes. J Biol Chem
268: 16564-16570, 1993.
25. Mok SC, Wong KK, Chan RK, Lau CC, Tsao SW, Knapp RC, and Berkowitz RS.
Molecular cloning of differentially expressed genes in human epithelial ovarian cancer.
Gynecol Oncol 52: 247-252, 1994.
26. Mok SC, Chan WY, Wong KK, Cheung KK, Lau CC, Ng SW, Baldini A, Colitti
CV, Rock CO, and Berkowitz RS. DOC-2, a candidate tumor suppressor gene in
human epithelial ovarian cancer. Oncogene 16: 2381-2387, 1998.
27. Morris SM, and Cooper JA. Disabled-2 colocalizes with the LDLR in clathrin-
coated pits and interacts with AP-2. Traffic 2: 111-123, 2001.
28. Morris SM, Arden SD, Roberts RC, Kendrick-Jones J, Cooper JA, Luzio JP,
and Buss F. Myosin VI binds to and localizes with Dab2, potentially linking receptor-
mediated endocytosis and the actin cytoskeleton. Traffic 3: 331-341, 2002.

29. Morris SM, Tallquist MD, Rock CO, and Cooper JA. Dual roles for the Dab2
adaptor protein in embryonic development and kidney transport. EMBO J 21: 1555-
1564, 2002.
30. Nagai M, Meerloo T, Takeda T, and Farquhar MG. The adaptor protein ARH
escorts megalin to and through endosomes. Mol Biol Cell 14: 4984-4996, 2003.
31.Nykjaer A, Dragun D, Walther D, Vorum H, Jacobsen C, Herz J, Melsen F,
Christensen EI, and Willnow TE. An endocytic pathway essential for renal uptake and
activation of the steroid 25-(OH) vitamin D3. Cell 96: 507-515, 1999.
32. Nykjaer A, and Willnow TE. The low-density lipoprotein receptor gene family: a
cellular Swiss army knife? Trends Cell Biol 12: 273-280, 2002.
33. Oleinikov AV, Zhao J, and Makker SP. Cytosolic adaptor protein Dab2 is an
intracellular ligand of endocytic receptor gp600/megalin. Biochem J 347: 613-621, 2000.
34. Rader K, Orlando RA, Lou X, and Farquhar MG. Characterization of ANKRA, a
novel ankyrin repeat protein that interacts with the cytoplasmic domain of megalin. J Am
Soc Nephrol 11: 2167-2178, 2000.
35. Saito A, Pietromonaco S, Loo AK, and Farquhar MG. Complete cloning and
sequencing of rat gp330/"megalin," a distinctive member of the low density lipoprotein
receptor gene family. Proc Natl Acad Sci USA 91: 9725-9729, 1994.
36. Takeda T, Yamazaki H, and Farquhar MG. Identification of an apical sorting
determinant in the cytoplasmic tail of megalin. Am J Physiol Cell Physiol 284: C1105-
C1113, 2003.
37. Tseng CP, Ely BD, Li Y, Pong RC, and Hsieh JT. Regulation of rat DOC-2 gene
during castration-induced rat ventral prostate degeneration and its growth inhibitory
function in human prostatic carcinoma cells. Endocrinology 139: 3542-3553, 1998.
38. Willnow TE, Rohlmann A, Horton J, Otani H, Braun JR, Hammer RE, and Herz
J. RAP, a specialized chaperone, prevents ligand-induced ER retention and

degradation of LDL receptor-related endocytic receptors. EMBO J 15: 2632-2639,
1996.
39. Willnow TE, Nykjaer A, and Herz J. Lipoprotein receptors: new roles for ancient
proteins. Nat Cell Biol 1: E157-E162, 1999.
40. Xu XX, Yang W, Jackowski S, and Rock CO. Cloning of a novel phosphoprotein
regulated by colony-stimulating factor 1 shares a domain with the Drosophila disabled
gene product. J Biol Chem 270: 14184-14191, 1995.
41. Zhai XY, Nielsen R, Birn H, Drumm K, Mildenberger S, Freudinger R, Moestrup
SK, Verroust PJ, Christensen EI, and Gekle M. Cubilin- and megalin-mediated uptake
of albumin in cultured proximal tubule cells of opossum kidney. Kidney Int 58: 1523-
1533, 2000.

Figure legends
Figure 1 Immunohistochemistry using anti-Dab2 antibody on cryosections of kidney
cortex from a Dab2 knock-out mouse (A) and a control mouse (B). Magnification:
X1,500.
Figure 2 Electron micrograph of a renal proximal tubule cell from a control rat
labeled with anti-Dab2 antibody. Magnification: X50,000; Insert (coated vesicle):
X160,000. CV = coated vesicle ; D = dense apical tubule; BB = brush border.
Figure 3 Immunofluorescent localization of Dab2 (A) and megalin (B) in kidney
specific megalin knock-out mouse. Labeling for Dab2 was seen in some renal proximal
tubular cells coinciding with cells containing megalin, whereas lack of Dab2 was
observed in neighboring cells also lacking megalin. A section with an unusually high
number of megalin-expressing cells is shown. Merged picture is shown in C.
Magnification: X 3,000
Figure 4 Double immunogold labeling for Dab2 (10 nm gold particles, arrows) and
megalin (5 nm gold particles, arrowheads) on ultrathin frozen sections of renal cortex
from kidney specific megalin knock-out mice. Magnification: X54,000.
Figure 5 Immunohistochemistry using anti-megalin antibody on cryosections of
kidney cortex from a Dab2 knock-out mouse (A) and a control mouse (B). Arrows
indicate the cytoplasmic vesicles labeled with anti-megalin antibody. Magnification:
X1,200.

Figure 6 Immunoblotting of Dab2, megalin, cubilin, clathrin heavy chain (HC) and
-adaptin in crude membrane fractions of kidney from Dab2 knock-out mice and control
mice.
Figure 7 Northern blot analysis for megalin mRNA in kidneys from Dab2 knock-out
mice and control mice.
Figure 8 Immunofluorescent localization of Dab2 (A) and megalin (B) in BN16 cells.
The merged image (C) indicates that Dab2 and megalin are partly co-localized (yellow).
Magnification: X1,000 in A-C.
Figure 9 Effect of transfection of anti-Dab2 antibody on 125 I-RAP uptake in
confluent BN16 cell monolayers. Confluent monolayers of BN16 cells were incubated in
the presence of rabbit anti-Dab2 antibody or normal rabbit Ig. Each column is the mean
± SE of five monolayers. *P

Figures
Figure 1
a) b)
Figure 2

c)
Figure 3
a) b)

Figure 4

Figure 6
Figure 5
a) b)

Figure 7
Figure 8
a) b)
c)

Figure 9
Table 1. Morphometric determination of megalin
localization in microvilli and cytoplasm of control
and Dab2 knock-out mice.
Gold/µm2 Controls Dab2 k.o.
Cytoplasm 110±14 72±22
Microvilli 96±14 150±55
Values are means ± S.D., n=6.